USRE50065E1 - Methods and product for optimising localised or spatial detection of gene expression in a tissue sample - Google Patents
Methods and product for optimising localised or spatial detection of gene expression in a tissue sample Download PDFInfo
- Publication number
- USRE50065E1 USRE50065E1 US16/353,937 US201316353937A USRE50065E US RE50065 E1 USRE50065 E1 US RE50065E1 US 201316353937 A US201316353937 A US 201316353937A US RE50065 E USRE50065 E US RE50065E
- Authority
- US
- United States
- Prior art keywords
- capture
- tissue sample
- substrate
- domain
- cdna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2543/00—Reactions characterised by the reaction site, e.g. cell or chromosome
- C12Q2543/10—Reactions characterised by the reaction site, e.g. cell or chromosome the purpose being "in situ" analysis
- C12Q2543/101—Reactions characterised by the reaction site, e.g. cell or chromosome the purpose being "in situ" analysis in situ amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
- C12Q2565/50—Detection characterised by immobilisation to a surface
- C12Q2565/514—Detection characterised by immobilisation to a surface characterised by the use of the arrayed oligonucleotides as identifier tags, e.g. universal addressable array, anti-tag or tag complement array
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
- C12Q2565/50—Detection characterised by immobilisation to a surface
- C12Q2565/537—Detection characterised by immobilisation to a surface characterised by the capture oligonucleotide acting as a primer
Definitions
- the present invention relates generally to the localised or spatial detection of nucleic acid in a tissue sample or a portion thereof.
- the present invention provides methods for detecting and/or analysing RNA, e.g. RNA transcripts, so as to obtain spatial information about the localisation, distribution or expression of genes in a tissue sample, for example in an individual cell.
- RNA transcripts e.g. RNA transcripts
- the present invention relates to a method for localised or spatial detection of transcripts in a tissue sample or a portion thereof, e.g. for determining and/or analysing a transcriptome, and especially the global transcriptome, of a tissue sample or a portion thereof.
- the method relates to a quantitative and/or qualitative method for analysing the distribution, location or expression of nucleic acid molecules in a tissue sample wherein the spatial expression or distribution or location pattern within the tissue sample is retained.
- the method provides a process for performing “spatial transcriptomics”, which enables the user to determine simultaneously the expression pattern, or the location/distribution pattern of the genes expressed, present in a tissue sample or a portion thereof.
- the present invention also provides methods for determining the optimum conditions for localized or spatial detection of (e.g. for capturing) nucleic acids from a tissue sample on a substrate, thereby allowing the maximum amount of nucleic acid molecules to be captured, whilst retaining the distribution or location pattern that originated within the tissue sample.
- the invention is particularly based on array technology and may be coupled with high throughput DNA sequencing technologies.
- the methods of the invention allow the nucleic acid molecules (e.g. RNA molecules) in the tissue sample, particularly mRNA, to be captured on an object substrate (e.g. a slide or chip, which may be an array) and labelled, which may include the incorporation of a positional tag.
- the labelled molecules may be visualised to determine or assess the efficacy of the conditions used to capture the nucleic acid molecules.
- the captured nucleic acid molecules (or a subset thereof, e.g. a portion of the nucleic acid molecules captured from the tissue sample) may be analysed further, e.g. by sequence analysis.
- the captured nucleic acid molecules may be used to template the synthesis of DNA molecules which are sequenced and analysed to determine which genes are expressed in all or one or more parts of the tissue sample.
- the individual, separate and specific transcriptome of each cell in the tissue sample may be obtained at the same time.
- the methods of the invention may be said to provide highly parallel comprehensive transcriptome signatures from individual cells (or groups of cells) within a tissue sample, or a portion thereof, without losing spatial information within said investigated tissue sample.
- the invention also provides an object substrate, such as a chip or slide (e.g. an array) for performing the method of the invention and methods for making the object substrate e.g. chip or slide, of the invention.
- the human body comprises over 100 trillion cells and is organized into more than 250 different organs and tissues.
- the development and organization of complex organs, such as the brain, are far from understood and there is a need to dissect the expression of genes expressed in such tissues using quantitative methods to investigate and determine the genes that control the development and function of such tissues.
- the organs are in themselves a mixture of differentiated cells that enable all bodily functions, such as nutrient transport, defense etc. to be coordinated and maintained. Consequently, cell function is dependent on the position of the cell within a particular tissue structure and the interactions it shares with other cells within that tissue, both directly and indirectly. Hence, there is a need to disentangle how these interactions influence each cell within a tissue at the transcriptional level.
- transcripts are merely a proxy for protein abundance, because the rates of RNA translation, degradation etc will influence the amount of protein produced from any one transcript.
- tissue specificity is achieved by precise regulation of protein levels in space and time, and that different tissues in the body acquire their unique characteristics by controlling not which proteins are expressed but how much of each is produced.
- transcriptome and proteome correlations have been compared demonstrating that the majority of all genes were shown to be expressed.
- RNA and protein levels were shown to be expressed.
- RNA and protein levels were shown to be high correlation between changes in RNA and protein levels for individual gene products which is indicative of the biological usefulness of studying the transcriptome in individual cells in the context of the functional role of proteins.
- Histology utilizing different staining techniques, first established the basic structural organization of healthy organs and the changes that take place in common pathologies more than a century ago. Developments in this field resulted in the possibility of studying protein distribution by immunohistochemistry and gene expression by in situ hybridization.
- transcriptome analysis typically is performed on mRNA extracted from whole tissues (or even whole organisms), and methods for collecting smaller tissue areas or individual cells for transcriptome analysis are typically labour intensive, costly and have low precision.
- the novel approach of the methods and products of the present invention utilizes now conventional array technology and may utilise well established sequencing technology, which may yield transcriptional information for all of the genes in a sample, whilst retaining positional information for the transcripts. It will be evident to the person of skill in the art that this represents a milestone in the life sciences.
- the new technology opens a new field of so-called “spatial transcriptomics”, which is likely to have profound consequences for our understanding of tissue development and tissue and cellular function in all multicellular organisms. It will be apparent that such techniques will be particularly useful in our understanding of the cause and progress of disease states and in developing effective treatments for such diseases, e.g. cancer.
- the methods of the invention will also find uses in the diagnosis of numerous medical conditions.
- Array technology particularly microarrays, arose from research at Stanford University where small amounts of DNA oligonucleotides were successfully attached to a glass surface in an ordered arrangement, a so-called “array”, and used it to monitor the transcription of 45 genes (Schena M et al, Science. 1995; 270: 368-9, 371).
- microarray technology Since then, researchers around the world have published more than 30,000 papers using microarray technology. Multiple types of microarray have been developed for various applications, e.g. to detect single nucleotide polymorphisms (SNPs) or to genotype or re-sequence mutant genomes, and an important use of microarray technology has been for the investigation of gene expression. Indeed, the gene expression microarray was created as a means to analyze the level of expressed genetic material in a particular sample, with the real gain being the possibility to compare expression levels of many genes simultaneously. Several commercial microarray platforms are available for these types of experiments but it has also been possible to create custom made gene expression arrays.
- SNPs single nucleotide polymorphisms
- NGS next-generation DNA sequencing
- NGS technologies for ultra-fast genome sequencing represents a milestone in the life sciences (Petterson E et al, Genomics. 2009; 93: 105-11). These new technologies have dramatically decreased the cost of DNA sequencing and enabled the determination of the genome of higher organisms at an unprecedented rate, including those of specific individuals (Wade C M et al Science. 2009; 326: 865-7; Rubin J et al, Nature 2010; 464: 587-91).
- the new advances in high-throughput genomics have reshaped the biological research landscape and in addition to complete characterization of genomes it is possible also to study the full transcriptome in a digital and quantitative fashion.
- the bioinformatics tools to visualize and integrate these comprehensive sets of data have also been significantly improved during recent years.
- the methods of the present invention can be used to analyse the expression of a single gene in a single cell in a sample, whilst retaining the cell within its context in the tissue sample.
- the methods can be used to determine the expression of every gene in each and every cell, or substantially all cells, in a tissue sample (or portion thereof) simultaneously, i.e. the global spatial expression pattern of a tissue sample or portion thereof.
- the methods of the invention also enable intermediate analyses to be performed.
- the methods may be used to determine or quantify the transcriptional activity of cells in a tissue sample (e.g. the relative abundance of transcripts in different cell or tissue types), which would allow transcriptome analysis to focus on specific regions of a tissue sample, e.g. regions or portions of tissues samples with high (or low) transcriptional activity.
- the efficacy of the step of capturing nucleic acid molecules from tissue samples may be dependent on the source of the tissue and/or the methods used to prepare the tissue sample. Accordingly, the methods and arrays of the invention may be used to determine the optimum conditions to capture the nucleic acid molecules from a tissue sample on an object substrate, e.g. an array.
- the invention requires reverse transcription (RT) primers to be immobilised on an object substrate, e.g. a glass slide or chip. Thin tissue sections are placed onto the substrate and a reverse transcription reaction is performed in the tissue section on the substrate.
- the RT primers to which the RNA in the tissue sample binds (or hybridizes), are extended using the bound RNA as a template to obtain cDNA, which is therefore bound to the surface of the substrate.
- the synthesized part of the cDNA is labelled, e.g. with a visibly detectable label, such as a fluorescently labelled nucleotide which may be incorporated into the synthesized cDNA molecules.
- each cDNA strand provides a detectable signal that corresponds to the presence of a RNA molecule in the tissue section, and the location of the cDNA on the surface of the substrate corresponds to its original location in the tissue section.
- the signal from the labelled cDNA is detected, e.g. the surface of the substrate is imaged, and accordingly, the relative abundance of transcript present in each part of the tissue section, e.g. each cell, can be detected and quantified.
- the tissue section may be visualised or imaged, e.g. stained and photographed, before or after the cDNA synthesis step to enable the labelled cDNA molecule to be correlated with a position within the tissue sample.
- the method may be viewed as a method for capturing and/or labelling the transcriptome of a tissue sample on an object substrate and it will be evident from the discussion below that this method may find a variety of utilities, particularly in methods for detecting and/or analysing the transcriptome of a tissue sample or a portion thereof.
- quantifying the relative abundance of the labelled cDNA may be used to determine the transcriptional activity of different regions of a tissue sample, e.g. to identify cells with high or no transcriptional activity.
- the method can be used to determine the optimum reaction conditions for detecting, e.g. capturing, the transcriptome of a tissue sample on an object substrate, e.g. by repeating the method using different conditions (e.g. conditions for permeabilizing the tissue to allow the nucleic acids in the tissue sample to interact with the immobilized primers on the substrate), comparing the intensity and/or resolution of the signal obtained from labelled cDNA molecules on the imaged substrates and optionally selecting the conditions that provide the optimum image intensity and/or resolution.
- the method may be viewed as a method for localized or spatial detection, e.g. quantification, of the relative abundance of one or more transcripts in a tissue sample, e.g. the RT primer may be specific for one or more transcripts thereby enabling a specific transcript (or set of transcripts) to be captured and labelled on the object surface, wherein subsequent detection, e.g. imaging, of the intensity and distribution of the signal from labelled transcript is representative of the amount of transcript (or set of transcripts) present in the tissue sample in specific locations.
- subsequent detection e.g. imaging
- the method may be viewed as a method for localized or spatial detection and/or analysis of the transcriptome of one or more portions of a tissue sample, e.g. the RT primer may be capable of capturing all of the transcripts on the object surface, which are then labelled as described above.
- Subsequent detection, e.g. imaging, of the intensity and distribution of the signal from labelled transcriptome can be used to select one or more portions of the substrate for further analysis, e.g. sequence analysis.
- the labelled transcripts on portions of the substrate that are not selected for further analysis may be removed from the surface of the substrate, e.g. by laser ablation, and discarded.
- the remaining subset of labelled transcripts may be analysed, e.g. sequenced, and the sequence information may be correlated with the portion(s) of the substrate from which the labelled transcripts were not removed and that correspond(s) to a position in the tissue sample.
- the reverse transcription (RT) primers comprise also unique positional tags (domains) and the RT primers may be arrayed on the object substrate, e.g. a glass slide or chip, to generate an “array”.
- the unique positional tags correspond to the location of the RT primers on the array (the features of the array).
- Thin tissue sections are placed onto the array and a reverse transcription reaction is performed in the tissue section on the substrate.
- the RT primers, to which the RNA in the tissue sample binds (or hybridizes) are extended using the bound RNA as a template to obtain cDNA, which is therefore bound to the surface of the array.
- the synthesized part of the cDNA is labelled, e.g.
- a detectable label such as a fluorescently labelled nucleotide
- each cDNA strand carries information about the position of the template RNA in the tissue section.
- the labelled cDNA is imaged, which enables the efficacy of the transcriptome capture step to be assessed.
- the visualisation of the cDNA molecules also allows areas of the substrate to be targeted for removal of surface bound material, e.g. by laser ablation, such that only transcripts from portions of tissue sample that are of interest may be analysed further, as described above.
- the tissue section may be visualised or imaged, e.g.
- the cDNA is sequenced, which results in a transcriptome with exact positional information.
- the sequence data can then be matched to a position in the tissue sample, which enables the visualization, e.g. using a computer, of the sequence data together with the tissue section, for instance to display the expression pattern of any gene of interest across the tissue.
- the methods of the invention may result in data that is in stark contrast to the data obtained using current methods to study mRNA populations.
- methods based on in situ hybridization provide only relative information of single mRNA transcripts.
- the methods of the present invention have clear advantages over current in situ technologies.
- the global gene expression information obtainable from the methods of the invention also allows co-expression information and quantitative estimates of transcript abundance. It will be evident that this is a generally applicable strategy available for the analysis of any tissue in any species, e.g. animal, plant, fungus.
- tissue sections does not interfere with synthesis of DNA (e.g. cDNA) primed by primers (e.g. reverse transcription primers) that are coupled to the surface of an object substrate, e.g. an array.
- primers e.g. reverse transcription primers
- labelling the cDNA synthesized on the object substrate allows specific portions of a tissue sample to be selected for further analysis, which enables resources, e.g. sequencing resources, to be focussed on the analysis of specific cell or tissue types within a tissue sample. This may result in reduced costs and a less complex data set which may be analysed more efficiently and robustly than a data set from the analysis of the transcriptome of the whole tissue sample.
- the present invention provides a method for localized or spatial detection and/or analysis of RNA, and particularly of transcripts, in a tissue sample or a portion thereof, comprising:
- step (d) labelling the cDNA molecules generated in step (c), wherein said labelling step may be contemporaneous with, or subsequent to, said generating step, preferably wherein the label is incorporated into the synthesized part of the cDNA molecules;
- step (f) imaging the tissue sample, wherein the tissue sample is imaged before or after step (c).
- the method may alternatively or additionally be viewed as a method for determining and/or analysing a transcriptome of a tissue sample or a portion thereof or a method for capturing and/or labelling the transcriptome of a tissue sample on an object substrate, e.g. an array.
- the present invention can be seen to provide a method for determining the optimum conditions for localised or spatial detection of RNA (e.g. transcripts) in a tissue sample on an object substrate, comprising steps (a)-(e), and optionally step (f), described above on a first object substrate and further steps:
- RNA e.g. transcripts
- step (g) repeating steps (a)-(e), and optionally step (f), with a second object substrate, using different conditions in step (b);
- the present invention can be seen to provide a method for determining and/or analysing RNA or a transcriptome of a tissue sample or a portion thereof comprising steps (a)-(e), and optionally step (f), described above and further steps:
- this third aspect allows a part of the RNA or transcriptome to be determined and/or analysed, and in particular to be selectively analysed; by removing the labelled cDNA from at least a portion of the object substrate surface, it may be selected which of the cDNA (and hence which of the captured RNA) to be analysed.
- the removal step is discussed further below, but it will be understood that this could be achieved by removing a portion of the tissue sample from the substrate (which will concomitantly remove the labelled cDNA)
- the object substrate is an array and the capture probes each comprise a positional domain that corresponds to the position of each capture probe on the array. Accordingly, the method may be viewed as comprising:
- each species of said capture probe comprises a nucleic acid molecule with 5′ to 3′:
- step (d′′) labelling the cDNA molecules generated in step (c′), wherein said labelling step may be contemporaneous with, or subsequent to, said generating step, preferably wherein the label is incorporated into the synthesized part of the cDNA molecules;
- step (f′′) optionally imaging the tissue sample, wherein the tissue sample is imaged before or after step (c′′).
- the methods allow the abundance of the transcripts from a tissue sample to visualised directly, e.g. by fluorescence, akin to a standard microarray.
- the abundance of the transcripts can be correlated directly with their position in the tissue sample.
- the detection of the labelled cDNA molecules in situ on the surface of the object substrate i.e. such that their distribution the object substrate corresponds directly their distribution in the tissue sample
- the detection of the labelled cDNA molecules in situ on the surface of the object substrate enables the provision of a method for determining the optimum conditions for capturing the transcriptome of a tissue sample on an object substrate, wherein the spatial distribution of the transcripts in the tissue sample is transferred directly to the surface of the object substrate.
- the object substrates used for optimising the conditions for capturing a transcriptome e.g. wherein the capture probes do not contain a positional domain and/or the probes are immobilized uniformly on the surface of the object substrate
- the optimum conditions determined using the inexpensive object substrate can be used to perform analyses using the expensive arrays.
- the methods may also be seen to reduce costs over other spatial transcriptomics methods.
- this aspect of the method may be viewed as providing or enabling a so-called “quality control” (QC) step to determine the optimum or most appropriate, e.g. cost-effective, conditions in which to perform a more detailed analysis using more expensive arrays.
- QC quality control
- the methods of the invention also represent a significant advance over other methods for spatial transcriptomics known in the art.
- the methods described herein may result in a global and spatial profile of all transcripts in the tissue sample or a portion thereof.
- the methods may enable the expression of every gene to be quantified for each position or feature on an array, which enables a multiplicity of analyses to be performed based on data from a single assay.
- the methods of the present invention make it possible to detect and/or quantify the spatial expression of all genes in single tissue sample or a portion thereof.
- the abundance of the transcripts also may be visualised both directly and indirectly.
- the methods include methods of indirect detection, e.g. sequence analysis, it is possible to measure the expression of genes in a single sample simultaneously even wherein said transcripts are present at vastly different concentrations in the same sample.
- any method of nucleic acid analysis may be used in the analysis step (j). Typically this may involve sequencing, but it is not necessary to perform an actual sequence determination.
- sequence-specific methods of analysis may be used.
- a sequence-specific amplification reaction may be performed, for example using primers which are specific for the positional domain and/or for a specific target sequence, e.g. a particular target DNA to be detected (i.e. corresponding to a particular cDNA/RNA etc).
- An exemplary analysis method is a sequence-specific PCR reaction.
- the sequence analysis information obtained in step (j) may be used to obtain spatial information as to the RNA in the sample or a portion of the sample.
- the sequence analysis information may provide information as to the location of the RNA in the tissue sample.
- This spatial information may be derived from the nature of the sequence analysis information determined, for example it may reveal the presence of a particular RNA which may itself be spatially informative in the context of the tissue sample used, and/or the spatial information (e.g. spatial localisation) may be derived from the position of the tissue sample on the array, coupled with the sequencing information.
- the method may involve simply correlating the sequence analysis information to a position in the tissue sample e.g. by virtue of the positional tag and its correlation to a position in the tissue sample.
- spatial information may conveniently be obtained by correlating the expression data, e.g. the intensity of the signal from the labelled cDNA detected, e.g. imaged, in step (e) or the sequence analysis data obtained from step (j), to an image of the tissue sample and this represents one preferred embodiment of the invention.
- the method also includes a step of:
- step (f) imaging the tissue sample wherein the tissue sample is imaged before or after step (c), preferably wherein the image of the labelled cDNA is correlated with an image of said tissue sample.
- the method described in the third aspect of the invention may comprise a step of:
- step (k) correlating said sequence analysis information with an image of said tissue sample, wherein the tissue sample is imaged before or after step (c).
- the method of the invention may be used for localized or spatial detection of a nucleic acid, specifically RNA, in a tissue sample.
- the method of the invention may be used for determining and/or analysing all of the transcriptome of a tissue sample e.g. the global transcriptome of a tissue sample.
- the method is not limited to this and encompasses determining and/or analysing all or part of the transcriptome of a tissue sample or a portion thereof.
- the method may involve determining and/or analysing a part or subset of the transcriptome, e.g. a transcriptome corresponding to one gene or a subset of genes, e.g. a set of particular genes, for example related to a particular disease or condition, tissue type etc.
- the method may involve determining and/or analysing all of the transcriptome of a portion of a tissue sample.
- the method steps set out above can be seen as providing a method of obtaining a spatially defined transcriptome, and in particular the spatially defined global transcriptome, of a tissue sample or portion thereof.
- the method of the invention may be seen as a method for localised or spatial detection of nucleic acid, e.g. RNA, in a tissue sample or a portion thereof, or for localised or spatial determination and/or analysis of nucleic acid (e.g. RNA) in a tissue sample or a portion thereof.
- the method may be used for the localised or spatial detection or determination and/or analysis of gene expression in a tissue sample or a portion thereof.
- the localised/spatial detection/determination/analysis means that the RNA may be localised to its native position or location within a cell or tissue in the tissue sample.
- the RNA may be localised to a cell or group of cells, or type of cells in the sample, or to particular regions of areas within a tissue sample.
- the native location or position of the RNA (or in other words, the location or position of the RNA in the tissue sample), e.g. an expressed gene, may be determined.
- the invention may also be viewed as providing methods for determining the optimum conditions for localised detection and/or analysis of nucleic acids in a tissue sample on an object substrate, i.e. for capturing and/or labelling nucleic acids from a tissue sample on an object substrate, e.g. a slide or chip.
- the invention can also be seen to provide an object substrate, e.g. a slide or chip, for use in the methods of the invention comprising a substrate on which one or more species of capture probe is directly or indirectly immobilized such that each probe is oriented to have a free 3′ end to enable said probe to function as a reverse transcriptase (RT) primer.
- object substrate e.g. a slide or chip
- the probes are immobilised uniformly on the object substrate, i.e. the probes are not arrayed as distinct features.
- the object substrate of the invention may be viewed as a featureless array, i.e. a microarray without distinct features, which are defined below.
- one species of capture probe is immobilized on the object surface, i.e. the capture probes are identical.
- the probes are capable of hybridizing to (i.e. capturing) all mRNA, i.e. RNA molecules with a polyA tail.
- the probes may comprise sequences of consecutive dTTP or dUTP nucleotides, e.g. oligoT and/or oligoU, as described in more detail below.
- the object substrate of the invention is for use in methods for determining the optimum conditions for the localised or spatial detection of transcripts from a tissue sample on an object substrate, e.g. array.
- the probes may be capable of hybridizing to (i.e. capturing) specific types of mRNA, i.e. RNA expressed from a specific gene of set of genes.
- the probes may comprise gene specific sequences or sequences that are degenerate for a family of genes.
- the object substrate of the invention is for use in methods for determining and/or analysing one or more transcripts from a tissue sample or a portion thereof.
- the object substrate of the present invention may be used to capture RNA, e.g. mRNA, of a tissue sample that is contacted with said array.
- the array may also be used for determining and/or analysing a partial or global transcriptome of a tissue sample or for obtaining a spatially defined partial or global transcriptome of a tissue sample.
- the object substrate may be for use in methods of the invention that may be considered as methods of determining, e.g. quantifying, the localised or spatial expression of one or more genes in a tissue sample or portion thereof.
- the object substrate may be for use in methods used to detect the spatial expression of one or more genes in a tissue sample or portion thereof.
- the object substrate may be for use in methods used to determine simultaneously the expression of one or more genes at one or more positions within a tissue sample or a portion thereof. Still further, the object substrate may be for use in methods for partial or global transcriptome analysis of a tissue sample or portion thereof with two-dimensional spatial resolution.
- the RNA may be any RNA molecule which may occur in a cell.
- it may be mRNA, tRNA, rRNA, viral RNA, small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), small interfering RNA (sRNA), piwi-interacting RNA (piRNA), ribozymal RNA, antisense RNA or non-coding RNA.
- snRNA small nuclear RNA
- snoRNA small nucleolar RNA
- miRNA microRNA
- sRNA small interfering RNA
- piRNA piwi-interacting RNA
- ribozymal RNA antisense RNA or non-coding RNA.
- antisense RNA antisense RNA or non-coding RNA.
- mRNA small nuclear RNA
- tRNA small nucleolar RNA
- miRNA microRNA
- sRNA small interfering RNA
- piRNA piwi-interacting RNA
- Step (c) in the methods above of generating cDNA from the captured RNA will be seen as relating to the synthesis of the cDNA.
- This will involve a step of reverse transcription of the captured RNA, extending the capture probe, which functions as the RT primer, using the captured RNA as template.
- Such a step generates so-called first strand cDNA.
- second strand cDNA synthesis may optionally take place on the array, or it may take place in a separate step, after release of first strand cDNA from the array.
- second strand synthesis may occur in the first step of amplification of a released first strand cDNA molecule.
- Step (d) in the methods above of labelling the cDNA molecules generated in step (c) will be seen as relating to any suitable method of labelling the cDNA molecules.
- the label will be provided to, e.g. as part of, or on, the generated cDNA molecule.
- the labelling step is performed contemporaneously with, i.e. at the same time as, the generating step.
- labelling the may involve the incorporation of labelled nucleotides into the synthesized cDNA molecule directly.
- the nucleotides may be labelled with directly or indirectly signal giving molecules.
- directly signal giving labels may be fluorescent molecules, i.e.
- the labelled nucleotides may be fluorescently labelled nucleotides.
- signal giving labels may be, for example, biotin molecules, i.e. the labelled nucleotides may be biotin labelled nucleotides, which require additional steps to provide a signal, e.g. the addition of streptavidin conjugated to an enzyme which may act on a chemical substrate to provide a detectable signal, e.g. a visibly detectable colour change.
- the cDNA generated in step (c) may be labelled after its synthesis, e.g. stained.
- Various methods for labelling nucleic acid molecules are known in the art and could be employed in the methods of the invention.
- the cDNA may be stained with a nucleic acid stain. If the cDNA generating step only creates a first strand of cDNA, it may be advantageous to use a strain capable of detecting single stranded nucleic acid such as SYBR Gold® or GelStar®, as the RNA template may degrade.
- a stain capable of detecting double stranded nucleic acid such as ethidium bromide or SYBR Green® may be used.
- it may be advantageous to remove the tissue sample from the object substrate before labelling the cDNA e.g. to avoid background signals from nucleic acid material remaining in the tissue sample, e.g. genomic DNA etc.
- it may be desirable to image the tissue sample to be able to correlate the detection, e.g. image, of the labelled cDNA with an image of the tissue sample it may be desirable to image the tissue sample before the step of generating the cDNA and particularly before the step of labelling the cDNA.
- the “object substrate” or “substrate” of the invention may be any solid substrate on which nucleic acid molecules can be immobilized directly or indirectly, e.g. a slide or chip.
- the object substrate may be viewed as being an array substrate, i.e. any substrate that could be used to generate a nucleic acid array, e.g. a microarray substrate.
- the capture probes may be immobilized on the object substrate in the form of an array, i.e. in some embodiments the object substrate is an array, e.g. a microarray. In other embodiments the capture probes are not immobilized on the object substrate in an array format, i.e.
- the substrate may have no distinct features and the capture probes may be immobilized on the object substrate uniformly.
- the object substrate is not an array.
- the object subject may be viewed as a featureless array or alternatively as an array comprising a single large feature.
- Array substrates, i.e. object substrates, for use in the context of nucleic acid analysis are discussed and described below.
- the term “multiple” means two or more, or at least two, e.g. 3, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 400, 500, 1000, 2000, 5000, 10,000, or more etc.
- the number of distinct capture probes i.e. capture probes with different sequences, e.g. different positional domains
- the number of distinct capture probes may be any integer in any range between any two of the aforementioned numbers. It will be appreciated however that it is envisaged that conventional-type arrays with many hundreds, thousands, tens of thousands, hundreds of thousands or even millions of capture probes may be used.
- the methods outlined herein may utilise, but are not limited to, high density nucleic acid arrays comprising “capture probes” for capturing and labelling transcripts from all of the single cells within a tissue sample e.g. a thin tissue sample slice, or “section”.
- tissue samples or sections for analysis are produced in a highly parallelized fashion, such that the spatial information in the section is retained.
- the captured RNA (preferably mRNA) molecules for each cell, or “transcriptomes” are transcribed into cDNA and the resultant cDNA molecules are labelled and detected and/or analyzed.
- the labelled cDNA molecules are detected and/or analysed by detecting the signal from the labelled molecules, e.g.
- the labelled cDNA molecules, or a portion thereof, may be subject to analysis, e.g. by high throughput sequencing.
- the resultant data from the first and/or subsequent detection and/or analysis may be correlated to images of the original tissue samples. For instance, an overlay of the two images may be used to determine areas of high, low or no expression, which may enable portions of the tissue sample to be selected for further analysis.
- the data from the further analyses may be correlated to images of the tissue sample by, e.g. so-called barcode sequences (or ID tags, defined herein as positional domains) incorporated into the arrayed nucleic acid probes.
- High density nucleic acid arrays or microarrays form a core component of some of the spatial transcriptome labelling methods described herein.
- a microarray is a multiplex technology used in molecular biology.
- a typical microarray consists of an arrayed series of microscopic spots of oligonucleotides (hundreds of thousands of spots, generally tens of thousands, can be incorporated on a single array).
- each nucleic acid (oligonucleotide) spot is known as a “feature” (and hence in some of the methods set out above each species of capture probe may be viewed as a specific feature of the array; each feature occupies a distinct position on the array), and typically each separate feature contains in the region of picomoles (10 ⁇ 12 moles) of a specific DNA sequence (a “species”), which are known as “probes” (or “reporters”). Typically, these can be a short section of a gene or other nucleic acid element to which a cDNA or cRNA sample (or “target”) can hybridize under high-stringency hybridization conditions.
- the probes of the present invention and/or their distribution on the array may differ from the probes of standard microarrays.
- probe-target hybridization is usually detected and quantified by detection of visual signal, e.g. a fluorophore, silver ion, or chemiluminescence-label, which has been incorporated into all of the targets before the targets are contacted with the array.
- visual signal e.g. a fluorophore, silver ion, or chemiluminescence-label
- the intensity of the visual signal correlates to the relative abundance of each target nucleic acid in the sample, but does not provide any spatial information about the origin of the target nucleic acid in the sample. Since an array can contain tens of thousands of probes, a microarray experiment can accomplish many genetic tests in parallel.
- the probes are attached to a solid surface or substrate by a covalent bond to a chemical matrix, e.g. epoxy-silane, amino-silane, lysine, polyacrylamide etc.
- the substrate typically is a glass, plastic or silicon chip or slide, although other microarray platforms are known, e.g. microscopic beads.
- the probes may be attached to the object substrate, e.g. array, of the invention by any suitable means.
- the probes are immobilized to the substrate by chemical immobilization. This may be an interaction between the substrate (support material) and the probe based on a chemical reaction.
- a chemical reaction typically does not rely on the input of energy via heat or light, but can be enhanced by either applying heat, e.g. a certain optimal temperature for a chemical reaction, or light of certain wavelength.
- a chemical immobilization may take place between functional groups on the substrate and corresponding functional elements on the probes.
- Such corresponding functional elements in the probes may either be an inherent chemical group of the probe, e.g. a hydroxyl group or be additionally introduced.
- An example of such a functional group is an amine group.
- the probe to be immobilized comprises a functional amine group or is chemically modified in order to comprise a functional amine group. Means and methods for such a chemical modification are well known.
- the localization of said functional group within the probe to be immobilized may be used in order to control and shape the binding behaviour and/or orientation of the probe, e.g. the functional group may be placed at the 5′ or 3′ end of the probe or within sequence of the probe.
- a typical substrate for a probe to be immobilized comprises moieties which are capable of binding to such probes, e.g. to amine-functionalized nucleic acids. Examples of such substrates are carboxy, aldehyde or epoxy substrates. Such materials are known to the person skilled in the art.
- Functional groups, which impart a connecting reaction between probes that are chemically reactive by the introduction of an amine group, and array substrates are known to the person skilled in the art.
- Alternative substrates on which probes may be immobilized may have to be chemically activated, e.g. by the activation of functional groups, available on the object substrate, e.g. array substrate.
- activated substrate relates to a material in which interacting or reactive chemical functional groups were established or enabled by chemical modification procedures as known to the person skilled in the art. For example, a substrate comprising carboxyl groups has to be activated before use.
- the probes may be immobilized on beads, e.g. plastic microbeads, which can be used to immobilize the probes on the substrate.
- Suitable techniques for immobilizing the nucleic acid molecules on beads may be selected from the techniques discussed above or selected from methods known in the art.
- the beads may be contacted with, and immobilized on, an object substrate, thereby indirectly immobilizing the probes on the surface of the substrate.
- the substrate may be treated crosslink the beads to each other and/or the surface of the substrate, e.g. the substrate may heated to partially melt the beads which are allowed to solidify, to generate an object substrate on which probes are indirectly immobilized.
- the probes may be synthesized directly on the substrate. Suitable methods for such an approach are known to the person skilled in the art. Examples are manufacture techniques developed by Agilent Inc., Affymetrix Inc., Roche Nimblegen Inc. or Flexgen BV. Typically, lasers and a set of mirrors that specifically activate the spots where nucleotide additions are to take place are used. Such an approach may provide, for example, spot sizes (i.e. features) of around 30 ⁇ m or larger.
- the probes may be immobilized uniformly on the substrate, i.e. a uniform, consistent or homogeneous distribution of probes across the surface of the substrate. Hence, it may be necessary simply to activate a portion or area of the substrate on which the probes will be immobilized. A “portion” of the substrate is described below.
- the object substrate therefore may be any suitable substrate known to the person skilled in the art.
- the substrate may have any suitable form or format, e.g. it may be flat, curved, e.g. convexly or concavely curved towards the area where the interaction between the tissue sample and the substrate takes place. Particularly preferred is the where the substrate is a flat, i.e. planar, such as a chip or slide.
- the substrate is a solid support and thereby allows for an accurate and traceable positioning of the probes on the substrate.
- An example of a substrate is a solid material or a substrate comprising functional chemical groups, e.g. amine groups or amine-functionalized groups.
- a substrate envisaged by the present invention is a non-porous substrate.
- Preferred non-porous substrates are glass, silicon, poly-L-lysine coated material, nitrocellulose, polystyrene, cyclic olefin copolymers (COCs), cyclic olefin polymers (COPs), polypropylene, polyethylene and polycarbonate.
- any suitable material known to the person skilled in the art may be used.
- glass or polystyrene is used.
- Polystyrene is a hydrophobic material suitable for binding negatively charged macromolecules because it normally contains few hydrophilic groups.
- nucleic acids immobilized on glass slides it is furthermore known that by increasing the hydrophobicity of the glass surface the nucleic acid immobilization may be increased.
- Such an enhancement may permit a relatively more densely packed formation, which is advantageous when the probes are arranged in an array format.
- the substrate, in particular glass may be treated by silanation, e.g. with epoxy-silane or amino-silane or by silynation or by a treatment with polyacrylamide.
- a number of standard arrays and array substrates are commercially available and both the number and size of the features may be varied.
- the concentration of the probes immobilized may be altered to correspond to the size and/or density of the cells present in different tissues or organisms.
- the arrangement of the features may be altered to correspond to the size and/or density of the cells present in different tissues or organisms. For instance, animal cells typically have a cross-section in the region of 1-100 ⁇ m, whereas the cross-section of plant cells typically may range from 1-10000 ⁇ m.
- Nimblegen® arrays which are available with up to 2.1 million features, or 4.2 million features, and feature sizes of 13 micrometers, may be preferred for tissue samples from an animal or fungus, whereas other formats, e.g. with 8 ⁇ 130 k features, may be sufficient for plant tissue samples.
- Commercial arrays are also available or known for use in the context of sequence analysis and in particular in the context of NGS technologies. Such arrays may also be used as the substrate, e.g. array substrate in the context of the present invention, e.g. an IIlumina bead array.
- the probes on a substrate may be immobilized, i.e. attached or bound, to the substrate, e.g. array, via the 5′ or 3′ end, depending on the chemical matrix of the array.
- the probes are attached via a 3′ linkage, thereby leaving a free 5′ end.
- substrates, e.g. arrays, comprising probes attached to the substrate via a 5′ linkage, thereby leaving a free 3′ end are available and may be synthesized using standard techniques that are well known in the art and are described elsewhere herein.
- the covalent linkage used to couple a nucleic acid probe to a substrate may be viewed as both a direct and indirect linkage, in that the although the probe is attached by a “direct” covalent bond, there may be a chemical moiety or linker separating the “first” nucleotide of the nucleic acid probe from the, e.g. glass or silicon, substrate i.e. an indirect linkage.
- probes that are immobilized to the substrate by a covalent bond and/or chemical linker are generally seen to be immobilized or attached directly to the substrate.
- the capture probes of the invention may be immobilized on, or interact with, the substrate, e.g. array, directly or indirectly.
- the capture probes need not bind directly to the substrate, but may interact indirectly, for example by binding to a molecule which itself binds directly or indirectly to the array (e.g. the capture probe may interact with (e.g. bind or hybridize to) a binding partner for the capture probe, i.e. a surface probe, which is itself bound to the substrate directly or indirectly).
- the capture probe will be, directly or indirectly (by one or more intermediaries), bound to, or immobilized on, the substrate.
- the method and object substrate, e.g. slide or chip, of the invention may comprise probes that are immobilized via their 5′ or 3′ end.
- the capture probe when it is immobilized directly to the array substrate, it may be immobilized only such that the 3′ end of the capture probe is free to be extended, e.g. it is immobilized by its 5′ end.
- the capture probe may be immobilized indirectly, such that it has a free, i.e. extendible, 3′ end.
- extended or extendible 3′ end it is meant that further nucleotides may be added to the most 3′ nucleotide of the nucleic acid molecule, e.g. capture probe, to extend the length of the nucleic acid molecule, i.e. the standard polymerization reaction utilized to extend nucleic acid molecules, e.g. templated polymerization catalyzed by a polymerase.
- the substrate e.g. array
- the substrate comprises probes that are immobilized directly via their 3′ end, so-called surface probes, which are defined below.
- Each species of surface probe comprises a region of complementarity to each species of capture probe, such that the capture probe may hybridize to the surface probe, resulting in the capture probe comprising a free extendible 3′ end.
- the capture probes are synthesized in situ on the substrate.
- the probes may be made up of ribonucleotides and/or deoxyribonucleotides as well as synthetic nucleotide residues that are capable of participating in Watson-Crick type or analogous base pair interactions.
- the nucleic acid domain may be DNA or RNA or any modification thereof, e.g. PNA or other derivatives containing non-nucleotide backbones.
- the capture probe e.g. the capture domain of the capture probe, must capable of priming a reverse transcription reaction to generate cDNA that is complementary to the captured RNA molecules.
- At least the capture domain of the capture probe comprises or consists of deoxyribonucleotides (dNTPs).
- dNTPs deoxyribonucleotides
- the whole of the capture probe comprises or consists of deoxyribonucleotides.
- the capture probes are immobilized on the substrate directly, i.e. by their 5′ end, resulting in a free extendible 3′ end.
- the capture probes of the invention comprise at least one domain, a capture domain, which is capable of interacting with (i.e. binding or hybridizing to) the RNA from the tissue, i.e. to capture the RNA.
- the probes preferably comprise at least two domains, a capture domain and a positional domain (or a feature identification tag or domain; the positional domain may alternatively be defined as an identification (ID) domain or tag, or as a positional tag).
- the capture probe may further comprise a universal domain as defined further below. Where the capture probe is indirectly attached to the array surface via hybridization to a surface probe, the capture probe requires a sequence (e.g. a portion or domain) which is complementary to the surface probe.
- Such a complementary sequence may be complementary to a positional/identification domain (if present in the capture probe) and/or a universal domain on the surface probe.
- the positional domain and/or universal domain may constitute the region or portion of the probe which is complementary to the surface probe.
- the capture probe may also comprise an additional domain (or region, portion or sequence) which is complementary to the surface probe.
- a surface probe-complementary region may be provided as part of, or as an extension of, the capture domain (such a part or extension not itself being used for, or capable of, binding to the target nucleic acid, e.g. RNA).
- the capture probes for use in the invention may comprise or consist of a capture domain.
- the capture probes may comprise or consist of: (i) a capture domain and a positional domain; (ii) a capture domain and a universal domain; (iii) a capture domain and a domain that is complementary to a surface probe; (iv) a capture domain, positional domain and a universal domain, and so forth.
- a single species of capture probe is immobilized to the substrate, preferably wherein the capture probe is immobilized on the substrate uniformly.
- a single species of capture probe may be arrayed on the substrate, such that each feature on the array comprises the same probe.
- multiple species of capture probe are immobilized to the substrate, preferably wherein each species of capture probe is immobilized at a different position on the substrate (i.e. each species forms a feature in an array), although a single capture probe may in some embodiments be immobilized at more than one position (a single species of capture probe may be used to form more than one feature).
- multiple species of capture probe may be combined to form a mixture which is immobilized on the substrate uniformly, i.e. such that there is an even distribution of each species of capture probe on the surface of the substrate.
- the capture domain is typically located at the 3′ end of the capture probe and comprises a free 3′ end that can be extended, e.g. by template dependent polymerization.
- the capture domain comprises a nucleotide sequence that is capable of hybridizing to nucleic acid, e.g. RNA (preferably mRNA) present in the cells of the tissue sample contacted with the array.
- the capture domain may be selected or designed to bind (or put more generally may be capable of binding) selectively or specifically to the particular nucleic acid, e.g. RNA, it is desired to detect or analyse.
- the capture domain may be selected or designed for the selective capture of mRNA. As is well known in the art, this may be on the basis of hybridisation to the poly-A tail of mRNA.
- the capture domain comprises a poly-T DNA oligonucleotide, i.e. a series of consecutive deoxythymidine residues linked by phosphodiester bonds, which is capable of hybridizing to the poly-A tail of mRNA.
- the capture domain may comprise nucleotides which are functionally or structurally analogous to poly-T, i.e. are capable of binding selectively to poly-A, for example a poly-U oligonucleotide or an oligonucleotide comprised of deoxythymidine analogues, wherein said oligonucleotide retains the functional property of binding specifically to poly-A.
- the capture domain, or more particularly the poly-T element of the capture domain comprises at least 10 nucleotides, preferably at least 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides.
- the poly-T element of the capture domain may comprise up to 30 or up to 35 nucleotides.
- the capture domain, or more particularly the poly-T element of the capture domain comprises at least 25, 30 or 35 nucleotides.
- the poly-T element of the capture domain may comprise 10-14 nucleotides, 15-25 nucleotides or 25-35 nucleotides.
- Random sequences may also be used in the capture of nucleic acid, as is known in the art, e.g. random hexamers or similar sequences, and hence such random sequences may be used to form all or a part of the capture domain.
- random sequences may be used in conjunction with poly-T (or poly-T analogue etc.) sequences.
- a capture domain comprises a poly-T (or a “poly-T-like”) oligonucleotide
- it may also comprise a random oligonucleotide sequence. This may for example be located 5′ or 3′ of the poly-T sequence, e.g. at the 3′ end of the capture probe, but the positioning of such a random sequence is not critical.
- Such a construct may facilitate the capturing of the initial part of the poly-A of mRNA.
- the capture domain may be an entirely random sequence. Degenerate capture domains may also be used, according to principles known in the art.
- the capture domain may be capable of binding selectively to a desired sub-type or subset of nucleic acid, e.g. RNA, for example a particular type of RNA such mRNA or rRNA etc. as listed above, or to a particular subset of a given type of RNA, for example, a particular mRNA species e.g. corresponding to a particular gene or group of genes.
- a capture probe may be selected or designed based on sequence of the RNA it is desired to capture. Thus it may be a sequence-specific capture probe, specific for a particular RNA target or group of targets (target group etc). Thus, it may be based on a particular gene sequence or particular motif sequence or common/conserved sequence etc., according to principles well known in the art.
- the capture domain may further comprise an upstream sequence (5′ to the sequence that hybridizes to the nucleic acid, e.g. RNA of the tissue sample) that is capable of hybridizing to 5′ end of the surface probe.
- the capture domain of the capture probe may be seen as a capture domain oligonucleotide, which may be used in the synthesis of the capture probe in embodiments where the capture probe is immobilized on the array indirectly.
- the positional domain (feature identification domain or tag) of the capture probe if present, is located directly or indirectly upstream, i.e. closer to the 5′ end of the capture probe nucleic acid molecule, of the capture domain.
- the positional domain is directly adjacent to the capture domain, i.e. there is no intermediate sequence between the capture domain and the positional domain.
- the positional domain forms the 5′ end of the capture probe, which may be immobilized directly or indirectly on the substrate of the array.
- each feature (distinct position) of the array comprises a spot of a species of nucleic acid probe, preferably wherein the positional domain at each feature is unique.
- the same positional domain may be used for a group of features, preferably a group of features in close proximity to each other. For instance, when multiple species of capture probes that contain different capture domains are used on the same substrate, it may be advantageous to use the same positional domain for each type of capture domain that is immobilized in a group of directly or indirectly adjacent features.
- Directly adjacent features are neighbouring features on the array, for instance if the features are arrayed in a standard grid formation, any single feature will have 8 features that are directly adjacent.
- Indirectly adjacent features may be viewed as features that are in close proximity to each other, i.e. they are immobilized within a specific area on the array surface, but may have one or more features separating them, e.g. 1, 2, 3, 4 or 5 features may separate indirectly adjacent features. In some cases, e.g. on high density arrays, indirectly adjacent features may be separated by up to 10, 20, 30, 40 or 50 features.
- a “species” of capture probe is defined with reference to the sequence of the capture domain and, if present, its positional domain; a single species of capture probe will have a unique capture domain sequence and/or unique combination of capture domain sequence and positional domain sequence. However, it is not required that each member of a species of capture probe has the same sequence in its entirety. In particular, since the capture domain may be or may comprise a random or degenerate sequence, the capture domains of individual probes within a species may vary. Accordingly, in some embodiments where the capture domains of the capture probes are the same, each feature comprises a single probe sequence.
- each feature or position of the array carries a capture probe of a single species (specifically each feature or position carries a capture probe which has an identical positional tag, i.e. there is a single positional domain at each feature or position, although probes immobilized at directly or indirectly adjacent features may comprise the same positional domain if they comprise different capture domains).
- Each species has a different capture domain, positional domain and/or combination of capture domain and positional domain which identifies the species.
- each member of a species may in some cases, as described in more detail herein, have a different capture domain, as the capture domain may be random or degenerate or may have a random or degenerate component. This means that within a given feature, or position, the capture domain of the probes may differ.
- the nucleotide sequence of any one probe molecule immobilized at a particular feature is the same as the other probe molecules immobilized at the same feature, but the nucleotide sequence of the probes at each feature is different, distinct or distinguishable from the probes immobilized at every other feature.
- each feature comprises a different species of probe.
- the nucleotide sequence of the positional domain of any one probe molecule immobilized at a particular feature may be the same as the other probe molecules immobilized at the same feature but the capture domain may vary.
- the capture domain may nonetheless be designed to capture the same type of molecule, e.g. mRNA in general.
- the positional domain when present in the capture probe, comprises the sequence which is unique to each feature or a group of directly or indirectly adjacent features, and acts as a positional or spatial marker (the identification tag).
- each region or domain of the tissue sample e.g. each cell in the tissue
- the positional domain of a capture probe in the array is one aspect of the methods of the invention that allows a specific transcript (or group of transcripts) to be correlated to a position in the tissue sample, for example it may be correlated to a cell in the sample.
- the positional domain of the capture domain may be seen as a nucleic acid tag (identification tag) and enables the position of a transcript to be correlated to a position in the sample indirectly, e.g. by analysis of the sequence of the captured transcript.
- the methods allow a specific transcript (or group of transcripts) to be correlated to a position in the tissue sample directly, i.e. without the need for sequence analysis.
- a species of capture probe may be immobilized on a substrate (either in an array format or uniformly), wherein the capture domain of the capture probe is specific for a transcript (or group of transcripts). Only the specific transcript(s) will interact with (hybridize to) the capture probes. The transcripts will be captured on the substrate in a position relative to where the transcript is expressed in the tissue sample.
- the steps of generating and labelling the cDNA molecules using the captured transcript as a template and subsequent detection e.g.
- imaging, of the labelled cDNA will allow the spatial expression pattern of the transcript to be determined directly.
- the information obtained from the spatial detection, e.g. image, of the labelled cDNA may be correlated with an image the tissue sample to determine the precise areas of expression in the tissue sample.
- the species of capture probe are arrayed on the substrate and the capture probes comprise a positional domain.
- groups of adjacent features i.e. defining a small area on the array
- the step of detecting, e.g. imaging, the labelled cDNA will provide a preliminary analysis of where the transcripts are expressed in the tissue sample. If more specific expression analysis is required or desirable, the immobilized cDNA molecules may be processed and analysed further, as described below. Sequence analysis of the immobilised cDNA allows the position of a particular transcript to be correlated to a position in the tissue sample, e.g. a cell, by virtue of the positional domain in the capture probe.
- the labelled cDNA may be used to as a marker to select areas of cDNA immobilized on the substrate (which are representative of expression activity in the tissue sample) for further analysis.
- immobilized cDNA molecules may be removed from all areas of the substrate except the area of interest, e.g. by laser ablation, and the remaining immobilized cDNA molecules may be processed and analysed as described in more detail below.
- the removal of immobilized cDNA molecules from the surface of the substrate e.g. from regions that correspond to cell or tissues in the tissue sample that are not of interest or from regions where the signal from the labelled cDNA molecules indicates that the transcripts are expressed above or below a specific threshold level, reduces the amount of further analysis required, i.e. fewer cDNA molecules for analysis means that less sequence analysis is required, which may result in a reduction in the amount of reagents and/or time required to perform the analysis.
- any suitable sequence may be used as the positional domain in the capture probes of the invention.
- a suitable sequence it is meant that the positional domain should not interfere with (i.e. inhibit or distort) the interaction between the RNA of the tissue sample and the capture domain of the capture probe.
- the positional domain should be designed such that nucleic acid molecules in the tissue sample do not hybridize specifically to the positional domain.
- the nucleic acid sequence of the positional domain of the capture probes has less than 80% sequence identity to the nucleic acid sequences in the tissue sample.
- the positional domain of the capture probe has less than 70%, 60%, 50% or less than 40% sequence identity across a substantial part of the nucleic acids molecules in the tissue sample. Sequence identity may be determined by any appropriate method known in the art, e.g. using the BLAST alignment algorithm.
- the positional domain of each species of capture probe contains a unique barcode sequence.
- the barcode sequences may be generated using random sequence generation.
- the randomly generated sequences may be followed by stringent filtering by mapping to the genomes of all common reference species and with pre-set Tm intervals, GC content and a defined distance of difference to the other barcode sequences to ensure that the barcode sequences will not interfere with the capture of the nucleic acid, e.g. RNA from the tissue sample and will be distinguishable from each other without difficulty.
- the capture probe may comprise a universal domain (or linker domain or tag).
- the universal domain of the capture probe is located directly or indirectly upstream, i.e. closer to the 5′ end of the capture probe nucleic acid molecule, of the capture domain or, if present, the positional domain.
- the universal domain is directly adjacent to the capture domain or, if present, the positional domain, i.e. there is no intermediate sequence between the capture domain and the universal domain or the positional domain and the universal domain.
- the domain will form the 5′ end of the capture probe, which may be immobilized directly or indirectly on the substrate of the array.
- the universal domain may be utilized in a number of ways in the methods of the invention.
- the methods of the invention comprise a step of releasing (e.g. removing) at least part of the synthesised (i.e. extended) nucleic acid, e.g. cDNA molecules from the surface of the array.
- this may be achieved in a number of ways, of which one comprises cleaving the nucleic acid, e.g. cDNA molecule from the surface of the array.
- the universal domain may itself comprise a cleavage domain, i.e. a sequence that can be cleaved specifically, either chemically or preferably enzymatically.
- the cleavage domain may comprise a sequence that is recognised by one or more enzymes capable of cleaving a nucleic acid molecule, i.e. capable of breaking the phosphodiester linkage between two or more nucleotides.
- the cleavage domain may comprise a restriction endonuclease (restriction enzyme) recognition sequence. Restriction enzymes cut double-stranded or single stranded DNA at specific recognition nucleotide sequences known as restriction sites and suitable enzymes are well known in the art. For example, it is particularly advantageous to use rare-cutting restriction enzymes, i.e.
- nucleic acid e.g. cDNA molecule
- removing or releasing at least part of the nucleic acid, e.g. cDNA molecule requires releasing a part comprising the capture domain of the nucleic acid, e.g. cDNA, and all of the sequence downstream of the capture domain, e.g. all of the sequence that is 3′ to the first nucleotide in the capture domain.
- cleavage of the nucleic acid, e.g. cDNA molecule should take place 5′ to the capture domain.
- removing or releasing at least part of the nucleic acid, e.g. cDNA, molecule requires releasing a part comprising the positional domain of the nucleic acid, e.g. cDNA and all of the sequence downstream of the positional domain, e.g. all of the sequence that is 3′ to the first nucleotide in the positional domain.
- cleavage of the nucleic acid, e.g. cDNA molecule should take place 5′ to the positional domain.
- the cleavage domain may comprise a poly-U sequence which may be cleaved by a mixture of Uracil DNA glycosylase (UDG) and the DNA glycosylase-lyase Endonuclease VIII, commercially known as the USERTM enzyme.
- UDG Uracil DNA glycosylase
- USERTM enzyme commercially known as the USERTM enzyme.
- a further example of a cleavage domain can be utilised in embodiments where the capture probe is immobilized to the array substrate indirectly, i.e. via a surface probe.
- the cleavage domain may comprise one or more mismatch nucleotides, i.e. when the complementary parts of the surface probe and the capture probe are not 100% complementary.
- Such a mismatch is recognised, e.g. by the MutY and T7 endonuclease I enzymes, which results in cleavage of the nucleic acid molecule at the position of the mismatch.
- the capture domain of the capture probe comprises a cleavage domain, wherein the said cleavage domain is located at the 5′ end of the capture domain. This cleavage domain may be viewed as a universal domain or part of the universal domain.
- the positional domain of the capture probe comprises a cleavage domain, wherein the said cleavage domain is located at the 5′ end of the positional domain. This cleavage domain may be viewed as a universal domain or part of the universal domain.
- the universal domain may comprise also an amplification domain. This may be in addition to, or instead of, a cleavage domain. In some embodiments of the invention, as described elsewhere herein, it may be advantageous to amplify the nucleic acid, e.g. cDNA molecules, for example after they have been released (e.g. removed or cleaved) from the substrate. It will be appreciated however, that the initial cycle of amplification, or indeed any or all further cycles of amplification may also take place in situ on the substrate.
- the amplification domain comprises a distinct sequence to which an amplification primer may hybridize.
- the amplification domain of the universal domain of the capture probe is preferably identical for each species of capture probe. Hence a single amplification reaction will be sufficient to amplify all of the nucleic acid, e.g. cDNA, molecules (which may or may not be released from the substrate prior to amplification).
- any suitable sequence may be used as the amplification domain in the capture probes of the invention.
- a suitable sequence it is meant that the amplification domain should not interfere with (i.e. inhibit or distort) the interaction between the nucleic acid, e.g. RNA of the tissue sample, and the capture domain of the capture probe.
- the amplification domain should comprise a sequence that is not the same or substantially the same as any sequence in the nucleic acid, e.g. RNA of the tissue sample, such that the primer used in the amplification reaction can hybridize only to the amplification domain under the amplification conditions of the reaction.
- the amplification domain should be designed such that nucleic acid molecules in the tissue sample do not hybridize specifically to the amplification domain or the complementary sequence of the amplification domain.
- the nucleic acid sequence of the amplification domain of the capture probes and the complement thereof has less than 80% sequence identity to the nucleic acid sequences in the tissue sample.
- the positional domain of the capture probe has less than 70%, 60%, 50% or less than 40% sequence identity across a substantial part of the nucleic acid molecules in the tissue sample. Sequence identity may be determined by any appropriate method known in the art, e.g. the using BLAST alignment algorithm.
- the universal domain of the capture probe may be seen as a universal domain oligonucleotide, which may be used in the synthesis of the capture probe in embodiments where the capture probe is immobilized on the array indirectly.
- the capture domain of the capture probe may be used as an amplification domain.
- the capture probe may be used to capture mRNA from a tissue sample, e.g. using a poly-T oligonucleotide.
- the signal from the labelled cDNA may be detected, e.g. imaged, and a portion of the array may be selected for further analysis.
- the unwanted cDNA molecules may be removed from the substrate, e.g. using laser ablation, and the remaining immobilized cDNA molecules may be released and/or amplified using the capture domain as a primer site, i.e.
- sequence analysis may provide positional information even when the captures probes do not contain positional domains because the sequence information is derived from nucleic acid molecules amplified only from a specific region of the substrate, which correlates to a specific region or portion of the tissue sample.
- the capture domains and universal domains are in one embodiment the same for every species of capture probe for any particular array to ensure that the capture of the nucleic acid, e.g. RNA, from the tissue sample is uniform across the array.
- the capture domains may differ by virtue of including random or degenerate sequences or gene specific sequences.
- the capture probe may be immobilized on the substrate indirectly, e.g. via hybridisation to a surface probe, the capture probe may be synthesised on the substrate as described below.
- each species of surface probe may be unique to each feature (distinct position) or groups of features (directly or indirectly adjacent features) of the array and is partly complementary to the capture probe, defined above.
- the surface probe comprises at its 5′ end a domain (complementary capture domain) that is complementary to a part of the capture domain that does not bind to the nucleic acid, e.g. RNA, of the tissue sample.
- a domain that can hybridize to at least part of a capture domain oligonucleotide.
- the surface probe may further comprise a domain (complementary positional domain or complementary feature identification domain) that is complementary to the positional domain of the capture probe, if present.
- the complementary positional domain is located directly or indirectly downstream (i.e. at the 3′ end) of the complementary capture domain, i.e. there may be an intermediary or linker sequence separating the complementary positional domain and the complementary capture domain.
- the surface probes of the array always comprise a domain (complementary universal domain) at the 3′ end of the surface probe, i.e. directly or indirectly downstream of the positional domain (if present), which is complementary to the universal domain of the capture probe.
- it comprises a domain that can hybridize to at least part of the universal domain oligonucleotide.
- the sequence of the surface probe shows 100% complementarity or sequence identity to the positional domain (if present) and the universal domain and to the part of the capture domain that does not bind to the nucleic acid, e.g. RNA, of the tissue sample.
- the sequence of the surface probe may show less than 100% sequence identity to the domains of the capture probe, e.g. less than 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% or 90%.
- the complementary universal domain shares less than 100% sequence identity to the universal domain of the capture probe.
- the capture probe is synthesized or generated on the substrate.
- the substrate comprises surface probes as defined above. Oligonucleotides that correspond to the capture domain and universal domain of the capture probe are contacted with the substrate and allowed to hybridize to the complementary domains of the surface probes. Excess oligonucleotides may be removed by washing the substrate under standard hybridization conditions.
- the resultant substrate comprises partially single stranded probes, wherein both the 5′ and 3′ ends of the surface probe are double stranded and the complementary positional domain is single stranded.
- the substrate may be treated with a polymerase enzyme to extend the 3′ end of the universal domain oligonucleotide, in a template dependent manner, so as to synthesize the positional domain of the capture probe.
- the 3′ end of the synthesized positional domain is then ligated, e.g. using a ligase enzyme, to the 5′ end of the capture domain oligonucleotide to generate the capture probe.
- a ligase enzyme e.g. a ligase enzyme
- the 5′ end of the capture domain oligonucleotide is phosphorylated to enable ligation to take place.
- each species of surface probe comprises a unique complementary positional domain
- each species of capture probe will comprise a unique positional domain.
- the polymerase extension step described above may be omitted.
- the capture domain and universal domain may be allowed to hybridize to the complementary domains of the surface probes. Excess oligonucleotides may be removed by washing the substrate under standard hybridization conditions. The 3′ end of the universal domain is then ligated, e.g. using a ligase enzyme, to the 5′ end of the capture domain oligonucleotide to generate the capture probe.
- hybridisation or “hybridises” as used herein refers to the formation of a duplex between nucleotide sequences which are sufficiently complementary to form duplexes via Watson-Crick base pairing. Two nucleotide sequences are “complementary” to one another when those molecules share base pair organization homology. “Complementary” nucleotide sequences will combine with specificity to form a stable duplex under appropriate hybridization conditions.
- two sequences need not have perfect homology to be “complementary” under the invention.
- two sequences are sufficiently complementary when at least about 90% (preferably at least about 95%) of the nucleotides share base pair organization over a defined length of the molecule.
- the domains of the capture and surface probes thus contain a region of complementarity.
- the capture domain of the capture probe contains a region of complementarity for the nucleic acid, e.g. RNA (preferably mRNA), of the tissue sample.
- the capture probe may also be synthesised on the substrate using polymerase extension (similarly to as described above) and a terminal transferase enzyme to add a “tail” which may constitute the capture domain.
- polymerase extension similarly to as described above
- a terminal transferase enzyme to add a “tail” which may constitute the capture domain.
- tail which may constitute the capture domain.
- the use of terminal transferases to add nucleotide sequences to the end of an oligonucleotide is known in the art, e.g. to introduce a homopolymeric tail, e.g. a poly-T tail. Accordingly, in such a synthesis an oligonucleotide that corresponds to the universal domain of the capture probe may be contacted with the substrate and allowed to hybridize to the complementary domain of the surface probes.
- Excess oligonucleotides may be removed by washing the substrate under standard hybridization conditions.
- the resultant substrate comprises partially single stranded probes, wherein the 3′ ends of the surface probes are double stranded and the complementary positional domain is single stranded.
- the substrate may be treated with a polymerase enzyme to extend the 3′ end of the universal domain oligonucleotide, in a template dependent manner, so as to synthesize the positional domain of the capture probe.
- the capture domain e.g. comprising a poly-T sequence, may then be introduced using a terminal transferase to add a poly-T tail to the positional domain to generate the capture probe.
- the polymerase extension step may be omitted and the capture domain may be introduced using a terminal transferase to add a poly-T tail to the universal domain to generate the capture probe.
- the object substrate (often simply referred to as the “substrate”) of, and for use in the methods of, the invention may contain multiple spots, or “features”.
- the object substrate may be an array, i.e. an object substrate, e.g. slide or chip, on which the immobilized probes are arrayed on the surface of the substrate.
- a feature may be defined as an area or distinct position on the array substrate at which a single species of capture probe is immobilized.
- each feature will comprise a multiplicity of probe molecules, of the same species. It will be understood in this context that whilst it is encompassed that each capture probe of the same species may have the same sequence, this need not necessarily be the case.
- Each species of capture probe may have the same positional domain (i.e. each member of a species and hence each probe in a feature may be identically “tagged”), but the sequence of each member of the feature (species) may differ, because the sequence of a capture domain may differ.
- random, degenerate or sequence specific capture domains may be used.
- the capture probes within a feature may comprise different random or degenerate sequences.
- the number and density of the features on the substrate, e.g. array will determine the resolution of the array, i.e. the level of detail at which the transcriptome of the tissue sample can be analysed. Hence, a higher density of features will typically increase the resolution of the array.
- the size and number of the features on the substrate, e.g. array, of the invention will depend on the nature of the tissue sample and required resolution.
- the number and/or density of features on the array may be reduced (i.e. lower than the possible maximum number of features) and/or the size of the features may be increased (i.e. the area of each feature may be greater than the smallest possible feature), e.g. an array comprising few large features.
- the capture probes immobilized on the substrate are not in an array format, i.e. the capture probes may be distributed uniformly on the substrate. In these embodiments, it is not necessary for the capture probes to comprise a positional domain, because the capture probes are not immobilized at specific positions on the substrate. However, the capture probes may comprise a universal domain.
- the capture probes are immobilized on at least a portion of the substrate and there is an even amount of capture probe immobilized in any specific area in that portion, i.e. the mean amount of probe immobilized per unit area is consistent across the portion of substrate on which the probe is immobilized.
- the mean amount of probe immobilized per unit area may be controlled by the concentration of probe contacted with the substrate to immobilize the probe or the conditions used to immobilize the probe. For instance, when the capture probe is immobilized to the substrate indirectly, e.g. by hybridisation to a surface probe, the hybridisation and/or wash conditions may be modified such that not all of the surface probes are bound to a capture probe, i.e. in some embodiments not all of the surface probes are occupied by (i.e. bound to) a capture probe. Substrates on which the amount of probe immobilized per unit area is high will have a higher resolution.
- a portion of the substrate may be at least 10% of the total substrate area. In some embodiments, a portion may be at least 20, 30, 40, 50, 60, 70, 80, 90, 95, 99 or 100% of the total substrate area.
- the portion of the substrate on which capture probes may be immobilized will be dependent on the size of the substrate and the size of the tissue sample to be contacted with the substrate.
- the area of the portion of the substrate on which probe is immobilized will be larger than the total area of the tissue sample.
- the area of the portion will be at least 1, 2, 3, 4 or 5% larger than the area of the tissue sample.
- the area of the portion will be least 10, 15, 20, 30, 40, 50% larger than the area of the tissue sample.
- single cell resolution may be a preferred and advantageous feature of the present invention, it is not essential to achieve this, and resolution at the cell group level is also of interest, for example to detect or distinguish a particular cell type or tissue region, e.g. normal vs tumour cells.
- the array may contain at least 2, 5, 10, 50, 100, 500, 750, 1000, 1500, 3000, 5000, 10000, 20000, 40000, 50000, 75000, 100000, 150000, 200000, 300000, 400000, 500000, 750000, 800000, 1000000, 1200000, 1500000, 1750000, 2000000, 2100000. 3000000, 3500000, 4000000, 4200000 or 4300000 features.
- 4300000 represents the maximum number of features presently available on a commercial array, it is envisaged that arrays with features in excess of this may be prepared and such arrays are of interest in the present invention.
- the substrate e.g. array
- the substrate may comprise at least 8600000, 12900000 or 17200000 features.
- the array could contain even larger numbers of features, e.g. it has been postulated that is may be possible to include as many as 3.3 ⁇ 10 9 features on an array.
- feature size may be decreased and this may allow greater numbers of features to be accommodated within the same or a similar area.
- these features may be comprised in an area of less than about 20 cm 2 , 10 cm 2 , 5 cm 2 , 1 cm 2 , 1 mm 2 , or 100 ⁇ m 2 .
- the area of each feature may be from about 1 ⁇ m 2 , 2 ⁇ m 2 , 3 ⁇ m 2 , 4 ⁇ m 2 , 5 ⁇ m 2 , 10 ⁇ m 2 , 12 ⁇ m 2 , 15 ⁇ m 2 , 20 ⁇ m 2 , 50 ⁇ m 2 , 75 ⁇ m 2 , 100 ⁇ m 2 , 150 ⁇ m 2 , 200 ⁇ m 2 , 250 ⁇ m 2 , 300 ⁇ m 2 , 400 ⁇ m 2 , or 500 ⁇ m 2 .
- the area of a feature may be less than 1 ⁇ m 2 , e.g. less than 0.5, 0.4, 0.2 or 0.1 ⁇ m 2 .
- the feature e.g. the area on which a capture probe is immobilized on the substrate with a homogeneous distribution, i.e. uniformly
- the feature may be from about 100 ⁇ m 2 -20 cm 2 , 1 mm 2 -10 cm 2 , 0.5 cm 2 -5 cm 2 , 0.6 cm 2 -4 cm 2 , 0.7 cm 2 -3 cm 2 , 0.8 cm 2 -2 cm 2 or 0.9 cm 2 -1 cm 2 . e.g. at least about 0.5 cm 2 , 0.6 cm 2 , 0.7 cm 2 , 0.8 cm 2 , 0.9 cm 2 , 1 cm 2 , 2 cm 2 , 3 cm 2 , 4 cm 2 or 5 cm 2, .
- tissue sample from any organism could be used in the methods of the invention, e.g. plant, animal or fungal.
- the substrate, e.g. array, of the invention allows the capture of any nucleic acid, e.g. mRNA molecules, which are present in cells that are capable of transcription and/or translation.
- the substrates, e.g. arrays, and methods of the invention are particularly suitable for isolating and analysing the transcriptome of cells within a sample, wherein spatial resolution of the transcriptomes is desirable, e.g. where the cells are interconnected or in contact directly with adjacent cells.
- the methods of the invention may also be useful for the analysis of the transcriptome of different cells or cell types within a sample even if said cells do not interact directly, e.g. a blood sample.
- the cells do not need to present in the context of a tissue and can be applied to the array as single cells (e.g. cells isolated from a non-fixed tissue).
- Such single cells whilst not necessarily fixed to a certain position in a tissue, are nonetheless applied to a certain position on the substrate, e.g. array, and can be individually identified.
- tissue sample may be defined as a sample of tissue comprising one or more cells. It may include a suspension of cells.
- the sample may thus be a harvested or biopsied tissue sample, or possibly a cultured sample.
- Representative samples include clinical samples e.g. whole blood or blood-derived products, blood cells, tissues, biopsies, or cultured tissues or cells etc. including cell suspensions.
- the sample may be enriched for one or more types of cell, e.g. specific types of blood cell or tumour cells. Techniques for cell isolation or enrichment are known in the art, and may include positive or negative selection based on expression of particular cell markers. Artificial tissues may for example be prepared from cell suspension (including for example blood cells). Cells may be captured in a matrix (for example a gel matrix e.g. agar, agarose, etc) and may then be sectioned in a conventional way. Such procedures are known in the art in the context of immunohistochemistry (see e.g. Andersson et al 2006, J. Histochem. Cytochem. 54(12): 1413-23. Epub 2006 Sep. 6).
- tumour cells especially transcriptionally active, e.g. metastatic, tumour cells or tumour cells with metastatic potential.
- tumour cells may be found in blood. Whilst about 90% of the population of circulating tumour cells may show no or little gene activity, because apoptosis or necrosis pathways are activated in this population, the remaining 10% are transcriptionally active. At least some of the transcriptionally active cells are likely to give rise to metastasis and it would be useful to be able to identify these cells.
- the tissue sample may be a suspension of cells containing tumour cells (e.g.
- tumour cells isolated from a blood sample, or a blood sample in which the tumour cells have been enriched, or a biopsy or tissue sample, or tumour cells enriched from such a sample).
- the method may be performed as described above, wherein the detection of labelled cDNA will correlate to transcriptionally active, e.g. metastatic or potentially metastatic, tumour cells.
- transcriptionally active e.g. metastatic or potentially metastatic, tumour cells.
- the invention may be seen as providing a method for the identification of tumour cells, especially transcriptionally active, e.g. potentially metastatic, tumour cells.
- tissue preparation may affect the transcriptomic analysis of the methods of the invention.
- various tissue samples will have different physical characteristics and it is well within the skill of a person in the art to perform the necessary manipulations to yield a tissue sample for use with the methods of the invention.
- any method of sample preparation may be used to obtain a tissue sample that is suitable for use in the methods of the invention.
- any layer of cells with a thickness of approximately 1 cell or less may be used in the methods of the invention.
- the thickness of the tissue sample may be less than 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2 or 0.1 of the cross-section of a cell.
- the present invention is not limited to single cell resolution and hence it is not a requirement that the tissue sample has a thickness of one cell diameter or less; thicker tissue samples may, if desired, be used.
- cryostat sections may be used, which may be e.g. 10-20 ⁇ m thick.
- the tissue sample may be prepared in any convenient or desired way and the invention is not restricted to any particular type of tissue preparation. Fresh, frozen, fixed or unfixed tissues may be used. Any desired convenient procedure may be used for fixing or embedding the tissue sample, as described and known in the art. Thus any known fixatives or embedding materials may be used.
- the tissue may prepared by deep freezing at temperature suitable to maintain or preserve the integrity (i.e. the physical characteristics) of the tissue structure, e.g. less than ⁇ 20° C. and preferably less than ⁇ 25, ⁇ 30, ⁇ 40, ⁇ 50, ⁇ 60, ⁇ 70 or ⁇ 80° C.
- the frozen tissue sample may be sectioned, i.e. thinly sliced, onto the substrate surface by any suitable means.
- the tissue sample may be prepared using a chilled microtome, a cryostat, set at a temperature suitable to maintain both the structural integrity of the tissue sample and the chemical properties of the nucleic acids in the sample, e.g. to less than ⁇ 15° C.
- the sample should be treated so as to minimize the degeneration or degradation of the nucleic acid, e.g. RNA in the tissue.
- the nucleic acid e.g. RNA in the tissue.
- Such conditions are well-established in the art and the extent of any degradation may be monitored through nucleic acid extraction, e.g. total RNA extraction and subsequent quality analysis at various stages of the preparation of the tissue sample.
- the tissue may be prepared using standard methods of formalin-fixation and paraffin-embedding (FFPE), which are well-established in the art. Following fixation of the tissue sample and embedding in a paraffin or resin block, the tissue samples may sectioned, i.e. thinly sliced, onto the substrate, e.g. array. As noted above, other fixatives and/or embedding materials can be used.
- FFPE formalin-fixation and paraffin-embedding
- tissue sample section will need to be treated to remove the embedding material, e.g. to deparaffinize, i.e. to remove the paraffin or resin, from the sample prior to carrying out the methods of the invention.
- This may be achieved by any suitable method and the removal of paraffin or resin or other material from tissue samples is well established in the art, e.g. by incubating the sample (on the surface of the array) in an appropriate solvent e.g. xylene, e.g. twice for 10 minutes, followed by an ethanol rinse, e.g. 99.5% ethanol for 2 minutes, 96% ethanol for 2 minutes, and 70% ethanol for 2 minutes.
- an appropriate solvent e.g. xylene, e.g. twice for 10 minutes
- an ethanol rinse e.g. 99.5% ethanol for 2 minutes, 96% ethanol for 2 minutes, and 70% ethanol for 2 minutes.
- RNA in tissue sections prepared using methods of FFPE or other methods of fixing and embedding is more likely to be partially degraded than in the case of frozen tissue.
- this may be advantageous in the methods of the invention. For instance, if the RNA in the sample is partially degraded the average length of the RNA polynucleotides will be less and more randomized than a non-degraded sample. It is postulated therefore that partially degraded RNA would result in less bias in the various processing steps, described elsewhere herein, e.g. ligation of adaptors (amplification domains), amplification of the cDNA molecules and sequencing thereof.
- the tissue sample i.e. the section of the tissue sample contacted with the substrate, e.g. array
- the tissue sample is prepared using FFPE or other methods of fixing and embedding.
- the sample may be fixed, e.g. fixed and embedded.
- the tissue sample is prepared by deep-freezing.
- a touch imprint of a tissue may be used, according to procedures known in the art.
- an unfixed sample may be used.
- the thickness of the tissue sample section for use in the methods of the invention may be dependent on the method used to prepare the sample and the physical characteristics of the tissue. Thus, any suitable section thickness may be used in the methods of the invention.
- the thickness of the tissue sample section will be at least 0.1 ⁇ m, further preferably at least 0.2, 0.3, 0.4, 0.5, 0.7, 1.0, 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 ⁇ m.
- the thickness of the tissue sample section is at least 10, 12, 13, 14, 15, 20, 30, 40 or 50 ⁇ m.
- the thickness is not critical and these are representative values only. Thicker samples may be used if desired or convenient e.g. 70 or 100 ⁇ m or more.
- the thickness of the tissue sample section is between 1-100 ⁇ m, 1-50 ⁇ m, 1-30 ⁇ m, 1-25 ⁇ m, 1-20 ⁇ m, 1-15 ⁇ m, 1-10 ⁇ m, 2-8 ⁇ m, 3-7 ⁇ m or 4-6 ⁇ m, but as mentioned above thicker samples may be used.
- the nucleic acid e.g. RNA
- the capture probes On contact of the tissue sample section with the substrate, e.g. following removal of the embedding material e.g. deparaffinization, the nucleic acid, e.g. RNA, molecules in the tissue sample will bind to the immobilized capture probes on the substrate.
- facilitating the hybridization comprises modifying the conditions under which hybridization occurs.
- the primary conditions that can be modified are the time and temperature of the incubation of the tissue section on the array prior to the reverse transcription step, which is described elsewhere herein.
- tissue samples from different sources may require different treatments to allow the nucleic acids to interact with, i.e. hybridize to, the capture probes immobilized on the substrate.
- the nucleic acid may be captured on the substrate, but may not correlate accurately with its original spatial distribution in the tissue sample (see FIG. 2 C ), i.e. the signal from the labelled cDNA molecules may have low spatial resolution.
- the signal from the labelled cDNA molecules may have low spatial resolution.
- the methods used to fix the tissue sample may also impact on the nucleic acid transfer from tissue sample to substrate.
- Suitable methods and agents for permeabilizing and/or fixing cells and tissues are well known in the art and any appropriate method may be selected for use in the methods of the invention.
- the methods of the invention may be used to determine the optimum conditions, e.g. the optimum combination of permeabilizing and/or fixative agents, for the capture of nucleic acids from a particular tissue sample.
- the inventors have found that some proteases are particularly useful in permeabilizing cells in a tissue sample, e.g. pepsin.
- Particularly useful fixatives include, e.g. methanol.
- the methods and substrate of the invention are particularly useful for determining the optimum conditions for localised or spatial detection of the transcriptome of a tissue sample.
- the step of labelling the cDNA generated on the substrate is particularly important because it enables the efficacy of the nucleic acid molecule capture to be assessed.
- Labelling the cDNA allows it to be detected, e.g. visualised, directly and the intensity and/or resolution of the detected signal can be quantified.
- the signal intensity and/or resolution may be compared with the signal obtained from cDNA generated on a substrate prepared using different methods, e.g. tissue permeabilization and/or fixation methods.
- the methods that result in the best signal intensity and/or resolution may be selected for use in future analyses and/or may be optimised further.
- the methods do not require the capture probes to comprise positional domains and/or universal domains (although the capture probes may comprise these domains in some embodiments). Furthermore, the capture probes do not need to be arrayed on the substrate (although the capture probes may be arrayed in some embodiments). Consequently, the methods and substrates of the invention are particularly advantageous because they can be performed cheaply and using commonly available instrumentation or apparatus. Once optimum conditions have been determined for capturing nucleic acid molecules on a substrate from a particularly type of tissue sample and/or tissue sample prepared using a particular method, the optimum conditions can be used to analyse similar tissue samples, wherein further analysis, such as sequence analysis may be performed. The methods of the invention therefore obviate the need to use expensive substrates to optimise the nucleic acid capture conditions, i.e. arrays comprising multiple species of immobilized capture probes, which contain positional and/or universal domains.
- the substrate may be incubated for at least 1 hour to allow the nucleic acid, e.g. RNA, to hybridize to the capture probes. This may be particularly useful for FFPE tissue samples before the paraffin is removed.
- the substrate may be incubated for at least 2, 3, 5, 10, 12, 15, 20, 22 or 24 hours or until the tissue sample section has dried. In other embodiments, e.g.
- the substrate may be incubated for less time, e.g. at least 5 minutes, e.g. at least 10, 15, 20, 25 or 30 minutes.
- the substrate incubation time is not critical and any convenient or desired time may be used.
- Typical substrate, e.g. array, incubations may be up to 72 hours.
- the incubation may occur at any suitable temperature, for instance at room temperature, although in a preferred embodiment the tissue sample section is incubated on the array at a temperature of at least 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37° C.
- Incubation temperatures of up to 55° C., e.g. 40, 45 or 50° C. are commonplace in the art.
- the tissue sample section is allowed to dry on the substrate, e.g. array, at 37° C. for 24 hours. In another preferred embodiment, the tissue sample section is allowed to dry on the substrate, e.g. array, at 50° C. for 15 minutes. It will be understood therefore that the precise conditions and methods for contacting the tissue sample with the array are not critical and may vary according to the nature of the sample and the fixation.
- the substrate may be stored at room temperature before performing the reverse transcription step. It will be understood that the if the tissue sample section is allowed to dry on the substrate surface, it will need to be rehydrated before further manipulation of the captured nucleic acid can be achieved, e.g. the step of reverse transcribing the captured RNA.
- the method of the invention may comprise a further step of rehydrating the tissue sample after contacting the sample with the substrate, e.g. array.
- the tissue sample e.g. tissue section
- the tissue sample may be treated or modified prior to the step of contacting the tissue sample with the substrate and/or prior to generating the cDNA molecules on the substrate, e.g. to select one or more portions of the tissue sample for analysis.
- the tissue sample may be dissected to isolate one or more portions for analysis.
- the tissue sample may be dissected to discard one or more portions for which analysis is not required. Any suitable method for dissecting the tissue sample may be utilised in the methods of the invention.
- the tissue sample is dissected using laser capture microdissection (LCM).
- the method of the invention may comprise a step of dissecting the tissue sample. This aspect of the method comprise a step of retaining one or more portions of tissue sample for analysis and/or discarding one or more portions of tissue sample.
- the tissue sample may be dissected on the substrate.
- the tissue sample may be contacted with (e.g. fixed to) a LCM membrane.
- the LCM membrane:tissue sample composite may be further contacted with the object substrate to form a “sandwich”, in which the tissue sample is the central layer in the sandwich.
- One or more portions of the tissue sample may be dissected using a laser, wherein the one or more portions of the tissue sample that are not required for analysis are removed from the substrate (e.g. peeled off along with the LCM membrane) and optionally discarded.
- the LCM membrane may be removed from the remaining one or more portions of tissue sample on the substrate and the method of the invention may be performed as described herein.
- the one or more portions of tissue sample removed from the substrate may be used for analysis.
- capture probes may be immobilized on the surface of the LCM membrane and/or the substrate.
- the LCM membrane may be an object substrate as described herein.
- the step of dissecting the tissue sample may comprise contacting the tissue sample with more than one substrate, wherein RNA is captured from one or more portions of the tissue sample on each substrate.
- the incorporation of a blocking domain may be incorporated into the capture probe when it is synthesised. However, the blocking domain may be incorporated to the capture probe after its synthesis.
- the capture probes may be blocked by any suitable and reversible means that would prevent modification of the capture domains during the process of modifying the nucleic acid and/or the tissue sample, which occurs after the tissue sample has been contacted with the substrate.
- the capture probes may be reversibly masked or modified such that the capture domain of the capture probe does not comprise a free 3′ end, i.e. such that the 3′ end is removed or modified, or made inaccessible so that the capture probe is not susceptible to the process or reaction which is used to modify the nucleic acid and/or the tissue sample.
- capture probe may be modified after the process or reaction to reveal and/or restore the 3′ end of the capture domain of the capture probe.
- blocking probes may be hybridised to the capture probes to mask the free 3′ end of the capture domain, e.g. hairpin probes or partially double stranded probes, suitable examples of which are known in the art.
- the free 3′ end of the capture domain may be blocked by chemical modification, e.g. addition of an azidomethyl group as a chemically reversible capping moiety such that the capture probes do not comprise a free 3′ end.
- Suitable alternative capping moieties are well known in the art, e.g. the terminal nucleotide of the capture domain could be a reversible terminator nucleotide, which could be included in the capture probe during or after probe synthesis.
- the capture domain of the capture probe could be modified so as to allow the removal of any modifications of the capture probe, e.g. additional nucleotides, that occur when the nucleic acid molecules and/or the tissue sample are modified.
- the capture probes may comprise an additional sequence downstream of the capture domain, i.e. 3′ to capture domain, namely a blocking domain. This could be in the form of, e.g. a restriction endonuclease recognition sequence or a sequence of nucleotides cleavable by specific enzyme activities, e.g. uracil.
- the capture probes could be subjected to an enzymatic cleavage, which would allow the removal of the blocking domain and any of the additional nucleotides that are added to the 3′ end of the capture probe during the modification process.
- the removal of the blocking domain would reveal and/or restore the free 3′ end of the capture domain of the capture probe.
- the blocking domain could be synthesised as part of the capture probe or could be added to the capture probe in situ (i.e. as a modification of an existing substrate), e.g. by ligation of the blocking domain.
- the capture probes may be blocked using any combination of the blocking mechanisms described above.
- the capture probe must be unblocked, e.g. by dissociation of the blocking oligonucleotide, removal of the capping moiety and/or blocking domain.
- the tissue sample is oriented in relation to the immobilized probes on the substrate, e.g. oriented in relation to the features on the array.
- the tissue sample is placed on the substrate, e.g. array, such that the position of a capture probe on the substrate, e.g. array, may be correlated with a position in the tissue sample.
- each species of capture probe or each feature of the array
- it may be identified to which location in the tissue sample the position of each species of capture probe corresponds. This may be done by virtue of positional markers present on the array, as described below.
- the tissue sample may be imaged following its contact with the array. This may be performed before or after the nucleic acid of the tissue sample is processed, e.g. before or after the cDNA generation step of the method, in particular the step of generating the first strand cDNA by reverse transcription.
- the tissue sample is imaged before the immobilized cDNA is labelled.
- the tissue sample may be imaged at the same time as the labelled cDNA is imaged.
- the tissue sample may be imaged prior to the release of the captured and synthesised (i.e. extended) cDNA from the substrate, e.g. array.
- the tissue is imaged after the nucleic acid of the tissue sample has been processed, e.g. after the reverse transcription step, and any residual tissue is removed (e.g. washed) from the array prior to detecting, e.g. imaging, the labelled cDNA and/or the release of molecules from the substrate, e.g. array.
- the step of processing the captured nucleic acid e.g. the reverse transcription step, may act to remove residual tissue from the array surface, e.g. when using tissue preparing by deep-freezing.
- imaging of the tissue sample may take place prior to the processing step, e.g. the cDNA synthesis step.
- imaging may take place at any time after contacting the tissue sample with the substrate, but before any step which degrades or removes the tissue sample. As noted above, this may depend on the tissue sample.
- the substrate e.g. array
- the substrate may comprise markers to facilitate the orientation of the tissue sample or the image thereof in relation to the immobilized capture probes on the substrate, e.g. the features of the array.
- Any suitable means for marking the array may be used such that they are detectable when the tissue sample is imaged.
- a molecule e.g. a fluorescent molecule, that generates a signal, preferably a visible signal, may be immobilized directly or indirectly on the surface of the array.
- the array comprises at least two markers in distinct positions on the surface of the substrate, further preferably at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 30, 40, 50, 60, 70, 80, 90 or 100 markers.
- markers may be provided in a pattern, for example the markers may make up an outer edge of the portion of the substrate on which the capture probes are immobilized, e.g. the markers may be a row of features on the outer border of the portion on which the capture probes are immobilized on the substrate, e.g. an entire outer row of features on an array.
- Other informative patterns may be used, e.g. lines sectioning the array. This may facilitate aligning an image of the tissue sample to the signal detected from the labelled cDNA molecules, (e.g. the image of the labelled cDNA molecules) i.e.
- the marker may be an immobilized molecule to which a signal giving molecule may interact to generate a signal.
- the substrate e.g. array
- the substrate may comprise a marker feature, e.g. a nucleic acid probe immobilized on the substrate to which a labelled nucleic acid may hybridize.
- a labelled nucleic acid molecule, or marker nucleic acid may be linked or coupled to a chemical moiety capable of fluorescing when subjected to light of a specific wavelength (or range of wavelengths), i.e. excited.
- Such a marker nucleic acid molecule may be contacted with the array before, contemporaneously with or after the tissue sample is stained in order to visualize or image the tissue sample.
- the marker must be detectable when the tissue sample is imaged.
- the marker may be detected using the same imaging conditions used to visualize the tissue sample.
- it is advantageous that the marker is detectable when the labelled cDNA is detected, e.g. imaged.
- the marker may be detected using the same conditions e.g. imaging conditions, used to detect the signal from the labelled cDNA.
- the substrate e.g. array
- the substrate comprises marker features to which a labelled, preferably fluorescently labelled, marker nucleic acid molecule, e.g. oligonucleotide, is hybridized.
- the step of detecting, e.g. imaging, the labelled cDNA may use any convenient means known in the art, but typically will comprise microscopy e.g. light, bright field, dark field, phase contrast, fluorescence, reflection, interference, confocal microscopy or a combination thereof.
- the method used will be dependent on the method used to label the cDNA synthesized on the surface of the substrate. Numerous methods for labelling nucleic acid molecules, both single stranded and double stranded molecules are known in the art.
- the label must result in a visibly detectable signal. Whilst the label does not have to be directly signal giving, this is preferred as it reduces the number of processing steps require to generate a signal. If several steps are required to generate a signal from the labelled cDNA, the resulting signal may be inconsistent, i.e. signals from different areas of the substrate may be non-uniform.
- a directly detectable label is one that can be directly detected without the use of additional reagents
- an indirectly detectable label is one that is detectable by employing one or more additional reagents, e.g., where the label is a member of a signal producing system made up of two or more components.
- the label is a directly detectable label, where directly detectable labels of interest include, but are not limited to: fluorescent labels, coloured labels, radioisotopic labels, chemiluminescent labels, and the like. Any spectrophotometrically or optically-detectable label may be used.
- the label may provide a signal indirectly, i.e. it may require the addition of further components to generate signal.
- the label may be capable of binding a molecule that is conjugated to a signal giving molecule.
- the label is incorporated into the synthesized part of the cDNA molecules, i.e. as part of the synthesized molecules, e.g. a labelled nucleotide, or binds to the newly synthesized part of the nucleic acid molecule.
- the capture probe, or a part thereof (such as a positional or universal domain), is not a label for the purpose of this aspect of the invention.
- the function of the label is to indicate areas on the substrate at which transcript has been captured and cDNA has been synthesized. Accordingly, a capture probe, or part thereof, cannot achieve this function as its presence on the surface of the substrate is not conditional on the presence of transcript captured on the surface of the substrate.
- the cDNA is labelled by the incorporation of a labelled nucleotide when the cDNA is synthesized.
- the labelled nucleotide may be incorporated in the first and/or second strand synthesis.
- the labelled nucleotide is a fluorescently labelled nucleotide.
- the labelled cDNA may be imaged by fluorescence microscopy.
- fluorescent labels require excitation to provide a detectable signal, as the source of excitation is derived from the instrument/apparatus used to detect the signal, fluorescent labels may be viewed as directly signal giving labels. Fluorescent molecules that may be used to label nucleotides are well known in the art, e.g.
- fluorescently tagged CTP (such as Cy3-CTP, Cy5-CTP) is incorporated into the cDNA molecules synthesized on the surface of the array.
- labels may be incorporated into the synthesized cDNA by binding to the molecules, e.g., via intercalation.
- Representative detectable molecules that may find use in such embodiments include fluorescent nucleic acid stains, such as phenanthridinium dyes, including monomers or homo- or heterodimers thereof, that give an enhanced fluorescence when complexed with nucleic acids.
- fluorescent nucleic acid stains such as phenanthridinium dyes, including monomers or homo- or heterodimers thereof, that give an enhanced fluorescence when complexed with nucleic acids.
- phenanthridinium dyes include ethidium homodimer, ethidium bromide, propidium iodide, and other alkyl-substituted phenanthridinium dyes.
- the nucleic acid stain is or incorporates an acridine dye, or a homo- or heterodimer thereof, such as acridine orange, acridine homodimer, ethidium-acridine heterodimer, or 9-amino-6-chloro-2-methoxyacridine.
- the nucleic acid stain is an indole or imidazole dye, such as Hoechst 33258, Hoechst 33342, Hoechst 34580 (BIOPROBES 34, Molecular Probes, Inc.
- nucleic acid stains include, but are not limited to, 7-aminoactinomycin D, hydroxystilbamidine, LDS 751, selected psoralens (furocoumarins), styryl dyes, metal complexes such as ruthenium complexes, and transition metal complexes (incorporating Tb 3+ and Eu 3+ , for example).
- the nucleic acid stain is a cyanine dye or a homo- or heterodimer of a cyanine dye that gives an enhanced fluorescence when associated with nucleic acids.
- a cyanine dye or a homo- or heterodimer of a cyanine dye that gives an enhanced fluorescence when associated with nucleic acids.
- nucleic acid stains commercially available under the trademarks TOTO, BOBO, POPO, YOYO, TO-PRO, BO-PRO, PO-PRO and YO-PRO from Molecular Probes, Inc., Eugene, Oreg. Any of the dyes described in U.S. Pat. No. 5,436,134 to Haugland et al. (1995), U.S. Pat. No. 5,658,751 to Yue et al. (1997), and U.S. Pat. No. 5,863,753 to Haugland et al.
- nucleic acid stains commercially available under the trademarks SYBR Green, SYBR Gold, EvaGreen, SYTO, SYTOX, PICOGREEN, OLIGREEN, and RIBOGREEN from Molecular Probes, Inc., Eugene, Oreg.
- the nucleic acid stain is a monomeric, homodimeric or heterodimeric cyanine dye that incorporates an aza- or polyazabenzazolium heterocycle, such as an azabenzoxazole, azabenzimidazole, or azabenzothiazole, that gives an enhanced fluorescence when associated with nucleic acids, including nucleic acid stains commercially available under the trademarks SYTO, SYTOX, JOJO, JO-PRO, LOLO, LO-PRO from Molecular Probes, Inc., Eugene, Oreg.
- the type of nucleic acid stain may be selected based on its capacity to bind to single or double stranded nucleic acid.
- nucleic acid stains capable of labelling single stranded nucleic acid molecules as the RNA transcript captured on the substrate and used to template cDNA synthesis may be partially or fully degraded.
- the methods may include a step of removing a portion of the nucleic acid molecules immobilized on the surface of the substrate.
- This step may be particularly advantageous for analysing the transcriptome of part or portion of a tissue sample, e.g. an area of interest, particular cell or tissue type etc. Removing nucleic acid molecules immobilized on the surface of the substrate that are not of interest may reduce costs and/or time required for further analysis steps. Fewer reagents are needed to perform sequence analysis on cDNA molecules from a portion of the tissue sample in comparison to the reagents required to perform sequence analysis on cDNA molecules from the whole of the tissue sample. Correspondingly, less sequence analysis is required for cDNA molecules from a portion of the tissue sample.
- a further benefit derived from removing a portion of the nucleic acid molecules from the surface of the substrate is that it is not necessary to include a positional domain in the capture probe to correlate the sequence analysis with a position in the tissue sample.
- the sequences analysed will have been derived from the specific area of the tissue sample that correlates to the portion of cDNA molecules that were not removed from the substrate. Accordingly, it is not necessary to immobilize the capture probes on the substrate in the form of an array.
- the capture probes comprise a positional domain and/or are immobilized on the substrate in an array format, i.e. the substrate is an array.
- the signal obtained from the step of detecting, e.g. imaging, the labelled cDNA molecules enables areas of the tissue sample to be selected for further analysis.
- a single discrete portion of the immobilized cDNA on the substrate may be selected for further analysis and all other immobilized nucleic acid molecules on the surface of the substrate may be removed. It will evident that more than one portion may be selected for further analysis, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more portions. In some embodiments 15, 20, 25, 30, 40, 50 or more portions may be selected. Accordingly, cDNA molecules from one or more portions may be selected for removal, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10 or more portions.
- the portions selected for further analysis (or removal) may be based cell or tissue types, by reference an image of the tissue sample and correlating the position in the tissue sample with the position on the substrate.
- the portions selected for further analysis (or removal) may be based on the amount of cDNA immobilized in a particular area. For instance, portions of the substrate in which the intensity of the signal from the immobilized labelled cDNA molecules is above and/or below specific threshold limits may be targeted for removal (or further analysis).
- portions on the substrate that correlate to parts of the tissue sample with high levels of transcription may be removed to enrich the proportion of the transcriptome analysed for parts of the tissue sample with moderate or low levels of transcription.
- the analysis may be focussed on parts of the tissue sample with high levels of transcription.
- the step of removing a portion of the nucleic acid molecules immobilized on the surface of the substrate may be achieved using any convenient means.
- the immobilized cDNA molecules may be removed by laser ablation, e.g. the portion(s) of the substrate from which the cDNA molecules are to be removed may be identified by detecting, e.g. imaging, the labelled cDNA molecules and those areas subjected to treatment with a laser that is sufficient to remove the cDNA molecules from the surface of the substrate.
- the laser ablation may also remove the tissue sample from the targeted areas.
- the tissue sample may be removed from the substrate, as described elsewhere herein, prior to the removal of a portion the immobilized cDNA molecules.
- Suitable instruments and apparatus for removing cDNA molecules from the surface of an array are known in the art, e.g. a MMI Cell cut instrument (Molecular Machines and Industries AG, Glattburg, Switzerland).
- Other means for removing cDNA molecules from the surface of the substrate may include cleavage, e.g. enzymatic cleavage.
- the portion(s) of the substrate for further analysis may be masked (e.g. using standard array mask apparatus) and the non-masked areas of the substrate subjected to a cleavage agent, e.g. an enzyme, to release the capture probes (and attached cDNA molecules) from the surface of the substrate, as described above.
- the portion of the substrate selected for further analysis may be unmasked and subsequent analysis performed according to the remaining method steps described herein.
- the step of imaging the tissue may use any convenient histological means known in the art, e.g. light, bright field, dark field, phase contrast, fluorescence, reflection, interference, confocal microscopy or a combination thereof.
- tissue sample is stained prior to visualization to provide contrast between the different regions, e.g. cells, of the tissue sample.
- the type of stain used will be dependent on the type of tissue and the region of the cells to be stained.
- staining protocols are known in the art.
- more than one stain may be used to visualize (image) different aspects of the tissue sample, e.g. different regions of the tissue sample, specific cell structures (e.g. organelles) or different cell types.
- the tissue sample may be visualized or imaged without staining the sample, e.g. if the tissue sample contains already pigments that provide sufficient contrast or if particular forms of microscopy are used.
- the tissue sample is visualized or imaged using fluorescence microscopy. Accordingly, in some embodiments, the tissue sample and the labelled cDNA may be visualized or imaged at the same time or sequentially using the same imaging apparatus.
- the tissue sample i.e. any residual tissue that remains in contact with the substrate following the reverse transcription step and detecting, e.g. imaging, the labelled cDNA, and optionally imaging the tissue sample if imaging the tissue sample is desired and was not carried out before reverse transcription, preferably is removed prior to the step of releasing the cDNA molecules from the substrate.
- the methods of the invention may comprise a step of washing the substrate. Removal of the residual tissue sample may be performed using any suitable means and will be dependent on the tissue sample.
- the substrate may be washed with water.
- the water may contain various additives, e.g. surfactants (e.g. detergents), enzymes etc to facilitate to removal of the tissue.
- the substrate is washed with a solution comprising a proteinase enzyme (and suitable buffer) e.g. proteinase K.
- a proteinase enzyme e.g. proteinase K.
- the solution may comprise also or alternatively cellulase, hemicellulase or chitinase enzymes, e.g. if the tissue sample is from a plant or fungal source.
- the temperature of the solution used to wash the substrate may be, e.g. at least 30° C., preferably at least 35, 40, 45, 50 or 55° C. It will be evident that the wash solution should minimize the disruption of the immobilized nucleic acid molecules.
- the nucleic acid molecules may be immobilized on the substrate indirectly, e.g. via hybridization of the capture probe and the RNA and/or the capture probe and the surface probe, thus the wash step should not interfere with the interaction between the molecules immobilized on the substrate, i.e. should not cause the nucleic acid molecules to be denatured.
- the step of securing (acquiring) the hybridized nucleic acid takes place.
- Securing or acquiring the captured nucleic acid involves extending the capture probe to produce a copy of the captured nucleic acid, e.g. generating cDNA from the captured (hybridized) RNA. It will be understood that this refers to the synthesis of a complementary strand of the hybridized nucleic acid, e.g. generating cDNA based on the captured RNA template (the RNA hybridized to the capture domain of the capture probe).
- the captured (hybridized) nucleic acid e.g. RNA acts as a template for the extension, e.g. reverse transcription, step.
- securing or acquiring the capture nucleic acid may be viewed as tagging or marking the captured nucleic acid with the positional domain specific to the feature on which the nucleic acid is captured.
- the step of securing or acquiring the captured nucleic acid involves the directly incorporating a signal giving label into the synthesized copy of the captured nucleic acid molecule.
- Reverse transcription concerns the step of synthesizing cDNA (complementary or copy DNA) from RNA, preferably mRNA (messenger RNA), by reverse transcriptase.
- cDNA can be considered to be a copy of the RNA present in a cell at the time at which the tissue sample was taken, i.e. it represents all or some of the genes that were expressed in said cell at the time of isolation.
- the capture probe acts as a primer for producing the complementary strand of the nucleic acid hybridized to the capture probe, e.g. a primer for reverse transcription.
- the nucleic acid e.g. cDNA
- the extension reaction e.g. reverse transcription reaction
- the sequence of the capture probe i.e. the extension reaction, e.g. reverse transcription reaction.
- the molecules generated by the extension reaction incorporate directly a label such that the amount of transcript in the tissue sample that is in contact with the substrate may be determined, e.g. by measuring the intensity of the signal generated by the label.
- each species of capture probe may comprise a positional domain (feature identification tag) that represents a unique sequence for each feature of the array.
- feature identification tag a positional domain that represents a unique sequence for each feature of the array.
- all of the nucleic acid, e.g. cDNA, molecules synthesized at a specific feature will comprise the same nucleic acid “tag”.
- the nucleic acid, e.g. cDNA, molecules synthesized at a specific position or area on the surface of the substrate, e.g. each feature of an array, may represent the genes expressed from the region or area of the tissue sample in contact with that position or area, e.g. feature.
- a tissue or cell type or group or sub-group thereof may further represent genes expressed under specific conditions, e.g. at a particular time, in a specific environment, at a stage of development or in response to stimulus etc.
- the cDNA at any single position or area, e.g. feature may represent the genes expressed in a single cell, or if the position or area, e.g.
- the cDNA may represent the genes expressed in more than one cell.
- each position within the area e.g. each feature, may represent a proportion of the genes expressed in said cell.
- the step of extending the capture probe may be performed using any suitable enzymes and protocol of which many exist in the art, as described in detail below. However, it will be evident that it is not necessary to provide a primer for the synthesis of the first nucleic acid, e.g. cDNA, strand because the capture domain of the capture probe acts as the primer, e.g. reverse transcription primer.
- the secured nucleic acid i.e. the nucleic acid covalently attached to the capture probe
- e.g. cDNA is treated to comprise double stranded DNA.
- Treatment of the captured nucleic acid to produce double stranded DNA may be achieved in a single reaction to generate only a second DNA, e.g. cDNA, strand, i.e. to produce double stranded DNA molecules without increasing the number of double stranded DNA molecules, or in an amplification reaction to generate multiple copies of the second strand, which may be in the form of single stranded DNA (e.g. linear amplification) or double stranded DNA, e.g. cDNA (e.g. exponential amplification).
- the step of second strand DNA, e.g. cDNA, synthesis may take place in situ on the substrate, either as a discrete step of second strand synthesis, for example using random primers as described in more detail below, or in the initial step of an amplification reaction.
- the first strand DNA, e.g. cDNA (the strand comprising, i.e. incorporating, the capture probe) may be released from the array and second strand synthesis, whether as a discrete step or in an amplification reaction may occur subsequently, e.g. in a reaction carried out in solution.
- the method may include an optional step of removing the captured nucleic acid, e.g. RNA, before the second strand synthesis, for example using an RNA digesting enzyme (RNase) e.g. RNase H.
- RNase RNA digesting enzyme
- Procedures for this are well known and described in the art. However, this is generally not necessary, and in most cases the RNA degrades naturally. Removal of the tissue sample from the array will generally remove the RNA from the array. RNase H can be used if desired to increase the robustness of RNA removal.
- RNA removal may be useful in embodiments where the cDNA is labelled after it has been generated, e.g. labelled with a nucleic acid stain.
- RNA removal of the RNA may provide a consistent target to which the nucleic acid stain can interact (bind), i.e. all of the immobilized molecules will be single stranded after RNA removal.
- the immobilized molecules Prior to a step of RNA removal, the immobilized molecules may be a mixture of fully or partially double stranded molecules (RNA:DNA hybrids) and single stranded molecules (where the RNA has already degraded).
- Some nucleic acid stains may provide a stronger signal when interacting with double stranded nucleic acid, when compared to the signal from single stranded nucleic acid.
- it is preferable when using a nucleic acid stain to label the immobilised cDNA that the molecules are either all fully single stranded or double stranded.
- the step of generating the double stranded cDNA may yield a sufficient amount of cDNA that it may be sequenced directly (following release from the substrate).
- second strand cDNA synthesis may be achieved by any means known in the art and as described below.
- the second strand synthesis reaction may be performed on the substrate directly, i.e. whilst the cDNA is immobilized on the substrate, or preferably after the cDNA has been released from the substrate, as described below.
- the first strand of the secured nucleic acid e.g. cDNA molecules, which comprise also the capture probe of the substrate, acts as a template for the amplification reaction, e.g. a polymerase chain reaction.
- the first reaction product of the amplification will be a second strand of DNA, e.g. cDNA, which itself will act as a template for further cycles of the amplification reaction.
- the second strand of DNA will comprise a complement of the capture probe.
- the capture probe comprises a universal domain, and particularly an amplification domain within the universal domain, then this may be used for the subsequent amplification of the DNA, e.g. cDNA, e.g. the amplification reaction may comprise a primer with the same sequence as the amplification domain, i.e. a primer that is complementary (i.e. hybridizes) to the complement of the amplification domain.
- the amplification domain is upstream of the positional domain (if present) of the capture probe (in the secured nucleic acid, e.g. the first cDNA strand)
- the complement of the positional domain if the position domain is present in the capture probe
- the second strand synthesis may be achieved by any suitable means.
- the first strand cDNA preferably, but not necessarily, released from the substrate, may be incubated with random primers, e.g. hexamer primers, and a DNA polymerase, preferably a strand displacement polymerase, e.g. klenow (exo ⁇ ), under conditions sufficient for templated DNA synthesis to occur.
- random primers e.g. hexamer primers
- a DNA polymerase preferably a strand displacement polymerase, e.g. klenow (exo ⁇ .
- This process will yield double stranded cDNA molecules of varying lengths and is unlikely to yield full-length cDNA molecules, i.e. cDNA molecules that correspond to entire mRNA from which they were synthesized.
- the random primers will hybridise to the first strand cDNA molecules at a random position, i.e. within the sequence rather than at the end of the sequence.
- RNA molecules i.e. molecules that correspond to the whole of the captured nucleic acid, e.g. RNA molecule (if the nucleic acid, e.g. RNA, was partially degraded in the tissue sample then the captured nucleic acid, e.g. RNA, molecules will not be “full-length” transcripts), then the 3′ end of the secured nucleic acid, e.g. first stand cDNA, molecules may be modified.
- a linker or adaptor may be ligated to the 3′ end of the cDNA molecules. This may be achieved using single stranded ligation enzymes such as T4 RNA ligase or CircligaseTM (Epicentre Biotechnologies).
- helper probe (a partially double stranded DNA molecule capable of hybridising to the 3′ end of the first strand cDNA molecule), may be ligated to the 3′ end of the secured nucleic acid, e.g. first strand cDNA, molecule using a double stranded ligation enzyme such as T4 DNA ligase.
- a double stranded ligation enzyme such as T4 DNA ligase.
- Other enzymes appropriate for the ligation step are known in the art and include, e.g. Tth DNA ligase, Taq DNA ligase, Thermococcus sp. (strain 9° N) DNA ligase (9° NTM DNA ligase, New England Biolabs), and AmpligaseTM (Epicentre Biotechnologies).
- the helper probe comprises also a specific sequence from which the second strand DNA, e.g. cDNA, synthesis may be primed using a primer that is complementary to the part of the helper probe that is ligated to the secured nucleic acid, e.g. first cDNA strand.
- a further alternative comprises the use of a terminal transferase active enzyme to incorporate a polynucleotide tail, e.g. a poly-A tail, at the 3′ end of the secured nucleic acid, e.g. first strand of cDNA, molecules.
- the second strand synthesis may be primed using a poly-T primer, which may also comprise a specific amplification domain for further amplification.
- Other methods for generating “full-length” double stranded DNA, e.g. cDNA, molecules are well-established in the art.
- second strand synthesis may use a method of template switching, e.g. using the SMARTTM technology from Clontech®.
- SMART Switching Mechanism at 5′ End of RNA Template
- reverse transcriptase enzymes e.g. Superscript® II (Invitrogen)
- the DNA overhang may provide a target sequence to which an oligonucleotide probe can hybridise to provide an additional template for further extension of the cDNA molecule.
- the oligonucleotide probe that hybridises to the cDNA overhang contains an amplification domain sequence, the complement of which is incorporated into the synthesised first strand cDNA product.
- Primers containing the amplification domain sequence, which will hybridise to the complementary amplification domain sequence incorporated into the cDNA first strand can be added to the reaction mix to prime second strand synthesis using a suitable polymerase enzyme and the cDNA first strand as a template. This method avoids the need to ligate adaptors to the 3′ end of the cDNA first strand.
- template switching Whilst template switching was originally developed for full-length mRNAs, which have a 5′ cap structure, it has since been demonstrated to work equally well with truncated mRNAs without the cap structure. Thus, template switching may be used in the methods of the invention to generate full length and/or partial or truncated cDNA molecules.
- the second strand synthesis may utilise, or be achieved by, template switching.
- the template switching reaction i.e. the further extension of the cDNA first strand to incorporate the complementary amplification domain, is performed in situ (whilst the capture probe is still attached, directly or indirectly, to the substrate, e.g. array).
- the second strand synthesis reaction is also performed in situ.
- the immobilized cDNA may be labelled by incorporating label into the second strand of the cDNA, e.g. incorporating labelled nucleotides into the cDNA second strand. This may be in addition to, or as an alternative to, incorporating labelled nucleotides into the first cDNA strand.
- amplification domains may be incorporated in the DNA, e.g. cDNA, molecules.
- a first amplification domain may be incorporated into the secured nucleic acid molecules, e.g. the first strand of the cDNA molecules, when the capture probe comprises a universal domain comprising an amplification domain.
- the second strand synthesis may incorporate a second amplification domain.
- the primers used to generate the second strand cDNA e.g.
- random hexamer primers poly-T primer, the primer that is complementary to the helper probe, may comprise at their 5′ end an amplification domain, i.e. a nucleotide sequence to which an amplification primer may hybridize.
- the resultant double stranded DNA may comprise an amplification domain at or towards each 5′ end of the double stranded DNA, e.g. cDNA, molecules.
- These amplification domains may be used as targets for primers used in an amplification reaction, e.g. PCR.
- the linker or adaptor which is ligated to the 3′ end of the secured nucleic acid molecules, e.g. first strand cDNA molecules may comprise a second universal domain comprising a second amplification domain.
- a second amplification domain may be incorporated into the first strand cDNA molecules by template switching.
- the second strand of the cDNA molecules may be synthesised in accordance with the above description.
- the resultant double stranded DNA molecules may be modified to incorporate an amplification domain at the 5′ end of the first DNA, e.g. cDNA, strand (a first amplification domain) and, if not incorporated in the second strand DNA, e.g. cDNA synthesis step, at the 5′ end of the second DNA, e.g. cDNA, strand (a second amplification domain).
- Such amplification domains may be incorporated, e.g. by ligating double stranded adaptors to the ends of the DNA, e.g.
- Enzymes appropriate for the ligation step are known in the art and include, e.g. Tth DNA ligase, Taq DNA ligase, Thermococcus sp. (strain 9° N) DNA ligase (9° NTM DNA ligase, New England Biolabs), AmpligaseTM (Epicentre Biotechnologies) and T4 DNA ligase.
- the first and second amplification domains comprise different sequences.
- universal domains which may comprise an amplification domain
- the secured (i.e. extended) DNA molecules for example to the cDNA molecules, or their complements (e.g. second strand) by various methods and techniques and combinations of such techniques known in the art, e.g. by use of primers which include such a domain, ligation of adaptors, use of terminal transferase enzymes and/or by template switching methods.
- such domains may be added before or after release of the DNA molecules from the array.
- the method of the invention may comprise a step of amplifying the DNA, e.g. cDNA, molecules.
- the amplification step is performed after the release of the DNA, e.g. cDNA molecules from the substrate.
- amplification may be performed on the substrate (i.e. in situ on the substrate).
- arrays which are known in the art as sequencing platforms or for use in any form of sequence analysis (e.g. in or by next generation sequencing technologies) may be used as the basis of the substrates of the present invention (e.g. Illumina bead arrays etc.)
- the second strand of DNA e.g. cDNA
- a strand displacement polymerase e.g. ⁇ 29 DNA polymerase, Bst (exo ⁇ ) DNA polymerase, klenow (exo ⁇ ) DNA polymerase
- the released nucleic acids will be at least partially double stranded (e.g. DNA:RNA hybrid) in embodiments where the capture probe is immobilized indirectly on the substrate of the array via a surface probe and the step of releasing the DNA, e.g. cDNA molecules comprises a cleavage step.
- the strand displacement polymerase is necessary to ensure that the second cDNA strand synthesis incorporates the complement of the capture probe including the positional domain (feature identification domain), if present, into the second DNA, e.g. cDNA strand.
- the step of releasing at least part of the DNA, e.g. cDNA molecules or their amplicons from the surface of the substrate may be achieved using a number of methods.
- the primary aim of the release step is to yield molecules into which the positional domain of the capture probe (or its complement) is incorporated (or included), such that the DNA, e.g. cDNA, molecules or their amplicons are “tagged” according to their feature (or position) on the array.
- a positional domain is not essential, particularly where only a portion of the nucleic acid molecules are released because the other nucleic acid molecules have been removed from the surface of the substrate (and discarded) in an earlier step.
- the release step thus removes DNA, e.g. cDNA, molecules or amplicons thereof from the substrate, which DNA, e.g. cDNA, molecules or amplicons include the positional information that can be correlated to the tissue sample.
- the released DNA comprises a positional domain or its complement (by virtue of it having been incorporated into the secured nucleic acid, e.g. the first strand cDNA by, e.g. extension of the capture probe, and optionally copied in the second strand DNA if second strand synthesis takes place on the array, or copied into amplicons if amplification takes place on the array).
- the released molecules comprise the positional domain of the capture probe (or its complement).
- the sequence analysis can be correlated with the region(s) in the tissue sample that were not removed from the substrate.
- the released molecule may be a first and/or second strand DNA, e.g. cDNA, molecule or amplicon, and since the capture probe may be immobilised indirectly on the substrate, it will be understood that whilst the release step may comprise a step of cleaving a DNA, e.g. cDNA molecule from the array, the release step does not require a step of nucleic acid cleavage; a DNA, e.g. cDNA molecule or an amplicon may simply be released by denaturing a double-stranded molecule, for example releasing the second cDNA strand from the first cDNA strand, or releasing an amplicon from its template or releasing the first strand cDNA molecule (i.e.
- a DNA, e.g. cDNA, molecule may be released from the substrate by nucleic acid cleavage and/or by denaturation (e.g. by heating to denature a double-stranded molecule). Where amplification is carried out in situ on the substrate, this will of course encompass releasing amplicons by denaturation in the cycling reaction.
- the DNA, e.g. cDNA, molecules are released by enzymatic cleavage of a cleavage domain, which may be located in the universal domain or positional domain of the capture probe.
- the cleavage domain must be located upstream (at the 5′ end) of the positional domain such that the released DNA, e.g. cDNA, molecules comprise the positional (identification) domain.
- Suitable enzymes for nucleic acid cleavage include restriction endonucleases, e.g. Rsal. Other enzymes, e.g.
- UDG Uracil DNA glycosylase
- USRTM enzyme DNA glycosylase-lyase Endonuclease VIII
- MutY and T7 endonuclease I enzymes are preferred embodiments of the methods of the invention.
- the DNA, e.g. cDNA, molecules may be released from the surface of the substrate by physical means.
- the capture probe is indirectly immobilized on the substrate, e.g. via hybridization to the surface probe, it may be sufficient to disrupt the interaction between the nucleic acid molecules.
- Methods for disrupting the interaction between nucleic acid molecules e.g. denaturing double stranded nucleic acid molecules, are well known in the art.
- a straightforward method for releasing the DNA, e.g. cDNA, molecules i.e. of stripping the substrate, e.g. array, of the synthesized DNA, e.g.
- the DNA, e.g. cDNA, molecules may be released by applying heated water, e.g. water or buffer of at least 85° C., preferably at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99° C.
- the solution may comprise salts, surfactants etc. that may further destabilize the interaction between the nucleic acid molecules, resulting in the release of the DNA, e.g. cDNA, molecules.
- the application of a high temperature solution e.g. 90-99° C. water may be sufficient to disrupt a covalent bond used to immobilize the capture probe or surface probe to the substrate.
- the DNA, e.g. cDNA, molecules may be released by applying hot water to the substrate to disrupt covalently immobilized capture or surface probes.
- the released DNA, e.g. cDNA, molecules are collected for further manipulation, e.g. second strand synthesis and/or amplification.
- the method of the invention may be seen to comprise a step of collecting or recovering the released DNA, e.g. cDNA, molecules.
- the released molecules may include amplicons of the secured nucleic acid, e.g. cDNA.
- any unextended capture probes may be, for example, after the step of releasing DNA molecules from the substrate. Any desired or convenient method may be used for such removal including, for example, use of an enzyme to degrade the unextended probes, e.g. exonuclease.
- the DNA, e.g. cDNA molecules, or amplicons, that have been released from the substrate, which may have been modified as discussed above, are analysed to investigate (e.g. determine their sequence, although as noted above actual sequence determination is not required—any method of analysing the sequence may be used).
- any method of nucleic acid analysis may be used.
- the step of sequence analysis may identify the positional domain and hence allow the analysed molecule to be localised to a position in the tissue sample. Similarly, the nature or identity of the analysed molecule may be determined. In this way the nucleic acid, e.g. RNA, at given position in the substrate, and hence in the tissue sample may be determined.
- the analysis step may include or use any method which identifies the analysed molecule (and hence the “target” molecule) and its positional domain.
- a method will be a sequence-specific method.
- the method may use sequence-specific primers or probes, particularly primers or probes specific for the positional domain and/or for a specific nucleic acid molecule to be detected or analysed e.g. a DNA molecule corresponding to a nucleic acid, e.g. RNA or cDNA molecule to be detected.
- sequence-specific amplification primers e.g. PCR primers may be used.
- the amplification and/or analysis methods described herein may use degenerate or gene family specific primers or probes that hybridise to a subset of the captured nucleic acids or nucleic acids derived therefrom, e.g. amplicons.
- the amplification and/or analysis methods may utilise a universal primer (i.e. a primer common to all of the captured sequences) in combination with a degenerate or gene family specific primer specific for a subset of target molecules.
- amplification-based, especially PCR-based, methods of sequence analysis are used.
- the steps of modifying and/or amplifying the released DNA, e.g. cDNA, molecules may introduce additional components into the sample, e.g. enzymes, primers, nucleotides etc.
- the methods of the invention may further comprise a step of purifying the sample comprising the released DNA, e.g. cDNA molecules or amplicons prior to the sequence analysis, e.g. to remove oligonucleotide primers, nucleotides, salts etc that may interfere with the sequencing reactions. Any suitable method of purifying the DNA, e.g. cDNA molecules may be used.
- sequence analysis of the released DNA molecules may be direct or indirect.
- the sequence analysis material or substrate (which may be viewed as the molecules which are subjected to the sequence analysis step or process) may directly be the molecules which is released from the object substrate, e.g. array, or it may be a molecule which is derived therefrom.
- the sequencing template may be the molecule which is released from the object substrate, e.g. array, or it may be a molecule derived therefrom.
- a first and/or second strand DNA, e.g. cDNA, molecule released from the substrate, e.g. array may be directly subjected to sequence analysis (e.g.
- sequence analysis i.e. may directly take part in the sequence analysis reaction or process (e.g. the sequencing reaction or sequencing process, or be the molecule which is sequenced or otherwise identified).
- the released molecule may be an amplicon.
- the released molecule may be subjected to a step of second strand synthesis or amplification before sequence analysis (e.g. sequencing or identification by other means).
- the sequence analysis substrate e.g. template
- the sequence analysis substrate may thus be an amplicon or a second strand of a molecule which is directly released from the object substrate, e.g. array.
- Both strands of a double stranded molecule may be subjected to sequence analysis (e.g. sequenced) but the invention is not limited to this and single stranded molecules (e.g. cDNA) may be analysed (e.g. sequenced).
- sequence analysis e.g. sequenced
- single stranded molecules e.g. cDNA
- various sequencing technologies may be used for single molecule sequencing, e.g. the Helicos or Pacbio technologies, or nanopore sequencing technologies which are being developed.
- the first strand of DNA, e.g. cDNA may be subjected to sequencing.
- the first strand DNA, e.g. cDNA may need to be modified at the 3′ end to enable single molecule sequencing. This may be done by procedures analogous to those for handling the second DNA, e.g. cDNA strand. Such procedures are known in the art.
- the sequence analysis will identify or reveal a portion of captured nucleic acid, e.g. RNA, sequence and optionally the sequence of the positional domain.
- the sequence of the positional domain (or tag) will identify the feature to which the nucleic acid, e.g. mRNA, molecule was captured.
- the sequence of the captured nucleic acid, e.g. RNA, molecule may be compared with a sequence database of the organism from which the sample originated to determine the gene to which it corresponds. By determining which region (e.g. cell) of the tissue sample was in contact with the position or area, e.g.
- the substrate from which the captured nucleic acid was released it is possible to determine which region of the tissue sample was expressing said gene.
- This analysis may be achieved for all of the DNA, e.g. cDNA, molecules generated by the methods of the invention, yielding a spatial transcriptome of the tissue sample.
- only a selection of the transcripts present in the tissue sample may be captured on the substrate (e.g. if the capture domain of the capture probe comprises a sequence specific for a gene or set of genes) and/or only a portion of the captured molecules may be selected for further analysis, e.g. sequence analysis (e.g. a portion of the captured molecules may be removed from the substrate prior to the sequence analysis step).
- sequencing data may be analysed to sort the sequences into specific species of capture probe, e.g. according to the sequence of the positional domain. This may be achieved by, e.g. using the FastX toolkit FASTQ Barcode splitter tool to sort the sequences into individual files for the respective capture probe positional domain (tag) sequences.
- the sequences of each species i.e. from each feature, may be analyzed to determine the identity of the transcripts. For instance, the sequences may be identified using e.g. Blastn software, to compare the sequences to one or more genome databases, preferably the database for the organism from which the tissue sample was obtained.
- the identity of the database sequence with the greatest similarity to the sequence generated by the methods of the invention will be assigned to said sequence. In general, only hits with a certainty of at least 1e ⁇ 6 , preferably 1e ⁇ 7 , 1e ⁇ 8 , or 1e ⁇ 9 will be considered to have been successfully identified.
- nucleic acid sequencing method may be utilised in the methods of the invention.
- the so-called “next generation sequencing” techniques will find particular utility in the present invention.
- High-throughput sequencing is particularly useful in the methods of the invention because it enables a large number of nucleic acids to be partially sequenced in a very short period of time.
- it is not essential to sequence the full length of the generated DNA, e.g. cDNA molecules to determine the gene to which each molecule corresponds.
- the first 100 nucleotides from each end of the DNA e.g.
- the sequence reaction from the “capture probe end” of the DNA e.g. cDNA molecules, yields the sequence of the positional domain and at least about 20 bases, preferably 30 or 40 bases of transcript specific sequence data.
- the sequence reaction from the “capture probe end” of the DNA may yield at least about 70 bases, preferably 80, 90, or 100 bases of transcript specific sequence data.
- the sequence reaction from the “non-capture probe end” may yield at least about 70 bases, preferably 80, 90, or 100 bases of transcript specific sequence data.
- the sequencing reaction may be based on reversible dye-terminators, such as used in the IlluminaTM technology.
- DNA molecules are first attached to primers on, e.g. a glass or silicon slide and amplified so that local clonal colonies are formed (bridge amplification).
- Four types of ddNTPs are added, and non-incorporated nucleotides are washed away.
- the DNA can only be extended one nucleotide at a time.
- a camera takes images of the fluorescently labelled nucleotides then the dye along with the terminal 3′ blocker is chemically removed from the DNA, allowing a next cycle. This may be repeated until the required sequence data is obtained.
- thousands of nucleic acids may be sequenced simultaneously on a single slide.
- pyrosequencing e.g. pyrosequencing
- the DNA is amplified inside water droplets in an oil solution (emulsion PCR), with each droplet containing a single DNA template attached to a single primer-coated bead that then forms a clonal colony.
- the sequencing machine contains many picolitre-volume wells each containing a single bead and sequencing enzymes. Pyrosequencing uses luciferase to generate light for detection of the individual nucleotides added to the nascent DNA and the combined data are used to generate sequence read-outs.
- An example of a technology in development is based on the detection of hydrogen ions that are released during the polymerisation of DNA.
- a microwell containing a template DNA strand to be sequenced is flooded with a single type of nucleotide. If the introduced nucleotide is complementary to the leading template nucleotide it is incorporated into the growing complementary strand. This causes the release of a hydrogen ion that triggers a hypersensitive ion sensor, which indicates that a reaction has occurred. If homopolymer repeats are present in the template sequence multiple nucleotides will be incorporated in a single cycle. This leads to a corresponding number of released hydrogen ions and a proportionally higher electronic signal.
- An essential feature of the present invention is a step of securing a complementary strand of the captured nucleic acid molecules to the capture probe, e.g. reverse transcribing the captured RNA molecules.
- the reverse transcription reaction is well known in the art and in representative reverse transcription reactions, the reaction mixture includes a reverse transcriptase, dNTPs and a suitable buffer.
- the reaction mixture may comprise other components, e.g. RNase inhibitor(s).
- the primers and template are the capture domain of the capture probe and the captured RNA molecules, as described above.
- each dNTP will typically be present in an amount ranging from about 10 to 5000 ⁇ M, usually from about 20 to 1000 ⁇ M. It will be evident that an equivalent reaction may be performed to generate a complementary strand of a captured DNA molecule, using an enzyme with DNA polymerase activity. Reactions of this type are well known in the art and are described in more detail below.
- a labelled dNTP may be present in the reaction mix, thereby incorporating a label into the synthesized DNA molecule.
- the labelled dNTP is a fluorescently labelled dNTP, e.g. Cy3-dCTP.
- the desired reverse transcriptase activity may be provided by one or more distinct enzymes, wherein suitable examples are: M-MLV, MuLV, AMV, HIV, ArrayScriptTM, MultiScribeTM, ThermoScriptTM, and SuperScript® I, II, and III enzymes.
- the reverse transcriptase reaction may be carried out at any suitable temperature, which will be dependent on the properties of the enzyme. Typically, reverse transcriptase reactions are performed between 37-55° C., although temperatures outside of this range may also be appropriate.
- the reaction time may be as little as 1, 2, 3, 4 or 5 minutes or as much as 48 hours. Typically the reaction will be carried out for between 3-12 hours, such as 5-120 minutes, 5-60, 5-45 or 5-30 minutes or 1-10 or 1-5 minutes according to choice.
- the reaction time is not critical and any desired reaction time may be used. For instance, overnight incubations are commonplace.
- certain embodiments of the methods include an amplification step, where the copy number of generated DNA, e.g. cDNA molecules is increased, e.g. in order to enrich the sample to obtain a better representation of the nucleic acids, e.g. transcripts, captured from the tissue sample.
- the amplification may be linear or exponential, as desired, where representative amplification protocols of interest include, but are not limited to: polymerase chain reaction (PCR); isothermal amplification, etc.
- PCR polymerase chain reaction
- the reaction mixture that includes the above released DNA, e.g. cDNA molecules from the substrate, e.g. array, which are combined with one or more primers that are employed in the primer extension reaction, e.g., the PCR primers that hybridize to the first and/or second amplification domains (such as forward and reverse primers employed in geometric (or exponential) amplification or a single primer employed in a linear amplification).
- the oligonucleotide primers with which the released DNA, e.g. cDNA molecules (hereinafter referred to as template DNA for convenience) is contacted will be of sufficient length to provide for hybridization to complementary template DNA under annealing conditions (described in greater detail below).
- the length of the primers will depend on the length of the amplification domains, but will generally be at least 10 bp in length, usually at least 15 bp in length and more usually at least 16 bp in length and may be as long as 30 bp in length or longer, where the length of the primers will generally range from 18 to 50 bp in length, usually from about 20 to 35 bp in length.
- the template DNA may be contacted with a single primer or a set of two primers (forward and reverse primers), depending on whether primer extension, linear or exponential amplification of the template DNA is desired.
- the reaction mixture produced in the subject methods typically includes a polymerase and deoxyribonucleoside triphosphates (dNTPs).
- the desired polymerase activity may be provided by one or more distinct polymerase enzymes.
- the reaction mixture includes at least a Family A polymerase, where representative Family A polymerases of interest include, but are not limited to: Thermus aquaticus polymerases, including the naturally occurring polymerase (Taq) and derivatives and homologues thereof, such as Klentaq (as described in Barnes et al, Proc. Natl. Acad.
- the reaction mixture may further include a polymerase enzyme having 3′-5′ exonuclease activity, e.g., as may be provided by a Family B polymerase, where Family B polymerases of interest include, but are not limited to: Thermococcus litoralis DNA polymerase (Vent) as described in Perler et al., Proc. Natl. Acad. Sci.
- Vent Thermococcus litoralis DNA polymerase
- the reaction mixture includes both a Family A and Family B polymerase
- the Family A polymerase may be present in the reaction mixture in an amount greater than the Family B polymerase, where the difference in activity will usually be at least 10-fold, and more usually at least about 100-fold.
- the reaction mixture will include four different types of dNTPs corresponding to the four naturally occurring bases present, i.e. dATP, dTTP, dCTP and dGTP. In the subject methods, each dNTP will typically be present in an amount ranging from about 10 to 5000 ⁇ M, usually from about 20 to 1000 ⁇ M.
- the reaction mixtures prepared in the reverse transcriptase and/or amplification steps of the subject methods may further include an aqueous buffer medium that includes a source of monovalent ions, a source of divalent cations and a buffering agent.
- a source of monovalent ions such as KCl, K-acetate, NH 4 -acetate, K-glutamate, NH 4 Cl, ammonium sulphate, and the like may be employed.
- the divalent cation may be magnesium, manganese, zinc and the like, where the cation will typically be magnesium. Any convenient source of magnesium cation may be employed, including MgCl 2 , Mg-acetate, and the like.
- the amount of Mg 2+ present in the buffer may range from 0.5 to 10 mM, but will preferably range from about 3 to 6 mM, and will ideally be at about 5 mM.
- Representative buffering agents or salts that may be present in the buffer include Tris, Tricine, HEPES, MOPS and the like, where the amount of buffering agent will typically range from about 5 to 150 mM, usually from about 10 to 100 mM, and more usually from about 20 to 50 mM, where in certain preferred embodiments the buffering agent will be present in an amount sufficient to provide a pH ranging from about 6.0 to 9.5, where most preferred is pH 7.3 at 72° C.
- Other agents which may be present in the buffer medium include chelating agents, such as EDTA, EGTA and the like.
- the various constituent components may be combined in any convenient order.
- the buffer may be combined with primer, polymerase and then template DNA, or all of the various constituent components may be combined at the same time to produce the reaction mixture.
- the DNA e.g. cDNA molecules may be modified by the addition of amplification domains to the ends of the nucleic acid molecules, which may involve a ligation reaction.
- a ligation reaction is also required for the in situ synthesis of the capture probe on the substrate, when the capture probe is immobilized indirectly on the substrate surface.
- ligases catalyze the formation of a phosphodiester bond between juxtaposed 3′-hydroxyl and 5′-phosphate termini of two immediately adjacent nucleic acids.
- Any convenient ligase may be employed, where representative ligases of interest include, but are not limited to: Temperature sensitive and thermostable ligases.
- Temperature sensitive ligases include, but are not limited to, bacteriophage T4 DNA ligase, bacteriophage T7 ligase, and E. coli ligase.
- Thermostable ligases include, but are not limited to, Taq ligase, Tth ligase, and Pfu ligase.
- Thermostable ligase may be obtained from thermophilic or hyperthermophilic organisms, including but not limited to, prokaryotic, eukaryotic, or archael organisms. Certain RNA ligases may also be employed in the methods of the invention.
- a suitable ligase and any reagents that are necessary and/or desirable are combined with the reaction mixture and maintained under conditions sufficient for ligation of the relevant oligonucleotides to occur.
- Ligation reaction conditions are well known to those of skill in the art.
- the reaction mixture in certain embodiments may be maintained at a temperature ranging from about 4° C. to about 50° C., such as from about 20° C. to about 37° C. for a period of time ranging from about 5 seconds to about 16 hours, such as from about 1 minute to about 1 hour.
- the reaction mixture may be maintained at a temperature ranging from about 35° C. to about 45° C., such as from about 37° C.
- the ligation reaction mixture includes 50 mM Tris pH7.5, 10 mM MgCl 2 , 10 mM DTT, 1 mM ATP, 25 mg/ml BSA, 0.25 units/ml RNase inhibitor, and T4 DNA ligase at 0.125 units/ml.
- RNA ligase In yet another representative embodiment, 2.125 mM magnesium ion, 0.2 units/ml RNase inhibitor; and 0.125 units/ml DNA ligase are employed.
- the amount of adaptor in the reaction will be dependent on the concentration of the DNA, e.g. cDNA in the sample and will generally be present at between 10-100 times the molar amount of DNA, e.g. cDNA.
- the method of the invention may comprise the following steps:
- the method of the invention may comprise the following steps:
- the method of the invention may comprise the following steps:
- step (f) repeating steps (a)-(e), with a second object substrate, using different conditions in step (a);
- the method of the invention may comprise the following steps:
- each species of said capture probe comprises a nucleic acid molecule with 5′ to 3′:
- RNA of the tissue sample hybridises to said capture probes
- the present invention includes any suitable combination of the steps in the above described methods. It will be understood that the invention also encompasses variations of these methods, for example where amplification is performed in situ on the substrate, e.g. array. Also encompassed are methods which omit the step of imaging the tissue sample.
- the invention may also be seen to include a method for making or producing an object substrate (i) for use in capturing mRNA from a tissue sample that is contacted with said substrate; (ii) for use in determining and/or analysing a (e.g. the partial or global) transcriptome of a tissue sample; or (iii) for use in determining the optimum conditions for localised or spatial detection of nucleic acid from a tissue sample contacted with a substrate, said method comprising immobilizing, directly or indirectly, at least one species of capture probe to a substrate such that each probe is oriented to have a free 3′ end to enable said probe to function as a reverse transcriptase (RT) primer.
- a method for making or producing an object substrate (i) for use in capturing mRNA from a tissue sample that is contacted with said substrate; (ii) for use in determining and/or analysing a (e.g. the partial or global) transcriptome of a tissue sample; or (iii) for use in determining the
- the probes are immobilized uniformly on the object substrate, i.e. the probes are not arrayed as distinct features.
- the probes are identical.
- the probes are capable of hybridizing to (i.e. capturing) all mRNA, i.e. RNA molecules with a polyA tail.
- the probes may comprise regions of consecutive dTTP or dUTP nucleotides, e.g. oligoT and/or oligoU nucleotides, as described in more detail above.
- the method of immobilizing the capture probes on the object substrate may be achieved using any suitable means as described herein. Where the capture probes are immobilized on the array indirectly the capture probe may be synthesized on the object substrate. Said method may comprise any one or more of the following steps:
- the method may be viewed as a method for making or producing an object substrate comprising a substrate on which one or more species of capture probe, comprising a capture domain, is directly or indirectly immobilized such that each probe is oriented to have a free 3′ end to enable said probe to function as a reverse transcriptase (RT) primer, wherein the probes are immobilised on the object substrate with a homogeneous distribution and said substrate is for use in:
- the invention provides an object substrate for use in the localised or spatial detection of RNA in a tissue sample, comprising a planar substrate on which one or more species of capture probe, comprising a capture domain, is directly or indirectly immobilized such that each probe is oriented to have a free 3′ end to enable said probe to function as a reverse transcriptase (RT) primer wherein the probes are immobilised on the object substrate with a homogeneous distribution and wherein the capture probe is selected from an oligonucleotide comprising a poly-T, poly-U and/or random oligonucleotide sequence.
- RT reverse transcriptase
- FIG. 1 shows 3′ to 5′ surface probe composition and synthesis of 5′ to 3′ oriented capture probes that are indirectly immobilized at the array surface.
- FIG. 2 shows how the methods of the invention can be used to determine the optimum conditions for capturing RNA from a tissue sample on a substrate, wherein: (A) shows a tissue sample that is not permeabilized sufficiently to allow the capture of RNA on the substrate; (B) shows a tissue sample that is permeabilized to allow capture of RNA on the substrate whilst retaining spatial information; and (C) shows a tissue sample that is too permeable such that the RNA has been allowed to diffuse away from its origin in the tissue sample and captured RNA does not correlate accurately with its original spatial distribution in the tissue sample.
- FIG. 3 shows a bar chart demonstrating the efficiency of enzymatic cleavage (USER or Rsal) from in-house manufactured arrays and by 99° C. water from Agilent manufactured arrays, as measured by hybridization of fluorescently labelled probes to the array surface after probe release.
- FIG. 4 shows a table that lists the reads sorted for their origin across the low density in-house manufactured DNA-capture array as seen in the schematic representation.
- FIG. 5 shows a schematic illustration of the principle of the method described in Example 4, i.e. use of microarrays with immobilized DNA oligos (capture probes) carrying spatial labelling tag sequences (positional domains).
- Each feature of oligos of the microarray carries a 1) a unique labelling tag (positional domain) and 2) a capture sequence (capture domain).
- FIG. 6 shows the composition of 5′ to 3′ oriented capture probes used on high-density capture arrays.
- FIG. 7 shows a Matlab visualization of captured transcripts from total RNA extracted from mouse olfactory bulb.
- FIG. 8 shows Olfr (olfactory receptor) transcripts as visualized across the capture array using Matlab visualization after capture from mouse olfactory bulb tissue.
- FIG. 9 shows a pattern of printing for in-house 41-ID-tag microarrays.
- FIG. 10 shows a Matlab visualization of captured ID-tagged transcripts from mouse olfactory bulb tissue on 41-ID-tag in-house arrays overlaid with the tissue image. For clarity, the specific features on which particular genes were identified have been circled.
- FIG. 11 shows a pattern of cDNA synthesis on array surface from a section of mouse brain olfactory bulb, as visualized by an Agilent microarray scanner.
- FIG. 12 shows a pattern of cDNA synthesis on array surface from a section of mouse brain cortex, as visualized by an Agilent microarray scanner.
- FIG. 13 shows a pattern of cDNA synthesis on array surface from a section of mouse brain olfactory bulb, before ablation (A) and after ablation of non-wanted areas (B), as imaged on the MMI cellcut instrument.
- FIG. 14 shows the resulting library made from cleaved fluorescently labelled cDNA library of non-ablated areas as visualized with a DNA high sensitivity chip on an Agilent Bioanalyzer.
- FIG. 15 shows a pattern of cDNA synthesis on a high-density feature array surface from a section of mouse brain olfactory bulb.
- a frame (visible at the top and to the right in the image) consisting of features containing a single DNA probe sequence was labelled by hybridization of a complementary oligonucleotide labelled with Cy3.
- FIG. 16 shows a bar chart of Cy3 intensities on arrays using different amounts of Cy3 labelled dCTP.
- FIG. 17 shows images of cDNA synthesis on array surfaces and corresponding images of the tissue sections on the array surface using various alternative sample types, wherein: (A) depicts the phase contrast image (left) and corresponding Cy3 labelled cDNA footprint (right) of a zebra fish sample; (B) depicts the phase contrast image (left) and corresponding Cy3 labelled cDNA footprint (right) of a fruit fly (Drosophila) sample; (C) depicts the phase contrast image (left) and corresponding Cy3 labelled cDNA footprint (right) of a prostate tumour section; and (D) depicts the phase contrast image (left) and corresponding Cy3 labelled cDNA footprint (right) of mouse fibroblast cells.
- oligonucleotide probes may be attached to an array substrate by either the 5′ or 3′ end to yield an array with capture probes capable of hybridizing to mRNA.
- RNA-capture oligonucleotides with individual tag sequences were spotted on glass slides to function as capture probes.
- the probes were synthesized with a 5′-terminus amino linker with a C6 spacer. All probes where synthesized by Sigma-Aldrich (St. Louis, Mo., USA).
- the RNA-capture probes were suspended at a concentration of 20 ⁇ M in 150 mM sodium phosphate, pH 8.5 and were spotted using a Nanoplotter NP2.1/E (Gesim, Grosserkmannsdorf, Germany) onto CodeLinkTM Activated microarray slides (7.5 cm ⁇ 2.5 cm; Surmodics, Eden Prairie, Minn., USA).
- the probes were printed in 16 identical arrays on the slide, and each array contained a pre-defined printing pattern.
- the 16 sub-arrays were separated during hybridization by a 16-pad mask (ChipClipTM Schleicher & Schuell BioScience, Keene, N.H., USA).
- hybridization solution containing 4 ⁇ SSC and 0.1% SDS, 2 ⁇ M extension primer (the universal domain oligonucleotide) and 2 ⁇ M thread joining primer (the capture domain oligonucleotide) was incubated for 4 min at 50° C. Meanwhile the in-house array was attached to a ChipClip (Whatman). The array was subsequently incubated at 50° C. for 30 min at 300 rpm shake with 50 ⁇ L of hybridization solution per well.
- the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2 ⁇ SSC solution with 0.1% SDS for 6 min at 300 rpm shake; 2) 0.2 ⁇ SSC for 1 min at 300 rpm shake; and 3) 0.1 ⁇ SSC for 1 min at 300 rpm shake. The array was then spun dry and placed back in the ChipClip.
- the method is depicted in FIG. 1 .
- Fresh non-fixed mouse brain tissue was trimmed if necessary and frozen down in ⁇ 40° C. cold isopentane and subsequently mounted for sectioning with a cryostat at 10 ⁇ m. A slice of tissue was applied onto each capture probe array to be used.
- Mouse brain tissue was fixed in 4% formalin at 4° C. for 24 h. After that it was incubated as follows: 3 ⁇ incubation in 70% ethanol for 1 hour; 1 ⁇ incubation in 80% ethanol for 1 hour; 1 ⁇ incubation in 96% ethanol for 1 hour; 3 ⁇ incubation in 100% ethanol for 1 hour; and 2 ⁇ incubation in xylene at room temperature for 1 h.
- the dehydrated samples were then incubated in liquid low melting paraffin 52-54° C. for up to 3 hours, during which the paraffin was changed once to wash out residual xylene. Finished tissue blocks were then stored at RT. Sections were then cut at 4 ⁇ m in paraffin with a microtome onto each capture probe array to be used.
- the sections were dried at 37° C. on the array slides for 24 hours and stored at RT.
- Formalin fixed paraffinized mouse brain 10 ⁇ m sections attached to CodeLink slides were deparaffinized in xylene twice for: 10 min, 99.5% ethanol for 2 min; 96% ethanol for 2 min; 70% ethanol for 2 min; and were then air dried.
- the reaction mix was removed from the wells and the slide was washed with: 2 ⁇ SSC, 0.1% SDS at 50° C. for 10 min; 0.2 ⁇ SSC at room temperature for 1 min; and 0.1 ⁇ SSC at room temperature for 1 min.
- the chip was then spin dried.
- fluorescent marker probes Prior to tissue application fluorescent marker probes were hybridized to features comprising marker oligonucleotides printed on the capture probe array.
- the fluorescent marker probes aid in the orientation of the resulting image after tissue visualization, making it possible to combine the image with the resulting expression profiles for individual capture probe “tag” (positional domain) sequences obtained after sequencing.
- the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2 ⁇ SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2 ⁇ SSC for 1 min at 300 rpm shake and 3) 0.1 ⁇ SSC for 1 min at 300 rpm shake. The array was then spun dry.
- FFPE tissue sections immobilized on capture probe arrays were washed and rehydrated after deparaffinization prior to cDNA synthesis as described previously, or washed after cDNA synthesis as described previously. They are then treated as follows: incubate for 3 minutes in Hematoxylin; rinse with deionized water; incubate 5 minutes in tap water; rapidly dip 8 to 12 times in acid ethanol; rinse 2 ⁇ 1 minute in tap water; rinse 2 minutes in deionized water; incubate 30 seconds in Eosin; wash 3 ⁇ 5 minutes in 95% ethanol; wash 3 ⁇ 5 minutes in 100% ethanol; wash 3 ⁇ 10 minutes in xylene (can be done overnight); place coverslip on slides using DPX; dry slides in the hood overnight.
- FFPE tissue sections immobilized on capture probe arrays were washed and rehydrated after deparaffinization prior to cDNA synthesis as described previously, or washed after cDNA synthesis as described previously. They were then treated as follows without being allowed to dry during the whole staining process: sections were incubated with primary antibody (dilute primary antibody in blocking solution comprising 1 ⁇ Tris Buffered Saline (50 mM Tris, 150 mM NaCl, pH 7.6), 4% donkey serum and 0.1% triton-x) in a wet chamber overnight at RT; rinse three times with 1 ⁇ TBS; incubate section with matching secondary antibody conjugated to a fluorochrome (FITC, Cy3 or Cy5) in a wet chamber at RT for 1 hour. Rinse 3 ⁇ with 1 ⁇ TBS, remove as much as possible of TBS and mount section with ProLong Gold+DAPI (Invitrogen) and analyze with fluorescence microscope and matching filter sets.
- primary antibody dilute primary antibody in blocking solution comprising 1
- a 16 well mask and CodeLink slide was attached to the ChipClip holder (Whatman). 50 ⁇ l of a mixture containing 1 ⁇ FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl2 (Roche), 200 ⁇ M dNTPs (New England Biolabs) and 0.1 U/1 ⁇ l USER Enzyme (New England Biolabs) was heated to 37° C. and was added to each well and incubated at 37° C. for 30 min with mixing (3 seconds at 300 rpm, 6 seconds at rest) (Thermomixer comfort; Eppendorf). The reaction mixture containing the released cDNA and probes was then recovered from the wells with a pipette.
- a 16 well mask and CodeLink slide was attached to the ChipClip holder (Whatman). 50 ⁇ l of 99° C. water was pipetted into each well. The 99° C. water was allowed to react for 30 minutes. The reaction mixture containing the released cDNA and probes was then recovered from the wells with a pipette.
- Capture Probe Release with Heated PCR Buffer Hybridized In situ Synthesized Capture Probes, i.e. Capture Probes Hybridized to Surface Probes
- Capture Probe Release with Heated TdT (Terminal Transferase) Buffer Hybridized In situ Synthesized Capture Probes, i.e. Capture Probes Hybridized to Surface Probes
- FIG. 3 The efficacy of treating the array with the USER enzyme and water heated to 99° C. can be seen in FIG. 3 .
- Enzymatic cleavage using the USER enzyme and the Rsal enzyme was performed using the “in-house” arrays described above ( FIG. 3 ).
- Hot water mediated release of DNA surface probes was also performed using commercial arrays manufactured by Agilent.
- first strand cDNA released from the array surface may be modified to produce double stranded DNA and subsequently amplified.
- Capture probes were released with uracil cleaving USER enzyme mixture in PCR buffer (covalently attached capture probes) or with heated PCR buffer (hybridized in situ synthesized capture probes, i.e. capture probes hybridized to surface probes).
- the released cDNA was amplified using the Picoplex (Rubicon Genomics) random primer whole genome amplification method, which was carried out according to manufacturers instructions.
- TdT Terminal Transferase
- Capture probes were released with uracil cleaving USER enzyme mixture in TdT (terminal transferase) buffer (covalently attached capture probes) or with heated TdT (terminal transferase) buffer (hybridized in situ synthesized capture probes, i.e. capture probes hybridized to surface probes).
- cleavage mixture 38 ⁇ l was placed in a clean 0.2 ml PCR tube.
- the mixture contained: 1 ⁇ TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com), 0.1 ⁇ g/ ⁇ l BSA (New England Biolabs); 0.1 U/ ⁇ l USER Enzyme (New England Biolabs) (not for heated release); released cDNA (extended from surface probes); and released surface probes.
- 1 ⁇ TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com), 0.1 ⁇ g/ ⁇ l BSA (New England Biolabs); 0.1 U/ ⁇ l USER Enzyme (New England Biolabs) (not for heated release); released cDNA (extended from
- PCR tube 0.5 ⁇ l RNase H (5 U/ ⁇ l, final concentration of 0.06 U/ ⁇ l), 1 ⁇ l TdT (20 U/ ⁇ l, final concentration of 0.5 U/ ⁇ l), and 0.5 ⁇ l dATPs (100 mM, final concentration of 1.25 mM), were added.
- dA tailing the tube was incubated in a thermocycler (Applied Biosystems) at 37° C. for 15 min followed by an inactivation of TdT at 70° C. for 10 min. After dA tailing, a PCR master mix was prepared.
- the mix contained: 1 ⁇ Faststart HiFi PCR Buffer (pH 8.3) with 1.8 mM MgCl 2 (Roche); 0.2 mM of each dNTP (Fermentas); 0.2 ⁇ M of each primer, A (complementary to the amplification domain of the capture probe) and B_(dT)24 (Eurofins MWG Operon) (complementary to the poly-A tail to be added to the 3′ end of the first cDNA strand); and 0.1 U/ ⁇ l Faststart HiFi DNA polymerase (Roche). 23 ⁇ l of PCR Master mix was placed into nine clean 0.2 ml PCR tubes.
- PCR amplification was carried out with the following program: Hot start at 95° C. for 2 minutes, second strand synthesis at 50° C. for 2 minutes and 72° C. for 3 minutes, amplification with 30 PCR cycles at 95° C. for 30 seconds, 65° C. for 1 minutes, 72° C. for 3 minutes, and a final extension at 72° C. for 10 minutes.
- dsDNA library for Illumina sequencing using sample indexing was carried out according to manufacturers instructions. Sequencing was carried out on an HiSeq2000 platform (Illumina).
- the sequencing data was sorted through the FastX toolkit FASTQ Barcode splitter tool into individual files for the respective capture probe positional domain (tag) sequences. Individually tagged sequencing data was then analyzed through mapping to the mouse genome with the Tophat mapping tool. The resulting SAM file was processed for transcript counts through the HTseq-count software.
- the sequencing data was converted from FASTQ format to FASTA format using the FastX toolkit FASTQ-to-FASTA converter.
- the sequencing reads was aligned to the capture probe positional domain (tag) sequences using Blastn and the reads with hits better than 1e ⁇ 6 to one of tag sequences were sorted out to individual files for each tag sequence respectively.
- the file of tag sequence reads was then aligned using Blastn to the mouse transcriptome, and hits were collected.
- the expression profiles for individual capture probe positional domain (tag) sequences are combined with the spatial information obtained from the tissue sections through staining. Thereby the transcriptomic data from the cellular compartments of the tissue section can be analyzed in a directly comparative fashion, with the availability to distinguish distinct expression features for different cellular subtypes in a given structural context
- thermo cycler (Applied Biosystems, www.appliedbiosystems.com). 1 ⁇ l Klenow Fragment (3′ to 5′ exo minus) (Illumina, www.illumina.com) and 1 ⁇ l handle coupled random primer (10 ⁇ M) (Eurofins MWG Operon, www.eurofinsdna.com) was added to the two tubes (B_R8 (octamer) to one of the tubes and B_R6 (hexamer) to the other tube), final concentration of 0.23 ⁇ M. The two tubes were incubated at 15° C. for 15 min, 25° C. for 15 min, 37° C. for 15 min and finally 75° C.
- thermo cycler (Applied Biosystems). After the incubation, 1 ⁇ l of each primer, A_P and B (10 ⁇ M) (Eurofins MWG Operon), was added to both tubes, final concentration of 0.22 ⁇ M each. 1 ⁇ l Faststart HiFi DNA polymerase (5 U/ ⁇ l) (Roche) was also added to both tubes, final concentration of 0.11 U/ ⁇ l. PCR amplification were carried out in a thermo cycler (Applied Biosystems) with the following program: Hot start at 94° C. for 2 min, followed by 50 cycles at 94° C. for 15 seconds, 55° C. for 30 seconds, 68° C. for 1 minute, and a final extension at 68° C. for 5 minutes.
- the cleaved cDNA was amplified in final reaction volumes of 10 ⁇ l. 7 ⁇ l cleaved template, 1 ⁇ l ID-specific forward primer (2 ⁇ M), 1 ⁇ l gene-specific reverse primer (2 ⁇ M) and 1 ⁇ l FastStart High Fidelity Enzyme Blend in 1.4 ⁇ FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl 2 to give a final reaction of 10 ⁇ l with 1 ⁇ FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl 2 and 1 U FastStart High Fidelity Enzyme Blend.
- PCR amplification were carried out in a thermo cycler (Applied Biosystems) with the following program: Hot start at 94° C. for 2 min, followed by 50 cycles at 94° C. for 15 seconds, 55° C. for 30 seconds, 68° C. for 1 minute, and a final extension at 68° C. for 5 minutes.
- Beta-2 microglobulin (B2M) primer SEQ ID NO: 43) 5′-TGGGGGTGAGAATTGCTAAG-3′ ID-1 primer (SEQ ID NO: 44) 5′-CCTTCTCCTTCTCCTTCACC-3′ ID-5 primer (SEQ ID NO: 45) 5′-GTCCTCTATTCCGTCACCAT-3′ ID-20 primer (SEQ ID NO: 46) 5′-CTGCTTCTTCCTGGAACTCA-3′
- results show successful amplification of ID-specific and gene-specific products using two different ID primers (i.e. specific for ID tags positioned at different locations on the microarray and the same gene specific primer from a brain tissue covering all the probes). Accordingly this experiment establishes that products may be identified by an ID tag-specific or target nucleic acid specific amplification reaction. It is further established that different ID tags may be distinguished. A second experiment, with tissue covering only half of the ID probes (i.e. capture probes) on the array resulted in a positive result (PCR product) for spots that were covered with tissue.
- tissue covering only half of the ID probes i.e. capture probes
- the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2 ⁇ SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2 ⁇ SSC for 1 min at 300 rpm shake and 3) 0.1 ⁇ SSC for 1 min at 300 rpm shake. The array was then spun dry and placed back in the ChipClip.
- Klenow Fragment 3′ to 5′ exo minus (Illumina, www.illumina.com) together with 10 ⁇ Klenow buffer, dNTPs 2 mM each (Fermentas) and water, was mixed into a 50 ⁇ l reaction and was pipetted into each well.
- the array was incubated at 15° C. for 15 min, 25° C. for 15 min, 37° C. for 15 min and finally 75° C. for 20 min in an Eppendorf Thermomixer.
- the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2 ⁇ SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2 ⁇ SSC for 1 min at 300 rpm shake and 3) 0.1 ⁇ SSC for 1 min at 300 rpm shake. The array was then spun dry and placed back in the ChipClip.
- dT tailing a 50 ⁇ l reaction mixture containing 1 ⁇ TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com), 0.1 ⁇ g/ ⁇ l BSA (New England Biolabs), 0.5 ⁇ l RNase H (5 U/ ⁇ l), 1 ⁇ l TdT (20 U/ ⁇ l) and 0.5 ⁇ l dTTPs (100 mM) was prepared. The mixture was added to the array surface and the array was incubated in a thermo cycler (Applied Biosystems) at 37° C. for 15 min followed by an inactivation of TdT at 70° C. for 10 min.
- TdT buffer 20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate
- BSA New England Biolabs
- 0.5 ⁇ l RNase H 5 U/ ⁇
- Pre-fabricated high-density microarrays chips were ordered from Roche-Nimblegen (Madison, Wis., USA). Each capture probe array contained 135,000 features of which 132,640 features carried a capture probe comprising a unique ID-tag sequence (positional domain) and a capture region (capture domain). Each feature was 13 ⁇ 13 ⁇ m in size.
- the capture probes were composed 5′ to 3′ of a universal domain containing five dUTP bases (a cleavage domain) and a general amplification domain, an ID tag (positional domain) and a capture region (capture domain) ( FIG. 6 and Table 4). Each array was also fitted with a frame of marker probes carrying a generic 30 bp sequence (Table 4) to enable hybridization of fluorescent probes to help with orientation during array visualization.
- the animal was perfused with 50 ml PBS and 100 ml 4% formalin solution. After excision of the olfactory bulb, the tissue was put into a 4% formalin bath for post-fixation for 24 hrs. The tissue was then sucrose treated in 30% sucrose dissolved in PBS for 24 hrs to stabilize morphology and to remove excess formalin. The tissue was frozen at a controlled rate down to ⁇ 40° C. and kept at ⁇ 20° C. between experiments. Similar preparation of tissue postfixed for 3 hrs or without post-fixation was carried out for a parallel specimen. Perfusion with 2% formalin without post-fixation was also used successfully. Similarly the sucrose treatment step could be omitted. The tissue was mounted into a cryostat for sectioning at 10 ⁇ m. A slice of tissue was applied onto each capture probe array to be used. Optionally for better tissue adherence, the array chip was placed at 50° C. for 15 minutes.
- Total RNA was extracted from a single tissue section (10 ⁇ m) using the RNeasy FFPE kit (Qiagen) according to manufacturers instructions. The total RNA obtained from the tissue section was used in control experiments for a comparison with experiments in which the RNA was captured on the array directly from the tissue section. Accordingly, in the case where total RNA was applied to the array the staining, visualization and degradation of tissue steps were omitted.
- proteinase K (Qiagen, Hilden, Germany) was diluted to 1 ⁇ g/ml in PBS. The solution was added to the wells and the slide incubated at room temperature for 5 minutes, followed by a gradual increase to 80° C. over 10 minutes. The slide was washed briefly in PBS before the reverse transcription reaction.
- the slide was placed at the bottom of a glass jar containing 50 ml 0.2 ⁇ SSC (Sigma-Aldrich) and was heated in a microwave oven for 1 minute at 800 W. Directly after microwave treatment the slide was placed onto a paper tissue and was dried for 30 minutes in a chamber protected from unnecessary air exposure. After drying, the slide was briefly dipped in water (RNase/DNase free) and finally spin-dried by a centrifuge before cDNA synthesis was initiated.
- SSC Sigma-Aldrich
- Reverse transcription reaction the SuperScript III One-Step RT-PCR System with Platinum Taq (Life Technologies/Invitrogen, Carlsbad, Calif., USA) was used. Reverse transcription reactions contained 1 ⁇ reaction mix, 1 ⁇ BSA (New England Biolabs, Ipswich, Mass., USA) and 2 ⁇ l SuperScript III RT/Platinum Taq mix in a final volume of 50 ⁇ l. This solution was heated to 50° C. before application to the tissue sections and the reaction was performed at 50° C. for 30 minutes. The reverse transcription solution was subsequently removed from the wells and the slide was allowed to air dry for 2 hours.
- BSA New England Biolabs, Ipswich, Mass., USA
- the marker probe was hybridized to the frame probes prior to placing the tissue on the array.
- the marker probe was then diluted to 170 nM in hybridization buffer (4 ⁇ SSC, 0.1% SDS). This solution was heated to 50° C. before application to the chip and the hybridization was performed at 50° C. for 30 minutes at 300 rpm. After hybridization, the slide was washed in 2 ⁇ SSC, 0.1% SDS at 50° C. and 300 rpm for 10 minutes, 0.2 ⁇ SSC at 300 rpm for 1 minute and 0.1 ⁇ SSC at 300 rpm for 1 minute. In that case the staining solution after cDNA synthesis only contained the nuclear DAPI stain diluted to 300 nM in PBS. The solution was applied to the wells and the slide was incubated at room temperature for 5 minutes, followed by brief washing in PBS and spin drying.
- the sections were microscopically examined with a Zeiss Axio Imager Z2 and processed with MetaSystems software.
- tissue sections were digested using Proteinase K diluted to 1.25 ⁇ g/ ⁇ l in PKD buffer from the RNeasy FFPE Kit (both from Qiagen) at 56° C. for 30 minutes with an interval mix at 300 rpm for 3 seconds, then 6 seconds rest.
- the slide was subsequently washed in 2 ⁇ SSC, 0.1% SDS at 50° C. and 300 rpm for 10 minutes, 0.2 ⁇ SSC at 300 rpm for 1 minute and 0.1 ⁇ SSC at 300 rpm for 1 minute.
- the 16-well Hybridization Cassette with silicone gasket (ArrayIt) was preheated to 37° C. and attached to the Nimblegen slide.
- a volume of 50 ⁇ l of cleavage mixture preheated to 37° C., consisting of Lysis buffer at an unknown concentration (Takara), 0.1 U/ ⁇ l USER Enzyme (NEB) and 0.1 ⁇ g/ ⁇ l BSA was added to each of wells containing surface immobilized cDNA. After removal of bubbles the slide was sealed and incubated at 37° C. for 30 minutes in a Thermomixer comfort with cycled shaking at 300 rpm for 3 seconds with 6 seconds rest in between. After the incubation 45 ⁇ l cleavage mixture was collected from each of the used wells and placed into 0.2 ml PCR tubes.
- Exonuclease I was added, to remove unextended cDNA probes, to a final volume of 46.2 ⁇ l and a final concentration of 0.52 U/ ⁇ l.
- the tubes were incubated in a thermo cycler (Applied Biosystems) at 37° C. for 30 minutes followed by inactivation of the exonuclease at 80° C. for 25 minutes.
- polyA-tailing mixture After the exonuclease step, 45 ⁇ l polyA-tailing mixture, according to manufacturers instructions consisting of TdT Buffer (Takara), 3 mM dATP (Takara) and manufacturers TdT Enzyme mix (TdT and RNase H) (Takara), was added to each of the samples. The mixtures were incubated in a thermocycler at 37° C. for 15 minutes followed by inactivation of TdT at 70° C. for 10 minutes.
- PCR master mix was placed into four new 0.2 ml PCR tubes per sample, to each tube 41 sample was added as a template.
- the final PCRs consisted of 1 ⁇ Ex Taq buffer (Takara), 200 ⁇ M of each dNTP (Takara), 600 nM A_primer (MWG), 600 nM B_dT20VN_primer (MWG) and 0.025 U/ ⁇ l Ex Taq polymerase (Takara)(Table 4).
- a second cDNA strand was created by running one cycle in a thermocycler at 95° C. for 3 minutes, 50° C. for 2 minutes and 72° C. for 3 minutes.
- samples were amplified by running 20 cycles (for library preparation) or 30 cycles (to confirm the presence of cDNA) at 95° C. for 30 seconds, 67° C. for 1 minute and 72° C. for 3 minutes, followed by a final extension at 72° C. for 10 minutes.
- the four PCRs (100 ⁇ l) were mixed with 500 ⁇ l binding buffer (Qiagen) and placed in a Qiaquick PCR purification column (Qiagen) and spun for 1 minute at 17,900 ⁇ g in order to bind the amplified cDNA to the membrane.
- the membrane was then washed with wash buffer (Qiagen) containing ethanol and finally eluted into 50 ⁇ l of 10 mM Tris-Cl, pH 8.5.
- the purified and concentrated sample was further purified and concentrated by CA-purification (purification by superparamagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp.
- the amplified cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and were then eluted into 15 ⁇ l of 10 mM Tris-Cl, pH 8.5.
- Samples amplified for 20 cycles were used further to prepare sequencing libraries.
- An index PCR master mix was prepared for each sample and 23 ⁇ l was placed into six 0.2 ml tubes. 2 ⁇ l of the amplified and purified cDNA was added to each of the six PCRs as template making the PCRs containing 1 ⁇ Phusion master mix (Fermentas), 500 nM InPE1.0 (Illumina), 500 nM Index 1-12 (IIlumina), and 0.4 nM InPE2.0 (IIlumina).
- the samples were amplified in a thermocycler for 18 cycles at 98° C. for 30 seconds, 65° C. for 30 seconds and 72° C. for 1 minute, followed by a final extension at 72° C. for 5 minutes.
- the six PCRs (150 ⁇ l) were mixed with 750 ⁇ l binding buffer and placed in a Qiaquick PCR purification column and spun for 1 minute at 17,900 ⁇ g in order to bind the amplified cDNA to the membrane (because of the large sample volume (900 ⁇ l), the sample was split in two (each 450 ⁇ l) and was bound in two separate steps). The membrane was then washed with wash buffer containing ethanol and finally eluted into 50 ⁇ l of 10 mM Tris-Cl, pH 8.5.
- the purified and concentrated sample was further purified and concentrated by CA-purification with an MBS robot. A final PEG concentration of 7.8% was used in order to remove fragments below 300-350 bp.
- the amplified cDNA was allowed to bind to the CA-beads for 10 min and were then eluted into 15 ⁇ l of 10 mM Tris-Cl, pH 8.5. Samples were analyzed with an Agilent Bioanalyzer in order to confirm the presence and size of the finished libraries, the DNA High Sensitivity kit or DNA 1000 kit were used according to manufacturers instructions depending on the amount of material.
- the libraries were sequenced on the Illumina Hiseq2000 or Miseq depending on desired data throughput according to manufacturers instructions.
- a custom sequencing primer B_r2 was used to avoid sequencing through the homopolymeric stretch of 20 T.
- Read 1 was trimmed 42 bases at 5′ end.
- Read 2 was trimmed 25 bases at 5′ end (optionally no bases were trimmed from read 2 if the custom primer was used).
- the reads were then mapped with bowtie to the repeat masked Mus musculus 9 genome assembly and the output was formatted in the SAM file format. Mapped reads were extracted and annotated with UCSC refGene gene annotations. Indexes were retrieved with ‘indexFinder’ (an inhouse software for index retrieval). A mongo DB database was then created containing information about all caught transcripts and their respective index position on the chip.
- a matlab implementation was connected to the database and allowed for spatial visualization and analysis of the data ( FIG. 7 ).
- the data visualization was overlaid with the microscopic image using the fluorescently labelled frame probes for exact alignment and enabling spatial transcriptomic data extraction.
- Pre-fabricated high-density microarrays chips were ordered from Roche-Nimblegen (Madison, Wis., USA). Each used capture probe array contained 72 k features out of which 66,022 contained a unique ID-tag complementary sequence. Each feature was 16 ⁇ 16 ⁇ m in size. The capture probes were composed 3′ to 5′ in the same way as the probes used for the in-house printed 3′ to 5′ arrays with the exception to 3 additional bases being added to the upper (P′) general handle of the probe to make it a long version of P′, LP′ (Table 4). Each array was also fitted with a frame of probes carrying a generic 30 bp sequence to enable hybridization of fluorescent probes to help with orientation during array visualization.
- the synthesis of 5′ to 3′ oriented capture probes on the high-density arrays was carried out as in the case with in-house printed arrays, with the exception that the extension and ligation steps were carried out at 55° C. for 15 mins followed by 72° C. for 15 mins.
- the A-handle probe (Table 4) included an A/G mismatch to allow for subsequent release of probes through the MutY enzymatic system described below.
- the P-probe was replaced by a longer LP version to match the longer probes on the surface.
- cDNA synthesis and staining was carried out as in the protocol for 5′ to 3′ oriented high-density Nimblegen arrays with the exception that biotin labelled dCTPs and dATPs were added to the cDNA synthesis together with the four regular dNTPs (each was present at 25 ⁇ times more than the biotin labelled ones).
- Tissue removal was carried out in the same way as in the protocol for 5′ to 3′ oriented high-density Nimblegen arrays described in Example 6.
- a 16-well Incubation chamber with silicone gasket (ArrayIT) was preheated to 37° C. and attached to the Codelink slide.
- a volume of 50 ⁇ l of cleavage mixture preheated to 37° C., consisting of 1 ⁇ Endonucelase VIII Buffer (NEB), 10 U/ ⁇ l MutY (Trevigen), 10 U/ ⁇ l Endonucelase VIII (NEB), 0.1 ⁇ g/ ⁇ l BSA was added to each of wells containing surface immobilized cDNA. After removal of bubbles the slide was sealed and incubated at 37° C. for 30 minutes in a Thermomixer comfort with cycled shaking at 300 rpm for 3 seconds with 6 seconds rest in between. After the incubation, the plate sealer was removed and 40 ⁇ l cleavage mixture was collected from each of the used wells and placed into a PCR plate.
- the samples were purified by binding the biotin labeled cDNA to streptavidin coated Cl-beads (Invitrogen) and washing the beads with 0.1M NaOH (made fresh). The purification was carried out with an MBS robot (Magnetic Biosolutions), the biotin labelled cDNA was allowed to bind to the Cl-beads for 10 min and was then eluted into 20 ⁇ l of water by heating the bead-water solution to 80° C. to break the biotin-streptavidin binding.
- MBS robot Magnetic Biosolutions
- PCR master mix was placed into four new 0.2 ml PCR tubes per sample, to each tube 41 sample was added as a template.
- the final PCRs consisted of 1 ⁇ Ex Taq buffer (Takara), 200 ⁇ M of each dNTP (Takara), 600 nM A_primer (MWG), 600 nM B_dT20VN_primer (MWG) and 0.025 U/ ⁇ l Ex Taq polymerase (Takara).
- a second cDNA strand was created by running one cycle in a thermo cycler at 95° C. for 3 minutes, 50° C. for 2 minutes and 72° C. for 3 minutes.
- samples were amplified by running 20 cycles (for library preparation) or 30 cycles (to confirm the presence of cDNA) at 95° C. for 30 seconds, 67° C. for 1 minute and 72° C. for 3 minutes, followed by a final extension at 72° C. for 10 minutes.
- the four PCRs (100 ⁇ l) were mixed with 500 ⁇ l binding buffer (Qiagen) and placed in a Qiaquick PCR purification column (Qiagen) and spun for 1 minute at 17,900 ⁇ g in order to bind the amplified cDNA to the membrane.
- the membrane was then washed with wash buffer (Qiagen) containing ethanol and finally eluted into 50 ⁇ l of 10 mM Tris-HCl, pH 8.5.
- the purified and concentrated sample was further purified and concentrated by CA-purification (purification by superparamagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp.
- the amplified cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and were then eluted into 15 ⁇ l of 10 mM Tris-HCl, pH 8.5.
- the final PCRs consisted of 1 ⁇ Ex Taq buffer (Takara), 200 ⁇ M of each dNTP (Takara), 600 nM A_primer (MWG), 600 nM B_ primer (MWG) and 0.025 U/ ⁇ l Ex Taq polymerase (Takara).
- the samples were heated to 95° C. for 3 minutes, and then amplified by running 10 cycles at 95° C. for 30 seconds, 65° C. for 1 minute and 72° C. for 3 minutes, followed by a final extension at 72° C. for 10 minutes.
- the four PCRs (100 ⁇ l) were mixed with 500 ⁇ l binding buffer (Qiagen) and placed in a Qiaquick PCR purification column (Qiagen) and spun for 1 minute at 17,900 ⁇ g in order to bind the amplified cDNA to the membrane.
- the membrane was then washed with wash buffer (Qiagen) containing ethanol and finally eluted into 50 ⁇ l of 10 mM Tris-Cl, pH 8.5.
- the purified and concentrated sample was further purified and concentrated by CA-purification (purification by super-paramagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp.
- the amplified cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and were then eluted into 15 ⁇ l of 10 mM Tris-HCl, pH 8.5.
- the samples was purified and concentrated by CA-purification with an MBS robot. A final PEG concentration of 7.8% was used in order to remove fragments below 300-350 bp.
- the amplified cDNA was allowed to bind to the CA-beads for 10 min and were then eluted into 15 ⁇ l of 10 mM Tris-HCl, pH 8.5.
- cDNA synthesis on chip as described above can also be combined with template switching to create a second strand by adding a template switching primer to the cDNA synthesis reaction (Table 4).
- the second amplification domain is introduced by coupling it to terminal bases added by the reverse transcriptase at the 3′ end of the first cDNA strand, and primes the synthesis of the second strand.
- the library can be readily amplified directly after release of the double-stranded complex from the array surface.
- RNA-capture oligonucleotide (Table 2) was printed on glass slides to function as the capture probe.
- the probe was synthesized with a 5′-terminus amino linker with a C6 spacer. All probes where synthesized by Sigma-Aldrich (St. Louis, Mo., USA).
- the RNA-capture probe was suspended at a concentration of 20 ⁇ M in 150 mM sodium phosphate, pH 8.5 and spotted using a pipette onto CodeLinkTM Activated microarray slides (7.5 cm ⁇ 2.5 cm; Surmodics, Eden Prairie, Minn., USA). Each array was printed with 10 ⁇ l of capture probe-containing solution, and left to dry. After printing, surface blocking was performed according to the manufacturer's instructions.
- the probes were printed in 16 arrays on the slide. The 16 sub-arrays were separated during reaction steps by a 16-pad mask (Arrayit Corporation, Sunnyvale, Calif., USA).
- Fresh non-fixed mouse brain tissue was trimmed if necessary and frozen in ⁇ 40° C. cold isopentane and subsequently mounted for sectioning with a cryostat at 10 ⁇ m. A slice of tissue was applied onto each probe array.
- Pepsin was diluted to 0.1% in 0.1M HCl and was preheated to 37° C.
- the array was attached to an ArrayIt 16-well mask and holder. 50 ⁇ l of the pepsin/HCl mixture was added to each well. The array was incubated for 10 minutes at 37° C. and the wells were washed with 100 ⁇ l 0.1 ⁇ SSC by pipetting.
- a cDNA synthesis mixture (80 ⁇ l) was prepared containing 4 ⁇ l each of dATP/dGTP/dTTP (10 mM), 4 ⁇ l dCTP (2.5 mM), 4 ⁇ l Cy3-dCTP (1 mM), 4 ⁇ l DTT (0.1M), 1 ⁇ BSA, 20 U/ ⁇ l Superscript III, 5 U/ ⁇ l RNaseOUT, 1 ⁇ first strand buffer (Superscript III, Invitrogen) and MilliQ water. 70 ⁇ l of the reaction mixture was added to each well. The reactions were covered with a plastic sealer and incubated at 37° C. overnight.
- the array was removed from the ArrayIt mask and holder and washed using the following steps: 1) 50° C. 2 ⁇ SSC solution with 0.1% SDS for 10 min at 300 rpm shake; 2) 0.2 ⁇ SSC for 1 min at 300 rpm shake; and 3) 0.1 ⁇ SSC for 1 min at 300 rpm shake. The array was spun dry.
- the array was attached to an ArrayIt slide holder and 16 well mask (ArrayIt Corporation). 10 ⁇ l Proteinase K Solution (Qiagen) was added for each 150 ⁇ l Proteinase K Digest Buffer from the RNeasy FFPE kit (Qiagen). 50 ⁇ l of the final mixture was added to each well and the array was incubated at 56° C. for 1 hour. The array was washed as described above.
- the array was imaged at 532 nm using an Agilent microarray scanner at 100% exposure and 5 ⁇ m resolution ( FIG. 11 and FIG. 12 ).
- Example 10 The method described in Example 10 was performed up to and including the step of tissue removal. Followed by the steps described below.
- the array was mounted into a MMI Cellcut instrument (Molecular Machines and Industries AG, Glattbrugg, Switzerland) and the sections of the fluorescently labelled cDNA to be removed were marked for ablation by laser.
- MMI Cellcut instrument Molecular Machines and Industries AG, Glattbrugg, Switzerland
- the codelink glass chip was imaged at 532 nm using an Agilent microarray scanner at 100% exposure and 5 ⁇ m resolution. Removal of ablated areas was verified ( FIGS. 13 a and b). The array was washed according to the procedure described in Example 10.
- the array was attached to an ArrayIt slide holder and 16 well mask (ArrayIt Corporation).
- a cleavage mixture 50 ⁇ l containing 1 ⁇ Exo I buffer (New England Biolabs, Ipswich, Mass., USA), 1 ⁇ BSA, RNase/DNase free water, 5 U of USER enzyme mix (New England Biolabs) was added to each well.
- the reactions were covered with a plastic sealer and incubated at 37° C. for 1 hour using interval mixing of 3 seconds at 300 rpm and 6 seconds rest. After the incubation, 45 ⁇ l cleavage mixture was collected from each of the used wells and placed into 0.2 ml PCR tubes.
- Exonuclease I was added, to remove unextended cDNA probes, to a final volume of 46.41 and a final concentration of 0.52 U/ ⁇ l.
- the tubes were incubated in a thermocycler (Applied Biosystems) at 37° C. for 30 minutes followed by inactivation of the exonuclease at 80° C. for 25 minutes.
- polyA-tailing mixture consisting of TdT Buffer (Takara), 3 mM dATP (Takara) and manufacturers TdT Enzyme mix (TdT and RNase H) (Takara), was added to each of the samples according to manufacturer's instructions.
- the mixtures were incubated in a thermo cycler at 37° C. for 15 minutes followed by inactivation of TdT at 70° C. for 10 minutes.
- PCR master mix was placed into four new 0.2 ml PCR tubes per sample. 2 ⁇ l of sample was added to each tube as a template.
- the final PCRs consisted of 1 ⁇ Ex Taq buffer (Takara), 200 ⁇ M of each dNTP (Takara), 600 nM A_primer (MWG), 600 nM B_dT20VN_primer (MWG) and 0.025 U/ ⁇ l Ex Taq polymerase (Takara)(Table 3).
- a second cDNA strand was created by running one cycle in a thermocycler at 95° C. for 3 minutes, 50° C. for 2 minutes and 72° C. for 3 minutes.
- the samples were amplified by running 20 cycles (for library preparation) or 30 cycles (to confirm the presence of cDNA) at 95° C. for 30 seconds, 67° C. for 1 minute and 72° C. for 3 minutes, followed by a final extension at 72° C. for 10 minutes.
- the four PCRs (100 ⁇ l) were mixed with 500 ⁇ l binding buffer (Qiagen) and placed in a Qiaquick PCR purification column (Qiagen) and spun for 1 minute at 17,900 ⁇ g in order to bind the amplified cDNA to the membrane.
- the membrane was then washed with wash buffer (Qiagen) containing ethanol and finally eluted into 50 ⁇ l of 10 mM Tris-Cl, pH 8.5.
- the purified and concentrated sample was further purified and concentrated by CA-purification (purification by superparamagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp.
- the amplified cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and were then eluted into 15 ⁇ l of 10 mM Tris-Cl, pH 8.5.
- Second strand synthesis and first PCR Amplification handles A_primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 48)
- B_dt20VN_primer AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTT TTTTTTTTVN (SEQ ID NO: 49)
- Probe1 (SEQ ID NO: 50) UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG TCCGATATGATTGCCGCTTTTTTTTTTTTTTTTTTVN
- Probe2 (SEQ ID NO: 51) UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA TGAGCCGGGTTCATCTTTTTTTTTTTTTTTTTTTTTTTTVN
- Probe3 (SEQ ID NO: 52) UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT GAGGCACTCTGTTGGGATTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
- Probe4 (SEQ ID NO: 53) UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA TGATTAGTCGCCATTCGTTTTTTTTTTTTTTTTTTTTTTVN
- Probe5 (SEQ ID NO: 54) UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA TGATTAGTCGC
- the following experiment demonstrates that the step of labelling the secured (captured) cDNA molecules can be performed using arrays that comprise a high density of capture probes comprising unique positional domains.
- Pre-fabricated high-density microarray chips were ordered from Roche-Nimblegen (Madison, Wis., USA). Each chip contained multiple probe arrays, each with 270,000 features of which 135,000 features carried a capture probe comprising a unique ID-tag sequence (positional domain) and a capture region (capture domain). Each feature was 13 ⁇ 13 ⁇ m in size.
- the capture probes were composed 5′ to 3′ of: a universal domain containing five dUTP bases (a cleavage domain) and a general 5′ amplification domain; an ID tag (positional domain); and a capture region (capture domain) (see Table 5). Each array was also fitted with a frame of marker probes carrying a generic 30 bp sequence (Table 5) to enable hybridization of fluorescent probes to help with orientation during array visualization.
- the probe-arrays were separated during reaction steps by a 16-pad mask (Arrayit Corporation, Sunnyvale, Calif., USA).
- Example 10 The method described in Example 10 was performed up to and including the step of tissue removal.
- a solution with frame marker probe (Table 5) at a concentration of 170 nM in PBS was prepared. This solution was added to the wells and the slide was incubated at room temperature for 5 minutes, followed by brief washing in PBS and spin drying.
- the high-density microarray glass chip was imaged at 532 nm using an Agilent microarray scanner at 100% exposure and 5 ⁇ m resolution ( FIG. 15 ).
- Example 10 The method described in Example 10 was performed up to the cDNA synthesis step, which was replaced by the step described below.
- cDNA synthesis mixture was prepared containing 4 ⁇ l each of dATP/dGTP/dTTP (10 mM), 4 ul DTT (0.1M), 1 ⁇ BSA, 20 U/ ⁇ l Superscript III, 5 U/ul RNaseOUT, 1 ⁇ first strand buffer (Superscript III, Invitrogen) and MilliQ water.
- concentration of dCTP and Cy3-dCTP was varied so that in five parallel experiments 1/1, 1/2, 1/4, 1/8 and 1/16 of the original concentration of 2.5 mM for dCTP and 1 mM for Cy3-dCTP was used.
- 4 ⁇ l of dCTP and 4 ⁇ l of Cy3-dCTP with these concentrations were pipetted into each respective synthesis mixture. 70 ⁇ l of the reaction mixture was added to each well. The reactions were covered with a plastic sealer and incubated at 37° C. overnight.
- the signal intensities resulting from imaging of the codelink glass chip in the Agilent microarray scanner were analyzed using the Genepix pro software. Average signal intensities were calculated from multiple selected areas within each Cy3 footprint and plotted in a diagram ( FIG. 16 ).
- Example 10 The method described in Example 10 was performed up to the Imaging step. The tissue preparation, fixation and imaging steps were replaced by the steps described below.
- Fresh non-fixed drosophila or zebrafish tissue was frozen with dry ice and subsequently mounted for sectioning with a cryostat at 10 ⁇ m. A slice of tissue was applied onto each probe array to be used.
- the sections were fixed in a pre-chilled methanol bath at ⁇ 20° C. for 10 min. After fixation, the slide was briefly washed for 10 seconds 1 ⁇ PBS and heat dried at 50° C. for 15 min in an eppendorf thermomixer.
- the probe array chip with zebrafish ( FIG. 17 A ) or drosophila ( FIG. 17 B ) tissue was imaged before removal using phase-contrast imaging. Imaging after removal of tissue use the Cy3 compatible channel on a MMI Cellcut instrument mounted on an Olympus IX 81 microscope.
- Example 10 The method described in Example 10 was performed up to the Imaging step.
- the tissue preparation, fixation, permeabilization, tissue removal and imaging steps were replaced by the steps described below.
- Fresh prostate cancer tissue was trimmed if necessary, embedded in Neg-50 (Thermo Scientific) and snap frozen in liquid nitrogen. The tissue was subsequently mounted for sectioning with a cryostat at 10 ⁇ m. A slice of tissue was applied onto each probe array to be used.
- the chip was attached to an ArrayIt 16-well mask and holder. 70 ⁇ l of 4% paraformaldehyde dissolved in PBS was added to the probe array well to cover the tissue section. The reaction was incubated at room temperature for 10 minutes. The mask was removed and the chip was washed for 10 seconds in PBS. The chip was then incubated at 50° C. for 15 minutes.
- Pepsin was diluted to 0.1% in 0.1M HCl and was preheated to 37° C.
- the chip was attached to an ArrayIt 16-well mask and holder. 70 ⁇ l of the pepsin/HCl mixture was added to each well. The reaction was incubated for 10 minutes at 37° C. The wells were washed with 100 ⁇ l 0.1 ⁇ SSC by pipetting.
- the array was attached to an ArrayIt slide holder and 16 well mask (ArrayIt Corporation). 20 ⁇ l Proteinase K Solution (Qiagen) was added for each 150 ⁇ l Proteinase K Digest Buffer from the RNeasy FFPE kit (Qiagen). 50 ⁇ l of the final mixture was added to each well and the array was incubated at 56° C. for 1 hour. The array was washed as described in Example 10.
- the probe array chip with prostate tissue was imaged before removal using phase-contrast imaging. Imaging after removal of tissue use the Cy3 compatible channel on a MMI Cellcut instrument mounted on an Olympus IX 81 microscope ( FIG. 17 C ).
- a cell sample i.e. a suspension of cells
- tissue sample i.e. a suspension of cells
- Example 10 The method described in Example 10 was performed up to the Imaging step.
- the tissue preparation, fixation, permeabilization, cDNA synthesis, tissue removal and imaging steps were replaced by the steps described below.
- the chip was attached to an ArrayIt 16-well mask and holder. 100 ul of 4% paraformaldehyde dissolved in PBS was added to the probe array well to cover the cells. The reaction was incubated at room temperature for 10 minutes. The probe array well was washed once with 100 ⁇ l 0.1 ⁇ SSC by pipetting. The chip was then incubated at 50° C. for 15 minutes.
- Pepsin was diluted to 0.1% in 0.1M HCl and was preheated to 37° C.
- the chip was attached to an ArrayIt 16-well mask and holder. 70 ⁇ l of the pepsin/HCl mixture was added to each well. The reaction was incubated for 1 minute at 37° C. The wells were washed with 100 ⁇ l 0.1 ⁇ SSC by pipetting.
- cDNA synthesis mixture was prepared containing 4 ⁇ l each of dATP/dGTP/dTTP (10 mM), 2 ⁇ l dCTP (2.5 mM), 2 ⁇ l Cy3-dCTP (1 mM), 4 ⁇ l DTT (0.1M), 1 ⁇ BSA, 20 U/ ⁇ l Superscript III, 5 U/ ⁇ l RNaseOUT, 1 ⁇ first strand buffer (Superscript III, Invitrogen) and MilliQ water. 70 ⁇ l of the reaction mixture was added to each well. The reactions were covered with a plastic sealer and incubated at 37° C. overnight.
- the probe array chip with cells was imaged before removal using phase-contrast imaging. Imaging after removal of tissue use the Cy3 compatible channel on a MMI Cellcut instrument mounted on an Olympus IX 81 microscope ( FIG. 17 D ).
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
Abstract
Description
-
- (i) a domain capable of hybridizing to part of the capture domain oligonucleotide (a part not involved in capturing the nucleic acid, e.g. RNA); and
- (ii) a complementary universal domain;
-
- (i) a domain capable of hybridizing to part of a capture domain oligonucleotide; and
- (ii) a domain that is complementary to a universal domain oligonucleotide;
| TABLE 1 | ||||
| Name | Sequence | 5′ mod | 3′ mod | Length |
| Sequences for free 3′ capture probes |
| TAP-ID1 | UUAAGTACAAATCTCGACTGCCACTCTGAACCTTCT | Amino-C6 | 72 | |
| CCTTCTCCTTCACCTTTTTTTTTTTTTTTTTTTTVN | ||||
| (SEQ ID NO: 1) | ||||
| Enzymatic | UUAAGTACAA (SEQ ID NO: 2) | 10 | ||
| recog | ||||
| Universal | ATCTCGACTGCCACTCTGAA (SEQ ID NO: 3) | 20 | ||
| amp handle P | ||||
| ID1 | CCTTCTCCTTCTCCTTCACC (SEQ ID NO: 4) | 20 | ||
| Capture | TTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 5) | 22 | ||
| sequence | ||||
| ID1 | CCTTCTCCTTCTCCTTCACC (SEQ ID NO: 6) | 20 | ||
| ID2 | CCTTGCTGCTTCTCCTCCTC (SEQ ID NO: 7) | 20 | ||
| ID3 | ACCTCCTCCGCCTCCTCCTC (SEQ ID NO: 8) | 20 | ||
| ID4 | GAGACATACCACCAAGAGAC (SEQ ID NO: 9) | 20 | ||
| ID5 | GTCCTCTATTCCGTCACCAT (SEQ ID NO: 10) | 20 | ||
| ID6 | GACTGAGCTCGAACATATGG (SEQ ID NO: 11) | 20 | ||
| ID7 | TGGAGGATTGACACAGAACG (SEQ ID NO: 12) | 20 | ||
| ID8 | CCAGCCTCTCCATTACATCG (SEQ ID NO: 13) | 20 | ||
| ID9 | AAGATCTACCAGCCAGCCAG (SEQ ID NO: 14) | 20 | ||
| ID10 | CGAACTTCCACTGTCTCCTC (SEQ ID NO: 15) | 20 | ||
| ID11 | TTGCGCCTTCTCCAATACAC (SEQ ID NO: 16) | 20 | ||
| ID12 | CTCTTCTTAGCATGCCACCT (SEQ ID NO: 17) | 20 | ||
| ID13 | ACCACTTCTGCATTACCTCC (SEQ ID NO: 18) | 20 | ||
| ID14 | ACAGCCTCCTCTTCTTCCTT (SEQ ID NO: 19) | 20 | ||
| ID15 | AATCCTCTCCTTGCCAGTTC (SEQ ID NO: 20) | 20 | ||
| ID16 | GATGCCTCCACCTGTAGAAC (SEQ ID NO: 21) | 20 | ||
| ID17 | GAAGGAATGGAGGATATCGC (SEQ ID NO: 22) | 20 | ||
| ID18 | GATCCAAGGACCATCGACTG (SEQ ID NO: 23) | 20 | ||
| ID19 | CCACTGGAACCTGACAACCG (SEQ ID NO: 24) | 20 | ||
| ID20 | CTGCTTCTTCCTGGAACTCA (SEQ ID NO: 25) | 20 | ||
| Sequences for free 5′ surface probes and on-chip free 3′ capture probe synthesis |
| Free 5′ | GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCATATC | Amino C7 | 66 |
| surface | GGACAGATCGGAAGAGCGTAGTGTAG (SEQ ID NO: 26) | ||
| probe-A | |||
| Free 5′ | GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCATATC | Amino C7 | 66 |
| surface | GGACGGCTGCTGGTAAATAGAGATCA (SEQ ID NO: 27) | ||
| probe-U | |||
| Nick | GCG | 3 | ||
| LP′ | TTCAGAGTGGCAGTCGAGATCAC (SEQ ID NO: 28) | 23 | ||
| ID′ | GCGGCAATCATATCGGAC (SEQ ID NO: 29) | 18 | ||
| A′ 22 | AGATCGGAAGAGCGTAGTGTAG (SEQ ID NO: 30) | 22 | ||
| bp MutY | ||||
| mismatch | ||||
| U′ 22 | GGCTGCTGGTAAATAGAGATCA (SEQ ID NO: 31) | |||
| bp MutY | ||||
| mismatch | ||||
| Hybridized sequences for capture probe synthesis |
| Illumina amp | ACACTCTTTCCCTACACGACGCTCTTCCGATCT | 33 | ||
| handle A | (SEQ ID NO: 32) | |||
| Universa ampl | AAGTGTGGAAAGTTGATCGCTATTTACCAGCAGCC | 35 | ||
| handle U | (SEQ ID NO: 33) | |||
| Capture_LP_Poly- | GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTTTTTTTTTVN | Phosphorylated | 45 |
| dTVN | (SEQ ID NO: 34) | ||
| Capture_LP_Poly- | GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTTTTTTTTTTTTT | Phosphorylated | 47 |
| d24T | (SEQ ID NO: 35) | ||
| Additional secondary universal amplification handles |
| Illumina | AGACGTGTGCTCTTCCGATCT (SEQ ID NO: 36) | 21 | ||
| amp handle B | ||||
| Universal | ACGTCTGTGAATAGCCGCAT (SEQ ID NO: 37) | 20 | ||
| amp handle X | ||||
| B_R6 handle | AGACGTGTGCTCTTCCGATCTNNNNNNNN (SEQ ID NO: 38) | 27 (26) | ||
| (or X) | ||||
| B_R8 handle | AGACGTGTGCTCTTCCGATCTNNNNNNNNNN (SEQ ID NO: 39) | 29 (28) | ||
| (or X) | ||||
| B_polyTVN | AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTVN | 43 (42) | ||
| (or X) | (SEQ ID NO: 40) | |||
| B_poly24T | AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTTTTT | 45 (44) | ||
| (or X) | (SEQ ID NO: 41) | |||
| Amplification handle to incorporate A handle into P handle products |
| A_P handle | ACACTCTTTCCCTACACGACGCTCTTCCGATCTATCTCGACTGCCAC | 53 | ||
| TCTGAA (SEQ ID NO: 42) | ||||
| Beta-2 microglobulin (B2M) primer | |
| (SEQ ID NO: 43) | |
| 5′-TGGGGGTGAGAATTGCTAAG-3′ | |
| ID-1 primer | |
| (SEQ ID NO: 44) | |
| 5′-CCTTCTCCTTCTCCTTCACC-3′ | |
| ID-5 primer | |
| (SEQ ID NO: 45) | |
| 5′-GTCCTCTATTCCGTCACCAT-3′ | |
| ID-20 primer | |
| (SEQ ID NO: 46) | |
| 5′-CTGCTTCTTCCTGGAACTCA-3′ |
| TABLE 2 |
| |
| Amino-C6-UUACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCCGA |
| TATGATTGCCGCTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 47) |
| TABLE 3 |
| Second strand synthesis and first PCR |
| Amplification handles |
| A_primer | ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| (SEQ ID NO: 48) | |
| B_dt20VN_primer | AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTT |
| TTTTTTTTVN (SEQ ID NO: 49) | |
| TABLE 4 |
| Oligos used for spatial transcriptomics |
| 5′ to 3′ | |
| Example 6 |
| Nimblegen 5′ to 3′ | |
| arrays with free 3′ | |
| end Array probes | |
| Probe1 (SEQ ID NO: 50) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| TCCGATATGATTGCCGCTTTTTTTTTTTTTTTTTTTTVN | |
| Probe2 (SEQ ID NO: 51) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TGAGCCGGGTTCATCTTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe3 (SEQ ID NO: 52) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| GAGGCACTCTGTTGGGATTTTTTTTTTTTTTTTTTTTVN | |
| Probe4 (SEQ ID NO: 53) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TGATTAGTCGCCATTCGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe5 (SEQ ID NO: 54) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| CTTGAGGGTAGATGTTTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe6 (SEQ ID NO: 55) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TGGCCAATACTGTTATCTTTTTTTTTTTTTTTTTTTTVN | |
| Probe7 (SEQ ID NO: 56) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| GCTACCCTGATTCGACCTTTTTTTTTTTTTTTTTTTTVN | |
| Probe8 (SEQ ID NO: 57) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| CCCACTTTCGCCGTAGTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe9 (SEQ ID NO: 58) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| GCAACTTTGAGCAAGATTTTTTTTTTTTTTTTTTTTTVN | |
| Probe10 (SEQ ID NO: 59) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| CCAATTCGGAATTCCGGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe11 (SEQ ID NO: 60) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| CGCCCAAGGTAATACATTTTTTTTTTTTTTTTTTTTTVN | |
| Probel2 (SEQ ID NO: 61) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| CGCATTTCCTATTCGAGTTTTTTTTTTTTTTTTTTTTVN | |
| Probel3 (SEQ ID NO: 62) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| TGCTAAATCTAACCGCCTTTTTTTTTTTTTTTTTTTTVN | |
| Probel4 (SEQ ID NO: 63) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| GAATTAAATTCTGATGGTTTTTTTTTTTTTTTTTTTTVN | |
| Probel5 (SEQ ID NO: 64) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| ATTACATAGGTGCTAAGTTTTTTTTTTTTTTTTTTTTVN | |
| Probel6 (SEQ ID NO: 65) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TTGACTTGCGCTCGCACTTTTTTTTTTTTTTTTTTTTVN | |
| Probel7 (SEQ ID NO: 66) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TAGTATCTCCCAAGTTCTTTTTTTTTTTTTTTTTTTTVN | |
| Probel8 (SEQ ID NO: 67) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| TGCGCCTGTAATCCGCATTTTTTTTTTTTTTTTTTTTVN | |
| Probel9 (SEQ ID NO: 68) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| CGCCACTCTTTAGGTAGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe20 (SEQ ID NO: 69) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| ATGCAAGTGATTGGCTTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe2l (SEQ ID NO: 70) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| CAAGCCACGTTTATACGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe22 (SEQ ID NO: 71) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| CCTGATTGCTGTATAACTTTTTTTTTTTTTTTTTTTTVN | |
| Probe23 (SEQ ID NO: 72) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| AGCGCATCTATCCTCTATTTTTTTTTTTTTTTTTTTTVN | |
| Probe24 (SEQ ID NO: 73) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| CCACGCGTAGGACTAGTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe25 (SEQ ID NO: 74) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| GACTAAGTATGTAGCGCTTTTTTTTTTTTTTTTTTTTVN | |
| Frame probe | |
| Layout1 (SEQ ID NO: 75) | AAATTTCGTCTGCTATCGCGCTTCTGTACC |
| Fluorescent marker probe | |
| PS_1 (SEQ ID NO: 76) | GGTACAGAAGCGCGATAGCAG-Cy3 |
| Second strand synthesis and | |
| first PCR Amplification handles | |
| A_primer (SEQ ID NO: 77) | ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| B_dt20VN primer | AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTT |
| (SEQ ID NO: 78) | TTVN |
| Custom sequencing primer | |
| B_r2 (SEQ ID NO: 79) | TCA GAC GTG TGC TCT TCC GAT CTT TTT TTT |
| TTT TTT TTT TTT T | |
| Example 7 |
| Nimblegen 3′ to | |
| 5′ arrays with free | |
| 5′ end Array probes | |
| Probe1 (SEQ ID NO: 80) | GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCATAT |
| CGGACAGATCGGAAGAGCGTAGTGTAG | |
| Probe2 (SEQ ID NO: 81) | GCGTTCAGAGTGGCAGTCGAGATCACAAGATGAACCCGG |
| CTCATAGATCGGAAGAGCGTAGTGTAG | |
| Probe3 (SEQ ID NO: 82) | GCGTTCAGAGTGGCAGTCGAGATCACTCCCAACAGAGTG |
| CCTCAAGATCGGAAGAGCGTAGTGTAG | |
| Probe4 (SEQ ID NO: 83) | GCGTTCAGAGTGGCAGTCGAGATCACCGAATGGCGACTA |
| ATCATAGATCGGAAGAGCGTAGTGTAG | |
| Probe5 (SEQ ID NO: 84) | GCGTTCAGAGTGGCAGTCGAGATCACAAACATCTACCCT |
| CAAGTAGATCGGAAGAGCGTAGTGTAG | |
| Probe6 (SEQ ID NO: 85) | GCGTTCAGAGTGGCAGTCGAGATCACGATAACAGTATTG |
| GCCATAGATCGGAAGAGCGTAGTGTAG | |
| Probe7 (SEQ ID NO: 86) | GCGTTCAGAGTGGCAGTCGAGATCACGGTCGAATCAGGG |
| TAGCGAGATCGGAAGAGCGTAGTGTAG | |
| Probe8 (SEQ ID NO: 87) | GCGTTCAGAGTGGCAGTCGAGATCACACTACGGCGAAAG |
| TGGGCAGATCGGAAGAGCGTAGTGTAG | |
| Probe9 (SEQ ID NO: 88) | GCGTTCAGAGTGGCAGTCGAGATCACATCTTGCTCAAAG |
| TTGCTAGATCGGAAGAGCGTAGTGTAG | |
| Probe10 (SEQ ID NO: 89) | GCGTTCAGAGTGGCAGTCGAGATCACCCGGAATTCCGAA |
| TTGGCAGATCGGAAGAGCGTAGTGTAG | |
| Probe11 (SEQ ID NO: 90) | GCGTTCAGAGTGGCAGTCGAGATCACATGTATTACCTTG |
| GGCGAAGATCGGAAGAGCGTAGTGTAG | |
| Probe12 (SEQ ID NO: 91) | GCGTTCAGAGTGGCAGTCGAGATCACCTCGAATAGGAAA |
| TGCGAAGATCGGAAGAGCGTAGTGTAG | |
| Probe13 (SEQ ID NO: 92) | GCGTTCAGAGTGGCAGTCGAGATCACGGCGGTTAGATTT |
| AGCAAAGATCGGAAGAGCGTAGTGTAG | |
| Probe14 (SEQ ID NO: 93) | GCGTTCAGAGTGGCAGTCGAGATCACCCATCAGAATTTA |
| ATTCCAGATCGGAAGAGCGTAGTGTAG | |
| Probe15 (SEQ ID NO: 94) | GCGTTCAGAGTGGCAGTCGAGATCACCTTAGCACCTATG |
| TAATGAGATCGGAAGAGCGTAGTGTAG | |
| Probe16 (SEQ ID NO: 95) | GCGTTCAGAGTGGCAGTCGAGATCACGTGCGAGCGCAAG |
| TCAATAGATCGGAAGAGCGTAGTGTAG | |
| Probe17 (SEQ ID NO: 96) | GCGTTCAGAGTGGCAGTCGAGATCACGAACTTGGGAGAT |
| ACTATAGATCGGAAGAGCGTAGTGTAG | |
| Probe18 (SEQ ID NO: 97) | GCGTTCAGAGTGGCAGTCGAGATCACTGCGGATTACAGG |
| CGCACAGATCGGAAGAGCGTAGTGTAG | |
| Probe19 (SEQ ID NO: 98) | GCGTTCAGAGTGGCAGTCGAGATCACCTACCTAAAGAGT |
| GGCGCAGATCGGAAGAGCGTAGTGTAG | |
| Probe20 (SEQ ID NO: 99) | GCGTTCAGAGTGGCAGTCGAGATCACAAGCCAATCACTT |
| GCATAAGATCGGAAGAGCGTAGTGTAG | |
| Probe21 (SEQ ID NO: 100) | GCGTTCAGAGTGGCAGTCGAGATCACCGTATAAACGTGG |
| CTTGGAGATCGGAAGAGCGTAGTGTAG | |
| Probe22 (SEQ ID NO: 101) | GCGTTCAGAGTGGCAGTCGAGATCACGTTATACAGCAAT |
| CAGGTAGATCGGAAGAGCGTAGTGTAG | |
| Probe23 (SEQ ID NO: 102) | GCGTTCAGAGTGGCAGTCGAGATCACTAGAGGATAGATG |
| CGCTGAGATCGGAAGAGCGTAGTGTAG | |
| Probe24 (SEQ ID NO: 103) | GCGTTCAGAGTGGCAGTCGAGATCACACTAGTCCTACGC |
| GTGGAAGATCGGAAGAGCGTAGTGTAG | |
| Probe25 (SEQ ID NO: 104) | GCGTTCAGAGTGGCAGTCGAGATCACGCGCTACATACTT |
| AGTCGAGATCGGAAGAGCGTAGTGTAG | |
| Frame probe | |
| Layout1 (SEQ ID NO: 105) | AAATTTCGTCTGCTATCGCGCTTCTGTACC |
| Capture probe | |
| LP_Poly-dTVN (SEQ ID NO: 106) | GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTTTTT |
| TTTTVN | |
| Amplification handle probe | |
| A-handle (SEQ ID NO: 107) | ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| Second strand synthesis | |
| and first PCR | |
| amplification handles | |
| A_primer (SEQ ID NO: 108) | ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| B_dt20VN_primer | AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTT |
| (SEQ ID NO: 109) | TTVN |
| Second PCR | |
| A_primer (SEQ ID NO: 110) | ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| B_primer (SEQ ID NO: 111) | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT |
| Example 9 |
| Template switching | |
| Templateswitch_longB | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATrGr |
| (SEQ ID NO: 112) | GrG |
| TABLE 5 |
| Nimblegen 5′ to 3′ arrays with free 3′ end Array probes |
| 5′ to 3′ | |
| Probe1 (SEQ ID NO: 113) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| TCCGATATGATTGCCGCTTTTTTTTTTTTTTTTTTTTVN | |
| Probe2 (SEQ ID NO: 114) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TGAGCCGGGTTCATCTTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe3 (SEQ ID NO: 115) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| GAGGCACTCTGTTGGGATTTTTTTTTTTTTTTTTTTTVN | |
| Probe4 (SEQ ID NO: 116) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TGATTAGTCGCCATTCGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe5 (SEQ ID NO: 117) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| CTTGAGGGTAGATGTTTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe6 (SEQ ID NO: 118) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TGGCCAATACTGTTATCTTTTTTTTTTTTTTTTTTTTVN | |
| Probe7 (SEQ ID NO: 119) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| GCTACCCTGATTCGACCTTTTTTTTTTTTTTTTTTTTVN | |
| Probe8 (SEQ ID NO: 120) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| CCCACTTTCGCCGTAGTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe9 (SEQ ID NO: 121) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| GCAACTTTGAGCAAGATTTTTTTTTTTTTTTTTTTTTVN | |
| Probe10 (SEQ ID NO: 122) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| CCAATTCGGAATTCCGGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe11 (SEQ ID NO: 123) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| CGCCCAAGGTAATACATTTTTTTTTTTTTTTTTTTTTVN | |
| Probe12 (SEQ ID NO: 124) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| CGCATTTCCTATTCGAGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe13 (SEQ ID NO: 125) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| TGCTAAATCTAACCGCCTTTTTTTTTTTTTTTTTTTTVN | |
| Probe14 (SEQ ID NO: 126) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| GAATTAAATTCTGATGGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe15 (SEQ ID NO: 127) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| ATTACATAGGTGCTAAGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe16 (SEQ ID NO: 128) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TTGACTTGCGCTCGCACTTTTTTTTTTTTTTTTTTTTVN | |
| Probe17 (SEQ ID NO: 129) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| TAGTATCTCCCAAGTTCTTTTTTTTTTTTTTTTTTTTVN | |
| Probe18 (SEQ ID NO: 130) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| TGCGCCTGTAATCCGCATTTTTTTTTTTTTTTTTTTTVN | |
| Probe19 (SEQ ID NO: 131) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTG |
| CGCCACTCTTTAGGTAGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe20 (SEQ ID NO: 132) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| ATGCAAGTGATTGGCTTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe21 (SEQ ID NO: 133) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| CAAGCCACGTTTATACGTTTTTTTTTTTTTTTTTTTTVN | |
| Probe22 (SEQ ID NO: 134) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTA |
| CCTGATTGCTGTATAACTTTTTTTTTTTTTTTTTTTTVN | |
| Probe23 (SEQ ID NO: 135) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| AGCGCATCTATCCTCTATTTTTTTTTTTTTTTTTTTTVN | |
| Probe24 (SEQ ID NO: 136) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTT |
| CCACGCGTAGGACTAGTTTTTTTTTTTTTTTTTTTTTVN | |
| Probe25 (SEQ ID NO: 137) | UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTC |
| GACTAAGTATGTAGCGCTTTTTTTTTTTTTTTTTTTTVN | |
| Frame probe (SEQ ID NO: 138) | AAATTTCGTCTGCTATCGCGCTTCTGTACC |
| Fluorescent marker probe | GGTACAGAAGCGCGATAGCAG-Cy3 |
| (SEQ ID NO: 139) | |
Claims (57)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/353,937 USRE50065E1 (en) | 2012-10-17 | 2013-10-16 | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
Applications Claiming Priority (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB1218654.0A GB201218654D0 (en) | 2012-10-17 | 2012-10-17 | Methods and product |
| GB1218654 | 2012-10-17 | ||
| GB201304585A GB201304585D0 (en) | 2013-03-14 | 2013-03-14 | Methods and product |
| GB1304585 | 2013-03-14 | ||
| US16/353,937 USRE50065E1 (en) | 2012-10-17 | 2013-10-16 | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| PCT/EP2013/071645 WO2014060483A1 (en) | 2012-10-17 | 2013-10-16 | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US14/434,274 US9593365B2 (en) | 2012-10-17 | 2013-10-16 | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| USRE50065E1 true USRE50065E1 (en) | 2024-07-30 |
Family
ID=49474395
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/434,274 Ceased US9593365B2 (en) | 2012-10-17 | 2013-10-16 | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US16/353,937 Active USRE50065E1 (en) | 2012-10-17 | 2013-10-16 | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/434,274 Ceased US9593365B2 (en) | 2012-10-17 | 2013-10-16 | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US9593365B2 (en) |
| EP (4) | EP3511423B2 (en) |
| CA (1) | CA2886974C (en) |
| DK (1) | DK3511423T4 (en) |
| ES (1) | ES3019910T3 (en) |
| WO (1) | WO2014060483A1 (en) |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12110541B2 (en) | 2020-02-03 | 2024-10-08 | 10X Genomics, Inc. | Methods for preparing high-resolution spatial arrays |
| US12129516B2 (en) | 2020-02-07 | 2024-10-29 | 10X Genomics, Inc. | Quantitative and automated permeabilization performance evaluation for spatial transcriptomics |
| US12157124B2 (en) | 2019-11-06 | 2024-12-03 | 10X Genomics, Inc. | Imaging system hardware |
| US12223751B2 (en) | 2021-12-20 | 2025-02-11 | 10X Genomics, Inc. | Self-test for imaging device |
| US12228544B2 (en) | 2020-03-04 | 2025-02-18 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
| US12234505B2 (en) | 2010-04-05 | 2025-02-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12241890B2 (en) | 2019-12-23 | 2025-03-04 | 10X Genomics, Inc. | Methods for generating barcoded nucleic acid molecules using fixed cells |
| US12241060B2 (en) | 2020-12-21 | 2025-03-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US12249085B2 (en) | 2020-09-18 | 2025-03-11 | 10X Genomics, Inc. | Sample handling apparatus and image registration methods |
| US12265079B1 (en) | 2020-06-02 | 2025-04-01 | 10X Genomics, Inc. | Systems and methods for detecting analytes from captured single biological particles |
| US12270077B2 (en) | 2018-08-28 | 2025-04-08 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12275988B2 (en) | 2021-11-10 | 2025-04-15 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| US12281357B1 (en) | 2020-02-14 | 2025-04-22 | 10X Genomics, Inc. | In situ spatial barcoding |
| US12287264B2 (en) | 2021-02-19 | 2025-04-29 | 10X Genomics, Inc. | Modular assay support devices |
| US12286673B2 (en) | 2020-02-05 | 2025-04-29 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US12297486B2 (en) | 2020-01-24 | 2025-05-13 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US12365935B2 (en) | 2021-05-06 | 2025-07-22 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| US12365942B2 (en) | 2020-01-13 | 2025-07-22 | 10X Genomics, Inc. | Methods of decreasing background on a spatial array |
| US12385083B2 (en) | 2018-12-10 | 2025-08-12 | 10X Genomics, Inc. | Methods of using master / copy arrays for spatial detection |
| US12399123B1 (en) | 2020-02-14 | 2025-08-26 | 10X Genomics, Inc. | Spatial targeting of analytes |
| US12405264B2 (en) | 2020-01-17 | 2025-09-02 | 10X Genomics, Inc. | Electrophoretic system and method for analyte capture |
| US12416603B2 (en) | 2020-05-19 | 2025-09-16 | 10X Genomics, Inc. | Electrophoresis cassettes and instrumentation |
| US12435363B1 (en) | 2020-06-10 | 2025-10-07 | 10X Genomics, Inc. | Materials and methods for spatial transcriptomics |
| US12442045B2 (en) | 2019-05-30 | 2025-10-14 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| US12508590B2 (en) | 2020-06-10 | 2025-12-30 | 10X Genomics, Inc. | Fluid delivery methods |
| US12553805B2 (en) | 2021-08-02 | 2026-02-17 | 10X Genomics, Inc. | Methods of preserving a biological sample |
| US12553898B1 (en) | 2020-08-10 | 2026-02-17 | 10X Genomics, Inc. | Fluorescent hybridization of antibody-oligonucleotide for multiplexing and signal amplification |
| US12566113B2 (en) | 2019-12-23 | 2026-03-03 | 10X Genomics, Inc. | Reversible fixing reagents and methods of use thereof |
| US12571029B1 (en) | 2022-11-09 | 2026-03-10 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of multiple analytes in a biological sample |
Families Citing this family (262)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8835358B2 (en) | 2009-12-15 | 2014-09-16 | Cellular Research, Inc. | Digital counting of individual molecules by stochastic attachment of diverse labels |
| DK2556171T3 (en) | 2010-04-05 | 2015-12-14 | Prognosys Biosciences Inc | Spatially CODED BIOLOGICAL ASSAYS |
| US20190300945A1 (en) | 2010-04-05 | 2019-10-03 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| GB201106254D0 (en) | 2011-04-13 | 2011-05-25 | Frisen Jonas | Method and product |
| CA2865575C (en) | 2012-02-27 | 2024-01-16 | Cellular Research, Inc. | Compositions and kits for molecular counting |
| KR102090851B1 (en) | 2012-08-14 | 2020-03-19 | 10엑스 제노믹스, 인크. | Microcapsule compositions and methods |
| US11591637B2 (en) | 2012-08-14 | 2023-02-28 | 10X Genomics, Inc. | Compositions and methods for sample processing |
| US10400280B2 (en) | 2012-08-14 | 2019-09-03 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10323279B2 (en) | 2012-08-14 | 2019-06-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US9701998B2 (en) | 2012-12-14 | 2017-07-11 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| WO2014060483A1 (en) | 2012-10-17 | 2014-04-24 | Spatial Transcriptomics Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US10533221B2 (en) | 2012-12-14 | 2020-01-14 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US9868979B2 (en) | 2013-06-25 | 2018-01-16 | Prognosys Biosciences, Inc. | Spatially encoded biological assays using a microfluidic device |
| ES2857908T3 (en) | 2013-08-28 | 2021-09-29 | Becton Dickinson Co | Massively parallel single cell analysis |
| US10395758B2 (en) | 2013-08-30 | 2019-08-27 | 10X Genomics, Inc. | Sequencing methods |
| US9834814B2 (en) * | 2013-11-22 | 2017-12-05 | Agilent Technologies, Inc. | Spatial molecular barcoding of in situ nucleic acids |
| US9824068B2 (en) | 2013-12-16 | 2017-11-21 | 10X Genomics, Inc. | Methods and apparatus for sorting data |
| AU2015261440A1 (en) * | 2014-05-14 | 2017-01-05 | Barbara BURWINKEL | Synthesis of double-stranded nucleic acids |
| KR102531677B1 (en) | 2014-06-26 | 2023-05-10 | 10엑스 제노믹스, 인크. | Methods of analyzing nucleic acids from individual cells or cell populations |
| MX2016016904A (en) | 2014-06-26 | 2017-03-27 | 10X Genomics Inc | NUCLEIC ACID SEQUENCE ANALYSIS. |
| US12312640B2 (en) | 2014-06-26 | 2025-05-27 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| GB201411624D0 (en) | 2014-06-30 | 2014-08-13 | Ge Healthcare Uk Ltd | Spatial molecular profiling of solid biological masses and profile storage |
| US9897791B2 (en) | 2014-10-16 | 2018-02-20 | Illumina, Inc. | Optical scanning systems for in situ genetic analysis |
| KR102321863B1 (en) | 2015-01-12 | 2021-11-08 | 10엑스 제노믹스, 인크. | Method and system for preparing nucleic acid sequencing library and library prepared using same |
| WO2016138496A1 (en) | 2015-02-27 | 2016-09-01 | Cellular Research, Inc. | Spatially addressable molecular barcoding |
| ES2934982T3 (en) | 2015-03-30 | 2023-02-28 | Becton Dickinson Co | Methods for encoding with combinatorial barcodes |
| EP4282977B1 (en) | 2015-04-10 | 2024-06-05 | 10x Genomics Sweden AB | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20180057873A1 (en) * | 2015-04-17 | 2018-03-01 | Centrillion Technology Holdings Corporation | Methods for performing spatial profiling of biological materials |
| US11390914B2 (en) | 2015-04-23 | 2022-07-19 | Becton, Dickinson And Company | Methods and compositions for whole transcriptome amplification |
| AU2016297513B2 (en) | 2015-07-17 | 2021-02-25 | Board Of Regents, The University Of Texas System | Simultaneous quantification of a plurality of proteins in a user-defined region of a cross-sectioned tissue |
| EP3325650B1 (en) | 2015-07-17 | 2024-01-03 | Nanostring Technologies, Inc. | Simultaneous quantification of gene expression in a user-defined region of a cross-sectioned tissue |
| CA3242290A1 (en) | 2015-07-27 | 2017-02-02 | Illumina, Inc. | Spatial mapping of nucleic acid sequence information |
| CN108026524A (en) | 2015-09-11 | 2018-05-11 | 赛卢拉研究公司 | Method and composition for nucleic acid library standardization |
| US11371094B2 (en) | 2015-11-19 | 2022-06-28 | 10X Genomics, Inc. | Systems and methods for nucleic acid processing using degenerate nucleotides |
| DK3882357T3 (en) | 2015-12-04 | 2022-08-29 | 10X Genomics Inc | Methods and compositions for the analysis of nucleic acids |
| US10301677B2 (en) | 2016-05-25 | 2019-05-28 | Cellular Research, Inc. | Normalization of nucleic acid libraries |
| US10640763B2 (en) | 2016-05-31 | 2020-05-05 | Cellular Research, Inc. | Molecular indexing of internal sequences |
| US10202641B2 (en) | 2016-05-31 | 2019-02-12 | Cellular Research, Inc. | Error correction in amplification of samples |
| KR102363716B1 (en) | 2016-09-26 | 2022-02-18 | 셀룰러 리서치, 인크. | Determination of protein expression using reagents having barcoded oligonucleotide sequences |
| GB201619458D0 (en) | 2016-11-17 | 2017-01-04 | Spatial Transcriptomics Ab | Method for spatial tagging and analysing nucleic acids in a biological specimen |
| US10815525B2 (en) | 2016-12-22 | 2020-10-27 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10550429B2 (en) | 2016-12-22 | 2020-02-04 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12264411B2 (en) | 2017-01-30 | 2025-04-01 | 10X Genomics, Inc. | Methods and systems for analysis |
| CN117512066A (en) | 2017-01-30 | 2024-02-06 | 10X基因组学有限公司 | Methods and systems for droplet-based single cell barcoding |
| US11319583B2 (en) | 2017-02-01 | 2022-05-03 | Becton, Dickinson And Company | Selective amplification using blocking oligonucleotides |
| US10995333B2 (en) | 2017-02-06 | 2021-05-04 | 10X Genomics, Inc. | Systems and methods for nucleic acid preparation |
| WO2018226293A1 (en) | 2017-06-05 | 2018-12-13 | Becton, Dickinson And Company | Sample indexing for single cells |
| US10837047B2 (en) | 2017-10-04 | 2020-11-17 | 10X Genomics, Inc. | Compositions, methods, and systems for bead formation using improved polymers |
| EP4241882B1 (en) | 2017-10-27 | 2025-04-30 | 10X Genomics, Inc. | Methods for sample preparation and analysis |
| SG11201913654QA (en) | 2017-11-15 | 2020-01-30 | 10X Genomics Inc | Functionalized gel beads |
| CN118818037A (en) | 2017-12-12 | 2024-10-22 | 10X基因组学有限公司 | Systems and methods for single cell processing |
| EP3728631A1 (en) | 2017-12-22 | 2020-10-28 | 10X Genomics, Inc. | Systems and methods for processing nucleic acid molecules from one or more cells |
| CN112005115A (en) | 2018-02-12 | 2020-11-27 | 10X基因组学有限公司 | Methods to characterize multiple analytes from single cells or cell populations |
| WO2019157445A1 (en) | 2018-02-12 | 2019-08-15 | Nanostring Technologies, Inc. | Biomolecular probes and methods of detecting gene and protein expression |
| US11639928B2 (en) | 2018-02-22 | 2023-05-02 | 10X Genomics, Inc. | Methods and systems for characterizing analytes from individual cells or cell populations |
| WO2019169028A1 (en) | 2018-02-28 | 2019-09-06 | 10X Genomics, Inc. | Transcriptome sequencing through random ligation |
| EP3788146A4 (en) | 2018-05-02 | 2022-06-01 | The General Hospital Corporation | HIGH RESOLUTION SPACE MACROMOLECULES ABUNDANCE ASSESSMENT |
| WO2019213237A1 (en) | 2018-05-03 | 2019-11-07 | Becton, Dickinson And Company | Molecular barcoding on opposite transcript ends |
| WO2019213294A1 (en) | 2018-05-03 | 2019-11-07 | Becton, Dickinson And Company | High throughput multiomics sample analysis |
| WO2019217758A1 (en) | 2018-05-10 | 2019-11-14 | 10X Genomics, Inc. | Methods and systems for molecular library generation |
| US11932899B2 (en) | 2018-06-07 | 2024-03-19 | 10X Genomics, Inc. | Methods and systems for characterizing nucleic acid molecules |
| US11703427B2 (en) | 2018-06-25 | 2023-07-18 | 10X Genomics, Inc. | Methods and systems for cell and bead processing |
| CA3105949A1 (en) | 2018-07-18 | 2020-01-23 | Max-Delbruck-Centrum Fur Molekulare Medizin In Der Helmholtz-Gemeinschaft | Method for analyzing cell sample heterogeneity |
| US12188014B1 (en) | 2018-07-25 | 2025-01-07 | 10X Genomics, Inc. | Compositions and methods for nucleic acid processing using blocking agents |
| US20200032335A1 (en) | 2018-07-27 | 2020-01-30 | 10X Genomics, Inc. | Systems and methods for metabolome analysis |
| US12163179B2 (en) | 2018-08-03 | 2024-12-10 | 10X Gemomics, Inc. | Methods and systems to minimize barcode exchange |
| US12065688B2 (en) | 2018-08-20 | 2024-08-20 | 10X Genomics, Inc. | Compositions and methods for cellular processing |
| WO2020041148A1 (en) | 2018-08-20 | 2020-02-27 | 10X Genomics, Inc. | Methods and systems for detection of protein-dna interactions using proximity ligation |
| US20210317524A1 (en) | 2018-08-28 | 2021-10-14 | 10X Genomics, Inc. | Resolving spatial arrays |
| CN113767175B (en) | 2018-08-28 | 2025-07-25 | 10X基因组学股份有限公司 | Increasing spatial array resolution |
| CN118853827A (en) | 2018-10-01 | 2024-10-29 | 贝克顿迪金森公司 | Determine 5' transcript sequence |
| CN112969789A (en) | 2018-11-08 | 2021-06-15 | 贝克顿迪金森公司 | Single cell whole transcriptome analysis using random priming |
| US11208648B2 (en) | 2018-11-16 | 2021-12-28 | International Business Machines Corporation | Determining position and transcriptomes of biological cells |
| US12529094B2 (en) | 2018-12-10 | 2026-01-20 | 10X Genomics, Inc. | Imaging system hardware |
| US11459607B1 (en) | 2018-12-10 | 2022-10-04 | 10X Genomics, Inc. | Systems and methods for processing-nucleic acid molecules from a single cell using sequential co-partitioning and composite barcodes |
| GB201820341D0 (en) | 2018-12-13 | 2019-01-30 | 10X Genomics Inc | Method for transposase-mediated spatial tagging and analysing genomic DNA in a biological specimen |
| GB201820300D0 (en) | 2018-12-13 | 2019-01-30 | 10X Genomics Inc | Method for spatial tagging and analysing genomic DNA in a biological specimen |
| EP3894552B1 (en) | 2018-12-13 | 2026-01-28 | Becton, Dickinson and Company | Selective extension in single cell whole transcriptome analysis |
| CN113423841A (en) | 2018-12-13 | 2021-09-21 | Dna斯克瑞普特公司 | Direct oligonucleotide synthesis on cells and biomolecules |
| US12286622B2 (en) | 2018-12-31 | 2025-04-29 | Auransa Inc. | Genomics-based identification and characterization of rare cell types |
| US11926867B2 (en) | 2019-01-06 | 2024-03-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11649485B2 (en) | 2019-01-06 | 2023-05-16 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| CA3125920A1 (en) * | 2019-01-07 | 2020-07-16 | Agilent Technologies, Inc. | Compositions and methods for genomic dna and gene expression analysis in single cells |
| US12169198B2 (en) | 2019-01-08 | 2024-12-17 | 10X Genomics, Inc. | Systems and methods for sample analysis |
| US11845983B1 (en) | 2019-01-09 | 2023-12-19 | 10X Genomics, Inc. | Methods and systems for multiplexing of droplet based assays |
| ES2945227T3 (en) | 2019-01-23 | 2023-06-29 | Becton Dickinson Co | Antibody Associated Oligonucleotides |
| US12529092B2 (en) | 2019-01-28 | 2026-01-20 | The Broad Institute, Inc. | In-situ spatial transcriptomics |
| CN110033474B (en) * | 2019-01-30 | 2021-09-03 | 西安天伟电子系统工程有限公司 | Target detection method, target detection device, computer equipment and storage medium |
| US11851683B1 (en) | 2019-02-12 | 2023-12-26 | 10X Genomics, Inc. | Methods and systems for selective analysis of cellular samples |
| US11467153B2 (en) | 2019-02-12 | 2022-10-11 | 10X Genomics, Inc. | Methods for processing nucleic acid molecules |
| WO2020167862A1 (en) | 2019-02-12 | 2020-08-20 | 10X Genomics, Inc. | Systems and methods for transfer of reagents between droplets |
| WO2020167866A1 (en) | 2019-02-12 | 2020-08-20 | 10X Genomics, Inc. | Systems and methods for transposon loading |
| WO2020168013A1 (en) | 2019-02-12 | 2020-08-20 | 10X Genomics, Inc. | Methods for processing nucleic acid molecules |
| US12305239B2 (en) | 2019-02-12 | 2025-05-20 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| US12275993B2 (en) | 2019-02-12 | 2025-04-15 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| EP3924506A1 (en) | 2019-02-14 | 2021-12-22 | Becton Dickinson and Company | Hybrid targeted and whole transcriptome amplification |
| US11655499B1 (en) | 2019-02-25 | 2023-05-23 | 10X Genomics, Inc. | Detection of sequence elements in nucleic acid molecules |
| EP3931354A1 (en) | 2019-02-28 | 2022-01-05 | 10X Genomics, Inc. | Profiling of biological analytes with spatially barcoded oligonucleotide arrays |
| WO2020185791A1 (en) | 2019-03-11 | 2020-09-17 | 10X Genomics, Inc. | Systems and methods for processing optically tagged beads |
| EP3938538A1 (en) * | 2019-03-15 | 2022-01-19 | 10X Genomics, Inc. | Methods for using spatial arrays for single cell sequencing |
| WO2020198071A1 (en) | 2019-03-22 | 2020-10-01 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| CN114450401A (en) | 2019-06-21 | 2022-05-06 | 赛默飞世尔科技波罗的海封闭股份公司 | Oligonucleotide-tethered nucleotide triphosphates useful for labeling nucleic acids for making next generation sequencing libraries |
| US20210024919A1 (en) * | 2019-07-22 | 2021-01-28 | Massachusetts Institute Of Technology | Functionalized solid support |
| CN114051534B (en) | 2019-07-22 | 2025-02-21 | 贝克顿迪金森公司 | Single-cell chromatin immunoprecipitation sequencing assay |
| US12235262B1 (en) | 2019-09-09 | 2025-02-25 | 10X Genomics, Inc. | Methods and systems for single cell protein analysis |
| CN114761992B (en) | 2019-10-01 | 2023-08-08 | 10X基因组学有限公司 | Systems and methods for identifying morphological patterns in tissue samples |
| EP4055185A1 (en) | 2019-11-08 | 2022-09-14 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| CN114729350A (en) | 2019-11-08 | 2022-07-08 | 贝克顿迪金森公司 | Obtaining full-length V (D) J information for immunohistorian sequencing using random priming |
| EP4025711A2 (en) | 2019-11-08 | 2022-07-13 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| ES3024383T3 (en) | 2019-11-13 | 2025-06-04 | 10X Genomics Inc | Generating capture probes for spatial analysis |
| CA3158603A1 (en) | 2019-11-18 | 2021-05-27 | Neil Ira WEISENFELD | Systems and methods for tissue classification |
| AU2020388573A1 (en) * | 2019-11-21 | 2022-06-23 | 10X Genomics, Inc, | Spatial analysis of analytes |
| CN115023734B (en) | 2019-11-22 | 2023-10-20 | 10X基因组学有限公司 | Systems and methods for spatial analysis of analytes using fiducial alignment |
| DK3891300T3 (en) | 2019-12-23 | 2023-05-22 | 10X Genomics Inc | METHODS FOR SPATIAL ANALYSIS USING RNA TEMPLATE LIGATION |
| EP4628596A3 (en) | 2020-01-10 | 2025-12-31 | 10X Genomics, Inc. | METHOD FOR DETERMINING THE POSITION OF A TARGET NUCLEAN ACID IN A BIOLOGICAL SAMPLE |
| EP4090763B1 (en) | 2020-01-13 | 2024-12-04 | Becton Dickinson and Company | Methods and compositions for quantitation of proteins and rna |
| US11732299B2 (en) | 2020-01-21 | 2023-08-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US11702693B2 (en) | 2020-01-21 | 2023-07-18 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| ES2993319T3 (en) | 2020-01-29 | 2024-12-27 | Becton Dickinson Co | Barcoded wells for spatial mapping of single cells through sequencing |
| US11821035B1 (en) | 2020-01-29 | 2023-11-21 | 10X Genomics, Inc. | Compositions and methods of making gene expression libraries |
| US12076701B2 (en) | 2020-01-31 | 2024-09-03 | 10X Genomics, Inc. | Capturing oligonucleotides in spatial transcriptomics |
| US11898205B2 (en) | 2020-02-03 | 2024-02-13 | 10X Genomics, Inc. | Increasing capture efficiency of spatial assays |
| US12112833B2 (en) | 2020-02-04 | 2024-10-08 | 10X Genomics, Inc. | Systems and methods for index hopping filtering |
| US11835462B2 (en) | 2020-02-11 | 2023-12-05 | 10X Genomics, Inc. | Methods and compositions for partitioning a biological sample |
| WO2021163630A1 (en) | 2020-02-13 | 2021-08-19 | 10X Genomics, Inc. | Systems and methods for joint interactive visualization of gene expression and dna chromatin accessibility |
| CN115052995B (en) * | 2020-02-14 | 2025-05-06 | 索尼集团公司 | Analytical method, analytical system and analytical surface |
| WO2021168278A1 (en) | 2020-02-20 | 2021-08-26 | 10X Genomics, Inc. | METHODS TO COMBINE FIRST AND SECOND STRAND cDNA SYNTHESIS FOR SPATIAL ANALYSIS |
| CN116157533A (en) | 2020-02-21 | 2023-05-23 | 10X基因组学有限公司 | Capture Genetic Targets Using Hybridization |
| JP2023514749A (en) | 2020-02-21 | 2023-04-07 | 10エックス ジェノミクス インコーポレイテッド | Methods and compositions for integrated in situ spatial assays |
| US11891654B2 (en) | 2020-02-24 | 2024-02-06 | 10X Genomics, Inc. | Methods of making gene expression libraries |
| EP4111168A1 (en) | 2020-02-25 | 2023-01-04 | Becton Dickinson and Company | Bi-specific probes to enable the use of single-cell samples as single color compensation control |
| US11926863B1 (en) | 2020-02-27 | 2024-03-12 | 10X Genomics, Inc. | Solid state single cell method for analyzing fixed biological cells |
| ES3014967T3 (en) | 2020-04-22 | 2025-04-28 | 10X Genomics Inc | Methods for spatial analysis using targeted rna depletion |
| US20230265491A1 (en) * | 2020-05-04 | 2023-08-24 | 10X Genomics, Inc. | Spatial transcriptomic transfer modes |
| US11851700B1 (en) | 2020-05-13 | 2023-12-26 | 10X Genomics, Inc. | Methods, kits, and compositions for processing extracellular molecules |
| CN115605614A (en) | 2020-05-14 | 2023-01-13 | 贝克顿迪金森公司(Us) | Primers for immune repertoire profiling |
| EP4153776B1 (en) | 2020-05-22 | 2025-03-05 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| WO2021237056A1 (en) * | 2020-05-22 | 2021-11-25 | 10X Genomics, Inc. | Rna integrity analysis in a biological sample |
| EP4414459B1 (en) | 2020-05-22 | 2025-09-03 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| WO2021242834A1 (en) | 2020-05-26 | 2021-12-02 | 10X Genomics, Inc. | Method for resetting an array |
| EP4025692A2 (en) | 2020-06-02 | 2022-07-13 | 10X Genomics, Inc. | Nucleic acid library methods |
| WO2021247593A1 (en) | 2020-06-02 | 2021-12-09 | Becton, Dickinson And Company | Oligonucleotides and beads for 5 prime gene expression assay |
| EP4158054B1 (en) | 2020-06-02 | 2025-04-16 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
| US12031177B1 (en) | 2020-06-04 | 2024-07-09 | 10X Genomics, Inc. | Methods of enhancing spatial resolution of transcripts |
| EP4421186B1 (en) | 2020-06-08 | 2025-08-13 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| WO2021252591A1 (en) | 2020-06-10 | 2021-12-16 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
| US20230279474A1 (en) | 2020-06-10 | 2023-09-07 | 10X Genomics, Inc. | Methods for spatial analysis using blocker oligonucleotides |
| EP4450639B1 (en) | 2020-06-25 | 2025-10-15 | 10X Genomics, Inc. | Spatial analysis of dna methylation |
| US12168801B1 (en) | 2020-07-02 | 2024-12-17 | 10X Genomics, Inc. | Hybrid/capture probe designs for full-length cDNA |
| US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US11981960B1 (en) | 2020-07-06 | 2024-05-14 | 10X Genomics, Inc. | Spatial analysis utilizing degradable hydrogels |
| US12209280B1 (en) | 2020-07-06 | 2025-01-28 | 10X Genomics, Inc. | Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis |
| US11932901B2 (en) | 2020-07-13 | 2024-03-19 | Becton, Dickinson And Company | Target enrichment using nucleic acid probes for scRNAseq |
| EP4182472A1 (en) | 2020-07-15 | 2023-05-24 | DNA Script | Massively parallel enzymatic synthesis of polynucleotides |
| US20230287475A1 (en) | 2020-07-31 | 2023-09-14 | 10X Genomics, Inc. | De-crosslinking compounds and methods of use for spatial analysis |
| US12391940B2 (en) | 2020-07-31 | 2025-08-19 | Becton, Dickinson And Company | Single cell assay for transposase-accessible chromatin |
| EP4121561A4 (en) | 2020-08-06 | 2024-04-17 | Singular Genomics Systems, Inc. | METHODS FOR IN SITU TRANSCRIPTOMICS AND PROTEOMICS |
| EP4121557A4 (en) | 2020-08-06 | 2024-05-01 | Singular Genomics Systems, Inc. | Spatial sequencing |
| US11981958B1 (en) | 2020-08-20 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using DNA capture |
| WO2022060798A1 (en) | 2020-09-15 | 2022-03-24 | 10X Genomics, Inc. | Methods of releasing an extended capture probe from a substrate and uses of the same |
| EP4214333A1 (en) | 2020-09-16 | 2023-07-26 | 10X Genomics, Inc. | Methods of determining the location of an analyte in a biological sample using a plurality of wells |
| AU2021343507A1 (en) | 2020-09-18 | 2023-04-06 | 10X Genomics, Inc. | Sample handling apparatus and fluid delivery methods |
| US11926822B1 (en) | 2020-09-23 | 2024-03-12 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| WO2022081643A2 (en) | 2020-10-13 | 2022-04-21 | 10X Genomics, Inc. | Compositions and methods for generating recombinant antigen binding molecules from single cells |
| EP4575500A3 (en) | 2020-10-22 | 2025-08-13 | 10x Genomics, Inc. | Methods for spatial analysis using rolling circle amplification |
| US12084715B1 (en) | 2020-11-05 | 2024-09-10 | 10X Genomics, Inc. | Methods and systems for reducing artifactual antisense products |
| US12480158B1 (en) | 2020-11-05 | 2025-11-25 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| CN116829733A (en) | 2020-11-06 | 2023-09-29 | 10X基因组学有限公司 | Compositions and methods for binding analytes to capture probes |
| AU2021385065A1 (en) | 2020-11-18 | 2023-06-15 | 10X Genomics, Inc. | Methods and compositions for analyzing immune infiltration in cancer stroma to predict clinical outcome |
| US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
| WO2022109343A1 (en) | 2020-11-20 | 2022-05-27 | Becton, Dickinson And Company | Profiling of highly expressed and lowly expressed proteins |
| EP4012046A1 (en) | 2020-12-11 | 2022-06-15 | 10X Genomics, Inc. | Methods and compositions for multimodal in situ analysis |
| EP4263859A1 (en) | 2020-12-15 | 2023-10-25 | Becton, Dickinson and Company | Single cell secretome analysis |
| CN112522371A (en) * | 2020-12-21 | 2021-03-19 | 广州基迪奥生物科技有限公司 | Analysis method of spatial transcriptome sequencing data |
| US20240076723A1 (en) | 2020-12-30 | 2024-03-07 | 10X Genomics, Inc. | Cleavage of capture probes for spatial analysis |
| WO2022147005A1 (en) | 2020-12-30 | 2022-07-07 | 10X Genomics, Inc. | Methods for analyte capture determination |
| ES2993714T3 (en) | 2020-12-30 | 2025-01-07 | 10X Genomics Inc | Molecular array generation using photoresist |
| US12576400B2 (en) | 2021-01-08 | 2026-03-17 | Cellanome, Inc. | Methods for incubating and analyzing a cell in a compartment of a fluidic device |
| MX2023007842A (en) | 2021-01-08 | 2023-09-19 | Cellanome Inc | Devices and methods for analyzing biological samples. |
| US20220220544A1 (en) * | 2021-01-08 | 2022-07-14 | Agilent Technologies, Inc. | Spatial nucleic acid detection using oligonucleotide microarrays |
| US12398262B1 (en) | 2021-01-22 | 2025-08-26 | 10X Genomics, Inc. | Triblock copolymer-based cell stabilization and fixation system and methods of use thereof |
| AU2022212231A1 (en) | 2021-01-29 | 2023-08-03 | 10X Genomics, Inc. | Method for transposase mediated spatial tagging and analyzing genomic dna in a biological sample |
| EP4298244A1 (en) | 2021-02-23 | 2024-01-03 | 10X Genomics, Inc. | Probe-based analysis of nucleic acids and proteins |
| WO2022198068A1 (en) | 2021-03-18 | 2022-09-22 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| EP4319792B1 (en) | 2021-04-05 | 2025-09-03 | 10X Genomics, Inc. | Recombinant ligase composition and uses thereof |
| EP4305196B1 (en) | 2021-04-14 | 2025-04-02 | 10X Genomics, Inc. | Methods of measuring mislocalization of an analyte |
| WO2022226057A1 (en) | 2021-04-20 | 2022-10-27 | 10X Genomics, Inc. | Methods for assessing sample quality prior to spatial analysis using templated ligation |
| EP4334706A4 (en) | 2021-05-05 | 2025-08-06 | Singular Genomics Systems Inc | Multiomic analysis device and methods of use thereof |
| EP4341429A1 (en) | 2021-05-19 | 2024-03-27 | Max-Delbrück-Centrum für Molekulare Medizin in der Helmholtz-Gemeinschaft | Method and system for 3d reconstruction of tissue gene expression data |
| EP4582555A3 (en) | 2021-06-03 | 2025-10-22 | 10X Genomics, Inc. | Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis |
| US20220403462A1 (en) | 2021-06-18 | 2022-12-22 | Miltenyi Biotec B.V. & Co. KG | Method of spatial sequencing of genes from tissue using padlocks with gaps on substrate |
| WO2022271820A1 (en) | 2021-06-22 | 2022-12-29 | 10X Genomics, Inc. | Spatial detection of sars-cov-2 using templated ligation |
| WO2023287765A1 (en) | 2021-07-13 | 2023-01-19 | 10X Genomics, Inc. | Methods for spatial analysis using targeted probe silencing |
| CN117651855A (en) | 2021-07-13 | 2024-03-05 | 10X基因组学有限公司 | Method for preparing polymeric matrices with controllable thickness |
| EP4370675B1 (en) | 2021-08-12 | 2025-10-01 | 10X Genomics, Inc. | Methods, compositions and systems for identifying antigen-binding molecules |
| EP4196605B1 (en) | 2021-09-01 | 2024-12-04 | 10X Genomics, Inc. | Methods for blocking a capture probe on a spatial array |
| WO2023044071A1 (en) | 2021-09-17 | 2023-03-23 | 10X Genomics, Inc. | Systems and methods for image registration or alignment |
| ES2975889T3 (en) | 2021-09-23 | 2024-07-17 | Miltenyi Biotec Bv & Co Kg | Method to obtain spatial and sequencing information from tissue mRNA |
| WO2023064822A1 (en) * | 2021-10-14 | 2023-04-20 | Indevr, Inc. | Nucleic acid arrays for mrna characterization |
| WO2023076345A1 (en) | 2021-10-26 | 2023-05-04 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna capture |
| EP4430398B1 (en) | 2021-11-10 | 2025-12-31 | 10X Genomics, Inc. | METHOD FOR IDENTIFYING ANTIGEN-BINDING MOLECULES |
| US20230167495A1 (en) | 2021-11-30 | 2023-06-01 | 10X Genomics, Inc. | Systems and methods for identifying regions of aneuploidy in a tissue |
| WO2023102118A2 (en) | 2021-12-01 | 2023-06-08 | 10X Genomics, Inc. | Methods, compositions, and systems for improved in situ detection of analytes and spatial analysis |
| JP2024545970A (en) * | 2021-12-24 | 2024-12-16 | セリジェント・バイオテクノロジー・リミテッド | Biochips for spatial transcriptome analysis, their preparation and use - Patents.com |
| WO2023150163A1 (en) | 2022-02-01 | 2023-08-10 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing analytes from lymphatic tissue |
| WO2023150171A1 (en) | 2022-02-01 | 2023-08-10 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing analytes from glioblastoma samples |
| US20250163501A1 (en) | 2022-02-01 | 2025-05-22 | 10X Genomics, Inc. | Methods, kits, compositions, and systems for spatial analysis |
| US12406364B2 (en) | 2022-02-15 | 2025-09-02 | 10X Genomics, Inc. | Systems and methods for spatial analysis of analytes using fiducial alignment |
| WO2023172670A2 (en) | 2022-03-11 | 2023-09-14 | 10X Genomics, Inc. | Sample handling apparatus and fluid delivery methods |
| US20250251403A1 (en) | 2022-04-12 | 2025-08-07 | 10X Genomics, Inc. | Compositions and methods for generating and characterizing recombinant antigen binding molecules |
| WO2023215612A1 (en) | 2022-05-06 | 2023-11-09 | 10X Genomics, Inc. | Analysis of antigen and antigen receptor interactions |
| WO2023215552A1 (en) | 2022-05-06 | 2023-11-09 | 10X Genomics, Inc. | Molecular barcode readers for analyte detection |
| WO2023225519A1 (en) | 2022-05-17 | 2023-11-23 | 10X Genomics, Inc. | Modified transposons, compositions and uses thereof |
| WO2023229988A1 (en) | 2022-05-23 | 2023-11-30 | 10X Genomics, Inc. | Tissue sample mold |
| WO2023229982A2 (en) | 2022-05-24 | 2023-11-30 | 10X Genomics, Inc. | Porous structure confinement for convection suppression |
| WO2023250077A1 (en) | 2022-06-22 | 2023-12-28 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US20240167077A1 (en) | 2022-06-29 | 2024-05-23 | 10X Genomics, Inc. | Covalent attachment of splint oligonucleotides for molecular array generation using ligation |
| WO2024006830A1 (en) | 2022-06-29 | 2024-01-04 | 10X Genomics, Inc. | Methods and compositions for patterned molecular array generation by directed bead delivery |
| WO2024006816A1 (en) | 2022-06-29 | 2024-01-04 | 10X Genomics, Inc. | Compositions and methods for oligonucleotide inversion on arrays |
| ES3005088T3 (en) | 2022-06-29 | 2025-03-13 | 10X Genomics Inc | High definition molecular array feature generation using photoresist |
| WO2024006797A1 (en) | 2022-06-29 | 2024-01-04 | 10X Genomics, Inc. | Methods and compositions for refining feature boundaries in molecular arrays |
| EP4659854A1 (en) | 2022-06-29 | 2025-12-10 | 10X Genomics, Inc. | Method of generating arrays using microfluidics and photolithography |
| US20240060127A1 (en) | 2022-06-29 | 2024-02-22 | 10X Genomics, Inc. | Methods and systems for light-controlled surface patterning using photomasks |
| WO2024006826A1 (en) | 2022-06-29 | 2024-01-04 | 10X Genomics, Inc. | Compositions and methods for generating molecular arrays using oligonucleotide printing and photolithography |
| EP4554973A1 (en) | 2022-07-13 | 2025-05-21 | 10X Genomics, Inc. | Methods for characterization of antigen-binding molecules from biological samples |
| WO2024015578A1 (en) | 2022-07-15 | 2024-01-18 | 10X Genomics, Inc. | Methods for determining a location of a target nucleic acid in a biological sample |
| US20240052404A1 (en) | 2022-08-05 | 2024-02-15 | 10X Genomics, Inc. | Systems and methods for immunofluorescence quantification |
| WO2024036191A1 (en) | 2022-08-10 | 2024-02-15 | 10X Genomics, Inc. | Systems and methods for colocalization |
| WO2024035844A1 (en) | 2022-08-12 | 2024-02-15 | 10X Genomics, Inc. | Methods for reducing capture of analytes |
| WO2024044703A1 (en) | 2022-08-24 | 2024-02-29 | 10X Genomics, Inc. | Compositions and methods for antigenic epitope mapping in biological samples |
| EP4573208A1 (en) | 2022-10-10 | 2025-06-25 | 10X Genomics, Inc. | In vitro transcription of spatially captured nucleic acids |
| WO2024081869A1 (en) | 2022-10-14 | 2024-04-18 | 10X Genomics, Inc. | Methods for analysis of biological samples |
| WO2024086167A2 (en) | 2022-10-17 | 2024-04-25 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| WO2024137826A1 (en) | 2022-12-21 | 2024-06-27 | 10X Genomics, Inc. | Analysis of analytes and spatial gene expression |
| WO2024145224A1 (en) | 2022-12-29 | 2024-07-04 | 10X Genomics, Inc. | Compositions, methods, and systems for high resolution spatial analysis |
| WO2024145441A1 (en) | 2022-12-29 | 2024-07-04 | 10X Genomics, Inc. | Methods, compositions, and kits for determining a location of a target nucleic acid in a fixed biological sample |
| WO2024145445A1 (en) | 2022-12-30 | 2024-07-04 | 10X Genomics, Inc. | Methods of capturing target analytes |
| WO2024138672A1 (en) * | 2022-12-30 | 2024-07-04 | 深圳华大生命科学研究院 | Improved nucleic acid capture method |
| EP4486913B1 (en) | 2022-12-30 | 2025-07-16 | 10x Genomics, Inc. | Methods, compositions, and kits for multiple barcoding and/or high-density spatial barcoding |
| EP4652292A1 (en) | 2023-01-16 | 2025-11-26 | DNA Script | Inkjet-assisted enzymatic nucleic acid synthesis |
| EP4689174A1 (en) | 2023-03-28 | 2026-02-11 | 10X Genomics, Inc. | Methods, compositions, and kits for reducing analyte mislocalization |
| US20250257393A1 (en) | 2023-04-21 | 2025-08-14 | 10X Genomics, Inc. | Methods and compositions for detecting nucleic acids in a fixed biological sample |
| WO2024238625A1 (en) | 2023-05-15 | 2024-11-21 | 10X Genomics, Inc. | Spatial antibody data normalization |
| WO2024238900A1 (en) | 2023-05-17 | 2024-11-21 | 10X Genomics, Inc. | Methods of reducing mislocalization of an analyte |
| WO2024238992A1 (en) | 2023-05-18 | 2024-11-21 | 10X Genomics, Inc. | Engineered non-strand displacing family b polymerases for reverse transcription and gap-fill applications |
| WO2024249961A1 (en) | 2023-06-01 | 2024-12-05 | Singular Genomics Systems, Inc. | Methods and probes for detecting polynucleotide sequences in cells and tissues |
| WO2024254316A1 (en) | 2023-06-07 | 2024-12-12 | 10X Genomics, Inc. | Compositions and methods for identifying blood clots in biological samples |
| WO2024258911A1 (en) | 2023-06-13 | 2024-12-19 | 10X Genomics, Inc. | Sequence specific dna binding proteins |
| WO2025029605A1 (en) | 2023-07-28 | 2025-02-06 | 10X Genomics, Inc. | Methods and compositions for detecting genetic variants using capture probes and primer extension |
| WO2025029627A1 (en) | 2023-07-31 | 2025-02-06 | 10X Genomics, Inc. | Methods, compositions, and kits for spatial detection of genetic variants |
| EP4581160A1 (en) | 2023-08-24 | 2025-07-09 | 10X Genomics, Inc. | Methods, kits, and compositions for spatial detection of genetic variants |
| WO2025043080A2 (en) * | 2023-08-24 | 2025-02-27 | Bruker Spatial Biology, Inc. | Systems and methods for cellular spatial analysis |
| WO2025072119A1 (en) | 2023-09-26 | 2025-04-03 | 10X Genomics, Inc. | Methods, compositions, and kits for detecting spatial chromosomal interactions |
| EP4530359A1 (en) | 2023-09-28 | 2025-04-02 | LMU Ludwig-Maximilians-Universität | Multiplexed single molecule rna fish using dna nanostructures |
| WO2025081111A1 (en) * | 2023-10-12 | 2025-04-17 | The University Of Chicago | Methods and compositions for characterizing rna-binding protein binding sites by in-situ reverse transcription-based sequencing |
| WO2025090912A1 (en) | 2023-10-26 | 2025-05-01 | 10X Genomics, Inc. | Spatial arrays containing reusable master probes |
| WO2025096581A1 (en) | 2023-10-31 | 2025-05-08 | 10X Genomics, Inc. | Methods of spatial analysis and single nuclei sequencing |
| WO2025101377A1 (en) | 2023-11-09 | 2025-05-15 | 10X Genomics, Inc. | Matrix-assisted spatial analysis of biological samples |
| WO2025101864A1 (en) | 2023-11-09 | 2025-05-15 | 10X Genomics, Inc. | Methods, compositions, and kits for reducing mislocalization of analytes in spatial analysis assays |
| WO2025255457A1 (en) | 2024-06-07 | 2025-12-11 | 10X Genomics, Inc. | Compositions and methods for improved on-target spatial profiling |
| WO2026024934A1 (en) | 2024-07-25 | 2026-01-29 | 10X Genomics, Inc. | Methods, compositions, and kits for spatial analysis by tagmentation |
| WO2026043885A1 (en) | 2024-08-20 | 2026-02-26 | 10X Genomics, Inc. | Methods and systems for preparing a nucleic acid library |
Citations (886)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4514388A (en) | 1983-03-22 | 1985-04-30 | Psaledakis Nicholas G | Proteolytic enzymes in the zymogen form to treat sarcoma cells |
| US4574729A (en) | 1984-08-06 | 1986-03-11 | E. I. Du Pont De Nemours & Co. | Chamber block for a cytocentrifuge having centrifugal force responsive supernatant withdrawal means |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4800159A (en) | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
| WO1989010977A1 (en) | 1988-05-03 | 1989-11-16 | Isis Innovation Limited | Analysing polynucleotide sequences |
| US4883867A (en) | 1985-11-01 | 1989-11-28 | Becton, Dickinson And Company | Detection of reticulocytes, RNA or DNA |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US4968601A (en) | 1988-02-09 | 1990-11-06 | The United States Of America As Represented By The Dept. Of Health & Human Services | Method for diagnosing latent viral infection |
| US4988617A (en) | 1988-03-25 | 1991-01-29 | California Institute Of Technology | Method of detecting a nucleotide change in nucleic acids |
| US5002882A (en) | 1989-04-27 | 1991-03-26 | New England Biolabs, Inc. | Method for producing the XmaI restriction endonuclease and methylase |
| WO1991006678A1 (en) | 1989-10-26 | 1991-05-16 | Sri International | Dna sequencing |
| US5061049A (en) | 1984-08-31 | 1991-10-29 | Texas Instruments Incorporated | Spatial light modulator and method |
| US5130238A (en) | 1988-06-24 | 1992-07-14 | Cangene Corporation | Enhanced nucleic acid amplification process |
| US5183053A (en) | 1991-04-12 | 1993-02-02 | Acuderm, Inc. | Elliptical biopsy punch |
| WO1993004199A2 (en) | 1991-08-20 | 1993-03-04 | Scientific Generics Limited | Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids |
| US5308751A (en) | 1992-03-23 | 1994-05-03 | General Atomics | Method for sequencing double-stranded DNA |
| US5321130A (en) | 1992-02-10 | 1994-06-14 | Molecular Probes, Inc. | Unsymmetrical cyanine dyes with a cationic side chain |
| US5410030A (en) | 1993-04-05 | 1995-04-25 | Molecular Probes, Inc. | Dimers of unsymmetrical cyanine dyes containing pyridinium moieties |
| US5436134A (en) | 1993-04-13 | 1995-07-25 | Molecular Probes, Inc. | Cyclic-substituted unsymmetrical cyanine dyes |
| WO1995023875A1 (en) | 1994-03-02 | 1995-09-08 | The Johns Hopkins University | In vitro transposition of artificial transposons |
| WO1995025116A1 (en) | 1994-03-16 | 1995-09-21 | California Institute Of Technology | Method and apparatus for performing multiple sequential reactions on a matrix |
| US5455166A (en) | 1991-01-31 | 1995-10-03 | Becton, Dickinson And Company | Strand displacement amplification |
| US5472881A (en) | 1992-11-12 | 1995-12-05 | University Of Utah Research Foundation | Thiol labeling of DNA for attachment to gold surfaces |
| WO1995035505A1 (en) | 1994-06-17 | 1995-12-28 | The Board Of Trustees Of The Leland Stanford Junior University | Method and apparatus for fabricating microarrays of biological samples |
| US5494810A (en) | 1990-05-03 | 1996-02-27 | Cornell Research Foundation, Inc. | Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease |
| US5503980A (en) | 1992-11-06 | 1996-04-02 | Trustees Of Boston University | Positional sequencing by hybridization |
| US5512462A (en) | 1994-02-25 | 1996-04-30 | Hoffmann-La Roche Inc. | Methods and reagents for the polymerase chain reaction amplification of long DNA sequences |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5559032A (en) | 1990-06-29 | 1996-09-24 | Pomeroy; Patrick C. | Method and apparatus for post-transfer assaying of material on solid support |
| US5582977A (en) | 1991-09-16 | 1996-12-10 | Molecular Probes, Inc. | Dimers of unsymmetrical cyanine dyes |
| US5589173A (en) | 1986-11-04 | 1996-12-31 | Genentech, Inc. | Method and therapeutic compositions for the treatment of myocardial infarction |
| US5599675A (en) | 1994-04-04 | 1997-02-04 | Spectragen, Inc. | DNA sequencing by stepwise ligation and cleavage |
| US5610287A (en) | 1993-12-06 | 1997-03-11 | Molecular Tool, Inc. | Method for immobilizing nucleic acid molecules |
| US5641658A (en) | 1994-08-03 | 1997-06-24 | Mosaic Technologies, Inc. | Method for performing amplification of nucleic acid with two primers bound to a single solid support |
| US5648245A (en) | 1995-05-09 | 1997-07-15 | Carnegie Institution Of Washington | Method for constructing an oligonucleotide concatamer library by rolling circle replication |
| US5658751A (en) | 1993-04-13 | 1997-08-19 | Molecular Probes, Inc. | Substituted unsymmetrical cyanine dyes with selected permeability |
| WO1997031256A2 (en) | 1996-02-09 | 1997-08-28 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US5672344A (en) | 1987-12-30 | 1997-09-30 | The Regents Of The University Of Michigan | Viral-mediated gene transfer system |
| US5695940A (en) | 1987-04-01 | 1997-12-09 | Hyseq, Inc. | Method of sequencing by hybridization of oligonucleotide probes |
| US5716825A (en) | 1995-11-01 | 1998-02-10 | Hewlett Packard Company | Integrated nucleic acid analysis system for MALDI-TOF MS |
| US5750341A (en) | 1995-04-17 | 1998-05-12 | Lynx Therapeutics, Inc. | DNA sequencing by parallel oligonucleotide extensions |
| US5763175A (en) | 1995-11-17 | 1998-06-09 | Lynx Therapeutics, Inc. | Simultaneous sequencing of tagged polynucleotides |
| WO1998044151A1 (en) | 1997-04-01 | 1998-10-08 | Glaxo Group Limited | Method of nucleic acid amplification |
| US5837860A (en) | 1997-03-05 | 1998-11-17 | Molecular Tool, Inc. | Covalent attachment of nucleic acid molecules onto solid-phases via disulfide bonds |
| US5837832A (en) | 1993-06-25 | 1998-11-17 | Affymetrix, Inc. | Arrays of nucleic acid probes on biological chips |
| US5854033A (en) | 1995-11-21 | 1998-12-29 | Yale University | Rolling circle replication reporter systems |
| US5866377A (en) | 1994-12-30 | 1999-02-02 | Chong Kun Dang Corporation | Aminooligosaccharide derivative and process for preparing the same |
| US5871921A (en) | 1994-02-16 | 1999-02-16 | Landegren; Ulf | Circularizing nucleic acid probe able to interlock with a target sequence through catenation |
| EP0901631A1 (en) | 1997-01-15 | 1999-03-17 | New Horizons Diagnostics Corporation | Method for detection of contaminants |
| US5912148A (en) | 1994-08-19 | 1999-06-15 | Perkin-Elmer Corporation Applied Biosystems | Coupled amplification and ligation method |
| WO1999032654A1 (en) | 1997-12-22 | 1999-07-01 | Hitachi Chemical Co., Ltd. | Direct rt-pcr on oligonucleotide-immobilized pcr microplates |
| US5919626A (en) | 1997-06-06 | 1999-07-06 | Orchid Bio Computer, Inc. | Attachment of unmodified nucleic acids to silanized solid phase surfaces |
| US5925545A (en) | 1996-09-09 | 1999-07-20 | Wisconsin Alumni Research Foundation | System for in vitro transposition |
| US5928906A (en) | 1996-05-09 | 1999-07-27 | Sequenom, Inc. | Process for direct sequencing during template amplification |
| WO1999044063A2 (en) | 1998-02-25 | 1999-09-02 | The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Tumor tissue microarrays for rapid molecular profiling |
| WO1999044062A1 (en) | 1998-02-25 | 1999-09-02 | The United States Of America As Represented By The Secretary Department Of Health And Human Services | Cellular arrays for rapid molecular profiling |
| US5958775A (en) | 1997-07-25 | 1999-09-28 | Thomas Jefferson University | Composition and method for targeted integration into cells |
| US5965443A (en) | 1996-09-09 | 1999-10-12 | Wisconsin Alumni Research Foundation | System for in vitro transposition |
| US5994136A (en) | 1997-12-12 | 1999-11-30 | Cell Genesys, Inc. | Method and means for producing high titer, safe, recombinant lentivirus vectors |
| EP0961110A2 (en) | 1998-05-27 | 1999-12-01 | Becton Dickinson and Company | Device for preparing thin liquid samples for microscopic analysis |
| WO1999063385A1 (en) | 1998-06-04 | 1999-12-09 | Board Of Regents, The University Of Texas System | Digital optical chemistry micromirror imager |
| WO1999067641A2 (en) | 1998-06-24 | 1999-12-29 | Illumina, Inc. | Decoding of array sensors with microspheres |
| US6013516A (en) | 1995-10-06 | 2000-01-11 | The Salk Institute For Biological Studies | Vector and method of use for nucleic acid delivery to non-dividing cells |
| US6013440A (en) | 1996-03-11 | 2000-01-11 | Affymetrix, Inc. | Nucleic acid affinity columns |
| RU2145635C1 (en) | 1989-05-18 | 2000-02-20 | Чирон Корпорейшн | Oligomer (variants), method of detection of hcv sequence (variants), set for detection, method of blood preparing |
| US6027889A (en) | 1996-05-29 | 2000-02-22 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions |
| WO2000017390A1 (en) | 1998-09-18 | 2000-03-30 | Micromet Ag | Dna amplification of a single cell |
| WO2000018957A1 (en) | 1998-09-30 | 2000-04-06 | Applied Research Systems Ars Holding N.V. | Methods of nucleic acid amplification and sequencing |
| US6054274A (en) | 1997-11-12 | 2000-04-25 | Hewlett-Packard Company | Method of amplifying the signal of target nucleic acid sequence analyte |
| WO2000024940A1 (en) | 1998-10-28 | 2000-05-04 | Vysis, Inc. | Cellular arrays and methods of detecting and using genetic disorder markers |
| US6060240A (en) | 1996-12-13 | 2000-05-09 | Arcaris, Inc. | Methods for measuring relative amounts of nucleic acids in a complex mixture and retrieval of specific sequences therefrom |
| US6083761A (en) | 1996-12-02 | 2000-07-04 | Glaxo Wellcome Inc. | Method and apparatus for transferring and combining reagents |
| US6136592A (en) | 1999-06-25 | 2000-10-24 | Leighton; Stephen B. | Multiple micro-arrays |
| US6143496A (en) | 1997-04-17 | 2000-11-07 | Cytonix Corporation | Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly |
| CN1273609A (en) | 1997-08-15 | 2000-11-15 | 希斯克有限公司 | Methods and compositions for detecting or quantifying nucleic acid species |
| US6153389A (en) | 1999-02-22 | 2000-11-28 | Haarer; Brian K. | DNA additives as a mechanism for unambiguously marking biological samples |
| US6157432A (en) | 1999-01-29 | 2000-12-05 | Hewlett-Packard Company | Heated ferroelectric liquid crystal spatial light modulator with improved contrast, improved grayscale resolution, and decreased pixel sticking when operated in a non-DC balanced mode |
| US6159736A (en) | 1998-09-23 | 2000-12-12 | Wisconsin Alumni Research Foundation | Method for making insertional mutations using a Tn5 synaptic complex |
| US6165714A (en) | 1996-12-16 | 2000-12-26 | Vysis, Inc. | Devices and methods for detecting nucleic acid analytes in samples |
| US6172218B1 (en) | 1994-10-13 | 2001-01-09 | Lynx Therapeutics, Inc. | Oligonucleotide tags for sorting and identification |
| WO2001006012A1 (en) | 1999-07-14 | 2001-01-25 | Packard Bioscience Company | Derivative nucleic acids and uses thereof |
| WO2001007915A2 (en) | 1999-07-26 | 2001-02-01 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health & Human Services, The National Institutes Of Health | Layered device with capture regions for cellular analysis |
| WO2001009363A1 (en) | 1999-08-02 | 2001-02-08 | Wisconsin Alumni Research Foundation | Mutant tn5 transposase enzymes and method for their use |
| WO2001012862A2 (en) | 1999-08-18 | 2001-02-22 | Illumina, Inc. | Compositions and methods for preparing oligonucleotide solutions |
| US6210894B1 (en) | 1991-09-04 | 2001-04-03 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
| US6210891B1 (en) | 1996-09-27 | 2001-04-03 | Pyrosequencing Ab | Method of sequencing DNA |
| US6214587B1 (en) | 1994-03-16 | 2001-04-10 | Gen-Probe Incorporated | Isothermal strand displacement nucleic acid amplification |
| US6221591B1 (en) | 1995-06-07 | 2001-04-24 | Universiteit Van Amsterdam | Determination of a genetic risk factor for infection and other diseases, and detection of activated phagocytes |
| US6221654B1 (en) | 1996-09-25 | 2001-04-24 | California Institute Of Technology | Method and apparatus for analysis and sorting of polynucleotides based on size |
| WO2001042796A1 (en) | 1999-12-13 | 2001-06-14 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health & Human Services, The National Institutes Of Health | High-throughput tissue microarray technology and applications |
| US6251639B1 (en) | 1999-09-13 | 2001-06-26 | Nugen Technologies, Inc. | Methods and compositions for linear isothermal amplification of polynucleotide sequences, using a RNA-DNA composite primer |
| WO2001046402A1 (en) | 1999-12-20 | 2001-06-28 | University Of Southern California | Method for isolation of rna from formalin-fixed paraffin-embedded tissue specimens |
| US6258568B1 (en) | 1996-12-23 | 2001-07-10 | Pyrosequencing Ab | Method of sequencing DNA based on the detection of the release of pyrophosphate and enzymatic nucleotide degradation |
| US6258558B1 (en) | 1997-01-21 | 2001-07-10 | The General Hospital Corporation | Method for selection of proteins using RNA-protein fusions |
| US6261804B1 (en) | 1997-01-21 | 2001-07-17 | The General Hospital Corporation | Selection of proteins using RNA-protein fusions |
| US6266459B1 (en) | 1997-03-14 | 2001-07-24 | Trustees Of Tufts College | Fiber optic sensor with encoded microspheres |
| US6265552B1 (en) | 1993-07-30 | 2001-07-24 | Affymax Technologies N.V. | Biotinylation of proteins |
| US6274320B1 (en) | 1999-09-16 | 2001-08-14 | Curagen Corporation | Method of sequencing a nucleic acid |
| WO2001059161A2 (en) | 2000-02-08 | 2001-08-16 | Clontech Laboratories, Inc. | Analyte assays employing universal arrays |
| US6281804B1 (en) | 1996-09-27 | 2001-08-28 | Daimlerchrysler Ag | Display arranged in a motor vehicle |
| US6291187B1 (en) | 2000-05-12 | 2001-09-18 | Molecular Staging, Inc. | Poly-primed amplification of nucleic acid sequences |
| US6291180B1 (en) | 1999-09-29 | 2001-09-18 | American Registry Of Pathology | Ultrasound-mediated high-speed biological reaction and tissue processing |
| US6300063B1 (en) | 1995-11-29 | 2001-10-09 | Affymetrix, Inc. | Polymorphism detection |
| US6309824B1 (en) | 1997-01-16 | 2001-10-30 | Hyseq, Inc. | Methods for analyzing a target nucleic acid using immobilized heterogeneous mixtures of oligonucleotide probes |
| US20010039029A1 (en) | 1999-12-22 | 2001-11-08 | Ryoichi Nemori | Method for measuring protease activity |
| US6323009B1 (en) | 2000-06-28 | 2001-11-27 | Molecular Staging, Inc. | Multiply-primed amplification of nucleic acid sequences |
| WO2001090415A2 (en) | 2000-05-20 | 2001-11-29 | The Regents Of The University Of Michigan | Method of producing a dna library using positional amplification |
| WO2001096608A1 (en) | 2000-06-15 | 2001-12-20 | Digene Corporation | Detection of nucleic acids by type-specific hybrid capture method |
| US20010055764A1 (en) | 1999-05-07 | 2001-12-27 | Empedocles Stephen A. | Microarray methods utilizing semiconductor nanocrystals |
| US6337472B1 (en) | 1998-10-19 | 2002-01-08 | The University Of Texas System Board Of Regents | Light imaging microscope having spatially resolved images |
| US20020006477A1 (en) | 2000-04-03 | 2002-01-17 | Takeshi Shishido | Exhaust processing method, plasma processing method and plasma processing apparatus |
| US6344316B1 (en) | 1996-01-23 | 2002-02-05 | Affymetrix, Inc. | Nucleic acid analysis techniques |
| US6348990B1 (en) | 1998-06-18 | 2002-02-19 | Hamamatsu Photonics K.K. | Spatial light modulator and spatial light modulating method |
| US6355431B1 (en) | 1999-04-20 | 2002-03-12 | Illumina, Inc. | Detection of nucleic acid amplification reactions using bead arrays |
| WO2002024952A1 (en) | 2000-09-22 | 2002-03-28 | Clinomics Biosciences, Inc. | Profile array substrates |
| US20020040275A1 (en) | 2000-04-10 | 2002-04-04 | The Scripps Research Institute | Proteomic analysis |
| US6368801B1 (en) | 2000-04-12 | 2002-04-09 | Molecular Staging, Inc. | Detection and amplification of RNA using target-mediated ligation of DNA by RNA ligase |
| US20020045272A1 (en) | 2000-01-31 | 2002-04-18 | Mcdevitt John T. | Method and apparatus for the delivery of samples to a chemical sensor array |
| US20020045169A1 (en) | 2000-08-25 | 2002-04-18 | Shoemaker Daniel D. | Gene discovery using microarrays |
| US20020048766A1 (en) | 2000-07-28 | 2002-04-25 | Doyle Michael D. | Method and system for the multidimensional morphological reconstruction of genome expression activity |
| US20020051986A1 (en) | 2000-06-13 | 2002-05-02 | Luis Baez | Method for the detection of an analyte by means of a nucleic acid reporter |
| US20020055100A1 (en) | 1997-04-01 | 2002-05-09 | Kawashima Eric H. | Method of nucleic acid sequencing |
| US20020058250A1 (en) | 1997-03-21 | 2002-05-16 | Marshall, Gerstein & Borun | Extraction and utilisation of vntr alleles |
| US6391937B1 (en) | 1998-11-25 | 2002-05-21 | Motorola, Inc. | Polyacrylamide hydrogels and hydrogel arrays made from polyacrylamide reactive prepolymers |
| WO2002040874A1 (en) | 2000-11-16 | 2002-05-23 | California Institute Of Technology | Apparatus and methods for conducting assays and high throughput screening |
| US20020064779A1 (en) | 2000-02-18 | 2002-05-30 | Ulf Landegren | Methods and kits for proximity probing |
| US6401267B1 (en) | 1993-09-27 | 2002-06-11 | Radoje Drmanac | Methods and compositions for efficient nucleic acid sequencing |
| US6404907B1 (en) | 1998-06-26 | 2002-06-11 | Visible Genetics Inc. | Method for sequencing nucleic acids with reduced errors |
| US20020086441A1 (en) | 2000-12-28 | 2002-07-04 | Mds Sciex | Elemental analysis of tagged biologically active materials |
| US6416950B1 (en) | 1998-12-02 | 2002-07-09 | Phylos, Inc. | DNA-protein fusions and uses thereof |
| WO2002059364A1 (en) | 2001-01-27 | 2002-08-01 | Electron-Bio, Inc. | Nucleic hybridization assay method and device using a cleavage technique responsive to the complementary double strand or the single strand of nucleic acids or oligonucleotides |
| WO2002059355A2 (en) | 2001-01-25 | 2002-08-01 | Tm Bioscience Corporation | Polynucleotides for use as tags and tag complements, manufacture and use thereof |
| US6432360B1 (en) | 1997-10-10 | 2002-08-13 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
| US20020137031A1 (en) | 1999-07-01 | 2002-09-26 | Paul K. Wolber | Multidentate arrays |
| WO2002077283A1 (en) | 2000-12-21 | 2002-10-03 | Affymetrix, Inc. | Methods for detecting transcripts |
| US20020150909A1 (en) | 1999-02-09 | 2002-10-17 | Stuelpnagel John R. | Automated information processing in randomly ordered arrays |
| US20020164611A1 (en) | 2000-11-15 | 2002-11-07 | Bamdad R. Shoshana | Oligonucleotide identifiers |
| WO2002088396A2 (en) | 2001-04-30 | 2002-11-07 | Ventana Medical Systems, Inc. | Reagents and methods for automated in situ or microarray hybridization |
| US20020168645A1 (en) | 1998-04-16 | 2002-11-14 | Seth Taylor | Analysis of polynucleotide sequence |
| US6485982B1 (en) | 1988-06-27 | 2002-11-26 | Armkel, Llc | Test device and method for colored particle immunoassay |
| US6503713B1 (en) | 1999-10-04 | 2003-01-07 | University Of Medicine And Dentistry Of New Jersey | Methods for identifying RNA binding compounds |
| WO2003002979A2 (en) | 2001-06-28 | 2003-01-09 | Illumina, Inc. | Multiplex decoding of array sensors with microspheres |
| US6506561B1 (en) | 1999-01-27 | 2003-01-14 | Commissariat A L'energie Atomique | Method of obtaining a library of tags capable of defining a specific state of a biological sample |
| WO2003003810A2 (en) | 2001-07-03 | 2003-01-16 | The Institute For Systems Biology | Methods for detection and quantification of analytes in complex mixtures |
| WO2003008538A2 (en) | 2001-07-20 | 2003-01-30 | Molecular Staging, Inc. | Gene expression profiling |
| US20030022207A1 (en) | 1998-10-16 | 2003-01-30 | Solexa, Ltd. | Arrayed polynucleotides and their use in genome analysis |
| WO2003010176A2 (en) | 2001-07-24 | 2003-02-06 | Oxford Glycosciences (Uk) Ltd | Protein-nucleic acid complexes |
| US20030040035A1 (en) | 2001-08-23 | 2003-02-27 | The Regents Of The University Of California | Frozen tissue microarray technology for analysis of RNA, DNA, and proteins |
| US6534266B1 (en) | 1999-04-22 | 2003-03-18 | Albert Einstein College Of Medicine Of Yeshiva University | Assay of transcription sites by multi-fluor fish |
| US20030064398A1 (en) | 2000-02-02 | 2003-04-03 | Solexa, Ltd. | Synthesis of spatially addressed molecular arrays |
| US6544790B1 (en) | 1999-09-17 | 2003-04-08 | Whitehead Institute For Biomedical Research | Reverse transfection method |
| US6544732B1 (en) | 1999-05-20 | 2003-04-08 | Illumina, Inc. | Encoding and decoding of array sensors utilizing nanocrystals |
| US20030073086A1 (en) | 2001-10-05 | 2003-04-17 | Surmodics, Inc. | Randomly ordered arrays and methods of making and using |
| US20030087232A1 (en) | 2001-01-25 | 2003-05-08 | Fred Christians | Methods for screening polypeptides |
| US6565727B1 (en) | 1999-01-25 | 2003-05-20 | Nanolytics, Inc. | Actuators for microfluidics without moving parts |
| US20030096323A1 (en) | 2001-07-31 | 2003-05-22 | Pfizer Inc. | PDE10 cell-based assay and sequences |
| US6573043B1 (en) | 1998-10-07 | 2003-06-03 | Genentech, Inc. | Tissue analysis and kits therefor |
| US6579695B1 (en) | 1995-10-13 | 2003-06-17 | President And Fellows Of Harvard College | Phosphopantetheinyl transferases and uses thereof |
| CN1425133A (en) | 1999-10-13 | 2003-06-18 | 西格雷特生物科学有限公司 | System and method for detecting and identifying molecular events in a test sample |
| US20030113713A1 (en) | 2001-09-10 | 2003-06-19 | Meso Scale Technologies, Llc | Methods and apparatus for conducting multiple measurements on a sample |
| US20030124595A1 (en) | 2001-11-06 | 2003-07-03 | Lizardi Paul M. | Sensitive coded detection systems |
| US20030134279A1 (en) | 2000-09-14 | 2003-07-17 | Jorma Isola | In situ hybridization probes and cancer therapy diagnostics |
| US20030148335A1 (en) | 2001-10-10 | 2003-08-07 | Li Shen | Detecting targets by unique identifier nucleotide tags |
| US20030153850A1 (en) | 2002-01-16 | 2003-08-14 | Davis Brian J. | Method and apparatus for image-guided therapy |
| US20030162216A1 (en) | 1997-12-15 | 2003-08-28 | Somalogic, Inc. | Nucleic acid ligand diagnostic biochip |
| US20030165948A1 (en) | 2001-03-09 | 2003-09-04 | Alsmadi Osama A. | Method and compositions for efficient and specific rolling circle amplification |
| US20030170637A1 (en) | 2002-03-06 | 2003-09-11 | Pirrung Michael C. | Method of analyzing mRNA splice variants |
| US6620584B1 (en) | 1999-05-20 | 2003-09-16 | Illumina | Combinatorial decoding of random nucleic acid arrays |
| US20030175844A1 (en) | 2002-03-12 | 2003-09-18 | Nadler Timothy K. | Method and apparatus for the identification and quantification of biomolecules |
| US20030175947A1 (en) | 2001-11-05 | 2003-09-18 | Liu Robin Hui | Enhanced mixing in microfluidic devices |
| US20030190744A1 (en) | 1999-12-15 | 2003-10-09 | Motorola | Method and apparatus for performing biological reactions on a substrate surface |
| US6632641B1 (en) | 1999-10-08 | 2003-10-14 | Metrigen, Inc. | Method and apparatus for performing large numbers of reactions using array assembly with releasable primers |
| US20030205632A1 (en) | 2000-07-25 | 2003-11-06 | Chang-Jin Kim | Electrowetting-driven micropumping |
| US20030211489A1 (en) | 2000-09-21 | 2003-11-13 | Shen Min-Jui Richard | Multiplex nucleic acid reactions |
| US20030215936A1 (en) | 2000-12-13 | 2003-11-20 | Olli Kallioniemi | High-throughput tissue microarray technology and applications |
| US20030224419A1 (en) | 1997-05-23 | 2003-12-04 | Lynx Therapeutics, Inc. | Data analysis and display system for ligation-based DNA sequencing |
| WO2003102233A1 (en) | 2002-06-03 | 2003-12-11 | Pamgene B.V. | Novel high density arrays and methods for analyte analysis |
| US20030232348A1 (en) | 2002-06-17 | 2003-12-18 | Affymetrix, Inc. | Complexity management of genomic DNA by locus specific amplification |
| WO2003106973A2 (en) | 2002-06-18 | 2003-12-24 | Invitrogen Corporation | Methods and apparatus for low resistance electrophoresis of prior-cast, hydratable separation media |
| US20030235535A1 (en) | 2002-04-15 | 2003-12-25 | Qun-Yong Zhou | Screening and therapeutic methods for treating circadian rhythm disorders |
| US20030235852A1 (en) | 2002-04-19 | 2003-12-25 | Roberts Richard W. | Nucleic acid-peptide display libraries containing peptides with unnatural amino acid residues, and methods of making same using peptide modifying agents |
| US20030235854A1 (en) | 2002-05-09 | 2003-12-25 | Chan Eugene Y. | Methods for analyzing a nucleic acid |
| US20040002090A1 (en) | 2002-03-05 | 2004-01-01 | Pascal Mayer | Methods for detecting genome-wide sequence variations associated with a phenotype |
| US6673620B1 (en) | 1999-04-20 | 2004-01-06 | Cytologix Corporation | Fluid exchange in a chamber on a microscope slide |
| US6677160B1 (en) | 1999-09-29 | 2004-01-13 | Pharmacia & Upjohn Company | Methods for creating a compound library and identifying lead chemical templates and ligands for target molecules |
| US20040019005A1 (en) | 2001-10-01 | 2004-01-29 | Jeffrey Van Ness | Methods for parallel measurement of genetic variations |
| US20040023320A1 (en) | 2000-10-24 | 2004-02-05 | Steiner Georg E. | Method and system for analyzing cells |
| WO2004015080A2 (en) | 2002-08-09 | 2004-02-19 | Illumina, Inc. | Nucleic acid detection methods using universal priming |
| US20040033499A1 (en) | 2002-08-16 | 2004-02-19 | Ilsley Diane D. | Method for synthesis of the second strand of cDNA |
| US6699710B1 (en) | 1998-02-25 | 2004-03-02 | The United States Of America As Represented By The Department Of Health And Human Services | Tumor tissue microarrays for rapid molecular profiling |
| US20040050699A1 (en) | 2002-09-11 | 2004-03-18 | Goncalves Antonio M. | Automated system for high-throughput electrophoretic separations |
| US20040067492A1 (en) | 2002-10-04 | 2004-04-08 | Allan Peng | Reverse transcription on microarrays |
| WO2004028955A2 (en) | 2002-09-25 | 2004-04-08 | California Institute Of Technology | Microfluidic large scale integration |
| US20040067493A1 (en) | 2001-07-25 | 2004-04-08 | Affymetrix, Inc. | Complexity management of genomic DNA |
| US20040082058A1 (en) | 2002-10-29 | 2004-04-29 | Arthur Schleifer | Array hybridization apparatus and method for making uniform sample volumes |
| US20040082059A1 (en) | 1999-07-22 | 2004-04-29 | Webb Peter G. | Methods of fabricating an addressable array of biopolymer probes |
| US6737236B1 (en) | 1997-01-08 | 2004-05-18 | Proligo, Llc | Bioconjugation of macromolecules |
| US20040096853A1 (en) | 2000-12-08 | 2004-05-20 | Pascal Mayer | Isothermal amplification of nucleic acids on a solid support |
| US20040106110A1 (en) | 1998-07-30 | 2004-06-03 | Solexa, Ltd. | Preparation of polynucleotide arrays |
| US20040121456A1 (en) | 2002-10-31 | 2004-06-24 | Fischer Andrew H. | Rapid cell block embedding method and apparatus |
| WO2004055159A2 (en) * | 2002-12-12 | 2004-07-01 | Chiron Corporation | Identification of oligonucleotides for the capture, detection and quantitation of west nile virus |
| US6770441B2 (en) | 2000-02-10 | 2004-08-03 | Illumina, Inc. | Array compositions and methods of making same |
| US6773886B2 (en) | 1999-08-13 | 2004-08-10 | Yale University | Binary encoded sequence tags |
| US6773566B2 (en) | 2000-08-31 | 2004-08-10 | Nanolytics, Inc. | Electrostatic actuators for microfluidics and methods for using same |
| WO2004067759A2 (en) | 2003-01-29 | 2004-08-12 | Cranfield University | Replication of nucleic acid arrays |
| US6787308B2 (en) | 1998-07-30 | 2004-09-07 | Solexa Ltd. | Arrayed biomolecules and their use in sequencing |
| US20040175822A1 (en) | 2002-12-18 | 2004-09-09 | West Virginia University Research Corporation | Apparatus and method for edman degradation using a microfluidic system |
| WO2004081225A2 (en) | 2003-03-07 | 2004-09-23 | Rubicon Genomics, Inc. | Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process |
| US6800453B2 (en) | 2001-01-23 | 2004-10-05 | President And Fellows Of Harvard College | Nucleic-acid programmable protein arrays |
| CN1537953A (en) | 2003-04-17 | 2004-10-20 | 中国人民解放军军事医学科学院放射医 | Preparation of gene chip for digagnosingantrax baiuus and its application |
| US6812005B2 (en) | 2000-02-07 | 2004-11-02 | The Regents Of The University Of California | Nucleic acid detection methods using universal priming |
| US20040219588A1 (en) | 2003-04-30 | 2004-11-04 | Masaru Furuta | Method for dispensing reagents onto biological samples and method for analyzing biological samples |
| US20040224326A1 (en) | 2003-01-03 | 2004-11-11 | Young-A Kim | Method of replicating nucleic acid array |
| US20040235103A1 (en) | 2003-04-17 | 2004-11-25 | Reznikoff William S. | Tn5 transposase mutants and the use thereof |
| US6828100B1 (en) | 1999-01-22 | 2004-12-07 | Biotage Ab | Method of DNA sequencing |
| US20040248325A1 (en) | 2001-07-19 | 2004-12-09 | Cuneyt Bukusoglu | Method for simultaneous multiple probes/multiple targets screening procedure |
| WO2004108268A1 (en) | 2003-05-30 | 2004-12-16 | Applera Corporation | Apparatus and method for hybridization and spr detection |
| US6833246B2 (en) | 1999-09-29 | 2004-12-21 | Solexa, Ltd. | Polynucleotide sequencing |
| US20040259105A1 (en) | 2002-10-03 | 2004-12-23 | Jian-Bing Fan | Multiplex nucleic acid analysis using archived or fixed samples |
| US20050003431A1 (en) | 1996-08-16 | 2005-01-06 | Wucherpfennig Kai W. | Monovalent, multivalent, and multimeric MHC binding domain fusion proteins and conjugates, and uses therefor |
| US20050014203A1 (en) | 2003-03-10 | 2005-01-20 | Darfler Marlene M. | Liquid tissue preparation from histopathologically processed biological samples, tissues and cells |
| US20050019842A1 (en) | 2002-11-06 | 2005-01-27 | Prober James M. | Microparticle-based methods and systems and applications thereof |
| US20050019776A1 (en) | 2002-06-28 | 2005-01-27 | Callow Matthew James | Universal selective genome amplification and universal genotyping system |
| WO2005007814A2 (en) | 2003-07-03 | 2005-01-27 | The Regents Of The University Of California | Genome mapping of functional dna elements and cellular proteins |
| US20050026188A1 (en) | 2003-05-30 | 2005-02-03 | Van Kessel Andrew G. | Methods of identifying, characterizing and comparing organism communities |
| WO2005010145A2 (en) | 2003-07-05 | 2005-02-03 | The Johns Hopkins University | Method and compositions for detection and enumeration of genetic variations |
| US6852487B1 (en) | 1996-02-09 | 2005-02-08 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US20050037393A1 (en) | 2003-06-20 | 2005-02-17 | Illumina, Inc. | Methods and compositions for whole genome amplification and genotyping |
| US20050037362A1 (en) | 2003-08-11 | 2005-02-17 | Eppendorf Array Technologies, S.A. | Detection and quantification of siRNA on microarrays |
| US6859570B2 (en) | 1997-03-14 | 2005-02-22 | Trustees Of Tufts College, Tufts University | Target analyte sensors utilizing microspheres |
| US20050042695A1 (en) | 2003-04-28 | 2005-02-24 | The Regents Of The University Of California | Element-coded affinity tags |
| US6864052B1 (en) | 1999-01-06 | 2005-03-08 | Callida Genomics, Inc. | Enhanced sequencing by hybridization using pools of probes |
| US6867028B2 (en) | 2000-07-24 | 2005-03-15 | Fermentas Ab | Strand-specific polynucleotide nickases |
| US20050064460A1 (en) | 2001-11-16 | 2005-03-24 | Medical Research Council | Emulsion compositions |
| WO2005026387A1 (en) | 2003-09-18 | 2005-03-24 | Nuevolution A/S | A method for obtaining structural information concerning an encoded molecule and method for selecting compounds |
| US20050064432A1 (en) | 2003-09-19 | 2005-03-24 | Linden Technologies, Inc. | Nucleic acid amplification and detection |
| US6872816B1 (en) | 1996-01-24 | 2005-03-29 | Third Wave Technologies, Inc. | Nucleic acid detection kits |
| US6875572B2 (en) | 1996-01-24 | 2005-04-05 | Third Wave Technologies, Inc. | Nucleic acid detection assays |
| US6878515B1 (en) | 1995-06-16 | 2005-04-12 | Ulf Landegren | Ultrasensitive immunoassays |
| US20050079520A1 (en) | 2003-07-21 | 2005-04-14 | Jie Wu | Multiplexed analyte detection |
| US20050095627A1 (en) | 2003-09-03 | 2005-05-05 | The Salk Institute For Biological Studies | Multiple antigen detection assays and reagents |
| US6890741B2 (en) | 2000-02-07 | 2005-05-10 | Illumina, Inc. | Multiplexed detection of analytes |
| WO2005042759A2 (en) | 2003-09-10 | 2005-05-12 | Althea Technologies, Inc. | Expression profiling using microarrays |
| US6897023B2 (en) | 2000-09-27 | 2005-05-24 | The Molecular Sciences Institute, Inc. | Method for determining relative abundance of nucleic acid sequences |
| US20050116161A1 (en) | 2003-10-10 | 2005-06-02 | Protein Discovery, Inc. | Methods and devices for concentration and purification of analytes for chemical analysis including matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) |
| US20050130188A1 (en) | 1997-03-14 | 2005-06-16 | The Trustees Of Tufts College | Methods for detecting target analytes and enzymatic reactions |
| US20050130173A1 (en) | 2003-01-29 | 2005-06-16 | Leamon John H. | Methods of amplifying and sequencing nucleic acids |
| US20050136414A1 (en) | 2003-12-23 | 2005-06-23 | Kevin Gunderson | Methods and compositions for making locus-specific arrays |
| US6911345B2 (en) | 1999-06-28 | 2005-06-28 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences |
| US6911132B2 (en) | 2002-09-24 | 2005-06-28 | Duke University | Apparatus for manipulating droplets by electrowetting-based techniques |
| US6913881B1 (en) | 1996-01-24 | 2005-07-05 | Third Wave Technologies, Inc. | Methods and compositions for detecting target sequences |
| US20050164292A1 (en) | 2001-10-24 | 2005-07-28 | Beckman Coulter, Inc. | Efficient synthesis of protein-oligonucleotide conjugates |
| WO2005067648A2 (en) | 2004-01-08 | 2005-07-28 | Vanderbilt University | Multiplex spatial profiling of gene expression |
| US20050179746A1 (en) | 2004-02-16 | 2005-08-18 | Commissariat A L'energie Atomique | Device for controlling the displacement of a drop between two or several solid substrates |
| US20050191698A1 (en) | 1999-04-20 | 2005-09-01 | Illumina, Inc. | Nucleic acid sequencing using microsphere arrays |
| US20050196786A1 (en) | 2004-01-08 | 2005-09-08 | Vanderbilt University | Multiplex spatial profiling of gene expression |
| US6942968B1 (en) | 1999-08-30 | 2005-09-13 | Illumina, Inc. | Array compositions for improved signal detection |
| CN1680604A (en) | 2004-04-10 | 2005-10-12 | 三星电子株式会社 | A microarray having microarray identification information stored in the form of a spot. method of producing the microarray and method of using the microarray |
| US20050226780A1 (en) | 2003-09-19 | 2005-10-13 | Donald Sandell | Manual seal applicator |
| US20050239192A1 (en) | 2002-08-26 | 2005-10-27 | The Regents Of The University Of California | Hybrid automated continuous nucleic acid and protein analyzer using real-time PCR and liquid bead arrays |
| US20050239119A1 (en) | 2004-04-26 | 2005-10-27 | Canon Kabushiki Kaisha | PCR amplification reaction apparatus and method for PCR amplification reaction using apparatus |
| US20050244850A1 (en) | 2000-06-21 | 2005-11-03 | Hiu Huang | Assembly of arrays on chips segmented from wafers |
| US20050255548A1 (en) | 1998-12-10 | 2005-11-17 | Phylos, Inc. | Protein scaffolds for antibody mimics and other binding proteins |
| US20050257284A1 (en) | 1998-04-30 | 2005-11-17 | Sumitomo Chemical Co., Ltd. | Method for producing transgenic plants resistant to weed control compounds which disrupt the porphyrin pathways of plants |
| US20050260653A1 (en) | 2004-04-14 | 2005-11-24 | Joshua Labaer | Nucleic-acid programmable protein arrays |
| US6969488B2 (en) | 1998-05-22 | 2005-11-29 | Solexa, Inc. | System and apparatus for sequential processing of analytes |
| US6969589B2 (en) | 2001-03-30 | 2005-11-29 | Perlegen Sciences, Inc. | Methods for genomic analysis |
| US20050266417A1 (en) | 2003-09-12 | 2005-12-01 | Francis Barany | Methods for identifying target nucleic acid molecules |
| WO2005113804A1 (en) | 2004-05-20 | 2005-12-01 | Trillion Genomics Limited | Use of mass labelled probes to detect target nucleic acids using mass spectrometry |
| US6977033B2 (en) | 1999-02-12 | 2005-12-20 | Board Of Regents, The University Of Texas System | Method and apparatus for programmable fluidic processing |
| US20060003394A1 (en) | 2004-06-30 | 2006-01-05 | Kimberly-Clark Worldwide, Inc. | Enzymatic detection techniques |
| RU2270254C2 (en) | 2004-04-30 | 2006-02-20 | Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук | Identification of transgenic dna sequences in plant material and products made of the same, oligonucleotide kit and bioarray therefor |
| US7001792B2 (en) | 2000-04-24 | 2006-02-21 | Eagle Research & Development, Llc | Ultra-fast nucleic acid sequencing device and a method for making and using the same |
| US20060039823A1 (en) | 2004-08-17 | 2006-02-23 | Hironobu Yamakawa | Chemical analysis apparatus |
| WO2006020515A1 (en) | 2004-08-09 | 2006-02-23 | Geneohm Sciences, Inc. | Amplification of target nucleotide sequence without polymerase chain reaction |
| US20060046313A1 (en) | 2004-08-26 | 2006-03-02 | Intel Corporation | Cellular analysis using Raman surface scanning |
| US7011944B2 (en) | 1996-01-24 | 2006-03-14 | Third Wave Technologies, Inc. | Invasive cleavage of nucleic acids |
| CN1749752A (en) | 2004-09-17 | 2006-03-22 | 北京大学 | Solution identification and surface addressing protein chip and its preparing and detecting method |
| US20060063160A1 (en) | 2004-09-22 | 2006-03-23 | West Jay A | Microfluidic microarray systems and methods thereof |
| US20060073506A1 (en) | 2004-09-17 | 2006-04-06 | Affymetrix, Inc. | Methods for identifying biological samples |
| US20060079453A1 (en) | 2002-10-03 | 2006-04-13 | John Sidney | Hla binding peptides and their uses |
| US20060084078A1 (en) | 2004-10-15 | 2006-04-20 | Department Of Health And Human Services | Method of identifying active chromatin domains |
| US20060105352A1 (en) | 2004-11-15 | 2006-05-18 | Eastman Kodak Company | Method for sensitive detection of multiple biological analytes |
| US20060110739A1 (en) | 2003-12-12 | 2006-05-25 | Saint Louis University | Biosensors for detecting macromolecules and other analytes |
| US7052244B2 (en) | 2002-06-18 | 2006-05-30 | Commissariat A L'energie Atomique | Device for displacement of small liquid volumes along a micro-catenary line by electrostatic forces |
| WO2006056861A1 (en) | 2004-11-26 | 2006-06-01 | Elettrofor S.A.S. Di Ruggero Massimo E C. | Method and apparatus for the simultaneous separation of biological molecules by two dimensional electrophoresis |
| US7057026B2 (en) | 2001-12-04 | 2006-06-06 | Solexa Limited | Labelled nucleotides |
| WO2006064199A1 (en) | 2004-12-13 | 2006-06-22 | Solexa Limited | Improved method of nucleotide detection |
| WO2006065597A2 (en) | 2004-12-17 | 2006-06-22 | Applera Corporation | Id-tag complexes, arrays, and methods of use thereof |
| US20060134669A1 (en) | 2004-11-19 | 2006-06-22 | Casasanta Vincenzo Iii | Plasmon resonance biosensor and method |
| US20060154286A1 (en) | 2002-09-20 | 2006-07-13 | New England Biolabs, Inc. | Helicase-dependent amplification of nucleic acids |
| WO2006074351A2 (en) | 2005-01-05 | 2006-07-13 | Agencourt Personal Genomics | Reversible nucleotide terminators and uses thereof |
| US20060164490A1 (en) | 2005-01-25 | 2006-07-27 | Chang-Jin Kim | Method and apparatus for promoting the complete transfer of liquid drops from a nozzle |
| WO2006084130A2 (en) | 2005-02-03 | 2006-08-10 | Perkinelmer Las, Inc. | Ultra-sensitive detection systems using multidimension signals |
| US20060188906A1 (en) | 2004-01-20 | 2006-08-24 | Joon-Ho Kim | Microfluidic chip for multiple bioassay and method of manufacturing the same |
| US20060188875A1 (en) | 2001-09-18 | 2006-08-24 | Perlegen Sciences, Inc. | Human genomic polymorphisms |
| US7098041B2 (en) | 2001-12-11 | 2006-08-29 | Kimberly-Clark Worldwide, Inc. | Methods to view and analyze the results from diffraction-based diagnostics |
| US20060194331A1 (en) | 2002-09-24 | 2006-08-31 | Duke University | Apparatuses and methods for manipulating droplets on a printed circuit board |
| US20060199183A1 (en) | 2003-03-13 | 2006-09-07 | Christophe Valat | Probe biochips and methods for use thereof |
| US20060199207A1 (en) | 2005-02-24 | 2006-09-07 | Matysiak Stefan M | Self-assembly of molecules using combinatorial hybridization |
| US20060211001A1 (en) | 2005-03-18 | 2006-09-21 | Wisconsin Alumni Research Foundation | Microdissection-based methods for determining genomic features of single chromosomes |
| US20060216775A1 (en) | 2003-06-17 | 2006-09-28 | The Regents Of The University Of Califoenia | Compositions and methods for analysis and manipulation of enzymes in biosynthetic proteomes |
| US20060216721A1 (en) | 2005-03-25 | 2006-09-28 | Illumina, Inc. | Compositions and methods for detecting protease activity |
| US7118883B2 (en) | 2000-12-28 | 2006-10-10 | Post Genome Institute Co., Ltd. | Process for producing peptides by using in vitro transcription/translation system |
| US20060228758A1 (en) | 2004-09-13 | 2006-10-12 | Xencor, Inc. | Analysis of MHC-peptide binding interactions |
| AU2003200718B2 (en) | 1997-12-15 | 2006-10-19 | Somalogic, Inc. | Nucleic acid ligand diagnostic biochip |
| US20060240439A1 (en) | 2003-09-11 | 2006-10-26 | Smith Geoffrey P | Modified polymerases for improved incorporation of nucleotide analogues |
| US7128893B2 (en) | 2002-05-06 | 2006-10-31 | Endocyte, Inc. | Vitamin-targeted imaging agents |
| WO2006117541A1 (en) | 2005-05-03 | 2006-11-09 | Oxford Gene Technology Ip Limited | Devices and processes for analysing individual cells |
| WO2006124771A2 (en) | 2005-05-12 | 2006-11-23 | Panomics, Inc. | Multiplex branched-chain dna assays |
| US20060263789A1 (en) | 2005-05-19 | 2006-11-23 | Robert Kincaid | Unique identifiers for indicating properties associated with entities to which they are attached, and methods for using |
| US20060275799A1 (en) | 2005-06-01 | 2006-12-07 | Sukanta Banerjee | Creation of functionalized microparticle libraries by oligonucleotide ligation or elongation |
| US20060275782A1 (en) | 1999-04-20 | 2006-12-07 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US20060281109A1 (en) | 2005-05-10 | 2006-12-14 | Barr Ost Tobias W | Polymerases |
| WO2006137733A1 (en) | 2005-06-23 | 2006-12-28 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US20070003954A1 (en) | 2005-05-12 | 2007-01-04 | The Board Of Regents Of The University Of Texas System | Protein and antibody profiling using small molecule microarrays |
| WO2007000669A2 (en) | 2005-06-07 | 2007-01-04 | Centre National De La Recherche Scientifique (Cnrs) | Use of conjugates with linkers cleavable by photodissociation or fragmentation for mass spectrometry analysis of tissue sections |
| US7163612B2 (en) | 2001-11-26 | 2007-01-16 | Keck Graduate Institute | Method, apparatus and article for microfluidic control via electrowetting, for chemical, biochemical and biological assays and the like |
| CN1898398A (en) | 2003-12-29 | 2007-01-17 | 英特尔公司 | Methods for determining nucleotide sequence information |
| US20070014810A1 (en) | 2003-12-31 | 2007-01-18 | Denise Baker | Inducing cellular immune responses to human papillomavirus using peptide and nucleic acid compositions |
| US20070020640A1 (en) | 2005-07-21 | 2007-01-25 | Mccloskey Megan L | Molecular encoding of nucleic acid templates for PCR and other forms of sequence analysis |
| US20070020625A1 (en) | 2001-02-07 | 2007-01-25 | Eric Duchaud | Sequence of the photorhabdus luminescens strain tt01 genome and uses |
| WO2007010251A2 (en) | 2005-07-20 | 2007-01-25 | Solexa Limited | Preparation of templates for nucleic acid sequencing |
| US20070020669A1 (en) | 2005-07-08 | 2007-01-25 | Olof Ericsson | Regulation analysis by cis reactivity, RACR |
| JP2007014297A (en) | 2005-07-11 | 2007-01-25 | Onchip Cellomics Consortium | Cell-constituting substance-fractionally collecting chip, cell-constituting substance-analyzing system and method for analyzing the cell-constituting substance by using them |
| US20070026430A1 (en) | 2005-06-30 | 2007-02-01 | Applera Corporation | Proximity probing of target proteins comprising restriction and/or extension |
| US20070023292A1 (en) | 2005-07-26 | 2007-02-01 | The Regents Of The University Of California | Small object moving on printed circuit board |
| US20070036511A1 (en) | 2005-08-11 | 2007-02-15 | Pacific Biosciences Of California, Inc. | Methods and systems for monitoring multiple optical signals from a single source |
| US20070048812A1 (en) | 2005-09-01 | 2007-03-01 | Moravec Richard A | Cell-based luminogenic and nonluminogenic proteasome assays |
| US20070054288A1 (en) | 2003-09-24 | 2007-03-08 | Intel Corporation | Programmable molecular barcodes |
| WO2007030373A2 (en) | 2005-09-07 | 2007-03-15 | St. Jude Children's Research Hospital | Method for in situ hybridization analysis |
| JP2007074967A (en) | 2005-09-13 | 2007-03-29 | Canon Inc | Identifier probe and nucleic acid amplification method using the same |
| WO2007037678A2 (en) | 2005-09-29 | 2007-04-05 | Keygene N.V. | High throughput screening of mutagenized populations |
| WO2007041689A2 (en) | 2005-10-04 | 2007-04-12 | President And Fellows Of Harvard College | Methods of site-specific labeling of molecules and molecules produced thereby |
| US20070087360A1 (en) | 2005-06-20 | 2007-04-19 | Boyd Victoria L | Methods and compositions for detecting nucleotides |
| US7211414B2 (en) | 2000-12-01 | 2007-05-01 | Visigen Biotechnologies, Inc. | Enzymatic nucleic acid synthesis: compositions and methods for altering monomer incorporation fidelity |
| US20070099208A1 (en) | 2005-06-15 | 2007-05-03 | Radoje Drmanac | Single molecule arrays for genetic and chemical analysis |
| EP1782737A1 (en) | 2005-11-02 | 2007-05-09 | BioPath Automation, L.L.C. | Tissue cassette for transporting |
| US7223371B2 (en) | 2002-03-14 | 2007-05-29 | Micronics, Inc. | Microfluidic channel network device |
| WO2007060599A1 (en) | 2005-11-25 | 2007-05-31 | Koninklijke Philips Electronics N.V. | Magnetic biosensor for determination of enzymic activity |
| US20070128656A1 (en) | 2003-06-26 | 2007-06-07 | University Of South Florida | Direct Fluorescent Label Incorporation Via 1st Strand cDNA Synthesis |
| US20070128624A1 (en) | 2005-11-01 | 2007-06-07 | Gormley Niall A | Method of preparing libraries of template polynucleotides |
| US20070128071A1 (en) | 2002-06-21 | 2007-06-07 | Shea Laurence R | Devices and methods for performing array based assays |
| CN1981188A (en) | 2004-05-06 | 2007-06-13 | 科隆迪亚戈芯片技术有限公司 | Device and method for detecting molecular interactions |
| US20070134723A1 (en) | 2005-12-09 | 2007-06-14 | Illumina, Inc. | Compositions and methods for detecting phosphomonoester |
| US20070141718A1 (en) | 2005-12-19 | 2007-06-21 | Bui Huy A | Reduction of scan time in imaging mass spectrometry |
| WO2007073165A1 (en) | 2005-12-22 | 2007-06-28 | Keygene N.V. | Method for high-throughput aflp-based polymorphism detection |
| WO2007073171A2 (en) | 2005-12-22 | 2007-06-28 | Keygene N.V. | Improved strategies for transcript profiling using high throughput sequencing technologies |
| WO2007073271A1 (en) | 2005-12-23 | 2007-06-28 | Telefonaktiebolaget Lm Ericsson (Publ) | Method and apparatus for solving data packet traffic congestion. |
| WO2007076128A2 (en) | 2005-12-23 | 2007-07-05 | Nanostring Technologies, Inc. | Nanoreporters and methods of manufacturing and use thereof |
| US20070161020A1 (en) | 2005-11-10 | 2007-07-12 | Panomics, Inc. | Detection of nucleic acids through amplification of surrogate nucleic acids |
| US20070161029A1 (en) | 2005-12-05 | 2007-07-12 | Panomics, Inc. | High throughput profiling of methylation status of promoter regions of genes |
| WO2007076726A1 (en) | 2006-01-04 | 2007-07-12 | Si Lok | Methods for nucleic acid mapping and identification of fine-structural-variations in nucleic acids and utilities |
| US7244559B2 (en) | 1999-09-16 | 2007-07-17 | 454 Life Sciences Corporation | Method of sequencing a nucleic acid |
| US20070166725A1 (en) | 2006-01-18 | 2007-07-19 | The Regents Of The University Of California | Multiplexed diagnostic platform for point-of care pathogen detection |
| US20070166705A1 (en) | 2002-08-23 | 2007-07-19 | John Milton | Modified nucleotides |
| US20070172873A1 (en) | 2006-01-23 | 2007-07-26 | Sydney Brenner | Molecular counting |
| US20070178503A1 (en) | 2005-12-19 | 2007-08-02 | Feng Jiang | In-situ genomic DNA chip for detection of cancer |
| US7255994B2 (en) | 2003-06-10 | 2007-08-14 | Applera Corporation | Ligation assay |
| US7259258B2 (en) | 2003-12-17 | 2007-08-21 | Illumina, Inc. | Methods of attaching biological compounds to solid supports using triazine |
| US7258976B2 (en) * | 1997-12-22 | 2007-08-21 | Hitachi Chemical Co. Ltd. | Method of preparing cell lysate |
| US20070207482A1 (en) | 2004-08-04 | 2007-09-06 | President And Fellows Of Harvard College | Wobble sequencing |
| US20070215466A1 (en) | 2006-03-17 | 2007-09-20 | Jun Okada | Nucleic acid detection device and nucleic acid detection apparatus |
| US20070231823A1 (en) | 2006-03-23 | 2007-10-04 | Mckernan Kevin J | Directed enrichment of genomic DNA for high-throughput sequencing |
| WO2007114693A2 (en) | 2006-04-04 | 2007-10-11 | Keygene N.V. | High throughput detection of molecular markers based on aflp and high throughput sequencing |
| US7282328B2 (en) | 2002-09-20 | 2007-10-16 | New England Biolabs, Inc. | Helicase dependent amplification of nucleic acids |
| US20070243634A1 (en) | 2006-04-18 | 2007-10-18 | Pamula Vamsee K | Droplet-based surface modification and washing |
| WO2007120241A2 (en) | 2006-04-18 | 2007-10-25 | Advanced Liquid Logic, Inc. | Droplet-based biochemistry |
| US20070254305A1 (en) | 2006-04-28 | 2007-11-01 | Nsabp Foundation, Inc. | Methods of whole genome or microarray expression profiling using nucleic acids prepared from formalin fixed paraffin embedded tissue |
| US20070251824A1 (en) | 2006-01-24 | 2007-11-01 | Perkinelmer Las, Inc. | Multiplexed analyte quantitation by two-dimensional planar electrochromatography |
| US20070264656A1 (en) | 2006-05-15 | 2007-11-15 | Canon Kabushiki Kaisha | Method of manufacturing probe-immobilized carrier |
| US7297518B2 (en) | 2001-03-12 | 2007-11-20 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension |
| US20070269805A1 (en) | 2003-09-02 | 2007-11-22 | Keygene N.V. | Ola-Based Methods for the Detection of Target Nucleic Avid Sequences |
| US20070280517A1 (en) | 2005-06-21 | 2007-12-06 | De La Torre-Bueno Jose | Serial section analysis for computer-controlled microscopic imaging |
| WO2007139766A2 (en) | 2006-05-22 | 2007-12-06 | Nanostring Technologies, Inc. | Systems and methods for analyzing nanoreporters |
| WO2007145612A1 (en) | 2005-06-06 | 2007-12-21 | 454 Life Sciences Corporation | Paired end sequencing |
| US7315019B2 (en) | 2004-09-17 | 2008-01-01 | Pacific Biosciences Of California, Inc. | Arrays of optical confinements and uses thereof |
| US20080003586A1 (en) | 2006-06-30 | 2008-01-03 | Searete Llc | Method of combing a nucleic acid |
| US20080009420A1 (en) | 2006-03-17 | 2008-01-10 | Schroth Gary P | Isothermal methods for creating clonal single molecule arrays |
| EP1878502A1 (en) | 2006-07-14 | 2008-01-16 | Roche Diagnostics GmbH | Instrument for heating and cooling |
| US20080032301A1 (en) | 2006-03-30 | 2008-02-07 | Pacific Biosciences Of California, Inc. | Articles having localized molecules disposed thereon and methods of producing same |
| US7329492B2 (en) | 2000-07-07 | 2008-02-12 | Visigen Biotechnologies, Inc. | Methods for real-time single molecule sequence determination |
| US7328979B2 (en) | 2003-11-17 | 2008-02-12 | Koninklijke Philips Electronics N.V. | System for manipulation of a body of fluid |
| US20080038734A1 (en) | 1999-10-29 | 2008-02-14 | Stratagene California | Compositions and methods for the detection of a nucleic acid using a cleavage reaction |
| WO2008022332A2 (en) | 2006-08-18 | 2008-02-21 | Board Of Regents, The University Of Texas System | System, method and kit for replicating a dna array |
| US20080047835A1 (en) | 2006-08-22 | 2008-02-28 | Macconnell William P | Genomic DNA Purifier |
| CN101142325A (en) | 2005-03-08 | 2008-03-12 | 灵维泰公司 | Method for preparing polynucleotide for analysis |
| US20080071071A1 (en) | 2006-06-29 | 2008-03-20 | President And Fellows Of Harvard College | Evaluating proteins |
| US7358047B2 (en) | 1998-12-15 | 2008-04-15 | Qiagen Gmbh | Methods of forming circular nucleic acid probes and uses thereof |
| US20080108804A1 (en) | 2006-11-02 | 2008-05-08 | Kabushiki Kaisha Dnaform | Method for modifying RNAS and preparing DNAS from RNAS |
| US20080108082A1 (en) | 2006-10-23 | 2008-05-08 | Pacific Biosciences Of California, Inc. | Polymerase enzymes and reagents for enhanced nucleic acid sequencing |
| US7375234B2 (en) | 2002-05-30 | 2008-05-20 | The Scripps Research Institute | Copper-catalysed ligation of azides and acetylenes |
| EP1923471A1 (en) | 1999-04-20 | 2008-05-21 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US7378242B2 (en) | 2004-03-18 | 2008-05-27 | Atom Sciences, Inc. | DNA sequence detection by limited primer extension |
| US20080124252A1 (en) | 2004-07-08 | 2008-05-29 | Commissariat A L'energie Atomique | Droplet Microreactor |
| US20080124810A1 (en) | 2006-05-10 | 2008-05-29 | Dxterity Diagnostics | Detection of nucleic acid targets using chemically reactive oligonucleotide probes |
| US20080132429A1 (en) | 2006-05-23 | 2008-06-05 | Uchicago Argonne | Biological microarrays with enhanced signal yield |
| US20080128627A1 (en) | 2006-09-01 | 2008-06-05 | Pacific Biosciences Of California, Inc. | Substrates, systems and methods for analyzing materials |
| WO2008069906A2 (en) | 2006-11-14 | 2008-06-12 | The Regents Of The University Of California | Digital expression of gene analysis |
| US20080145616A1 (en) | 2006-07-10 | 2008-06-19 | Morteza Gharib | Method for selectively anchoring large numbers of nanoscale structures |
| US20080145378A1 (en) | 2005-01-25 | 2008-06-19 | Huib Ovaa | Means and Methods for Breaking Noncovalent Binding Interactions Between Molecules |
| CN101205560A (en) | 2007-11-30 | 2008-06-25 | 李松 | High-throughput single nucleotide polymorphism detecting method based on magnetic nano-particles and universal label technique |
| US20080153086A1 (en) | 2003-08-08 | 2008-06-26 | Wong Albert J | Method For Rapid Identification of Alternative Splicing |
| US7393665B2 (en) | 2005-02-10 | 2008-07-01 | Population Genetics Technologies Ltd | Methods and compositions for tagging and identifying polynucleotides |
| CN101221182A (en) | 2007-01-08 | 2008-07-16 | 山东司马特生物芯片有限公司 | Novel method for blood serum tumor series diagnosis by fluorescent protein chip |
| US7405281B2 (en) | 2005-09-29 | 2008-07-29 | Pacific Biosciences Of California, Inc. | Fluorescent nucleotide analogs and uses therefor |
| US7407757B2 (en) | 2005-02-10 | 2008-08-05 | Population Genetics Technologies | Genetic analysis by sequence-specific sorting |
| US20080199929A1 (en) * | 2005-05-20 | 2008-08-21 | Richard Yeung | Method and System For Collecting Cells Following Laser Microdissection |
| US20080220981A1 (en) | 1997-09-02 | 2008-09-11 | Rowett Research Institute | Chimeric binding peptide library screening method |
| US20080220434A1 (en) | 2007-02-07 | 2008-09-11 | Perscitus Biosciences, Llc | Detection Of Molecule Proximity |
| US7427678B2 (en) | 1998-01-08 | 2008-09-23 | Sigma-Aldrich Co. | Method for immobilizing oligonucleotides employing the cycloaddition bioconjugation method |
| US20080261204A1 (en) | 2004-01-23 | 2008-10-23 | Lingvitae As | Polynucleotide Ligation Reactions |
| US20080280773A1 (en) | 2004-12-13 | 2008-11-13 | Milan Fedurco | Method of Nucleotide Detection |
| US7456012B2 (en) | 1997-11-06 | 2008-11-25 | Cellectricon Ab | Method and apparatus for spatially confined electroporation |
| US20080293046A1 (en) | 1996-01-24 | 2008-11-27 | Third Wave Technologies, Inc. | RNA detection assays |
| US20080293591A1 (en) | 2005-06-09 | 2008-11-27 | Taussig Michael J | Repeatable Protein Arrays |
| US20080312103A1 (en) | 2004-10-15 | 2008-12-18 | Japan Science And Technology Agency | Linker For Constructing Mrna-Puromycin-Protein Conjugate |
| WO2008157801A2 (en) | 2007-06-21 | 2008-12-24 | Gen-Probe Incorporated | Instrument and receptacles for performing processes |
| US20090005252A1 (en) | 2006-02-24 | 2009-01-01 | Complete Genomics, Inc. | High throughput genome sequencing on DNA arrays |
| US20090006002A1 (en) | 2007-04-13 | 2009-01-01 | Sequenom, Inc. | Comparative sequence analysis processes and systems |
| KR20090000812A (en) | 2007-04-04 | 2009-01-08 | 엔에이치엔(주) | Automatic file creation method and device |
| US20090018024A1 (en) | 2005-11-14 | 2009-01-15 | President And Fellows Of Harvard College | Nanogrid rolling circle dna sequencing |
| US20090023148A1 (en) | 2005-09-21 | 2009-01-22 | Moyle William R | Sensors for biomolecular detection and cell classification |
| US20090026082A1 (en) | 2006-12-14 | 2009-01-29 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes using large scale FET arrays |
| JP2009036694A (en) | 2007-08-03 | 2009-02-19 | Tokyo Medical & Dental Univ | Method for analyzing intracellular biological material with spatial distribution |
| US7499806B2 (en) | 2002-02-14 | 2009-03-03 | Illumina, Inc. | Image processing in microsphere arrays |
| US20090062148A1 (en) | 1996-04-17 | 2009-03-05 | Affymetrix, Inc. | Substrate preparation process |
| US7501245B2 (en) | 1999-06-28 | 2009-03-10 | Helicos Biosciences Corp. | Methods and apparatuses for analyzing polynucleotide sequences |
| WO2009032167A1 (en) | 2007-08-29 | 2009-03-12 | Illumina Cambridge | Method for sequencing a polynucleotide template |
| US20090082212A1 (en) | 1998-12-14 | 2009-03-26 | Pacific Biosciences | System and methods for nucleic acid sequencing of single molecules by polymerase synthesis |
| WO2009036525A2 (en) | 2007-09-21 | 2009-03-26 | Katholieke Universiteit Leuven | Tools and methods for genetic tests using next generation sequencing |
| US20090099041A1 (en) | 2006-02-07 | 2009-04-16 | President And Fellows Of Harvard College | Methods for making nucleotide probes for sequencing and synthesis |
| US20090105959A1 (en) | 2007-06-01 | 2009-04-23 | Braverman Michael S | System and method for identification of individual samples from a multiplex mixture |
| US20090117573A1 (en) | 2007-09-14 | 2009-05-07 | Affymetrix, Inc. | Locus specific amplification using array probes |
| US7534991B2 (en) | 2007-07-10 | 2009-05-19 | Cambridge Research & Instrumentation, Inc. | Athermalized birefringent filter apparatus and method |
| US20090127589A1 (en) | 2006-12-14 | 2009-05-21 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes using large scale FET arrays |
| US7544473B2 (en) | 2006-01-23 | 2009-06-09 | Population Genetics Technologies Ltd. | Nucleic acid analysis using sequence tokens |
| US7547380B2 (en) | 2003-01-13 | 2009-06-16 | North Carolina State University | Droplet transportation devices and methods having a fluid surface |
| US20090155781A1 (en) | 2006-02-24 | 2009-06-18 | Complete Genomics, Inc. | High throughput genome sequencing on DNA arrays |
| US7555155B2 (en) | 2005-01-27 | 2009-06-30 | Cambridge Research & Instrumentation, Inc. | Classifying image features |
| US20090169089A1 (en) | 2005-05-16 | 2009-07-02 | Isis Innovation Limited | Cell Analysis |
| US7561336B2 (en) | 2005-06-10 | 2009-07-14 | Ricoh Company, Ltd. | Micro-optical device, spatial optical modulator and projector utilizing the micro-optical device |
| US20090181375A1 (en) | 2008-01-11 | 2009-07-16 | Peter Brian J | Method for detection of nucleic acid barcodes |
| KR20090081260A (en) | 2008-01-23 | 2009-07-28 | 삼성전자주식회사 | Micro array hybridization detection method |
| US20090192044A1 (en) | 2004-07-09 | 2009-07-30 | Commissariat A L'energie Atomique | Electrode addressing method |
| US20090197326A1 (en) | 2002-09-16 | 2009-08-06 | The Board Of Trustees Of The Leland Stanford Junior University | Biological Analysis Arrangement and Approach Therefor |
| US20090202998A1 (en) | 2005-12-16 | 2009-08-13 | Qiagen Gmbh | Method for the extraction of biomolecules from fixed tissues |
| US7579153B2 (en) | 2005-01-25 | 2009-08-25 | Population Genetics Technologies, Ltd. | Isothermal DNA amplification |
| US20090215633A1 (en) | 2006-03-01 | 2009-08-27 | Keygene N.V. | High throughput sequence-based detection of snps using ligation assays |
| US7582420B2 (en) | 2001-07-12 | 2009-09-01 | Illumina, Inc. | Multiplex nucleic acid reactions |
| CN101522915A (en) | 2006-08-02 | 2009-09-02 | 加州理工学院 | Methods and systems for detecting and/or sorting targets |
| US20090233802A1 (en) | 2007-02-02 | 2009-09-17 | Helen Bignell | Methods for indexing samples and sequencing multiple polynucleotide templates |
| US20090239232A1 (en) | 2008-03-21 | 2009-09-24 | Nugen Technologies Inc | Methods of rna amplification in the presence of dna |
| US20090253582A1 (en) | 2006-06-29 | 2009-10-08 | Ge Healthcare Bio-Sciences Ab | Chamber apparatus |
| US20090253163A1 (en) | 2008-04-02 | 2009-10-08 | General Electric Company | Iterative staining of biological samples |
| US7601498B2 (en) | 2005-03-17 | 2009-10-13 | Biotium, Inc. | Methods of using dyes in association with nucleic acid staining or detection and associated technology |
| US7608434B2 (en) | 2004-08-04 | 2009-10-27 | Wisconsin Alumni Research Foundation | Mutated Tn5 transposase proteins and the use thereof |
| US7611869B2 (en) | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
| US20090280487A1 (en) | 2003-11-21 | 2009-11-12 | Gene Hung | Methods for producing olfactory gpcrs |
| US20090283407A1 (en) | 2008-05-15 | 2009-11-19 | Gaurav Jitendra Shah | Method for using magnetic particles in droplet microfluidics |
| US20090291854A1 (en) | 2006-07-05 | 2009-11-26 | Austrian Research Centers Gmbh - Arc | Identification of Pathogens |
| US20090289184A1 (en) | 2008-05-14 | 2009-11-26 | Soren-Oliver Deininger | Method for the analysis of tissue sections |
| US20090305237A1 (en) | 2005-05-26 | 2009-12-10 | Trustees Of Boston University | Quantification of nucleic acids and proteins using oligonucleotide mass tags |
| US7635566B2 (en) | 2007-06-29 | 2009-12-22 | Population Genetics Technologies Ltd. | Methods and compositions for isolating nucleic acid sequence variants |
| WO2009152928A2 (en) | 2008-05-28 | 2009-12-23 | Genxpro Gmbh | Method for the quantitative analysis of nucleic acids, markers therefor and their use |
| WO2009156725A1 (en) | 2008-06-24 | 2009-12-30 | Trillion Genomics Limited | Characterising planar samples by mass spectrometry |
| US20090321262A1 (en) | 2006-07-10 | 2009-12-31 | Sakuichiro Adachi | Liquid transfer device |
| US20100009871A1 (en) | 2006-06-23 | 2010-01-14 | Mark Reed | Devices and systems for creation of dna cluster arrays |
| US20100014537A1 (en) | 2004-03-30 | 2010-01-21 | Sagem Sa | Method of exchanging information between two networks operating under different routing protocols |
| US7655898B2 (en) | 2006-11-30 | 2010-02-02 | Cambridge Research & Instrumentation, Inc. | Optical filter assembly with selectable bandwidth and rejection |
| US20100035249A1 (en) | 2008-08-05 | 2010-02-11 | Kabushiki Kaisha Dnaform | Rna sequencing and analysis using solid support |
| WO2010019826A1 (en) | 2008-08-14 | 2010-02-18 | Nanostring Technologies, Inc | Stable nanoreporters |
| US7666612B2 (en) | 2003-05-23 | 2010-02-23 | Epfl-Ecole Polytechnique Federale De Lausanne | Methods for protein labeling based on acyl carrier protein |
| US20100055733A1 (en) | 2008-09-04 | 2010-03-04 | Lutolf Matthias P | Manufacture and uses of reactive microcontact printing of biomolecules on soft hydrogels |
| US7674752B2 (en) | 2000-08-15 | 2010-03-09 | Discema Limited | Functional protein arrays |
| EP2161336A1 (en) | 2005-05-09 | 2010-03-10 | ONO Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| WO2010027870A2 (en) | 2008-08-26 | 2010-03-11 | Fluidigm Corporation | Assay methods for increased throughput of samples and/or targets |
| US20100069263A1 (en) | 2008-09-12 | 2010-03-18 | Washington, University Of | Sequence tag directed subassembly of short sequencing reads into long sequencing reads |
| US7700286B2 (en) | 2005-04-06 | 2010-04-20 | Maurice Stroun | Method for the detection of cancer |
| US20100096266A1 (en) | 2006-11-02 | 2010-04-22 | The Regents Of The University Of California | Method and apparatus for real-time feedback control of electrical manipulation of droplets on chip |
| US20100099103A1 (en) | 2008-09-30 | 2010-04-22 | Abbott Laboratories | Antibody Libraries |
| US20100105052A1 (en) | 2007-10-29 | 2010-04-29 | Complete Genomics, Inc. | Nucleic acid sequencing and process |
| US20100105112A1 (en) | 2006-08-07 | 2010-04-29 | Christian Holtze | Fluorocarbon emulsion stabilizing surfactants |
| US7709198B2 (en) | 2005-06-20 | 2010-05-04 | Advanced Cell Diagnostics, Inc. | Multiplex detection of nucleic acids |
| US20100113302A1 (en) | 2007-02-12 | 2010-05-06 | Proteonova, Inc | GENERATION OF LIBRARY OF SOLUBLE RANDOM POLYPEPTIDES LINKED TO mRNA |
| US20100111768A1 (en) | 2006-03-31 | 2010-05-06 | Solexa, Inc. | Systems and devices for sequence by synthesis analysis |
| US20100120043A1 (en) | 2006-11-16 | 2010-05-13 | General Electric Company | Sequential analysis of biological samples |
| US20100120097A1 (en) | 2008-05-30 | 2010-05-13 | Board Of Regents, The University Of Texas System | Methods and compositions for nucleic acid sequencing |
| US20100120098A1 (en) | 2008-10-24 | 2010-05-13 | Epicentre Technologies Corporation | Transposon end compositions and methods for modifying nucleic acids |
| WO2010053587A2 (en) | 2008-11-07 | 2010-05-14 | Mlc Dx Incorporated | Methods of monitoring conditions by sequence analysis |
| US20100129874A1 (en) | 2008-09-05 | 2010-05-27 | The Washington University | Method for multiplexed nucleic acid patch polymerase chain reaction |
| US20100126862A1 (en) | 2008-10-08 | 2010-05-27 | Sage Science, Inc. | Multichannel preparative electrophoresis system |
| US20100137143A1 (en) | 2008-10-22 | 2010-06-03 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes |
| WO2010060439A1 (en) | 2008-11-03 | 2010-06-03 | Stichting Sanquin Bloedvoorziening | Detecting antigen responsive cells in a sample |
| US20100145037A1 (en) | 2001-11-13 | 2010-06-10 | Rubicon Genomics, Inc. | Dna amplification and sequencing using dna molecules generated by random fragmentation |
| US20100151511A1 (en) | 2008-10-28 | 2010-06-17 | Millipore Corporation | Biological culture assembly |
| US20100151447A1 (en) | 2008-12-17 | 2010-06-17 | Cornell University | Method for double staining in immunohistochemistry |
| US20100159446A1 (en) | 2007-07-27 | 2010-06-24 | Haff Lawrence A | Detection Assays and Use Thereof |
| US7754429B2 (en) | 2006-10-06 | 2010-07-13 | Illumina Cambridge Limited | Method for pair-wise sequencing a plurity of target polynucleotides |
| US20100184618A1 (en) | 2009-01-16 | 2010-07-22 | Affymetrix, Inc. | Dna ligation on rna template |
| US20100184614A1 (en) | 2007-05-23 | 2010-07-22 | Zheng Ye | Microarray systems and methods for identifying dna-binding proteins |
| US7776567B2 (en) | 2005-03-17 | 2010-08-17 | Biotium, Inc. | Dimeric and trimeric nucleic acid dyes, and associated systems and methods |
| US20100210475A1 (en) | 2009-02-11 | 2010-08-19 | Samsung Electronics Co., Ltd. | Microarray having bright fiducial mark and method of obtaining optical data from the mircoarray |
| US7785869B2 (en) | 2003-09-19 | 2010-08-31 | Microfluidic Systems, Inc. | Sonication to selectively lyse different cell types |
| US20100267590A1 (en) | 2002-01-22 | 2010-10-21 | Grace Bio-Labs, Inc. | Reaction Surface Array Diagnostic Apparatus |
| US20100273219A1 (en) | 2009-04-02 | 2010-10-28 | Fluidigm Corporation | Multi-primer amplification method for barcoding of target nucleic acids |
| US20100273679A1 (en) | 2007-09-14 | 2010-10-28 | Twof, Inc | Methods for the preparation of dna microarrays with linear high density probes |
| WO2010126614A2 (en) | 2009-04-30 | 2010-11-04 | Good Start Genetics, Inc. | Methods and compositions for evaluating genetic markers |
| WO2010127186A1 (en) | 2009-04-30 | 2010-11-04 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US20100282617A1 (en) | 2006-12-14 | 2010-11-11 | Ion Torrent Systems Incorporated | Methods and apparatus for detecting molecular interactions using fet arrays |
| US7844940B2 (en) | 2007-02-13 | 2010-11-30 | Samsung Electronics Co., Ltd. | Mask set for microarray, method of fabricating mask set, and method of fabricating microarray using mask set |
| US20100303722A1 (en) | 2006-06-23 | 2010-12-02 | Sungho Jin | Articles comprising large-surface-area bio-compatible materials and methods for making and using them |
| US7848553B2 (en) | 2003-08-08 | 2010-12-07 | General Electric Company | Method and apparatus of multi-modality image fusion |
| WO2011008502A2 (en) | 2009-06-29 | 2011-01-20 | California Institute Of Technology | Isolation of unknown rearranged t-cell receptors from single cells |
| RU2410439C1 (en) * | 2009-07-06 | 2011-01-27 | Российская Федерация, От Имени Которой Выступает Министерство Образования И Науки Российской Федерации | Method for ablation of target dna from surface of dna biochips |
| US20110027772A1 (en) | 2009-07-30 | 2011-02-03 | Korea Institute Of Science And Technology | Antigen Detection Kit and Method |
| US20110028685A1 (en) | 2006-06-30 | 2011-02-03 | Applera Corporation. | Analyte Determination Utilizing Mass Tagging Reagents Comprising A Non-Encoded Detectable Label |
| US20110024511A1 (en) | 2008-03-18 | 2011-02-03 | Manfred Rietzler | Layered composite for a card body and method for producing the layered composite |
| WO2011014879A2 (en) | 2009-07-31 | 2011-02-03 | Prognosys Biosciences, Inc. | Assay tools and methods of use |
| US20110033854A1 (en) | 2007-12-05 | 2011-02-10 | Complete Genomics, Inc. | Methods and compositions for long fragment read sequencing |
| US20110048951A1 (en) | 2007-06-27 | 2011-03-03 | Digital Biosystems | Digital microfluidics based apparatus for heat-exchanging chemical processes |
| US20110059865A1 (en) | 2004-01-07 | 2011-03-10 | Mark Edward Brennan Smith | Modified Molecular Arrays |
| US7910304B2 (en) | 2003-02-26 | 2011-03-22 | Callida Genomics, Inc. | Random array DNA analysis by hybridization |
| US20110086774A1 (en) | 2009-10-13 | 2011-04-14 | Dunaway Dwayne L | Protein Detection Via Nanoreporters |
| US20110111409A1 (en) | 2009-11-10 | 2011-05-12 | Dominick Sinicropi | Methods for depleting rna from nucleic acid samples |
| WO2011062933A2 (en) | 2009-11-18 | 2011-05-26 | Raybiotech, Inc. | Array-based proximity ligation association assays |
| WO2011071943A1 (en) | 2009-12-07 | 2011-06-16 | Prognosys Biosciences, Inc. | Peptide display arrays |
| US20110177518A1 (en) | 2010-01-21 | 2011-07-21 | Kartalov Emil P | Methods and devices for micro-isolation, extraction, and/or analysis of microscale components |
| EP2350648A2 (en) | 2008-09-22 | 2011-08-03 | Biomicro, Inc. | Selective processing of biological material on a microarray substrate |
| US20110201515A1 (en) | 2010-02-11 | 2011-08-18 | Webster Philippa J | Compositions and methods for the detection of small rnas |
| WO2011102903A1 (en) | 2010-02-18 | 2011-08-25 | Bima Limited | Immobilised-bead immunomultiplex assay |
| US20110207134A1 (en) | 2008-11-07 | 2011-08-25 | Sequenta, Inc. | Monitoring health and disease status using clonotype profiles |
| US20110223613A1 (en) | 2008-09-04 | 2011-09-15 | Commissariat A L'energie Atomique Et Aux Energies Alternatives (Cea) | Method of imaging by mass spectrometry and new mass tag associated trityl derivatives |
| JP2011182702A (en) | 2010-03-08 | 2011-09-22 | Tokyo Univ Of Agriculture & Technology | Fused mhc molecule connecting magnetic fine particle, method for screening antigen peptide, recombinant vector and transformant of magnetic bacterium |
| US8030477B2 (en) | 1998-02-23 | 2011-10-04 | Wisconsin Alumni Research Foundation | Methods for the synthesis of arrays of DNA probes |
| US20110245101A1 (en) | 2010-04-05 | 2011-10-06 | Prognosys Biosciences, Inc. | Co-localization affinity assays |
| US20110244448A1 (en) | 2008-09-08 | 2011-10-06 | Masataka Shirai | Dna detecting apparatus, dna detecting device and dna detecting method |
| US20110245111A1 (en) | 2010-04-05 | 2011-10-06 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20110269647A1 (en) | 2010-04-28 | 2011-11-03 | Medical Research Council | Method |
| US20110275077A1 (en) | 2009-01-12 | 2011-11-10 | William James | Oligonucleotide-Coated Affinity Membranes and Uses Thereof |
| WO2011143583A1 (en) | 2010-05-13 | 2011-11-17 | Illumina, Inc. | Binding assays for markers |
| US8076063B2 (en) | 2000-02-07 | 2011-12-13 | Illumina, Inc. | Multiplexed methylation detection methods |
| WO2011155833A2 (en) | 2010-06-09 | 2011-12-15 | Keygene N.V. | Combinatorial sequence barcodes for high throughput screening |
| US8092784B2 (en) | 2005-11-30 | 2012-01-10 | Biotium, Inc. | Enzyme substrate comprising a functional dye and associated technology and methods |
| US20120010091A1 (en) | 2009-03-30 | 2012-01-12 | Illumina, Inc. | Gene expression analysis in single cells |
| US20120021930A1 (en) | 2005-11-22 | 2012-01-26 | Stichting Dienst Landbouwkundig Onderzoek | Multiplex Nucleic Acid Detection |
| US20120046178A1 (en) | 2008-10-30 | 2012-02-23 | Sequenom, Inc. | Products and processes for multiplex nucleic acid identification |
| US20120046175A1 (en) | 2007-10-23 | 2012-02-23 | Matthew Rodesch | Methods and systems for solution based sequence enrichment |
| WO2012022975A1 (en) | 2010-08-17 | 2012-02-23 | Isis Innovation Limited | Identification of ligands and their use |
| US8124751B2 (en) | 2005-03-08 | 2012-02-28 | California Institute Of Technology | Hybridization chain reaction amplification for in situ imaging |
| US20120077693A1 (en) | 2010-09-29 | 2012-03-29 | Hospices Civils De Lyon (Hcl) | Method and kit for establishing an in vitro prognosis on a patient exhibiting sirs |
| US8148518B2 (en) | 2007-02-14 | 2012-04-03 | Eastman Chemical Company | Cellulose esters and their production in carboxylated ionic liquids |
| WO2012048341A1 (en) * | 2010-10-08 | 2012-04-12 | President And Fellows Of Harvard College | High-throughput single cell barcoding |
| WO2012049316A1 (en) | 2010-10-15 | 2012-04-19 | Olink Ab | Dynamic range methods |
| WO2012058096A1 (en) | 2010-10-27 | 2012-05-03 | Illumina, Inc. | Microdevices and biosensor cartridges for biological or chemical analysis and systems and methods for the same |
| WO2012061832A1 (en) | 2010-11-05 | 2012-05-10 | Illumina, Inc. | Linking sequence reads using paired code tags |
| WO2012071428A2 (en) | 2010-11-22 | 2012-05-31 | Solulink, Inc. | Methods and/or use of oligonucleotide conjugates for assays and detections |
| US20120142014A1 (en) | 2010-03-08 | 2012-06-07 | California Institute Of Technology | Molecular indicia of cellular constituents and resolving the same by super-resolution technologies in single cells |
| US8198028B2 (en) * | 2008-07-02 | 2012-06-12 | Illumina Cambridge Limited | Using populations of beads for the fabrication of arrays on surfaces |
| US8199999B2 (en) | 2008-06-17 | 2012-06-12 | Cambridge Research & Instrumentation, Inc. | Image classifier training |
| WO2012083225A2 (en) | 2010-12-16 | 2012-06-21 | Gigagen, Inc. | System and methods for massively parallel analysis of nycleic acids in single cells |
| US20120157322A1 (en) | 2010-09-24 | 2012-06-21 | Samuel Myllykangas | Direct Capture, Amplification and Sequencing of Target DNA Using Immobilized Primers |
| US8207093B2 (en) | 1997-01-21 | 2012-06-26 | The General Hospital Corporation | Selection of proteins using RNA-protein fusions |
| US20120160683A1 (en) | 2009-09-01 | 2012-06-28 | Zheng Ye | Reversible current gel electrophoresis device for separating biological macromolecules |
| US20120196297A1 (en) | 2009-07-14 | 2012-08-02 | Yost Richard A | Mass tags for mass spectrometric analysis of immunoglobulins |
| US20120195810A1 (en) | 2009-10-02 | 2012-08-02 | Fluidigm Corporation | Microfluidic devices with removable cover and methods of fabrication and application |
| US20120202704A1 (en) | 2009-12-07 | 2012-08-09 | Illumina, Inc. | Multi-sample indexing for multiplex genotyping |
| US20120220479A1 (en) | 2009-07-23 | 2012-08-30 | Agilent Technologies, Inc. | Probes for specific analysis of nucleic acids |
| US8268554B2 (en) | 2006-03-20 | 2012-09-18 | Olink Ab | Method for analyte detection using proximity probes |
| US20120245053A1 (en) | 2009-12-04 | 2012-09-27 | Hitachi, Ltd. | GENE EXPRESSION ANALYSIS METHOD USING TWO DIMENSIONAL cDNA LIBRARY |
| WO2012129242A2 (en) | 2011-03-23 | 2012-09-27 | Pacific Biosciences Of California, Inc. | Isolation of polymerase-nucleic acid complexes and loading onto substrates |
| US8278034B2 (en) | 2000-06-22 | 2012-10-02 | Nuclea Biotechnologies, Inc. | Methods of making frozen tissue microarrays |
| US20120252702A1 (en) | 2009-12-15 | 2012-10-04 | Agency For Science, Technology And Research | Processing of amplified dna fragments for sequencing |
| WO2012139110A2 (en) | 2011-04-08 | 2012-10-11 | Prognosys Biosciences, Inc. | Peptide constructs and assay systems |
| US8288122B2 (en) | 2008-12-03 | 2012-10-16 | The United States Of America As Represented By The Department Of Veterans Affairs | Pressure-assisted molecular recovery (PAMR) of biomolecules, pressure-assisted antigen retrieval (PAAR), and pressure-assisted tissue histology (PATH) |
| WO2012140224A1 (en) | 2011-04-13 | 2012-10-18 | Jonas Frisen | Method and product for localised or spatial detection of nucleic acid in a tissue sample |
| WO2012142213A2 (en) | 2011-04-15 | 2012-10-18 | The Johns Hopkins University | Safe sequencing system |
| US20120270305A1 (en) | 2011-01-10 | 2012-10-25 | Illumina Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
| WO2012148477A1 (en) | 2010-12-15 | 2012-11-01 | Cellular Research, Inc. | Digital counting of individual molecules by stochastic attachment of diverse label-tags |
| US20120279954A1 (en) | 2008-02-15 | 2012-11-08 | Bio-Rad Laboratories, Inc., LSG - GXD Division | Thermal cycler with self-adjusting lid |
| CN202548048U (en) | 2011-01-10 | 2012-11-21 | 伊鲁米那股份有限公司 | Flow cell and jet device for analyzing samples |
| WO2012159089A1 (en) | 2011-05-19 | 2012-11-22 | Sequenom, Inc. | Products and processes for multiplex nucleic acid identification |
| US20120301925A1 (en) | 2011-05-23 | 2012-11-29 | Alexander S Belyaev | Methods and compositions for dna fragmentation and tagging by transposases |
| US8330087B2 (en) | 2007-10-16 | 2012-12-11 | Cambridge Research & Instrumentation, Inc. | Spectral imaging system with dynamic optical correction |
| WO2012168003A1 (en) | 2011-06-06 | 2012-12-13 | Biocartis S.A. | Selective lysis of cells by ionic surfactants |
| US20120322099A1 (en) | 2011-06-17 | 2012-12-20 | Daniel Lapen | Fixative and staining solutions |
| US8337851B2 (en) | 2005-05-18 | 2012-12-25 | Novartis Ag | Methods of monitoring the efficacy of anti-CD40 antibodies in treating a subject for a CD40-expressing cancer |
| US8343500B2 (en) | 2000-08-21 | 2013-01-01 | Apitope Technology (Bristol) Limited | Peptide composition |
| CN102851369A (en) | 2006-12-13 | 2013-01-02 | 卢米耐克斯公司 | Systems and methods for multiplex analysis of PCR in real time |
| US20130005600A1 (en) | 2010-02-03 | 2013-01-03 | Sven Olek | Assay for Determining the Type and/or Status of a Cell Based on the Epigenetic Pattern and the Chromatin Structure |
| US20130005594A1 (en) | 2010-03-29 | 2013-01-03 | Dxterity Diagnostics Incorporated | Methods and compositions for detecting target nucleic acids |
| US20130023433A1 (en) | 2009-09-28 | 2013-01-24 | Yuling Luo | Methods of detecting nucleic acid sequences with high specificity |
| US20130035239A1 (en) | 2011-08-03 | 2013-02-07 | Bio-Rad Laboratories | Filtering small nucleic acids using permeabilized cells |
| WO2013025952A2 (en) | 2011-08-16 | 2013-02-21 | Oncocyte Corporation | Methods and compositions for the treatment and diagnosis of breast cancer |
| US8383338B2 (en) | 2006-04-24 | 2013-02-26 | Roche Nimblegen, Inc. | Methods and systems for uniform enrichment of genomic regions |
| CN102947330A (en) | 2010-02-18 | 2013-02-27 | 奥斯陆大学 | Disulphide bond-stabilized functional soluble mhc class ii heterodimers |
| US20130053273A1 (en) | 2011-08-30 | 2013-02-28 | The Royal Institution For The Advancement Of Learning / Mcgill University | Methods and devices for multiplexed microarray microfluidic analysis of biomolecules |
| US20130052331A1 (en) | 2009-11-13 | 2013-02-28 | Ventana Medical Systems, Inc. | Thin film processing apparatuses for adjustable volume accommodation |
| WO2013033271A2 (en) | 2011-08-29 | 2013-03-07 | Derren Barken | Method to augment immune system in response to disease or injury |
| US20130065788A1 (en) | 2005-12-21 | 2013-03-14 | Meso Scale Technologies, L.L.C. | Assay modules having assay reagents and methods of making and using same |
| US20130065768A1 (en) | 2011-09-12 | 2013-03-14 | Sequenta, Inc. | Random array sequencing of low-complexity libraries |
| US20130079232A1 (en) | 2011-09-23 | 2013-03-28 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
| US8415102B2 (en) | 2007-04-10 | 2013-04-09 | Nanostring Technologies, Inc. | Methods and computer systems for identifying target-specific sequences for use in nanoreporters |
| US20130096033A1 (en) | 2011-10-28 | 2013-04-18 | Prognosys Biosciences, Inc. | Methods for manufacturing molecular arrays |
| US8431691B2 (en) | 2005-02-01 | 2013-04-30 | Applied Biosystems Llc | Reagents, methods, and libraries for bead-based sequencing |
| US20130122516A1 (en) | 2010-07-02 | 2013-05-16 | Rui Hong | Detecting targets using mass tags and mass spectrometry |
| US8462981B2 (en) | 2010-04-07 | 2013-06-11 | Cambridge Research & Instrumentation, Inc. | Spectral unmixing for visualization of samples |
| US20130146459A1 (en) | 2009-06-16 | 2013-06-13 | Massachusetts Institute Of Technology | Multiphase non-linear electrokinetic devices |
| WO2013090390A2 (en) | 2011-12-13 | 2013-06-20 | Sequenta, Inc. | Method of measuring immune activation |
| US20130171621A1 (en) | 2010-01-29 | 2013-07-04 | Advanced Cell Diagnostics Inc. | Methods of in situ detection of nucleic acids |
| US8481258B2 (en) | 2007-06-04 | 2013-07-09 | President And Fellows Of Harvard College | Methods and compounds for chemical ligation |
| US8481292B2 (en) | 2010-09-21 | 2013-07-09 | Population Genetics Technologies Litd. | Increasing confidence of allele calls with molecular counting |
| US8481698B2 (en) | 2009-03-19 | 2013-07-09 | The President And Fellows Of Harvard College | Parallel proximity ligation event analysis |
| US20130202718A1 (en) | 2008-11-07 | 2013-08-08 | Sequenta, Inc. | Monitoring immunoglobulin heavy chain evolution in b-cell acute lymphoblastic leukemia |
| US20130203100A1 (en) | 2009-11-13 | 2013-08-08 | Ventana Medical Systems, Inc. | Opposables and automated specimen processing systems with opposables |
| US20130211249A1 (en) | 2010-07-22 | 2013-08-15 | The Johns Hopkins University | Drug eluting hydrogels for catheter delivery |
| WO2013123442A1 (en) | 2012-02-17 | 2013-08-22 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
| WO2013131962A1 (en) | 2012-03-06 | 2013-09-12 | Illumina Cambridge Limited | Improved methods of nucleic acid sequencing |
| US20130244884A1 (en) | 2010-05-13 | 2013-09-19 | Gen9, Inc. | Methods for Nucleotide Sequencing and High Fidelity Polynucleotide Synthesis |
| WO2013138510A1 (en) | 2012-03-13 | 2013-09-19 | Patel Abhijit Ajit | Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing |
| WO2013142389A1 (en) | 2012-03-20 | 2013-09-26 | University Of Washington Through Its Center For Commercialization | Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing |
| US20130260372A1 (en) | 2012-04-03 | 2013-10-03 | Illumina, Inc. | Integrated optoelectronic read head and fluidic cartridge useful for nucleic acid sequencing |
| US20130261019A1 (en) | 2010-10-29 | 2013-10-03 | President And Fellows Of Harvard College | Nucleic acid nanostructure barcode probes |
| US8551710B2 (en) | 2011-02-15 | 2013-10-08 | Leica Biosystems Newcastle Ltd. | Methods for localized in situ detection of mRNA |
| WO2013150082A1 (en) * | 2012-04-03 | 2013-10-10 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Hybridization-based replication of nucleic acid molecules |
| WO2013155119A1 (en) | 2012-04-13 | 2013-10-17 | Sequenta, Inc. | Detection and quantitation of sample contamination in immune repertoire analysis |
| WO2013158936A1 (en) | 2012-04-20 | 2013-10-24 | Sequenta, Inc | Monitoring immunoglobulin heavy chain evolution in b-cell acute lymphoblastic leukemia |
| US8568979B2 (en) | 2006-10-10 | 2013-10-29 | Illumina, Inc. | Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization |
| US20130296174A1 (en) | 2012-05-02 | 2013-11-07 | Imec | Microfluidics System for Sequencing |
| US20130302801A1 (en) | 2008-11-07 | 2013-11-14 | Sequenta, Inc. | Detection and quantification of sample contamination in immune repertoire analysis |
| US8603743B2 (en) | 2009-04-03 | 2013-12-10 | Timothy Z. Liu | Multiplex nucleic acid detection methods and systems |
| US20130338042A1 (en) | 2012-06-15 | 2013-12-19 | Illumina, Inc. | Kinetic exclusion amplification of nucleic acid libraries |
| US8637242B2 (en) | 2011-11-07 | 2014-01-28 | Illumina, Inc. | Integrated sequencing apparatuses and methods of use |
| US8658361B2 (en) | 2010-10-21 | 2014-02-25 | Advanced Cell Diagnostics, Inc. | Ultra sensitive method for in situ detection of nucleic acids |
| US20140065609A1 (en) | 2010-10-22 | 2014-03-06 | James Hicks | Varietal counting of nucleic acids for obtaining genomic copy number information |
| US20140079923A1 (en) | 2012-06-08 | 2014-03-20 | Wayne N. George | Polymer coatings |
| US20140080715A1 (en) | 2012-09-20 | 2014-03-20 | The Chinese University Of Hong Kong | Non-invasive determination of methylome of fetus or tumor from plasma |
| WO2014044724A1 (en) | 2012-09-18 | 2014-03-27 | Qiagen Gmbh | Method and kit for preparing a target rna depleted sample |
| WO2014060483A1 (en) | 2012-10-17 | 2014-04-24 | Spatial Transcriptomics Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US20140121118A1 (en) | 2010-11-23 | 2014-05-01 | Opx Biotechnologies, Inc. | Methods, systems and compositions regarding multiplex construction protein amino-acid substitutions and identification of sequence-activity relationships, to provide gene replacement such as with tagged mutant genes, such as via efficient homologous recombination |
| US8741564B2 (en) * | 2011-05-04 | 2014-06-03 | Htg Molecular Diagnostics, Inc. | Quantitative nuclease protection assay (QNPA) and sequencing (QNPS) improvements |
| US20140155274A1 (en) | 2011-03-24 | 2014-06-05 | President And Fellows Of Harvard College | Single Cell Nucleic Acid Detection and Analysis |
| US20140155295A1 (en) | 2012-08-14 | 2014-06-05 | 10X Technologies, Inc. | Capsule array devices and methods of use |
| WO2014085725A1 (en) | 2012-11-27 | 2014-06-05 | Tufts University | Biopolymer-based inks and use thereof |
| US20140162293A1 (en) | 2011-08-30 | 2014-06-12 | Jacobs University Bremen Ggmbh | Gene coded for a mhc class i molecule, plasmid, expression system protein, multimer, reagent and kit to analyze a t cell frequency |
| US8778849B2 (en) | 2011-10-28 | 2014-07-15 | Illumina, Inc. | Microarray fabrication system and method |
| US20140213533A1 (en) | 2013-01-31 | 2014-07-31 | Manikkam Suthanthiran | Methods to detect, treat and prevent acute cellular rejection in kidney allografts |
| US8809238B2 (en) | 2011-05-09 | 2014-08-19 | Fluidigm Corporation | Probe based nucleic acid detection |
| US20140243224A1 (en) | 2013-02-26 | 2014-08-28 | Illumina, Inc. | Gel patterned surfaces |
| WO2014128129A1 (en) | 2013-02-25 | 2014-08-28 | Biocartis N.V. | Isolation of nucleic acids |
| WO2014130576A1 (en) | 2013-02-19 | 2014-08-28 | Biodot, Inc. | Automated fish analysis of tissue and cell samples using an isolating barrier for precise dispensing of probe and other reagents on regions of interest |
| US20140274731A1 (en) | 2012-12-10 | 2014-09-18 | Clearfork Bioscience, Inc. | Methods for targeted genomic analysis |
| WO2014142841A1 (en) | 2013-03-13 | 2014-09-18 | Illumina, Inc. | Multilayer fluidic devices and methods for their fabrication |
| WO2014144713A2 (en) | 2013-03-15 | 2014-09-18 | Immumetrix, Inc. | Methods of sequencing the immune repertoire |
| WO2014152397A2 (en) | 2013-03-14 | 2014-09-25 | The Broad Institute, Inc. | Selective purification of rna and rna-bound molecular complexes |
| US20140296081A1 (en) | 2013-03-15 | 2014-10-02 | The Board Of Trustees Of The Leland Stanford Junior University | Identification and use of circulating tumor markers |
| WO2014163886A1 (en) | 2013-03-12 | 2014-10-09 | President And Fellows Of Harvard College | Method of generating a three-dimensional nucleic acid containing matrix |
| US20140323330A1 (en) | 2013-04-25 | 2014-10-30 | Vladislav B. Bergo | Microarray compositions and methods of their use |
| JP2014217381A (en) | 2004-11-12 | 2014-11-20 | アシュラジェン インコーポレイテッド | METHODS AND COMPOSITIONS INVOLVING miRNA AND miRNA INHIBITOR MOLECULES |
| US20140342921A1 (en) | 2011-12-09 | 2014-11-20 | Illumina, Inc. | Expanded radix for polymeric tags |
| WO2014200767A1 (en) | 2013-06-12 | 2014-12-18 | The General Hospital Corporation | Methods, kits, and systems for multiplexed detection of target molecules and uses thereof |
| US20140378345A1 (en) | 2012-08-14 | 2014-12-25 | 10X Technologies, Inc. | Compositions and methods for sample processing |
| US20140378350A1 (en) | 2012-08-14 | 2014-12-25 | 10X Technologies, Inc. | Compositions and methods for sample processing |
| WO2014210225A1 (en) | 2013-06-25 | 2014-12-31 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| WO2014210353A2 (en) | 2013-06-27 | 2014-12-31 | 10X Technologies, Inc. | Compositions and methods for sample processing |
| US20150000854A1 (en) | 2013-06-27 | 2015-01-01 | The Procter & Gamble Company | Sheet products bearing designs that vary among successive sheets, and apparatus and methods for producing the same |
| US20150005447A1 (en) | 2013-07-01 | 2015-01-01 | Illumina, Inc. | Catalyst-free surface functionalization and polymer grafting |
| US20150010860A1 (en) | 2012-02-14 | 2015-01-08 | Sharp Kabushiki Kaisha | Toner for electrostatic development, image forming device using same, and image forming method |
| US8951728B2 (en) | 2004-11-22 | 2015-02-10 | Chemgene Holding Aps | Template directed split and mix synthesis of small molecule libraries |
| US20150051085A1 (en) | 2012-03-26 | 2015-02-19 | The Johns Hopkins University | Rapid aneuploidy detection |
| US8986926B2 (en) | 2005-12-23 | 2015-03-24 | Nanostring Technologies, Inc. | Compositions comprising oriented, immobilized macromolecules and methods for their preparation |
| US20150087027A1 (en) | 2012-03-13 | 2015-03-26 | Swift Biosciences, Inc. | Methods and Compositions for Size-Controlled Homopolymer Tailing of Substrate Polynucleotides by a Nucleic Acid Polymerase |
| US20150125053A1 (en) | 2013-11-01 | 2015-05-07 | Illumina, Inc. | Image analysis useful for patterned objects |
| US20150148239A1 (en) | 2013-11-22 | 2015-05-28 | Agilent Technologies, Inc. | Spatial molecular barcoding of in situ nucleic acids |
| EP2881465A1 (en) | 2012-07-30 | 2015-06-10 | Hitachi, Ltd. | Tag-sequence-attached two-dimensional cdna library device, and gene expression analysis method and gene expression analysis apparatus each utilizing same |
| US20150219618A1 (en) | 2012-07-18 | 2015-08-06 | Biological Dynamics, Inc. | Manipulation of microparticles in low field dielectrophoretic regions |
| US9121069B2 (en) | 2007-07-23 | 2015-09-01 | The Chinese University Of Hong Kong | Diagnosing cancer using genomic sequencing |
| US20150246336A1 (en) | 2012-10-22 | 2015-09-03 | Universität Wien | Method of in situ synthesizing microarrays |
| US20160003812A1 (en) | 2010-12-23 | 2016-01-07 | Good Start Genetics, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
| US20160019337A1 (en) | 2013-03-15 | 2016-01-21 | Htg Molecular Diagnostics, Inc. | Subtyping lung cancers |
| US20160032282A1 (en) | 2013-03-15 | 2016-02-04 | Abvitro, Inc. | Single cell bar-coding for antibody discovery |
| US20160033496A1 (en) | 2013-03-15 | 2016-02-04 | The Trustees Of The Princeton University | Analyte Detection Enhancement by Targeted Immobilization, Surface Amplification, and Pixelated Reading and Analysis |
| US20160041159A1 (en) | 2013-03-15 | 2016-02-11 | Joshua Labaer | Biosensor microarray compositions and methods |
| US9273349B2 (en) | 2013-03-14 | 2016-03-01 | Affymetrix, Inc. | Detection of nucleic acids |
| US20160108458A1 (en) | 2014-10-06 | 2016-04-21 | The Board Of Trustees Of The Leland Stanford Junior University | Multiplexed detection and quantification of nucleic acids in single-cells |
| US20160122817A1 (en) | 2014-10-29 | 2016-05-05 | 10X Genomics, Inc. | Methods and compositions for targeted nucleic acid sequencing |
| US9340830B2 (en) | 2010-12-30 | 2016-05-17 | Foundation Medicine, Inc. | Optimization of multigene analysis of tumor samples |
| US9376717B2 (en) | 2011-04-25 | 2016-06-28 | University Of Washington Through Its Center For Commercialization | Compositions and methods for multiplex biomarker profiling |
| US20160201125A1 (en) | 2011-02-18 | 2016-07-14 | Raindance Technologies, Inc. | Compositions and methods for molecular labeling |
| US9416409B2 (en) | 2009-07-31 | 2016-08-16 | Ibis Biosciences, Inc. | Capture primers and capture sequence linked solid supports for molecular diagnostic tests |
| US20160304952A1 (en) | 2015-04-14 | 2016-10-20 | Massachusetts Institue Of Technology | In situ nucleic acid sequencing of expanded biological samples |
| US9518980B2 (en) | 2012-10-10 | 2016-12-13 | Howard Hughes Medical Institute | Genetically encoded calcium indicators |
| US20160369329A1 (en) | 2013-04-30 | 2016-12-22 | California Institute Of Technology | Multiplex labeling of molecules by sequential hybridization barcoding using probes with cleavable linkers |
| US20160376642A1 (en) | 2012-11-14 | 2016-12-29 | Olink Ab | Localised RCA-based Amplification Method |
| US9541504B2 (en) | 2010-08-05 | 2017-01-10 | Cambridge Research & Instrumentation, Inc. | Enhancing visual assessment of samples |
| US20170009278A1 (en) | 2014-02-04 | 2017-01-12 | Olink Bioscience Ab | Proximity assay with detection based on hybridisation chain reaction (hcr) |
| US20170016053A1 (en) | 2015-07-17 | 2017-01-19 | Nanostring Technologies, Inc. | Simultaneous quantification of gene expression in a user-defined region of a cross-sectioned tissue |
| WO2017013170A1 (en) | 2015-07-22 | 2017-01-26 | F. Hoffmann-La Roche Ag | Identification of antigen epitopes and immune sequences recognizing the antigens |
| US9557330B2 (en) | 2009-10-09 | 2017-01-31 | Invisible Sentinel, Inc. | Device for detection of analytes and uses thereof |
| US20170029875A1 (en) | 2014-04-18 | 2017-02-02 | William Marsh Rice University | Competitive compositions of nucleic acid molecules for enrichment of rare-allele-bearing species |
| US20170029872A1 (en) | 2013-03-15 | 2017-02-02 | The Broad Institute, Inc. | Ribosomal Ribonucleic Acid Hybridization for Organism Identification |
| US9582877B2 (en) | 2013-10-07 | 2017-02-28 | Cellular Research, Inc. | Methods and systems for digitally counting features on arrays |
| US20170067096A1 (en) | 2015-08-07 | 2017-03-09 | Massachusetts Institute Of Technology | Nanoscale Imaging of Proteins and Nucleic Acids via Expansion Microscopy |
| US9598728B2 (en) | 2012-02-14 | 2017-03-21 | Cornell University | Method for relative quantification of nucleic acid sequence, expression, or copy changes, using combined nuclease, ligation, and polymerase reactions |
| US20170089811A1 (en) | 2015-08-07 | 2017-03-30 | Massachusetts Institute Of Technology | Protein Retention Expansion Microscopy |
| US9644204B2 (en) | 2013-02-08 | 2017-05-09 | 10X Genomics, Inc. | Partitioning and processing of analytes and other species |
| US9694361B2 (en) | 2014-04-10 | 2017-07-04 | 10X Genomics, Inc. | Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same |
| US20170241911A1 (en) | 2016-02-22 | 2017-08-24 | Miltenyi Biotec Gmbh | Automated analysis tool for biological specimens |
| US20170253918A1 (en) | 2016-03-01 | 2017-09-07 | Expansion Technologies | Combining protein barcoding with expansion microscopy for in-situ, spatially-resolved proteomics |
| US9778155B2 (en) | 2013-09-20 | 2017-10-03 | California Institute Of Technology | Methods for phenotyping of intact whole tissues |
| US9783841B2 (en) | 2012-10-04 | 2017-10-10 | The Board Of Trustees Of The Leland Stanford Junior University | Detection of target nucleic acids in a cellular sample |
| US9816134B2 (en) | 2010-05-27 | 2017-11-14 | Affymetrix, Inc. | Multiplex amplification methods |
| US9856521B2 (en) | 2015-01-27 | 2018-01-02 | BioSpyder Technologies, Inc. | Ligation assays in liquid phase |
| US20180052081A1 (en) | 2016-05-11 | 2018-02-22 | Expansion Technologies | Combining modified antibodies with expansion microscopy for in-situ, spatially-resolved proteomics |
| US9938566B2 (en) | 2014-09-08 | 2018-04-10 | BioSpyder Technologies, Inc. | Profiling expression at transcriptome scale |
| US20180105808A1 (en) | 2016-10-19 | 2018-04-19 | 10X Genomics, Inc. | Methods and systems for barcoding nucleic acid molecules from individual cells or cell populations |
| US20180112209A1 (en) | 2011-12-22 | 2018-04-26 | Ibis Biosciences, Inc. | Systems and methods for isolating nucleic acids |
| US9957550B2 (en) | 2014-09-08 | 2018-05-01 | BioSpyder Technologies, Inc. | Attenuators |
| US20180163265A1 (en) | 2014-12-19 | 2018-06-14 | The Broad Institute Inc. | Unbiased identification of double-strand breaks and genomic rearrangement by genome-wide insert capture sequencing |
| US20180201925A1 (en) | 2014-06-30 | 2018-07-19 | Illumina, Inc. | Methods and compositions using one-sided transposition |
| US10032064B2 (en) | 2012-08-21 | 2018-07-24 | Cambridge Research & Instrumentation, Inc. | Visualization and measurement of cell compartments |
| US20180208967A1 (en) | 2015-07-24 | 2018-07-26 | The Johns Hopkins University | Compositions and methods of rna analysis |
| US20180216161A1 (en) | 2017-01-23 | 2018-08-02 | Massachusetts Institute Of Technology | Multiplexed Signal Amplified FISH via Splinted Ligation Amplification and Sequencing |
| US20180216162A1 (en) | 2017-01-30 | 2018-08-02 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
| US10041949B2 (en) | 2013-09-13 | 2018-08-07 | The Board Of Trustees Of The Leland Stanford Junior University | Multiplexed imaging of tissues using mass tags and secondary ion mass spectrometry |
| US10049770B2 (en) | 2015-12-30 | 2018-08-14 | Case Western Reserve University | Prediction of recurrence of non-small cell lung cancer |
| US20180237864A1 (en) | 2015-01-27 | 2018-08-23 | BioSpyder Technologies, Inc. | Focal Gene Expression Profiling of Stained FFPE Tissues with Spatial Correlation to Morphology |
| US10059989B2 (en) | 2013-05-23 | 2018-08-28 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US20180245142A1 (en) | 2015-07-27 | 2018-08-30 | Illumina, Inc. | Spatial mapping of nucleic acid sequence information |
| US10072104B2 (en) | 2006-05-27 | 2018-09-11 | Fluidigm Canada Inc. | Polymer backbone element tags |
| US20180312822A1 (en) | 2017-04-26 | 2018-11-01 | 10X Genomics, Inc. | Mmlv reverse transcriptase variants |
| US10144966B2 (en) | 2008-01-17 | 2018-12-04 | Sequenom, Inc. | Methods of nucleic acid sequences analysis using solid supports containing identifier sequences |
| EP3425053A1 (en) | 2013-04-02 | 2019-01-09 | Molecular Assemblies, Inc. | Methods and apparatus for synthesizing nucleic acid |
| US10196691B2 (en) * | 2011-01-25 | 2019-02-05 | Almac Diagnostics Limited | Colon cancer gene expression signatures and methods of use |
| US20190055594A1 (en) | 2016-02-26 | 2019-02-21 | The Board Of Trustee Of The Leland Stanford Junior University | Multiplexed single molecule rna visualization with a two-probe proximity ligation system |
| US20190064173A1 (en) | 2017-08-22 | 2019-02-28 | 10X Genomics, Inc. | Methods of producing droplets including a particle and an analyte |
| US10221461B2 (en) | 2012-10-01 | 2019-03-05 | Adaptive Biotechnologies Corp. | Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization |
| US10227639B2 (en) | 2011-12-22 | 2019-03-12 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US20190085383A1 (en) | 2014-07-11 | 2019-03-21 | President And Fellows Of Harvard College | Methods for High-Throughput Labelling and Detection of Biological Features In Situ Using Microscopy |
| US10266876B2 (en) | 2010-03-08 | 2019-04-23 | California Institute Of Technology | Multiplex detection of molecular species in cells by super-resolution imaging and combinatorial labeling |
| US10273541B2 (en) | 2012-08-14 | 2019-04-30 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20190145982A1 (en) | 2016-05-02 | 2019-05-16 | Encodia, Inc. | Macromolecule analysis employing nucleic acid encoding |
| US20190161796A1 (en) | 2016-06-21 | 2019-05-30 | Cartana Ab | Nucleic acid sequencing |
| US20190177789A1 (en) | 2012-08-14 | 2019-06-13 | 10X Genomics, Inc. | Methods and systems for sample processing polynucleotides |
| US20190177800A1 (en) | 2017-12-08 | 2019-06-13 | 10X Genomics, Inc. | Methods and compositions for labeling cells |
| US20190194709A1 (en) | 2016-08-31 | 2019-06-27 | President And Fellows Of Harvard College | Methods of Combining the Detection of Biomolecules Into a Single Assay Using Fluorescent In Situ Sequencing |
| US20190203275A1 (en) | 2015-04-10 | 2019-07-04 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20190218276A1 (en) | 2016-03-21 | 2019-07-18 | The Broad Institute, Inc. | Methods for determining spatial and temporal gene expression dynamics in single cells |
| US20190271031A1 (en) | 2010-04-05 | 2019-09-05 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20190300945A1 (en) | 2010-04-05 | 2019-10-03 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US10457980B2 (en) | 2013-04-30 | 2019-10-29 | California Institute Of Technology | Multiplex labeling of molecules by sequential hybridization barcoding |
| US20190330617A1 (en) | 2016-08-31 | 2019-10-31 | President And Fellows Of Harvard College | Methods of Generating Libraries of Nucleic Acid Sequences for Detection via Fluorescent in Situ Sequ |
| US10465235B2 (en) | 2011-05-24 | 2019-11-05 | Navinci Diagnostics Ab | Multiplexed proximity ligation assay |
| US20190360034A1 (en) | 2011-04-01 | 2019-11-28 | Centrillion Technology Holdings Corporation | Methods and systems for sequencing nucleic acids |
| US20190367997A1 (en) | 2018-04-06 | 2019-12-05 | 10X Genomics, Inc. | Systems and methods for quality control in single cell processing |
| US20190367982A1 (en) | 2018-02-12 | 2019-12-05 | 10X Genomics, Inc. | Methods and systems for analysis of cell lineage |
| US10501791B2 (en) | 2011-10-14 | 2019-12-10 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US10510435B2 (en) | 2013-04-30 | 2019-12-17 | California Institute Of Technology | Error correction of multiplex imaging analysis by sequential hybridization |
| US20200002764A1 (en) | 2016-12-22 | 2020-01-02 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20200024641A1 (en) | 2016-07-27 | 2020-01-23 | The Board Of Trustees Of The Leland Stanford Junior University | Highly-multiplexed fluorescent imaging |
| US10545075B2 (en) | 2012-08-09 | 2020-01-28 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for preparing biological specimens for microscopic analysis |
| US10580128B2 (en) | 2013-01-10 | 2020-03-03 | Akoya Biosciences, Inc. | Whole slide multispectral imaging systems and methods |
| US20200080136A1 (en) | 2016-09-22 | 2020-03-12 | William Marsh Rice University | Molecular hybridization probes for complex sequence capture and analysis |
| WO2020076979A1 (en) | 2018-10-10 | 2020-04-16 | Readcoor, Inc. | Surface capture of targets |
| US10640826B2 (en) | 2012-06-05 | 2020-05-05 | President And Fellows Of Harvard College | Spatial sequencing of nucleic acids using DNA origami probes |
| WO2020123318A1 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc. | Resolving spatial arrays using deconvolution |
| US10697013B1 (en) | 2009-08-20 | 2020-06-30 | 10X Genomics, Inc. | Methods for analyzing nucleic acids from single cells |
| US20200224244A1 (en) | 2017-10-06 | 2020-07-16 | Cartana Ab | Rna templated ligation |
| US10724078B2 (en) | 2015-04-14 | 2020-07-28 | Koninklijke Philips N.V. | Spatial mapping of molecular profiles of biological tissue samples |
| US20200239946A1 (en) | 2017-10-11 | 2020-07-30 | Expansion Technologies | Multiplexed in situ hybridization of tissue sections for spatially resolved transcriptomics with expansion microscopy |
| US20200256867A1 (en) | 2016-12-09 | 2020-08-13 | Ultivue, Inc. | Methods for Multiplex Imaging Using Labeled Nucleic Acid Imaging Agents |
| WO2020167862A1 (en) | 2019-02-12 | 2020-08-20 | 10X Genomics, Inc. | Systems and methods for transfer of reagents between droplets |
| WO2020176882A1 (en) | 2019-02-28 | 2020-09-03 | 10X Genomics, Inc. | Devices, systems, and methods for increasing droplet formation efficiency |
| US20200283852A1 (en) | 2010-08-06 | 2020-09-10 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| WO2020190509A1 (en) | 2019-03-15 | 2020-09-24 | 10X Genomics, Inc. | Methods for using spatial arrays for single cell sequencing |
| WO2020198071A1 (en) | 2019-03-22 | 2020-10-01 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| US10794802B2 (en) | 2013-09-20 | 2020-10-06 | California Institute Of Technology | Whole-body tissue stabilization and selective extractions via tissue-hydrogel hybrids for high resolution intact circuit mapping and phenotyping |
| US20200332368A1 (en) | 2012-05-22 | 2020-10-22 | Veracyte, Inc. | Nano46 genes and methods to predict breast cancer outcome |
| WO2020219901A1 (en) | 2019-04-26 | 2020-10-29 | 10X Genomics, Inc. | Imaging support devices |
| US20200354774A1 (en) | 2011-12-22 | 2020-11-12 | President And Fellows Of Harvard College | Method for Generating A Three-Dimensional Nucleic Acid Containing Matrix |
| US20200407781A1 (en) | 2018-08-28 | 2020-12-31 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample |
| US10964001B2 (en) | 2013-01-10 | 2021-03-30 | Akoya Biosciences, Inc. | Multispectral imaging systems and methods |
| US20210140982A1 (en) | 2019-10-18 | 2021-05-13 | 10X Genomics, Inc. | Identification of spatial biomarkers of brain disorders and methods of using the same |
| WO2021091611A1 (en) | 2019-11-08 | 2021-05-14 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| WO2021092433A2 (en) | 2019-11-08 | 2021-05-14 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| WO2021097255A1 (en) | 2019-11-13 | 2021-05-20 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US20210190770A1 (en) | 2019-12-23 | 2021-06-24 | 10X Genomics, Inc. | Compositions and methods for using fixed biological samples in partition-based assays |
| US20210189475A1 (en) | 2018-12-10 | 2021-06-24 | 10X Genomics, Inc. | Imaging system hardware |
| US20210199660A1 (en) | 2019-11-22 | 2021-07-01 | 10X Genomics, Inc. | Biomarkers of breast cancer |
| US20210198741A1 (en) | 2019-12-30 | 2021-07-01 | 10X Genomics, Inc. | Identification of spatial biomarkers of heart disorders and methods of using the same |
| WO2021133849A1 (en) | 2019-12-23 | 2021-07-01 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
| US20210214785A1 (en) | 2020-01-13 | 2021-07-15 | Spatial Transcriptomics Ab | Methods of decreasing background on a spatial array |
| WO2021142233A1 (en) | 2020-01-10 | 2021-07-15 | 10X Genomics, Inc. | Methods for determining a location of a target nucleic acid in a biological sample |
| US20210222241A1 (en) | 2020-01-21 | 2021-07-22 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| US20210223227A1 (en) | 2020-01-17 | 2021-07-22 | Spatial Transcriptomics Ab | Electrophoretic system and method for analyte capture |
| US20210222253A1 (en) | 2020-01-21 | 2021-07-22 | 10X Genomics, Inc. | Identification of biomarkers of glioblastoma and methods of using the same |
| US20210222242A1 (en) | 2020-01-21 | 2021-07-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US20210230681A1 (en) | 2020-01-24 | 2021-07-29 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US20210237022A1 (en) | 2020-01-31 | 2021-08-05 | 10X Genomics, Inc. | Capturing oligonucleotides in spatial transcriptomics |
| US20210238664A1 (en) | 2020-02-03 | 2021-08-05 | 10X Genomics, Inc. | Methods for preparing high-resolution spatial arrays |
| US20210238680A1 (en) | 2020-02-03 | 2021-08-05 | 10X Genomics, Inc. | Increasing capture efficiency of spatial assays |
| US20210238675A1 (en) | 2020-02-05 | 2021-08-05 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US20210247316A1 (en) | 2020-02-11 | 2021-08-12 | 10X Genomics, Inc. | Methods and compositions for partitioning a biological sample |
| WO2021168278A1 (en) | 2020-02-20 | 2021-08-26 | 10X Genomics, Inc. | METHODS TO COMBINE FIRST AND SECOND STRAND cDNA SYNTHESIS FOR SPATIAL ANALYSIS |
| US20210262019A1 (en) | 2020-02-24 | 2021-08-26 | 10X Genomics, Inc. | Methods of making gene expression libraries |
| WO2021168261A1 (en) | 2020-02-21 | 2021-08-26 | 10X Genomics, Inc. | Capturing genetic targets using a hybridization approach |
| US20210285036A1 (en) | 2019-01-06 | 2021-09-16 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US20210317524A1 (en) | 2018-08-28 | 2021-10-14 | 10X Genomics, Inc. | Resolving spatial arrays |
| WO2021207610A1 (en) | 2020-04-10 | 2021-10-14 | 10X Genomics, Inc. | Cold protease treatment method for preparing biological samples |
| US20210324457A1 (en) | 2018-08-28 | 2021-10-21 | Eswar Prasad Ramachandran Iyer | Methods for Generating Spatially Barcoded Arrays |
| WO2021216708A1 (en) | 2020-04-22 | 2021-10-28 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna depletion |
| WO2021225900A1 (en) | 2020-05-04 | 2021-11-11 | 10X Genomics, Inc. | Spatial transcriptomic transfer modes |
| WO2021236625A1 (en) | 2020-05-19 | 2021-11-25 | 10X Genomics, Inc. | Electrophoresis cassettes and instrumentation |
| WO2021237056A1 (en) | 2020-05-22 | 2021-11-25 | 10X Genomics, Inc. | Rna integrity analysis in a biological sample |
| WO2021236929A1 (en) | 2020-05-22 | 2021-11-25 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| WO2021237087A1 (en) | 2020-05-22 | 2021-11-25 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| WO2021242834A1 (en) | 2020-05-26 | 2021-12-02 | 10X Genomics, Inc. | Method for resetting an array |
| WO2021247543A2 (en) | 2020-06-02 | 2021-12-09 | 10X Genomics, Inc. | Nucleic acid library methods |
| WO2021247568A1 (en) | 2020-06-02 | 2021-12-09 | 10X Genomics, Inc. | Spatial trancriptomics for antigen-receptors |
| WO2021252576A1 (en) | 2020-06-10 | 2021-12-16 | 10X Genomics, Inc. | Methods for spatial analysis using blocker oligonucleotides |
| WO2021252499A1 (en) | 2020-06-08 | 2021-12-16 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| WO2021252591A1 (en) | 2020-06-10 | 2021-12-16 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
| WO2021263111A1 (en) | 2020-06-25 | 2021-12-30 | 10X Genomics, Inc. | Spatial analysis of dna methylation |
| US20220010367A1 (en) | 2019-02-28 | 2022-01-13 | 10X Genomics, Inc. | Profiling of biological analytes with spatially barcoded oligonucleotide arrays |
| US20220017951A1 (en) | 2019-03-22 | 2022-01-20 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| WO2022025965A1 (en) | 2020-07-31 | 2022-02-03 | 10X Genomics, Inc. | De-crosslinking compounds and methods of use for spatial analysis |
| US20220049293A1 (en) | 2018-12-10 | 2022-02-17 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
| US20220081728A1 (en) | 2019-05-30 | 2022-03-17 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| WO2022060798A1 (en) | 2020-09-15 | 2022-03-24 | 10X Genomics, Inc. | Methods of releasing an extended capture probe from a substrate and uses of the same |
| WO2022060953A1 (en) | 2020-09-16 | 2022-03-24 | 10X Genomics, Inc. | Methods of determining the location of an analyte in a biological sample using a plurality of wells |
| WO2022087273A1 (en) | 2020-10-22 | 2022-04-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification |
| WO2022099037A1 (en) | 2020-11-06 | 2022-05-12 | 10X Genomics, Inc. | Compositions and methods for binding an analyte to a capture probe |
| US20220145361A1 (en) | 2019-03-15 | 2022-05-12 | 10X Genomics, Inc. | Methods for using spatial arrays for single cell sequencing |
| WO2022098810A1 (en) | 2020-11-06 | 2022-05-12 | 10X Genomics, Inc. | Assay support devices |
| WO2022103712A1 (en) | 2020-11-13 | 2022-05-19 | 10X Genomics, Inc. | Nano-partitions (encapsulated nucleic acid processing enzymes) for cell-lysis and multiple reactions in partition-based assays |
| WO2022109181A1 (en) | 2020-11-18 | 2022-05-27 | 10X Genomics, Inc. | Methods and compositions for analyzing immune infiltration in cancer stroma to predict clinical outcome |
| WO2022140028A1 (en) | 2020-12-21 | 2022-06-30 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| WO2022147296A1 (en) | 2020-12-30 | 2022-07-07 | 10X Genomics, Inc. | Cleavage of capture probes for spatial analysis |
| WO2022147005A1 (en) | 2020-12-30 | 2022-07-07 | 10X Genomics, Inc. | Methods for analyte capture determination |
| WO2022164615A1 (en) | 2021-01-29 | 2022-08-04 | 10X Genomics, Inc. | Method for transposase mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20220267844A1 (en) | 2019-11-27 | 2022-08-25 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
| WO2022178267A2 (en) | 2021-02-19 | 2022-08-25 | 10X Genomics, Inc. | Modular assay support devices |
| WO2022198068A1 (en) | 2021-03-18 | 2022-09-22 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| US20220333195A1 (en) | 2018-08-28 | 2022-10-20 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20220334031A1 (en) | 2019-12-23 | 2022-10-20 | 10X Genomics, Inc. | Reversible fixing reagents and methods of use thereof |
| WO2022221425A1 (en) | 2021-04-14 | 2022-10-20 | 10X Genomics, Inc. | Methods of measuring mislocalization of an analyte |
| US20220333192A1 (en) | 2021-04-20 | 2022-10-20 | 10X Genomics, Inc. | Methods and devices for spatial assessment of rna quality |
| WO2022226057A1 (en) | 2021-04-20 | 2022-10-27 | 10X Genomics, Inc. | Methods for assessing sample quality prior to spatial analysis using templated ligation |
| US20220348992A1 (en) | 2020-01-10 | 2022-11-03 | 10X Genomics, Inc. | Methods for determining a location of a target nucleic acid in a biological sample |
| WO2022236054A1 (en) | 2021-05-06 | 2022-11-10 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| US11519138B2 (en) | 2018-12-17 | 2022-12-06 | Hamm Ag | Soil processing machine |
| WO2022256503A1 (en) | 2021-06-03 | 2022-12-08 | 10X Genomics, Inc. | Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis |
| WO2022271820A1 (en) | 2021-06-22 | 2022-12-29 | 10X Genomics, Inc. | Spatial detection of sars-cov-2 using templated ligation |
| US20230014008A1 (en) | 2021-07-13 | 2023-01-19 | 10X Genomics, Inc. | Methods for improving spatial performance |
| WO2023287765A1 (en) | 2021-07-13 | 2023-01-19 | 10X Genomics, Inc. | Methods for spatial analysis using targeted probe silencing |
| US20230034039A1 (en) | 2021-08-02 | 2023-02-02 | 10X Genomics, Inc. | Methods of preserving a biological sample |
| US20230034216A1 (en) | 2021-07-28 | 2023-02-02 | 10X Genomics, Inc. | Multiplexed spatial capture of analytes |
| US20230042817A1 (en) | 2021-08-04 | 2023-02-09 | 10X Genomics, Inc. | Analyte capture from an embedded biological sample |
| US20230047782A1 (en) | 2020-02-07 | 2023-02-16 | 10X Genomics, Inc. | Quantitative and automated permeabilization performance evaluation for spatial transcriptomics |
| WO2023018799A1 (en) | 2021-08-12 | 2023-02-16 | 10X Genomics, Inc. | Methods, compositions and systems for identifying antigen-binding molecules |
| WO2023034489A1 (en) | 2021-09-01 | 2023-03-09 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US20230135010A1 (en) | 2021-11-03 | 2023-05-04 | 10X Genomics, Inc. | Sequential analyte capture |
| WO2023076345A1 (en) | 2021-10-26 | 2023-05-04 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna capture |
| US20230147726A1 (en) | 2018-09-28 | 2023-05-11 | Danmarks Tekniske Universitet | High throughput epitope identification and t cell receptor specificity determination using loadable detection molecules |
| US20230143569A1 (en) | 2019-02-28 | 2023-05-11 | 10X Genomics, Inc. | Profiling of biological analytes with spatially barcoded oligonucleotide arrays |
| WO2023086880A1 (en) | 2021-11-10 | 2023-05-19 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| WO2023102118A2 (en) | 2021-12-01 | 2023-06-08 | 10X Genomics, Inc. | Methods, compositions, and systems for improved in situ detection of analytes and spatial analysis |
| US20230175045A1 (en) | 2021-12-03 | 2023-06-08 | 10X Genomics, Inc. | Method for transposase mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20230194470A1 (en) | 2020-03-04 | 2023-06-22 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
| US20230242976A1 (en) | 2018-12-10 | 2023-08-03 | 10X Genomics, Inc. | Imaging system hardware |
| WO2023150171A1 (en) | 2022-02-01 | 2023-08-10 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing analytes from glioblastoma samples |
| WO2023150163A1 (en) | 2022-02-01 | 2023-08-10 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing analytes from lymphatic tissue |
| WO2023150098A1 (en) | 2022-02-01 | 2023-08-10 | 10X Genomics, Inc. | Methods, kits, compositions, and systems for spatial analysis |
| US20230265488A1 (en) | 2020-04-16 | 2023-08-24 | 10X Genomics, Inc. | Compositions and methods for use with fixed samples |
| US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US20230323434A1 (en) | 2019-01-06 | 2023-10-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| WO2023215552A1 (en) | 2022-05-06 | 2023-11-09 | 10X Genomics, Inc. | Molecular barcode readers for analyte detection |
| US11821035B1 (en) | 2020-01-29 | 2023-11-21 | 10X Genomics, Inc. | Compositions and methods of making gene expression libraries |
| WO2023225519A1 (en) | 2022-05-17 | 2023-11-23 | 10X Genomics, Inc. | Modified transposons, compositions and uses thereof |
| US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
| WO2023229988A1 (en) | 2022-05-23 | 2023-11-30 | 10X Genomics, Inc. | Tissue sample mold |
| WO2023250077A1 (en) | 2022-06-22 | 2023-12-28 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US20230416850A1 (en) | 2022-06-22 | 2023-12-28 | 10X Genomics, Inc. | Methods, compositions, and systems for detecting exogenous nucleic acids |
| WO2024015578A1 (en) | 2022-07-15 | 2024-01-18 | 10X Genomics, Inc. | Methods for determining a location of a target nucleic acid in a biological sample |
| US20240026445A1 (en) | 2019-01-06 | 2024-01-25 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
-
2013
- 2013-10-16 WO PCT/EP2013/071645 patent/WO2014060483A1/en not_active Ceased
- 2013-10-16 EP EP18208823.7A patent/EP3511423B2/en active Active
- 2013-10-16 DK DK18208823.7T patent/DK3511423T4/en active
- 2013-10-16 CA CA2886974A patent/CA2886974C/en active Active
- 2013-10-16 EP EP21163827.5A patent/EP3901280B1/en active Active
- 2013-10-16 EP EP13780111.4A patent/EP2909337B1/en active Active
- 2013-10-16 ES ES21163827T patent/ES3019910T3/en active Active
- 2013-10-16 EP EP25162454.0A patent/EP4592400A3/en active Pending
- 2013-10-16 US US14/434,274 patent/US9593365B2/en not_active Ceased
- 2013-10-16 US US16/353,937 patent/USRE50065E1/en active Active
Patent Citations (1367)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4514388A (en) | 1983-03-22 | 1985-04-30 | Psaledakis Nicholas G | Proteolytic enzymes in the zymogen form to treat sarcoma cells |
| US4574729A (en) | 1984-08-06 | 1986-03-11 | E. I. Du Pont De Nemours & Co. | Chamber block for a cytocentrifuge having centrifugal force responsive supernatant withdrawal means |
| US5061049A (en) | 1984-08-31 | 1991-10-29 | Texas Instruments Incorporated | Spatial light modulator and method |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683202B1 (en) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4883867A (en) | 1985-11-01 | 1989-11-28 | Becton, Dickinson And Company | Detection of reticulocytes, RNA or DNA |
| US4683195B1 (en) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4800159A (en) | 1986-02-07 | 1989-01-24 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US5589173A (en) | 1986-11-04 | 1996-12-31 | Genentech, Inc. | Method and therapeutic compositions for the treatment of myocardial infarction |
| US5695940A (en) | 1987-04-01 | 1997-12-09 | Hyseq, Inc. | Method of sequencing by hybridization of oligonucleotide probes |
| US5672344A (en) | 1987-12-30 | 1997-09-30 | The Regents Of The University Of Michigan | Viral-mediated gene transfer system |
| US4968601A (en) | 1988-02-09 | 1990-11-06 | The United States Of America As Represented By The Dept. Of Health & Human Services | Method for diagnosing latent viral infection |
| US4988617A (en) | 1988-03-25 | 1991-01-29 | California Institute Of Technology | Method of detecting a nucleotide change in nucleic acids |
| WO1989010977A1 (en) | 1988-05-03 | 1989-11-16 | Isis Innovation Limited | Analysing polynucleotide sequences |
| US5130238A (en) | 1988-06-24 | 1992-07-14 | Cangene Corporation | Enhanced nucleic acid amplification process |
| US6485982B1 (en) | 1988-06-27 | 2002-11-26 | Armkel, Llc | Test device and method for colored particle immunoassay |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5002882A (en) | 1989-04-27 | 1991-03-26 | New England Biolabs, Inc. | Method for producing the XmaI restriction endonuclease and methylase |
| RU2145635C1 (en) | 1989-05-18 | 2000-02-20 | Чирон Корпорейшн | Oligomer (variants), method of detection of hcv sequence (variants), set for detection, method of blood preparing |
| WO1991006678A1 (en) | 1989-10-26 | 1991-05-16 | Sri International | Dna sequencing |
| US5494810A (en) | 1990-05-03 | 1996-02-27 | Cornell Research Foundation, Inc. | Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease |
| US5830711A (en) | 1990-05-03 | 1998-11-03 | Cornell Research Foundation, Inc. | Thermostable ligase mediated DNA amplification system for the detection of genetic diseases |
| US5559032A (en) | 1990-06-29 | 1996-09-24 | Pomeroy; Patrick C. | Method and apparatus for post-transfer assaying of material on solid support |
| US5455166A (en) | 1991-01-31 | 1995-10-03 | Becton, Dickinson And Company | Strand displacement amplification |
| US5183053A (en) | 1991-04-12 | 1993-02-02 | Acuderm, Inc. | Elliptical biopsy punch |
| WO1993004199A2 (en) | 1991-08-20 | 1993-03-04 | Scientific Generics Limited | Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids |
| US6210894B1 (en) | 1991-09-04 | 2001-04-03 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
| US5582977A (en) | 1991-09-16 | 1996-12-10 | Molecular Probes, Inc. | Dimers of unsymmetrical cyanine dyes |
| US5321130A (en) | 1992-02-10 | 1994-06-14 | Molecular Probes, Inc. | Unsymmetrical cyanine dyes with a cationic side chain |
| US5308751A (en) | 1992-03-23 | 1994-05-03 | General Atomics | Method for sequencing double-stranded DNA |
| US5503980A (en) | 1992-11-06 | 1996-04-02 | Trustees Of Boston University | Positional sequencing by hybridization |
| US5472881A (en) | 1992-11-12 | 1995-12-05 | University Of Utah Research Foundation | Thiol labeling of DNA for attachment to gold surfaces |
| US5410030A (en) | 1993-04-05 | 1995-04-25 | Molecular Probes, Inc. | Dimers of unsymmetrical cyanine dyes containing pyridinium moieties |
| US5436134A (en) | 1993-04-13 | 1995-07-25 | Molecular Probes, Inc. | Cyclic-substituted unsymmetrical cyanine dyes |
| US5658751A (en) | 1993-04-13 | 1997-08-19 | Molecular Probes, Inc. | Substituted unsymmetrical cyanine dyes with selected permeability |
| US5837832A (en) | 1993-06-25 | 1998-11-17 | Affymetrix, Inc. | Arrays of nucleic acid probes on biological chips |
| US6265552B1 (en) | 1993-07-30 | 2001-07-24 | Affymax Technologies N.V. | Biotinylation of proteins |
| US6401267B1 (en) | 1993-09-27 | 2002-06-11 | Radoje Drmanac | Methods and compositions for efficient nucleic acid sequencing |
| US5610287A (en) | 1993-12-06 | 1997-03-11 | Molecular Tool, Inc. | Method for immobilizing nucleic acid molecules |
| US5871921A (en) | 1994-02-16 | 1999-02-16 | Landegren; Ulf | Circularizing nucleic acid probe able to interlock with a target sequence through catenation |
| US5512462A (en) | 1994-02-25 | 1996-04-30 | Hoffmann-La Roche Inc. | Methods and reagents for the polymerase chain reaction amplification of long DNA sequences |
| WO1995023875A1 (en) | 1994-03-02 | 1995-09-08 | The Johns Hopkins University | In vitro transposition of artificial transposons |
| US6214587B1 (en) | 1994-03-16 | 2001-04-10 | Gen-Probe Incorporated | Isothermal strand displacement nucleic acid amplification |
| WO1995025116A1 (en) | 1994-03-16 | 1995-09-21 | California Institute Of Technology | Method and apparatus for performing multiple sequential reactions on a matrix |
| US5599675A (en) | 1994-04-04 | 1997-02-04 | Spectragen, Inc. | DNA sequencing by stepwise ligation and cleavage |
| US5807522A (en) | 1994-06-17 | 1998-09-15 | The Board Of Trustees Of The Leland Stanford Junior University | Methods for fabricating microarrays of biological samples |
| WO1995035505A1 (en) | 1994-06-17 | 1995-12-28 | The Board Of Trustees Of The Leland Stanford Junior University | Method and apparatus for fabricating microarrays of biological samples |
| US5641658A (en) | 1994-08-03 | 1997-06-24 | Mosaic Technologies, Inc. | Method for performing amplification of nucleic acid with two primers bound to a single solid support |
| US5912148A (en) | 1994-08-19 | 1999-06-15 | Perkin-Elmer Corporation Applied Biosystems | Coupled amplification and ligation method |
| US6130073A (en) | 1994-08-19 | 2000-10-10 | Perkin-Elmer Corp., Applied Biosystems Division | Coupled amplification and ligation method |
| US6172218B1 (en) | 1994-10-13 | 2001-01-09 | Lynx Therapeutics, Inc. | Oligonucleotide tags for sorting and identification |
| US5863753A (en) | 1994-10-27 | 1999-01-26 | Molecular Probes, Inc. | Chemically reactive unsymmetrical cyanine dyes and their conjugates |
| US5866377A (en) | 1994-12-30 | 1999-02-02 | Chong Kun Dang Corporation | Aminooligosaccharide derivative and process for preparing the same |
| US6306597B1 (en) | 1995-04-17 | 2001-10-23 | Lynx Therapeutics, Inc. | DNA sequencing by parallel oligonucleotide extensions |
| US5750341A (en) | 1995-04-17 | 1998-05-12 | Lynx Therapeutics, Inc. | DNA sequencing by parallel oligonucleotide extensions |
| US5648245A (en) | 1995-05-09 | 1997-07-15 | Carnegie Institution Of Washington | Method for constructing an oligonucleotide concatamer library by rolling circle replication |
| US6221591B1 (en) | 1995-06-07 | 2001-04-24 | Universiteit Van Amsterdam | Determination of a genetic risk factor for infection and other diseases, and detection of activated phagocytes |
| US6878515B1 (en) | 1995-06-16 | 2005-04-12 | Ulf Landegren | Ultrasensitive immunoassays |
| US6013516A (en) | 1995-10-06 | 2000-01-11 | The Salk Institute For Biological Studies | Vector and method of use for nucleic acid delivery to non-dividing cells |
| US20030138879A1 (en) | 1995-10-13 | 2003-07-24 | President And Fellows Of Harvard College | Phosphopantetheinyl transferases and uses thereof |
| US6579695B1 (en) | 1995-10-13 | 2003-06-17 | President And Fellows Of Harvard College | Phosphopantetheinyl transferases and uses thereof |
| US7192735B2 (en) | 1995-10-13 | 2007-03-20 | President & Fellows Of Harvard College | Phosphopantetheinyl transferases and uses thereof |
| US5716825A (en) | 1995-11-01 | 1998-02-10 | Hewlett Packard Company | Integrated nucleic acid analysis system for MALDI-TOF MS |
| US5763175A (en) | 1995-11-17 | 1998-06-09 | Lynx Therapeutics, Inc. | Simultaneous sequencing of tagged polynucleotides |
| US6344329B1 (en) | 1995-11-21 | 2002-02-05 | Yale University | Rolling circle replication reporter systems |
| US5854033A (en) | 1995-11-21 | 1998-12-29 | Yale University | Rolling circle replication reporter systems |
| US6300063B1 (en) | 1995-11-29 | 2001-10-09 | Affymetrix, Inc. | Polymorphism detection |
| US6344316B1 (en) | 1996-01-23 | 2002-02-05 | Affymetrix, Inc. | Nucleic acid analysis techniques |
| US6913881B1 (en) | 1996-01-24 | 2005-07-05 | Third Wave Technologies, Inc. | Methods and compositions for detecting target sequences |
| US6875572B2 (en) | 1996-01-24 | 2005-04-05 | Third Wave Technologies, Inc. | Nucleic acid detection assays |
| US20080293046A1 (en) | 1996-01-24 | 2008-11-27 | Third Wave Technologies, Inc. | RNA detection assays |
| US6872816B1 (en) | 1996-01-24 | 2005-03-29 | Third Wave Technologies, Inc. | Nucleic acid detection kits |
| US7011944B2 (en) | 1996-01-24 | 2006-03-14 | Third Wave Technologies, Inc. | Invasive cleavage of nucleic acids |
| US7892747B2 (en) | 1996-02-09 | 2011-02-22 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US7888009B2 (en) | 1996-02-09 | 2011-02-15 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US7914981B2 (en) | 1996-02-09 | 2011-03-29 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US6852487B1 (en) | 1996-02-09 | 2005-02-08 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| WO1997031256A2 (en) | 1996-02-09 | 1997-08-28 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US8624016B2 (en) | 1996-02-09 | 2014-01-07 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays |
| US6013440A (en) | 1996-03-11 | 2000-01-11 | Affymetrix, Inc. | Nucleic acid affinity columns |
| US20090062148A1 (en) | 1996-04-17 | 2009-03-05 | Affymetrix, Inc. | Substrate preparation process |
| US5928906A (en) | 1996-05-09 | 1999-07-27 | Sequenom, Inc. | Process for direct sequencing during template amplification |
| US6027889A (en) | 1996-05-29 | 2000-02-22 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions |
| US6268148B1 (en) | 1996-05-29 | 2001-07-31 | Francis Barany | Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions |
| US8597891B2 (en) | 1996-05-29 | 2013-12-03 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions |
| US6797470B2 (en) | 1996-05-29 | 2004-09-28 | Cornell Research Foundation, Inc. | Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions |
| US20050003431A1 (en) | 1996-08-16 | 2005-01-06 | Wucherpfennig Kai W. | Monovalent, multivalent, and multimeric MHC binding domain fusion proteins and conjugates, and uses therefor |
| US5965443A (en) | 1996-09-09 | 1999-10-12 | Wisconsin Alumni Research Foundation | System for in vitro transposition |
| US5925545A (en) | 1996-09-09 | 1999-07-20 | Wisconsin Alumni Research Foundation | System for in vitro transposition |
| US6221654B1 (en) | 1996-09-25 | 2001-04-24 | California Institute Of Technology | Method and apparatus for analysis and sorting of polynucleotides based on size |
| US6281804B1 (en) | 1996-09-27 | 2001-08-28 | Daimlerchrysler Ag | Display arranged in a motor vehicle |
| US6210891B1 (en) | 1996-09-27 | 2001-04-03 | Pyrosequencing Ab | Method of sequencing DNA |
| US6083761A (en) | 1996-12-02 | 2000-07-04 | Glaxo Wellcome Inc. | Method and apparatus for transferring and combining reagents |
| US6060240A (en) | 1996-12-13 | 2000-05-09 | Arcaris, Inc. | Methods for measuring relative amounts of nucleic acids in a complex mixture and retrieval of specific sequences therefrom |
| US6165714A (en) | 1996-12-16 | 2000-12-26 | Vysis, Inc. | Devices and methods for detecting nucleic acid analytes in samples |
| US6258568B1 (en) | 1996-12-23 | 2001-07-10 | Pyrosequencing Ab | Method of sequencing DNA based on the detection of the release of pyrophosphate and enzymatic nucleotide degradation |
| US6737236B1 (en) | 1997-01-08 | 2004-05-18 | Proligo, Llc | Bioconjugation of macromolecules |
| EP0901631A1 (en) | 1997-01-15 | 1999-03-17 | New Horizons Diagnostics Corporation | Method for detection of contaminants |
| US6309824B1 (en) | 1997-01-16 | 2001-10-30 | Hyseq, Inc. | Methods for analyzing a target nucleic acid using immobilized heterogeneous mixtures of oligonucleotide probes |
| US6518018B1 (en) | 1997-01-21 | 2003-02-11 | The General Hospital Corporation | RNA-antibody fusions and their selection |
| US8207093B2 (en) | 1997-01-21 | 2012-06-26 | The General Hospital Corporation | Selection of proteins using RNA-protein fusions |
| US6261804B1 (en) | 1997-01-21 | 2001-07-17 | The General Hospital Corporation | Selection of proteins using RNA-protein fusions |
| US6258558B1 (en) | 1997-01-21 | 2001-07-10 | The General Hospital Corporation | Method for selection of proteins using RNA-protein fusions |
| US7270950B2 (en) | 1997-01-21 | 2007-09-18 | The General Hospital Corporation | Nucleic acid-protein fusions and methods of making and selecting fusions |
| US5837860A (en) | 1997-03-05 | 1998-11-17 | Molecular Tool, Inc. | Covalent attachment of nucleic acid molecules onto solid-phases via disulfide bonds |
| US6266459B1 (en) | 1997-03-14 | 2001-07-24 | Trustees Of Tufts College | Fiber optic sensor with encoded microspheres |
| US6859570B2 (en) | 1997-03-14 | 2005-02-22 | Trustees Of Tufts College, Tufts University | Target analyte sensors utilizing microspheres |
| US20050130188A1 (en) | 1997-03-14 | 2005-06-16 | The Trustees Of Tufts College | Methods for detecting target analytes and enzymatic reactions |
| US20020058250A1 (en) | 1997-03-21 | 2002-05-16 | Marshall, Gerstein & Borun | Extraction and utilisation of vntr alleles |
| US7985565B2 (en) | 1997-04-01 | 2011-07-26 | Illumina, Inc. | Method of nucleic acid amplification |
| US20050100900A1 (en) | 1997-04-01 | 2005-05-12 | Manteia Sa | Method of nucleic acid amplification |
| US20080286795A1 (en) | 1997-04-01 | 2008-11-20 | Solexa Limited | Method of nucleic acid amplification |
| WO1998044151A1 (en) | 1997-04-01 | 1998-10-08 | Glaxo Group Limited | Method of nucleic acid amplification |
| US20020055100A1 (en) | 1997-04-01 | 2002-05-09 | Kawashima Eric H. | Method of nucleic acid sequencing |
| US6143496A (en) | 1997-04-17 | 2000-11-07 | Cytonix Corporation | Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly |
| US20030224419A1 (en) | 1997-05-23 | 2003-12-04 | Lynx Therapeutics, Inc. | Data analysis and display system for ligation-based DNA sequencing |
| US5919626A (en) | 1997-06-06 | 1999-07-06 | Orchid Bio Computer, Inc. | Attachment of unmodified nucleic acids to silanized solid phase surfaces |
| US5958775A (en) | 1997-07-25 | 1999-09-28 | Thomas Jefferson University | Composition and method for targeted integration into cells |
| CN1273609A (en) | 1997-08-15 | 2000-11-15 | 希斯克有限公司 | Methods and compositions for detecting or quantifying nucleic acid species |
| US20080220981A1 (en) | 1997-09-02 | 2008-09-11 | Rowett Research Institute | Chimeric binding peptide library screening method |
| US6432360B1 (en) | 1997-10-10 | 2002-08-13 | President And Fellows Of Harvard College | Replica amplification of nucleic acid arrays |
| US7456012B2 (en) | 1997-11-06 | 2008-11-25 | Cellectricon Ab | Method and apparatus for spatially confined electroporation |
| US6054274A (en) | 1997-11-12 | 2000-04-25 | Hewlett-Packard Company | Method of amplifying the signal of target nucleic acid sequence analyte |
| US5994136A (en) | 1997-12-12 | 1999-11-30 | Cell Genesys, Inc. | Method and means for producing high titer, safe, recombinant lentivirus vectors |
| US20030162216A1 (en) | 1997-12-15 | 2003-08-28 | Somalogic, Inc. | Nucleic acid ligand diagnostic biochip |
| AU2003200718B2 (en) | 1997-12-15 | 2006-10-19 | Somalogic, Inc. | Nucleic acid ligand diagnostic biochip |
| WO1999032654A1 (en) | 1997-12-22 | 1999-07-01 | Hitachi Chemical Co., Ltd. | Direct rt-pcr on oligonucleotide-immobilized pcr microplates |
| US7258976B2 (en) * | 1997-12-22 | 2007-08-21 | Hitachi Chemical Co. Ltd. | Method of preparing cell lysate |
| US7427678B2 (en) | 1998-01-08 | 2008-09-23 | Sigma-Aldrich Co. | Method for immobilizing oligonucleotides employing the cycloaddition bioconjugation method |
| US8030477B2 (en) | 1998-02-23 | 2011-10-04 | Wisconsin Alumni Research Foundation | Methods for the synthesis of arrays of DNA probes |
| WO1999044063A2 (en) | 1998-02-25 | 1999-09-02 | The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Tumor tissue microarrays for rapid molecular profiling |
| US6699710B1 (en) | 1998-02-25 | 2004-03-02 | The United States Of America As Represented By The Department Of Health And Human Services | Tumor tissue microarrays for rapid molecular profiling |
| WO1999044062A1 (en) | 1998-02-25 | 1999-09-02 | The United States Of America As Represented By The Secretary Department Of Health And Human Services | Cellular arrays for rapid molecular profiling |
| US20020168645A1 (en) | 1998-04-16 | 2002-11-14 | Seth Taylor | Analysis of polynucleotide sequence |
| US20050257284A1 (en) | 1998-04-30 | 2005-11-17 | Sumitomo Chemical Co., Ltd. | Method for producing transgenic plants resistant to weed control compounds which disrupt the porphyrin pathways of plants |
| US6969488B2 (en) | 1998-05-22 | 2005-11-29 | Solexa, Inc. | System and apparatus for sequential processing of analytes |
| EP0961110A2 (en) | 1998-05-27 | 1999-12-01 | Becton Dickinson and Company | Device for preparing thin liquid samples for microscopic analysis |
| WO1999063385A1 (en) | 1998-06-04 | 1999-12-09 | Board Of Regents, The University Of Texas System | Digital optical chemistry micromirror imager |
| US6348990B1 (en) | 1998-06-18 | 2002-02-19 | Hamamatsu Photonics K.K. | Spatial light modulator and spatial light modulating method |
| WO1999067641A2 (en) | 1998-06-24 | 1999-12-29 | Illumina, Inc. | Decoding of array sensors with microspheres |
| US8460865B2 (en) | 1998-06-24 | 2013-06-11 | Illumina, Inc. | Multiplex decoding of array sensors with microspheres |
| US6404907B1 (en) | 1998-06-26 | 2002-06-11 | Visible Genetics Inc. | Method for sequencing nucleic acids with reduced errors |
| US20100151464A1 (en) | 1998-06-29 | 2010-06-17 | Lllumina, Lnc. | Compositions and methods for preparing oligonucleotide solutions |
| US6787308B2 (en) | 1998-07-30 | 2004-09-07 | Solexa Ltd. | Arrayed biomolecules and their use in sequencing |
| US20040106110A1 (en) | 1998-07-30 | 2004-06-03 | Solexa, Ltd. | Preparation of polynucleotide arrays |
| WO2000017390A1 (en) | 1998-09-18 | 2000-03-30 | Micromet Ag | Dna amplification of a single cell |
| US6159736A (en) | 1998-09-23 | 2000-12-12 | Wisconsin Alumni Research Foundation | Method for making insertional mutations using a Tn5 synaptic complex |
| US20080160580A1 (en) | 1998-09-30 | 2008-07-03 | Solexa, Inc | Methods of nucleic acid amplification and sequencing |
| US7115400B1 (en) | 1998-09-30 | 2006-10-03 | Solexa Ltd. | Methods of nucleic acid amplification and sequencing |
| WO2000018957A1 (en) | 1998-09-30 | 2000-04-06 | Applied Research Systems Ars Holding N.V. | Methods of nucleic acid amplification and sequencing |
| US6573043B1 (en) | 1998-10-07 | 2003-06-03 | Genentech, Inc. | Tissue analysis and kits therefor |
| US20060183150A1 (en) | 1998-10-07 | 2006-08-17 | Cohen Robert L | Tissue analysis and kits therefor |
| US7674589B2 (en) | 1998-10-07 | 2010-03-09 | Genentech, Inc. | Methods for tissue analysis |
| US20030022207A1 (en) | 1998-10-16 | 2003-01-30 | Solexa, Ltd. | Arrayed polynucleotides and their use in genome analysis |
| US6337472B1 (en) | 1998-10-19 | 2002-01-08 | The University Of Texas System Board Of Regents | Light imaging microscope having spatially resolved images |
| US20020132246A1 (en) | 1998-10-28 | 2002-09-19 | Olli-P Kallioniemi | Cellular arrays and methods of detecting and using genetic disorder markers |
| WO2000024940A1 (en) | 1998-10-28 | 2000-05-04 | Vysis, Inc. | Cellular arrays and methods of detecting and using genetic disorder markers |
| US6391937B1 (en) | 1998-11-25 | 2002-05-21 | Motorola, Inc. | Polyacrylamide hydrogels and hydrogel arrays made from polyacrylamide reactive prepolymers |
| US6416950B1 (en) | 1998-12-02 | 2002-07-09 | Phylos, Inc. | DNA-protein fusions and uses thereof |
| US20050255548A1 (en) | 1998-12-10 | 2005-11-17 | Phylos, Inc. | Protein scaffolds for antibody mimics and other binding proteins |
| US20090082212A1 (en) | 1998-12-14 | 2009-03-26 | Pacific Biosciences | System and methods for nucleic acid sequencing of single molecules by polymerase synthesis |
| US7358047B2 (en) | 1998-12-15 | 2008-04-15 | Qiagen Gmbh | Methods of forming circular nucleic acid probes and uses thereof |
| US6864052B1 (en) | 1999-01-06 | 2005-03-08 | Callida Genomics, Inc. | Enhanced sequencing by hybridization using pools of probes |
| US20050191656A1 (en) | 1999-01-06 | 2005-09-01 | Callida Genomics, Inc. | Enhanced sequencing by hybridization using pools of probes |
| US6828100B1 (en) | 1999-01-22 | 2004-12-07 | Biotage Ab | Method of DNA sequencing |
| US6565727B1 (en) | 1999-01-25 | 2003-05-20 | Nanolytics, Inc. | Actuators for microfluidics without moving parts |
| US6506561B1 (en) | 1999-01-27 | 2003-01-14 | Commissariat A L'energie Atomique | Method of obtaining a library of tags capable of defining a specific state of a biological sample |
| US6157432A (en) | 1999-01-29 | 2000-12-05 | Hewlett-Packard Company | Heated ferroelectric liquid crystal spatial light modulator with improved contrast, improved grayscale resolution, and decreased pixel sticking when operated in a non-DC balanced mode |
| US20020150909A1 (en) | 1999-02-09 | 2002-10-17 | Stuelpnagel John R. | Automated information processing in randomly ordered arrays |
| US6977033B2 (en) | 1999-02-12 | 2005-12-20 | Board Of Regents, The University Of Texas System | Method and apparatus for programmable fluidic processing |
| US7641779B2 (en) | 1999-02-12 | 2010-01-05 | Board Of Regents, The University Of Texas System | Method and apparatus for programmable fluidic processing |
| US6153389A (en) | 1999-02-22 | 2000-11-28 | Haarer; Brian K. | DNA additives as a mechanism for unambiguously marking biological samples |
| US6673620B1 (en) | 1999-04-20 | 2004-01-06 | Cytologix Corporation | Fluid exchange in a chamber on a microscope slide |
| EP1923471A1 (en) | 1999-04-20 | 2008-05-21 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US20060275782A1 (en) | 1999-04-20 | 2006-12-07 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US6355431B1 (en) | 1999-04-20 | 2002-03-12 | Illumina, Inc. | Detection of nucleic acid amplification reactions using bead arrays |
| US20050191698A1 (en) | 1999-04-20 | 2005-09-01 | Illumina, Inc. | Nucleic acid sequencing using microsphere arrays |
| US8486625B2 (en) | 1999-04-20 | 2013-07-16 | Illumina, Inc. | Detection of nucleic acid reactions on bead arrays |
| US6534266B1 (en) | 1999-04-22 | 2003-03-18 | Albert Einstein College Of Medicine Of Yeshiva University | Assay of transcription sites by multi-fluor fish |
| US20010055764A1 (en) | 1999-05-07 | 2001-12-27 | Empedocles Stephen A. | Microarray methods utilizing semiconductor nanocrystals |
| US9163283B2 (en) | 1999-05-20 | 2015-10-20 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US6620584B1 (en) | 1999-05-20 | 2003-09-16 | Illumina | Combinatorial decoding of random nucleic acid arrays |
| US7960119B2 (en) | 1999-05-20 | 2011-06-14 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US6544732B1 (en) | 1999-05-20 | 2003-04-08 | Illumina, Inc. | Encoding and decoding of array sensors utilizing nanocrystals |
| US7563576B2 (en) | 1999-05-20 | 2009-07-21 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US8206917B2 (en) | 1999-05-20 | 2012-06-26 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US7166431B2 (en) | 1999-05-20 | 2007-01-23 | Illumina, Inc. | Combinatorial decoding of random nucleic acid arrays |
| US6136592A (en) | 1999-06-25 | 2000-10-24 | Leighton; Stephen B. | Multiple micro-arrays |
| US7501245B2 (en) | 1999-06-28 | 2009-03-10 | Helicos Biosciences Corp. | Methods and apparatuses for analyzing polynucleotide sequences |
| US6911345B2 (en) | 1999-06-28 | 2005-06-28 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences |
| US7462449B2 (en) | 1999-06-28 | 2008-12-09 | California Institute Of Technology | Methods and apparatuses for analyzing polynucleotide sequences |
| US20020137031A1 (en) | 1999-07-01 | 2002-09-26 | Paul K. Wolber | Multidentate arrays |
| WO2001006012A1 (en) | 1999-07-14 | 2001-01-25 | Packard Bioscience Company | Derivative nucleic acids and uses thereof |
| US20040082059A1 (en) | 1999-07-22 | 2004-04-29 | Webb Peter G. | Methods of fabricating an addressable array of biopolymer probes |
| WO2001007915A2 (en) | 1999-07-26 | 2001-02-01 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health & Human Services, The National Institutes Of Health | Layered device with capture regions for cellular analysis |
| WO2001009363A1 (en) | 1999-08-02 | 2001-02-08 | Wisconsin Alumni Research Foundation | Mutant tn5 transposase enzymes and method for their use |
| US6773886B2 (en) | 1999-08-13 | 2004-08-10 | Yale University | Binary encoded sequence tags |
| WO2001012862A2 (en) | 1999-08-18 | 2001-02-22 | Illumina, Inc. | Compositions and methods for preparing oligonucleotide solutions |
| US6942968B1 (en) | 1999-08-30 | 2005-09-13 | Illumina, Inc. | Array compositions for improved signal detection |
| US6251639B1 (en) | 1999-09-13 | 2001-06-26 | Nugen Technologies, Inc. | Methods and compositions for linear isothermal amplification of polynucleotide sequences, using a RNA-DNA composite primer |
| US7264929B2 (en) | 1999-09-16 | 2007-09-04 | 454 Life Sciences Corporation | Method of sequencing a nucleic acid |
| US7244559B2 (en) | 1999-09-16 | 2007-07-17 | 454 Life Sciences Corporation | Method of sequencing a nucleic acid |
| US6274320B1 (en) | 1999-09-16 | 2001-08-14 | Curagen Corporation | Method of sequencing a nucleic acid |
| US6544790B1 (en) | 1999-09-17 | 2003-04-08 | Whitehead Institute For Biomedical Research | Reverse transfection method |
| US6291180B1 (en) | 1999-09-29 | 2001-09-18 | American Registry Of Pathology | Ultrasound-mediated high-speed biological reaction and tissue processing |
| US6833246B2 (en) | 1999-09-29 | 2004-12-21 | Solexa, Ltd. | Polynucleotide sequencing |
| US6677160B1 (en) | 1999-09-29 | 2004-01-13 | Pharmacia & Upjohn Company | Methods for creating a compound library and identifying lead chemical templates and ligands for target molecules |
| US6503713B1 (en) | 1999-10-04 | 2003-01-07 | University Of Medicine And Dentistry Of New Jersey | Methods for identifying RNA binding compounds |
| US20030232382A1 (en) | 1999-10-08 | 2003-12-18 | Brennan Thomas M. | Method and apparatus for performing large numbers of reactions using array assembly |
| US6632641B1 (en) | 1999-10-08 | 2003-10-14 | Metrigen, Inc. | Method and apparatus for performing large numbers of reactions using array assembly with releasable primers |
| CN1425133A (en) | 1999-10-13 | 2003-06-18 | 西格雷特生物科学有限公司 | System and method for detecting and identifying molecular events in a test sample |
| US20080038734A1 (en) | 1999-10-29 | 2008-02-14 | Stratagene California | Compositions and methods for the detection of a nucleic acid using a cleavage reaction |
| WO2001042796A1 (en) | 1999-12-13 | 2001-06-14 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health & Human Services, The National Institutes Of Health | High-throughput tissue microarray technology and applications |
| US20030190744A1 (en) | 1999-12-15 | 2003-10-09 | Motorola | Method and apparatus for performing biological reactions on a substrate surface |
| WO2001046402A1 (en) | 1999-12-20 | 2001-06-28 | University Of Southern California | Method for isolation of rna from formalin-fixed paraffin-embedded tissue specimens |
| US20010039029A1 (en) | 1999-12-22 | 2001-11-08 | Ryoichi Nemori | Method for measuring protease activity |
| US20020045272A1 (en) | 2000-01-31 | 2002-04-18 | Mcdevitt John T. | Method and apparatus for the delivery of samples to a chemical sensor array |
| US20030064398A1 (en) | 2000-02-02 | 2003-04-03 | Solexa, Ltd. | Synthesis of spatially addressed molecular arrays |
| US20180094316A1 (en) | 2000-02-07 | 2018-04-05 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US9850536B2 (en) | 2000-02-07 | 2017-12-26 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US7361488B2 (en) | 2000-02-07 | 2008-04-22 | Illumina, Inc. | Nucleic acid detection methods using universal priming |
| US8906626B2 (en) | 2000-02-07 | 2014-12-09 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US8288103B2 (en) | 2000-02-07 | 2012-10-16 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US7611869B2 (en) | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
| US6812005B2 (en) | 2000-02-07 | 2004-11-02 | The Regents Of The University Of California | Nucleic acid detection methods using universal priming |
| US8076063B2 (en) | 2000-02-07 | 2011-12-13 | Illumina, Inc. | Multiplexed methylation detection methods |
| US6890741B2 (en) | 2000-02-07 | 2005-05-10 | Illumina, Inc. | Multiplexed detection of analytes |
| US8003354B2 (en) | 2000-02-07 | 2011-08-23 | Illumina, Inc. | Multiplex nucleic acid reactions |
| WO2001059161A2 (en) | 2000-02-08 | 2001-08-16 | Clontech Laboratories, Inc. | Analyte assays employing universal arrays |
| US6770441B2 (en) | 2000-02-10 | 2004-08-03 | Illumina, Inc. | Array compositions and methods of making same |
| US20020064779A1 (en) | 2000-02-18 | 2002-05-30 | Ulf Landegren | Methods and kits for proximity probing |
| US20020006477A1 (en) | 2000-04-03 | 2002-01-17 | Takeshi Shishido | Exhaust processing method, plasma processing method and plasma processing apparatus |
| US20020040275A1 (en) | 2000-04-10 | 2002-04-04 | The Scripps Research Institute | Proteomic analysis |
| US6368801B1 (en) | 2000-04-12 | 2002-04-09 | Molecular Staging, Inc. | Detection and amplification of RNA using target-mediated ligation of DNA by RNA ligase |
| US7001792B2 (en) | 2000-04-24 | 2006-02-21 | Eagle Research & Development, Llc | Ultra-fast nucleic acid sequencing device and a method for making and using the same |
| US6291187B1 (en) | 2000-05-12 | 2001-09-18 | Molecular Staging, Inc. | Poly-primed amplification of nucleic acid sequences |
| WO2001090415A2 (en) | 2000-05-20 | 2001-11-29 | The Regents Of The University Of Michigan | Method of producing a dna library using positional amplification |
| US20020051986A1 (en) | 2000-06-13 | 2002-05-02 | Luis Baez | Method for the detection of an analyte by means of a nucleic acid reporter |
| WO2001096608A1 (en) | 2000-06-15 | 2001-12-20 | Digene Corporation | Detection of nucleic acids by type-specific hybrid capture method |
| US20050244850A1 (en) | 2000-06-21 | 2005-11-03 | Hiu Huang | Assembly of arrays on chips segmented from wafers |
| US8278034B2 (en) | 2000-06-22 | 2012-10-02 | Nuclea Biotechnologies, Inc. | Methods of making frozen tissue microarrays |
| US6323009B1 (en) | 2000-06-28 | 2001-11-27 | Molecular Staging, Inc. | Multiply-primed amplification of nucleic acid sequences |
| US7329492B2 (en) | 2000-07-07 | 2008-02-12 | Visigen Biotechnologies, Inc. | Methods for real-time single molecule sequence determination |
| US20110059436A1 (en) | 2000-07-07 | 2011-03-10 | Life Technologies Corporation | Methods for sequence determination |
| US6867028B2 (en) | 2000-07-24 | 2005-03-15 | Fermentas Ab | Strand-specific polynucleotide nickases |
| US20030205632A1 (en) | 2000-07-25 | 2003-11-06 | Chang-Jin Kim | Electrowetting-driven micropumping |
| US20020048766A1 (en) | 2000-07-28 | 2002-04-25 | Doyle Michael D. | Method and system for the multidimensional morphological reconstruction of genome expression activity |
| US7674752B2 (en) | 2000-08-15 | 2010-03-09 | Discema Limited | Functional protein arrays |
| US8343500B2 (en) | 2000-08-21 | 2013-01-01 | Apitope Technology (Bristol) Limited | Peptide composition |
| US20020045169A1 (en) | 2000-08-25 | 2002-04-18 | Shoemaker Daniel D. | Gene discovery using microarrays |
| US6773566B2 (en) | 2000-08-31 | 2004-08-10 | Nanolytics, Inc. | Electrostatic actuators for microfluidics and methods for using same |
| US20030134279A1 (en) | 2000-09-14 | 2003-07-17 | Jorma Isola | In situ hybridization probes and cancer therapy diagnostics |
| US20030211489A1 (en) | 2000-09-21 | 2003-11-13 | Shen Min-Jui Richard | Multiplex nucleic acid reactions |
| US7955794B2 (en) | 2000-09-21 | 2011-06-07 | Illumina, Inc. | Multiplex nucleic acid reactions |
| WO2002024952A1 (en) | 2000-09-22 | 2002-03-28 | Clinomics Biosciences, Inc. | Profile array substrates |
| US6897023B2 (en) | 2000-09-27 | 2005-05-24 | The Molecular Sciences Institute, Inc. | Method for determining relative abundance of nucleic acid sequences |
| US20040023320A1 (en) | 2000-10-24 | 2004-02-05 | Steiner Georg E. | Method and system for analyzing cells |
| US20020164611A1 (en) | 2000-11-15 | 2002-11-07 | Bamdad R. Shoshana | Oligonucleotide identifiers |
| WO2002040874A1 (en) | 2000-11-16 | 2002-05-23 | California Institute Of Technology | Apparatus and methods for conducting assays and high throughput screening |
| US7211414B2 (en) | 2000-12-01 | 2007-05-01 | Visigen Biotechnologies, Inc. | Enzymatic nucleic acid synthesis: compositions and methods for altering monomer incorporation fidelity |
| US20040096853A1 (en) | 2000-12-08 | 2004-05-20 | Pascal Mayer | Isothermal amplification of nucleic acids on a solid support |
| US20030215936A1 (en) | 2000-12-13 | 2003-11-20 | Olli Kallioniemi | High-throughput tissue microarray technology and applications |
| US20030017451A1 (en) | 2000-12-21 | 2003-01-23 | Hui Wang | Methods for detecting transcripts |
| WO2002077283A1 (en) | 2000-12-21 | 2002-10-03 | Affymetrix, Inc. | Methods for detecting transcripts |
| US7118883B2 (en) | 2000-12-28 | 2006-10-10 | Post Genome Institute Co., Ltd. | Process for producing peptides by using in vitro transcription/translation system |
| US20020086441A1 (en) | 2000-12-28 | 2002-07-04 | Mds Sciex | Elemental analysis of tagged biologically active materials |
| US6800453B2 (en) | 2001-01-23 | 2004-10-05 | President And Fellows Of Harvard College | Nucleic-acid programmable protein arrays |
| US20050048580A1 (en) | 2001-01-23 | 2005-03-03 | President And Fellows Of Harvard College | Nucleic-acid programmable protein arrays |
| WO2002059355A2 (en) | 2001-01-25 | 2002-08-01 | Tm Bioscience Corporation | Polynucleotides for use as tags and tag complements, manufacture and use thereof |
| US20030087232A1 (en) | 2001-01-25 | 2003-05-08 | Fred Christians | Methods for screening polypeptides |
| WO2002059364A1 (en) | 2001-01-27 | 2002-08-01 | Electron-Bio, Inc. | Nucleic hybridization assay method and device using a cleavage technique responsive to the complementary double strand or the single strand of nucleic acids or oligonucleotides |
| US20070020625A1 (en) | 2001-02-07 | 2007-01-25 | Eric Duchaud | Sequence of the photorhabdus luminescens strain tt01 genome and uses |
| US20030165948A1 (en) | 2001-03-09 | 2003-09-04 | Alsmadi Osama A. | Method and compositions for efficient and specific rolling circle amplification |
| US7297518B2 (en) | 2001-03-12 | 2007-11-20 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension |
| US6969589B2 (en) | 2001-03-30 | 2005-11-29 | Perlegen Sciences, Inc. | Methods for genomic analysis |
| WO2002088396A2 (en) | 2001-04-30 | 2002-11-07 | Ventana Medical Systems, Inc. | Reagents and methods for automated in situ or microarray hybridization |
| WO2003002979A2 (en) | 2001-06-28 | 2003-01-09 | Illumina, Inc. | Multiplex decoding of array sensors with microspheres |
| WO2003003810A2 (en) | 2001-07-03 | 2003-01-16 | The Institute For Systems Biology | Methods for detection and quantification of analytes in complex mixtures |
| US7473767B2 (en) | 2001-07-03 | 2009-01-06 | The Institute For Systems Biology | Methods for detection and quantification of analytes in complex mixtures |
| US7582420B2 (en) | 2001-07-12 | 2009-09-01 | Illumina, Inc. | Multiplex nucleic acid reactions |
| US20040248325A1 (en) | 2001-07-19 | 2004-12-09 | Cuneyt Bukusoglu | Method for simultaneous multiple probes/multiple targets screening procedure |
| WO2003008538A2 (en) | 2001-07-20 | 2003-01-30 | Molecular Staging, Inc. | Gene expression profiling |
| WO2003010176A2 (en) | 2001-07-24 | 2003-02-06 | Oxford Glycosciences (Uk) Ltd | Protein-nucleic acid complexes |
| US20040067493A1 (en) | 2001-07-25 | 2004-04-08 | Affymetrix, Inc. | Complexity management of genomic DNA |
| US20030096323A1 (en) | 2001-07-31 | 2003-05-22 | Pfizer Inc. | PDE10 cell-based assay and sequences |
| US20030040035A1 (en) | 2001-08-23 | 2003-02-27 | The Regents Of The University Of California | Frozen tissue microarray technology for analysis of RNA, DNA, and proteins |
| US7858321B2 (en) | 2001-09-10 | 2010-12-28 | Meso Scale Technologies, Llc | Methods and apparatus for conducting multiple measurements on a sample |
| US20030113713A1 (en) | 2001-09-10 | 2003-06-19 | Meso Scale Technologies, Llc | Methods and apparatus for conducting multiple measurements on a sample |
| US20060188875A1 (en) | 2001-09-18 | 2006-08-24 | Perlegen Sciences, Inc. | Human genomic polymorphisms |
| US20040019005A1 (en) | 2001-10-01 | 2004-01-29 | Jeffrey Van Ness | Methods for parallel measurement of genetic variations |
| US20030073086A1 (en) | 2001-10-05 | 2003-04-17 | Surmodics, Inc. | Randomly ordered arrays and methods of making and using |
| US20030148335A1 (en) | 2001-10-10 | 2003-08-07 | Li Shen | Detecting targets by unique identifier nucleotide tags |
| US20050164292A1 (en) | 2001-10-24 | 2005-07-28 | Beckman Coulter, Inc. | Efficient synthesis of protein-oligonucleotide conjugates |
| US20030175947A1 (en) | 2001-11-05 | 2003-09-18 | Liu Robin Hui | Enhanced mixing in microfluidic devices |
| US20030124595A1 (en) | 2001-11-06 | 2003-07-03 | Lizardi Paul M. | Sensitive coded detection systems |
| US20100145037A1 (en) | 2001-11-13 | 2010-06-10 | Rubicon Genomics, Inc. | Dna amplification and sequencing using dna molecules generated by random fragmentation |
| US20050064460A1 (en) | 2001-11-16 | 2005-03-24 | Medical Research Council | Emulsion compositions |
| US7163612B2 (en) | 2001-11-26 | 2007-01-16 | Keck Graduate Institute | Method, apparatus and article for microfluidic control via electrowetting, for chemical, biochemical and biological assays and the like |
| US7057026B2 (en) | 2001-12-04 | 2006-06-06 | Solexa Limited | Labelled nucleotides |
| US20060188901A1 (en) | 2001-12-04 | 2006-08-24 | Solexa Limited | Labelled nucleotides |
| US7098041B2 (en) | 2001-12-11 | 2006-08-29 | Kimberly-Clark Worldwide, Inc. | Methods to view and analyze the results from diffraction-based diagnostics |
| US20030153850A1 (en) | 2002-01-16 | 2003-08-14 | Davis Brian J. | Method and apparatus for image-guided therapy |
| US20100267590A1 (en) | 2002-01-22 | 2010-10-21 | Grace Bio-Labs, Inc. | Reaction Surface Array Diagnostic Apparatus |
| US7499806B2 (en) | 2002-02-14 | 2009-03-03 | Illumina, Inc. | Image processing in microsphere arrays |
| US20040002090A1 (en) | 2002-03-05 | 2004-01-01 | Pascal Mayer | Methods for detecting genome-wide sequence variations associated with a phenotype |
| US20030170637A1 (en) | 2002-03-06 | 2003-09-11 | Pirrung Michael C. | Method of analyzing mRNA splice variants |
| US20030175844A1 (en) | 2002-03-12 | 2003-09-18 | Nadler Timothy K. | Method and apparatus for the identification and quantification of biomolecules |
| US7223371B2 (en) | 2002-03-14 | 2007-05-29 | Micronics, Inc. | Microfluidic channel network device |
| US20030235535A1 (en) | 2002-04-15 | 2003-12-25 | Qun-Yong Zhou | Screening and therapeutic methods for treating circadian rhythm disorders |
| US20030235852A1 (en) | 2002-04-19 | 2003-12-25 | Roberts Richard W. | Nucleic acid-peptide display libraries containing peptides with unnatural amino acid residues, and methods of making same using peptide modifying agents |
| US7128893B2 (en) | 2002-05-06 | 2006-10-31 | Endocyte, Inc. | Vitamin-targeted imaging agents |
| US20030235854A1 (en) | 2002-05-09 | 2003-12-25 | Chan Eugene Y. | Methods for analyzing a nucleic acid |
| US7375234B2 (en) | 2002-05-30 | 2008-05-20 | The Scripps Research Institute | Copper-catalysed ligation of azides and acetylenes |
| WO2003102233A1 (en) | 2002-06-03 | 2003-12-11 | Pamgene B.V. | Novel high density arrays and methods for analyte analysis |
| US20050202433A1 (en) | 2002-06-03 | 2005-09-15 | Van Beuningen Marinus Gerardus J. | Novel high density arrays and methods for analyte analysis |
| US20030232348A1 (en) | 2002-06-17 | 2003-12-18 | Affymetrix, Inc. | Complexity management of genomic DNA by locus specific amplification |
| US7052244B2 (en) | 2002-06-18 | 2006-05-30 | Commissariat A L'energie Atomique | Device for displacement of small liquid volumes along a micro-catenary line by electrostatic forces |
| WO2003106973A2 (en) | 2002-06-18 | 2003-12-24 | Invitrogen Corporation | Methods and apparatus for low resistance electrophoresis of prior-cast, hydratable separation media |
| US20070128071A1 (en) | 2002-06-21 | 2007-06-07 | Shea Laurence R | Devices and methods for performing array based assays |
| US20050019776A1 (en) | 2002-06-28 | 2005-01-27 | Callow Matthew James | Universal selective genome amplification and universal genotyping system |
| WO2004015080A2 (en) | 2002-08-09 | 2004-02-19 | Illumina, Inc. | Nucleic acid detection methods using universal priming |
| US20040033499A1 (en) | 2002-08-16 | 2004-02-19 | Ilsley Diane D. | Method for synthesis of the second strand of cDNA |
| US20070166705A1 (en) | 2002-08-23 | 2007-07-19 | John Milton | Modified nucleotides |
| US20050239192A1 (en) | 2002-08-26 | 2005-10-27 | The Regents Of The University Of California | Hybrid automated continuous nucleic acid and protein analyzer using real-time PCR and liquid bead arrays |
| US20040050699A1 (en) | 2002-09-11 | 2004-03-18 | Goncalves Antonio M. | Automated system for high-throughput electrophoretic separations |
| US20090197326A1 (en) | 2002-09-16 | 2009-08-06 | The Board Of Trustees Of The Leland Stanford Junior University | Biological Analysis Arrangement and Approach Therefor |
| US7595883B1 (en) | 2002-09-16 | 2009-09-29 | The Board Of Trustees Of The Leland Stanford Junior University | Biological analysis arrangement and approach therefor |
| US20060154286A1 (en) | 2002-09-20 | 2006-07-13 | New England Biolabs, Inc. | Helicase-dependent amplification of nucleic acids |
| US7282328B2 (en) | 2002-09-20 | 2007-10-16 | New England Biolabs, Inc. | Helicase dependent amplification of nucleic acids |
| US20060194331A1 (en) | 2002-09-24 | 2006-08-31 | Duke University | Apparatuses and methods for manipulating droplets on a printed circuit board |
| US6911132B2 (en) | 2002-09-24 | 2005-06-28 | Duke University | Apparatus for manipulating droplets by electrowetting-based techniques |
| US20040112442A1 (en) | 2002-09-25 | 2004-06-17 | California Institute Of Technology | Microfluidic large scale integration |
| WO2004028955A2 (en) | 2002-09-25 | 2004-04-08 | California Institute Of Technology | Microfluidic large scale integration |
| US20110152111A1 (en) | 2002-10-03 | 2011-06-23 | Illumina, Inc. | Multiplex nucleic acid analysis using archived or fixed samples |
| US20040259105A1 (en) | 2002-10-03 | 2004-12-23 | Jian-Bing Fan | Multiplex nucleic acid analysis using archived or fixed samples |
| US20060079453A1 (en) | 2002-10-03 | 2006-04-13 | John Sidney | Hla binding peptides and their uses |
| US20040067492A1 (en) | 2002-10-04 | 2004-04-08 | Allan Peng | Reverse transcription on microarrays |
| US20040082058A1 (en) | 2002-10-29 | 2004-04-29 | Arthur Schleifer | Array hybridization apparatus and method for making uniform sample volumes |
| US20040121456A1 (en) | 2002-10-31 | 2004-06-24 | Fischer Andrew H. | Rapid cell block embedding method and apparatus |
| US6913921B2 (en) | 2002-10-31 | 2005-07-05 | University Of Massachusetts | Rapid cell block embedding method and apparatus |
| US20050019842A1 (en) | 2002-11-06 | 2005-01-27 | Prober James M. | Microparticle-based methods and systems and applications thereof |
| WO2004055159A2 (en) * | 2002-12-12 | 2004-07-01 | Chiron Corporation | Identification of oligonucleotides for the capture, detection and quantitation of west nile virus |
| US20040175822A1 (en) | 2002-12-18 | 2004-09-09 | West Virginia University Research Corporation | Apparatus and method for edman degradation using a microfluidic system |
| US20040224326A1 (en) | 2003-01-03 | 2004-11-11 | Young-A Kim | Method of replicating nucleic acid array |
| US7547380B2 (en) | 2003-01-13 | 2009-06-16 | North Carolina State University | Droplet transportation devices and methods having a fluid surface |
| US20050130173A1 (en) | 2003-01-29 | 2005-06-16 | Leamon John H. | Methods of amplifying and sequencing nucleic acids |
| WO2004067759A2 (en) | 2003-01-29 | 2004-08-12 | Cranfield University | Replication of nucleic acid arrays |
| US7910304B2 (en) | 2003-02-26 | 2011-03-22 | Callida Genomics, Inc. | Random array DNA analysis by hybridization |
| WO2004081225A2 (en) | 2003-03-07 | 2004-09-23 | Rubicon Genomics, Inc. | Amplification and analysis of whole genome and whole transcriptome libraries generated by a dna polymerization process |
| US20050014203A1 (en) | 2003-03-10 | 2005-01-20 | Darfler Marlene M. | Liquid tissue preparation from histopathologically processed biological samples, tissues and cells |
| US20060199183A1 (en) | 2003-03-13 | 2006-09-07 | Christophe Valat | Probe biochips and methods for use thereof |
| US20040235103A1 (en) | 2003-04-17 | 2004-11-25 | Reznikoff William S. | Tn5 transposase mutants and the use thereof |
| CN1537953A (en) | 2003-04-17 | 2004-10-20 | 中国人民解放军军事医学科学院放射医 | Preparation of gene chip for digagnosingantrax baiuus and its application |
| US7083980B2 (en) | 2003-04-17 | 2006-08-01 | Wisconsin Alumni Research Foundation | Tn5 transposase mutants and the use thereof |
| US20050042695A1 (en) | 2003-04-28 | 2005-02-24 | The Regents Of The University Of California | Element-coded affinity tags |
| US20040219588A1 (en) | 2003-04-30 | 2004-11-04 | Masaru Furuta | Method for dispensing reagents onto biological samples and method for analyzing biological samples |
| US20100173384A1 (en) | 2003-05-23 | 2010-07-08 | Kai Johnsson | Methods for protein labeling based on acyl carrier protein |
| US7666612B2 (en) | 2003-05-23 | 2010-02-23 | Epfl-Ecole Polytechnique Federale De Lausanne | Methods for protein labeling based on acyl carrier protein |
| WO2004108268A1 (en) | 2003-05-30 | 2004-12-16 | Applera Corporation | Apparatus and method for hybridization and spr detection |
| US20050026188A1 (en) | 2003-05-30 | 2005-02-03 | Van Kessel Andrew G. | Methods of identifying, characterizing and comparing organism communities |
| US7255994B2 (en) | 2003-06-10 | 2007-08-14 | Applera Corporation | Ligation assay |
| US20060216775A1 (en) | 2003-06-17 | 2006-09-28 | The Regents Of The University Of Califoenia | Compositions and methods for analysis and manipulation of enzymes in biosynthetic proteomes |
| US20050037393A1 (en) | 2003-06-20 | 2005-02-17 | Illumina, Inc. | Methods and compositions for whole genome amplification and genotyping |
| US20070128656A1 (en) | 2003-06-26 | 2007-06-07 | University Of South Florida | Direct Fluorescent Label Incorporation Via 1st Strand cDNA Synthesis |
| WO2005007814A2 (en) | 2003-07-03 | 2005-01-27 | The Regents Of The University Of California | Genome mapping of functional dna elements and cellular proteins |
| US7601492B2 (en) | 2003-07-03 | 2009-10-13 | The Regents Of The University Of California | Genome mapping of functional DNA elements and cellular proteins |
| WO2005010145A2 (en) | 2003-07-05 | 2005-02-03 | The Johns Hopkins University | Method and compositions for detection and enumeration of genetic variations |
| US20050079520A1 (en) | 2003-07-21 | 2005-04-14 | Jie Wu | Multiplexed analyte detection |
| US7848553B2 (en) | 2003-08-08 | 2010-12-07 | General Electric Company | Method and apparatus of multi-modality image fusion |
| US20080153086A1 (en) | 2003-08-08 | 2008-06-26 | Wong Albert J | Method For Rapid Identification of Alternative Splicing |
| US20050037362A1 (en) | 2003-08-11 | 2005-02-17 | Eppendorf Array Technologies, S.A. | Detection and quantification of siRNA on microarrays |
| US20070269805A1 (en) | 2003-09-02 | 2007-11-22 | Keygene N.V. | Ola-Based Methods for the Detection of Target Nucleic Avid Sequences |
| US20050095627A1 (en) | 2003-09-03 | 2005-05-05 | The Salk Institute For Biological Studies | Multiple antigen detection assays and reagents |
| WO2005042759A2 (en) | 2003-09-10 | 2005-05-12 | Althea Technologies, Inc. | Expression profiling using microarrays |
| US20060240439A1 (en) | 2003-09-11 | 2006-10-26 | Smith Geoffrey P | Modified polymerases for improved incorporation of nucleotide analogues |
| US20050266417A1 (en) | 2003-09-12 | 2005-12-01 | Francis Barany | Methods for identifying target nucleic acid molecules |
| WO2005026387A1 (en) | 2003-09-18 | 2005-03-24 | Nuevolution A/S | A method for obtaining structural information concerning an encoded molecule and method for selecting compounds |
| US7785869B2 (en) | 2003-09-19 | 2010-08-31 | Microfluidic Systems, Inc. | Sonication to selectively lyse different cell types |
| US20050064432A1 (en) | 2003-09-19 | 2005-03-24 | Linden Technologies, Inc. | Nucleic acid amplification and detection |
| US20050226780A1 (en) | 2003-09-19 | 2005-10-13 | Donald Sandell | Manual seal applicator |
| US20070054288A1 (en) | 2003-09-24 | 2007-03-08 | Intel Corporation | Programmable molecular barcodes |
| US20050116161A1 (en) | 2003-10-10 | 2005-06-02 | Protein Discovery, Inc. | Methods and devices for concentration and purification of analytes for chemical analysis including matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) |
| US7328979B2 (en) | 2003-11-17 | 2008-02-12 | Koninklijke Philips Electronics N.V. | System for manipulation of a body of fluid |
| US20090280487A1 (en) | 2003-11-21 | 2009-11-12 | Gene Hung | Methods for producing olfactory gpcrs |
| US20060110739A1 (en) | 2003-12-12 | 2006-05-25 | Saint Louis University | Biosensors for detecting macromolecules and other analytes |
| US7259258B2 (en) | 2003-12-17 | 2007-08-21 | Illumina, Inc. | Methods of attaching biological compounds to solid supports using triazine |
| US20050136414A1 (en) | 2003-12-23 | 2005-06-23 | Kevin Gunderson | Methods and compositions for making locus-specific arrays |
| CN1898398A (en) | 2003-12-29 | 2007-01-17 | 英特尔公司 | Methods for determining nucleotide sequence information |
| US20070014810A1 (en) | 2003-12-31 | 2007-01-18 | Denise Baker | Inducing cellular immune responses to human papillomavirus using peptide and nucleic acid compositions |
| US20110059865A1 (en) | 2004-01-07 | 2011-03-10 | Mark Edward Brennan Smith | Modified Molecular Arrays |
| US9889422B2 (en) | 2004-01-07 | 2018-02-13 | Illumina Cambridge Limited | Methods of localizing nucleic acids to arrays |
| US20050196786A1 (en) | 2004-01-08 | 2005-09-08 | Vanderbilt University | Multiplex spatial profiling of gene expression |
| WO2005067648A2 (en) | 2004-01-08 | 2005-07-28 | Vanderbilt University | Multiplex spatial profiling of gene expression |
| US20060188906A1 (en) | 2004-01-20 | 2006-08-24 | Joon-Ho Kim | Microfluidic chip for multiple bioassay and method of manufacturing the same |
| US20080261204A1 (en) | 2004-01-23 | 2008-10-23 | Lingvitae As | Polynucleotide Ligation Reactions |
| US20050179746A1 (en) | 2004-02-16 | 2005-08-18 | Commissariat A L'energie Atomique | Device for controlling the displacement of a drop between two or several solid substrates |
| US7378242B2 (en) | 2004-03-18 | 2008-05-27 | Atom Sciences, Inc. | DNA sequence detection by limited primer extension |
| US20100014537A1 (en) | 2004-03-30 | 2010-01-21 | Sagem Sa | Method of exchanging information between two networks operating under different routing protocols |
| CN1680604A (en) | 2004-04-10 | 2005-10-12 | 三星电子株式会社 | A microarray having microarray identification information stored in the form of a spot. method of producing the microarray and method of using the microarray |
| US20050227271A1 (en) | 2004-04-10 | 2005-10-13 | Kwon Tae-Joon | Microarray having microarray identification information stored in the form of a spot, method of producing the microarray and method of using the microarray |
| US20050260653A1 (en) | 2004-04-14 | 2005-11-24 | Joshua Labaer | Nucleic-acid programmable protein arrays |
| US20050239119A1 (en) | 2004-04-26 | 2005-10-27 | Canon Kabushiki Kaisha | PCR amplification reaction apparatus and method for PCR amplification reaction using apparatus |
| RU2270254C2 (en) | 2004-04-30 | 2006-02-20 | Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук | Identification of transgenic dna sequences in plant material and products made of the same, oligonucleotide kit and bioarray therefor |
| CN1981188A (en) | 2004-05-06 | 2007-06-13 | 科隆迪亚戈芯片技术有限公司 | Device and method for detecting molecular interactions |
| WO2005113804A1 (en) | 2004-05-20 | 2005-12-01 | Trillion Genomics Limited | Use of mass labelled probes to detect target nucleic acids using mass spectrometry |
| US20060003394A1 (en) | 2004-06-30 | 2006-01-05 | Kimberly-Clark Worldwide, Inc. | Enzymatic detection techniques |
| US20080124252A1 (en) | 2004-07-08 | 2008-05-29 | Commissariat A L'energie Atomique | Droplet Microreactor |
| US20090192044A1 (en) | 2004-07-09 | 2009-07-30 | Commissariat A L'energie Atomique | Electrode addressing method |
| US7608434B2 (en) | 2004-08-04 | 2009-10-27 | Wisconsin Alumni Research Foundation | Mutated Tn5 transposase proteins and the use thereof |
| US20070207482A1 (en) | 2004-08-04 | 2007-09-06 | President And Fellows Of Harvard College | Wobble sequencing |
| WO2006020515A1 (en) | 2004-08-09 | 2006-02-23 | Geneohm Sciences, Inc. | Amplification of target nucleotide sequence without polymerase chain reaction |
| US20060039823A1 (en) | 2004-08-17 | 2006-02-23 | Hironobu Yamakawa | Chemical analysis apparatus |
| US7776547B2 (en) | 2004-08-26 | 2010-08-17 | Intel Corporation | Cellular analysis using Raman surface scanning |
| US20060046313A1 (en) | 2004-08-26 | 2006-03-02 | Intel Corporation | Cellular analysis using Raman surface scanning |
| US20060228758A1 (en) | 2004-09-13 | 2006-10-12 | Xencor, Inc. | Analysis of MHC-peptide binding interactions |
| CN1749752A (en) | 2004-09-17 | 2006-03-22 | 北京大学 | Solution identification and surface addressing protein chip and its preparing and detecting method |
| US7315019B2 (en) | 2004-09-17 | 2008-01-01 | Pacific Biosciences Of California, Inc. | Arrays of optical confinements and uses thereof |
| US20060073506A1 (en) | 2004-09-17 | 2006-04-06 | Affymetrix, Inc. | Methods for identifying biological samples |
| US20060063160A1 (en) | 2004-09-22 | 2006-03-23 | West Jay A | Microfluidic microarray systems and methods thereof |
| US20060084078A1 (en) | 2004-10-15 | 2006-04-20 | Department Of Health And Human Services | Method of identifying active chromatin domains |
| US20080312103A1 (en) | 2004-10-15 | 2008-12-18 | Japan Science And Technology Agency | Linker For Constructing Mrna-Puromycin-Protein Conjugate |
| JP2014217381A (en) | 2004-11-12 | 2014-11-20 | アシュラジェン インコーポレイテッド | METHODS AND COMPOSITIONS INVOLVING miRNA AND miRNA INHIBITOR MOLECULES |
| US9506061B2 (en) | 2004-11-12 | 2016-11-29 | Asuragen, Inc. | Methods and compositions involving miRNA and miRNA inhibitor molecules |
| US20060105352A1 (en) | 2004-11-15 | 2006-05-18 | Eastman Kodak Company | Method for sensitive detection of multiple biological analytes |
| US20060134669A1 (en) | 2004-11-19 | 2006-06-22 | Casasanta Vincenzo Iii | Plasmon resonance biosensor and method |
| US8951728B2 (en) | 2004-11-22 | 2015-02-10 | Chemgene Holding Aps | Template directed split and mix synthesis of small molecule libraries |
| WO2006056861A1 (en) | 2004-11-26 | 2006-06-01 | Elettrofor S.A.S. Di Ruggero Massimo E C. | Method and apparatus for the simultaneous separation of biological molecules by two dimensional electrophoresis |
| WO2006064199A1 (en) | 2004-12-13 | 2006-06-22 | Solexa Limited | Improved method of nucleotide detection |
| US20080280773A1 (en) | 2004-12-13 | 2008-11-13 | Milan Fedurco | Method of Nucleotide Detection |
| WO2006065597A2 (en) | 2004-12-17 | 2006-06-22 | Applera Corporation | Id-tag complexes, arrays, and methods of use thereof |
| WO2006074351A2 (en) | 2005-01-05 | 2006-07-13 | Agencourt Personal Genomics | Reversible nucleotide terminators and uses thereof |
| US20080145378A1 (en) | 2005-01-25 | 2008-06-19 | Huib Ovaa | Means and Methods for Breaking Noncovalent Binding Interactions Between Molecules |
| US7579153B2 (en) | 2005-01-25 | 2009-08-25 | Population Genetics Technologies, Ltd. | Isothermal DNA amplification |
| US20060164490A1 (en) | 2005-01-25 | 2006-07-27 | Chang-Jin Kim | Method and apparatus for promoting the complete transfer of liquid drops from a nozzle |
| US7555155B2 (en) | 2005-01-27 | 2009-06-30 | Cambridge Research & Instrumentation, Inc. | Classifying image features |
| US8431691B2 (en) | 2005-02-01 | 2013-04-30 | Applied Biosystems Llc | Reagents, methods, and libraries for bead-based sequencing |
| WO2006084130A2 (en) | 2005-02-03 | 2006-08-10 | Perkinelmer Las, Inc. | Ultra-sensitive detection systems using multidimension signals |
| US9194001B2 (en) | 2005-02-10 | 2015-11-24 | Population Genetics Technologies Ltd. | Methods and compositions for tagging and identifying polynucleotides |
| US7393665B2 (en) | 2005-02-10 | 2008-07-01 | Population Genetics Technologies Ltd | Methods and compositions for tagging and identifying polynucleotides |
| US8148068B2 (en) | 2005-02-10 | 2012-04-03 | Population Genetics Technologies Ltd | Methods and compositions for tagging and identifying polynucleotides |
| US7407757B2 (en) | 2005-02-10 | 2008-08-05 | Population Genetics Technologies | Genetic analysis by sequence-specific sorting |
| US20060199207A1 (en) | 2005-02-24 | 2006-09-07 | Matysiak Stefan M | Self-assembly of molecules using combinatorial hybridization |
| US8507204B2 (en) | 2005-03-08 | 2013-08-13 | California Institute Of Technology | Hybridization chain reaction amplification for in situ imaging |
| CN101142325A (en) | 2005-03-08 | 2008-03-12 | 灵维泰公司 | Method for preparing polynucleotide for analysis |
| US8124751B2 (en) | 2005-03-08 | 2012-02-28 | California Institute Of Technology | Hybridization chain reaction amplification for in situ imaging |
| US7776567B2 (en) | 2005-03-17 | 2010-08-17 | Biotium, Inc. | Dimeric and trimeric nucleic acid dyes, and associated systems and methods |
| US7601498B2 (en) | 2005-03-17 | 2009-10-13 | Biotium, Inc. | Methods of using dyes in association with nucleic acid staining or detection and associated technology |
| US7803943B2 (en) | 2005-03-17 | 2010-09-28 | Biotium, Inc. | Methods of using dyes in association with nucleic acid staining or detection and associated technology |
| US20060211001A1 (en) | 2005-03-18 | 2006-09-21 | Wisconsin Alumni Research Foundation | Microdissection-based methods for determining genomic features of single chromosomes |
| US20060216721A1 (en) | 2005-03-25 | 2006-09-28 | Illumina, Inc. | Compositions and methods for detecting protease activity |
| US7229769B2 (en) | 2005-03-25 | 2007-06-12 | Illumina, Inc. | Compositions and methods for detecting protease activity |
| USRE44596E1 (en) | 2005-04-06 | 2013-11-12 | Guardant Health, Inc. | Method for the detection of cancer |
| US7700286B2 (en) | 2005-04-06 | 2010-04-20 | Maurice Stroun | Method for the detection of cancer |
| WO2006117541A1 (en) | 2005-05-03 | 2006-11-09 | Oxford Gene Technology Ip Limited | Devices and processes for analysing individual cells |
| EP2161336A1 (en) | 2005-05-09 | 2010-03-10 | ONO Pharmaceutical Co., Ltd. | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| US20060281109A1 (en) | 2005-05-10 | 2006-12-14 | Barr Ost Tobias W | Polymerases |
| US20070003954A1 (en) | 2005-05-12 | 2007-01-04 | The Board Of Regents Of The University Of Texas System | Protein and antibody profiling using small molecule microarrays |
| WO2006124771A2 (en) | 2005-05-12 | 2006-11-23 | Panomics, Inc. | Multiplex branched-chain dna assays |
| US20090169089A1 (en) | 2005-05-16 | 2009-07-02 | Isis Innovation Limited | Cell Analysis |
| US8337851B2 (en) | 2005-05-18 | 2012-12-25 | Novartis Ag | Methods of monitoring the efficacy of anti-CD40 antibodies in treating a subject for a CD40-expressing cancer |
| US20060263789A1 (en) | 2005-05-19 | 2006-11-23 | Robert Kincaid | Unique identifiers for indicating properties associated with entities to which they are attached, and methods for using |
| US20080199929A1 (en) * | 2005-05-20 | 2008-08-21 | Richard Yeung | Method and System For Collecting Cells Following Laser Microdissection |
| US20090305237A1 (en) | 2005-05-26 | 2009-12-10 | Trustees Of Boston University | Quantification of nucleic acids and proteins using oligonucleotide mass tags |
| US20060275799A1 (en) | 2005-06-01 | 2006-12-07 | Sukanta Banerjee | Creation of functionalized microparticle libraries by oligonucleotide ligation or elongation |
| WO2007145612A1 (en) | 2005-06-06 | 2007-12-21 | 454 Life Sciences Corporation | Paired end sequencing |
| US20110151451A1 (en) | 2005-06-07 | 2011-06-23 | Centre National De La Recherche Scientifique | Use of Conjugates with linkers cleavable by photodissociation or fragmentation for mass spectromety analysis of tissue sections |
| WO2007000669A2 (en) | 2005-06-07 | 2007-01-04 | Centre National De La Recherche Scientifique (Cnrs) | Use of conjugates with linkers cleavable by photodissociation or fragmentation for mass spectrometry analysis of tissue sections |
| US20080293591A1 (en) | 2005-06-09 | 2008-11-27 | Taussig Michael J | Repeatable Protein Arrays |
| US7561336B2 (en) | 2005-06-10 | 2009-07-14 | Ricoh Company, Ltd. | Micro-optical device, spatial optical modulator and projector utilizing the micro-optical device |
| US20070099208A1 (en) | 2005-06-15 | 2007-05-03 | Radoje Drmanac | Single molecule arrays for genetic and chemical analysis |
| US20070087360A1 (en) | 2005-06-20 | 2007-04-19 | Boyd Victoria L | Methods and compositions for detecting nucleotides |
| US8604182B2 (en) | 2005-06-20 | 2013-12-10 | Advanced Cell Diagnostics, Inc. | Multiplex detection of nucleic acids |
| US8951726B2 (en) | 2005-06-20 | 2015-02-10 | Advanced Cell Diagnostics, Inc. | Multiplex detection of nucleic acids |
| US7709198B2 (en) | 2005-06-20 | 2010-05-04 | Advanced Cell Diagnostics, Inc. | Multiplex detection of nucleic acids |
| US20070280517A1 (en) | 2005-06-21 | 2007-12-06 | De La Torre-Bueno Jose | Serial section analysis for computer-controlled microscopic imaging |
| US8785353B2 (en) | 2005-06-23 | 2014-07-22 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US9898576B2 (en) | 2005-06-23 | 2018-02-20 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| EP2302070A2 (en) | 2005-06-23 | 2011-03-30 | Keygene N.V. | Strategies for high throughput identification and detection fo polymorpisms |
| US20090036323A1 (en) | 2005-06-23 | 2009-02-05 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US9898577B2 (en) | 2005-06-23 | 2018-02-20 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US9493820B2 (en) | 2005-06-23 | 2016-11-15 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US9453256B2 (en) | 2005-06-23 | 2016-09-27 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US9447459B2 (en) | 2005-06-23 | 2016-09-20 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US9376716B2 (en) | 2005-06-23 | 2016-06-28 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US9896721B2 (en) | 2005-06-23 | 2018-02-20 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US9023768B2 (en) | 2005-06-23 | 2015-05-05 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| WO2006137733A1 (en) | 2005-06-23 | 2006-12-28 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US20180247017A1 (en) | 2005-06-23 | 2018-08-30 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US10095832B2 (en) | 2005-06-23 | 2018-10-09 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US8685889B2 (en) | 2005-06-23 | 2014-04-01 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| EP2292788A1 (en) | 2005-06-23 | 2011-03-09 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| EP1910562A1 (en) | 2005-06-23 | 2008-04-16 | Keygene N.V. | Strategies for high throughput identification and detection of polymorphisms |
| US20070026430A1 (en) | 2005-06-30 | 2007-02-01 | Applera Corporation | Proximity probing of target proteins comprising restriction and/or extension |
| US20070020669A1 (en) | 2005-07-08 | 2007-01-25 | Olof Ericsson | Regulation analysis by cis reactivity, RACR |
| JP2007014297A (en) | 2005-07-11 | 2007-01-25 | Onchip Cellomics Consortium | Cell-constituting substance-fractionally collecting chip, cell-constituting substance-analyzing system and method for analyzing the cell-constituting substance by using them |
| WO2007010251A2 (en) | 2005-07-20 | 2007-01-25 | Solexa Limited | Preparation of templates for nucleic acid sequencing |
| US20070020640A1 (en) | 2005-07-21 | 2007-01-25 | Mccloskey Megan L | Molecular encoding of nucleic acid templates for PCR and other forms of sequence analysis |
| US20070023292A1 (en) | 2005-07-26 | 2007-02-01 | The Regents Of The University Of California | Small object moving on printed circuit board |
| US20070036511A1 (en) | 2005-08-11 | 2007-02-15 | Pacific Biosciences Of California, Inc. | Methods and systems for monitoring multiple optical signals from a single source |
| US20070048812A1 (en) | 2005-09-01 | 2007-03-01 | Moravec Richard A | Cell-based luminogenic and nonluminogenic proteasome assays |
| WO2007030373A2 (en) | 2005-09-07 | 2007-03-15 | St. Jude Children's Research Hospital | Method for in situ hybridization analysis |
| JP2007074967A (en) | 2005-09-13 | 2007-03-29 | Canon Inc | Identifier probe and nucleic acid amplification method using the same |
| US20090023148A1 (en) | 2005-09-21 | 2009-01-22 | Moyle William R | Sensors for biomolecular detection and cell classification |
| US9657335B2 (en) | 2005-09-29 | 2017-05-23 | Keygene N.V. | High throughput screening of populations carrying naturally occurring mutations |
| US20090170713A1 (en) | 2005-09-29 | 2009-07-02 | Keygene N.V. | High throughput screening of mutagenized populations |
| US8614073B2 (en) | 2005-09-29 | 2013-12-24 | Keygene N.V. | High throughput screening of mutagenized populations |
| EP1929039A2 (en) | 2005-09-29 | 2008-06-11 | Keygene N.V. | High throughput screening of mutagenized populations |
| US7405281B2 (en) | 2005-09-29 | 2008-07-29 | Pacific Biosciences Of California, Inc. | Fluorescent nucleotide analogs and uses therefor |
| US9376719B2 (en) | 2005-09-29 | 2016-06-28 | Keygene N.V. | High throughput screening of mutagenized populations |
| WO2007037678A2 (en) | 2005-09-29 | 2007-04-05 | Keygene N.V. | High throughput screening of mutagenized populations |
| US9745627B2 (en) | 2005-09-29 | 2017-08-29 | Keygene N.V. | High throughput screening of populations carrying naturally occurring mutations |
| US20170166962A1 (en) | 2005-09-29 | 2017-06-15 | Keygene N.V. | High throughput screening of populations carrying naturally occurring mutations |
| US9670542B2 (en) | 2005-09-29 | 2017-06-06 | Keygene N.V. | High throughput screening of populations carrying naturally occurring mutations |
| US9574230B2 (en) | 2005-09-29 | 2017-02-21 | Keygene N.V. | High throughput screening of populations carrying naturally occuring mutations |
| WO2007041689A2 (en) | 2005-10-04 | 2007-04-12 | President And Fellows Of Harvard College | Methods of site-specific labeling of molecules and molecules produced thereby |
| US20070128624A1 (en) | 2005-11-01 | 2007-06-07 | Gormley Niall A | Method of preparing libraries of template polynucleotides |
| US20070116612A1 (en) | 2005-11-02 | 2007-05-24 | Biopath Automation, L.L.C. | Prefix tissue cassette |
| EP1782737A1 (en) | 2005-11-02 | 2007-05-09 | BioPath Automation, L.L.C. | Tissue cassette for transporting |
| US20070161020A1 (en) | 2005-11-10 | 2007-07-12 | Panomics, Inc. | Detection of nucleic acids through amplification of surrogate nucleic acids |
| US20090018024A1 (en) | 2005-11-14 | 2009-01-15 | President And Fellows Of Harvard College | Nanogrid rolling circle dna sequencing |
| US9624538B2 (en) | 2005-11-14 | 2017-04-18 | President And Fellows Of Harvard College | Nanogrid rolling circle DNA sequencing |
| US20120021930A1 (en) | 2005-11-22 | 2012-01-26 | Stichting Dienst Landbouwkundig Onderzoek | Multiplex Nucleic Acid Detection |
| WO2007060599A1 (en) | 2005-11-25 | 2007-05-31 | Koninklijke Philips Electronics N.V. | Magnetic biosensor for determination of enzymic activity |
| US8092784B2 (en) | 2005-11-30 | 2012-01-10 | Biotium, Inc. | Enzyme substrate comprising a functional dye and associated technology and methods |
| US20070161029A1 (en) | 2005-12-05 | 2007-07-12 | Panomics, Inc. | High throughput profiling of methylation status of promoter regions of genes |
| US20070134723A1 (en) | 2005-12-09 | 2007-06-14 | Illumina, Inc. | Compositions and methods for detecting phosphomonoester |
| US20090202998A1 (en) | 2005-12-16 | 2009-08-13 | Qiagen Gmbh | Method for the extraction of biomolecules from fixed tissues |
| US20070178503A1 (en) | 2005-12-19 | 2007-08-02 | Feng Jiang | In-situ genomic DNA chip for detection of cancer |
| US20070141718A1 (en) | 2005-12-19 | 2007-06-21 | Bui Huy A | Reduction of scan time in imaging mass spectrometry |
| US20130065788A1 (en) | 2005-12-21 | 2013-03-14 | Meso Scale Technologies, L.L.C. | Assay modules having assay reagents and methods of making and using same |
| EP1966393A1 (en) | 2005-12-22 | 2008-09-10 | Keygene N.V. | Method for high-throughput aflp-based polymorphism detection |
| WO2007073165A1 (en) | 2005-12-22 | 2007-06-28 | Keygene N.V. | Method for high-throughput aflp-based polymorphism detection |
| EP2789696A1 (en) | 2005-12-22 | 2014-10-15 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| US8815512B2 (en) | 2005-12-22 | 2014-08-26 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| US8911945B2 (en) | 2005-12-22 | 2014-12-16 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| US9062348B1 (en) | 2005-12-22 | 2015-06-23 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| US8481257B2 (en) | 2005-12-22 | 2013-07-09 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| US9777324B2 (en) | 2005-12-22 | 2017-10-03 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| EP2363504A1 (en) | 2005-12-22 | 2011-09-07 | Keygene N.V. | Method for high-throughtput AFLP-based polymorphism detection |
| WO2007073171A2 (en) | 2005-12-22 | 2007-06-28 | Keygene N.V. | Improved strategies for transcript profiling using high throughput sequencing technologies |
| US9328383B2 (en) | 2005-12-22 | 2016-05-03 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| US9334536B2 (en) | 2005-12-22 | 2016-05-10 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| US9702004B2 (en) | 2005-12-22 | 2017-07-11 | Keygene N.V. | Method for high-throughput AFLP-based polymorphism detection |
| EP3045544A1 (en) | 2005-12-22 | 2016-07-20 | Keygene N.V. | Method for high-throughput aflp-based polymorphism detection |
| US8986926B2 (en) | 2005-12-23 | 2015-03-24 | Nanostring Technologies, Inc. | Compositions comprising oriented, immobilized macromolecules and methods for their preparation |
| US9371563B2 (en) | 2005-12-23 | 2016-06-21 | Nanostring Technologies, Inc. | Nanoreporters and methods of manufacturing and use thereof |
| WO2007073271A1 (en) | 2005-12-23 | 2007-06-28 | Telefonaktiebolaget Lm Ericsson (Publ) | Method and apparatus for solving data packet traffic congestion. |
| WO2007076128A2 (en) | 2005-12-23 | 2007-07-05 | Nanostring Technologies, Inc. | Nanoreporters and methods of manufacturing and use thereof |
| WO2007076726A1 (en) | 2006-01-04 | 2007-07-12 | Si Lok | Methods for nucleic acid mapping and identification of fine-structural-variations in nucleic acids and utilities |
| US20070166725A1 (en) | 2006-01-18 | 2007-07-19 | The Regents Of The University Of California | Multiplexed diagnostic platform for point-of care pathogen detection |
| US7537897B2 (en) | 2006-01-23 | 2009-05-26 | Population Genetics Technologies, Ltd. | Molecular counting |
| US20070172873A1 (en) | 2006-01-23 | 2007-07-26 | Sydney Brenner | Molecular counting |
| US7544473B2 (en) | 2006-01-23 | 2009-06-09 | Population Genetics Technologies Ltd. | Nucleic acid analysis using sequence tokens |
| US20070251824A1 (en) | 2006-01-24 | 2007-11-01 | Perkinelmer Las, Inc. | Multiplexed analyte quantitation by two-dimensional planar electrochromatography |
| US20090099041A1 (en) | 2006-02-07 | 2009-04-16 | President And Fellows Of Harvard College | Methods for making nucleotide probes for sequencing and synthesis |
| US8771950B2 (en) | 2006-02-07 | 2014-07-08 | President And Fellows Of Harvard College | Methods for making nucleotide probes for sequencing and synthesis |
| US20090005252A1 (en) | 2006-02-24 | 2009-01-01 | Complete Genomics, Inc. | High throughput genome sequencing on DNA arrays |
| US20090264299A1 (en) | 2006-02-24 | 2009-10-22 | Complete Genomics, Inc. | High throughput genome sequencing on DNA arrays |
| US20090155781A1 (en) | 2006-02-24 | 2009-06-18 | Complete Genomics, Inc. | High throughput genome sequencing on DNA arrays |
| US20090215633A1 (en) | 2006-03-01 | 2009-08-27 | Keygene N.V. | High throughput sequence-based detection of snps using ligation assays |
| US20070215466A1 (en) | 2006-03-17 | 2007-09-20 | Jun Okada | Nucleic acid detection device and nucleic acid detection apparatus |
| US20080009420A1 (en) | 2006-03-17 | 2008-01-10 | Schroth Gary P | Isothermal methods for creating clonal single molecule arrays |
| US8268554B2 (en) | 2006-03-20 | 2012-09-18 | Olink Ab | Method for analyte detection using proximity probes |
| US20070231823A1 (en) | 2006-03-23 | 2007-10-04 | Mckernan Kevin J | Directed enrichment of genomic DNA for high-throughput sequencing |
| US20080032301A1 (en) | 2006-03-30 | 2008-02-07 | Pacific Biosciences Of California, Inc. | Articles having localized molecules disposed thereon and methods of producing same |
| US20100111768A1 (en) | 2006-03-31 | 2010-05-06 | Solexa, Inc. | Systems and devices for sequence by synthesis analysis |
| EP2963127A1 (en) | 2006-04-04 | 2016-01-06 | Keygene N.V. | High throughput detection of molecular markers based on restriction fragments |
| EP2002017A2 (en) | 2006-04-04 | 2008-12-17 | Keygene N.V. | High throughput detection of molecular markers based on restriction fragments |
| US20090253581A1 (en) | 2006-04-04 | 2009-10-08 | Keygene N.V. | High Throughput Detection of Molecular Markers Based on AFLP and High Throughput Sequencing |
| US20180291439A1 (en) | 2006-04-04 | 2018-10-11 | Keygene N.V. | High throughput detection of molecular markers based on aflp and high through-put sequencing |
| US20120202698A1 (en) | 2006-04-04 | 2012-08-09 | Keygene N.V. | High throughput detection of molecular markers based on aflp and high through-put sequencing |
| US10023907B2 (en) | 2006-04-04 | 2018-07-17 | Keygene N.V. | High throughput detection of molecular markers based on AFLP and high through-put sequencing |
| EP3239304A1 (en) | 2006-04-04 | 2017-11-01 | Keygene N.V. | High throughput detection of molecular markers based on aflp and high troughput sequencing |
| WO2007114693A2 (en) | 2006-04-04 | 2007-10-11 | Keygene N.V. | High throughput detection of molecular markers based on aflp and high throughput sequencing |
| US20120135871A1 (en) | 2006-04-04 | 2012-05-31 | Keygene N.V. | High throughput detection of molecular markers based on aflp and high through-put sequencing |
| WO2007120241A2 (en) | 2006-04-18 | 2007-10-25 | Advanced Liquid Logic, Inc. | Droplet-based biochemistry |
| US20070243634A1 (en) | 2006-04-18 | 2007-10-18 | Pamula Vamsee K | Droplet-based surface modification and washing |
| US8383338B2 (en) | 2006-04-24 | 2013-02-26 | Roche Nimblegen, Inc. | Methods and systems for uniform enrichment of genomic regions |
| US20070254305A1 (en) | 2006-04-28 | 2007-11-01 | Nsabp Foundation, Inc. | Methods of whole genome or microarray expression profiling using nucleic acids prepared from formalin fixed paraffin embedded tissue |
| US20080124810A1 (en) | 2006-05-10 | 2008-05-29 | Dxterity Diagnostics | Detection of nucleic acid targets using chemically reactive oligonucleotide probes |
| US10829803B2 (en) | 2006-05-10 | 2020-11-10 | Dxterity Diagnostics Incorporated | Detection of nucleic acid targets using chemically reactive oligonucleotide probes |
| US20070264656A1 (en) | 2006-05-15 | 2007-11-15 | Canon Kabushiki Kaisha | Method of manufacturing probe-immobilized carrier |
| US7941279B2 (en) | 2006-05-22 | 2011-05-10 | Nanostring Technologies, Inc. | Systems and methods for analyzing nanoreporters |
| WO2007139766A2 (en) | 2006-05-22 | 2007-12-06 | Nanostring Technologies, Inc. | Systems and methods for analyzing nanoreporters |
| US20080132429A1 (en) | 2006-05-23 | 2008-06-05 | Uchicago Argonne | Biological microarrays with enhanced signal yield |
| US10072104B2 (en) | 2006-05-27 | 2018-09-11 | Fluidigm Canada Inc. | Polymer backbone element tags |
| US20100303722A1 (en) | 2006-06-23 | 2010-12-02 | Sungho Jin | Articles comprising large-surface-area bio-compatible materials and methods for making and using them |
| US20100009871A1 (en) | 2006-06-23 | 2010-01-14 | Mark Reed | Devices and systems for creation of dna cluster arrays |
| US20080071071A1 (en) | 2006-06-29 | 2008-03-20 | President And Fellows Of Harvard College | Evaluating proteins |
| US20090253582A1 (en) | 2006-06-29 | 2009-10-08 | Ge Healthcare Bio-Sciences Ab | Chamber apparatus |
| US20110028685A1 (en) | 2006-06-30 | 2011-02-03 | Applera Corporation. | Analyte Determination Utilizing Mass Tagging Reagents Comprising A Non-Encoded Detectable Label |
| US20080003586A1 (en) | 2006-06-30 | 2008-01-03 | Searete Llc | Method of combing a nucleic acid |
| US20090291854A1 (en) | 2006-07-05 | 2009-11-26 | Austrian Research Centers Gmbh - Arc | Identification of Pathogens |
| US20080145616A1 (en) | 2006-07-10 | 2008-06-19 | Morteza Gharib | Method for selectively anchoring large numbers of nanoscale structures |
| US20090321262A1 (en) | 2006-07-10 | 2009-12-31 | Sakuichiro Adachi | Liquid transfer device |
| EP1878502A1 (en) | 2006-07-14 | 2008-01-16 | Roche Diagnostics GmbH | Instrument for heating and cooling |
| CN101522915A (en) | 2006-08-02 | 2009-09-02 | 加州理工学院 | Methods and systems for detecting and/or sorting targets |
| US20100105112A1 (en) | 2006-08-07 | 2010-04-29 | Christian Holtze | Fluorocarbon emulsion stabilizing surfactants |
| WO2008022332A2 (en) | 2006-08-18 | 2008-02-21 | Board Of Regents, The University Of Texas System | System, method and kit for replicating a dna array |
| US20080047835A1 (en) | 2006-08-22 | 2008-02-28 | Macconnell William P | Genomic DNA Purifier |
| US20080128627A1 (en) | 2006-09-01 | 2008-06-05 | Pacific Biosciences Of California, Inc. | Substrates, systems and methods for analyzing materials |
| US7754429B2 (en) | 2006-10-06 | 2010-07-13 | Illumina Cambridge Limited | Method for pair-wise sequencing a plurity of target polynucleotides |
| US7960120B2 (en) | 2006-10-06 | 2011-06-14 | Illumina Cambridge Ltd. | Method for pair-wise sequencing a plurality of double stranded target polynucleotides |
| US8568979B2 (en) | 2006-10-10 | 2013-10-29 | Illumina, Inc. | Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization |
| US20080108082A1 (en) | 2006-10-23 | 2008-05-08 | Pacific Biosciences Of California, Inc. | Polymerase enzymes and reagents for enhanced nucleic acid sequencing |
| US20080108804A1 (en) | 2006-11-02 | 2008-05-08 | Kabushiki Kaisha Dnaform | Method for modifying RNAS and preparing DNAS from RNAS |
| US20100096266A1 (en) | 2006-11-02 | 2010-04-22 | The Regents Of The University Of California | Method and apparatus for real-time feedback control of electrical manipulation of droplets on chip |
| WO2008069906A2 (en) | 2006-11-14 | 2008-06-12 | The Regents Of The University Of California | Digital expression of gene analysis |
| US20110045462A1 (en) | 2006-11-14 | 2011-02-24 | The Regents Of The University Of California | Digital analysis of gene expression |
| US9201063B2 (en) | 2006-11-16 | 2015-12-01 | General Electric Company | Sequential analysis of biological samples |
| US20100120043A1 (en) | 2006-11-16 | 2010-05-13 | General Electric Company | Sequential analysis of biological samples |
| US7655898B2 (en) | 2006-11-30 | 2010-02-02 | Cambridge Research & Instrumentation, Inc. | Optical filter assembly with selectable bandwidth and rejection |
| CN102851369A (en) | 2006-12-13 | 2013-01-02 | 卢米耐克斯公司 | Systems and methods for multiplex analysis of PCR in real time |
| US20100282617A1 (en) | 2006-12-14 | 2010-11-11 | Ion Torrent Systems Incorporated | Methods and apparatus for detecting molecular interactions using fet arrays |
| US20090127589A1 (en) | 2006-12-14 | 2009-05-21 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes using large scale FET arrays |
| US20090026082A1 (en) | 2006-12-14 | 2009-01-29 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes using large scale FET arrays |
| CN101221182A (en) | 2007-01-08 | 2008-07-16 | 山东司马特生物芯片有限公司 | Novel method for blood serum tumor series diagnosis by fluorescent protein chip |
| US20090233802A1 (en) | 2007-02-02 | 2009-09-17 | Helen Bignell | Methods for indexing samples and sequencing multiple polynucleotide templates |
| US20080220434A1 (en) | 2007-02-07 | 2008-09-11 | Perscitus Biosciences, Llc | Detection Of Molecule Proximity |
| US20100113302A1 (en) | 2007-02-12 | 2010-05-06 | Proteonova, Inc | GENERATION OF LIBRARY OF SOLUBLE RANDOM POLYPEPTIDES LINKED TO mRNA |
| US7844940B2 (en) | 2007-02-13 | 2010-11-30 | Samsung Electronics Co., Ltd. | Mask set for microarray, method of fabricating mask set, and method of fabricating microarray using mask set |
| US8148518B2 (en) | 2007-02-14 | 2012-04-03 | Eastman Chemical Company | Cellulose esters and their production in carboxylated ionic liquids |
| KR20090000812A (en) | 2007-04-04 | 2009-01-08 | 엔에이치엔(주) | Automatic file creation method and device |
| US8415102B2 (en) | 2007-04-10 | 2013-04-09 | Nanostring Technologies, Inc. | Methods and computer systems for identifying target-specific sequences for use in nanoreporters |
| US20090006002A1 (en) | 2007-04-13 | 2009-01-01 | Sequenom, Inc. | Comparative sequence analysis processes and systems |
| US20100184614A1 (en) | 2007-05-23 | 2010-07-22 | Zheng Ye | Microarray systems and methods for identifying dna-binding proteins |
| US20090105959A1 (en) | 2007-06-01 | 2009-04-23 | Braverman Michael S | System and method for identification of individual samples from a multiplex mixture |
| US8481258B2 (en) | 2007-06-04 | 2013-07-09 | President And Fellows Of Harvard College | Methods and compounds for chemical ligation |
| WO2008157801A2 (en) | 2007-06-21 | 2008-12-24 | Gen-Probe Incorporated | Instrument and receptacles for performing processes |
| US20110048951A1 (en) | 2007-06-27 | 2011-03-03 | Digital Biosystems | Digital microfluidics based apparatus for heat-exchanging chemical processes |
| US7635566B2 (en) | 2007-06-29 | 2009-12-22 | Population Genetics Technologies Ltd. | Methods and compositions for isolating nucleic acid sequence variants |
| US7534991B2 (en) | 2007-07-10 | 2009-05-19 | Cambridge Research & Instrumentation, Inc. | Athermalized birefringent filter apparatus and method |
| US9121069B2 (en) | 2007-07-23 | 2015-09-01 | The Chinese University Of Hong Kong | Diagnosing cancer using genomic sequencing |
| US20100159446A1 (en) | 2007-07-27 | 2010-06-24 | Haff Lawrence A | Detection Assays and Use Thereof |
| JP2009036694A (en) | 2007-08-03 | 2009-02-19 | Tokyo Medical & Dental Univ | Method for analyzing intracellular biological material with spatial distribution |
| WO2009032167A1 (en) | 2007-08-29 | 2009-03-12 | Illumina Cambridge | Method for sequencing a polynucleotide template |
| US20100273679A1 (en) | 2007-09-14 | 2010-10-28 | Twof, Inc | Methods for the preparation of dna microarrays with linear high density probes |
| US20090117573A1 (en) | 2007-09-14 | 2009-05-07 | Affymetrix, Inc. | Locus specific amplification using array probes |
| US20100227329A1 (en) | 2007-09-21 | 2010-09-09 | Katholieke Universiteit Leuven K.U.Leuven R&D | Tools and methods for genetic tests using next generation sequencing |
| WO2009036525A2 (en) | 2007-09-21 | 2009-03-26 | Katholieke Universiteit Leuven | Tools and methods for genetic tests using next generation sequencing |
| US8330087B2 (en) | 2007-10-16 | 2012-12-11 | Cambridge Research & Instrumentation, Inc. | Spectral imaging system with dynamic optical correction |
| US20120046175A1 (en) | 2007-10-23 | 2012-02-23 | Matthew Rodesch | Methods and systems for solution based sequence enrichment |
| US20100105052A1 (en) | 2007-10-29 | 2010-04-29 | Complete Genomics, Inc. | Nucleic acid sequencing and process |
| CN101205560A (en) | 2007-11-30 | 2008-06-25 | 李松 | High-throughput single nucleotide polymorphism detecting method based on magnetic nano-particles and universal label technique |
| US20110033854A1 (en) | 2007-12-05 | 2011-02-10 | Complete Genomics, Inc. | Methods and compositions for long fragment read sequencing |
| US20090181375A1 (en) | 2008-01-11 | 2009-07-16 | Peter Brian J | Method for detection of nucleic acid barcodes |
| US10144966B2 (en) | 2008-01-17 | 2018-12-04 | Sequenom, Inc. | Methods of nucleic acid sequences analysis using solid supports containing identifier sequences |
| US20090312193A1 (en) | 2008-01-23 | 2009-12-17 | Samsung Electronics Co., Ltd. | Microarray hybridization assay methods |
| KR20090081260A (en) | 2008-01-23 | 2009-07-28 | 삼성전자주식회사 | Micro array hybridization detection method |
| US20120279954A1 (en) | 2008-02-15 | 2012-11-08 | Bio-Rad Laboratories, Inc., LSG - GXD Division | Thermal cycler with self-adjusting lid |
| US20110024511A1 (en) | 2008-03-18 | 2011-02-03 | Manfred Rietzler | Layered composite for a card body and method for producing the layered composite |
| US20090239232A1 (en) | 2008-03-21 | 2009-09-24 | Nugen Technologies Inc | Methods of rna amplification in the presence of dna |
| US20090253163A1 (en) | 2008-04-02 | 2009-10-08 | General Electric Company | Iterative staining of biological samples |
| US20090289184A1 (en) | 2008-05-14 | 2009-11-26 | Soren-Oliver Deininger | Method for the analysis of tissue sections |
| US20090283407A1 (en) | 2008-05-15 | 2009-11-19 | Gaurav Jitendra Shah | Method for using magnetic particles in droplet microfluidics |
| WO2009152928A2 (en) | 2008-05-28 | 2009-12-23 | Genxpro Gmbh | Method for the quantitative analysis of nucleic acids, markers therefor and their use |
| US20100120097A1 (en) | 2008-05-30 | 2010-05-13 | Board Of Regents, The University Of Texas System | Methods and compositions for nucleic acid sequencing |
| US8199999B2 (en) | 2008-06-17 | 2012-06-12 | Cambridge Research & Instrumentation, Inc. | Image classifier training |
| US20110172115A1 (en) | 2008-06-24 | 2011-07-14 | Thompson Andrew H | Characterising planar samples by mass spectrometry |
| WO2009156725A1 (en) | 2008-06-24 | 2009-12-30 | Trillion Genomics Limited | Characterising planar samples by mass spectrometry |
| US8198028B2 (en) * | 2008-07-02 | 2012-06-12 | Illumina Cambridge Limited | Using populations of beads for the fabrication of arrays on surfaces |
| US20100035249A1 (en) | 2008-08-05 | 2010-02-11 | Kabushiki Kaisha Dnaform | Rna sequencing and analysis using solid support |
| US8519115B2 (en) | 2008-08-14 | 2013-08-27 | Nanostring Technologies, Inc. | Stable nanoreporters |
| WO2010019826A1 (en) | 2008-08-14 | 2010-02-18 | Nanostring Technologies, Inc | Stable nanoreporters |
| WO2010027870A2 (en) | 2008-08-26 | 2010-03-11 | Fluidigm Corporation | Assay methods for increased throughput of samples and/or targets |
| US20110223613A1 (en) | 2008-09-04 | 2011-09-15 | Commissariat A L'energie Atomique Et Aux Energies Alternatives (Cea) | Method of imaging by mass spectrometry and new mass tag associated trityl derivatives |
| US20100055733A1 (en) | 2008-09-04 | 2010-03-04 | Lutolf Matthias P | Manufacture and uses of reactive microcontact printing of biomolecules on soft hydrogels |
| US8586310B2 (en) | 2008-09-05 | 2013-11-19 | Washington University | Method for multiplexed nucleic acid patch polymerase chain reaction |
| US8936912B2 (en) | 2008-09-05 | 2015-01-20 | Washington University | Method for multiplexed nucleic acid patch polymerase chain reaction |
| US20100129874A1 (en) | 2008-09-05 | 2010-05-27 | The Washington University | Method for multiplexed nucleic acid patch polymerase chain reaction |
| US20120289414A1 (en) | 2008-09-05 | 2012-11-15 | The Washington University | Method for multiplexed nucleic acid patch polymerase chain reaction |
| US20110244448A1 (en) | 2008-09-08 | 2011-10-06 | Masataka Shirai | Dna detecting apparatus, dna detecting device and dna detecting method |
| US20100069263A1 (en) | 2008-09-12 | 2010-03-18 | Washington, University Of | Sequence tag directed subassembly of short sequencing reads into long sequencing reads |
| US8865410B2 (en) | 2008-09-12 | 2014-10-21 | University Of Washington | Error detection in sequence tag directed subassemblies of short sequencing reads |
| EP2350648A2 (en) | 2008-09-22 | 2011-08-03 | Biomicro, Inc. | Selective processing of biological material on a microarray substrate |
| US20100099103A1 (en) | 2008-09-30 | 2010-04-22 | Abbott Laboratories | Antibody Libraries |
| US20100126862A1 (en) | 2008-10-08 | 2010-05-27 | Sage Science, Inc. | Multichannel preparative electrophoresis system |
| US20100137143A1 (en) | 2008-10-22 | 2010-06-03 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes |
| US20100120098A1 (en) | 2008-10-24 | 2010-05-13 | Epicentre Technologies Corporation | Transposon end compositions and methods for modifying nucleic acids |
| US20110287435A1 (en) | 2008-10-24 | 2011-11-24 | Epicentre Technologies Corporation | Transposon end compositions and methods for modifying nucleic acids |
| US20100151511A1 (en) | 2008-10-28 | 2010-06-17 | Millipore Corporation | Biological culture assembly |
| US20120046178A1 (en) | 2008-10-30 | 2012-02-23 | Sequenom, Inc. | Products and processes for multiplex nucleic acid identification |
| WO2010060439A1 (en) | 2008-11-03 | 2010-06-03 | Stichting Sanquin Bloedvoorziening | Detecting antigen responsive cells in a sample |
| US20110269155A1 (en) | 2008-11-03 | 2011-11-03 | Stichting Het Nederlands Kanker Instituut | Detecting Antigen Responsive Cells in a Sample |
| US9217176B2 (en) | 2008-11-07 | 2015-12-22 | Sequenta, Llc | Methods of monitoring conditions by sequence analysis |
| WO2010053587A2 (en) | 2008-11-07 | 2010-05-14 | Mlc Dx Incorporated | Methods of monitoring conditions by sequence analysis |
| US20110207134A1 (en) | 2008-11-07 | 2011-08-25 | Sequenta, Inc. | Monitoring health and disease status using clonotype profiles |
| US20130302801A1 (en) | 2008-11-07 | 2013-11-14 | Sequenta, Inc. | Detection and quantification of sample contamination in immune repertoire analysis |
| US10246752B2 (en) | 2008-11-07 | 2019-04-02 | Adaptive Biotechnologies Corp. | Methods of monitoring conditions by sequence analysis |
| US20130202718A1 (en) | 2008-11-07 | 2013-08-08 | Sequenta, Inc. | Monitoring immunoglobulin heavy chain evolution in b-cell acute lymphoblastic leukemia |
| US8748103B2 (en) | 2008-11-07 | 2014-06-10 | Sequenta, Inc. | Monitoring health and disease status using clonotype profiles |
| US9512487B2 (en) | 2008-11-07 | 2016-12-06 | Adaptive Biotechnologies Corp. | Monitoring health and disease status using clonotype profiles |
| US8288122B2 (en) | 2008-12-03 | 2012-10-16 | The United States Of America As Represented By The Department Of Veterans Affairs | Pressure-assisted molecular recovery (PAMR) of biomolecules, pressure-assisted antigen retrieval (PAAR), and pressure-assisted tissue histology (PATH) |
| US20100151447A1 (en) | 2008-12-17 | 2010-06-17 | Cornell University | Method for double staining in immunohistochemistry |
| US20110275077A1 (en) | 2009-01-12 | 2011-11-10 | William James | Oligonucleotide-Coated Affinity Membranes and Uses Thereof |
| US20100184618A1 (en) | 2009-01-16 | 2010-07-22 | Affymetrix, Inc. | Dna ligation on rna template |
| US8790873B2 (en) | 2009-01-16 | 2014-07-29 | Affymetrix, Inc. | DNA ligation on RNA template |
| US20100210475A1 (en) | 2009-02-11 | 2010-08-19 | Samsung Electronics Co., Ltd. | Microarray having bright fiducial mark and method of obtaining optical data from the mircoarray |
| US8481698B2 (en) | 2009-03-19 | 2013-07-09 | The President And Fellows Of Harvard College | Parallel proximity ligation event analysis |
| US20120010091A1 (en) | 2009-03-30 | 2012-01-12 | Illumina, Inc. | Gene expression analysis in single cells |
| US20100273219A1 (en) | 2009-04-02 | 2010-10-28 | Fluidigm Corporation | Multi-primer amplification method for barcoding of target nucleic acids |
| US8603743B2 (en) | 2009-04-03 | 2013-12-10 | Timothy Z. Liu | Multiplex nucleic acid detection methods and systems |
| US9085798B2 (en) | 2009-04-30 | 2015-07-21 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US20160333403A1 (en) | 2009-04-30 | 2016-11-17 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US20170088881A1 (en) | 2009-04-30 | 2017-03-30 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| WO2010127186A1 (en) | 2009-04-30 | 2010-11-04 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US20170058339A1 (en) | 2009-04-30 | 2017-03-02 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US20170058345A1 (en) | 2009-04-30 | 2017-03-02 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US20120065081A1 (en) | 2009-04-30 | 2012-03-15 | Chee Mark S | Nucleic acid constructs and methods of use |
| US20170058340A1 (en) | 2009-04-30 | 2017-03-02 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| WO2010126614A2 (en) | 2009-04-30 | 2010-11-04 | Good Start Genetics, Inc. | Methods and compositions for evaluating genetic markers |
| US20160024576A1 (en) | 2009-04-30 | 2016-01-28 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US20130146459A1 (en) | 2009-06-16 | 2013-06-13 | Massachusetts Institute Of Technology | Multiphase non-linear electrokinetic devices |
| WO2011008502A2 (en) | 2009-06-29 | 2011-01-20 | California Institute Of Technology | Isolation of unknown rearranged t-cell receptors from single cells |
| RU2410439C1 (en) * | 2009-07-06 | 2011-01-27 | Российская Федерация, От Имени Которой Выступает Министерство Образования И Науки Российской Федерации | Method for ablation of target dna from surface of dna biochips |
| US20120196297A1 (en) | 2009-07-14 | 2012-08-02 | Yost Richard A | Mass tags for mass spectrometric analysis of immunoglobulins |
| US20120220479A1 (en) | 2009-07-23 | 2012-08-30 | Agilent Technologies, Inc. | Probes for specific analysis of nucleic acids |
| US20110027772A1 (en) | 2009-07-30 | 2011-02-03 | Korea Institute Of Science And Technology | Antigen Detection Kit and Method |
| US20120129248A1 (en) | 2009-07-31 | 2012-05-24 | Prognosys Biosciences, Inc. | Assay tools and methods of use |
| WO2011014879A2 (en) | 2009-07-31 | 2011-02-03 | Prognosys Biosciences, Inc. | Assay tools and methods of use |
| US9416409B2 (en) | 2009-07-31 | 2016-08-16 | Ibis Biosciences, Inc. | Capture primers and capture sequence linked solid supports for molecular diagnostic tests |
| US10697013B1 (en) | 2009-08-20 | 2020-06-30 | 10X Genomics, Inc. | Methods for analyzing nucleic acids from single cells |
| US10767223B1 (en) | 2009-08-20 | 2020-09-08 | 10X Genomics, Inc. | Methods for analyzing nucleic acids from single cells |
| US20120160683A1 (en) | 2009-09-01 | 2012-06-28 | Zheng Ye | Reversible current gel electrophoresis device for separating biological macromolecules |
| US20130023433A1 (en) | 2009-09-28 | 2013-01-24 | Yuling Luo | Methods of detecting nucleic acid sequences with high specificity |
| US20120195810A1 (en) | 2009-10-02 | 2012-08-02 | Fluidigm Corporation | Microfluidic devices with removable cover and methods of fabrication and application |
| US9557330B2 (en) | 2009-10-09 | 2017-01-31 | Invisible Sentinel, Inc. | Device for detection of analytes and uses thereof |
| US20110086774A1 (en) | 2009-10-13 | 2011-04-14 | Dunaway Dwayne L | Protein Detection Via Nanoreporters |
| US9714937B2 (en) | 2009-10-13 | 2017-07-25 | Nanostring Technologies, Inc. | Protein detection via nanoreporters |
| US9902991B2 (en) | 2009-11-10 | 2018-02-27 | Genomic Health, Inc. | Methods for depleting RNA from nucleic acid samples |
| US9005891B2 (en) | 2009-11-10 | 2015-04-14 | Genomic Health, Inc. | Methods for depleting RNA from nucleic acid samples |
| US20110111409A1 (en) | 2009-11-10 | 2011-05-12 | Dominick Sinicropi | Methods for depleting rna from nucleic acid samples |
| US20130052331A1 (en) | 2009-11-13 | 2013-02-28 | Ventana Medical Systems, Inc. | Thin film processing apparatuses for adjustable volume accommodation |
| US20130203100A1 (en) | 2009-11-13 | 2013-08-08 | Ventana Medical Systems, Inc. | Opposables and automated specimen processing systems with opposables |
| WO2011062933A2 (en) | 2009-11-18 | 2011-05-26 | Raybiotech, Inc. | Array-based proximity ligation association assays |
| US20120245053A1 (en) | 2009-12-04 | 2012-09-27 | Hitachi, Ltd. | GENE EXPRESSION ANALYSIS METHOD USING TWO DIMENSIONAL cDNA LIBRARY |
| US20120270748A1 (en) | 2009-12-07 | 2012-10-25 | Prognosys Biosciences, Inc. | Peptide display arrays |
| US20120202704A1 (en) | 2009-12-07 | 2012-08-09 | Illumina, Inc. | Multi-sample indexing for multiplex genotyping |
| WO2011071943A1 (en) | 2009-12-07 | 2011-06-16 | Prognosys Biosciences, Inc. | Peptide display arrays |
| US8835358B2 (en) | 2009-12-15 | 2014-09-16 | Cellular Research, Inc. | Digital counting of individual molecules by stochastic attachment of diverse labels |
| US9290808B2 (en) | 2009-12-15 | 2016-03-22 | Cellular Research, Inc. | Digital counting of individual molecules by stochastic attachment of diverse labels |
| US9290809B2 (en) | 2009-12-15 | 2016-03-22 | Cellular Research, Inc. | Digital counting of individual molecules by stochastic attachment of diverse labels |
| US20120252702A1 (en) | 2009-12-15 | 2012-10-04 | Agency For Science, Technology And Research | Processing of amplified dna fragments for sequencing |
| US20110177518A1 (en) | 2010-01-21 | 2011-07-21 | Kartalov Emil P | Methods and devices for micro-isolation, extraction, and/or analysis of microscale components |
| US20130171621A1 (en) | 2010-01-29 | 2013-07-04 | Advanced Cell Diagnostics Inc. | Methods of in situ detection of nucleic acids |
| US20130005600A1 (en) | 2010-02-03 | 2013-01-03 | Sven Olek | Assay for Determining the Type and/or Status of a Cell Based on the Epigenetic Pattern and the Chromatin Structure |
| US20110201515A1 (en) | 2010-02-11 | 2011-08-18 | Webster Philippa J | Compositions and methods for the detection of small rnas |
| US9714446B2 (en) | 2010-02-11 | 2017-07-25 | Nanostring Technologies, Inc. | Compositions and methods for the detection of small RNAs |
| WO2011102903A1 (en) | 2010-02-18 | 2011-08-25 | Bima Limited | Immobilised-bead immunomultiplex assay |
| CN102947330A (en) | 2010-02-18 | 2013-02-27 | 奥斯陆大学 | Disulphide bond-stabilized functional soluble mhc class ii heterodimers |
| US10267808B2 (en) | 2010-03-08 | 2019-04-23 | California Institute Of Technology | Molecular indicia of cellular constituents and resolving the same by super-resolution technologies in single cells |
| JP2011182702A (en) | 2010-03-08 | 2011-09-22 | Tokyo Univ Of Agriculture & Technology | Fused mhc molecule connecting magnetic fine particle, method for screening antigen peptide, recombinant vector and transformant of magnetic bacterium |
| US20120142014A1 (en) | 2010-03-08 | 2012-06-07 | California Institute Of Technology | Molecular indicia of cellular constituents and resolving the same by super-resolution technologies in single cells |
| US10266876B2 (en) | 2010-03-08 | 2019-04-23 | California Institute Of Technology | Multiplex detection of molecular species in cells by super-resolution imaging and combinatorial labeling |
| US20130005594A1 (en) | 2010-03-29 | 2013-01-03 | Dxterity Diagnostics Incorporated | Methods and compositions for detecting target nucleic acids |
| US20230159994A1 (en) | 2010-04-05 | 2023-05-25 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20190177777A1 (en) | 2010-04-05 | 2019-06-13 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20110245101A1 (en) | 2010-04-05 | 2011-10-06 | Prognosys Biosciences, Inc. | Co-localization affinity assays |
| US20110245111A1 (en) | 2010-04-05 | 2011-10-06 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11479810B1 (en) | 2010-04-05 | 2022-10-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20220290219A1 (en) | 2010-04-05 | 2022-09-15 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11401545B2 (en) | 2010-04-05 | 2022-08-02 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11384386B2 (en) | 2010-04-05 | 2022-07-12 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| WO2011127006A1 (en) | 2010-04-05 | 2011-10-13 | Prognosys Biosciences, Inc. | Co-localization affinity assays |
| WO2011127099A1 (en) | 2010-04-05 | 2011-10-13 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11371086B2 (en) | 2010-04-05 | 2022-06-28 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20220196644A1 (en) | 2010-04-05 | 2022-06-23 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11365442B2 (en) | 2010-04-05 | 2022-06-21 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20190309355A1 (en) | 2010-04-05 | 2019-10-10 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20190309353A1 (en) | 2010-04-05 | 2019-10-10 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11519022B2 (en) | 2010-04-05 | 2022-12-06 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20220389491A1 (en) | 2010-04-05 | 2022-12-08 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11313856B2 (en) | 2010-04-05 | 2022-04-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20190309354A1 (en) | 2010-04-05 | 2019-10-10 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20220112545A1 (en) | 2010-04-05 | 2022-04-14 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11293917B2 (en) | 2010-04-05 | 2022-04-05 | Prognosys Biosciences, Inc. | Systems for analyzing target biological molecules via sample imaging and delivery of probes to substrate wells |
| US20190323071A1 (en) | 2010-04-05 | 2019-10-24 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US10472669B2 (en) | 2010-04-05 | 2019-11-12 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10480022B2 (en) | 2010-04-05 | 2019-11-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20220003755A1 (en) | 2010-04-05 | 2022-01-06 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11208684B2 (en) | 2010-04-05 | 2021-12-28 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11156603B2 (en) | 2010-04-05 | 2021-10-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20210270822A1 (en) | 2010-04-05 | 2021-09-02 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20210269864A1 (en) | 2010-04-05 | 2021-09-02 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20210255175A1 (en) | 2010-04-05 | 2021-08-19 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20210222235A1 (en) | 2010-04-05 | 2021-07-22 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11067567B2 (en) | 2010-04-05 | 2021-07-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10494667B2 (en) | 2010-04-05 | 2019-12-03 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11542543B2 (en) | 2010-04-05 | 2023-01-03 | Prognosys Biosciences, Inc. | System for analyzing targets of a tissue section |
| US11549138B2 (en) | 2010-04-05 | 2023-01-10 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20220333171A1 (en) | 2010-04-05 | 2022-10-20 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20210207202A1 (en) | 2010-04-05 | 2021-07-08 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11008607B2 (en) | 2010-04-05 | 2021-05-18 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11560587B2 (en) | 2010-04-05 | 2023-01-24 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11001879B1 (en) | 2010-04-05 | 2021-05-11 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20230040363A1 (en) | 2010-04-05 | 2023-02-09 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10308982B2 (en) | 2010-04-05 | 2019-06-04 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20190177778A1 (en) | 2010-04-05 | 2019-06-13 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11001878B1 (en) | 2010-04-05 | 2021-05-11 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20210130884A1 (en) | 2010-04-05 | 2021-05-06 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20210130883A1 (en) | 2010-04-05 | 2021-05-06 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20190300945A1 (en) | 2010-04-05 | 2019-10-03 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20200048690A1 (en) | 2010-04-05 | 2020-02-13 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20200063195A1 (en) | 2010-04-05 | 2020-02-27 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US10996219B2 (en) | 2010-04-05 | 2021-05-04 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20230042088A1 (en) | 2010-04-05 | 2023-02-09 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20210123095A1 (en) | 2010-04-05 | 2021-04-29 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20190300944A1 (en) | 2010-04-05 | 2019-10-03 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20200063196A1 (en) | 2010-04-05 | 2020-02-27 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20230107023A1 (en) | 2010-04-05 | 2023-04-06 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US10982268B2 (en) | 2010-04-05 | 2021-04-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11634756B2 (en) | 2010-04-05 | 2023-04-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20230151412A1 (en) | 2010-04-05 | 2023-05-18 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10612079B2 (en) | 2010-04-05 | 2020-04-07 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10983113B2 (en) | 2010-04-05 | 2021-04-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10962532B2 (en) | 2010-04-05 | 2021-03-30 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20230212655A1 (en) | 2010-04-05 | 2023-07-06 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US10961566B2 (en) | 2010-04-05 | 2021-03-30 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20210062249A1 (en) | 2010-04-05 | 2021-03-04 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US10914730B2 (en) | 2010-04-05 | 2021-02-09 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20210017586A1 (en) | 2010-04-05 | 2021-01-21 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US10619196B1 (en) | 2010-04-05 | 2020-04-14 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20200140934A1 (en) | 2010-04-05 | 2020-05-07 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20240011081A1 (en) | 2010-04-05 | 2024-01-11 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20210002713A1 (en) | 2010-04-05 | 2021-01-07 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20200140935A1 (en) | 2010-04-05 | 2020-05-07 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20200370106A1 (en) | 2010-04-05 | 2020-11-26 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11733238B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11866770B2 (en) | 2010-04-05 | 2024-01-09 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11732292B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays correlating target nucleic acid to tissue section location |
| US20200325531A1 (en) | 2010-04-05 | 2020-10-15 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US9371598B2 (en) | 2010-04-05 | 2016-06-21 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10662467B2 (en) | 2010-04-05 | 2020-05-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11761030B2 (en) | 2010-04-05 | 2023-09-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20190271030A1 (en) | 2010-04-05 | 2019-09-05 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US11767550B2 (en) | 2010-04-05 | 2023-09-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10662468B2 (en) | 2010-04-05 | 2020-05-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20230416807A1 (en) | 2010-04-05 | 2023-12-28 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20230358733A1 (en) | 2010-04-05 | 2023-11-09 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20200208206A1 (en) | 2010-04-05 | 2020-07-02 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20230323436A1 (en) | 2010-04-05 | 2023-10-12 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20200208205A1 (en) | 2010-04-05 | 2020-07-02 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20160298180A1 (en) | 2010-04-05 | 2016-10-13 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10787701B2 (en) | 2010-04-05 | 2020-09-29 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US20200224256A1 (en) | 2010-04-05 | 2020-07-16 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20200299757A1 (en) | 2010-04-05 | 2020-09-24 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20190271031A1 (en) | 2010-04-05 | 2019-09-05 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20230332211A1 (en) | 2010-04-05 | 2023-10-19 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US20190300943A1 (en) | 2010-04-05 | 2019-10-03 | Prognosys Biosciences, Inc. | Spatially Encoded Biological Assays |
| US8462981B2 (en) | 2010-04-07 | 2013-06-11 | Cambridge Research & Instrumentation, Inc. | Spectral unmixing for visualization of samples |
| US20110269647A1 (en) | 2010-04-28 | 2011-11-03 | Medical Research Council | Method |
| WO2011143583A1 (en) | 2010-05-13 | 2011-11-17 | Illumina, Inc. | Binding assays for markers |
| US20130244884A1 (en) | 2010-05-13 | 2013-09-19 | Gen9, Inc. | Methods for Nucleotide Sequencing and High Fidelity Polynucleotide Synthesis |
| US9816134B2 (en) | 2010-05-27 | 2017-11-14 | Affymetrix, Inc. | Multiplex amplification methods |
| US9080210B2 (en) | 2010-06-09 | 2015-07-14 | Keygene N.V. | High throughput screening using combinatorial sequence barcodes |
| WO2011155833A2 (en) | 2010-06-09 | 2011-12-15 | Keygene N.V. | Combinatorial sequence barcodes for high throughput screening |
| EP2580351A2 (en) | 2010-06-09 | 2013-04-17 | Keygene N.V. | Combinatorial sequence barcodes for high throughput screening |
| US20130122516A1 (en) | 2010-07-02 | 2013-05-16 | Rui Hong | Detecting targets using mass tags and mass spectrometry |
| US20130211249A1 (en) | 2010-07-22 | 2013-08-15 | The Johns Hopkins University | Drug eluting hydrogels for catheter delivery |
| US9541504B2 (en) | 2010-08-05 | 2017-01-10 | Cambridge Research & Instrumentation, Inc. | Enhancing visual assessment of samples |
| US20200283852A1 (en) | 2010-08-06 | 2020-09-10 | Ariosa Diagnostics, Inc. | Detection of target nucleic acids using hybridization |
| WO2012022975A1 (en) | 2010-08-17 | 2012-02-23 | Isis Innovation Limited | Identification of ligands and their use |
| US8481292B2 (en) | 2010-09-21 | 2013-07-09 | Population Genetics Technologies Litd. | Increasing confidence of allele calls with molecular counting |
| US8741606B2 (en) | 2010-09-21 | 2014-06-03 | Population Genetics Technologies Ltd. | Method of tagging using a split DBR |
| US9309556B2 (en) | 2010-09-24 | 2016-04-12 | The Board Of Trustees Of The Leland Stanford Junior University | Direct capture, amplification and sequencing of target DNA using immobilized primers |
| JP2013544498A (en) | 2010-09-24 | 2013-12-19 | ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー | Direct capture, amplification, and sequencing of target DNA using immobilized primers |
| US20120157322A1 (en) | 2010-09-24 | 2012-06-21 | Samuel Myllykangas | Direct Capture, Amplification and Sequencing of Target DNA Using Immobilized Primers |
| US20120077693A1 (en) | 2010-09-29 | 2012-03-29 | Hospices Civils De Lyon (Hcl) | Method and kit for establishing an in vitro prognosis on a patient exhibiting sirs |
| US9902950B2 (en) | 2010-10-08 | 2018-02-27 | President And Fellows Of Harvard College | High-throughput single cell barcoding |
| WO2012048341A1 (en) * | 2010-10-08 | 2012-04-12 | President And Fellows Of Harvard College | High-throughput single cell barcoding |
| WO2012049316A1 (en) | 2010-10-15 | 2012-04-19 | Olink Ab | Dynamic range methods |
| US10669569B2 (en) | 2010-10-15 | 2020-06-02 | Navinci Diagnostics Ab | Dynamic range methods |
| US8658361B2 (en) | 2010-10-21 | 2014-02-25 | Advanced Cell Diagnostics, Inc. | Ultra sensitive method for in situ detection of nucleic acids |
| US9404156B2 (en) | 2010-10-22 | 2016-08-02 | Cold Spring Harbor Laboratory | Varietal counting of nucleic acids for obtaining genomic copy number information |
| US20140065609A1 (en) | 2010-10-22 | 2014-03-06 | James Hicks | Varietal counting of nucleic acids for obtaining genomic copy number information |
| WO2012058096A1 (en) | 2010-10-27 | 2012-05-03 | Illumina, Inc. | Microdevices and biosensor cartridges for biological or chemical analysis and systems and methods for the same |
| US20130261019A1 (en) | 2010-10-29 | 2013-10-03 | President And Fellows Of Harvard College | Nucleic acid nanostructure barcode probes |
| WO2012061832A1 (en) | 2010-11-05 | 2012-05-10 | Illumina, Inc. | Linking sequence reads using paired code tags |
| WO2012071428A2 (en) | 2010-11-22 | 2012-05-31 | Solulink, Inc. | Methods and/or use of oligonucleotide conjugates for assays and detections |
| US20140121118A1 (en) | 2010-11-23 | 2014-05-01 | Opx Biotechnologies, Inc. | Methods, systems and compositions regarding multiplex construction protein amino-acid substitutions and identification of sequence-activity relationships, to provide gene replacement such as with tagged mutant genes, such as via efficient homologous recombination |
| WO2012148477A1 (en) | 2010-12-15 | 2012-11-01 | Cellular Research, Inc. | Digital counting of individual molecules by stochastic attachment of diverse label-tags |
| WO2012083225A2 (en) | 2010-12-16 | 2012-06-21 | Gigagen, Inc. | System and methods for massively parallel analysis of nycleic acids in single cells |
| US20160003812A1 (en) | 2010-12-23 | 2016-01-07 | Good Start Genetics, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
| US9340830B2 (en) | 2010-12-30 | 2016-05-17 | Foundation Medicine, Inc. | Optimization of multigene analysis of tumor samples |
| US8951781B2 (en) | 2011-01-10 | 2015-02-10 | Illumina, Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
| CN202548048U (en) | 2011-01-10 | 2012-11-21 | 伊鲁米那股份有限公司 | Flow cell and jet device for analyzing samples |
| US20120270305A1 (en) | 2011-01-10 | 2012-10-25 | Illumina Inc. | Systems, methods, and apparatuses to image a sample for biological or chemical analysis |
| US10196691B2 (en) * | 2011-01-25 | 2019-02-05 | Almac Diagnostics Limited | Colon cancer gene expression signatures and methods of use |
| US8551710B2 (en) | 2011-02-15 | 2013-10-08 | Leica Biosystems Newcastle Ltd. | Methods for localized in situ detection of mRNA |
| US20160201125A1 (en) | 2011-02-18 | 2016-07-14 | Raindance Technologies, Inc. | Compositions and methods for molecular labeling |
| WO2012129242A2 (en) | 2011-03-23 | 2012-09-27 | Pacific Biosciences Of California, Inc. | Isolation of polymerase-nucleic acid complexes and loading onto substrates |
| US20140155274A1 (en) | 2011-03-24 | 2014-06-05 | President And Fellows Of Harvard College | Single Cell Nucleic Acid Detection and Analysis |
| US20190360034A1 (en) | 2011-04-01 | 2019-11-28 | Centrillion Technology Holdings Corporation | Methods and systems for sequencing nucleic acids |
| US20120258871A1 (en) | 2011-04-08 | 2012-10-11 | Prognosys Biosciences, Inc. | Peptide constructs and assay systems |
| US9958454B2 (en) | 2011-04-08 | 2018-05-01 | Prognosys Biosciences, Inc. | Peptide constructs and assay systems |
| WO2012139110A2 (en) | 2011-04-08 | 2012-10-11 | Prognosys Biosciences, Inc. | Peptide constructs and assay systems |
| US11352659B2 (en) | 2011-04-13 | 2022-06-07 | Spatial Transcriptomics Ab | Methods of detecting analytes |
| US11479809B2 (en) | 2011-04-13 | 2022-10-25 | Spatial Transcriptomics Ab | Methods of detecting analytes |
| US20140066318A1 (en) | 2011-04-13 | 2014-03-06 | Spatial Transcriptomics Ab | Method and product for localized or spatial detection of nucleic acid in a tissue sample |
| US20220213526A1 (en) | 2011-04-13 | 2022-07-07 | Spatial Transcriptomics Ab | Methods of Detecting Analytes |
| US20190017106A1 (en) | 2011-04-13 | 2019-01-17 | Spatial Transcriptomics Ab | Method and product for localized or spatial detection of nucleic acid in a tissue sample |
| US20190024153A1 (en) | 2011-04-13 | 2019-01-24 | Spatial Transcriptomics Ab | Method and product for localized or spatial detection of nucleic acid in a tissue sample |
| US11795498B2 (en) | 2011-04-13 | 2023-10-24 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| US11788122B2 (en) | 2011-04-13 | 2023-10-17 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| US20190024154A1 (en) | 2011-04-13 | 2019-01-24 | Spatial Transcriptomics Ab | Method and product for localized or spatial detection of nucleic acid in a tissue sample |
| US20190264268A1 (en) | 2011-04-13 | 2019-08-29 | Spatial Transcriptions Ab | Methods of Detecting Analytes |
| WO2012140224A1 (en) | 2011-04-13 | 2012-10-18 | Jonas Frisen | Method and product for localised or spatial detection of nucleic acid in a tissue sample |
| US20220127659A1 (en) | 2011-04-13 | 2022-04-28 | Spatial Transcriptomics Ab | Methods of Detecting Analytes |
| US10030261B2 (en) | 2011-04-13 | 2018-07-24 | Spatial Transcriptomics Ab | Method and product for localized or spatial detection of nucleic acid in a tissue sample |
| US20230100497A1 (en) | 2011-04-13 | 2023-03-30 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| US20230242973A1 (en) | 2011-04-13 | 2023-08-03 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| US20220090058A1 (en) | 2011-04-13 | 2022-03-24 | Spatial Transcriptomics Ab | Methods of Detecting Analytes |
| WO2012142213A2 (en) | 2011-04-15 | 2012-10-18 | The Johns Hopkins University | Safe sequencing system |
| US20140227705A1 (en) | 2011-04-15 | 2014-08-14 | The Johns Hopkins University | Safe sequencing system |
| US9376717B2 (en) | 2011-04-25 | 2016-06-28 | University Of Washington Through Its Center For Commercialization | Compositions and methods for multiplex biomarker profiling |
| US8741564B2 (en) * | 2011-05-04 | 2014-06-03 | Htg Molecular Diagnostics, Inc. | Quantitative nuclease protection assay (QNPA) and sequencing (QNPS) improvements |
| US8809238B2 (en) | 2011-05-09 | 2014-08-19 | Fluidigm Corporation | Probe based nucleic acid detection |
| WO2012159089A1 (en) | 2011-05-19 | 2012-11-22 | Sequenom, Inc. | Products and processes for multiplex nucleic acid identification |
| US9005935B2 (en) | 2011-05-23 | 2015-04-14 | Agilent Technologies, Inc. | Methods and compositions for DNA fragmentation and tagging by transposases |
| US20120301925A1 (en) | 2011-05-23 | 2012-11-29 | Alexander S Belyaev | Methods and compositions for dna fragmentation and tagging by transposases |
| US10465235B2 (en) | 2011-05-24 | 2019-11-05 | Navinci Diagnostics Ab | Multiplexed proximity ligation assay |
| WO2012168003A1 (en) | 2011-06-06 | 2012-12-13 | Biocartis S.A. | Selective lysis of cells by ionic surfactants |
| US20120322099A1 (en) | 2011-06-17 | 2012-12-20 | Daniel Lapen | Fixative and staining solutions |
| US20130035239A1 (en) | 2011-08-03 | 2013-02-07 | Bio-Rad Laboratories | Filtering small nucleic acids using permeabilized cells |
| WO2013025952A2 (en) | 2011-08-16 | 2013-02-21 | Oncocyte Corporation | Methods and compositions for the treatment and diagnosis of breast cancer |
| WO2013033271A2 (en) | 2011-08-29 | 2013-03-07 | Derren Barken | Method to augment immune system in response to disease or injury |
| US9494588B2 (en) | 2011-08-30 | 2016-11-15 | Jacobs University Bremen Ggmbh | Gene coded for a MHC class I molecule, plasmid, expression system protein, multimer, reagent and kit to analyze a T cell frequency |
| US20130053273A1 (en) | 2011-08-30 | 2013-02-28 | The Royal Institution For The Advancement Of Learning / Mcgill University | Methods and devices for multiplexed microarray microfluidic analysis of biomolecules |
| US20140162293A1 (en) | 2011-08-30 | 2014-06-12 | Jacobs University Bremen Ggmbh | Gene coded for a mhc class i molecule, plasmid, expression system protein, multimer, reagent and kit to analyze a t cell frequency |
| US20130065768A1 (en) | 2011-09-12 | 2013-03-14 | Sequenta, Inc. | Random array sequencing of low-complexity libraries |
| US20130079232A1 (en) | 2011-09-23 | 2013-03-28 | Illumina, Inc. | Methods and compositions for nucleic acid sequencing |
| US10501791B2 (en) | 2011-10-14 | 2019-12-10 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US20130109595A1 (en) | 2011-10-28 | 2013-05-02 | Prognosys Biosciences, Inc. | Methods for manufacturing molecular arrays |
| US8778849B2 (en) | 2011-10-28 | 2014-07-15 | Illumina, Inc. | Microarray fabrication system and method |
| US20130096033A1 (en) | 2011-10-28 | 2013-04-18 | Prognosys Biosciences, Inc. | Methods for manufacturing molecular arrays |
| US8637242B2 (en) | 2011-11-07 | 2014-01-28 | Illumina, Inc. | Integrated sequencing apparatuses and methods of use |
| US20140342921A1 (en) | 2011-12-09 | 2014-11-20 | Illumina, Inc. | Expanded radix for polymeric tags |
| WO2013090390A2 (en) | 2011-12-13 | 2013-06-20 | Sequenta, Inc. | Method of measuring immune activation |
| US20200354774A1 (en) | 2011-12-22 | 2020-11-12 | President And Fellows Of Harvard College | Method for Generating A Three-Dimensional Nucleic Acid Containing Matrix |
| US20180112209A1 (en) | 2011-12-22 | 2018-04-26 | Ibis Biosciences, Inc. | Systems and methods for isolating nucleic acids |
| US10227639B2 (en) | 2011-12-22 | 2019-03-12 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US20150010860A1 (en) | 2012-02-14 | 2015-01-08 | Sharp Kabushiki Kaisha | Toner for electrostatic development, image forming device using same, and image forming method |
| US9598728B2 (en) | 2012-02-14 | 2017-03-21 | Cornell University | Method for relative quantification of nucleic acid sequence, expression, or copy changes, using combined nuclease, ligation, and polymerase reactions |
| WO2013123442A1 (en) | 2012-02-17 | 2013-08-22 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
| WO2013131962A1 (en) | 2012-03-06 | 2013-09-12 | Illumina Cambridge Limited | Improved methods of nucleic acid sequencing |
| WO2013138510A1 (en) | 2012-03-13 | 2013-09-19 | Patel Abhijit Ajit | Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing |
| US20150087027A1 (en) | 2012-03-13 | 2015-03-26 | Swift Biosciences, Inc. | Methods and Compositions for Size-Controlled Homopolymer Tailing of Substrate Polynucleotides by a Nucleic Acid Polymerase |
| WO2013142389A1 (en) | 2012-03-20 | 2013-09-26 | University Of Washington Through Its Center For Commercialization | Methods of lowering the error rate of massively parallel dna sequencing using duplex consensus sequencing |
| US20150051085A1 (en) | 2012-03-26 | 2015-02-19 | The Johns Hopkins University | Rapid aneuploidy detection |
| US20150072867A1 (en) | 2012-04-03 | 2015-03-12 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Analysis of nucleic acid molecules distributed on a surface or within a layer by sequencing with position identification |
| US20130260372A1 (en) | 2012-04-03 | 2013-10-03 | Illumina, Inc. | Integrated optoelectronic read head and fluidic cartridge useful for nucleic acid sequencing |
| WO2013150082A1 (en) * | 2012-04-03 | 2013-10-10 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Hybridization-based replication of nucleic acid molecules |
| WO2013150083A1 (en) | 2012-04-03 | 2013-10-10 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Analysis of nucleic acid molecules distributed on a surface or within a layer by sequencing with position identification |
| WO2013155119A1 (en) | 2012-04-13 | 2013-10-17 | Sequenta, Inc. | Detection and quantitation of sample contamination in immune repertoire analysis |
| WO2013158936A1 (en) | 2012-04-20 | 2013-10-24 | Sequenta, Inc | Monitoring immunoglobulin heavy chain evolution in b-cell acute lymphoblastic leukemia |
| US20130296174A1 (en) | 2012-05-02 | 2013-11-07 | Imec | Microfluidics System for Sequencing |
| US20200332368A1 (en) | 2012-05-22 | 2020-10-22 | Veracyte, Inc. | Nano46 genes and methods to predict breast cancer outcome |
| US10640826B2 (en) | 2012-06-05 | 2020-05-05 | President And Fellows Of Harvard College | Spatial sequencing of nucleic acids using DNA origami probes |
| US20140079923A1 (en) | 2012-06-08 | 2014-03-20 | Wayne N. George | Polymer coatings |
| US20130338042A1 (en) | 2012-06-15 | 2013-12-19 | Illumina, Inc. | Kinetic exclusion amplification of nucleic acid libraries |
| US8895249B2 (en) | 2012-06-15 | 2014-11-25 | Illumina, Inc. | Kinetic exclusion amplification of nucleic acid libraries |
| US20150219618A1 (en) | 2012-07-18 | 2015-08-06 | Biological Dynamics, Inc. | Manipulation of microparticles in low field dielectrophoretic regions |
| EP2881465A1 (en) | 2012-07-30 | 2015-06-10 | Hitachi, Ltd. | Tag-sequence-attached two-dimensional cdna library device, and gene expression analysis method and gene expression analysis apparatus each utilizing same |
| US10545075B2 (en) | 2012-08-09 | 2020-01-28 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for preparing biological specimens for microscopic analysis |
| US20190177789A1 (en) | 2012-08-14 | 2019-06-13 | 10X Genomics, Inc. | Methods and systems for sample processing polynucleotides |
| US10273541B2 (en) | 2012-08-14 | 2019-04-30 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20140155295A1 (en) | 2012-08-14 | 2014-06-05 | 10X Technologies, Inc. | Capsule array devices and methods of use |
| US20140378350A1 (en) | 2012-08-14 | 2014-12-25 | 10X Technologies, Inc. | Compositions and methods for sample processing |
| US10053723B2 (en) | 2012-08-14 | 2018-08-21 | 10X Genomics, Inc. | Capsule array devices and methods of use |
| US20140378345A1 (en) | 2012-08-14 | 2014-12-25 | 10X Technologies, Inc. | Compositions and methods for sample processing |
| US10032064B2 (en) | 2012-08-21 | 2018-07-24 | Cambridge Research & Instrumentation, Inc. | Visualization and measurement of cell compartments |
| WO2014044724A1 (en) | 2012-09-18 | 2014-03-27 | Qiagen Gmbh | Method and kit for preparing a target rna depleted sample |
| US20140080715A1 (en) | 2012-09-20 | 2014-03-20 | The Chinese University Of Hong Kong | Non-invasive determination of methylome of fetus or tumor from plasma |
| US10221461B2 (en) | 2012-10-01 | 2019-03-05 | Adaptive Biotechnologies Corp. | Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization |
| US9783841B2 (en) | 2012-10-04 | 2017-10-10 | The Board Of Trustees Of The Leland Stanford Junior University | Detection of target nucleic acids in a cellular sample |
| US9518980B2 (en) | 2012-10-10 | 2016-12-13 | Howard Hughes Medical Institute | Genetically encoded calcium indicators |
| US20150344942A1 (en) | 2012-10-17 | 2015-12-03 | Spatial Transcriptomics Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US9593365B2 (en) | 2012-10-17 | 2017-03-14 | Spatial Transcriptions Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| WO2014060483A1 (en) | 2012-10-17 | 2014-04-24 | Spatial Transcriptomics Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US20150246336A1 (en) | 2012-10-22 | 2015-09-03 | Universität Wien | Method of in situ synthesizing microarrays |
| US20160376642A1 (en) | 2012-11-14 | 2016-12-29 | Olink Ab | Localised RCA-based Amplification Method |
| WO2014085725A1 (en) | 2012-11-27 | 2014-06-05 | Tufts University | Biopolymer-based inks and use thereof |
| US20140274731A1 (en) | 2012-12-10 | 2014-09-18 | Clearfork Bioscience, Inc. | Methods for targeted genomic analysis |
| US10964001B2 (en) | 2013-01-10 | 2021-03-30 | Akoya Biosciences, Inc. | Multispectral imaging systems and methods |
| US10580128B2 (en) | 2013-01-10 | 2020-03-03 | Akoya Biosciences, Inc. | Whole slide multispectral imaging systems and methods |
| US20140213533A1 (en) | 2013-01-31 | 2014-07-31 | Manikkam Suthanthiran | Methods to detect, treat and prevent acute cellular rejection in kidney allografts |
| US9644204B2 (en) | 2013-02-08 | 2017-05-09 | 10X Genomics, Inc. | Partitioning and processing of analytes and other species |
| WO2014130576A1 (en) | 2013-02-19 | 2014-08-28 | Biodot, Inc. | Automated fish analysis of tissue and cell samples using an isolating barrier for precise dispensing of probe and other reagents on regions of interest |
| WO2014128129A1 (en) | 2013-02-25 | 2014-08-28 | Biocartis N.V. | Isolation of nucleic acids |
| US20140243224A1 (en) | 2013-02-26 | 2014-08-28 | Illumina, Inc. | Gel patterned surfaces |
| US9512422B2 (en) | 2013-02-26 | 2016-12-06 | Illumina, Inc. | Gel patterned surfaces |
| WO2014163886A1 (en) | 2013-03-12 | 2014-10-09 | President And Fellows Of Harvard College | Method of generating a three-dimensional nucleic acid containing matrix |
| US20180051322A1 (en) | 2013-03-12 | 2018-02-22 | President And Fellows Of Harvard College | Method for Generating A Three-Dimensional Nucleic Acid Containing Matrix |
| US10494662B2 (en) | 2013-03-12 | 2019-12-03 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US20160024555A1 (en) | 2013-03-12 | 2016-01-28 | President And Fellows Of Harvard College | Method for Generating A Three-Dimensional Nucleic Acid Containing Matrix |
| US10138509B2 (en) | 2013-03-12 | 2018-11-27 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| WO2014142841A1 (en) | 2013-03-13 | 2014-09-18 | Illumina, Inc. | Multilayer fluidic devices and methods for their fabrication |
| US9273349B2 (en) | 2013-03-14 | 2016-03-01 | Affymetrix, Inc. | Detection of nucleic acids |
| WO2014152397A2 (en) | 2013-03-14 | 2014-09-25 | The Broad Institute, Inc. | Selective purification of rna and rna-bound molecular complexes |
| US20160032282A1 (en) | 2013-03-15 | 2016-02-04 | Abvitro, Inc. | Single cell bar-coding for antibody discovery |
| WO2014144713A2 (en) | 2013-03-15 | 2014-09-18 | Immumetrix, Inc. | Methods of sequencing the immune repertoire |
| US20160019337A1 (en) | 2013-03-15 | 2016-01-21 | Htg Molecular Diagnostics, Inc. | Subtyping lung cancers |
| US20160033496A1 (en) | 2013-03-15 | 2016-02-04 | The Trustees Of The Princeton University | Analyte Detection Enhancement by Targeted Immobilization, Surface Amplification, and Pixelated Reading and Analysis |
| US20170029872A1 (en) | 2013-03-15 | 2017-02-02 | The Broad Institute, Inc. | Ribosomal Ribonucleic Acid Hybridization for Organism Identification |
| US20160041159A1 (en) | 2013-03-15 | 2016-02-11 | Joshua Labaer | Biosensor microarray compositions and methods |
| US20140296081A1 (en) | 2013-03-15 | 2014-10-02 | The Board Of Trustees Of The Leland Stanford Junior University | Identification and use of circulating tumor markers |
| EP3425053A1 (en) | 2013-04-02 | 2019-01-09 | Molecular Assemblies, Inc. | Methods and apparatus for synthesizing nucleic acid |
| US20140323330A1 (en) | 2013-04-25 | 2014-10-30 | Vladislav B. Bergo | Microarray compositions and methods of their use |
| US10457980B2 (en) | 2013-04-30 | 2019-10-29 | California Institute Of Technology | Multiplex labeling of molecules by sequential hybridization barcoding |
| US10510435B2 (en) | 2013-04-30 | 2019-12-17 | California Institute Of Technology | Error correction of multiplex imaging analysis by sequential hybridization |
| US20160369329A1 (en) | 2013-04-30 | 2016-12-22 | California Institute Of Technology | Multiplex labeling of molecules by sequential hybridization barcoding using probes with cleavable linkers |
| US10059989B2 (en) | 2013-05-23 | 2018-08-28 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US20170275669A1 (en) | 2013-06-12 | 2017-09-28 | The General Hospital Corporation | Methods, kits, and systems for multiplexed detection of target molecules and uses thereof |
| US10655163B2 (en) | 2013-06-12 | 2020-05-19 | The General Hospital Corporation | Methods, kits, and systems for multiplexed detection of target molecules and uses thereof |
| WO2014200767A1 (en) | 2013-06-12 | 2014-12-18 | The General Hospital Corporation | Methods, kits, and systems for multiplexed detection of target molecules and uses thereof |
| US10266874B2 (en) | 2013-06-12 | 2019-04-23 | The General Hospital Corporation | Methods, kits, and systems for multiplexed detection of target molecules and uses thereof |
| US20210317510A1 (en) | 2013-06-25 | 2021-10-14 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20220325325A1 (en) | 2013-06-25 | 2022-10-13 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US9879313B2 (en) | 2013-06-25 | 2018-01-30 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US10927403B2 (en) | 2013-06-25 | 2021-02-23 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US9868979B2 (en) | 2013-06-25 | 2018-01-16 | Prognosys Biosciences, Inc. | Spatially encoded biological assays using a microfluidic device |
| US10774372B2 (en) | 2013-06-25 | 2020-09-15 | Prognosy s Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20220154255A1 (en) | 2013-06-25 | 2022-05-19 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20230304074A1 (en) | 2013-06-25 | 2023-09-28 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20210172007A1 (en) | 2013-06-25 | 2021-06-10 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11046996B1 (en) | 2013-06-25 | 2021-06-29 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20200109443A1 (en) | 2013-06-25 | 2020-04-09 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20160145677A1 (en) | 2013-06-25 | 2016-05-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays using a microfluidic device |
| US11821024B2 (en) | 2013-06-25 | 2023-11-21 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11753674B2 (en) | 2013-06-25 | 2023-09-12 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20160138091A1 (en) | 2013-06-25 | 2016-05-19 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11286515B2 (en) | 2013-06-25 | 2022-03-29 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20210017583A1 (en) | 2013-06-25 | 2021-01-21 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11359228B2 (en) | 2013-06-25 | 2022-06-14 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20180201980A1 (en) | 2013-06-25 | 2018-07-19 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| WO2014210223A1 (en) | 2013-06-25 | 2014-12-31 | Prognosys Biosciences, Inc. | Spatially encoded biological assays using a microfluidic device |
| US11618918B2 (en) | 2013-06-25 | 2023-04-04 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20210010068A1 (en) | 2013-06-25 | 2021-01-14 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| WO2014210225A1 (en) | 2013-06-25 | 2014-12-31 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US20150000854A1 (en) | 2013-06-27 | 2015-01-01 | The Procter & Gamble Company | Sheet products bearing designs that vary among successive sheets, and apparatus and methods for producing the same |
| WO2014210353A2 (en) | 2013-06-27 | 2014-12-31 | 10X Technologies, Inc. | Compositions and methods for sample processing |
| US20150005447A1 (en) | 2013-07-01 | 2015-01-01 | Illumina, Inc. | Catalyst-free surface functionalization and polymer grafting |
| US10041949B2 (en) | 2013-09-13 | 2018-08-07 | The Board Of Trustees Of The Leland Stanford Junior University | Multiplexed imaging of tissues using mass tags and secondary ion mass spectrometry |
| US10794802B2 (en) | 2013-09-20 | 2020-10-06 | California Institute Of Technology | Whole-body tissue stabilization and selective extractions via tissue-hydrogel hybrids for high resolution intact circuit mapping and phenotyping |
| US9778155B2 (en) | 2013-09-20 | 2017-10-03 | California Institute Of Technology | Methods for phenotyping of intact whole tissues |
| US9582877B2 (en) | 2013-10-07 | 2017-02-28 | Cellular Research, Inc. | Methods and systems for digitally counting features on arrays |
| US20150125053A1 (en) | 2013-11-01 | 2015-05-07 | Illumina, Inc. | Image analysis useful for patterned objects |
| US9834814B2 (en) | 2013-11-22 | 2017-12-05 | Agilent Technologies, Inc. | Spatial molecular barcoding of in situ nucleic acids |
| US20150148239A1 (en) | 2013-11-22 | 2015-05-28 | Agilent Technologies, Inc. | Spatial molecular barcoding of in situ nucleic acids |
| US20170009278A1 (en) | 2014-02-04 | 2017-01-12 | Olink Bioscience Ab | Proximity assay with detection based on hybridisation chain reaction (hcr) |
| US9694361B2 (en) | 2014-04-10 | 2017-07-04 | 10X Genomics, Inc. | Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same |
| US20170029875A1 (en) | 2014-04-18 | 2017-02-02 | William Marsh Rice University | Competitive compositions of nucleic acid molecules for enrichment of rare-allele-bearing species |
| US20180201925A1 (en) | 2014-06-30 | 2018-07-19 | Illumina, Inc. | Methods and compositions using one-sided transposition |
| US20190085383A1 (en) | 2014-07-11 | 2019-03-21 | President And Fellows Of Harvard College | Methods for High-Throughput Labelling and Detection of Biological Features In Situ Using Microscopy |
| US9957550B2 (en) | 2014-09-08 | 2018-05-01 | BioSpyder Technologies, Inc. | Attenuators |
| US9938566B2 (en) | 2014-09-08 | 2018-04-10 | BioSpyder Technologies, Inc. | Profiling expression at transcriptome scale |
| US20160108458A1 (en) | 2014-10-06 | 2016-04-21 | The Board Of Trustees Of The Leland Stanford Junior University | Multiplexed detection and quantification of nucleic acids in single-cells |
| US20160122817A1 (en) | 2014-10-29 | 2016-05-05 | 10X Genomics, Inc. | Methods and compositions for targeted nucleic acid sequencing |
| US20180163265A1 (en) | 2014-12-19 | 2018-06-14 | The Broad Institute Inc. | Unbiased identification of double-strand breaks and genomic rearrangement by genome-wide insert capture sequencing |
| US20180237864A1 (en) | 2015-01-27 | 2018-08-23 | BioSpyder Technologies, Inc. | Focal Gene Expression Profiling of Stained FFPE Tissues with Spatial Correlation to Morphology |
| US9856521B2 (en) | 2015-01-27 | 2018-01-02 | BioSpyder Technologies, Inc. | Ligation assays in liquid phase |
| US11299774B2 (en) | 2015-04-10 | 2022-04-12 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20220195505A1 (en) | 2015-04-10 | 2022-06-23 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11390912B2 (en) | 2015-04-10 | 2022-07-19 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20220002791A1 (en) | 2015-04-10 | 2022-01-06 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20230183785A1 (en) | 2015-04-10 | 2023-06-15 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20230304078A1 (en) | 2015-04-10 | 2023-09-28 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11739372B2 (en) | 2015-04-10 | 2023-08-29 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20190203275A1 (en) | 2015-04-10 | 2019-07-04 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20220298560A1 (en) | 2015-04-10 | 2022-09-22 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11162132B2 (en) | 2015-04-10 | 2021-11-02 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20200399687A1 (en) | 2015-04-10 | 2020-12-24 | Spatial Transcriptomics Ab | Spatially Distinguished, Multiplex Nucleic Acid Analysis of Biological Specimens |
| US20210292822A1 (en) | 2015-04-10 | 2021-09-23 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US20210292748A1 (en) | 2015-04-10 | 2021-09-23 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US10774374B2 (en) | 2015-04-10 | 2020-09-15 | Spatial Transcriptomics AB and Illumina, Inc. | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11613773B2 (en) | 2015-04-10 | 2023-03-28 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US10724078B2 (en) | 2015-04-14 | 2020-07-28 | Koninklijke Philips N.V. | Spatial mapping of molecular profiles of biological tissue samples |
| US10059990B2 (en) | 2015-04-14 | 2018-08-28 | Massachusetts Institute Of Technology | In situ nucleic acid sequencing of expanded biological samples |
| US20160304952A1 (en) | 2015-04-14 | 2016-10-20 | Massachusetts Institue Of Technology | In situ nucleic acid sequencing of expanded biological samples |
| US20170016053A1 (en) | 2015-07-17 | 2017-01-19 | Nanostring Technologies, Inc. | Simultaneous quantification of gene expression in a user-defined region of a cross-sectioned tissue |
| WO2017013170A1 (en) | 2015-07-22 | 2017-01-26 | F. Hoffmann-La Roche Ag | Identification of antigen epitopes and immune sequences recognizing the antigens |
| US20180208967A1 (en) | 2015-07-24 | 2018-07-26 | The Johns Hopkins University | Compositions and methods of rna analysis |
| US20180245142A1 (en) | 2015-07-27 | 2018-08-30 | Illumina, Inc. | Spatial mapping of nucleic acid sequence information |
| US20170089811A1 (en) | 2015-08-07 | 2017-03-30 | Massachusetts Institute Of Technology | Protein Retention Expansion Microscopy |
| US20170067096A1 (en) | 2015-08-07 | 2017-03-09 | Massachusetts Institute Of Technology | Nanoscale Imaging of Proteins and Nucleic Acids via Expansion Microscopy |
| US10078895B2 (en) | 2015-12-30 | 2018-09-18 | Case Western Reserve University | Prediction of recurrence of non-small cell lung cancer with tumor infiltrating lymphocyte (TIL) graphs |
| US10049770B2 (en) | 2015-12-30 | 2018-08-14 | Case Western Reserve University | Prediction of recurrence of non-small cell lung cancer |
| US20170241911A1 (en) | 2016-02-22 | 2017-08-24 | Miltenyi Biotec Gmbh | Automated analysis tool for biological specimens |
| US20190055594A1 (en) | 2016-02-26 | 2019-02-21 | The Board Of Trustee Of The Leland Stanford Junior University | Multiplexed single molecule rna visualization with a two-probe proximity ligation system |
| US20170253918A1 (en) | 2016-03-01 | 2017-09-07 | Expansion Technologies | Combining protein barcoding with expansion microscopy for in-situ, spatially-resolved proteomics |
| US20190218276A1 (en) | 2016-03-21 | 2019-07-18 | The Broad Institute, Inc. | Methods for determining spatial and temporal gene expression dynamics in single cells |
| US20190145982A1 (en) | 2016-05-02 | 2019-05-16 | Encodia, Inc. | Macromolecule analysis employing nucleic acid encoding |
| US20180052081A1 (en) | 2016-05-11 | 2018-02-22 | Expansion Technologies | Combining modified antibodies with expansion microscopy for in-situ, spatially-resolved proteomics |
| US20190161796A1 (en) | 2016-06-21 | 2019-05-30 | Cartana Ab | Nucleic acid sequencing |
| US20200024641A1 (en) | 2016-07-27 | 2020-01-23 | The Board Of Trustees Of The Leland Stanford Junior University | Highly-multiplexed fluorescent imaging |
| US20190330617A1 (en) | 2016-08-31 | 2019-10-31 | President And Fellows Of Harvard College | Methods of Generating Libraries of Nucleic Acid Sequences for Detection via Fluorescent in Situ Sequ |
| US20190194709A1 (en) | 2016-08-31 | 2019-06-27 | President And Fellows Of Harvard College | Methods of Combining the Detection of Biomolecules Into a Single Assay Using Fluorescent In Situ Sequencing |
| US20200080136A1 (en) | 2016-09-22 | 2020-03-12 | William Marsh Rice University | Molecular hybridization probes for complex sequence capture and analysis |
| US20210238581A1 (en) | 2016-10-19 | 2021-08-05 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20180105808A1 (en) | 2016-10-19 | 2018-04-19 | 10X Genomics, Inc. | Methods and systems for barcoding nucleic acid molecules from individual cells or cell populations |
| US20220333191A1 (en) | 2016-10-19 | 2022-10-20 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20220389503A1 (en) | 2016-10-19 | 2022-12-08 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20200256867A1 (en) | 2016-12-09 | 2020-08-13 | Ultivue, Inc. | Methods for Multiplex Imaging Using Labeled Nucleic Acid Imaging Agents |
| US10858702B2 (en) | 2016-12-22 | 2020-12-08 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20200002764A1 (en) | 2016-12-22 | 2020-01-02 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20180216161A1 (en) | 2017-01-23 | 2018-08-02 | Massachusetts Institute Of Technology | Multiplexed Signal Amplified FISH via Splinted Ligation Amplification and Sequencing |
| US20180216162A1 (en) | 2017-01-30 | 2018-08-02 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
| US20180312822A1 (en) | 2017-04-26 | 2018-11-01 | 10X Genomics, Inc. | Mmlv reverse transcriptase variants |
| US10357771B2 (en) | 2017-08-22 | 2019-07-23 | 10X Genomics, Inc. | Method of producing emulsions |
| US20190064173A1 (en) | 2017-08-22 | 2019-02-28 | 10X Genomics, Inc. | Methods of producing droplets including a particle and an analyte |
| US20200224244A1 (en) | 2017-10-06 | 2020-07-16 | Cartana Ab | Rna templated ligation |
| US20200239946A1 (en) | 2017-10-11 | 2020-07-30 | Expansion Technologies | Multiplexed in situ hybridization of tissue sections for spatially resolved transcriptomics with expansion microscopy |
| US20190177800A1 (en) | 2017-12-08 | 2019-06-13 | 10X Genomics, Inc. | Methods and compositions for labeling cells |
| US20190367982A1 (en) | 2018-02-12 | 2019-12-05 | 10X Genomics, Inc. | Methods and systems for analysis of cell lineage |
| US10725027B2 (en) | 2018-02-12 | 2020-07-28 | 10X Genomics, Inc. | Methods and systems for analysis of chromatin |
| US20190367997A1 (en) | 2018-04-06 | 2019-12-05 | 10X Genomics, Inc. | Systems and methods for quality control in single cell processing |
| US11519033B2 (en) | 2018-08-28 | 2022-12-06 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US20240018589A1 (en) | 2018-08-28 | 2024-01-18 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20210010070A1 (en) | 2018-08-28 | 2021-01-14 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20210332425A1 (en) | 2018-08-28 | 2021-10-28 | Rajiv Bharadwaj | Increasing spatial array resolution |
| US20220333195A1 (en) | 2018-08-28 | 2022-10-20 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20210332424A1 (en) | 2018-08-28 | 2021-10-28 | 10X Genomics, Inc. | Methods of generating an array |
| US20210324457A1 (en) | 2018-08-28 | 2021-10-21 | Eswar Prasad Ramachandran Iyer | Methods for Generating Spatially Barcoded Arrays |
| US20230323447A1 (en) | 2018-08-28 | 2023-10-12 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20210317524A1 (en) | 2018-08-28 | 2021-10-14 | 10X Genomics, Inc. | Resolving spatial arrays |
| US20200407781A1 (en) | 2018-08-28 | 2020-12-31 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20230147726A1 (en) | 2018-09-28 | 2023-05-11 | Danmarks Tekniske Universitet | High throughput epitope identification and t cell receptor specificity determination using loadable detection molecules |
| WO2020076979A1 (en) | 2018-10-10 | 2020-04-16 | Readcoor, Inc. | Surface capture of targets |
| US20210230692A1 (en) | 2018-10-10 | 2021-07-29 | Readcoor, Llc | Surface capture of targets |
| US20220112486A1 (en) | 2018-12-10 | 2022-04-14 | 10X Genomics, Inc. | Resolving spatial arrays by proximity-based deconvolution |
| US20200277664A1 (en) | 2018-12-10 | 2020-09-03 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
| US20200277663A1 (en) | 2018-12-10 | 2020-09-03 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
| US20220290217A1 (en) | 2018-12-10 | 2022-09-15 | 10X Genomics, Inc. | Resolving spatial arrays using deconvolution |
| WO2020123317A2 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc | Three-dimensional spatial analysis |
| US20230242976A1 (en) | 2018-12-10 | 2023-08-03 | 10X Genomics, Inc. | Imaging system hardware |
| US20220064630A1 (en) | 2018-12-10 | 2022-03-03 | 10X Genomics, Inc. | Resolving spatial arrays using deconvolution |
| US20210189475A1 (en) | 2018-12-10 | 2021-06-24 | 10X Genomics, Inc. | Imaging system hardware |
| WO2020123318A1 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc. | Resolving spatial arrays using deconvolution |
| US20220049293A1 (en) | 2018-12-10 | 2022-02-17 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
| US20220241780A1 (en) | 2018-12-10 | 2022-08-04 | 10X Genomics, Inc. | Imaging system hardware |
| WO2020123309A1 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc. | Resolving spatial arrays by proximity-based deconvolution |
| US20220049294A1 (en) | 2018-12-10 | 2022-02-17 | 10X Genomics, Inc. | Imaging system hardware |
| US20220033888A1 (en) | 2018-12-10 | 2022-02-03 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| WO2020123311A2 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc. | Resolving spatial arrays using deconvolution |
| WO2020123305A2 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US20220025446A1 (en) | 2018-12-10 | 2022-01-27 | 10X Genomics, Inc. | Methods of using master / copy arrays for spatial detection |
| WO2020123319A2 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc. | Methods of using master / copy arrays for spatial detection |
| US20220025447A1 (en) | 2018-12-10 | 2022-01-27 | 10X Genomics, Inc. | Generating spatial arrays with gradients |
| WO2020123316A2 (en) | 2018-12-10 | 2020-06-18 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
| US11519138B2 (en) | 2018-12-17 | 2022-12-06 | Hamm Ag | Soil processing machine |
| US20240026445A1 (en) | 2019-01-06 | 2024-01-25 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
| US20230323434A1 (en) | 2019-01-06 | 2023-10-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11753675B2 (en) | 2019-01-06 | 2023-09-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11649485B2 (en) | 2019-01-06 | 2023-05-16 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US20210285036A1 (en) | 2019-01-06 | 2021-09-16 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US20230129552A1 (en) | 2019-01-06 | 2023-04-27 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| WO2020167862A1 (en) | 2019-02-12 | 2020-08-20 | 10X Genomics, Inc. | Systems and methods for transfer of reagents between droplets |
| US20220010367A1 (en) | 2019-02-28 | 2022-01-13 | 10X Genomics, Inc. | Profiling of biological analytes with spatially barcoded oligonucleotide arrays |
| US20230143569A1 (en) | 2019-02-28 | 2023-05-11 | 10X Genomics, Inc. | Profiling of biological analytes with spatially barcoded oligonucleotide arrays |
| WO2020176882A1 (en) | 2019-02-28 | 2020-09-03 | 10X Genomics, Inc. | Devices, systems, and methods for increasing droplet formation efficiency |
| US20230159995A1 (en) | 2019-02-28 | 2023-05-25 | 10X Genomics, Inc. | Profiling of biological analytes with spatially barcoded oligonucleotide arrays |
| WO2020190509A1 (en) | 2019-03-15 | 2020-09-24 | 10X Genomics, Inc. | Methods for using spatial arrays for single cell sequencing |
| US20220145361A1 (en) | 2019-03-15 | 2022-05-12 | 10X Genomics, Inc. | Methods for using spatial arrays for single cell sequencing |
| US20220017951A1 (en) | 2019-03-22 | 2022-01-20 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| WO2020198071A1 (en) | 2019-03-22 | 2020-10-01 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| WO2020219901A1 (en) | 2019-04-26 | 2020-10-29 | 10X Genomics, Inc. | Imaging support devices |
| US20220081728A1 (en) | 2019-05-30 | 2022-03-17 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| US20210140982A1 (en) | 2019-10-18 | 2021-05-13 | 10X Genomics, Inc. | Identification of spatial biomarkers of brain disorders and methods of using the same |
| WO2021092433A2 (en) | 2019-11-08 | 2021-05-14 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| US20220127672A1 (en) | 2019-11-08 | 2022-04-28 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| US20230323453A1 (en) | 2019-11-08 | 2023-10-12 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| US11592447B2 (en) | 2019-11-08 | 2023-02-28 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| US11702698B2 (en) | 2019-11-08 | 2023-07-18 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| US20220326251A1 (en) | 2019-11-08 | 2022-10-13 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| WO2021091611A1 (en) | 2019-11-08 | 2021-05-14 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| US11808769B2 (en) | 2019-11-08 | 2023-11-07 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| US20230228762A1 (en) | 2019-11-08 | 2023-07-20 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| WO2021097255A1 (en) | 2019-11-13 | 2021-05-20 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US20230002812A1 (en) | 2019-11-13 | 2023-01-05 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US20210199660A1 (en) | 2019-11-22 | 2021-07-01 | 10X Genomics, Inc. | Biomarkers of breast cancer |
| US20220267844A1 (en) | 2019-11-27 | 2022-08-25 | 10X Genomics, Inc. | Methods for determining a location of a biological analyte in a biological sample |
| US11560593B2 (en) | 2019-12-23 | 2023-01-24 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US20230160008A1 (en) | 2019-12-23 | 2023-05-25 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
| US20230392204A1 (en) | 2019-12-23 | 2023-12-07 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
| US20210348221A1 (en) | 2019-12-23 | 2021-11-11 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
| US20210190770A1 (en) | 2019-12-23 | 2021-06-24 | 10X Genomics, Inc. | Compositions and methods for using fixed biological samples in partition-based assays |
| US11332790B2 (en) | 2019-12-23 | 2022-05-17 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| WO2021133842A1 (en) | 2019-12-23 | 2021-07-01 | 10X Genomics, Inc. | Compositions and methods for using fixed biological samples in partition-based assays |
| US20220334031A1 (en) | 2019-12-23 | 2022-10-20 | 10X Genomics, Inc. | Reversible fixing reagents and methods of use thereof |
| US20230064372A1 (en) | 2019-12-23 | 2023-03-02 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
| US20220282329A1 (en) | 2019-12-23 | 2022-09-08 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
| US11505828B2 (en) | 2019-12-23 | 2022-11-22 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| WO2021133849A1 (en) | 2019-12-23 | 2021-07-01 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
| US20210285046A1 (en) | 2019-12-23 | 2021-09-16 | 10X Genomics, Inc. | Methods for spatial analysis using rna-templated ligation |
| US11795507B2 (en) | 2019-12-23 | 2023-10-24 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US20210198741A1 (en) | 2019-12-30 | 2021-07-01 | 10X Genomics, Inc. | Identification of spatial biomarkers of heart disorders and methods of using the same |
| US20220348992A1 (en) | 2020-01-10 | 2022-11-03 | 10X Genomics, Inc. | Methods for determining a location of a target nucleic acid in a biological sample |
| WO2021142233A1 (en) | 2020-01-10 | 2021-07-15 | 10X Genomics, Inc. | Methods for determining a location of a target nucleic acid in a biological sample |
| US20210214785A1 (en) | 2020-01-13 | 2021-07-15 | Spatial Transcriptomics Ab | Methods of decreasing background on a spatial array |
| US20210223227A1 (en) | 2020-01-17 | 2021-07-22 | Spatial Transcriptomics Ab | Electrophoretic system and method for analyte capture |
| US11732299B2 (en) | 2020-01-21 | 2023-08-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US20230332227A1 (en) | 2020-01-21 | 2023-10-19 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US20210222242A1 (en) | 2020-01-21 | 2021-07-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US20230295722A1 (en) | 2020-01-21 | 2023-09-21 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| US20210222253A1 (en) | 2020-01-21 | 2021-07-22 | 10X Genomics, Inc. | Identification of biomarkers of glioblastoma and methods of using the same |
| US20210222241A1 (en) | 2020-01-21 | 2021-07-22 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| US11702693B2 (en) | 2020-01-21 | 2023-07-18 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| US20230077364A1 (en) | 2020-01-24 | 2023-03-16 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US20210230681A1 (en) | 2020-01-24 | 2021-07-29 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US11821035B1 (en) | 2020-01-29 | 2023-11-21 | 10X Genomics, Inc. | Compositions and methods of making gene expression libraries |
| US20210237022A1 (en) | 2020-01-31 | 2021-08-05 | 10X Genomics, Inc. | Capturing oligonucleotides in spatial transcriptomics |
| US20210238680A1 (en) | 2020-02-03 | 2021-08-05 | 10X Genomics, Inc. | Increasing capture efficiency of spatial assays |
| US20210238664A1 (en) | 2020-02-03 | 2021-08-05 | 10X Genomics, Inc. | Methods for preparing high-resolution spatial arrays |
| US11732300B2 (en) | 2020-02-05 | 2023-08-22 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US20210238675A1 (en) | 2020-02-05 | 2021-08-05 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US20240002931A1 (en) | 2020-02-05 | 2024-01-04 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US20230047782A1 (en) | 2020-02-07 | 2023-02-16 | 10X Genomics, Inc. | Quantitative and automated permeabilization performance evaluation for spatial transcriptomics |
| US20230393071A1 (en) | 2020-02-11 | 2023-12-07 | 10X Genomics, Inc. | Methods and compositions for partitioning a biological sample |
| US20210247316A1 (en) | 2020-02-11 | 2021-08-12 | 10X Genomics, Inc. | Methods and compositions for partitioning a biological sample |
| US11835462B2 (en) | 2020-02-11 | 2023-12-05 | 10X Genomics, Inc. | Methods and compositions for partitioning a biological sample |
| WO2021168278A1 (en) | 2020-02-20 | 2021-08-26 | 10X Genomics, Inc. | METHODS TO COMBINE FIRST AND SECOND STRAND cDNA SYNTHESIS FOR SPATIAL ANALYSIS |
| US20230081381A1 (en) | 2020-02-20 | 2023-03-16 | 10X Genomics, Inc. | METHODS TO COMBINE FIRST AND SECOND STRAND cDNA SYNTHESIS FOR SPATIAL ANALYSIS |
| WO2021168261A1 (en) | 2020-02-21 | 2021-08-26 | 10X Genomics, Inc. | Capturing genetic targets using a hybridization approach |
| US20210262019A1 (en) | 2020-02-24 | 2021-08-26 | 10X Genomics, Inc. | Methods of making gene expression libraries |
| US11891654B2 (en) | 2020-02-24 | 2024-02-06 | 10X Genomics, Inc. | Methods of making gene expression libraries |
| US11768175B1 (en) | 2020-03-04 | 2023-09-26 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
| US20230194470A1 (en) | 2020-03-04 | 2023-06-22 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
| US20230220368A1 (en) | 2020-04-10 | 2023-07-13 | 10X Genomics, Inc. | Cold protease treatment method for preparing biological samples |
| WO2021207610A1 (en) | 2020-04-10 | 2021-10-14 | 10X Genomics, Inc. | Cold protease treatment method for preparing biological samples |
| US20230265488A1 (en) | 2020-04-16 | 2023-08-24 | 10X Genomics, Inc. | Compositions and methods for use with fixed samples |
| US20220090181A1 (en) | 2020-04-22 | 2022-03-24 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna depletion |
| US20240018575A1 (en) | 2020-04-22 | 2024-01-18 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna depletion |
| US11535887B2 (en) | 2020-04-22 | 2022-12-27 | 10X Genomics, Inc. | Methods for spatial analysis using targeted RNA depletion |
| WO2021216708A1 (en) | 2020-04-22 | 2021-10-28 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna depletion |
| US20230145575A1 (en) | 2020-04-22 | 2023-05-11 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna depletion |
| US11773433B2 (en) | 2020-04-22 | 2023-10-03 | 10X Genomics, Inc. | Methods for spatial analysis using targeted RNA depletion |
| WO2021225900A1 (en) | 2020-05-04 | 2021-11-11 | 10X Genomics, Inc. | Spatial transcriptomic transfer modes |
| US20230265491A1 (en) | 2020-05-04 | 2023-08-24 | 10X Genomics, Inc. | Spatial transcriptomic transfer modes |
| US20230194469A1 (en) | 2020-05-19 | 2023-06-22 | 10X Genomics, Inc. | Electrophoresis cassettes and instrumentation |
| WO2021236625A1 (en) | 2020-05-19 | 2021-11-25 | 10X Genomics, Inc. | Electrophoresis cassettes and instrumentation |
| US11608520B2 (en) | 2020-05-22 | 2023-03-21 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| WO2021236929A1 (en) | 2020-05-22 | 2021-11-25 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| WO2021237087A1 (en) | 2020-05-22 | 2021-11-25 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| US20220106632A1 (en) | 2020-05-22 | 2022-04-07 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| US20230265489A1 (en) | 2020-05-22 | 2023-08-24 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| WO2021237056A1 (en) | 2020-05-22 | 2021-11-25 | 10X Genomics, Inc. | Rna integrity analysis in a biological sample |
| US11866767B2 (en) | 2020-05-22 | 2024-01-09 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| US11624086B2 (en) | 2020-05-22 | 2023-04-11 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| US20220090175A1 (en) | 2020-05-22 | 2022-03-24 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| US20230220455A1 (en) | 2020-05-22 | 2023-07-13 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| US20220170083A1 (en) | 2020-05-22 | 2022-06-02 | 10X Genomics, Inc. | Rna integrity analysis in a biological sample |
| US20230111225A1 (en) | 2020-05-26 | 2023-04-13 | 10X Genomics, Inc. | Method for resetting an array |
| US11560592B2 (en) | 2020-05-26 | 2023-01-24 | 10X Genomics, Inc. | Method for resetting an array |
| WO2021242834A1 (en) | 2020-05-26 | 2021-12-02 | 10X Genomics, Inc. | Method for resetting an array |
| US20220098661A1 (en) | 2020-05-26 | 2022-03-31 | 10X Genomics, Inc. | Method for resetting an array |
| US11608498B2 (en) | 2020-06-02 | 2023-03-21 | 10X Genomics, Inc. | Nucleic acid library methods |
| US11840687B2 (en) | 2020-06-02 | 2023-12-12 | 10X Genomics, Inc. | Nucleic acid library methods |
| US11845979B2 (en) | 2020-06-02 | 2023-12-19 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
| US20220195422A1 (en) | 2020-06-02 | 2022-06-23 | 10X Genomics, Inc. | Nucleic Acid Library Methods |
| US11859178B2 (en) | 2020-06-02 | 2024-01-02 | 10X Genomics, Inc. | Nucleic acid library methods |
| WO2021247543A2 (en) | 2020-06-02 | 2021-12-09 | 10X Genomics, Inc. | Nucleic acid library methods |
| WO2021247568A1 (en) | 2020-06-02 | 2021-12-09 | 10X Genomics, Inc. | Spatial trancriptomics for antigen-receptors |
| US11512308B2 (en) | 2020-06-02 | 2022-11-29 | 10X Genomics, Inc. | Nucleic acid library methods |
| US20230033960A1 (en) | 2020-06-02 | 2023-02-02 | 10X Genomics, Inc. | Nucleic acid library methods |
| US11692218B2 (en) | 2020-06-02 | 2023-07-04 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
| US20220106633A1 (en) | 2020-06-02 | 2022-04-07 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
| US20230287399A1 (en) | 2020-06-02 | 2023-09-14 | 10X Genomics, Inc. | Nucleic acid library methods |
| US20230183684A1 (en) | 2020-06-02 | 2023-06-15 | 10X Genomics, Inc. | Nucleic acid library methods |
| US20230227811A1 (en) | 2020-06-08 | 2023-07-20 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US20230056549A1 (en) | 2020-06-08 | 2023-02-23 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| WO2021252499A1 (en) | 2020-06-08 | 2021-12-16 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US20230323340A1 (en) | 2020-06-08 | 2023-10-12 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US20220098576A1 (en) | 2020-06-08 | 2022-03-31 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11407992B2 (en) | 2020-06-08 | 2022-08-09 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US20220348905A1 (en) | 2020-06-08 | 2022-11-03 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11781130B2 (en) | 2020-06-08 | 2023-10-10 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11492612B1 (en) | 2020-06-08 | 2022-11-08 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11624063B2 (en) | 2020-06-08 | 2023-04-11 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US20230279474A1 (en) | 2020-06-10 | 2023-09-07 | 10X Genomics, Inc. | Methods for spatial analysis using blocker oligonucleotides |
| US20220119869A1 (en) | 2020-06-10 | 2022-04-21 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
| WO2021252591A1 (en) | 2020-06-10 | 2021-12-16 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
| WO2021252576A1 (en) | 2020-06-10 | 2021-12-16 | 10X Genomics, Inc. | Methods for spatial analysis using blocker oligonucleotides |
| US11434524B2 (en) | 2020-06-10 | 2022-09-06 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
| US20220403455A1 (en) | 2020-06-10 | 2022-12-22 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
| US11661626B2 (en) | 2020-06-25 | 2023-05-30 | 10X Genomics, Inc. | Spatial analysis of DNA methylation |
| US20230080543A1 (en) | 2020-06-25 | 2023-03-16 | 10X Genomics, Inc. | Spatial analysis of dna methylation |
| WO2021263111A1 (en) | 2020-06-25 | 2021-12-30 | 10X Genomics, Inc. | Spatial analysis of dna methylation |
| US20220127666A1 (en) | 2020-06-25 | 2022-04-28 | 10X Genomics, Inc. | Spatial analysis of dna methylation |
| US11408029B2 (en) | 2020-06-25 | 2022-08-09 | 10X Genomics, Inc. | Spatial analysis of DNA methylation |
| US20230383344A1 (en) | 2020-07-06 | 2023-11-30 | 10X Genomics, Inc. | Methods for identifying a location of an rna in a biological sample |
| US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US20230287475A1 (en) | 2020-07-31 | 2023-09-14 | 10X Genomics, Inc. | De-crosslinking compounds and methods of use for spatial analysis |
| WO2022025965A1 (en) | 2020-07-31 | 2022-02-03 | 10X Genomics, Inc. | De-crosslinking compounds and methods of use for spatial analysis |
| US20220404245A1 (en) | 2020-07-31 | 2022-12-22 | 10X Genomics, Inc. | De-crosslinking compounds and methods of use for spatial analysis |
| US20230220454A1 (en) | 2020-09-15 | 2023-07-13 | 10X Genomics, Inc. | Methods of releasing an extended capture probe from a substrate and uses of the same |
| WO2022060798A1 (en) | 2020-09-15 | 2022-03-24 | 10X Genomics, Inc. | Methods of releasing an extended capture probe from a substrate and uses of the same |
| WO2022060953A1 (en) | 2020-09-16 | 2022-03-24 | 10X Genomics, Inc. | Methods of determining the location of an analyte in a biological sample using a plurality of wells |
| US20230313279A1 (en) | 2020-09-16 | 2023-10-05 | 10X Genomics, Inc. | Methods of determining the location of an analyte in a biological sample using a plurality of wells |
| US20240018572A1 (en) | 2020-10-22 | 2024-01-18 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification |
| WO2022087273A1 (en) | 2020-10-22 | 2022-04-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification |
| WO2022099037A1 (en) | 2020-11-06 | 2022-05-12 | 10X Genomics, Inc. | Compositions and methods for binding an analyte to a capture probe |
| WO2022098810A1 (en) | 2020-11-06 | 2022-05-12 | 10X Genomics, Inc. | Assay support devices |
| US20230332212A1 (en) | 2020-11-06 | 2023-10-19 | 10X Genomics, Inc. | Compositions and methods for binding an analyte to a capture probe |
| US20230279481A1 (en) | 2020-11-13 | 2023-09-07 | 10X Genomics, Inc. | Nano-partitions for multiple reactions in partition-based assays |
| WO2022103712A1 (en) | 2020-11-13 | 2022-05-19 | 10X Genomics, Inc. | Nano-partitions (encapsulated nucleic acid processing enzymes) for cell-lysis and multiple reactions in partition-based assays |
| WO2022109181A1 (en) | 2020-11-18 | 2022-05-27 | 10X Genomics, Inc. | Methods and compositions for analyzing immune infiltration in cancer stroma to predict clinical outcome |
| US20230407404A1 (en) | 2020-11-18 | 2023-12-21 | 10X Genomics, Inc. | Methods and compositions for analyzing immune infiltration in cancer stroma to predict clinical outcome |
| US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
| US11873482B2 (en) | 2020-12-21 | 2024-01-16 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US20230203478A1 (en) | 2020-12-21 | 2023-06-29 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US20230113230A1 (en) | 2020-12-21 | 2023-04-13 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US20230383285A1 (en) | 2020-12-21 | 2023-11-30 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US11618897B2 (en) | 2020-12-21 | 2023-04-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| WO2022140028A1 (en) | 2020-12-21 | 2022-06-30 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US20220356464A1 (en) | 2020-12-21 | 2022-11-10 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US20230332138A1 (en) | 2020-12-21 | 2023-10-19 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US11680260B2 (en) | 2020-12-21 | 2023-06-20 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| WO2022147005A1 (en) | 2020-12-30 | 2022-07-07 | 10X Genomics, Inc. | Methods for analyte capture determination |
| WO2022147296A1 (en) | 2020-12-30 | 2022-07-07 | 10X Genomics, Inc. | Cleavage of capture probes for spatial analysis |
| WO2022164615A1 (en) | 2021-01-29 | 2022-08-04 | 10X Genomics, Inc. | Method for transposase mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20220364163A1 (en) | 2021-01-29 | 2022-11-17 | 10X Genomics, Inc. | Method for transposase mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20240035937A1 (en) | 2021-02-19 | 2024-02-01 | 10X Genomics, Inc. | Modular assay support devices |
| WO2022178267A2 (en) | 2021-02-19 | 2022-08-25 | 10X Genomics, Inc. | Modular assay support devices |
| US20240011090A1 (en) | 2021-03-18 | 2024-01-11 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| US20220389504A1 (en) | 2021-03-18 | 2022-12-08 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| US11739381B2 (en) | 2021-03-18 | 2023-08-29 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| WO2022198068A1 (en) | 2021-03-18 | 2022-09-22 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| WO2022221425A1 (en) | 2021-04-14 | 2022-10-20 | 10X Genomics, Inc. | Methods of measuring mislocalization of an analyte |
| US20230126825A1 (en) | 2021-04-14 | 2023-04-27 | 10X Genomics, Inc. | Methods of measuring mislocalization of an analyte |
| US20220333192A1 (en) | 2021-04-20 | 2022-10-20 | 10X Genomics, Inc. | Methods and devices for spatial assessment of rna quality |
| WO2022226057A1 (en) | 2021-04-20 | 2022-10-27 | 10X Genomics, Inc. | Methods for assessing sample quality prior to spatial analysis using templated ligation |
| US20230069046A1 (en) | 2021-05-06 | 2023-03-02 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| WO2022236054A1 (en) | 2021-05-06 | 2022-11-10 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| WO2022256503A1 (en) | 2021-06-03 | 2022-12-08 | 10X Genomics, Inc. | Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis |
| US20230295699A1 (en) | 2021-06-03 | 2023-09-21 | 10X Genomics, Inc. | Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis |
| WO2022271820A1 (en) | 2021-06-22 | 2022-12-29 | 10X Genomics, Inc. | Spatial detection of sars-cov-2 using templated ligation |
| US20230014008A1 (en) | 2021-07-13 | 2023-01-19 | 10X Genomics, Inc. | Methods for improving spatial performance |
| WO2023287765A1 (en) | 2021-07-13 | 2023-01-19 | 10X Genomics, Inc. | Methods for spatial analysis using targeted probe silencing |
| US20230034216A1 (en) | 2021-07-28 | 2023-02-02 | 10X Genomics, Inc. | Multiplexed spatial capture of analytes |
| US20230034039A1 (en) | 2021-08-02 | 2023-02-02 | 10X Genomics, Inc. | Methods of preserving a biological sample |
| US20230042817A1 (en) | 2021-08-04 | 2023-02-09 | 10X Genomics, Inc. | Analyte capture from an embedded biological sample |
| WO2023018799A1 (en) | 2021-08-12 | 2023-02-16 | 10X Genomics, Inc. | Methods, compositions and systems for identifying antigen-binding molecules |
| WO2023034489A1 (en) | 2021-09-01 | 2023-03-09 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US11753673B2 (en) | 2021-09-01 | 2023-09-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US20230212650A1 (en) | 2021-09-01 | 2023-07-06 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US20230366008A1 (en) | 2021-09-01 | 2023-11-16 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US11840724B2 (en) | 2021-09-01 | 2023-12-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US20230279477A1 (en) | 2021-10-26 | 2023-09-07 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna capture |
| WO2023076345A1 (en) | 2021-10-26 | 2023-05-04 | 10X Genomics, Inc. | Methods for spatial analysis using targeted rna capture |
| US20230135010A1 (en) | 2021-11-03 | 2023-05-04 | 10X Genomics, Inc. | Sequential analyte capture |
| WO2023086880A1 (en) | 2021-11-10 | 2023-05-19 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| WO2023102118A2 (en) | 2021-12-01 | 2023-06-08 | 10X Genomics, Inc. | Methods, compositions, and systems for improved in situ detection of analytes and spatial analysis |
| US20230416808A1 (en) | 2021-12-01 | 2023-12-28 | 10X Genomics, Inc. | Methods, compositions, and systems for improved in situ detection of analytes and spatial analysis |
| US20230287481A1 (en) | 2021-12-03 | 2023-09-14 | 10X Genomics, Inc. | Method for transposase mediated spatial tagging and analyzing genomic dna in a biological sample |
| US20230175045A1 (en) | 2021-12-03 | 2023-06-08 | 10X Genomics, Inc. | Method for transposase mediated spatial tagging and analyzing genomic dna in a biological sample |
| WO2023150171A1 (en) | 2022-02-01 | 2023-08-10 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing analytes from glioblastoma samples |
| WO2023150163A1 (en) | 2022-02-01 | 2023-08-10 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing analytes from lymphatic tissue |
| WO2023150098A1 (en) | 2022-02-01 | 2023-08-10 | 10X Genomics, Inc. | Methods, kits, compositions, and systems for spatial analysis |
| US20230332247A1 (en) | 2022-02-01 | 2023-10-19 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing analytes from glioblastoma samples |
| WO2023215552A1 (en) | 2022-05-06 | 2023-11-09 | 10X Genomics, Inc. | Molecular barcode readers for analyte detection |
| WO2023225519A1 (en) | 2022-05-17 | 2023-11-23 | 10X Genomics, Inc. | Modified transposons, compositions and uses thereof |
| WO2023229988A1 (en) | 2022-05-23 | 2023-11-30 | 10X Genomics, Inc. | Tissue sample mold |
| US20230416850A1 (en) | 2022-06-22 | 2023-12-28 | 10X Genomics, Inc. | Methods, compositions, and systems for detecting exogenous nucleic acids |
| WO2023250077A1 (en) | 2022-06-22 | 2023-12-28 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| WO2024015578A1 (en) | 2022-07-15 | 2024-01-18 | 10X Genomics, Inc. | Methods for determining a location of a target nucleic acid in a biological sample |
Non-Patent Citations (762)
| Title |
|---|
| [No Author Listed], "HuSNP Mapping Assay User's Manual," Affymetrix Part No. 90094 (Affymetrix, Santa Clara, Calif.), GeneChip, 2000, 104 pages. |
| [No Author Listed], "Microarray technologies have excellent possibilities in genomics-related researches," Science Tools From Amersham Pharmacia Biotech, 1998, 3(4): 8 pages (with English Translation). |
| Abaan et al., "The exomes of the NCI-60 panel: a genomic resource for cancer biology and systems pharmacology," Cancer Res., Jul. 2013, 73(14):4372-82. |
| Adessi et al., "Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms," Nucl. Acids Res., Oct. 2000, 28(20):E87, 8 pages. |
| Adiconis et al., "Comparative analysis of RNA sequencing methods for degraded or low-input samples," Nat Methods, Jul. 2013, 10(7):623-9. |
| Affymetrix, "GeneChip Human Genome U133 Set," retrieved from the Internet: on the World Wide Web at affymetrix.com/support/technical/datasheets/hgu133_datasheet.pdf, retrieved on Feb. 26, 2003. |
| Affymetrix, "HG-U133 Plus2.0 Annotation File (filtered excerpt)," affymetrix.com, dated Mar. 18, 2013, retrieved from <http://www.affymetrix.com/Auth/analysis/downloads/na26/ivt/HG-U133_Plus_2.na26.annot.csv.zip>, 1 page. |
| Affymetrix, "Human Genome U95Av2," Internet Citation, retrieved from the internet: on the World Wide Web affymetrix.com, retrieved on Oct. 2, 2002. |
| Agasti et al., "Photocleavable DNA Barcode-Antibody Conjugates Allow Sensitive and Multiplexed Protein Analysis in Single Cells," Journal of the American Chemical Society, Oct. 23, 2012, 134(45): 18499-18502. |
| Agbavwe et al., "Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays," Journal of Nanobiotechnology, Dec. 2011, 9:57, 17 pages. |
| Ahern et al., "Biochemical, Reagents Kits Offer Scientists Good Return On Investment," The Scientist, 1995, 9(15):20, 7 pages. |
| Ahern, "Biochemical, Reagents Kits Offer Scientists Good Return On Investment," The Scientist, Jul. 1995, 9(15):20, 7 pages. |
| Ahlfen et al., "Determinants of RNA quality from FFPE samples," PLoS One, Dec. 2007, 2(12):e1261, 7 pages. |
| AJCC, "25 Lungs and 26 Pleural Mesothelioma," AJCC Cancer Staging Manual 7th Ed., Springer, 2010, pp. 253-278, 38 pages. |
| Akatsuka et al., "Rapid screening of T-cell receptor (TCR) variable gene usage by multiplex PCR: Application for assessment of clonal composition," Tissue Antigens, Jan. 5, 1999, 53:122-134. |
| Akatsuka et al., "T cell receptor clonal diversity following allogeneic marrow grafting," Human Immunology, Jun.-Jul. 1996, 48:125-134. |
| Akeroyd, "Click chemistry for the preparation of advanced macromolecular architectures," Stellenbosch University, PhD Dissertation, Mar. 2010, 138 pages. |
| Albretsen et al., "Applications of magnetic beads with covalently attached oligonucleotides in hybridization: Isolation and detection of specific measles virus mRNA from a crude cell lysate", Anal. Biochem. 189: 40-50, 1990. |
| Albretsen et al., "Optimal conditions for hybridization with oligonucleotides: a study with myc-oncogene DNA probes," Anal Biochem., Apr. 1988, 170(1):193-202. |
| Allawi and SantaLucia, "Thermodynamics and NMR of Internal GâT Mismatches in DNA," Biochemistry, 36:10581-94. |
| Almog et al., "The crystal structures of the psychrophilic subtilisin S41 and the mesophilic subtilisin Sph reveal the same calcium-loaded state," Proteins, Feb. 1, 2009, 74(2): 489-496. |
| Altaras et al., "Production and formulation of adenovirus vectors," Adv Biochem Eng Biotechnol., Nov. 2005, 99:193-260. |
| Altman et al., "Phenotypic Analysis of Antigen-Specific T Lymphocytes," Science, Oct. 4, 1996, 274(5284):94-96. |
| Altschul et al., "Basic local alignment search tool," J. Mol. Biol., Oct. 5, 1990, 215(3):403-410. |
| Andersen et al., "Parallel Detection of Antigen-Specific T Cell Responses by Combinatorial Encoding of MHC Multimers," Nature Protocols, Apr. 12, 2012, 7(5):891-902. |
| Anderson et al., "Microarrayed Compound Screening to Identify Activators and Inhibitors of AMP-Activated Protein Kinase," J. of Biomolecular Screening, 2004, 9:112. |
| Andersson et al., "Analysis of protein expression in cell microarrays: a tool for antibody-based proteomics.," J Histochem Cytochem., 4(12): 1413-1423, 2006. |
| Andresen et al., "Deciphering the Antibodyome—Peptide Arrays for Serum Antibody Biomarker Diagnostics," Current Proteomics, 6(1), 1-12, 2009. |
| Andresen et al., "Helicase-dependent amplification: use in OnChip amplification and potential for point-of-care diagnostics," Expert Rev Mol Diagn., Oct. 2009, 9(7):645-650. |
| Angenendt et al., "Cell-free expression and functional assay in a nanowell chip format," Analytical Chemistry, 2004, 76(7): 1844-49. |
| Angenendt et al., "Generation of High Density Protein Microarrays by Cell-free in Situ Expression of Unpurified PCR Products," Molecular and Cellular Proteomics, (2006) Ch. 5.9, pp. 1658-1666. |
| Appella, "Non-natural nucleic acids for synthetic biology," Current Opinion in Chemical Biology, Dec. 2009, 13(5-6): 687-696. |
| Armani et al., "2D-PCR: a method of mapping DNA in tissue sections, " Lab on a Chip, 2009, 9(24):3526-34. |
| Atkinson, Overview of Translation: Lecture Manuscript, U of Texas (2000) DD. 6.1-6.8. |
| Azioune et al., "Simple and rapid process for single cell micro-patterning," Lab Chip, Jun. 2009, 9(11):1640-1642. |
| Bains et al., "A Novel Method for Nucleic Acid Sequence Determination", Journal of Theoretical Biology, 1988, 135(3), 303-7. |
| Baird et al., "Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD markers," PLOS One, 2008, 3(1 0):e3376. |
| Bakker et al., "Conditional MHC class I ligands and peptide exchange technology for the human MHC gene products HLA-A1, −A3, −A11, and −B7," Proc Natl Acad Sci USA, Mar. 11, 2008, 105(10):3825-3830. |
| Balakrishnan et al., "Flap endonuclease 1," Annu Rev Biochem., Jun. 2013, 82:119-138. |
| Baner et al., "Signal amplification of padlock probes by rolling circle replication," Nucleic Acids Res., 1998, 26(22):5073-5078. |
| Barbie et al., "Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1," Nature, Nov. 2009, 462(7269):108-12. |
| Barnes, "PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates.," Proc. Natl. Acad. Sci USA, 91: 2216-2220, 1994. |
| Baugh et al., "Quantitative analysis of mRNA amplification by in vitro transcription," Nucleic Acids Res., 2001, 29:5:e29. |
| Beattie et al., "Advances in genosensor research," Clin Chem., May 1995, 41(5):700-6. |
| Bechara et al., "Cell-penetrating peptides: 20 years later, where do we stand?," FEBS Lett., Jun. 2013, 587(12):1693-702. |
| Beier et al., "Versatile derivatisation of solid support media for covalent bonding on DNA-microchips," Nucleic Acids Res., May 1999, 27(9):1970-7. |
| Bell, "A Simple Way to Treat PCR Products Prior to Sequencing Using ExoSAP-IT," Biotechniques, 2008, vol. 44, No. 6. |
| Belton et al., "Hi-C: A comprehensive technique to capture the conformation of genomes," Methods, Nov. 2012, 58(3):268-276, 16 pages. |
| Bentley et al., "Accurate whole human genome sequencing using reversible terminator chemistry", Nature, 2008, 456:53-59. |
| Berent et al., "Comparison of oligonucleotide and long DNA fragments as probes in DNA and RNA dot, Southern, Northern, colony and plaque hybridizations," Biotechniques, 1985, 3(3):208-220 (Abstract Only). |
| Berger et al., "Universal bases for hybridization, replication and chain termination," Nucleic Acid Res., Aug. 2000, 28(15):2911-2914. |
| Bessmertnykh et al., "Efficient Palladium-Catalyzed Synthesis of Aminopyridyl Phosphonates from Bromopyridines and Diethyl Phosphite," Synthesis, 2008, 10:1575-1579. |
| Bibikova et al., "Quantitative gene expression profiling in formalin-fixed paraffin-embedded tissues using universal bead arrays," The American Journal of Pathology, Nov. 1, 2004, 165(5):1799-1807. |
| Bielas et al., "Human cancers express a mutator phenotype," Proc. Natl. Acad. Sci. USA, 2006, 103(48): 18238-18242. |
| Bielas et al., "Quantification of random genomic mutations," Nat. Methods, 2005, 2(4):285-290. |
| Biol.wwu.edu [online], "Principles of Di-Base Sequencing and the Advantages of Color Space Analysis in the SOLiD System," 2008, retrieved on Mar. 11, 2022, retrieved from URL<https://biol.wwu.edu//young/470/stuff/abi-solid.pdf>, 4 pages. |
| Birney, et al., "Identification and analysis of functional elements in 1% of the human genome by the Encode pilot project," Nature, 2007, 447:799-816. |
| Blair et al., "Microarray temperature optimization using hybridization kinetics," Methods Mol Biol., 2009, 529:171-96. |
| Blanchard et al., "High-density oligonucleotide arrays," Biosensors & Bioelectronics, 1996, 11(6-7):687-690. |
| Blanco et al., "A practical approach to FRET-based PNA fluorescence in situ hybridization," Methods, Dec. 2010, 52(4):343-51. |
| Blandini et al., "Animal models of Parkinson's disease," Febs J., Apr. 2012, 279(7):1156-66. |
| Blokzijl et al., "Profiling protein expression and interactions: proximity liqation as a tool for personalized medicine," J Intern. Med., 2010, 268:232-245. |
| Blow, "Tissue Issues," Nature, 448(23), 959-962, 2007. |
| Boeke et al., "Transcription and reverse transcription of retrotransposons," Annu Rev Microbiol, 1989, 43:403-34. |
| Bonfield et al., "The application of numerical estimates of base calling accuracy to DNA sequencing projects," Nucleic Acids Research, 1995, 23(8):1406-1410. |
| Bootman et al., "Loading fluorescent Ca2+ indicators into living cells," Cold Spring Harb Protoc., Feb. 2013, 2013(2):122-5. |
| Bos et al., "In Vitro Evaluation of DNA-DNA Hybridization as a Two-Step Approach in Radioimmunotherapy of Cancer," Cancer Res., Jul. 1, 1994, 54(13):3479-3486. |
| Boulé et al., "Terminal deoxynucleotidyl transferase indiscriminately incorporates ribonucleotides and deoxyribonucleotides," J Biol Chem., Aug. 2001, 276(33):31388-93. |
| Boutros et al., "The art and design of genetic screens: RNA interference," Nat Rev Genet., Jul. 2008, 9(7):554-66. |
| Bowen et al., "Concurrent V(D)J recombination and DNA end instability increase interchromosomal trans-rearrangements in ATM-deficient thymocytes," Nucleic Acids Research, Apr. 1, 2013, 41(8):4535-4548. |
| Bowtell, "The genesis and evolution of high-grade serous ovarian cancer," Nat. Rev. Cancer, 2010, (11 ):803-808 Abstract. |
| Brandon et al., "Mitochondrial mutations in cancer," Oncogene, 2006, 25(34):4647-4662. |
| Brenner et al., "Gene expression analysis by massively parallel signature sequencing (MPSS) on microbead arrays", Nat. Biotech. 18: 630-634, 2000. |
| Brenner et al., "In vitro cloning of complex mixtures of DNA on microbeads: physical separation of differentially expressed cDNAs," Proc. Natl. Acad. Sci. USA, 2000, 97, 1665-1670. |
| Brockman et al., "Quality scores and SNP detection in sequencing-by-synthesis systems," Methods, 2008, 18:763-770. |
| Brow, "35—The Cleavase I enzyme for mutation and polymorphism scanning," PCR Applications Protocols for Functional Genomics, 1999, pp. 537-550. |
| Brown et al., "Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein," Proc Natl Acad Sci USA, Apr. 1989, 86(8):2525-9. |
| Bullard et al., "Direct comparison of nick-joining activity of the nucleic acid ligases from bacteriophage T4," Biochem. J. 2006, 398:135-144. |
| Burns et al., "Well-less, gel-permeation formats for ultra-HTS," DDT, 2001, 6(12):S40-S47. |
| Burton et al., "Coverslip Mounted-Immersion Cycled in Situ RT-PCR for the Localization of mRNA in Tissue Sections," Biotechniques, 1998, 24; pp. 92-100. |
| Cai et al., "Glutathione-mediated shedding of PEG layers based on disulfide-linked catiomers for DNA delivery," J. Mater. Chem., Sep. 20, 2011, 21(38):14639-14645. |
| Calvert, "Materials science. Printing cells," Science, Oct. 2007, 318(5848):208-209. |
| Cardona et al., "TrakEM2 0.9a User Manual," Sep. 8, 2011, retrieved on Jul. 29, 2022, retrieved from URL <https://www.ini.uzh.ch/˜acardona/trakem2_manual.html>, 38 pages. |
| Cardullo et al., "Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer," PNAS, Dec. 1, 1988, 85:8790-8794. |
| Carlson et al., "Formylglycine-generating Enzyme," J. of Biological Chemistry, 2008, 283(29):20117-125. |
| Carter et al., "Stabilization of an optical microscope to 0.1 nm in three dimensions," Applied Optics, 2007, 46:421-427. |
| Cerritelli et al., "Ribonuclease H: the enzymes in eukaryotes," FEBS Journal, Mar. 2009, 276(6):1494-505. |
| Cerutti et al., "Generation of sequence-specific, high affinity anti-DNA antibodies," Journal of Biological Chemistry, 2001, 276(16):12769-12773. |
| Cha et al., "Specificity, Efficiency and Fidelity of PCR," Genome Res., 1993, 3:518-29. |
| Chandra et al., "Cell-free synthesis-based protein microarrays and their applications," Proteomics, 2009, 5(6):717-30. |
| Chatterjee et al., "Protein Microarray On-Demand: A Novel Protein Microarray System," PLos One, 2008, 3(9):e3265. |
| Chatterjee, et al., "Mitochondrial DNA mutations in human cancer. Oncogene," 2006, 25(34):4663-4674. |
| Chen et al. "Arrayed profiling of multiple glycans on whole living cell surfaces." Analytical chemistry, Oct. 15, 2013, 85(22):11153-11158. |
| Chen et al., "A Homogeneous, Ligase-mediated DNA diagnostic test," Genome research, 1998, 8(5):549-556. |
| Chen et al., "DNA hybridization detection in a microfluidic Channel using two fluorescently labelled nucleic acid probes," Biosensors and Bioelectronics, 2008, 23:1878-1882. |
| Chen et al., "Fusion protein linkers: Property, design and functionality," Advanced Drug Delivery Reviews, Oct. 15, 2013, 65(10):1357-1369, 32 pages. |
| Chen et al., "Geometric control of cell life and death," Science, May 1997, 276(5317):1425-1428. |
| Chen et al., "Gray-scale photolithography using microfluidic photomasks," PNAS, Feb. 2003, 100(4):1499-1504. |
| Chen et al., "High PLTP activity is associated with depressed left ventricular systolic function," Atherosclerosis, Jun. 2013, 228(2):438-42. |
| Chen et al., "Parallel single nucleotide polymorphism genotyping by surface invasive cleavage with universal detection," Anal Chem., Apr. 2005, 77(8):2400-5. |
| Chen et al., "Spatially resolved, highly multiplexed RNA profiling in single cells", Science 348(6233), 36 pages, 2015. |
| Cheng et al., "Sensitive Detection of Small Molecules by Competitive Immunomagnetic-Proximity Ligation Assay," Anal Chem, 2012, 84:2129-2132. |
| Cheng, "The Contrast Formation in Optical Microscopy," Handbook Of Biological Confocal Microscopy, 2006, Chapter 8, pp. 162-206. |
| Chester et al., "Dimethyl sulfoxide-mediated primer Tm reduction: a method for analyzing the role of renaturation temperature in the polymerase chain reaction," Anal Biochem, Mar. 1993, 209(2):284-90. |
| Chial, "DNA Sequencing Technologies Key to the Human Genome Project," Nature Education, 2008, 1(1):219, 7 pages. |
| Chiang et al., "NFkappaB translocation in human microvessel endothelial cells using a four-compartment subcellular protein redistribution assay," J Biochem Biophys Methods, Nov. 2000, 46(1-2):53-68. |
| Choi et al., "Multiplexed detection of mRNA using porosity-tuned hydrogel microparticles," Analytical chemistry, Sep. 28, 2012, 84(21):9370-9378. |
| Chrisey et al., "Covalent attachment of synthetic DNA to self-assembled monolayer films," Nucleic Acids Res., Aug. 1996, 24(15):3031-9. |
| Chu et al., "SV40 DNA transfection of cells in suspension: analysis of the efficiency of transcription and translation of T-antigen," Gene, Mar. 1981, 13(2): 197-202, 1 page (Abstract Only). |
| Chung et al., "Imaging single-cell signaling dynamics with a deterministic high-density single-cell trap array," Anal Chem, Sep. 2011, 83(18):7044-7052. |
| Chung et al., "Structural and molecular interrogation of intact biological systems," Nature, May 16, 2013, 497:332-337. |
| Ciaccio et al., "Systems analysis of EGF receptor signaling dynamics with microwestern arrays," Nat Methods, Feb. 2010, 7(2):148-55. |
| Cockroft et al., "A single-molecule nanopore device detects DNA polymerase activity with single-nucleotide resolution," J Am Chem Soc., Jan. 2008, 130(3):818-20. |
| Colegio et al., "In vitro transposition system for efficient generation of random mutants of Campylobacter jejuni," J Bacteriol., Apr. 2001, 183(7):2384-8. |
| Condina et al., "A sensitive magnetic bead method for the detection and identification of tyrosine phosphorylation in proteins by Maldi-Tof/Tof Ms," Proteomics, 2009, 9:3047-3057. |
| Constantine et al., "Use of genechip high-density oligonucleotide arrays for gene expression monitoring," Life Sceience News, Amersham Life Science; 11-14, 1998. |
| Cook et al., "The effects of secondary structure and O2 on the formation of direct strand breaks upon UV irradiation of 5-bromodeoxyuridine-containing oligonucleotides," Chem Biol., Jul. 1999, 6(7):451-9. |
| Copeland et al., "Mitochondrial DNA Alterations in Cancer," Cancer Invest., 2002, 557-569. |
| Cornett et al., "Maldi imaging mass spectrometry: molecular snapshots of biochemical systems," Nature Methods, 2007, 4(10):828-833. |
| Cox et al., "Tissue subcellular fractionation and protein extraction for use in mass-spectrometry-based proteomics," Nat Protoc., 2006, 1(4):1872-8. |
| Craig, "Transposon Tn7" Curr Top Microbiol Immunol., 1996, 204:27-48. |
| Craig, "V(D)J recombination and transposition: closer than expected," Science, Mar. 1996, 271(5255):1512, 1 page. |
| Crisalli et al., "Importance of ortho Proton Donors in Catalysis of Hydrazone Formation," Org. Lett., 2013, 15(7):1646-1649. |
| Crisalli et al., "Multi-Path Quenchers: Efficient Quenching of Common Fluorophores," Bioconjug Chem., Oct. 28, 2011, 22(11): 2345-2354. |
| Cujec et al. "Selection of v-abl tyrosine kinase substate sequences from randomnized peptide and cellular proteomic libraries using mRNA display," Chemistry and Biology, 2002, 9:253-264. |
| Curtis et al., "Adhesion of cells to polystyrene surfaces," J Cell Biol., Nov. 1983, 97(5):1500-1506. |
| Czarnik, "Encoding methods for combinatorial chemistry," Curr Opin Chem Biol., Jun. 1997, 1(1):60-6. |
| Dahl et al., "Circle-to-circle amplification for precise and sensitive DNA analysis," Proc. Natl. Acad. Sci., 2004, 101:4548-4553. |
| Daley et al., "Predicting the molecular complexity of sequencing libraries," Nature Methods, Apr. 2013, 10:325-327. |
| Dalma-Weiszhausz et al., "The affymetrix GeneChip platform: an overview," Methods Enzymol., 2006, 410:3-28. |
| Dandapani et al., "Selecting, Acquiring, and Using Small Molecule Libraries for High-Throughput Screening," Curr Protoc Chem Biol., Sep. 2012, 4:177-191. |
| Darmanis, et al., "ProteinSeq: High-Performance Proteomic Analyses by Proximity, Ligation and Next Generation Sequencing," PLos One, 2011, 6(9):e25583. |
| Darnell, Jr., "Reflections on the history of pre-mRNA processing and highlights of current knowledge: A unified picture," RNA, Feb. 2013, 19:443-460, 19 pages. |
| Daubendiek et al., "Rolling-Circle RNA Synthesis: Circular Oligonucleotides as Efficient Substrates for T7 RNA Polymerase," J. Am. Chem. Soc., 1995, 117:77818-7819. |
| Dawson et al., "Genetic animal models of Parkinson's disease," Neuron, Jun. 2010, 66(5):646-661. |
| De Clercq, "A 40-year journey in search of selective antiviral chemotherapy," Annu Rev Pharmacol Toxicol., 2011, 51:1-24. |
| Deamer et al., "Characterization of nucleic acids by nanopore analysis," Acc Chem Res., Oct. 2002, 35(10):817-25. |
| Deamer et al., "Nanopores and nucleic acids: prospects for ultrarapid sequencing," Trends Biotechnol., Apr. 2000, 18(4):147-51. |
| Dean et al., "Comprehensive human genome amplification using multiple displacement amplification," Proc Natl. Acad. Sci. USA 99:5261-66 (2002. |
| Dean et al., "Rapid Amplification Of Plasmid And Phage DNA Using Phi29 DNA Polymerase And Multiply-Primed Rolling Circle Amplification," Genome Research, Jun. 2001, 11:1095-1099. |
| Deibel et al., "Biochemical properties of purified human terminal deoxynucleotidyltransferase," J Biol Chem., May 1980, 255(9):4206-12. |
| Deininger et al., "Allograft inflammatory factor-1 defines a distinct subset of infiltrating macrophages/microglial cells in rat and human gliomas," Acta Neuropathol, Dec. 2000, 100(6):673-680. |
| Deo et al., "Detection of mammalian microRNA expression by in situ hybridization with RNA oligonucleotides," Dev Dyn., Sep. 2006, 235(9):2538-48. |
| Desfarges et al., "Viral Integration and Consequences on Host Gene Expression," Viruses: Essential Agents of Life, Sep. 25, 2012, 147-175. |
| Devine et al., "Efficient integration of artificial transposons into plasmid targets in vitro: a useful tool for DNA mapping, sequencing and genetic analysis," Nucleic Acids Res., Sep. 1994, 22(18):3765-72. |
| Dhindsa et al., "Virtual Electrowetting Channels: Electronic Liquid Transport with Continuous Channel Functionality," Lab Chip, 2010, 10:832-836. |
| Diez-Roux et al., "A high-resolution anatomical atlas of the transcriptome in the mouse embryo," PLoS Biol., Jan. 2011, 9(1):e1000582, 14 pages. |
| Ding et al., "On-chip manipulation of single microparticles, cells, and organisms using surface acoustic waves," PNAS, Jul. 2012, 109(28):11105-11109. |
| Doddridge et al., "UV-induced strand break damage in single stranded bromodeoxyuridine-containing DNA oligonucleotides," Chem Commun., 1998, p. 1997-1998. |
| Dressman et al., "Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations," Proc. Natl. Acad. Sci. USA, 2003, 100:8817-8822. |
| Drmanac et al., "Accurate sequencing by hybridization for DNA diagnostics and individual genomics," Nature Biotechnology, 16:54-58, 1998. |
| Druley et al., "Quantification of rare allelic variants from pooled genomic DNA," Nat. Methods 6: 263-65, 2009. |
| Duhr et al., "Why molecules move along a temperature gradient," Proc Natl Acad Sci USA, Dec. 2006, 103(52):19678-19682. |
| Duncan et al., "Affinity chromatography of a sequence-specific DNA binding protein using teflon-linked oligonucleotides", Anal. Biochem. 169: 104-108, 1988. |
| Dundas et al., "Reference genes for measuring mRNA expression," Theory Biosci., May 17, 2012, 131:215-223. |
| Eagen, "Principles of Chromosome Architecture Revealed by Hi-C", Trends in Biochemical Sciences, vol. 43, No. 6, 10 pages, 2018. |
| Eastburn et al., "Ultrahigh-throughput Mammalian Single Cell Reverse-transcriptase Polymerase Chain Reaction in Microfluiding Drops," Analytical Chemistry, American Chemical Society, Aug. 20, 2013, 85(16):8016-8021. |
| Eberwine et al., "Analysis of gene expression in single live neurons," Proc. Natl. Acad. Sci., USA 89, 3010-3014, 1992. |
| Eberwine, "Amplification of mRNA Populations Using aRNA Generated from Immobi-lized Oligo(dT)-T7 Primed cDNA," BioTechniques 20 (4), 584, 1996. |
| Ebihara et al., "Molecular detection of dermatophytes and nondermatophytes in onychomycosis by nested polymerase chain reaction based on 28S ribosomal RNA gene sequences," Br J Dermatol., Nov. 2009, 161(5):1038-44. |
| Eguiluz et al., "Multitissue array review: A chronological description of tissue array techniques, applications and procedures," Pathology Research and Practice, : 8: 561-568, 2002. |
| Eisenberg et al., "Human housekeeping genes, revisited," Trends in Genetics, Oct. 2013, 29(10):569-574. |
| Ekins et al., "Microarrays: their origins and applications," Trends in Biotechnology, Jun. 1999, 17(6):217-218. |
| Eldridge et al. "An in vitro selection strategy for conferring protease resistance to ligand binding peptides," Protein Eng Des Sel., 22(11): 691-698, 2009. |
| Ellington et al., "Antibody-based protein multiplex platforms: technical and operational challenges," Clin Chem 56(2): 186-193, 2010. |
| Emmert-Buck et al.(Science, 1996. vol. 274, pp. 998-1001) (Year: 1996). * |
| EP Aplication 13780111.4 Office Action of Jul. 7, 2016; 6 pages. |
| Ergin et al., "Proteomic Analysis of PAXgene-Fixed Tissues," J Proteome Res., 2010, 9(10):5188-96. |
| Escholarship.org [online], "Methods and devices for fabricating and assembling DNA and protein arrays for high-throughput analyses [electronic resource]," 2010, retrieved on Jun. 8, 2022, retrieved from URL<https://escholarship.org/uc/item/6tf7p46s>, 155 pages. |
| Espina et al., "Laser-capture microdissection," Nat Protoc, 2006, 1(2):586-603. |
| Evers et al., "The effect of formaldehyde fixation on RNA: optimization of formaldehyde adduct removal," J Mol Diagn., May 2011, 13(3):282-8. |
| Examination Search Report for Canadian Appln. No. 2,794,522, dated Apr. 28, 2015, 3 pages. |
| Examination Search Report issued in Australian Appln. No. 2010278710, dated Feb. 11, 2014, 4 pages. |
| Examination Search Report issued in Australian Appln. No. 2010328226, dated May 9, 2013, 4 pages. |
| Examination Search Report issued in Australian Appln. No. 2011237729, dated Jul. 9, 2013, 3 pages. |
| Examination Search Report issued in Australian Appln. No. 2012241730, dated Jun. 27, 2016, 3 pages. |
| Extended European Search Report in European Appln. No. 18208823.7, dated May 6, 2019, 12 pages. |
| Extended European Search Report in European Appln. No. 21163827.5, dated Sep. 24, 2021, 12 pages. |
| Extended European Search Report issued in European Appln. No. 10836568.5, dated Feb. 13, 2013, 6 pages. |
| Extended European Search Report issued in European Appln. No. 11766613.1, dated Jan. 15, 2014, 4 pages. |
| Extended European Search Report issued in European Appln. No. 12767937, dated Nov. 18, 2014, 5 pages. |
| Extended European Search Report issued in European Appln. No. 14765026.1, dated Sep. 26, 2016, 9 pages. |
| Extended European Search Report issued in European Appln. No. 14816674.7, dated Feb. 3, 2017, 8 pages. |
| Extended European Search Report issued in European Appln. No. 14818012.8, dated Feb. 3, 2017, 8 pages. |
| Extended European Search Report issued in European Appln. No. 16183356.1, dated Apr. 24, 2017, 12 pages. |
| Extended European Search Report issued in European Appln. No. 19204655.5, dated Jun. 8, 2020, 13 pages. |
| Fahy et al., "Design and synthesis of polyacrylamide-based oligonucleotide supports for use in nucleic acid diagnostics," Nucleic Acids Res., Apr. 1993, 21(8):1819-26. |
| Falconnet et al., "Surface engineering approaches to micropattern surfaces for cell-based assays," Biomaterials, Jun. 2006, 27(16):3044-3063. |
| Fan et al., "A versatile assay for high-throughput gene expression profiling on universal array matrices," Genome Research, May 1, 2004, 14(5):878-885. |
| Fan et al., "Highly parallel SNP genotyping," Cold Spring Symp. Quant. Biol., 68: 69-78, 2003. |
| Fan et al., "Illumina Universal Bead Arrays," Methods in Enzymology, 2006, 410:57-73. |
| Fang et al., "Fluoride-cleavable biotinylation phosphoramidite for 5′-end-labeling and affinity purification of synthetic oligonucleotides," Nucleic Acids Res., Jan. 2003, 31(2):708-715. |
| Faruqi et al., "High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification," BMC Genomics, Aug. 2001, 2:4, 10 pages. |
| Ferreira et al., "Photocrosslinkable Polymers for Biomedical Applications," Biomedical Engineering—Frontiers and Challenges, Prof. Reza, 2011, 22 pages. |
| Fire and Xu, "Rolling replication of short DNA circles," Proc. Natl. Acad. Sci., 92: 4641-4645, 1995. |
| Fischer et al., "Hematoxylin and eosin staining of tissue and cell sections," CSH Protoc., May 2008, 3(5):1-3. |
| Flanigon et al., "Multiplex protein detection with DNA readout via mass spectrometry," N. Biotechnol., 30(2): 153-158, 2013. |
| Fodor et al., "Light-Directed, Spatially Addressable Parallel Chemical Synthesis," Science, 251(4995), 767-773, 1995. |
| Folch et al., "Microfabricated elastomeric stencils for micropatterning cell cultures," J Biomed Mater Res. Nov. 2000, 52(2):346-353. |
| Fredriksson et al., "Multiplexed protein detection by proximity ligation for cancer detection," Nature Methods, 4(4): 327-29, 2007. |
| Fredriksson et al., "Multiplexed proximity ligation assays to profile putative plasma biomarkers relevant to pancreatic and ovarian cancer," Clin. Chem., 5(3): 582-89, 2008. |
| Fredriksson et al., "Protein detection using proximity-dependent DNA ligation assays," Nature Biotech., 20: 473-77, 2002. |
| Frese et al., "Formylglycine Aldehyde Tag-Protein Engineering through a Novel Posttranslational Modification," ChemBioChem., 10: 425-27, 2009. |
| Friedman et al., "The synthesis of high yields of full-length reverse transcripts of globin mRNA," Nucleic Acids Res., Oct. 1, 1977, 4(10):3455-3471. |
| Fu et al., "Counting individual DNA molecules by the stochastic attachment of diverse labels," PNAS, 108: 9026-9031, 2011. |
| Fu et al., "Repeat subtraction-mediated sequence capture from a complex genome," Plant J., Jun. 2010. 62(5):898-909. |
| Fullwood et al., "Next-generation DNA sequencing of paired-end tags (PET) for transcriptome and genome analyses," Genome Res., 19: 521-532, 2009. |
| Galon et al., "The immune score as a new possible approach for the classification of cancer," J Transl Med., Jan. 2012, 10:1, 4 pages. |
| Gamper et al., "Gene expression profile of bladder tissue of patients with ulcerative interstitial cystitis," BMC Genomics, Apr. 28, 2009, 10(199):1-17. |
| Gans et al., "Inkjet Printing of Polymers: State of the Art and Future Developments," Advanced Materials, Feb. 2004, 16(3):203-213. |
| Gao et al., "High density peptide microarrays. In situ synthesis and applications," Molecular Diversity, 8, 177-187, 2004. |
| GB1218654.0, filed Oct. 17, 2012, Search Report dated May 29, 2013, 2 pages. |
| Geiss et al., "Direct multiplexed measurement of gene expression with color-coded probe pairs," nature biotechnology, 2008, 26(3):317-325. |
| Genbank Accession No. AC009495.1, "Homo sapiens clone NH0490102, *** Sequencing in Progress *** , 12 unordered pieces," Aug. 24, 1999, 53 pages. |
| Genbank Accession No. AC009495.5, "Homo sapiens BAC clone RP11-49012 from 2, complete sequence," Apr. 21, 2005, 32 pages. |
| Genbank Accession No. AC037198.2, "Homo sapiens chromosome 15 clone CTD-2033D15 map 15q14. *** Sequencing in Progress *** , 62 unordered pieces," Apr. 25, 2000, 39 pages. |
| Genbank Accession No. AC087379.2, "Homo sapiens chromosome 11 clone RP11-396O20 map 11, *** Sequencing in Progress *** , 5 ordered pieces," Jul. 6, 2002, 47 pages. |
| Genbank Accession No. AC087741.1, "Homo sapiens chromosome 17 clone RP11-334C17 map 17, Low-Pass Sequence Sampling," Jan. 22, 2001, 18 pages. |
| Genbank Accession No. AC100826.1, "Homo sapiens chromosome 15 clone RP11-279F6 map 15, Low-Pass Sequence Sampling," Nov. 22, 2001, 21 pages. |
| Genbank Accession No. AL445433.14, "Human DNA sequence from clone RP11-234N17 on chromosome 1, complete sequence," Jan. 24, 2013, 32 pages. |
| Genbank Accession No. AL445524.1, "Homo sapiens chromosome 1 clone RP11-295G20, Working Draft Sequence, 19 unordered pieces," Oct. 14, 2000, 47 pages. |
| Genome.ucsc.edu, [online], "Genome Browser Gateway," 2000, retrieved on Jun. 11, 2021, retrieved from URL<https://genome.ucsc.edu/cgi-bin/hgGateway>, 3 pages. |
| Gerard et al., "Excess dNTPs minimize RNA hydrolysis during reverse transcription," Biotechniques, Nov. 2002, 33(5):984, 986, 988, 990. |
| Giam et al., "Scanning probe-enabled nanocombinatorics define the relationship between fibronectin feature size and stem cell fate," PNAS, Mar. 2012, 109(12):4377-4382. |
| Gibson et al., "Enzymatic assembly of DNA molecules up to several hundred kilobases," Nat Methods., May 2009, 6(5):343-5. |
| Gibson-Corley et al., "Principles for valid histopathologic scoring in research," Vet Pathol., Nov. 2013, 50(6):1007-15. |
| Gilar et al., "Study of phosphorothioate-modified oligonucleotide resistance to 3′-exonuclease using capillary electrophoresis," J Chromatogr B Biomed Sci Appl., Aug. 28, 1998, 714(1):13-20. |
| Gill et al., "Nucleic acid isothermal amplification technologies: a review," Nucleosides Nucleotides Nucleic Acids, Mar. 2008, 27(3):224-43. |
| Gilles et al., "Single nucleotide polymorphic discrimination by an electronic dot blot assay on semiconductor microchips," Nat Biotechnol, Apr. 1999, 17(4):365-70. |
| Glass et al., "Simple: a sequential immunoperoxidase labeling and erasing method," J. Histochem. Cytochem., Oct. 2009, 57(10):899-905. |
| Gloor, "Gene targeting in Drosophila," Methods Mol Biol., 2004, 260:97-114. |
| Glorioso et al., "Development and Application of Herpes Simplex Virus Vectors for Human Gene Therapy," Annu. Rev. Microbiol., 1995; 49:675-710, 1 page (Abstract Only). |
| Gnanapragasam, "Unlocking the molecular archive: the emerging use of formalin-fixed paraffin-embedded tissue for biomarker research in urological cancer," BJU International, 105, 274-278, 2009. |
| Goebl et al., "Development of a sensitive and specific in situ hybridization technique for the cellular localization of antisense oligodeoxynucleotide drugs in tissue sections," Toxicologie Pathology, Jun. 2007, 35(4):541-548. |
| Goldkom and Prockop, "A simple and efficient enzymatic method for covalent attachment of DNA to cellulose. Application for hybridization-restriction analysis and for in vitro synthesis of DNA probes.", Nucleic Acids Res. 14: 9171-9191, 1986. |
| Goldmeyer et al., "Development of a novel one-tube isothermal reverse transcription thermophilic helicase-dependent amplification platform for rapid RNA detection," Journal of Molecular Diagnostics, American Society for Investigative Pathology and the Association for Molecular Pathology, Nov. 1, 2007, 9(5):639-644. |
| Goransson et al., "A single molecule array for digital targeted molecular analyses," Nucleic Acids Res., Nov. 25, 2009, 37(1):e7, 9 pages. |
| Goryshin et al., "Tn5 in vitro transposition," J Biol Chem., Mar. 1998, 273(13):7367-74. |
| Gotz et al., "Animal models of Alzheimer's disease and frontotemporal dementia," Nat Rev Neurosci., Jul. 2008, 9(7):532-44. |
| Graham et al., "A new technique for the assay of infectivity of human adenovirus 5 DNA," Virology, Apr. 1973, 52(2):456-467, 3 pages (Abstract Only). |
| Grant et al., "Pathways and mechanisms of endocytic recycling," Nat. Rev. Mol. Cell Biol., Sep. 2009, 10(9):597-608. |
| Grokhovsky, "Specificity of DNA cleavage by ultrasound," Molecular Biology, 2006, 40(2):276-283. |
| Grünweller et al., "Locked Nucleic Acid Oligonucleotides," BioDrugs, Jul. 2007, 21(4): 235-243. |
| Gu et al., "Multiplex single-molecule interaction profiling of DNA-barcoded proteins," Nature, Sep. 21, 2014, 515:554-557. |
| Gu et al., "Protein tag-mediated conjugation of oligonucleotides to recombinant affinity binders for proximity ligation," N Biotechnol., 30(2): 144-152, 2013. |
| Gudjonsson et al., "Myoepithelial cells: their origin and function in breast morphogenesis and neoplasia," J Mammary Gland Biol Neoplasia, Jul. 2005, 10(3):261-72. |
| Gunderson et al., "Decoding Randomly Ordered DNA Arrays," Genome Research 14: 870-877, 2004. |
| Guo et al., "Direct fluorescence analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass supports," Nucleic Acids Res., Dec. 1994, 22(24):5456-65. |
| Ha et al., "Self-assembly hollow nanosphere for enzyme encapsulation," Soft Matter, Feb. 11, 2010, 6, 1405-1408, 10 pages. |
| Hadrup et al., "Parallel detection of antigen-specific T-cell responses by multidimensional encoding of MHC multimers," Nat. Methods., Jul. 2009, 6(7), 520-526. |
| Hafner et al., "Identification of microRNAs and other small regulatory RNAs using cDNA library sequencing," Methods, Jan. 2008, 44(1):3-12. |
| Hahnke et al., "Striptease on glass: validation of an improved stripping procedure for in situ microarrays," J Biotechnol., Jan. 2007, 128(1): 1-13. |
| Hajduk et al., "Drug discovery: A question of library design," Nature, Feb. 2011, 470(7332):42-43. |
| Halova et al., "Mast cell chemotaxis—chemoattractants and signaling pathways," Front Immunol., May 2012, 3:119, 20 pages. |
| Hamaguchi et al., "Direct reverse transcription-PCR on oligo(dT)-immobilized polypropylene microplates after capturing total mRNA from crude cell lysates," Clin Chem., Nov. 1998, 44(11):2256-63. |
| Hammond et al., "Profiling cellular protein complexes by proximity ligation with dual tag microarray readout," 7(7): e40405, 2012. |
| Hanauer et al., "Separation of nanoparticles by gel electrophoresis according to size and shape," Nano Lett., Sep. 2007, 7(9):2881-5. |
| Hardenbol et al., "Highly multiplexed molecular inversion probe genotyping: over 10,000 targeted SNPs genotyped in a single tube assay," Genome Res., Feb. 2005, 15(2):269-75. |
| Hardenbol et al., "Multiplexed genotyping with sequence-tagged molecular inversion probes," Nature Biotechnol., Jun. 2003, 21(6):673-678. |
| Harris et al., "Chloroplast ribosomes and protein synthesis," Microbiol. Mol. Biol. Rev., Dec. 1, 1994, 58(4): 700-754. |
| Harris et al., "The design and application of target-focused compound libraries," Comb Chem High Throughput Screen, Jul. 2011, 14(6):521-531. |
| Harrow et al., "Gencode: The reference human genome annotation for The Encode Project," Genome Res., Sep. 2012, 22(9):1760-1774. |
| Hattersley et al., "Development of a microfluidic device for the maintenance and interrogation of viable tissue biopsies," Lab Chip., Nov. 2008, 8(11):1842-6. |
| Hayes et al., "Electrophoresis of proteins and nucleic acids: I-Theory," BMJ, Sep. 1989, 299(6703):843-6. |
| He et al., "In situ synthesis of protein arrays," Current Opinion in Biotechnology, 19: 4-9, 2008. |
| He et al., "Printing protein arrays from DNA arrays," Nature Methods, 5: 175-77, 2008. |
| He, "Cell-free protein synthesis: applications in proteomics and biotechnology," New Biotechnology 25: 126-132, 2008. |
| Healy, "Nanopore-based single-molecule DNA analysis," Nanomedicine (Lond), Aug. 2007, 2(4):459-81. |
| Hedskog et al., "Dynamics of HIV-1 Quasispecies during Antiviral Treatment Dissected using Ultra-Deep Pyrosequencing," PLoS One, 5(7): e11345, 2010. |
| Hein et al., "Click Chemistry, A Powerful Tool for Pharmaceutical Sciences", Pharm Res., 25(10): 2216-2230, 2008. |
| Hejatko et al., "In Situ Hybridization Techniques for mRNA Detection in Whole Mount Arabidopsis Samples," Nature Protocols, 2006, 1(4):1939-1946. |
| Hendrickson et al., "High sensitivity multianalyte immunoassay using covalent DNA-labeled antibodies and polymerase chain reaction," Nucleic Acid Research, Feb. 11, 1995, 23(3):522-529. |
| Hessner et al., "Genotyping of factor V G1691A (Leiden) without the use of PCR by invasive cleavage of oligonucleotide probes," Clin Chem., Aug. 2000, 46(8 Pt 1): 1051-6. |
| Hiatt et al., "Parallel, tag-directed assembly of locally-derived short sequence reads," Nature Methods, 7(2): 119-25, 2010. |
| Hlubek et al. Heterogeneous expression of Wnt/b-catenin target genes within colorectal cancer, 2007. Int. J. Cancer: 2017, 1941-1948. |
| Hlubek et al., "Heterogeneous expression of Wnt/beta-catenin target genes within colorectal cancer," Int J Cancer., Nov. 2007, 121(9):1941-8. |
| Ho et al., "Bacteriophage T4 RNA ligase 2 (gp24.1) exemplifies a family of RNA ligases found in all phylogenetic domains," PNAS, Oct. 2002, 99(20):12709-14. |
| Ho et al., "Characterization of an ATP-Dependent DNA Ligase Encoded by Chlorella Virus PBCV-1," Journal of Virology, Mar. 1997, 71(3): 1931-1937. |
| Hober et al., "Human protein atlas and the use of microarray technologies," Curr Opin Biotechnol., Feb. 2008, 19(1):30-35. |
| Holmstrøm et al., "A highly sensitive and fast nonradioactive method for detection of polymerase chain reaction products," Anal Biochem, Mar. 1993, 209(2):278-83. |
| Holscher et al., "Application of Laser-Assisted Microdissection for Tissue and Cell-Specific Analysis of RNA," Progress in Botany, Jan. 2008, 69(3):141-167. |
| Howell et al., "iFRET: An Improved Fluorescence System for DNA-Melting Analysis," Genome Research, 2002, 12:1401-1407. |
| Hoyer et al., "Electrostatic spraying: a novel technique for preparation of polymer coatings on electrodes," Anal Chem, Nov. 1996, 68(21):3840-4. |
| Hsuih et al., "Novel, Ligation-Dependent PCR Assay for Detection of Hepatitis C Virus in Serum," Journal of Clinical Microbiology, Mar. 1996, 34(3):501-507. |
| Hu et al., "High reproducibility using sodium hydroxide-stripped long oligonucleotide DNA microarrays." Biotechniques, Jan. 2005, 38(1): 121-4. |
| Hughes et al., "Microfluidic Western blotting," PNAS, Dec. 2012, 109(52):21450-21455. |
| Hycultbiotech.com, [online], "Immunohistochemistry, Paraffin" Apr. 2010, retrieved on Apr. 16, 2020, retrieved from URL<https://www.hycultbiotech.com/media/wysiwyg/Protocol_Immunohistochemistry_Paraffin_2.pdf>, 3 pages. |
| Hytönen et al., "Design and construction of highly stable, protease-resistant chimeric avidins," J Biol Chem., Mar. 2005, 280(11):10228-33. |
| Ichikawa et al., "In vitro transposition of transposon Tn3," J Biol. Chem., Nov. 1990, 265(31):18829-32, Abstract. |
| Illumina.com [online], "Array-Based Gene Expression Analysis," 2011, retrieved on Dec. 13, 2021, retrieved from URL<https://www.illumina.com/documents/products/datasheets/datasheet_gene_exp_analysis.pdf>, 5 pages. |
| Im et al., "An Introduction to Performing Immunofluorescence Staining," Biobanking: Methods and Protocols, Method in Molecular Biology, Yong (ed.), 2019, 1897, Chapter 26, 299-311. |
| Imbeaud et al., "Towards standardization of RNA quality assessment using user-independent classifiers of microcapillary electrophoresis traces," Nucleic Acids Res., Mar. 2005, 33(6):e56, 12 pages. |
| Inoue and Wittbrodt, "One for All—A Highly Efficient and Versatile Method for Fluorescent Immunostaining in Fish Embryos," PLoS One 6, e19713, 2011. |
| International Search Report and Written Opinion; International Application No. PCT/EP2013/071645; International Filing Date Oct. 16, 2013; Date of Mailing Dec. 11, 2013; 12 pages. |
| Invitrogen, Immune Response Biomarker Profiling Service Report, Invitrogen, 2009, 1-33. |
| Jabara et al., Accurate sampling and deep sequencing of the HIV-1 protease gene using a Primer ID. PNAS 108(50); 20166-20171, 2011. |
| Jain, "Transport of molecules, particles, and cells in solid tumors," Annu. Rev. Biomed. Eng., 1999, 1:241-263. |
| Jamur and Oliver, "Permeabilization of cell membranes.," Method Mal. Biol., 588: 63-66, 2010. |
| Jawhar et al., "Tissue Microarray: A rapidly evolving diagnostic and research tool," Annals of Saudi Medicine, Mar. 2009, 29(2):123-7. |
| Jeffers, "A Basic Subroutine for Geary's Contiguity Ratio," J. Royal Stat. Society, Series D, Dec. 1973, 22(4):299-302. |
| Jennane et al., "Photolithography of self-assembled monolayers: optimization of protecting groups by an electroanalytical method," Can. J Chem., Dec. 1996, 74(12):2509-2517. |
| Jensen et al., "Zinc fixation preserves flow cytometry scatter and fluorescence parameters and allows simultaneous analysis of DNA content and synthesis, and intracellular and surface epitopes," Cytometry A., Aug. 2010, 77(8):798-804. |
| Jones et al., Comparative lesion sequencing provides insights into tumor evolution. Proc. Natl. Acad. Sci. USA 105(11): 4283-4288, 2008. |
| Joos et al., "Covalent attachment of hybridizable oligonucleotides to glass supports," Anal Biochem., Apr. 1997, 247(1):96-101. |
| Ju et al., "Supramolecular dendrimer capsules by cooperative binding," Chem. Commun., Jan. 7, 2011, 47(1):268-270, 8 pages. |
| Jucá et al., "Effect of dimethyl sulfoxide on reverse transcriptase activity," Braz. J. Med. Biol. Res., Mar. 1995, 28(3):285-90. |
| Kainkaryam et al., "Pooling in high-throughput drug screening" Curr Opin Drug Discov Devel., May 2009, 12(3):339-50. |
| Kandoth et al., "Mutational landscape and significance across 12 major cancer types," Nature, Oct. 2013, 502(7471):333-339, 20 pages. |
| Kanehisa, "Use of statistical criteria for screening potential homologies in nucleic acid sequences", Nucleic Acids Res. 12: 203-213, 1984. |
| Kap et al., "Histological Assessment of PAXgene Tissue Fixation and Stabilization Reagents," PLoS One 6, e27704, 10 pages, 2011. |
| Kapteyn et al., "Incorporation of Non-Natural Nucleotides Into Template-Switching Oligonucleotides Reduces Background and Improves cDNA Synthesis From Very Small RNA Samples," BMC Genomics, 2010, 11(413): 1-9. |
| Karlin et al., "Applications and statistics for multiple high-scoring segments in molecular sequences," Proc. Natl. Acad. Sci., Jun. 15, 1993, 90:5873-7. |
| Ke et al., "In situ sequencing for RNA analysis in preserved tissue and cells," Nat Methods., Sep. 2013, 10(9):857-60. |
| Ke et al., "In situ sequencing for RNA analysis in preserved tissue and cells," Nat Methods., Sep. 2013, Supplementary Materials, 29 pages. |
| Kelleher et al., "Characterization of RNA Strand Displacement Synthesis by Moloney Murine Leukemia Virus Reverse Transcriptase," J Biol Chem, Apr. 1998, 273(16):9976-86. |
| Kibbe, "OligoCalc: an online oligonucleotide properties calculator," Nucleic Acids Res., Jul. 2007, 35:W43-6. |
| Kim, "Development of Microdevices for Applications to Bioanalysis," Dissertation for the degree of Doctor of Philosophy, University of Texas at Austin, Aug. 2007, 176 pages. |
| Kirby et al., "Cryptic plasmids of Mycobacterium avium: Tn552 to the rescue," Mol Microbiol., Jan. 2002, 43(1):173-86. |
| Kleckner et al., "Tn10 and IS10 transposition and chromosome rearrangements: mechanism and regulation in vivo and in vitro," Curr Top Microbiol Immunol., 1996, 204:49-82. |
| Koch et al., "Photochemical immobilization of anthraquinone conjugated oligonucleotides and PCR amplicons on solid surfaces," Bioconjugate Chem., Jul. 2000, 11(4):474-483. |
| Kokkat et al., "Archived formalin-fixed paraffin-embedded (FFPE) blocks: A valuable underexploited resource for extraction of DNA, RNA, and protein," Apr. 2013, 11(2):101-6. |
| Kolb et al., "Click Chemistry: Diverse Chemical Function from a Few Good Reactions.", Angew. Chem. Int. Ed., 40(11): 2004-2021, 2001. |
| Kolbert et al., "Ribosomal DNA sequencing as a tool for identification of bacterial pathogens," Curr Opin Microbiol, Jun. 1999, 2(3):299-305. |
| König et al., "iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution," Nat Struct Mol Biol., Jul. 2010, 17(7):909-915. |
| Korbel et al., "Paired-End Mapping Reveals Extensive Structural Variation in the Human Genome," Science, 318(5849): 420-426, 2007. |
| Korlach et al., "Selective aluminum passivation for targeted immobilization of single DNA polymerase molecules in zero-mode waveguide nanostructures," Proc. Natl. Acad. Sci. USA 105, 1176-1181, 2008. |
| Kozlov et al., "A High-Complexity Multiplexed Solution-Phase Assay for Profiling Protease Activity on Microarrays," Comb. Chem. And Hiah Throuahout, 11: 24-35, 2008. |
| Kozlov et al., "A Highly Scalable Peptide-Based Assay System for Proteomics," Plos One, 7(6): e37441, 2012. |
| Kozlov et al., "A Method for Rapid Protease Substrate Evaluation and Optimization," Comb. Chem. and Hiah Throuahout, 9: 481-87, 2006. |
| Kristensen et al., "High-Throughput Methods for Detection of Genetic Variation," BioTechniques, Feb. 2001, 30(2):318-332. |
| Kuijpers et al. "Specific recognition of antibody-oligonucleotide conjugates by radiolabeled antisense nucleotides: a novel approach for two-step radioimmunotherapy of cancer." Bioconjugate Chem., Jan. 1, 1993, 4(1):94-102. |
| Kuiper et al., "Enzymes containing porous polymersomes as nano reaction vessels for cascade reactions," Org. Biomol, Chem, Oct. 15, 2008, 6(23):4315-4318. |
| Kumar et al., "Template-directed oligonucleotide strand ligation, covalent intramolecular DNA circularization and catenation using click chemistry," J Am Chem Soc., May 2007, 129(21):6859-64. |
| Kung et al., "Long Noncoding RNAs: Past, Present, and Future," Genetics, Mar. 1, 2013, 193(3):651-669. |
| Kurtulus, "Assessment of CD4(+) and CD8 (+) T cell responses using MHC class I and II tetramers," Methods Mol Biol, 2013, 979:71-79, 10 pages. |
| Kurz et al., "eDNA-Protein Fusions: Covalent Protein-Gene Conjugates for the In Vitro Selection of Peptides and Proteins," ChemBioChem., 2: 666-72, 2001. |
| Kwok, "High-throughput genotyping assay approaches," Pharmocogenomics, Feb. 2000, 1(1):95-100. |
| Kwon et al., Polyelectrolyte Gels—Fundamentals and Applications, Nov. 10, 2006, Polymer Journal, 38, pp. 1211-1219. |
| Kwon, "Single-molecule fluorescence in situ hybridization: Quantitative imaging of single RNA molecules," Department of Biomedical Engineering, Oregon Health & Science University, Feb. 2013, 46:65-72. |
| LaFerla et al., "Animal models of Alzheimer disease," Cold Spring Harb Perspect Med., Nov. 2012, 2(11):a006320, 14 pages. |
| Lage et al., "Whole Genome Analysis of Genetic Alterations in Small DNA Samples Using Hyperbranched Strand Displacement Amplification and Array—CGH," Genome Research 13: 294-307, 2003. |
| Lakhin et al., "Aptamers: problems, solutions and prospects," Acta Naturae, Oct. 2013, 5(4):34-43. |
| Lampe et al., "A purified mariner transposase is sufficient to mediate transposition in vitro," Embo J., Oct. 1996, 15(19):5470-9. |
| Lamture et al., "Direct detection of nucleic acid hybridization on the surface of a charge coupled device," Nucleic Acid Res., Jun. 1994, 22(11):2121-5. |
| Landegren et al., "A Ligase-Mediated Gene Detection Technique," Science, 1988, 241(4869):1077-1080. |
| Landegren et al., "Reading bits of genetic information: methods for single-nucleotide polymorphism analysis," Genome Res., Aug. 1998, 8(8):769-76. |
| Langdale et al., "A rapid method of gene detection using DNA bound to Sephacryl", Gene 36: 201-210, 1985. |
| Larman et al., "Autoantigen discovery with a synthetic human peptidome," Nature Biotechnology, doi:10.1038/nbt.1856, vol. 29, No. 6, pp. 535-541, 2011. |
| Larsen et al., "Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp," Febs J., Jan. 2006, 273(1):47-60. |
| Larsson et al., "In situ detection and genotyping of individual mRNA molecules," Nat Methods, May 2010, 7(5):395-7. |
| Larsson et al., "In situ genotyping individual DNA molecules by target-primed rolling-circle amplification of padlock probes," Nat Methods, Dec. 2004, 1(3):227-32. |
| Lassmann et al., A Novel Approach For Reliable Microarray Analysis of Microdissected Tumor Cells From Formalin-Fixed and Paraffin-Embedded Colorectal Cancer Resection Specimens, J Mol Med, 87, 211-224, 2009. |
| Laurell et al., "Chip integrated strategies for acoustic separation and manipulation of cells and particles," Chem. Soc. Rev., Mar. 2007, 36(3):492-506. |
| Le Reste et al., "Characterization of dark quencher chromophores as nonfluorescent acceptors for single-molecule FRET," Biophysical Journal, Jun. 2012, 102(11):2658-2668. |
| Lee et al., "A novel COL3A1 gene mutation in patient with aortic dissected aneurysm and cervical artery dissections," Heart Vessels, Mar. 2008, 23(2):144-8. |
| Lee et al., "Cytokines in cancer immunotherapy," Cancers (Basel), Oct. 2011, 3(4):3856-3893. |
| Lee et al., "Improving the efficiency of genomic loci capture using oligonucleotide arrays for high throughput resequencing," BMC Genomics, Dec. 2009, 10:646, 12 pages. |
| Lee et al., "Protein nanoarrays generated by dip-pen nanolithography," Science, Mar. 2002, 295(5560):1702-1705. |
| Lenard, "Viral Membranes," Encyclopedia of Virology, Jul. 2008, pp. 308-314. |
| Leriche et al., "Cleavable linkers in chemical biology.", Bioorganic & Medicinal Chemistry, 20: 571-582, 2012. |
| Levene et al., "Zero-Mode Waveguides for Single-Molecule Analysis at High Concentrations," Science 299, 682-686, 2003. |
| Li et al., "A photocleavable fluorescent nucleotide for DNA sequencing and analysis," Proc. Natl. Acad. Sci., 100: 414-419, 2003. |
| Li et al., "Beyond Moran's I: Testing for Spatial Dependence Based on the Spatial Autoregressive Model," Geographical Analysis, Sep. 18, 2007, 39(4):357-375. |
| Li et al., "DNA molecules and configurations in a solid-state nanopore microscope," Nat Mater., Sep. 2003, 2(9):611-5. |
| Li et al., "RASL-seq for Massively Parallel and Quantitative Analysis of Gene Expression," Curr Protoc Mol Biol., Apr. 2012, 4(13):1-10. |
| Lin et al., "Microfluidic cell trap array for controlled positioning of single cells on adhesive micropatterns," Lab Chip, Feb. 2013, 13(4):714-721. |
| Lin et al., "Replication of DNA microarrays from zip code masters," J. Am. Chem. Soc., 2006, 128(10):3268-3272. |
| Linnarsson, "Recent advances in DNA sequencing methods—general principles of sample preparation," Experimental Cell Research, 316: 1339-1343, 2010. |
| Liu et al. "Barcoded oligonucleotides ligated on RNA amplified for multiplexed and parallel in situ analyses," Nucleic Acids Res., Mar. 8, 2021, 49(10):e58, 15 pages. |
| Liu et al., "Method for Quantitative Proteomics Research by Using Metal Element Chelated Tags Coupled with Mass Spectrometry," Analytical Chemistry, 2006, 78:6614-6621. |
| Liu et al., "Preparation and Characterization of Temperature-Sensitive Poly(N-isopropylacrylamide)-b-poly(d,1-lactide) Microspheres for Protein Delivery," Biomacromolecules, 2003, 4(6):1784-1793. |
| Liu et al., "Surface and interface control on photochemically initiated immobilization," J Am Chem Soc., Nov. 2006, 128(43):14067-72. |
| Liu et al., An integrated and sensitive detection platform for biosensing application based on Fe@Au magnetic nanoparticles as bead array carries Biosensors and Bioelectronics, 2010, 26(4): 1442-1448. |
| Lizardi et al., "Mutation detection and single-molecule counting using isothermal rolling-circle amplification," Nat. Genet. 19: 225-232, 1998. |
| Lopez-Otín et al., "Protease degradomics: a new challenge for proteomics," Nat Rev Mol Cell Biol., Jul. 2002, 3(7):509-19. |
| Lu et al., "A microfluidic electroporation device for cell lysis," Lab Chip., Jan. 2005, 5(1):23-29. |
| Lubeck et al., "Single cell systems biology by super-resolution imaging and combinatorial labeling," Nature Methods, Jan. 2013, 9(7):743-748, 18 pages. |
| Lund et al., "Assessment of methods for covalent binding of nucleic acids to magnetic beads, Dynabeads, and the characteristics of the bound nucleic acids in hybridization reactions.", Nucleic Acids Res., 16: 10861-80, 1988. |
| Lundberg et al., "High-fidelity amplification using a thermostable DNA polymerase isolated from Pyrococcus furiosus.," Gene., 108(1): 1-6, 1991. |
| Lundberg et al., "Homogeneous antibody-based proximity extension assays provide sensitive and specific detection of low-abundant proteins in human blood," Nucleic Acids Res., 39(15): e102, 2011. |
| Lundberg et al., "Multiplexed homogeneous proximity ligation assays for high-throughput protein biomarker research in serological material, " Mol Cell Proteomics, 10(4): M110.004978, 2011. |
| Lundin et al., "Increased throughput by parallelization of library preparation for massive sequencing," PLoS One, Apr. 2010, 5(4): e10029, 7 pages. |
| Lundquist et al., "Parallel confocal detection of single molecules in real time," Opt. Lett. 33, 1026-1028, 2008. |
| Lyamichev et al., "Invader assay for SNP genotyping," Methods Mol Biol., 2003, 212:229-40. |
| Lyamichev et al., "Polymorphism identification and quantitative detection of genomic DNA by invasive cleavage of oligonucleotide probes," Nat Biotechnol., Mar. 1999, 17(3):292-6. |
| Lyck, et al., "Immunohistochemical Markers for Quantitative Studies of Neurons and Glia in Human Neocortex," J Histochem Cytochem 56, 201-21, 2008. |
| Lykidis et al., "Novel zinc-based fixative for high quality DNA, RNA and protein analysis," Nucleic Acids Res., Jun. 2007, 35(12):e85, 10 pages. |
| Ma et al., "Isothermal amplification method for next-generation sequencing," PNAS, Aug. 12, 2013, 110(35):14320-14323. |
| Mabruk et al., "In situ hybridization: detecting viral nucleic acid in formalin-fixed, paraffin-embedded tissue samples," Expert Rev. Mol. Diagn., 2004, 4(5):653-661. |
| MacBeath et al., "Printing proteins as microarrays for high-throughput function determination," Science, Sep. 2000, 289(5485):1760-1763. |
| MacIntyre, "Unmasking antigens for immunohistochemistry.," Br J Biomed Sci. 58, 190-6, 2001. |
| Magaki et al., "An introduction to Performance of Immunohistochemistry," Biobanking: Methods and Protocols, Method in Molecular Biology, Yong (ed.), 2019, 1897, Chapter 25, 289-298. |
| Makaryus et al., "Coronary venous angioplasty and stenting for biventricular pacemaker left ventricular lead implantation," Journal of Invasive Cardiology, 2008, 19(5), 3 pages. |
| Malkov et al., "Multiplexed measurements of gene signatures in different analytes using the Nanostring nCounter™ Assay System." BMC research notes., 2009, 2:80. |
| Manz et al., "Phylogenetic Composition, Spatial Structure, and Dynamics of Lotic Bacterial Biofilms Investigated by Fluorescent in situ Hybridization and Confocal Laser Scanning Microscopy," Microb Ecol, May 1999, 37(4):225-237. |
| Marras, "Selection of fluorophore and quencher pairs for fluorescent nucleic acid hybridization probes," Methods Mol Biol., 2006, 335:3-16. |
| Martin, "Cutadapt removes adapter sequences from high-throughput sequencing reads," EMBnet Journal, 2011, 17(1):10-12. |
| Massey et al., "Fluorescence resonance energy transfer (FRET) for DNA biosensors: FRET pairs and Förster distances for various dye-DNA conjugates," Anal Chim Acta., May 2006, 568(1-2):181-9. |
| Masuda et al., "Analysis of chemical modification of RNA from formalin-fixed samples and optimization of molecular biology applications for such samples," Nucleic Acids Research, Nov. 1999, 27(22):4436-4443. |
| Materna et al., "High accuracy, high-resolution prevalence measurement for the majority of locally expressed regulatory genes in early sea urchin development," Gene Expr Patterns., 2010, 10(4-5):177-184. |
| Mattheyses et al., "Imaging with total internal reflection fluorescence microscopy for the cell biologist," J Cell Sci., Nov. 2010, 123(Pt 21):3621-3628. |
| Mauleon et al., "Precise Spatial and Temporal Control of Oxygen within In Vitro Brain Slices via Microfluidic Gas Channels," PLoS One, Aug. 2012, 7(8):e43309, 9 pages. |
| McCloskey et al., "Encoding PCR Products with Batch-stamps and Barcodes.," Biochem. Genet. 45: 761-767, 2007. |
| Mcgee, "Structure and Analysis of Affymetrix Arrays," UTSW Microarray Analysis Course, Oct. 28, 2005. |
| McKernan et al., "Sequence and structural variation in a human genome uncovered by short-read, massively parallel ligation sequencing using two-base encoding," Genome Res., 19: 1527-41, 2009. |
| Megason et al., "Imaging in Systems Biology," Cell 130, Sep. 7, 2007, pp. 784-795. |
| Metzker "Sequencing technologies—the next generation," Nature Reviews Genetics, 11: 31-46, 2010. |
| Meyer et al., "Fast evolving 18S rRNA sequences from Solenogastres (Mollusca) resist standard PCR amplification and give new insights into mollusk substitution rate heterogeneity," BMC Evol. Biol., Mar. 2010, 10:70, 12 pages. |
| Micke et al., "Biobanking of fresh frozen tissue: RNA is stable in nonfixed surgical specimens," Lab Invest., Feb. 2006, 86(2):202-11. |
| Miele et al., "Mapping cis- and trans-chromatin interaction networks using chromosome conformation capture (3C)," Methods Mol Biol., 2009, 464:105-21. |
| Miller et al., "Basic Concepts of Microarrays and Potential Applications in Clinical Microbiology," Clinical Microbiology Reviews, vol. 22, No. 4, pp. 611-633, 2009. |
| Miller et al., "Rapid and Efficient Enzyme Encapsulation in a Dendrimer Silica Nanocomposite," Macromolecular Bioscience, Oct. 25, 2006, 6(10):839-845. |
| Miner et al., "Molecular barcodes detect redundancy and contamination in hairpin-bisulfite PCR," Nucleic Acids Res., Sep. 2004, 32(17):e135, 4 pages. |
| Mir et al., "Sequencing by cyclic ligation and cleavage (CycliC) directly on a microarray captured template," Nucleic Acids Research, 37(1 ): e5-1, 2009. |
| Mitra et al., "Digital genotyping and haplotyping with polymerase colonies," Proc. Natl. Acad. Sci. USA, May 2003, 100(10):5926-5931. |
| Mitra et al., "Fluorescent in situ sequencing on polymerase colonies," Anal Biochem, Sep. 2003, 320(1):55-65. |
| Mitra et al., "In situ localized amplification and contact replication of many individual DNA molecules," Nucleic Acids Res., Dec. 1999, 27(24):e34, 6 pages. |
| Mitsuhashi et al., "Gene manipulation on plastic plates," Nature 357: 519-520, 1992. |
| Mizusawa et al., "A bacteriophage lambda vector for cloning with BamHI and Sau3A," Gene, 20: 317-322, 1982. |
| Mlecinik et al., "Histopathologic-based prognostic factors of colorectal cancers are associated with the state of the local immune reaction," J Clin Oncol., Feb. 2011, 29(6):610-8. |
| Morlan et al., "Selective depletion of rRNA enables whole transcriptome profiling of archival fixed tissue," PLoS One, Aug. 2012, 7(8): e42882, 8 pages. |
| Mortazavi et al., "Mapping and quantifying mammalian transcriptomes by RNA-Seq," Nature Methods, 5(7): 621-8, 2008. |
| Moshrefzadeh et al., "Nonuniform photobleaching of dyed polymers for optical waveguides," Applied Physics Letters, 1993, 62:16-18. |
| Motea et al., "Terminal deoxynucleotidyl transferase: the story of a misguided DNA polymerase," Biochim Biophys Acta., May 2010, 1804(5):1151-66. |
| Mueller et al., "RNA Integrity Number (RIN)—Standardization of RNA Quality Control," Agilent Technologies, 2004, 8 pages. |
| Nadji et al., "Immunohistochemistry of tissue prepared by a molecular-friendly fixation and processing system," Appl Immunohistochem Mol Morphol., Sep. 2005, 13(3):277-82. |
| Nagahara et al., "Neuroprotective effects of brain-derived neurotrophic factor in rodent and primate models of Alzheimer's disease," Nat Med., Mar. 2009, 15(3):331-337. |
| Nagai et al., "Site-specific DNA cleavage by antisense oligonucleotides covalently linked to phenazine di-N-oxide," J Biol. Chem., Dec. 1991, 266(35):23994-4002. |
| Nakamura et al., "Biocompatible inkjet printing technique for designed seeding of individual living cells," Tissue Eng, Nov. 2005, 11(11-12):1658-1666. |
| Nakao et al., "Myosin heavy chain gene expression in human heart failure," J Clin Invest., Nov. 1997, 100(9):2362-70. |
| Nallur et al., "Signal amplification by rolling circle amplification on DNA microarrays," Nucleic Acids Res., Dec. 1, 2001, 29(23):e118, 9 pages. |
| Nam et al., "Nanoparticle-Based Bio-Bar Codes for the Ultrasensitive Detection of Proteins," Science, Sep. 26, 2003, 301(5641): 1884-1886. |
| Nandakumar et al., "How an RNA Ligase Discriminates RNA versus DNA Damage," Molecular Cell, 2004, 16(2):211-221. |
| Nandakumar et al., "RNA Substrate Specificity and Structure-guided Mutational Analysis of Bacteriophage T4 RNA Ligase 2," Journal of Biological Chemistry, Jul. 2004, 279(30):31337-31347. |
| Ng et al., "Gene identification signature (GIS) analysis for transcriptome characterization and genome annotation," Nature Methods, 2(2): 105-111, 2005. |
| Ng et al., "Massively parallel sequencing and rare disease," Human Malec. Genetics, 19(2): R119-R124, 2010. |
| Ng et al., "Multiplex sequencing of paired-end ditags (MS-PET): a strategy for the ultra-high-throughput analysis of transcriptomes and genomes," Nucleic Acids Research, Jul. 2006, 34(12): e84, 10 pages. |
| Nichols et al., "RNA Ligases," Curr Protoc Mol Biol., Oct. 2008, 84(1):3.15.1-3.15.4. |
| Nicholson, "Diffusion and related transport mechanisms in brain tissue," Rep. Prog. Phys., Jun. 2001, 64(7):815-884. |
| Niedringhaus et al., "Landscape of next-generation sequencing technologies," Anal Chem., Jun. 2011, 83(12):4327-41. |
| Niemeyer, "The developments of semisynthetic DNA-protein conjugates," TrendsBiotechnol, Sep. 2002, 20(9): 395-401. |
| Nikiforov et al., "The use of 96-well polystyrene plates for DNA hybridization-based assays: an evaluation of different approaches to oligonucleotide immobilization," Anal Biochem, May 1995, 227(1):201-9. |
| Niklas et al., "Selective permeabilization for the high-throughput measurement of compartmented enzyme activities in mammalian cells," Anal Biochem, Sep. 2011, 416(2):218-27. |
| Nilsson et al., "Padlock Probes: Circularizing Oligonucleotides for Localized DNA Detection," Science, Sep. 30, 1994, 265(5181):2085-2088. |
| Nilsson et al., "RNA-templated DNA ligation for transcript analysis," Nucleic Acids Res., Jan. 2001, 29(2):578-81. |
| Nuovo, "In situ detection of microRNAs in paraffin embedded, formalin fixed tissues and the co-localization of their putative targets," Methods, 2010, 52(4):307-315. |
| Nuovo, "In situ PCR: protocols and applications.," Genome Res, Feb. 1995, 4 (4):151-167. |
| Ohtsubo et al., "Bacterial insertion sequences," Curr Top Microbiol Immunol., 1996, 204:1-26. |
| Oleinikov et al., "Self-assembling protein arrays using electronic semiconductor microchips and in vitro translation," J Proteome Res, May-Jun. 2003, 2(3): 313-319. |
| Olivier, "The Invader assay for SNP genotyping," Mutat. Res., Jun. 2005, 573(1-2):103-110. |
| Oren et al., "Selective lysis of bacteria but not mammalian cells by diastereomers of melittin: structure-function study," Biochemistry, Feb. 1997, 36(7):1826-35. |
| Osada et al., "Epitope mapping using ribosome display in a resconstituted cell-free protein synthesis system," J Biochem, May 2009, 145(5): 693-700. |
| O-Shannessy et al., "Detection and quantitation of hexa-histidine-tagged recombinant proteins on western blots and by a surface plasmon resonance biosensor technique," Anal Biochem, 229(1): 119-124, 1995. |
| Ostuni et al., "Patterning Mammalian Cells Using Elastomeric Membranes," Langmuir, Aug. 2000, 16(20):7811-7819. |
| Ozsolak et al., "Digital transcriptome profiling from attomole-level RNA samples," Genome Res., Apr. 2010, 20(4):519-25. |
| Palamanda et al., "Evaluation of CYPIA1 and CYP2B1/2 m-RNA Induction in Rat Liver Slices Using the NanoString® Technology: A Novel Tool for Drug Discovery Lead Optimization," Drug metabolism letters, Nov. 3, 2009. 3(3):171-175. |
| Pandey et al., "Inhibition of terminal deoxynucleotidyl transferase by adenine dinucleotides. Unique inhibitory action of Ap5A," FEBS Lett., Mar. 1987, 213(1):204-8. |
| Park et al., "Cancer gene therapy using adeno-associated virus vectors," Front Biosci., Jan. 2008, 13:2653-59. |
| Park et al., "The Estimation of Breast Cancer Disease-Probability by Difference of Individual Susceptibility," Cancer Res. Treat., Feb. 2003, 35(1):35-51, Abstract. |
| Patil et al., "DNA-based therapeutics and DNA delivery systems: a comprehensive review," AAPS J, Apr. 2005, 7(1):E61-77. |
| Patton et al., "Rainbow's end: the quest for multiplexed fluorescence quantitative analysis in proteomics." Current Opinion in Chemical Biology, Feb. 1, 2002, 6(1):63-69. |
| PCT International Preliminary Report on Patentability in International Appln. No. PCT/EP2012/056823, dated Oct. 15, 2013, 7 pages. |
| PCT International Preliminary Report on Patentability in International Appln. No. PCT/EP2013/071645, dated Apr. 21, 2015, 6 pages. |
| PCT International Preliminary Report on Patentability issued in International Appln. No. PCT/US2010/033064, dated Nov. 1, 2011, 6 pages. |
| PCT International Preliminary Report on Patentability issued in International Appln. No. PCT/US2010/044134, dated Jan. 31, 2012, 20 pages. |
| PCT International Preliminary Report on Patentability issued in International Appln. No. PCT/US2010/059327, dated Jun. 12, 2012, 12 pages. |
| PCT International Preliminary Report on Patentability issued in International Appln. No. PCT/US2011/031163, dated Oct. 9, 2012, 7 pages. |
| PCT International Preliminary Report on Patentability issued in International Appln. No. PCT/US2011/031308, dated Oct. 9, 2012, 7 pages. |
| PCT International Preliminary Report on Patentability issued in International Appln. No. PCT/US2012/032759, dated Oct. 8, 2013, 17 pages. |
| PCT International Search Report and Written Opinion in International Appln. No. PCT/EP2012/056823, dated Jun. 29, 2012, 12 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/EP2013/071645, dated Dec. 11, 2013, 10 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/EP2016/057355, dated Aug. 5, 2016, 8 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US14/29691, dated Aug. 19, 2014, 10 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US14/44196, dated Nov. 7, 2014, 15 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US14/64588, dated Mar. 11, 2015, 20 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US2010/033064, dated Jul. 30, 2010, 8 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US2010/044134, dated Mar. 18, 2011, 16 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US2010/059327, dated Mar. 29, 2011, 12 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US2011/031163, dated May 23, 2011, 8 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US2011/031308, dated Jun. 7, 2011, 8 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US2012/032759, dated Sep. 28, 2012, 14 pages. |
| PCT International Search Report and Written Opinion issued in International Appln. No. PCT/US2014/044191, dated Nov. 7, 2014, 10 pages. |
| Pearson et al., "Improved tools for biological sequence comparison," Proc. Natl. Acad. Sci., May 1988, 85:2444-2448. |
| Pellestor et al., "The peptide nucleic acids (PNAs), powerful tools for molecular genetics and cytogenetics," Eur J Hum Genet., Sep. 2004, 12(9):694-700. |
| Pemov et al., "DNA analysis with multiplex microarray-enhanced PCR," Nucl. Acids Res., Jan. 2005, 33(2):e11, 9 pages. |
| Penland et al., "RNA expression analysis of formalin-fixed paraffin-embedded tumors," Laboratory Investigation, Apr. 2007, 87(4):383-391. |
| Perler et al., "Intervening sequences in an Archaea DNA polymerase gene," PNAS USA, Jun. 1992, 89(12): 5577-5581. |
| Perocchi et al., "Antisense artifacts in transcriptome microarray experiments are resolved by actinomycin D," Nucleic Acids Res., 2007, 35(19):e128, 7 pages. |
| Petterson et al., "Generations of sequencing technologies," Genomics, 2009, 105-111. |
| Pipenburg et al., "DNA detection using recombination proteins," PLoS Biol., Jul. 2006, 4(7):e204, 7 pages. |
| Pirici et al., "Antibody elution method for multiple immunohistochemistry on primary antibodies raised in the same species and of the same subtypem," J. Histochem. Cytochem., Jun. 2009, 57(6):567-75. |
| Piston et al., "Fluorescent protein FRET: the good, the bad and the ugly," Trends Biochem Sci., Sep. 2007, 32(9):407-14. |
| Plasterk, "The Tc1/mariner transposon family," Curr Top Microbiol Immunol., 1996, 204:125-43. |
| Pluen et al., "Diffusion of macromolecules in agarose gels: comparison of linear and globular configurations," Biophys J., Jul. 1999, 77(1):542-552. |
| Polsky-Cynkin et al., "Use of DNA Immobilizedon Plastic and Agarose Supports to DetectDNA by SandwichHybridization", Clin. Chem. 31: 1438-1443, 1985. |
| Porreca et al., "Polony DNA sequencing," Curr Protoc Mol Biol., Nov. 2006, Chapter 7, Unit 7.8, pp. 7.8.1-7.8.22. |
| Promega, "GoScript™ Reverse Transcription System—Technical Manual," promega.com, revised Dec. 2012, 24 pages. |
| Punwaney et al., "Human papillomavirus may be common within nasopharyngeal carcinoma of Caucasian Americans: investigation of Epstein-Barr virus and human papillomavirus in eastern and western nasopharyngeal carcinoma using ligation-dependent polymerase chain reaction," Head & Neck, Jan. 1999, 21(1):21-29. |
| Raab et al., "Human tRNA genes function as chromatin insulators," Embo J., Jan. 2012, 31(2):330-50. |
| Rahimi et al., "Synthesis and Characterization of Thermo-Sensitive Nanoparticles for Drug Delivery Applications," J. Biomed. Nanotechnol. Dec. 2008, 4(4):482-490, 19 pages. |
| Raj et al., "Imaging individual mRNA molecules using multiple singly labeled probes," Nature Methods, Oct. 2008, 5(10):877-879, 9 pages. |
| Rajeswari et al., "Multiple pathogen biomarker detection using an encoded bead array in droplet PCR," J. Microbial Methods, Aug. 2017, 139:22-28. |
| Ramachandran et al., "Next-generation high-density self-assembling functional protein arrays," Nature Methods, Jun. 2008, 5(6):535-538. |
| Ramanujan et al., "Diffusion and convection in collagen gels: implications for transport in the tumor interstitium," Biophys. J., Sep. 2002, 83(3):1650-1660. |
| Ranki et al., "Sandwich hybridization as a convenient method for the detection of nucleic acids in crude samples", Gene 21: 77-85, cellulose, 1983. |
| Raouane et al., "Lipid conjugated oligonucleotides: a useful strategy for delivery," Bioconjug Chem., Jun. 2012, 23(6):1091-104. |
| Razonable, "Antiviral drugs for viruses other than human immunodeficiency virus," Mayo Clinic Proceedings, Oct. 2011, 86(10):1009-26. |
| Reijenga et. al., "Buffer Capacity, Ionic Strength and Heat Dissipation in Capillary Electrophoresis," Journal of Chromatography A, Sep. 13, 1996, 744(1-2):147-153. |
| Reinartz et al., "Massively parallel signature sequencing (MPSS) as a tool for in-depth quantitative gene expression profiling in all organisms," Brief Funct Genomic Proteomic, Feb. 2002, 1(1):95-104. |
| Rettig et al., "Large-scale single-cell trapping and imaging using microwell arrays," Anal Chem, Sep. 2005, 77(17):5628-5634. |
| Reznikoff, "Tn5 as a model for understanding DNA transposition," Mol Microbiol., Mar. 2003, 47(5):1199-206. |
| Ristova et al., "Study of hydrogenated amorphous silicon thin films as a potential sensor for He—Ne laser light detection," Applied Surface Science, Sep. 2003, 218(1-4):44-53. |
| Roberts et al., "RNA-peptide fusions for the in vitro selection of peptides and proteins," PNAS USA, Nov. 1997, 94: 12297-122302. |
| Robins et al., "Comprehensive assessment of T-cell receptor ß-chain diversity in αß T cells," Blood, Nov. 5, 2009, 114(19):4099-4107. |
| Robinson et al., "Small-sample estimation of negative binomial dispersion, with applications to Sage data," Biostatistics, Apr. 2008, 9(2):321-332. |
| Rogers et al., "Immobilization of oligonucleotides onto a glass support via disulfide bonds: A method for preparation of DNA microarrays," Anal Biochem., Jan. 1999, 266(1):23-30. |
| Rogers et al., "Use of a novel cross-linking method to modify adenovirus tropism," Gene Ther., Dec. 1997, 4(12):1387-92. |
| Ronaghi et al., "A sequencing method based on real-time pyrophosphate," Science, Jul. 1998, 281(5375): 363-365. |
| Ronaghi et al., "Real-time DNA sequencing using detection of pyrophosphate release," Analytical Biochemistry, Nov. 1996, 242(1): 84-89. |
| Ronaghi, "Pyrosequencing sheds light on DNA sequencing," Genome Res, Jan. 2001, 11(1):3-11. |
| Rosenthal et al., "Cell patterning chip for controlling the stem cell microenvironment," Biomaterials, Jul. 2007, 28(21):3208-3216. |
| Rouillard et al., "OligoArray 2.0: design of oligonucleotide probes for DNA microarrays usina a thermodynamic approach," Nuc. Acid Research, Jun. 2003, 31(12): 3057-3062. |
| Rountenberg et al., "Microfluidic probe: a new tool for integrating microfluidic environments and electronic wafer-orobina," Lab Chip, Oct. 2009, 10: 123-127. |
| Rubin et al., "Whole-genome resequencing reveals loci under selection during chicken domestication.," Nature, Mar. 2010, 464: 587-591. |
| Rubina et al., "Hydrogel-based protein microchips: manufacturing, properties, and applications," Biotechniques, May 2003, 34(5):1008-14. |
| Running et al., "A procedure for productive coupling of synthetic oligonucleotides to polystyrene microtiter wells for hybridization capture," Biotechniques, Mar. 1990, 8(3):276-279. |
| Rush et al., "New Aldehyde Tag Sequences Identified by Screening Formylglycine Generating Enzymes in Vitro and in Vivo," J. of American Chemical Society, Aug. 2008, 130(37): 12240-12241. |
| Rusk, "Spatial transcriptomics," Nature Methods, Sep. 2016, 13(9):710-711. |
| Russell et al., "Molecular mechanisms of late endosome morphology, identity and sorting," Curr. Opin. Cell Bio., Aug. 2006, 18(4):422-428. |
| Sambrook and Russell, "Chapter 5, Gel Electrophoresis of DNA and Pulsed-field Agarose Gel Electrophoresis: Protocol 13, Preparation of DNA for Pulsed-field Gel Electrophoresis: Isolation of DNA from Mammalian Cells and Tissues," Molecular Cloning: A Laboratory Manual, 2001, 5 pages. |
| San Paulo et al., "High-resolution imaging of antibodies by tapping-mode atomic force microscopy; attractive and repulsive tip-sample interaction regimes," Biophys J., Mar. 2000, 78(3):1599-1605. |
| Sano et al., "Immuno-PCR: Very Sensitive Antigen Detection by Means of Specific Antibody-DNA Conjugates," Science, Oct. 2, 1992, 258(5079):120-122. |
| Schellings et al., "Absence of SPARC results in increased cardiac rupture and dysfunction after acute myocardial infarction," J Exp Med., Jan. 2009, 206(1):113-23. |
| Schena et al., "Entering the Postgenome Era," Science, 1995, 270:368-9, 371. |
| Schena et al., "Quantitative monitoring of gene expression patterns with a complementary DNA microarray," Science, Oct. 1995, 270(5235): 467-470. |
| Schlapak et al., "Glass surfaces grafted with high-density poly (ethylene glycol) as substrates for DNA oligonucleotide microarrays," Langinuir, Jan. 2006, 22: 277-285. |
| Schmidt et al., "Cerebrospinal fluid melanin-concentrating hormone (MCH) and hypocretin-1 (HCRT-1, orexin-A) in Alzheimer's disease," PloS one, May 2013, 8(5):e63136, 6 pages. |
| Schmitt et al., "Detection of ultra-rare mutations by next-generation sequencing," PNAS (2012) 109:14508-14523. |
| Scholz et al., "The Molecular Chaperone Hsp90 Is Required for Signal Transduction by Wild-Type Hck and Maintenance of Its Constitutively Active Counterpart1," Cell Growth Differ., Aug. 2001, 12(8):409-417. |
| Schouten et al., "Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification," Nucleic Acids Res., Jun. 2002, 30(12):e57, 13 pages. |
| Schroeder et al., "The RIN: an RNA integrity number for assigning integrity values to RNA measurements," BMC Molecular Biology, Jan. 2006, 7:3, 14 pages. |
| Schwartz et al., "Capturing native long-range contiguity by in situ library construction and optical sequencing," PNAS, Nov. 13, 2012, 109(46): 18749-18754. |
| Schweitzer et al., "Immunoassays with rolling circle DNA amplification: A versatile platform for ultrasensitive antigen detection," Proc. Natl Acad. Sci. USA, May 22, 2000, 97:10113-119. |
| Schweitzer et al., "Multiplexed protein profiling on microarrays by rolling-circle amplification," Nature Biotechnology, Apr. 2002, 20(4):359-365. |
| Schwers et al., "A high-sensitivity, medium-density, and target amplification-free planar waveguide microarray system for gene expression analysis of formalin-fixed and paraffin-embedded tissue," Clin. Chem., Nov. 2009, 55(11):1995-2003. |
| ScienceDirect.com [online], "Plant Fibers," Definition, 2011, retrieved on Apr. 13, 2022, retrieved from URL<https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/plant-fibers>, 9 pages. |
| Search Report issued in Application No. GB1106254.4, dated Mar. 29, 2012, in 1 page. |
| Sekar et al., "Fluorescence resonance energy transfer (FRET) microscopy imaging of live cell protein localizations," J Cell Biol., Mar. 2003, 160(5):629-33. |
| Sergeeva et al., "Display technologies: Application for the discovery of drug and gene delivery aaents," Advanced Drua Delivery Reviews (2006) 58(15):1622-1654. |
| Seurynck-Servoss et al., "Evaluation of Surface Chemistries for Antibody Microarrays", Anal Biochem., 371(1): 105-115, 2007. |
| Shalon et al., "A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe hybridization," Genome Res., Jul. 1996, 6(7):639-45. |
| Shelbourne et al., "Fast copper-free click DNA ligation by the ring-strain promoted alkyne-azide cycloaddition reaction.", Chem. Commun., 47: 6257-6259, 2011. |
| Shendure et al., "Accurate Multiplex Polony Sequencing of an Evolved Bacterial Genome," Science, 2005, 309:1728-1732. |
| Shi et al., "The MicroArray Quality Control (MAQC) project shows inter- and intraplatform reproducibility of gene expression measurements," Nature Biotechnology, 2006, 24(9):1151-61. |
| Shi, "Enabling large-scale pharmacogenetic studies by high-throughput mutation detection and genotyping technologies," Clin. Chem., Feb. 2001, 47(2):164-172. |
| Shibata et al., "Detection of human papilloma virus in paraffin-embedded tissue using the polymerase chain reaction," J Exp Med., Jan. 1988, 167(1):225-30. |
| Shirai et al., "Novel Tools for Analyzing Gene Expressions in Single Cells," The 5th International Workshop on Approaches to Single-Cell Analysis, The University of Tokyo, Mar. 3-4, 2011, 1 page. |
| Shirai et al.; "Novel Tools for Analyzing Gene Expressions in Single Cells"; Nature Methods; 6; pp. 503-506; (2009)_Abstract only. |
| Shoemaker et al., "Quantitative phenotypic analysis of yeast deletion mutants using a highly parallel molecular bar-coding strategy," Nature genetics (1996) 14:450-456. |
| Shults et al., "A multiplexed protein kinase assay," Chem Bio Chem (2007) 8:933-942. |
| Sievertzon et al., "Transcriptome analysis in primary neural stem cells using a tag cDNA amplification method," BMC Neuroscience, Dec. 2005, 6: 28. |
| Simonis et al., "Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C)," Nat Genet., Nov. 2006, 38(11):1348-54. |
| Slomovic et al., "Addition of poly(A) and poly(A)-rich tails during RNA degradation in the cytoplasm of human cells," Proc Natl Acad Sci USA, Apr. 2010, 107(16):7407-12. |
| Slonim and Yanai, "Getting started in gene expression microarray analysis," Plos Computational Biology, 2009, 5(10):e1000543. |
| Smejkal et al., "Microfluidic isotachophoresis: a review," Electrophoresis, Jun. 2013, 34(11): 1493-1509. |
| Smolock et al., "Ribosomal Protein L17, RpL 17, is an Inhibitor of Vascular Smooth Muscle Growth and Carotid Intima Formation," Circulation, Nov. 2012, 126(20):2418-2427. |
| Soderberg et al. "Characterizing proteins and their interactions in cells and tissues using the in situ proximity ligation assay," Methods, Jul. 2008, 45(3):227-232. |
| Soderberg et al., "Direct observation of individual endogenous protein complexes in situ by proximity ligation," Nature Methods, 2006, 3:995-1000. |
| Soen et al., "Detection and Characterization of Cellular Immune Responses Using Peptide-MHC Microarrays," PLOS Biology, Dec. 22, 2003, 1(3):429-438. |
| Son et al., "A platform for ultrasensitive and selective multiplexed marker protein assay toward early-stage cancer diagnosis," Nanomedicine, Feb. 7, 2007, 2(1):79-82. |
| Soni and Meller, "Progress toward ultrafast DNA sequencing using solid-state nanopores," Clin Chem., 2007, 53: 1996-2001. |
| Spiess et al., "A highly efficient method for long-chain cDNA synthesis using trehalose and betaine," Anal. Biochem., Feb. 2002, 301(2):168-74. |
| Spurgeon et al., "High Throughput Gene Expression Measurement with Real Time PCR in a Microfluidic Dynamic Array," PlosONE, 2008, 3(2):e1662. |
| Stanton et al., "Altered patterns of gene expression in response to myocardial infarction," Circulation research, May 12, 2000, 86(9), 939-945. |
| Stevens Jr. et al., "Enhancement of phosphoprotein analysis using a fluorescent affinity tag and mass spectrometry," Rapid Commun Mass Spectrom, 2005, 19(15):2157-62. |
| Stimpson et al., "Real-time detection of DNA hybridization and melting on oligonucleotide arrays by using optical wave guides," Proc Natl Acad Sci USA, Jul. 1995, 92(14):6379-83. |
| Stoddart et al., "Single-nucleotide discrimination in immobilized DNA oligonucleotides with a biological nanopore," PNAS U S A., May 2009, 106(19):7702-7707. |
| Stougaard et al., "In situ detection of non-polyadenylated RNA molecules using Turtle Probes and target primed rolling circle Prins," BMC Biotechnology, Dec. 18, 2007, 7(69):1-10. |
| Stroh et al., "Quantum dots spectrally distinguish multiple species within the tumor milieu in vivo," Nat Med., Jun. 2005, 11(6):678-82. |
| Subramanian et al., "Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles," PNAS, Oct. 2005, 102(43): 15545-15550. |
| Suh et al., "A simple soft lithographic route to fabrication of poly(ethylene glycol) microstructures for protein and cell patterning," Biomaterials, Feb. 2004, 25(3):557-563. |
| Sumitomo et al., "Ca2+ ion transport through channels formed by −hemolysin analyzed using a microwell array on a Si substrate," Biosensors and Bioelectronics, 2012, 31(1):445-450. |
| Summersgill et al., "Fluorescence In Situ Hybridization Analysis of Formalin Fixed Paraffin Embedded Tissues, Including Tissue Microarrays," Chapter 4, Bridger, J. Ed., Methods in Molecular Biology 659, 2010, 51-70, 2010. |
| Sun et al., "Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay," Anal. Bio. Chem., 402: 741-748, 2012. |
| Surzhik et al., "Template-dependent biosynthesis of poly(G) x poly (C) and its antiviral activity in vitro and in vivo," Antiviral Res., May 1988, 38(2):131-40. |
| Sutherland et al., "Utility of formaldehyde cross-linking and mass spectrometry in the study of protein-protein interactions," J. Mass Spectrom., Jun. 2008, 43(6):699-715. |
| Swartz et al., "Interstitial flow and its effects in soft tissues," Annu Rev Biomed Eng., 2007, 9:229-56. |
| Syková et al., "Diffusion in brain extracellular space," Physiol Rev., Oct. 2008, 88(4):1277-340. |
| Tai et al., "Replication-competent retrovirus vectors for cancer gene therapy," Front Biosci., Jan. 2008, 13:3083-95. |
| Takahashi et al., "In Vitro Selection of Protein and Peptide Libraries Using mRNA Display," Nucleic Acid and Peptide Aptamers: Methods and Protocols (2009) 535:293-314 (Ch. 17). |
| Tan et al., "Parylene peel-off arrays to probe the role of cell-cell interactions in tumour angiogenesis," Integr Biol (Camb), Oct. 2009, 1(10):587-594. |
| Tang et al., "mRNA-Seq whole-transcriptome analysis of a single cell," Nat Methods, 2009, 6:377-382. |
| Tang et al., "RNA-Seq analysis to capture the transcriptome landscape of a single cell.," Nat Protoc., 5: 516-35, 2010. |
| Tang et al.; "RNA-Seq Analysis to Capture the Transcriptome Landscape of a Single Cell"; Nat Protoc. 5(3); pp. 1-34; (2010); Author Manuscript in Europ PMC Funders Group, Nat Protoc. Author Manuscript, available in PMC Dec. 3, 2013. |
| Taniguchi et al., "Quantitative analysis of gene expression in a single cell by qPCR," Nature Methods, 6, pp. 503-506, 2009. |
| Tawfik et al., "Man-made cell-like compartments for molecular evolution," Nat Biotechnol., Jul. 1998, 16(7):652-6. |
| Taylor et al., "Microfluidic local perfusion chambers for the visualization and manipulation of synapses," Neuron., Apr. 2010, 66(1):57-68, 25 pages. |
| Taylor et al., "Mitochondrial DNA mutations in human disease." Nature Reviews Genetics. May 2005, 6(5):389-402. |
| Tegtmeyer et al., "Alternative Interactions of the SV40 A Protein with DNA," Virology, 1981, 115:75-87. |
| Thacker et al., "Alkaline Hydrolysis—Carcass Disposal: A Comprehensive Review," National Agriculture Biosecurity Center, Aug. 2004, Chapter 6, pp. 1-12. |
| Thiery et al., "Multiplex target protein imagine in tissue sections by mass spectrometry—TAMSIM," Rapid. Commun. Mass Spectrom, 2007, 21:823-829. |
| Thiery et al., "Multiplex target protein imaging in tissue sections by mass spectrometry—Tamsim," Rapid Commun. Mass Spectrom., 2007, 21:823-829. |
| Thomas et al., "A chamber for the perfusion of in vitro tissue with multiple solutions," J. Neurophysiol., Jul. 2013, 110:269-277. |
| Thorne et al., "In vivo diffusion analysis with quantum dots and dextrans predicts the width of brain extracellular space," Proc Natl Acad Sci USA, Apr. 2006, 103(14):5567-5572. |
| Thornton, "High rate thick film growth." Annual review of materials science, Aug. 1977, 7(1):239-60. |
| Tian et al., "Antigen peptide-based immunosensors for rapid detection of antibodies and antigens," Anal Chem May 26, 2009, 81 (13):5218-5225. |
| Tijssen, "Overview of principles of hybridization and the strategy of nucleic acid assays" in Techniques in 5 Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes 1993. |
| Timofeev et al., "Regioselective immobilization of short oligonucleotides to acrylic copolymer gels," Nucleic Acids Res., Aug. 1996, 24(16):3142-8. |
| Tolbert et al., "New Methods for Proteomic Research: Preparation of Proteins with N-Terminal Cysteines for Labeling and Conjugation" Angewandte Chemie International Edition, Jun. 17, 2002, 41(12):2171-4. |
| Toseland, "Fluorescent labeling and modification of proteins," J Chem Biol., Apr. 2013, 6(3):85-95. |
| Totet et al., "Immunocompetent infants as a human reservoir for Pneumocystis jirovecii: rapid screening by non-invasive sampling and real-time PCR at the mitochondrial large subunit rRNA gene," J Eukaryot Microbiol., 2003, pp. 668-669. |
| Toubanaki et al., "Dry-reagent disposable biosensor for visual genotyping of single nucleotide polymorphisms by oligonucleotide ligation reaction: application to pharmacogenetic analysis," Hum Mutat., Aug. 2008, 29(8):1071-8. |
| Toy et al., "A Simple Plastic Perfusion Chamber for Continuous Maintenance and Cinematography of Tissue Cultures," Experimental Cell Research, 1958, 14:97-103. |
| Tseng et al., "Magnetic nanoparticle-mediated massively parallel mechanical modulation of single-cell behavior," Nat Methods, Nov. 2012, 9(11):1113-1119. |
| Twyman et al., "Techniques Patents for SNP Genotyping," Pharmacogenomics, Jan. 2003, 4(1):67-79. |
| Tzanetakis et al., "The use of reverse transcriptase for efficient first- and second-strand cDNA synthesis from single-and double-stranded RNA templates," J Virol Methods, Mar. 2005, 24(1-2):73-7. |
| U.S. Appl. No. 13/080,616, filed Oct. 6, 2011, Chee. |
| U.S. Appl. No. 13/080,616, US-2011-0245111-A1, U.S. Pat. No. 9,371,598, filed Apr. 5, 2011, Mark S. Chee. |
| U.S. Appl. No. 14/111,482, US-2014-0066318-A1, U.S. Pat. No. 10,030,261, filed Oct. 11, 2013, Jonas Frisen. |
| U.S. Appl. No. 14/434,274, US-2015-0344942-A1, U.S. Pat. No. 9,593,365, filed Apr. 8, 2015, Jonas Frisen. |
| U.S. Appl. No. 14/900,602, US-2016-0145677-A1, U.S. Pat. No. 9,868,979, filed Dec. 21, 2015, Mark S. Chee. |
| U.S. Appl. No. 14/900,604, US-2016-0138091-A1, U.S. Pat. No. 9,879,313, filed Dec. 21, 2015, Mark S. Chee. |
| U.S. Appl. No. 15/187,661, US-2016-0298180-A1, U.S. Pat. No. 10,308,982, filed Jun. 20, 2016, Mark S. Chee. |
| U.S. Appl. No. 15/565,637, filed Oct. 10, 2017, Jonas Frisen. |
| U.S. Appl. No. 15/565,637, US-2019-0203275-A1, U.S. Pat. No. 10,774,374, filed Nov. 15, 2018, Jonas Frisen. |
| U.S. Appl. No. 15/831,158, US-2018-0201980-A1, filed Dec. 4, 2017, Mark S. Chee. |
| U.S. Appl. No. 16/013,654, US-2019-0017106-A1, filed Jun. 20, 2018, Jonas Frisen. |
| U.S. Appl. No. 16/042,950, US-2019-0024153-A1, filed Jul. 23, 2018, Jonas Frisen. |
| U.S. Appl. No. 16/043,038, US-2019-0024154-A1, filed Jul. 23, 2018, Jonas Frisen. |
| U.S. Appl. No. 16/254,443, US-2019-0264268-A1, filed Jan. 22, 2019, Jonas Frisen. |
| U.S. Appl. No. 16/276,235, US-2019-0177777-A1, U.S. Pat. No. 10,480,022, filed Feb. 14, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/276,260, US-2019-0177778-A1, U.S. Pat. No. 10,662,467, filed Feb. 14, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/402,098, US-2019-0271030-A1, U.S. Pat. No. 10,472,669, filed May 2, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/402,098, US-2019-0271031-A1, U.S. Pat. No. 10,472,669, filed May 2, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/414,213, US-2019-0271031-A1, U.S. Pat. No. 10,787,701, filed May 16, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/430,015, US-2019-0300943-A1, filed Jun. 3, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/430,109, US-2019-0300944-A1, filed Jun. 3, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/435,176, US-2019-0323071-A1, filed Jun. 7, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/435,295, US-2019-0309353-A1, U.S. Pat. No. 10,996,219, filed Jun. 7, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/437,637, US-2019-0309354-A1, U.S. Pat. No. 10,494,667, filed Jun. 11, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/437,726, US-2011-0245111-A1, filed Jun. 1, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/437,726, US-2019-0300945-A1, filed Jun. 11, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/443,771, US-2019-0309355-A1, filed Jun. 17, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/596,200, US-2020-0109443-A1, U.S. Pat. No. 10,774,372, filed Oct. 8, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/660,234, US-2020-0048690-A1, U.S. Pat. No. 10,662,468, filed Oct. 22, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/669,246, US-2020-0063195-A1, U.S. Pat. No. 10,982,268, filed Oct. 30, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/669,246, US-2020-0063195-A1, U.S. Pat. No. 10,982,568, filed Oct. 30, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/670,603, US-2020-0063196-A1, U.S. Pat. No. 10,612,079, filed Oct. 31, 2019, Mark S. Chee. |
| U.S. Appl. No. 16/734,216, US-2020-0140934-A1, U.S. Pat. No. 10,619,196, filed Jan. 3, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/734,237, US-2020-0140935-A1, filed Jan. 3, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/816,177, US-2020-0208205-A1, U.S. Pat. No. 10,914,730, filed Mar. 11, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/816,192, US-2020-0208206-A1, U.S. Pat. No. 10,962,532, filed Mar. 11, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/837,924, US-2020-0224256-A1, U.S. Pat. No. 10,983,113, filed Apr. 1, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/894,369, US-2020-0299757-A1, filed Jun. 5, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/913,672, US-2020-0325531-A1, filed Jun. 26, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/945,345, US-2021-0017583-A1, filed Jul. 31, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/984,034. |
| U.S. Appl. No. 16/986,922, 2021-0010068-A1, U.S. Pat. No. 10,927,403, filed Aug. 6, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/986,922, US-2021-0010068-A1, U.S. Pat. No. 10,927,403, filed Aug. 6, 2020, Mark S. Chee. |
| U.S. Appl. No. 16/988,284, US-2020-0370106-A1, U.S. Pat. No. 10,961,566, filed Aug. 7, 2020, Mark S. Chee. |
| U.S. Appl. No. 17/011,923, US-2020-0399687-A1, filed Sep. 3, 2020, Jonas Frisen. |
| U.S. Appl. No. 17/030,230, US-2011-0002713-A1, filed Sep. 23, 2020, Mark S. Chee. |
| U.S. Appl. No. 17/030,230, US-2021-0002713-A1, filed Sep. 23, 2020, Mark S. Chee. |
| U.S. Appl. No. 17/032,317, US-2011-0017586-A1, filed Sep. 25, 2020, Mark S. Chee. |
| U.S. Appl. No. 17/032,317, US-2021-0017586-A1, filed Sep. 25, 2020, Mark S. Chee. |
| U.S. Appl. No. 17/097,824, US-2021-0062249-A1, U.S. Pat. No. 11,008,607, filed Nov. 13, 2020, Mark S. Chee. |
| U.S. Appl. No. 17/144,965, US-2021-0123095-A1, U.S. Pat. No. 11,001,878, filed Jan. 8, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/144,971, US-2011-0130883-A1, U.S. Pat. No. 11,001,879, filed Jan. 8, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/144,971, US-2021-0130883-A1, U.S. Pat. No. 11,001,879, filed Jan. 8, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/145,210, US-2021-0130884-A1, filed Jan. 8, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/180,356, US-2011-0172007-A1, U.S. Pat. No. 11,046,996, filed Feb. 19, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/180,356, US-2021-0172007-A1, U.S. Pat. No. 11,046,996, filed Feb. 19, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/211,231 filed Mar. 24, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/223,669, US-2021-0207202-A1, U.S. Pat. No. 11,067,567, filed Apr. 6, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/237,652, filed Apr. 22, 2021, Jonas Frisen. |
| U.S. Appl. No. 17/237,670, filed Apr. 22, 2021, Jonas Frisen. |
| U.S. Appl. No. 17/306,510, filed May 3, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/321,090, filed May 14, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/322,654, filed May 17, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/358,280, filed Jun. 25, 2021, Mark S. Chee. |
| U.S. Appl. No. 17/707,189, filed Mar. 29, 2022, Chell et al. |
| U.S. Appl. No. 60/416,118 Fan et al., Multiplex Nucleic Acid Analysis Using Archived or Fixed Samples, filed Oct. 3, 2002, 22 pages. |
| U.S. Appl. No. 61/267,363, filed Dec. 7, 2009 (Year: 2009). |
| U.S. Appl. No. 61/687,681 Priority Document Soldatov Drawings, Apr. 30, 2012. * |
| U.S. Appl. No. 61/687,681 Priority Document Soldatov Sequence Listing, Apr. 30, 2012. * |
| U.S. Appl. No. 61/687,681 Priority Document Soldatov Specification, Apr. 30, 2012. * |
| U.S. Appl. No. 61/839,313, filed Jun. 25, 2013, Chee et al. |
| U.S. Appl. No. 61/839,320, filed Jun. 25, 2013, Chee et al. |
| U.S. Appl. No. 61/902,105, filed Nov. 8, 2013, Kozlov et al. |
| U.S. Appl. No. 62/839,575, filed Apr. 26, 2019, Bent et al. |
| Ueno et al., "cDNA Display: Rapid Stabilitzation of mRNA Display," Antibody-Drug Conjugates, Methods in Molecular Biology, Jan. 2012, pp. 113-135. |
| Ulery et al., "Biomedical Applications of Biodegradable Polymers," J Polym Sci B Polym Phys., Jun. 2011, 49(12):832-864. |
| Valencia et al., "mRNA-Display-Based Selections for Proteins with Desired Functions: A Protease-Substrate Case Study." Biotechnology progress, May 2008, 24(3):561-9. |
| Valley et al., "Optoelectronic tweezers as a tool for parallel single-cell manipulation and stimulation," IEEE Trans Biomed Circuits Syst., Dec. 2009, 3(6):424-31. |
| Van Gelder et al., "Amplified RNA synthesized from limited quantities of heterogeneous cDNA," Proc. Natl. Acad. Sci. USA 87, 1663-1667, 1990. |
| Van Ness et al., "A versatile solid support system for oligodeoxynucleotide probe-based hybridization assays", Nucleic Acids Res. 19: 3345-3350, 1991. |
| Vandenbroucke et al., "Quantification of splice variants using real-time PCR," Nucleic Acids Research, 2001, 29(13):e68, 7 pages. |
| Vandernoot et al., "cDNA normalization by hydroxyapatite chromatography to enrich transcriptome diversity in RNA-seq applications," Biotechniques, Dec. 2012, 53(6):373-80. |
| Vasiliskov et al., "Fabrication of microarray of gel-immobilized compounds on a chip by copolymerization," Biotechniques, Sep. 1999, 27(3):592-606. |
| Velculescu et al., "Serial analysis of gene expression." Science, Oct. 20, 1995, 270(5235):484-7. |
| Verma et al., "Modified Oligonucleotides: Synthesis and Strategy for Users," Annual Review of Biochemistry, 1998, 67(1):99-134. |
| Vermesh et al., "High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications," Angew Chem Int Ed Engl, Aug. 2011, 50(32):7378-7380. |
| Villa et al., "Partial V(D)J Recombination Activity Leads to Omenn Syndrome," Cell, May 29, 1998, 93:885-896. |
| Vincent et al., "Helicase-dependent isothermal DNA amplification," Embo Rep., Aug. 2004, 5(8):795-800. |
| Viollet et al., "T4 RNA ligase 2 truncated active site mutants: improved tools for RNA analysis," BMC Biotechnol., Jul. 2011, 11:72, 14 pages. |
| Vogelstein et al., "Digital PCR," Proceedings of the National Academy of Sciences, Aug. 3, 1999, 96:9236-9241. |
| Wade et al., "Genome sequence, comparative analysis, and population genetics of the domestic horse.," Science., 326: 865-7, 2009. |
| Waichman et al., "Functional immobilization and patterning of proteins by an enzymatic transfer reaction." Analytical chemistry, Jan. 21, 2010, 82(4): 1478-85. |
| Walker et al., "Strand displacement amplification—an isothermal, in vitro DNA amplification technique." Nucleic acids research. Apr. 11, 1992, 1992, 20(7): 1691-1696. |
| Walker et al., Ed., "Chapter 1: Basic Techniques in Molecular Biology," Medical Biomethods Handbook, Humana Press, Totowa, New Jersey, 2005, 19 pages. |
| Wang et al., "High-fidelity mRNA amplification for gene profiling." Nature biotechnology. Apr. 2000, 18(4):457-459. |
| Wang et al., "Mutations in NEXN, a Z-disc gene, are associated with hypertrophic cardiomyopathy," Am J Hum Genet., Nov. 2010, 87(5):687-93. |
| Wang et al., "Paramagnetic microspheres with core-shell-ed structures," Journal of Materials Science, Apr. 2012, 47(16):5946-54. |
| Wang et al., "Single cell analysis: the new frontier in ‘omics’., " Trends Biotechnol., 28: 281-90, 2010. |
| Wang et al., "Tagmentation-based whole-genome bisulfite sequencing," Nature Protocols, Oct. 2013, 8(10):2022-2032. |
| Wang, "RNA amplification for successful gene profiling analysis," J Transl Med., Jul. 2005, 3:28, 11 pages. |
| Watanabe et al., "Cellular networks involved in the influenza virus life cycle," Cell Host & Microbe, Jun. 2010, 7(6):427-39. |
| Waxman et al., "De-regulation of common housekeeping genes in hepatocellular carcinoma," BMC Genomics, 2007, 1-9. |
| Weichhart et al., "Functional selection of vaccine candidate peptides from Staphylococcus aureus whole-genome expression libraries in vitro," Infection and Immunity, 2003, 71 (8):4333-4641. |
| Weinreich et al., "Evidence that the cis Preference of the Tn5 Transposase is Caused by Nonproductive Multimerization," Genes and Development, Oct. 1994, 8(19):2363-2374. |
| Wheeler et al., "Microfluidic device for single-cell analysis," Analytical Chemistry, Jul. 2003, 75(14):3581-3586. |
| Wiedmann et al., "Ligase chain reaction (LCR)—overview and applications," PCR Methods Appl., Feb. 1994, 3(4):S51-64. |
| Wikipedia.org [online], "Random hexamer," Jan. 2012, Retrieved on Jan. 21, 2022, retrieved from URL<https://en.wikipedia.org/w/index.php?title=Random_hexamer&oldid=473042236>, 1 page. |
| Williams et al., "Disc electrophoresis in polyacrylamide gels: extension to new conditions of pH and buffer," Annals of the New York Academy of Sciences, Dec. 1964, 121(2):373-381. |
| Williams, "RAC reviews serious adverse event associated with AAV therapy trial," Mol Ther., Dec. 2007, 15(12):2053-54. |
| Willi-Monnerat et al., "Comprehensive spatiotemporal transcriptomic analyses of the ganglionic eminences demonstrate the uniqueness of its caudal subdivision," Molecular and Cellular Nueorsciences 37: 845-856, 2008. |
| Wilson et al., "New transposon delivery plasmids for insertional mutagenesis in Bacillus anthracis," J Microbiol Methods, Dec. 2007, 71(3):332-5. |
| Wolf et al., "Rapid hybridization kinetics of DNA attached to submicron latex particles", Nucleic Acids Res. 15: 2911-2926, 1987. |
| Wong et al., "Direct Site-Selective Covalent Protein Immobilization Catalyzed by a Phosphopantetheinyl Transferase," J. Am. Chem Soc., 2008, 130:12456-64. |
| Woo et al., "A Comparison of cDNA, Oligonucleotide, and Affymetrix GeneChip Gene Expression Microarray Platforms," Journal of Biomolecular Techniques, 2004, 15(4), 276-284. |
| Wood et al., "Single cell trapping and DNA damage analysis using microwell arrays," PNAS, Jun. 2010, 107(22):10008-10013. |
| Worthington et al., "Cloning of random oligonucleotides to create single-insert plasmid libraries," Analyt. Biochem, 2001, 294:169-175. |
| Wright et al., "Reusable, reversibly sealable parylene membranes for cell and protein patterning," J Biomed Mater Res A., May 2008, 85(2):530-538. |
| Wu et al., "Detection DNA Point Mutation with Rolling-Circle Amplification Chip," Bioinformatics and Biomedical Engineering (ICBBE), 2010 4th International Conference on IEEE, Piscatway, NJ, USA, Jun. 18, 2010, 1-4 pages. |
| Xiao et al., "Direct determination of haplotypes from single DNA molecules," Nature Methods, 2009, 6(3): 199-01. |
| Xie et al., "CryoFish: Fluorescence In Situ Hybridization on Ultrathin Cryosections," Fluorescence in situ Hybridization (FISH), Jul. 2010, pp. 221-230. |
| Yan et al., "Decorin gene delivery inhibits cardiac fibrosis in spontaneously hypertensive rats by modulation of transforming growth factor-beta/Smad and p38 mitogen-activated protein kinase signaling pathways," Hum Gene Ther., Oct. 2009, 20(10):1190-200. |
| Yang et al., "Nucleoside alpha-Thiotriphosphates, Polymerases and the Exonuclease III Analysis of Oligonucleotides Containing Phosphorothioate Linkages," Nucleic Acids Research, Apr. 22, 2007, 35(9):3118-3127. |
| Yao et al., "Influence of laser parameters on nanoparticle-induced membrane permeabilization," Journal of Biomedical Optics, 2009, 14(5):054034, 7 pages. |
| Yasukawa et al., "Effects of organic solvents on the reverse transcription reaction catalyzed by reverse transcriptases from avian myeloblastosis virus and Moloney murine leukemia virus," Biosci Biotechnol Biochem., 2010, 74(9):1925-30. |
| Yeakley et al, Profiling alternative splicing on fiber-optic arrays, 2002, Nature biotechnology, 20, 353-358 (Year: 2002). |
| Yeakley et al., "Profiling alternative splicing on fiber-optic arrays," Nature Biotechnology, Apr. 2002, 20(4):353-358. |
| Yershov et al., "DNA analysis and diagnostics on oligonucleotide microchips," Proc. Natl. Acad. Sci. USA, May 1996, 93(10):4913-4918. |
| Yet et al., "Cardiac-specific expression of heme oxygenase-1 protects against ischemia and reperfusion injury in transgenic mice," Circ Res., Jul. 2001, 89(2):168-73. |
| Yin et al., "Genetically encoded short peptide tag for versatile protein labeling by Sfp phosphopantetheinyl transferase," PNAS, 2005, 102(44):15815-20. |
| Yonezawa et al., "DNA display for in vitro selection of diverse peptide libraries," Nucleic Acids Research, 2003, 31 (19):e118. |
| Yu et al., "Shrinkage estimation of dispersion in Negative Binomial models for RNA-seq experiments with small sample size," Bioinformatics, May 2013, 29(10):1275-1282. |
| Yusof et al., "Inkjet-like printing of single-cells," Lab Chip, Jul. 2011, 11(14):2447-2454. |
| Zhang et al., "A novel mechanism of transposon-mediated gene activation," PLoS Genet., Oct. 2009, 5(10):e1000689, 10 pages. |
| Zhang et al., "Assembling DNA through Affinity Binding to Achieve Ultrasensitive Protein Detection," Anaew Chem Int Ed (2013) 52:2-10. |
| Zhang et al., "Binding-induced DNA assembly and its application to yoctomole detection of proteins," Anal Chem (2012) 84(2):877-884. |
| Zhang et al., "Single-base mutational analysis of cancer and genetic diseases using membrane bound modified oligonucleotides," Nucleic Acids Res., Jul. 1991, 19(14):3929-33. |
| Zhang et al., "Stripping custom microRNA microarrays and the lessons learned about probe-slide interactions," Anal Biochem., Mar. 2009, 386(2):222-7. |
| Zheng et al., Origins of human mitochondrial point mutations as DNA polymerase mediated errors. Mutat. Res. 599(1-2): 11-20 (2006. |
| Zheng, "Spectroscopy-based quantitative fluorescence resonance energy transfer analysis," Methods Mol Biol., 2006, 337:65-77. |
| Zhou et al., "Analysis of the expression profile of Dickkopf-1 gene in human glioma and the associate with tumor malignancy," Journal of Experimental & Clinical Cancer Research, Oct. 28, 2010, 29(138):1-7. |
| Zhou et al., "Genetically Encoded Short Peptide Tags for Orthogonal Protein Labeling by Sfp and Ac S Phos ho entethein I Transferases," ACS Chemical Biolo 2007 2 5 : 337-346. |
| Zhu et al., "Reverse Transcriptase Template Switching: A Smart Approach for Full-Length cDNA Library Construction," BioTechniques, 2001, 30(4): 892-897. |
| Zieba et al., "Bright-field microscopy visualization of proteins and protein complexes by in situ proximity ligation with peroxidase detection," Clin Chem, Jan. 2010, 56(1):99-110. |
| Zilberman et al., "Genome-wide analysis of DNA methylation patterns," Development (2007) 134: 3959-3965. |
| Zlobec et al., "Next-generation tissue microarray (ngTMA) increases the quality of biomarker studies: an example using CD3, CD8, and CD45RO in the tumor microenvironment of six different solid tumor t es," Journal of Translational Medicine 2013 11:104. |
| Zuker. "Mfold web server for nucleic acid folding and hybridization prediction," Nucleic Acids Res., Jul. 2003, 31(13):3406-15. |
Cited By (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12234505B2 (en) | 2010-04-05 | 2025-02-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12297487B2 (en) | 2010-04-05 | 2025-05-13 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12297488B2 (en) | 2010-04-05 | 2025-05-13 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12391980B2 (en) | 2010-04-05 | 2025-08-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12391979B2 (en) | 2010-04-05 | 2025-08-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12378607B2 (en) | 2018-08-28 | 2025-08-05 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12270077B2 (en) | 2018-08-28 | 2025-04-08 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12344892B2 (en) | 2018-08-28 | 2025-07-01 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12497654B2 (en) | 2018-12-10 | 2025-12-16 | 10X Genomics, Inc. | Resolving spatial arrays by proximity-based deconvolution |
| US12545949B2 (en) | 2018-12-10 | 2026-02-10 | 10X Genomics, Inc. | Resolving spatial arrays using deconvolution |
| US12385083B2 (en) | 2018-12-10 | 2025-08-12 | 10X Genomics, Inc. | Methods of using master / copy arrays for spatial detection |
| US12442045B2 (en) | 2019-05-30 | 2025-10-14 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| US12157124B2 (en) | 2019-11-06 | 2024-12-03 | 10X Genomics, Inc. | Imaging system hardware |
| US12241890B2 (en) | 2019-12-23 | 2025-03-04 | 10X Genomics, Inc. | Methods for generating barcoded nucleic acid molecules using fixed cells |
| US12566113B2 (en) | 2019-12-23 | 2026-03-03 | 10X Genomics, Inc. | Reversible fixing reagents and methods of use thereof |
| US12365942B2 (en) | 2020-01-13 | 2025-07-22 | 10X Genomics, Inc. | Methods of decreasing background on a spatial array |
| US12405264B2 (en) | 2020-01-17 | 2025-09-02 | 10X Genomics, Inc. | Electrophoretic system and method for analyte capture |
| US12297486B2 (en) | 2020-01-24 | 2025-05-13 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US12110541B2 (en) | 2020-02-03 | 2024-10-08 | 10X Genomics, Inc. | Methods for preparing high-resolution spatial arrays |
| US12286673B2 (en) | 2020-02-05 | 2025-04-29 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US12129516B2 (en) | 2020-02-07 | 2024-10-29 | 10X Genomics, Inc. | Quantitative and automated permeabilization performance evaluation for spatial transcriptomics |
| US12281357B1 (en) | 2020-02-14 | 2025-04-22 | 10X Genomics, Inc. | In situ spatial barcoding |
| US12399123B1 (en) | 2020-02-14 | 2025-08-26 | 10X Genomics, Inc. | Spatial targeting of analytes |
| US12228544B2 (en) | 2020-03-04 | 2025-02-18 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
| US12416603B2 (en) | 2020-05-19 | 2025-09-16 | 10X Genomics, Inc. | Electrophoresis cassettes and instrumentation |
| US12265079B1 (en) | 2020-06-02 | 2025-04-01 | 10X Genomics, Inc. | Systems and methods for detecting analytes from captured single biological particles |
| US12508590B2 (en) | 2020-06-10 | 2025-12-30 | 10X Genomics, Inc. | Fluid delivery methods |
| US12435363B1 (en) | 2020-06-10 | 2025-10-07 | 10X Genomics, Inc. | Materials and methods for spatial transcriptomics |
| US12553898B1 (en) | 2020-08-10 | 2026-02-17 | 10X Genomics, Inc. | Fluorescent hybridization of antibody-oligonucleotide for multiplexing and signal amplification |
| US12249085B2 (en) | 2020-09-18 | 2025-03-11 | 10X Genomics, Inc. | Sample handling apparatus and image registration methods |
| US12241060B2 (en) | 2020-12-21 | 2025-03-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US12371688B2 (en) | 2020-12-21 | 2025-07-29 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US12287264B2 (en) | 2021-02-19 | 2025-04-29 | 10X Genomics, Inc. | Modular assay support devices |
| US12566114B2 (en) | 2021-02-19 | 2026-03-03 | 10X Genomics, Inc. | Methods of using modular assay support devices |
| US12365935B2 (en) | 2021-05-06 | 2025-07-22 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| US12553805B2 (en) | 2021-08-02 | 2026-02-17 | 10X Genomics, Inc. | Methods of preserving a biological sample |
| US12275988B2 (en) | 2021-11-10 | 2025-04-15 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| US12223751B2 (en) | 2021-12-20 | 2025-02-11 | 10X Genomics, Inc. | Self-test for imaging device |
| US12571029B1 (en) | 2022-11-09 | 2026-03-10 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of multiple analytes in a biological sample |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3901280B1 (en) | 2025-03-12 |
| EP2909337B1 (en) | 2019-01-09 |
| DK3511423T3 (en) | 2021-06-07 |
| CA2886974A1 (en) | 2014-04-24 |
| EP3511423A1 (en) | 2019-07-17 |
| WO2014060483A1 (en) | 2014-04-24 |
| EP3511423B1 (en) | 2021-03-24 |
| EP3511423B2 (en) | 2024-05-29 |
| EP2909337A1 (en) | 2015-08-26 |
| EP4592400A2 (en) | 2025-07-30 |
| US20150344942A1 (en) | 2015-12-03 |
| EP4592400A3 (en) | 2025-10-29 |
| US9593365B2 (en) | 2017-03-14 |
| ES3019910T3 (en) | 2025-05-21 |
| DK3511423T4 (en) | 2024-07-29 |
| EP3901280A1 (en) | 2021-10-27 |
| EP3901280C0 (en) | 2025-03-12 |
| CA2886974C (en) | 2021-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11479809B2 (en) | Methods of detecting analytes | |
| USRE50065E1 (en) | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO SMALL (ORIGINAL EVENT CODE: SMAL); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
|
| FEPP | Fee payment procedure |
Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
|
| AS | Assignment |
Owner name: SPATIAL TRANSCRIPTOMICS AB, SWEDEN Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FRISEN, JONAS;STAHL, PATRIK;LUNDEBERG, JOAKIM;AND OTHERS;REEL/FRAME:056426/0931 Effective date: 20130926 |
|
| AS | Assignment |
Owner name: 10X GENOMICS SWEDEN AB, SWEDEN Free format text: CHANGE OF NAME;ASSIGNOR:SPATIAL TRANSCRIPTOMICS AB;REEL/FRAME:064426/0521 Effective date: 20220923 |
|
| MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY Year of fee payment: 8 |