CN101522915A

CN101522915A - Methods and systems for detecting and/or sorting targets

Info

Publication number: CN101522915A
Application number: CNA2007800367254A
Authority: CN
Inventors: 盖布·克翁; 瑞安·贝利; 樊荣; 詹姆斯·R·希思
Original assignee: California Institute of Technology CalTech
Current assignee: California Institute of Technology CalTech
Priority date: 2006-08-02
Filing date: 2007-08-01
Publication date: 2009-09-02

Abstract

Provided herein are methods and systems for detecting and/or sorting targets in a sample based on the combined use of polynucleotide-encoded protein and- substrate polynucleotides. The polyhucleotide-encoded protein is comprised of a protein that specifically binds to a predetermined target and of an encoding polynucleotide that specifically binds to a substrate polynucleotide, wherein the substrate polynucleotide is attached to a substrate.

Description

Be used to detect and/or the method and system of sorting targets

With CROSS-REFERENCE TO RELATED APPLICATIONS

The application requires following right of priority: the U.S. Provisional Application that on August 2nd, 2006 submitted to, reel number CIT-4707, sequence number 60/834,823, be entitled as ＂ A unified Platform for MultiplexedCell Sorting and Detection of Genes and Proteins ＂, and the U.S. Provisional Application of submission on July 16th, 2007, reel number CIT-4944, sequence number 60/959,665, be entitled as ＂ DigitalDEAL:A quantitative and digital Protein Detection Immunoassay ＂, its disclosure is incorporated this paper into by reference in its entirety.

The government-funded statement

Subsidy DAAD19-03-D-0004/0008 that gives according to the subsidy CA119347 that is given by the state-run cancer research of Frederick institute with by ARO-United States Army Robert Morris shopping center and subsidy 5U54CA 119347, United States Government enjoys some right to present disclosure.

Technical field

Present disclosure relates to detection one or more targets, especially biomarker in sample such as biological sample.More specifically, it relates to and is used to detect and/or the method and system of sorting targets.

Background technology

The high-sensitivity detection of target (especially biomarker) is a challenge in the biomolecule analysis field, especially when attempt detects multiple target.No matter be used for pathological examination or fundamental biological knowledge research, all have Several Methods generally to be used to detect the biomaterial and the biomolecules of plurality of classes.

Some technology that generally are used to detect single biological target in the laboratory comprise gel electrophoresis, polyacrylamide gel electrophoresis (PAGE), western trace, fluorescence in situ hybridization (FISH), fluorescent activation cell sorting (FACS), polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA).These methods provide at biological sample and have detected the ability of one or more biomarkers as in organizing, and also are applicable to diagnostic purpose.

Yet genome of overall importance and the proteome analysis to tissue influencing our understanding to many human cancers on molecular level at present.Integrate the two the research of genetic expression and protein science data and especially had informedness.This class multiparameter data sets has begun to disclose regulating networks (Lin, the B. of the confusion that defines cancer generation and development; White, J.T.; Lu, W.; Xie, T.; Utleg, A.G; Yan, X.; Yi, E.C; Shannon, P.; Khretbukova, I.; Lange, P.H.; Goodlett, D.R.; Zhou, D.; Vasicek, T.J.; Hood, L.Cancer Res.2005,65,3081-3091.Kwong, K.Y.; Bloom, G C; Yang, I.; Boulware, D.; Coppola, D.; Haseman, J.; Chen, E.; McGrath, A.; Makusky, A.J.; Taylor, J.; Steiner, S.; Zhou, J.; Yeatman, T.J.; Quackenbush, J.Genomics 2005,86,142-158.Huber, M.; Bahr, L; Kratzchmar, J.R.; Becker, A.; Muller, E.-C; Donner, P.; Pohlenz, H.-D.; Schneider, M.R.; Sommer, A.Molec.Cell.Proteomics2004,3,43-55.Tian, Q.; Stepaniants, S.B.; Mao, M.; Weng, L.; Feetham, M.C; Doyle, M.J.; Yi, E.C; Dai, H.; Thorsson, V.; Eng, J.; Goodlett, D.; Berger, J.P.; Gunter, B.; Linseley, P.S.; Stoughton, R.B.; Aebersold, R.; Collins, S.J.; Hanlon, W.A.; Hood, L.E.Molec.Cell.Proteomics 2004,3,960-969.Chen, G; Gharib .T.G; Huang, C-C; Taylor, J.M.G; Misek, D.E.; Kardia, S.L.R.; Giordano, T.J.; Iannettoni, M.D.; Orringer, M.B.; Hanash, S.M.; Beer, D.G Molec.Cell.Proteomics 2002,1,304-313).To this fresh condition of complex disease such as cancer and appearance (Prados, the M. of promising new cancer drug; Chang, S.; Burton, E.; Kapadia, A.; Rabbitt, J.; Page, M.; Federoff, A.; Kelly, S.; Fyfe, G Proc.Am.Soc.Clin.Oncology 2003,22,99.Rich, J.N.; Reardon, D.A.; Peery, T.; Dowell, J.M.; Quinn, J.A.; Penne, K.L.; Wikstrand, C J.; Van Duyn, L.B.; Dancey, J.E.; McLendon, R.E.; Kao, J.C; Stenzel, T.T.; Rasheed, B.K.A.; Tourt-Uhlig, S.E.; Herndon, J.E.; Vredenburgh, J.J.; Sampson, J.H.; Friedman, A.H.; Bigner, D.D.; Friedman, H.S.J.Clin.Oncology 2004,22,133-142.) clinical pathology proposed new requirement (Mellinghoff, I.K.; Wang, M.Y.; Vivanco, I.; Haas-Kogan, D.A.; Zhu, S.; Dia, E.Q.; Lu, K.V.; Yoshimoto, K; Huang, J.H.Y.; Chute, D.J.; Riggs, B.L.; Horvath, S.; Liau., L.M.; Cavenee, W.K.; Rao, P.N.; Beroukhim, R.; Peck, T.C; Lee, J.C; Sellers, W.R.; Stokoe, D.; Prados, M.; Cloughesy, T.F; Sawyers, C.L.; Mischel, P.S.N.Engl.J.Med.2006,353,2012-2024).For example, traditional pathology are put into practice (i.e. Zu Zhi microscopical analysis) and can not be distinguished potential respondent and non-responder (Betensky, R.A. to new cancer molecule therapy; Louis, D.N.; Cairncross, J.G J.Clin.Oncology 2002,20,2495-2499).Such example is arranged recently, and wherein few parameters (pauciparameter) molecule method of masurement is used to identify potential respondent (Hughes, the T. at least two kinds of therapies; Branford, S., 2003.Semin Hematol.2 Suppl 2,62-68.Lamb, J.; Crawford, E.D.; Peck, D.; Modell, J.W.; Blat, I.C; Wrobel, M.J.; Lerner, J.; Brunet, J.P.; Subramanian, A.; Ross, K.N.; Reich, M.; Hieronymus, H.; Wei, G.; Armstrong, S.A.; Haggarty, S.J.; Clemons, P.A.; Wei, R.; Carr, S.A.; Lander, E.S.; Golub, T.R., Science2006,313, (5795), 1929-1935.Martin, M., CHn.Transl Oncol.8, (1), 7-14.Radich, J.P.; Dai, H.; Mao, M.; Oehler, V.; Schelter, J.; Druker, B.; Sawyers, C.L.; Shah, N.; Stock, W.; Willman, C.L.; Friend, S.; Linsley, P.S., Proc.Natl.Acad.Sci.2006,103, (8), 2794-2799).Yet the one-parameter method of masurement unlikely becomes common situation.Replace, the associating of molecular diagnostics and molecule therapy finally can need to measure the combination of multiparameter (for example cell, mRNA and protein) biomarker, and it can be used for instructing the patient to carry out suitable therapy or combination treatment.

At present, the multiparameter biomarker combination of measuring from illing tissue needs combination microscopical analysis, microarray data (Mischel, P.S.; Cloughesy, T.F.; ＂ Nelson, S.F.Nature Rev.Neuroseience 2004,5,782-794), immunohistochemical staining, Western trace (Mellinghoff, I.K.; Wang, M.Y.; Vivanco, I.; Haas-Kogan, D.A.; Zhu, S.; Dia, E.Q.; Lu, K.V.; Yoshimoto, K.; Huang, J.H.Y; Chute, D.J.; Riggs, B.L.; Horvath, S.; Liau., L.M.; Cavenee, W.K.; Rao, P.N.; Beroukhim, R.; Peck, T.C; Lee, J.C.; Sellers, W.R.; Stokoe, D.; Prados, M.; Cloughesy, T.F.; Sawyers, C.L.; Mischel, P.S.N.Engl.J.Med.2006,353,2012-2024) and additive method.The data integration of collecting is advanced in the some diseases model to produce diagnosis, and described model is cancer approach model (Weinberg, R.A., C ancer Biology.Garland Science:2006) for example.At present, carry out the tissue sample that these multiple method of masurement need surgical resection.The heterogeneity of this class biopsy samples can cause significant sampling error, because the different zones of each comfortable tissue of cell, mRNA and proteinic multiple measurement is carried out.

Summary of the invention

This paper provides based on the method and system that will be used in combination with the protein and the substrate polynucleotide of polynucleotide encoding.Protein with polynucleotide encoding disclosed herein by specificity in conjunction with the protein of target be attached to this proteinic coded polynucleotide and form.Described coded polynucleotide is made up of the sequence of specificity bonded substrate polynucleotide.Substrate polynucleotide disclosed herein are attached to substrate, and are made up of in conjunction with the sequence of described coded polynucleotide specificity.

Can carry out multiple mensuration according to method and system disclosed herein, the mensuration that includes but not limited to be used to detect and/or separate target, described target is biomarker especially, for example cell, protein and/or polynucleotide.Particularly, in the mensuration of using method and system disclosed herein, use and is used the substrate polynucleotide will described protein with polynucleotide encoding-target complex body to combine with substrate to be used for detection in conjunction with target with the protein of polynucleotide encoding specificity in the protein-target complex body of polynucleotide encoding.Read behind the present disclosure conspicuously as the technician, method and system disclosed herein allows to produce the advantageous property of some mensuration, especially in microfluid (microfluidic) environment.

According to first aspect, test sample hit calibration method and system are disclosed, this method and system is based on being used in combination the substrate polynucleotide that are attached to substrate and protein with polynucleotide encoding, described protein with polynucleotide encoding is made up of protein and coded polynucleotide, described protein specific is in conjunction with target, and described coded polynucleotide specificity is in conjunction with the substrate polynucleotide that are attached to substrate.

In the method, to contact certain hour under certain condition with sample and substrate polynucleotide with the protein of polynucleotide encoding, to allow this protein in protein-target complex body, to combine with target with polynucleotide encoding with polynucleotide encoding, and allow coded polynucleotide to combine, thereby provide and substrate polynucleotide bonded polynucleotide encoding protein-target complex body with the substrate polynucleotide.In the method, read present disclosure by the technician subsequently after discernible detection technique detect and substrate polynucleotide bonded polynucleotide encoding protein-target complex body.

In this system, substrate is provided with polynucleotide encoding protein, described substrate has the substrate polynucleotide that are attached to this substrate, and described polynucleotide encoding protein comprises specificity in conjunction with the protein of target and the coded polynucleotide of specificity bonded substrate polynucleotide.

According to second aspect, the method and system that is used for the multiple target of test sample is disclosed, this method and system is based on being used in combination multiple substrate polynucleotide and the multiple antibody with polynucleotide encoding that is attached to substrate.

In this method and system, various substrate polynucleotide are sequence-specific, and can be distinguished from each other on the position.In this method and system, every kind of polynucleotide encoding protein is by protein and be attached to this proteinic coded polynucleotide and form, wherein said protein combines with the predetermined target specificity of a plurality of targets, and described coded polynucleotide combines with the differentiable substrate polynucleotide of sequence-specific and position specificity in the described multiple substrate polynucleotide.In addition, in this method and system, range protein and coded polynucleotide in conjunction with aspect can be distinguished from each other.

In the method, multiple polynucleotide encoding antibody is contacted certain hour with sample under certain condition with multiple substrate polynucleotide, in multiple polynucleotide encoding protein-target complex body, combine with target with permission antibody, and allow coded polynucleotide to combine with the substrate polynucleotide.In the method, subsequently by the technician read behind the present disclosure discernible detection technique detect with substrate on the multiple polynucleotide encoding protein of multiple substrate polynucleotide bonded-target complex body.

In this system, comprised substrate and multiple polynucleotide encoding antibody, described substrate has the multiple substrate polynucleotide that are attached to this substrate.

According to the 3rd aspect, the method and system that is used for the multiple target of test sample is disclosed, wherein said target comprises at least a target polynucleotide.This method and system is based on being used in combination the multiple substrate polynucleotide that are attached to substrate, at least a polynucleotide encoding protein and at least a through the mark polynucleotide.

In this method and system, each substrate polynucleotide are sequence-specific, and can be distinguished from each other on the position.In this method and system, described at least aly combine with at least a target polynucleotide specificity through the mark polynucleotide, various through the mark polynucleotide in conjunction with aspect can be distinguished from each other.In this method and system, described at least a polynucleotide encoding protein is made up of protein and coded polynucleotide, described protein specific is in conjunction with the predetermined target in the described multiple target, and described coded polynucleotide combines with the differentiable substrate polynucleotide of sequence-specific and position specificity in the described multiple substrate polynucleotide.In this method and system, each protein and coded polynucleotide in conjunction with aspect can be distinguished from each other, each protein also can be distinguished from each other aspect combining through the mark polynucleotide with various, and each polynucleotide encoding protein can be distinguished from each other aspect combining through the labels targets polynucleotide with various.

In the method, at least aly contact certain hour under certain condition with sample with described through the mark polynucleotide, combine with target polynucleotide through the mark polynucleotide with permission, thereby provide at least a through the labels targets polynucleotide, wherein said at least aly be made up of such sequence through the labels targets polynucleotide, described sequence combines with the differentiable substrate polynucleotide of sequence-specific and position specificity.In addition, in the method, described at least a polynucleotide encoding protein is contacted certain hour under certain condition with sample, combine at least a polynucleotide encoding protein-target complex body with target to allow this protein.In addition, in the method, described at least a target polynucleotide through mark is contacted certain hour with described at least a polynucleotide encoding protein-target complex body under certain condition with multiple substrate polynucleotide, allowing described at least a target polynucleotide through mark to combine, and allow described at least a coded polynucleotide to combine with substrate polynucleotide accordingly with corresponding substrate polynucleotide.In the method, subsequently by use technology personnel discernible detection technique after reading present disclosure detect with substrate on the localized multiple substrate polynucleotide bonded in space through labels targets polynucleotide and polynucleotide encoding protein-target complex body.

In this system, comprised substrate and at least a through mark polynucleotide and at least a polynucleotide encoding protein, described substrate has the multiple substrate polynucleotide that are attached to this substrate.In this system, at least a of this system is the target polynucleotides that are used to produce mark through the mark polynucleotide, and described target polynucleotide through mark combines with the differentiable substrate polynucleotide of sequence-specific and position specificity.

According to the 4th aspect, the method and system of the target that is used for the multiple target of sorting is disclosed, this method and system is based on being used in combination multiple substrate polynucleotide and the multiple polynucleotide encoding antibody that is attached to substrate.In some embodiments, target is a cell, and this method and system is used for the sorting various kinds of cell.

In this method and system, each substrate polynucleotide is sequence-specific and can be distinguished from each other on the position.In this method and system, each polynucleotide encoding protein is by protein and be attached to this proteinic coded polynucleotide and form, wherein said protein combines with predetermined target specificity in the described multiple target, and described coded polynucleotide combines with the differentiable substrate polynucleotide of sequence-specific and position specificity in the described multiple substrate polynucleotide.In this method and system, each protein and coded polynucleotide in conjunction with aspect can be distinguished from each other.

In the method, multiple polynucleotide encoding antibody is contacted certain hour under certain condition with sample, combine with target to allow antibody, thereby multiple polynucleotide encoding protein-target complex body is provided.In the method, then multiple polynucleotide encoding protein-target complex body is contacted certain hour under certain condition with multiple substrate polynucleotide, allowing this coded polynucleotide to combine with the substrate polynucleotide that are attached to substrate, thus with the multiple polynucleotide encoding protein of substrate bonded-target complex body in sorting targets.

According to the 5th aspect, the array that is used for one or more targets of detection of sample fluid is disclosed, this array comprises substrate, described substrate has the multiple substrate polynucleotide that are attached to described substrate assembly, this substrate polynucleotide sequence is specific and can distinguishes on the position, and wherein each substrate polynucleotide is by forming with the be independent of each other sequence of (orthogonal) of another substrate polynucleotide sequence.

According to the 6th aspect, the substrate in each method disclosed herein, system and the array is effectively related with microfluid component, and described microfluid component comprises the microfluid member that is used for carry fluid.Therefore in the method, coded polynucleotide and/or can in the fluid of microfluid member loading, carry out with contacting of substrate polynucleotide at least through mark polynucleotide target.In addition, each system disclosed herein also can comprise the microfluid component with microfluid member.

First advantage of method and system disclosed herein is, in each method and system disclosed herein, polynucleotide encoding protein and target contact can this protein with carry out before substrate combines.Therefore, when the target of use such as cell, substrate can not damage target approaching to protein binding site, and protein and target molecule can have all that orientation is free completely when contacting, thus the sensitivity that has improved any related assays that carries out with disclosed method and system.

Second advantage of method and system disclosed herein is, in each method and system disclosed herein, polynucleotide encoding protein can assemble in solution, thereby the relevant denaturation of protein of art methods is minimized, and described art methods is included in conjunction with the after drying substrate and improves temperature (for example near 100 ℃).In some these class art methods, produce protein array by using fine needle (fine pin) point sample on glass substrate (spotting), thereby manufacturing step needs monitoring closely, to guarantee moist excessive and thereby the sex change of protein.On the contrary, in method and system disclosed herein, can in solution, protein be assemblied on the substrate, thus with protein dry excessively and sex change be minimized to zero.

The 3rd advantage of method and system disclosed herein is, in each method and system disclosed herein, biofouling (biofouling, be non-coded protein and the non-specific binding of substrate) compare with system significantly based on method of protein with this area and reduce, thereby allow more effective combination, and allow when expectation detects, compare target molecule in the detection by quantitative sample more accurately based on the method and system of antibody with this area.

The 4th advantage of method and system disclosed herein is to compare with system based on method of protein with this area, and the multichannel (multiplexed) that can carry out higher target number detects and/or separation.This is owing to several factors.First factor is that the biofouling reduction relevant with the substrate polynucleotide that are attached to substrate with being used in combination polynucleotide encoding protein allows more effectively to make polynucleotide encoding protein-target complex body to combine and detect with substrate.Second factor is in method and system disclosed herein, and the size of substrate polynucleotide and this area are compared much smaller based on the corresponding anchoring molecule of using in method of protein and the system.Therefore, compared with prior art, can on substrate, assemble more highdensity protein (for example about per square inch 5,000 points are than 96 orifice plates of for example elisa technique).

The 5th advantage of method and system disclosed herein is in each method and system disclosed herein, might in single substrate, detect and the target of separation chemistry different in kind, comprise biomarker such as polynucleotide, protein and have the cell of different surfaces mark.Therefore, method and system disclosed herein allows in identical environment gene, protein and cell to be carried out the multichannel detection and/or separate.

Another advantage of target sorting method disclosed herein and system is, method and system disclosed herein makes the cell after the sorting can be used for sorting post analysis (post-sorting analysis) at once, and this is that it is especially relevant can be used in the embodiment of the cell of gene and protein expression in the sorting post analysis cell at target.

A kind of extra advantage of method and system disclosed herein is when being used to carry out diagnostic assay, can carry out multichannel to the multiple biomarker from same tissue region on single substrate and detect.Another advantage of this method and system is when being used to carry out diagnostic assay, and described biomarker can be the different biomarker of chemical property, and as cell, mRNA and protein, and detection can be detection by quantitative and/or qualitative detection.Another advantage of method and system disclosed herein is when being used to carry out diagnostic assay, their allow the genome and/or the protein group spectrum of detection of complex, and this spectrum is providing after relatively being that the diagnosis of the disease (as cancer) of feature is indicated with the regulating networks confusion with predetermined spectrum.The another kind of advantage of method and system disclosed herein is when being used to carry out diagnostic assay, might be with a small amount of biological sample of multiparameter pattern analysis, and can be with three association areas of bioinformation, promptly gene (by the DNA representative), protein and cell link together.

When substrate and microfluid component are effectively related, another remarkable advantage of all method and systems disclosed herein is, compare with corresponding existing method and system, the sample that permission significantly reduces with size carries out the multichannel multiparameter with the number of steps that reduces and measures in the time that reduces.Especially, in view of the minimizing of analyzing required sample size makes the needs of putting to death mouse minimize, multichannel multiparameter microfluidic methods disclosed herein and system are especially favourable when target comes the biomarker of self-organization.Thus, the method and system that carries out in microfluidic environment disclosed herein allows to detect the target that is included on a small quantity in the sample, flies mol (femto Molar, concentration fM) is present in the molecule in the sample thereby allow to detect to be low to moderate about 10.

When substrate is effectively related with microfluid component when being used to carry out diagnostic assay, another advantage of method and system disclosed herein is, the multichannel that allows to carry out biomarker detects, and comprises biomarker such as polynucleotide, protein and cell that chemical property is different.Therein in the effectively related embodiment of substrate and microfluid component, another additional advantage of diagnostic method disclosed herein and system is, allows to carry out multichannel multiparameter mensuration on the simple sample of identical microcosmos area in from heterogeneous tissue.Therefore, method and system disclosed herein also makes the sampling error that is associated with heterogeneous biopsy minimize, and described heterogeneous biopsy is that to carry out being used in this area detecting the multiple measurement of the diagnostic method of the biomarker of number of chemical different in kind and system required.

The details of one or more embodiments of present disclosure is open in accompanying drawing and following description.Other features, target and advantage will be clearly from specification sheets and accompanying drawing and claims.

The accompanying drawing summary

Description of drawings one or more embodiments of present disclosure, and explain the principle and the enforcement of present disclosure with detailed Description Of The Invention, described accompanying drawing is incorporated herein and constitutes the part of specification sheets.

In the accompanying drawings:

Fig. 1 is the diagram that is used to prepare the proteinic coupling strategy of polynucleotide encoding disclosed herein.Figure a is the diagram of the reaction of preparation antibody; Figure b is the diagram of the reaction of preparation polynucleotide; Figure c has showed by puting together antibody shown in the figure a and scheming the polynucleotide encoding antibody that polynucleotide obtain shown in the b; Figure d shows gel shift rate fluctuation measurement (gel mobility shift assay), and its demonstration can be by regulating the number of controlling the polynucleotide chain A1 ' that is attached to antibody with the amount of scheming the molecule of antibody coupling shown in a.Swimming lane I-IV corresponds respectively to the stoichiometric ratio of coupling molecule and the antibody of 300:1,100:1,50:1,25:1 herein.

Fig. 2 is the proteinic diagram of puting together chemistry of polynucleotide encoding disclosed herein.Figure a shows the diagram of puting together chemistry between polynucleotide and the protein strepto-avidin; Figure b shows the Streptavidin and the proteinic assembling that contains vitamin H of polynucleotide encoding, and vitamin H is the part of Streptavidin; SA represents Streptavidin albumen, and " vitamin H-protein " expression contains the protein of part vitamin H.

Fig. 3 has shown the sketch of the polynucleotide load of showing the optimization polynucleotide encoding antibody that is used for cell surface marker identification disclosed herein.Figure a shows the FACS curve, its with α-CD90.2/FITC-polynucleotide conjugate (α of FITC-DNA-mark-CD90.2) with antibody on non-cohesive FITC α-CD90.2 antibody that polynucleotide are arranged (FITC α-CD90.2) and no antibody and the negative control that does not have polynucleotide encoding antibody (unlabelled) compare.Fluorescence intensity corresponding to the FITC passage provides on the x axle, and the y axle is corresponding to empty fluorescence channel; Figure b shows the histogram of the different number FITC-polynucleotide average fluorescent strengths that are attached to antibody; Report the polynucleotide number that is attached to antibody on the x axle, reported average fluorescent strength on the y axle.

Fig. 4 is the diagram that is used in combination polynucleotide encoding antibody disclosed herein and substrate polynucleotide.

Fig. 5 has showed the embodiment of method and system, and wherein polynucleotide encoding protein is based on Streptavidin-biotin system, and target is a cell.Figure a shows the assembling of the Streptavidin of polynucleotide encoding among Fig. 2, the protein that wherein contains vitamin H is major histocompatibility complex (MHC), and the purpose cell with the Streptavidin of polynucleotide encoding is pre-assembled on the substrate before glass substrate contacts.Figure b shows that the MHC with polynucleotide encoding contacts with microarray in conjunction with the back in solution with cell.

Fig. 6 has showed and uses polynucleotide encoding antibody disclosed herein and substrate polynucleotide to detect the method for multiple target.Figure a shows the diagram that is used in combination multiple polynucleotide encoding antibody disclosed herein and the combination of substrate polynucleotide; Figure b shows the related immune mensuration of using polynucleotide encoding antibody disclosed herein and substrate polynucleotide to carry out.

Fig. 7 shows the spatial encoding protein determination that uses polynucleotide encoding antibody disclosed herein and substrate polynucleotide to carry out.Figure a shows the immunoassay of carrying out and use respectively polynucleotide A1 ', B1 ' and C1 ' mark with three kinds of anti-human IgGs of identical goat (with Alexa 488, Alexa 594 or Alexa 647 dye markers); Fig. 6 has shown the immunoassay result's who comes from the figure a array portion of indicating with white line segment diagram; The scale line segment that shows among the figure is corresponding to 1mm.

Fig. 8 shows the result of immunoassay, and its demonstration is used in combination nonspecific proteins matter that polynucleotide encoding antibody disclosed herein and substrate polynucleotide are caused and absorbs and minimize.Figure a shows the microarray that while and the anti-human IgG-Alexa488/A1 ' of goat, the anti-human IgG-Alexa647/C1 ' of goat (puting together with the specificity polynucleotide separately) contact with the anti-human IgG-Alexa594 of goat (not having incidental DNA); Figure b shows the immunoassay result's who comes from the figure a array portion of indicating with white line segment diagram, and the scale line segment that shows among the figure is corresponding to 1mm.

Fig. 9 has set forth the result of computer (in silico) the irrelevantization processing (orthogonalization) of substrate polynucleotide, wherein every kind of substrate polynucleotide all are independent of each other with other substrate polynucleotide, and the combination of its corresponding antibodies specific polynucleotide.Figure a shows the slide glass that is printed on three kinds of substrate polynucleotide be exposed to two kinds of polynucleotide encoding antibody, two kinds of complementations in described two kinds of polynucleotide encoding antibody and the three kinds of substrate polynucleotide; Figure b shows by the computer hybridization of A1 and with the computer of two kinds of substrate polynucleotide of antibodies specific polynucleotide complementary hybridizes formed secondary structure; Figure c shows that computer produces other substrate polynucleotide, and its restriction is that each chain is independent of each other each other, and is independent of each other with its respective complementary sequence; Figure d shows one group of 6 sequence that are independent of each other, from 5 ' list to 3 ' end.

Figure 10 has showed and uses polynucleotide encoding antibody disclosed herein and substrate polynucleotide to carry out the method for multichannel cell sorting.Figure a shows that homogeneous measures, and wherein polynucleotide encoding antibody and cell make up, and then mixture is introduced on the DNA array microchip of point sample; Figure b shows that polynucleotide encoding antibody is assembled on the DNA array of point sample, introduces cell then; Figure c shows the bright visual field and the fluorescence microscopy images of multichannel cell sorting experiment, the 1:1 mixture space lamination of B cell (green channel) that wherein will express the T cell (red channel) of mRFP and express EGFP is on an A1 and C1, corresponding to respectively with the α-CD90.2 and the α-B220 antibody of A1 ' and C1 ' coding; Figure d is the fluorescence micrograph from the primary cell multichannel sorting of mouse collection.Utilize the anti-CD4-A1 ' of conjugate of polynucleotide encoding and anti-CD8-C1 ' respectively, will from the CD4+ cell of EGFP transgenic mice and from the 1:1 mixture separation of the CD8+ cell of dsRed transgenic mice to putting A1 and C1.

Figure 11 is the diagram that is used in combination polynucleotide encoding antibody disclosed herein and substrate polynucleotide, and it is used for cell sorting and/or detects the different molecule of chemical property jointly.

Figure 12 has showed the embodiment according to method and system disclosed herein, the ability of the multiple target of polynucleotide encoding protein detection; Figure a shows the microarray be exposed to antibody and polynucleotide, and described antibody has specificity to the antigen I L4 with polynucleotide C1 coding, described polynucleotide and polynucleotide B1 complementation with the fluorophore mark; Figure b shows the diagram of the embodiment of the method and system disclosed herein that is used to measure; Figure c shows among the figure A diagram with measurement result shown in the part of white wire segment identification.

Figure 13 shows micro-image, and it has showed that carrying out cell capture and gene and proteinic multiparameter simultaneously detects, and the scale line segment that shows among the figure is corresponding to 300l μ m.

Figure 14 shows a kind of protein array, and it is used for detecting in the embodiment of the target disclosed herein that microfluid assembles.

It is the fluoroscopic image and the bright field-of-view image of the protein immunoassay of template with DNA that Figure 15 is presented at what carry out in the microfluidic channel, with the white dashed line wide passage of 600l μ m that draws.Figure a shows the two-parameter immunoassay that the combination of use polynucleotide encoding antibody disclosed herein and substrate polynucleotide is carried out; Figure b is presented at and detects the target concentration series in the embodiment of method and system disclosed herein, wherein uses the technology based on fluorescence to detect; Figure c is presented at and detects the target concentration series in the embodiment of method and system disclosed herein, and the non-electro-deposition that wherein uses gold is as developing and amplifying strategy and detect.

Figure 16 is the diagram that is used in combination polynucleotide encoding antibody and substrate polynucleotide according to an embodiment of method and system disclosed herein, polynucleotide encoding antibody metal nanoparticle mark.

Figure 17 another diagram that to be Figure 16 be used in combination according to an embodiment of method and system disclosed herein, it shows and combine the also polynucleotide encoding antibody-target complex body of usefulness metal nanoparticle mark with substrate.

Figure 18 is the diagram according to the equipment and the methods involving of method and system detection signal disclosed herein, the use by oneself polynucleotide encoding antibody of metal nanoparticle mark of described signal.

Figure 19 shows that with method and system detection protein group disclosed herein the non-electro-deposition that wherein uses gold is as developing and amplifying strategy and detect.Figure a is presented under the concentration of about 100pM and detects; Figure b is presented under the concentration of about 100fM and detects; Figure c is presented under the concentration of about 100aM and detects.

Figure 20 shows that with method and system detection protein group disclosed herein the non-electro-deposition that wherein uses gold is as developing and amplifying strategy and detect.Figure a is presented under the concentration of about 100pM and detects; Figure b is presented under the concentration of about 1pM and detects; Figure c is presented under the concentration of about 10fM and detects; Figure d is presented under the concentration of about 100aM and detects; Figure e shows histogram, and its albumen prime number (y axle) with counting is associated with its concentration (x axle) in solution.

Figure 21 shows that with the protein group of method and system detection three kinds of protein (IFN-γ, TNF-α and IL-2) disclosed herein in being added with (spiked with) these 3 kinds of proteinic tissue culture medium (TCM)s the non-electro-deposition that wherein uses gold is as developing and amplifying strategy and detect.Figure a shows the detection of IFN-γ; Figure b shows the detection of TNF-α; Figure c shows the detection of IL-2.

Figure 22 shows and detects three kinds of protein (IFN-γ, TNF-α and IL-2) with method and system disclosed herein (figure is neutralize protein group in the healthy human serum (figure b) a), and the non-electro-deposition that wherein uses gold is as developing and amplifying strategy and detect being added with these three kinds of proteinic serum samples.

Figure 23 is a histogram, and it is showed with method and system disclosed herein protein markers Pten calibration and quantitative; Figure a shows histogram, has wherein showed detected mean fluorecence strength of signal from micro-fluid experiment shown in figure b and the c; Figure b shows to come the raw data at reorganization pten of self calibration swimming lane; Figure c shows the original fluorescence data from sample, and described sample is from two kinds of clones, and a kind of is the empty U87 that expresses the horizontal pten of substrate, and another kind was the cell sample of expressing U-87-pten.

Figure 24 has showed from finding that by tandem mass spectrometry serum biomarker (figure a or 1) is to carrying out antibody recognize by extensive SPR (figure b or 2) and selecting the approach of an embodiment affirmation clinical pathway (scheming c or 3) of use method and system disclosed herein again.

Detailed Description Of The Invention

The invention discloses test sample hit calibration method and system. In method and system disclosed herein, polynucleotide encoding protein and substrate polynucleotides are used in combination, with one or more targets in the test sample.

This paper uses term " detection " expression to determine there be (existence), (presence) or true (fact) occurring of target in the limited space segment or signal, and described limited space segment includes but are not limited to sample, reactant mixture, molecular complex and substrate. When expression, the quantity (quantity) that relates to or comprise measurement target drone or signal or amount (amount) (being also referred to as " quantitatively "), detection is " quantitative ", and it includes but not limited to be designed to measure any analysis of amount or the ratio of target or signal. When expression, relate to or just comprise that when the relative abundance of another target or signal (not quantitative) identified the character of target or signal or kind, detection was " qualitatively ".

This paper uses term " target " to refer to the goal analysis thing. Term " analyte " refers to the material whether it exists to be detected, compound or component in sample. Analyte includes but not limited to biomolecule, especially biomarker. Material, compound or component that this paper uses term " biomolecule " expression to be associated with biotic environment include but not limited to part, vitamin, hormone of sugar, amino acid, peptide, protein, oligonucleotides, polynucleotides, polypeptide, organic molecule, haptens, epi-position, biological cell, biological cell etc. Term " biomarker " refers to the biomolecule that is associated with bioenvironmental particular state, and described state includes but not limited to stage, health and the morbid state of cell cycle. The existence of biomarker, disappearance, minimizing, rise are associated with particular state, or indicate specific state.

This paper uses term " sample " to refer to representing limited amount these article of greater amount article, includes but not limited to from bioenvironmental fluid, sample, culture, tissue, commodity recombinant protein, synthetic compound or its part.

This paper uses term " polynucleotides " to refer to organic polymer by two or more monomer compositions, and described monomer comprises nucleotides, nucleosides or its analog. Term " nucleotides " refers to any in some following compounds, and described compound is comprised of the ribose or the deoxyribose that are connected with purine or pyrimidine bases and be connected with phosphate, and is the basic structural unit of nucleic acid. Term " nucleosides " refers to such compound (for example guanosine or adenosine), and it is comprised of purine or the pyrimidine bases with deoxyribose or ribose combination, and is present in the nucleic acid especially. Term " nucleotide analog " or " nucleoside analog " refer to that respectively wherein one or more individual atoms have been replaced by nucleotides or the nucleosides of homoatomic not or different functional groups. Therefore, term " polynucleotides " comprises the nucleic acid of any length, DNA RNA analog and fragment thereof. The polynucleotides of three or more nucleotides also are known as nucleotide oligomer or oligonucleotides.

This paper uses term " polypeptide " to refer to the organic polymer that is comprised of two or more amino acid monomers and/or its analog. Term " polypeptide " comprises the amino acid polymer of any length, comprises protein and the peptide of total length, and analog and fragment. Three or more amino acid whose polypeptide are also referred to as protein oligomer or oligopeptides. This paper uses term " amino acid ", " amino acid monomer " or " amino acid residue " to refer to that 20 kinds naturally exist any in the amino acid, comprise the synthesizing amino acid with non-natural side chain, and comprise D and L optical isomer. Term " amino acid analogue " refers to such amino acid, and wherein one or more individual atoms are replaced by different atoms, isotope or different functional groups, but other aspects are identical with its natural amino acid analog.

The polypeptide that this paper uses term " protein " to refer to have specific secondary structure and tertiary structure, it can participate in the interaction of (but being not limited to) and other biological molecule, and described other biological molecule comprises other protein, DNA, RNA, lipid, metabolin, hormone, chemotactic factor (CF) and little molecule.

This paper uses term " antibody " to refer to such protein, described protein is produced by the B cell of activation after antigenic stimulus, and is combined with antigentic specificity, and Promote immunity is replied in biosystem, described protein is comprised of four subunits usually, comprises two heavy chains and two light chains. Term " antibody " comprises natural antibody and synthetic antibody, includes but not limited to monoclonal antibody, polyclonal antibody or its fragment. Exemplary antibody comprises IgA, IgD, IgG1, IgG2, IgG3, IgM etc. Exemplary fragment comprises Fab Fv, Fab ' F (ab ') 2 etc. Monoclonal antibody is such antibody, is called single particular space and the polar structure specific binding of " epi-position " in itself and another biomolecule, and thereby is defined as complementary with it. Polyclonal antibody refers to the mixture of monoclonal antibody, and each monoclonal antibody is in conjunction with different antigenic epitopes. Antibody can be by technology well known in the art preparation, immune host and collect serum (polyclonal antibody) for example, or by preparation continuous hybrid oncocyte system and collect secreted protein (monoclonal antibody).

This paper is mentioning that wording " specifically ", " specifically " or " specificity " that molecule uses refer to identification between another molecule of described molecule and this, contact and form stable complex when another molecule is combined, and in described molecule and another molecule each with other molecules between significantly still less until do not identify, contact and form stable complex. Exemplary specific binding is antibody-AI, cell receptor-ligand interaction, multi-nucleotide hybrid, enzyme-substrate interaction etc. The term that this paper uses when mentioning the molecular components of complex " specificity " refers to the unique association of this component complex specific with it, and described component is the part of described specific complex. The term that this paper uses when mentioning polynucleotide sequence " specificity " refers to this sequence and unique association as the single polynucleotides of its complementary series.

Wording " polynucleotide encoding protein " refers to polynucleotides-protein complex, the coded polynucleotide that it comprises protein component and is attached to this protein component, described protein component and target specific binding also thereby are defined as with this target complementary. In some embodiments, the coded polynucleotide that is attached to protein is protein specific. It is known and need to utilize in the situation of this target of Sensitive Detection protein specific to interact to detect the mensuration of other protein, cell factor, chemotactic factor (CF), little molecule, DNA, RNA, lipid etc. that these embodiments are used in any target.

This paper uses term " polynucleotide encoding antibody " to refer to polynucleotide encoding protein, and wherein said protein component is antibody.

This paper uses term " to adhere to " or " adhering to " refers to connect or merge by key, connection (link), power or contact (tie), thereby two or more components are kept together, this term comprises directly or indirectly and adhering to, so that for example wherein the first molecule and the second molecule or the direct combination of material, and wherein one or more intermediate molecules are placed in embodiment between this first molecule and the second molecule or the material.

This paper uses wording " substrate polynucleotides " thereby referring to be attached to substrate keeps polynucleotides in conjunction with the ability of its complementary polynucleotide. The substrate polynucleotides especially can be comprised of following sequence, the coded polynucleotide specific binding of described sequence and polynucleotide encoding protein, and thereby be defined as complementary with it.

This paper uses term " substrate " to refer to holder or the substrate of bottom. Exemplary substrate comprises solid substrate, reads discernible other substrates behind the present disclosure such as glass plate, microwell plate, magnetic bead, silicon wafer (silicon wafer) and technical staff.

In polynucleotide encoding protein disclosed herein, each protein and predetermined target specific binding and thereby be defined as complementaryly with it, and each coded polynucleotide is with predetermined substrate polynucleotides specific binding and thereby be defined as complementary with it.

Protein is in the embodiment of antibody therein, and it is antibody-AI that protein-target interacts. Protein is not in the embodiment of antibody therein, and interaction can be that receptor-ligand binding, enzyme-substrate interact and the technical staff reads discernible other protein-protein interactions behind the present disclosure. For example, protein is in the embodiment of Streptavidin therein, and it is receptor-ligand binding that protein-target interacts, and wherein acceptor is Streptavidin, and part is free or is attached to the biotin of any other biomolecule.

In addition, in method and system disclosed herein, each substrate polynucleotides and coded polynucleotide in conjunction with aspect can be distinguished from each other. In some embodiments of method and system disclosed herein, each the substrate polynucleotides in the substrate are sequence-specific, and can be distinguished from each other in position.

This paper relate to the wording that minute period of the day from 11 p.m. to 1 a.m uses " in conjunction with aspect can distinguish " referring to can be based on the specific molecular specific binding and thereby be defined as complementary with it ability and the molecule distinguished. Therefore, if the first molecule is combined with the 3rd molecular specificity also thereby is defined as and the 3rd complementary element, and the second molecule be combined with the 4th molecular specificity that is different from the 3rd molecule and thereby be defined as and the 4th complementary element, then the first molecule and the second molecule in conjunction with aspect can distinguish.

This paper relates to wording that minute period of the day from 11 p.m. to 1 a.m uses " can distinguish " molecule that refers to the point that can occupy based on molecule or zone and distinguish on the position. Therefore, differentiable substrate polynucleotides are such substrate polynucleotides on the position, and it occupies point or position different on the substrate, and thereby are differentiable on the position.

Polynucleotide encoding protein disclosed herein can produce with common biological conjugation methods (bioconjugation method), for example chemical crosslinking comprises depending on to exist in the protein and treats in conjunction with the primary amine technology of (usually being present on the lysine residue). Especially, polynucleotide encoding protein especially can be puted together strategy by the covalency that shows for the Streptavidin (Fig. 2) of polynucleotide encoding antibody (Fig. 1) and polynucleotide encoding among Fig. 1 and 2 and produces.

In the embodiment that Fig. 1 shows, 5 '-polynucleotides of amination are by hydrazone key and antibody coupling (Kozlov, I.A.; Melnyk, P.C; Stromsborg, K.E.; Chee, M.S.; Barker, D.L.; Zhao, C.Biopolymers 2004,73,621-630), as shown in Figure 1 with the example of embodiment 1.

Identical biology is puted together chemical reaction and be can be used for producing any polynucleotide encoding protein, for example with the Streptavidin of polynucleotide encoding, such as the example of embodiment 2 and shown in Figure 2.

Wait that the coded polynucleotide number of puting together specific polynucleotide encoding protein can change. Especially can regulate and control to be attached to the polynucleotides number of protein component, minimize so that treat the size of bound fraction, thereby its steric hindrance is minimized, and still keep puting together specificity simultaneously. Can by example among the embodiment 3 and in relevant Fig. 3 illustrated step be optimized. In embodiment 3 and Fig. 3, produced different batches polynucleotide encoding antibody, the polynucleotides sum that wherein links to each other from each antibody is different. Because contain fluorogen in the coded polynucleotide of Fig. 3 and embodiment 3, so can use FACS to measure each variant to the joint efficiency of cell surface marker. It should be noted that, exist measurement and optimization as other similar techniques of the affinity of antibody of polynucleotides load function, the technology that comprises the binding kinetics of direct measurement antibody, such as surperficial plasmon resonance (surface plasmon resonance, SPR) and isothermal titration calorimetry (ITC).

In some embodiments, the coded polynucleotide number of waiting to be attached to each protein can be any number of from 1 to 6. In some embodiments (for example cell sorting), 3 coded polynucleotides of each protein attachment provide the three-dimensional effect that makes mark minimized additional advantages, and therefore allow to come mark polynucleotide encoding protein with the Multi-encoding polynucleotides, be used for the high-affinity hybridization with complementary substrate polynucleotides.

Also can control the length that forms the polynucleotides for the treatment of bound fraction, to optimize the combination of polynucleotide encoding protein and substrate. Especially, can be for the purpose of irrelevantization processing the length of Optimized Coding Based polynucleotides, such as institute's illustration among embodiment 8 and Fig. 9 with hereinafter further discuss.

In the following detailed description, frequent meeting reference wherein polynucleotide encoding protein is the embodiment of polynucleotide encoding antibody. After reading present disclosure, the technical staff should make the instruction that provides for polynucleotide encoding antibody be adapted to other polynucleotide encoding protein.

Can produce the substrate polynucleotides by the common technique of this area. For example, but chemical synthesis polynucleotides at first. Then according to Pat Brown (Schena M, Shalon D, Davis RW, the Brown PO.Science.1995 Oct 20 of Stanford; 270 (5235): the example that 467-70 points out carries out pin mark sample (pin spotted) to polynucleotides. Then can read discernible technology behind the present disclosure according to the technical staff, the substrate polynucleotides of producing like this are attached to substrate. Especially, comprise at least 75 monomer length on the poly-D-lysine substrate for the production of the suitable polynucleotides of substrate polynucleotides.

In some embodiments, coded polynucleotide and/or substrate polynucleotides are by haveing nothing to do processing, so that the non-specific binding between coded polynucleotide and the substrate polynucleotides minimizes. Therefore, the polynucleotides of irrelevantization processing comprise such polynucleotides, its sequence is produced by computer, so that incomplete base pairing, metastable state and/or other secondary structures minimize, thereby the non-specific interaction between the polynucleotides is minimized, and make usually with polynucleotides that the at random generation of correlated series is associated in non-linear secondary interaction minimize.

Use term " irrelevantization processing " to refer to that computer produces the process of one group of polynucleotides herein, wherein not exclusively base pairing, metastable state and other secondary structures are minimized, so that polynucleotides only are combined with its complementary strand, not with other any chain combinations. The exemplary irrelevantization treatment technology that uses in the present disclosure comprises according to (Dirks, R.M. such as Dirks; Lin, M.; Winfree, E.; Pierce, N. A.Nucleic Acids Research 2004,32, (4), 1392-1403) the irrelevantization processing carried out of described example.

Particularly, in some embodiments, coded polynucleotide is to have the irrelevantization processing polynucleotide (see embodiment 8 and relevant table 1) of SEQ ID NO:7 to the sequence of SEQ ID NO 18 with corresponding complementary substrate polynucleotide.

Can further identify the polynucleotide of other irrelevantization processing by method and step (irrelevantization of computer processing (being computerized irrelevantization processing) and technician as the illustration among the embodiment 8 and the polynucleotide of setting forth read other steps that can understand behind the present disclosure) in Fig. 9.

Method and system disclosed herein can be used for detecting the mensuration of target, comprises that one-parameter is measured and multiparameter is measured, and all can be used as multichannel mensuration and carries out.

This paper uses term " one-parameter mensuration " to be meant to be used to measure a kind of existence of target, does not exist or quantitative analysis.Term " multiparameter mensuration " is meant and is used to measure the existence of multiple target, does not exist or quantitative analysis.Term " multichannel " is measured and be meant that multiple assaying reaction (for example measuring multiple analytes simultaneously) carries out and/or the mensuration to analyze in single separation and the test format in single reactor.

In some embodiments, method and system disclosed herein can be advantageously used in and carry out diagnostic assay, and target wherein to be detected is and the predetermined biomarker of being scheduled to the disease-related connection.These embodiments are especially favourable in such diagnostic method, and wherein different types of biomaterial and each leisure of biomolecules are generally in the heterogeneous tissue sample different zones and measure, and inevitably are difficult to quantitative noise source thereby introduced.

In some embodiments of method and system disclosed herein, polynucleotide encoding protein and substrate polynucleotide are used in combination, and as shown in Figure 4, the protein of polynucleotide encoding shown in it is polynucleotide encoding antibody.

In the embodiment of Fig. 4, polynucleotide encoding antibody (10) provides with substrate (100) combination.Polynucleotide encoding antibody (10) is made up of antibody (11) and coded polynucleotide (12).Substrate (100) has and substrate surface bonded substrate polynucleotide (120).Coded polynucleotide (12) and substrate polynucleotide (120) complementation are so that substrate polynucleotide (120) are hybridized after contacting with coded polynucleotide (12).

In the embodiment depicted in fig. 4, polynucleotide encoding antibody disclosed herein forms protein array, and it can contact with sample, with the target in the test sample.The embodiment of Fig. 4 is especially favourable for detection and/or sorting protein matter target.

In other embodiments, especially be applicable to detect and/or the embodiment of sorting cells target in, with polynucleotide encoding antibody with before complementary substrate polynucleotide contact, some or all polynucleotide encoding antibody are contacted with sample.In these other embodiments, combination that antibody and one or more corresponding targets can be when the linerless ends (for example solution mutually in), wherein two kinds of molecules all have orientation freedom completely, and the approaching substrate effect that is not subjected to of target antagonist binding pocket (binding pocket).In addition, the protein denaturation of spatial induction not taking place, because polynucleotide encoding antibody is retained in the solution, has kept proteinic three grades to fold.In addition, biofouling is minimized (description that also vide infra), has improved sensitivity and the specificity of being measured thereby compare with system with the correlation method of this area, and with the detectability of substrate bonded antibody target complex body.The exemplary that shows some above-mentioned advantages is shown in Fig. 5,7,8,11 and 13.

In method and system disclosed herein, finally detect and substrate bonded antibody-target complex body from substrate.

In some embodiments, by the detection of carrying out complex body through the molecule of mark is provided, described molecule through mark comprise can specificity in conjunction with any molecule (for example antibody, aptamers, peptide etc.) of polynucleotide encoding protein-target complex body to be detected, and the mark that marking signal is provided, describedly be attached on the described molecule through tagged compound.To contact with polynucleotide encoding protein-target complex body through the molecule of mark, can read the discernible method in present disclosure (especially embodiment part) back according to the technician then and come the certification mark signal, described marking signal from substrate on polynucleotide encoding protein-target complex body bonded through tagged compound.

As hereinafter detecting in greater detail in the embodiment of one or more targets and/or multiple target, can form through tagged molecule by multiple therein through tagged molecule.Every kind through tagged molecule comprise with one or more targets/multiple target in a kind of target specificity bonded molecule, and the tagged compound that is attached to this molecule, this tagged compound provides marking signal, and each molecule through mark can be distinguished from each other in context of detection.

This paper relates to the wording of using through tagged molecule and " can distinguish in context of detection " and be meant the molecule that can distinguish based on the marking signal that tagged compound provided that is attached to this molecule.Exemplary tagged compound (its can be used in be provided at context of detection differentiable through tagged molecule) includes but not limited to that radio isotope, fluorophore, chemoluminescence dyestuff, chromophore, enzyme, enzyme substrates, enzyme cofactor, enzyme inhibitors, dyestuff, metal ion, nano particle, metal-sol (metal sol), part (biological example element, avidin, Streptavidin or haptens) and technician read discernible other compounds behind the present disclosure.

In some embodiments, contact certain hour through tagged molecule under certain condition with multiple polynucleotide encoding protein-target complex body, combine through tagged molecule with multiple to allow multiple polynucleotide encoding protein-target complex body with multiple.Certification mark signal then, this signal from substrate on multiple polynucleotide encoding protein-target complex body bonded multiple through tagged molecule.

In some embodiments, detection method can be undertaken by the reading (readout) based on fluorescence, wherein through traget antibody fluorophore mark, described fluorophore includes but are not limited to small molecules dyestuff, protein chromophore, quantum dot (quantum dot) and gold nano grain.Particularly, in some embodiments, in any method and system disclosed herein, detection can be carried out in the secondary detection system of gold nano grain mark, and the Chang Yong scalable gold nano grain of photographic development liquid wherein is as hereinafter further describing.In addition, if reading comes from dark-field (dark field) scattering of gold grain, then can carry out unit molecule numeral Proteomic analysis.It is discernible that other technology is that the technician reads behind the present disclosure, will no longer further go through.

This paper is meant the molecule that can detect as term " mark " and " through the tagged molecule " of the component of complex body or molecule, includes but not limited to radio isotope, fluorophore, chemoluminescence dyestuff, chromophore, enzyme, enzyme substrates, enzyme cofactor, enzyme inhibitors, dyestuff, metal ion, nano particle, metal-sol, part (biological example element, avidin, Streptavidin or haptens) or the like.Term " fluorophore " is meant material or its part that can demonstrate fluorescence in detectable image.Therefore, wording used herein " marking signal " is meant that the permission by the mark emission detects the signal of this mark, includes but not limited to radioactivity, fluorescence, chemoluminescence, produces compound or the like in the result of enzyme reaction.

In some embodiments, detect a kind of specificity target.In these embodiments, can with polynucleotide encoding antibody with polynucleotide encoding antibody is contacted with target before or after substrate contacts.

Wherein polynucleotide encoding antibody and the embodiment that polynucleotide antibody is contacted with target before substrate contacts are being particularly useful for sorting or are detecting cell.In these embodiments, bonded efficient and specificity are maximized between antibody and the target, even if also be like this for detecting single target.The explanation of a kind of possibility (but uncertain) is, in method and system disclosed herein, target is caught the interaction that is not by antibody pair cell surface marker and is driven, but by driving by collaborative avidity in conjunction with corresponding chain on antibodies specific polynucleotide that improve and the microarray, this has significantly improved capture rate.This advantage especially target cell with such is relevant, and it can be caught effectively, is converged the DNA point (seeing embodiment 5 and Fig. 5) that cellular layer occupies fully thereby use this method typically to observe.

Wherein be particularly useful for the highly sensitive sorting or detect protein in polynucleotide encoding antibody and the embodiment that polynucleotide encoding antibody is contacted with target after substrate contacts.Disclosed hereinly wherein be illustrated in embodiment 12 and 13 with the exemplary of the method and system that polynucleotide encoding antibody is contacted with target after substrate contacts, and be shown in Figure 15,19,20,21,22,23,24 (c) at polynucleotide encoding antibody.In these embodiments, can eliminate in conjunction with between the polynucleotide encoding protein of target and the polynucleotide encoding protein that does not combine target to the competition of same specificity substrate polynucleotide, thereby improve the sensitivity of measuring.In addition, in these embodiments, by determining various bonded epuilibrium thermodynamics laws, can optimize the concentration of polynucleotide on the substrate, make the polynucleotide encoding protein of greater concn to combine with substrate, this so can cause the concentration of complex body of correct assembling higher, and then improve whole detection sensitivity.

Can use the method and system of illustration among Figure 4 and 5 and the embodiment 5 to carry out one-parameter mensuration, described method and system includes but not limited to: any mensuration that is used for detecting serum unique identification thing, single protein detection in the biological sample, carry out cell sorting according to a kind of surface marker, and the technician reads discernible other mensuration behind the present disclosure.

In some embodiments, carry out the detection of multiple target according to the strategy shown in Fig. 6.

Produce multiple polynucleotide encoding antibody (10,20 and 30), every kind of polynucleotide encoding antibody can the specificity combination have a kind of predetermined target of antibody component (11,21 and 31), and can be in conjunction with the complementary substrate polynucleotide that have coded polynucleotide component (12,22 and 32).Generation has the substrate of the differentiable substrate polynucleotide of sequence-specific and position (112,122 and 132).

Then polynucleotide encoding antibody (10), (20) are contacted with (132) with substrate polynucleotide (112), (122) with (30), and at the antibodies specific polynucleotide with after corresponding substrate polynucleotide combine, the self-assembly on substrate of polynucleotide encoding antibody complex body.

In the embodiment shown in Fig. 6, produce protein array by multiple combination can be distinguished and the differentiable antibody in position is formed.These embodiments are for the highly sensitive sorting and/or to detect different protein-targets be especially favourable.The exemplary embodiment of being illustrated in 9,10 of these embodiments and 12 and Figure 10,12,13 and 15a in show.

In other embodiments, before contact substrate polynucleotide, multiple polynucleotide encoding antibody is contacted with sample, be used to detect relevant target.In these embodiments, method and system disclosed herein can be used for carrying out the multichannel multiparameter and measures, wherein since with antibody and target when not having substrate in conjunction with sensitivity that is associated and optionally raising, and, can effectively detect the large number of biological mark in mode quantitatively and/or qualitatively in view of the minimizing of biofouling and protein denaturation.These embodiments exemplary be illustrated in

embodiment

9,10 and 12 and Figure 10,12,13 and 15 in show.

Example and be shown in multiparameter that Figure 10,12,13 and 15 method and system carry out and measure and include but not limited to any proteome analysis, fabric analysis, serum diagnosis, biomarker, serum collection of illustrative plates (serum profiling), multiparameter cell sorting, unicellular research among the

available embodiment

9,10 and 12, and those skilled in the art read discernible other mensuration behind the present disclosure.

In some embodiments, shown in Figure 6 being used in combination can be applicable in the method for the multiple target of sorting, and this is especially favourable at described multiple target when forming by dissimilar cell (especially primary cell).In these embodiments, according to example among the embodiment 9 and be shown in the method for Figure 10, preferably contacting with substrate BeforePolynucleotide encoding antibody is contacted with the sample that comprises cell.

It is more favourable that the embodiment of the method and system that wherein multiple target is made up of dissimilar cells is especially for example eluriated (panning) than corresponding existing method and system, wherein cell be imprinted on the surface marker specific antibody of supporting on the substrate and contact (Cardoso, A.A.; Watt, S.M.; Batard, P.; Li, M.L.; Hatzfeld, A.; Genevier, H.; Hatzfeld, J.Exp.Hematol.1995,23,407-412).Particularly, owing to use polynucleotide that antibody is combined with substrate, the cell capture efficient on substrate improves (seeing Fig. 5 and Figure 10) for the method and system of prior art.In addition, these embodiment preferred not and the identical restriction of conventional point sample protein microarray, the antibody of correct orientation from the teeth outwards always not for example, and/or may be excessively dry and lose the antibody of function.

The embodiment of any sorting cells all has the some advantages that are better than cell sorting method known in the art and system (as FACS), because the cell by method and system sorting disclosed herein can be used for gene and/or protein expressioning analysis after the sorting immediately.In addition, method and system disclosed herein carries out the space multi-way sorting to various kinds of cell, this is especially effective in according to various kinds of cell surface marker sorting cells, and do not can be used for the restriction that the mark branch is selected the different fluorophore quantity of the spectrum of cell surface marker for use, as embodiment 9 with as shown in relevant Figure 10.

In some embodiments, being used in combination shown in Fig. 6 can be used for detecting according to method shown in Figure 11 the target of number of chemical different in kind.Particularly, shown that this method is used to separate multiple different biomarker such as DNA, cell and protein.In the embodiment depicted in fig. 11, be used for analysis of cells, gene and proteinic multiparameter mensuration, use is attached with the substrate (2) of multiple substrate polynucleotide (3) and implements method and system disclosed herein, (see Figure 11 with isolated cell (1), arrow A 1) also analyzes relevant genome and proteomics feature (signature) (seeing Figure 11, arrow 2).

In some such embodiments, sample is contacted with multiple polynucleotide encoding antibody, to allow forming multiple biomarker complex body with polynucleotide encoding, then it is contacted with substrate such as DNA array, wherein antibodies specific polynucleotide specificity is in conjunction with corresponding D NA chain.Detect in some embodiments of target polynucleotide in expectation, also can be with specificity in conjunction with the combining with sample of target polynucleotide through the mark polynucleotide, generation is through the target polynucleotide of mark, and it combines with predetermined DNA chain specificity on the substrate.Target polynucleotide through mark finally combines also detected with the substrate polynucleotide.According to this method, cell, protein and DNA biomarker are detected on single substrate then by sorting, measure thereby allow advantageously to carry out the multichannel multiparameter.

In these embodiments, by using polynucleotide as cell, cDNA and proteinic general assemble strategy, can be at high DNA load on the point sample substrate and the load-optimised substrate condition of the complementary DNA on the antibody.Allow be used for the highly sensitive sandwich method for determining of protein detection and efficient cell sorting (with tradition elutriation compare) based on polynucleotide in conjunction with relevant biological dirty reduction with antibody on this optimization and the substrate.A kind of illustrative methods and the system that carry out the different biomarker detection of chemical property describe in embodiment 10 and are shown among Figure 13.

Use example among the

embodiment

9,10,12 and 13 and be shown in target sorting that Figure 13,10c, 10d, 15a, 22,23,24 method and system can carry out and measure and comprise that the technician reads behind the present disclosure mensuration of particular target (including but not limited to cell target, protein target or gene target) in discernible any needs detection mixture.

In some embodiments, can carry out the high-sensitivity detection of single or multiple target by antibody, described antibody carries out mark with the metal nanoparticle that is used to detect, and carries out non-electro-deposition deposition (electroless metal deposition) then.

In these embodiments, can implement any method and system disclosed herein, to detect and the protein-target complex body of substrate bonded with polynucleotide encoding by using metal nanoparticle (especially gold nano grain) molecule that serves as a mark.Particularly, metal nanoparticle (as gold nano grain) with put together through the molecule (for example second antibody) of mark, be used for mark and substrate bonded polynucleotide encoding protein-target complex body.Metallic particles (as gold nano grain) has unique optical characteristics, because the particle more much smaller than visible wavelength still can use scattering of light imaging easily.This allows to use the scattering of light microscope by counting nanoparticle label (thereby and counting protein) reading to be carried out in immunoassay.This method also is defined as numerical approach and digital DEAL in this article---and suppose each nano particle corresponding to single protein, then the granule number of counting is represented the proteinic absolute quantity of catching by specific antibody.

Figure 16 and 17 has shown a kind of exemplary of method and system disclosed herein, and wherein tagged molecule comprises metal nanoparticle, as gold nano grain.Particularly, gold nano grain (210) is attached on the second antibody (212) by linkers (211).One or more ssDNA oligomer (214) on first antibody (213), have been adhered to.Target to be detected (217) is in solution or the coenocorrelation.Mensuration itself should go up in the surface that is coated with ssDNA ' (215) (216) and measure.Exemplary embodiment further is showed in Figure 18 to 22, and in embodiment 13 example.

When using metal nanoparticle to carry out mark, an advantage of some embodiments of method and system disclosed herein is not need at every turn all to measure the back immunoassay are calibrated carrying out protein, because the protein content of counting is represented absolute measured value.Comparatively speaking, fluorometric assay or absorbance measurement have been represented the relative measurement value, because they depend on background fluorescence (absorbancy) level, light amplification electronics, photobleaching (for fluorescence) or the like.Numerical approach and system based on nano particle disclosed herein can be advantageously used in: (1) (exceeds conventional ELISA immunoassay 10 in high aM level ³-10 ⁶Improvement doubly) detection protein in hypersensitive ground and under the wide concentration range; (2) multichannel detects multiple proteins on same chip; (3) extracellular signaling molecule---the cytokine among the detection people patients serum.

Some embodiments of method and system disclosed herein (wherein by using metal nanoparticle to carry out mark and detection) are based on following detection system, as Rayleigh scattering mechanism, its permission will manifest indirectly with the individual plasmon nano particle (plasmonic nanoparticle) that detection antibody is puted together, thereby realize single protein counting, described particle is the gold nano grain of 40nm in this case.Can use graphics software interface (graphical software interface) that the particulate absolute number is carried out digital counting, thus the amount of quantitative protein.These embodiments are completely contradicted with use the conventional quantivative approach of average signal reading after amplification.Combine with the antibody library technology of dna encoding, the serve as a mark method and system of compound of use metal nanoparticle disclosed herein can make the detection demultiplexing by the different sorts protein of counting simultaneously from identical biological sample.

Another advantage that method and system disclosed herein (wherein use nano particle serve as a mark compound) is better than existing highly sensitive protein detection technology (it is based on the variant of ELISA scheme) is, might erasure signal amplifies with relevant extra noise and moves the required time.Art methods all needs certain amplification procedure, and every kind of method all needs the calibration of certain level, and described calibration must be measured at each that implemented and carry out.For example, reported the method for wherein using the dna marker second antibody and using polymerase chain reaction (PCR) DNA amplification.This DNA after this amplification is detected and be associated with measured protein concn subsequently.In another modification, with gold nano grain mark second antibody, (pass through non-electro-deposition) then argent is deposited on the gold nano grain, thereby produce the absorbance signal that amplifies.For both of these case, amplification procedure itself is all introduced noise in measuring, and needs extra time, normally a large amount of time.

Another advantage that the method and system disclosed herein of use nano particle is better than described art methods is that art methods all is not digital, be that these methods all do not relate to actual count protein quantity, but the measurement relative signal, as fluorescence or absorbancy.This means that they must be calibrated.On the contrary,, then do not need calibration, because proteinic counting produces the absolute number that can be associated with protein concn in case characterized the mensuration of being undertaken by method and system disclosed herein (its use metal nanoparticle serve as a mark compound).

This application is for the detection in the proteomics field (Figure 21 and 22) and/or detect that to be present in for the biomarker (Figure 19 and 20) in the small samples (for example bleeding) with extremely low concentration be especially favourable.

In other embodiments, the substrate in any method and system disclosed herein can be associated with microfluid component, thereby allows to carry out the mensuration based on microfluid.Mensuration based on microfluid provides following advantage, for example as the sample that reduces and minute (Breslauer, the D.N. of reagent volume and shortening; Lee, P.J.; Lee, L.P.Mol.BioSyst.2006,2,97-112).For example, under some operational condition, surface bonding is measured kinetics mainly by analyte (protein) concentration and analyte/antigen avidity decision, rather than by diffusion decision (Zimmermann, M.; Delamarche, E.; Wolf, M.; Hunziker, P.Biomedical Microdevices 2005,7, (2), 99-110.).

This paper uses term " microfluid " to be meant assembly or the system that contains the microfluid member, for example passage and/or the chamber made from micron or submicron-scale usually.For example, typical passage or chamber have at least one for about 0.1 micron to about 1500 microns, be more typically about 0.2 micron to about 1000 microns, be more typically about 0.4 micron and arrive about 500 microns cross-sectional dimension (cross-sectionaldimension).Individual microfluid member is loaded with very small amount of fluid usually, for example receives from about 10 and is raised to about 5 milliliters, more generally receives from about 100 and is raised to about 2 milliliters, further more generally receives from about 200 and is raised to about 500 microlitres, or still more generally receive from about 500 and be raised to about 200 microlitres.

Described microfluid component can be included in the integrated equipment (integrated device).This paper uses " integrated equipment " to be meant the equipment with two (or more) assemblies, and described assembly is combined physically with in the operation.Assembly can (completely or partially) be made and make the back in its (wholly or in part) and make up independently of one another, and perhaps described integrated equipment can be made into and comprises different assemblies in this integrated equipment.Integrated microfluidic arrays (microfluidic array) equipment comprises the array with the microfluid component combination, wherein this microfluid component and array component operationally are associated each other, thereby the array substrate of this array component is communicated with the microfluid member fluid of microfluid component.Microfluid component is such assembly, and it comprises the microfluid member, and is suitable for operationally being associated with array component.Array component is the assembly that comprises substrate and be suitable for operationally being associated with microfluid component.

Also can provide microfluid system with modular form." module " described such system or equipment, and it has the multiple modular unit that is used for using together, and wherein one of multiple different instances of a class component can be replaced by the another kind in the similar assembly, to change the function or the ability of system or equipment; In such system or equipment, each modular unit all is one " module ".

Carry out the exemplary of the method and system disclosed herein of microfluidic assay and in

embodiment

10 and 11, describe and be shown in Figure 13 and 14.

In the microfluid embodiment of method and system disclosed herein, might in minimum sample volume, measure very big protein markers spectrum, and may obtain low-down background/biofouling (seeing Figure 14).

In the microfluid embodiment of method and system disclosed herein, can also improve the sensitivity of mensuration, be low to moderate the target of 10fM with detectable level, comprise the biomarker of before thinking below the detection level of any other technology (for example protein in the human serum).

In exemplary embodiment, obtain such result: improve the loading capacity and the antibody that uses with the metal nanoparticle mark that is used to detect of substrate, carry out non-electro-deposition deposition (seeing embodiment 11 and Figure 14 (c)) then by following steps.

In addition, because in exemplary embodiment, demultiplexing usage space rather than colorimetric in method and system disclosed herein is so can be converted into optical readings with the reading based on fluorescence.Therefore, microfluidic methods disclosed herein and system allow mensuration is carried out optical readings, and this is than sensitive 100-1000 times (the seeing Figure 14) of corresponding existing method and system.Therefore, the another advantage of microfluidic methods disclosed herein and system is, might use described method and system as digital technique, promptly comes the proteinic technology of detection by quantitative by monomolecular counting.This application is particularly advantageous in the detection (Figure 14) in proteomics field and/or is present in the detection of the biomarker in the small samples (for example bleeding) with extremely low concentration.

Therefore, compare with system with system and other non-microfluidic methods with the corresponding existing microfluidic methods that is used for Molecular Detection, microfluidic methods disclosed herein and system allow in the time quantum that reduces, to use sample that size reduces with higher sensitivity carry out (i) single stage measure (wherein polynucleotide encoding antibody, target contact in single step with antibody through mark) and (ii) multistep measure (wherein the substrate priority contacts with polynucleotide encoding antibody, target, contacts with second antibody subsequently) (seeing embodiment 11 and 12) suddenly.

Another advantage that is associated with microfluidic methods disclosed herein and system comprises, might relate to any mensuration of the antibody of supporting with substrate in microfluidic environment, they can't bear micro-fluid chip when using previous technology assembling.

Other advantages relevant with method and system disclosed herein are: might use low-cost reagent such as glass and plastics to carry out sensitive and measure; Substrate and other combination of components that are used for sample pretreatment and purifying might be used.

Method and system disclosed herein allows to carry out the detection of multichannel multiparameter, sorting and the relevant diagnositc analysis of purpose biomarker.Be used for the exemplary embodiment of being illustrated in 14 that this paper method and system of diagnositc analysis uses and describe and in Figure 23 and 24, show, also have the technician to read discernible any other mensuration behind the present disclosure.

System disclosed herein can provide with the form of array or test kit.Array is called " microarray " sometimes, is meant any one dimension, two dimension or the three-dimensional arrangement of addressable area, and described zone has the specific molecular that is associated with this zone.Common distinctive characteristic dimension is a micron.Fig. 4,5,6,7,8,9 and 10 provides exemplary microarray.

In test kit, polynucleotide encoding protein and substrate are included in the test kit independently.Polynucleotide encoding protein is included in one or more compositions, and each polynucleotide encoding protein is included in the composition with suitable carriers (vehicle), vehicle (carrier) or auxiliary (auxiliary agent).

The substrate that provides in the system can have the polynucleotide that are attached to this substrate.In some embodiments, the substrate polynucleotide additional assemblies that also can be used as test kit provides.Additional assemblies can comprise through the mark polynucleotide, through traget antibody, mark, micro-fluid chip, reference standard product, and the technician reads discernible additional assemblies behind the present disclosure.Particularly, the assembly of test kit can must provide by reagent with suitable operation instruction and other, to carry out method disclosed herein.Test kit is independently containing composition in the container usually.Usually comprise the specification sheets that is used to measure in the test kit, for example literal on paper or electron carrier such as tape or the CD-ROM or audio description book.According to the concrete grammar that uses, test kit also can contain other and be packaged in interior reagent and material (being lavation buffer solution or the like).

Those skilled in the art read can discern behind the present disclosure and relate to suitable vehicle reagent (carrier agent) or the general manufacturing of auxiliary and test kit and other details of packing of identifying composition.

Embodiment

Method and system disclosed herein is further elaborated in the following embodiments, and it provides with illustrative approach, and is not intended to restriction.

Embodiment 1: produce the antibody with polynucleotide encoding

According to two step strategies generation shown in Figure 1 antibody with dna encoding.Particularly, (Fig. 1 figure a) to use the commercial reagent to introduce aldehyde functional group by the succinimide chemical reaction in the aminating oligonucleotide of 5-.Similarly, by with corresponding antibodies in the reaction of lysine side-chain introduce the hydrazides part (Fig. 1 figure a).Forming by the stoichiometric hydrazone key between aldehyde and the hydrazides functional group then promotes the DNA-antibody conjugates to form.Form and control DNA load (Fig. 1 figure b) by PAGE electrophoresis checking conjugate.

In order to carry out these experiments, buy the anti-human IgG of polyclone goat of using AlexaFluor 488,594 and 647 marks from Invitrogen.Mono-clonal rabbit antihuman interleukin-4 (clone 8D4-8), the anti-human tumor necrosis factor-alpha of rabbit non-blooming and the APC mark (being respectively clone MAb1 and MAb11), and the non-blooming and anti-human interferon-gamma of the rabbit PE mark (being respectively clone NIB42 and 4S.B3) is all available from eBioscience.Non-blooming and biotin labeled mouse anti human interleukin-2 (being respectively clone 5344.111 and B33-2) is available from BD Biosciences.All DNA chains all with have 5 '-amido modified form is available from Midland Certified Reagent company.All six 26 aggressiveness and naming accordingly in following table 1 with separately name/identifier provide, and by described name/identifier sequence are listed in the incidental sequence table.

Table 1

Name/identifier	Sequence
Name/identifier	Sequence	SEQ?ID?NO?1	A1：5’-NH2-AAAAAAAAAACGTGACATCATGCATG-3’
SEQ?ID?NO?2	3’-GCACTGTAGTACGTACAAAAAAAAAA-NH2-5’：A1’	SEQ?ID?NO?1	A1：5’-NH2-AAAAAAAAAACGTGACATCATGCATG-3’
SEQ?ID?NO?2	3’-GCACTGTAGTACGTACAAAAAAAAAA-NH2-5’：A1’	SEQ?ID?NO?3	B1：5’-NH2-AAAAAAAAAAGGATTCGCATACCAGT-3’
SEQ?ID?NO?4	3’-CCTAAGCGTATGGTCAAAAAAAAAAA-NH2-5’：B1’	SEQ?ID?NO?3	B1：5’-NH2-AAAAAAAAAAGGATTCGCATACCAGT-3’
SEQ?ID?NO?4	3’-CCTAAGCGTATGGTCAAAAAAAAAAA-NH2-5’：B1’	SEQ?ID?NO?5	C1：5’-NH2-AAAAAAAAAATGGACGCATTGCACAT-3’
SEQ?ID?NO?6	3’-ACCTGCGTAACGTGTAAAAAAAAAAA-NH2-5’：C1’	SEQ?ID?NO?5	C1：5’-NH2-AAAAAAAAAATGGACGCATTGCACAT-3’

With all antibody desalinations, be pH7.4PBS before using, and use 3000MWCO centrifugal filter (Millipore buffer exchange ^TM) it is concentrated into～1mg/ml.

In the parallel introducing monoclonal antibody of hydrazides group, and from 5 ' (figure that sees Fig. 1 is a) for single stranded DNA that aminating oligomer preparation 5 ' aldehyde is modified.

Particularly, with succinyl-4-diazanyl nicotinic acid acetone hydrazone (succinimidyl4-hydrazinonicotinate acetone hydrazone, SANH, Solulink ^TM) the different molar excess (1000:1 is to 5:1) of antagonist adds the SANH among the DMF in antibody.Change the hydrazides group number of introducing antibody by this.In PBS, add succinyl-4-formyl radical benzoic ether (succinimidyl4-formylbenzoate, SFB, Solulink among the DMF in 5 ' aminating 26 yuan of oligomer with 20 times of molar excess independently ^TM).This ratio of SFB and DNA guarantees that 5 ' amido complete reaction produces 5 ' aldehyde.After at room temperature 4 hours, the two does not all observe the further raising of productive rate described antibody and oligonucleotide linked reaction.Remove excessive SANH and SFB, and use the centrifugal post (Pierce of albumen desalination ^TM) be the pH6.0 citrate buffer with the buffer exchange of sample.

Then with 20 times of excessive derivatize DNA and antibodies, and allow at room temperature to react to spend the night, form the antibody of the dna encoding that shows among the figure b of Fig. 1.With the centrifugal post of size exclusion (Bio-Gel P-30, Bio-Rad ^TM) remove not link coupled DNA, or use Pharmacia Superdex200 gel-filtration column purifying under 0.5ml/ minute PBS equal strength stream (isocratic flow).Under 60 ℃ loose sex change condition, use synthesizing 5 minutes of irreducibility 7.5% Tris-HCl SDS-PAGE validating DNA-antibody conjugates, and develop with Molecular Imager FX gel scanner (Bio-Rad).Use suitable excite and launch spectral filter, similarly the conjugation reaction that relates to fluorescence antibody or fluorescent mark oligonucleotide is carried out imaging.

Measure the load of different oligomers on the anti-people IL-4 (chain A1 ') by the gel shift rate fluctuation measurement) (seeing the figure b of Fig. 1).By changing the stoichiometric ratio (swimming lane I-IV corresponds respectively to 300:1,100:1,50:1,25:1) of SANH and antibody, can control and on average adhere to the oligonucleoside acid number.

Estimate to cause the DNA load distribution at each antibody although it should be noted that above-mentioned conjugate synthetic method, this effect can be subjected to carrying out the influence of the method that PAGE analyzes.Especially observe, the normal condition of the thermal induction sex change before the gel electrophoresis (100 ° 5 minutes) has reduced the DNA chain quantity of developing, and this may be because due to the hydrazone bond rupture between DNA and the protein.By loosening the sex change condition, show 7 discrete bands at the most at 60 ° of samples that heat 5 minutes (the good required minimum value of gel), and show there is not additional oligonucleotide in 5 minutes same sample of 100 ° of heating.

Embodiment 2: the Streptavidin of producing polynucleotide encoding

The identical approach of antibody that the generation of the Streptavidin of dna encoding is produced dna encoding according to being used to described in the embodiment 1 carries out.Unique difference is SANH: the Streptavidin ratio is kept the constant 100:1 that is.

Embodiment 3: the polynucleotide load of optimizing polynucleotide encoding antibody

Unfavorable steric effect in the time of will considering with the oligonucleotide traget antibody when carrying out multiple measure, immunoassay for example as herein described of described mensuration and cell sorting/catch experiment.For this reason, studied the ability that the coded antibody of DNA keeps the recognizing cells surface marker, (FACS) manifests by the fluorescent activation cell sorting.By using covalent labeling, use FACS that the conjugate of polynucleotide encoding is optimized DNA load at the fluorophore on the DNA rather than on the antibody.For carrying out this analysis, with the different chemical metering of SANH and antibody than (5:1,25:1,50:1,100:1,300:1) with 5 ' dna marker of aminating, 3 ' FITC mark is on anti-CD90.2 antibody.This average generation have 1,2,3 respectively, the conjugate of 4-5 and 6-7 bar FITC-DNA chain, measured as measuring by gel shift rate, see the figure d of Fig. 1.By with flow cytometer monitoring FITC fluorescence, test the ability of these conjugates in conjunction with T clone VL3 (expressing CD90.2).Use B clone A20 (CD90.2 feminine gender) as negative control (seeing Fig. 3 figure a and b).

Particularly, the rat anti-mouse CD90.2 that VL3 and A-20 cell are puted together with 0.5 μ g FITC-on ice (Thyl.2, BD Pharmingen, clone 30-H12, catalog number (Cat.No.) 553012) was hatched 20 minutes in 100 μ L PBS-3% FCS.Also use the anti-CD90.2/FITC-DNA conjugate incubated cell of equimolar amount, described conjugate feature is different FITC-DNA load.With PBS-3%FCS once, then at operation BD FACSDiva with cell washing ^TMThe BDFACSCanto of software ^TMAnalyze by flow cytometry on the equipment.

The result shows in Fig. 3, and (figure a) and histogram (scheming b) wherein to have shown the FACS curve that will resist CD90.2/FITC-DNA conjugate and the anti-CD90.2 antibody of commercially available FITC (no DNA) to compare.

As shown in Figure 3, this conjugate has very little non-specific interaction (1.3%) in conjunction with VL3 cell (100%) with A20.Compare with the anti-CD90.2 of FITC, 10 times of overall fluorescent strength degradation are then high slightly with the non-specific binding of A20.Histogram at the average fluorescent strength of multiple FITC-DNA load shown in the figure b shows that fluorescence intensity roughly is linear when the quantity of DNA chain is increased to 2 to 3 from 1, corresponding to 1,2 and 3 chromophore (every chain 1).For higher load.Fluorescence is stable, descends then.

Particularly, under higher load, the increase of fluorescence at first stable (4-5 oligomer) reduces then until crest (6-7 oligomer).Therefore, excessive dna marker (4-7 oligomer) has spatially reduced the ability of antibody recognition cell surface marker really.SANH with 50:1: antibody ratio (corresponding to three DNA chains of about each antibody) synthetic antibody has been realized the optimal load of pair cell surface marker identification.Consider this observations and carried out cell sorting experiment subsequently.Compare with the anti-CD90.2 of FITC contrast, the dna antibody conjugate has and has reduced 10 times fluorescence and the non-specific binding high slightly to the A20 cell.A possible factor is for dna antibody conjugate and commercially available antibody, and fluorophore is different with the stoichiometric ratio of antibody.For the dna antibody conjugate, every chain of DNA only be attached to a fluorophore (conjugate that promptly has a DNA chain has the fluorophore of 1:1: the antibody ratio), and commercially available antibody usually each antibody have more than a fluorophore (be that fluorescence antibody has〉1 fluorophore: the antibody ratio).

Therefore, the fluorescence that has reduced 10 times should be not that dna antibody conjugate avidity has reduced 10 times by strict interpretation, reduces although oligomer steric effect discussed above might be explained the part of relative intensity of fluorescence really.Compare with corresponding unmodified antibody, the avidity that the method for use as surperficial plasmon resonance (SPR) is directly measured the dna antibody conjugate can provide more concluding information.

The following further optimization of carrying out the polynucleotide load of polynucleotide encoding antibody.Studied the complementary polynucleotide of two kinds of different lengthss.One group has the overlapping of 16 bases, and another group has the overlapping of 20 bases.According to method shown in following examples 8, the dna sequence dna that design is independent of each other at 16 or 20 groups, and find by experience, 16 bases do not have the sequence sum variability that possibility produces the sequence number that is independent of each other in a large number.As if when turning to 20 bases, the original storehouse of possible sequence significantly increases, and it is much easier to calculate the sequence that is independent of each other.The sum that should be noted that the possibility sequence is an index (4 ⁿ, wherein n is the length in complementary district).

Embodiment 4: make microarray

(ISB-Seattle, microarray facility WA) is printed on bag by on the slide glass of amine by standard method with dna microarray with Institute for Systems Biology.Particularly, printing has the dna microarray of multiple oligomer combination, and described oligomer has sequence SEQ ID NO 2, SEQ IDNO 4, SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16 and SEQ ID NO 18.

Typical some size and interval are respectively 150 and 500 μ m.The poly-lysine slide is homemade.In ultra sonic bath, respectively the barren slide glass is cleaned 10 minutes with IPA and water.Under 150W, it was handled 60 seconds then, immerse rapidly then in the deionized water, produce the high water-wetted surface of silanol end with oxygen plasma.After being dried with the nitrogen spray gun, be applied to described surface through Cement Composite Treated by Plasma 15 minutes, use the deionized water rinsing several seconds then with poly-l-lysine solution (Sigma P8920,0.1%w/v, undiluted).At last, the slide that these were handled was 60 ℃ of bakings 1 hour.Then these slides being delivered to ISB also prints as mentioned above.

Embodiment 5: based on the one-parameter immunoassay with the antibody of polynucleotide encoding

Fig. 5 is to use the Streptavidin of dna encoding to carry out an example of cell sorting experiment.At this moment, at first, the coded Streptavidin of DNA is contacted with the biotin labeled protein of its part with the ratio of the coded Streptavidin of vitamin H-MHC:DNA of 4:1.At this, described protein is major histocompatibility complex (MHC).Eluriate corresponding scheme and test the two parallel carrying out with solution phase cell capture.Particularly, 5 μ l Streptavidin-C3 ' and 20 μ l tyrosine oxidase MHC are combined in the 200 μ l RPMI substratum.They were assembled on ice 20 minutes.Afterwards,, make the tetramer combine 30 minutes with substrate and in PBS, wash, make 2 * 10 subsequently eluriating corresponding scheme ⁶Individual cell contacts with array.In figure b, at first allow the MHC of dna encoding to combine 20 minutes on ice with the cell of equal amts, contact with lower floor DNA array afterwards.Cell capture efficient between two groups is tangible.It is much higher that the solution phase capture ratio of pMHC complex body is eluriated corresponding scheme.Cell capture efficient that it should be noted that the one group of incident in back improves.

Embodiment 6: comprise the protein array with the antibody of polynucleotide encoding

Use three kinds of anti-human IgGs of identical goat to show the polynucleotide encoding protein method that is used for spatial positioning antibody, described three kinds of IgG respectively carry different molecular fluorescence group and separately with the DNA chain encoding of uniqueness.On with the microarray of complementary oligonucleotide point sample, introduce the solution that contains all three kinds of antibody then.After hybridizing two hours and carrying out substrate flushing, antibody carries out self-assembly according to the Watson-Crick base pairing.

Particularly, following generation antibody microarray: at first use 0.1% BSA in 3 * SSC, the DNA slide to be sealed 30 minutes down at 37 ℃.Use dH ₂O washing slide also dries up.The 30 μ l solution (3 * SSC, 0.1% SDS, 0.1% BSA, the various conjugates of 15ng/ μ l) that contain the DNA-antibody conjugates are clipped between microslide and the array, and hatch 4 hours at 37 ℃.Then at first washing array and soft stirring in 1 * SSC, 0.05% SDS under 37 ℃, then in 0.2 * SSC, in 0.05 * SSC, wash at last.Slide dried up and with double-colored array scanning instrument (the Axon Instruments of Gene Pix 4200 A ^TM) scanning.

For immunoassay, first antibody (15ng/ μ l), antigen (3ng/ μ l) and the fluorescently-labeled second antibody (0.5ng/ μ l) of combination DNA coding in single test tube.37 ℃ hatch 2 hours after, described in the embodiment 3 antibody-the antigen-antibody complexes that forms is introduced in the microarray as mentioned.Washing step subsequently is identical with developing.

Particularly, use three kinds of oligomer A1 ', B1 ' and C1 ' marks in the anti-human IgG of goat identical aspect the biological chemistry (with Alexa488, Alexa594 or Alexa647 dye marker) respectively.After hatching 2 hours, antibody/DNA conjugate is positioned the specific site of lower floor's dna microarray indication.

The results are shown in Fig. 6 and 7, wherein shown to have the segmental spatial encoding protein array of scale, described scale fragment is corresponding to 1mm.As indicated in Fig. 7, DNA on antibody and substrate assembling, thereby will the complementary DNA chip of 900 points is converted into multicomponent antibody microarray (see figure 7).This observations means and can assemble sizable antibody array with similar mode.

Embodiment 7: reduce biofouling

The critical size of any protein array is limited by the interference of protein non-specific binding probably.In the trial of the influence that manifests non-specific binding, similarly introduce three kinds of antibody on microarray: two kinds of antibody that have with the oligonucleotide of complementary DNA mark point sample, the third is the antibody of unmodified.Particularly, the anti-human IgG-Alexa594 of goat that makes microarray contact the conjugate of the anti-human IgG-Alexa488/A1 ' of goat, the anti-human IgG-Alexa647/C1 ' polynucleotide encoding of goat simultaneously and not have additional DNA.

In order to show purpose, after hybridization,, therefore observe by the caused high background signal of the non-specific adsorption of noncoding fluorescent-labeled antibody not with the slide cleaning down.

The result shows that in Fig. 8 it has shown the resistance of polynucleotide encoding method of protein to the absorption of nonspecific proteins matter.

When array not by complete closed and/or when flushing, on the surface of slide glass, observe non-specific binding, but on the DNA noncomplementation point of printing, do not observe, be the B1 point not from the fluorescence of noncomplementation IgG conjugate, do not show from not with the protein of the dna encoding (fluorescence of the anti-human IgG of goat-Alexa594) yet.

Antibody does not carry out the non-specific attachment protein matter of the point sample Nucleotide zone displaying much less of chemical code, means that DNA has significantly reduced the biofouling of active regions.The retardance of such biofouling allows the people associate substrate (Prime, K.L. with polyoxyethylene glycol (PEG) functionalization easily; Whitesides, G.M.Science1991,252,1164-1167.Prime, K.L.; Whitesides, G.M.J.Am.Chem.Soc.1993,115, (23), 10714-10721).The infer mechanism relevant with PEG is carried out analogy (Jeon, S.I.; Lee, J.H.; Andrade, J.D.; De Gennes, P.GJournal of Colloid and Interface Science 1991,142, (1), 149-158.Jeon, S.I.; Andrade, J.D.Journal of Colloid and Interface Science1991,142, (1), 159-166.Andrade, J.D.; Hlady, V.Advances in Polymer Science1986,79, (1-63)), the applicant infers that the interaction of the protein hydrophobic part that often exposes during the water-wet behavior of point sample oligonucleotide and the non-specific adsorption minimizes.Also 5 degree in the duplex melting temperature(Tm) of calculating have carried out the conjugate hybrid experiment with interior, interact thereby utilize the Watson-Crick severity and eliminated nonspecific DNA.Under any circumstance, the biofouling of this minimizing means that polynucleotide encoding protein method can be used in the sizable protein combination of detection in single environment probably.

Embodiment 8: carry out the processing of irrelevantization of polynucleotide with computer

Another important empirical considering is phase mutual interference (crosstalk) level between the noncomplementation DNA chain.Dna sequence dna A1, B1 and C1 produce at random with its complement.Only restriction is to comprise the 5 ' A that is used to realize handiness (flexibility) ₁₀The identification length of section and 16 bases.But when experimentizing, find to exist a small amount of appreciable noise, described noise is freed from non-linear secondary and interacts and the sequence of mispairing.Only use strict washing can not obviously remove noise.In the multiparameter platform of any reality, this noise all can increase pro rata with the number of parameters in the research.Therefore, model platform should be utilized such dna sequence dna, and described sequence is independent of each other each other and is independent of each other with the complementary strand that is printed on all exposures on the DNA array.

Therefore, come the design dna sequence to be minimised as target in any intramolecularly between described sequence and the complementary target and molecular interaction under 37 ℃.Use (Dirks, R.M. such as Dirks; Lin, M.; Winfree, E.; Pierce, N.A.Nucleic Acids Research 2004,32, (4), 1392-1403) example of Miao Shuing carries out Computer Design.Particularly, design has also rule of thumb been verified six sequences that are independent of each other, and reports in table 2.

Table 2

Coded polynucleotide	Corresponding matrix polynucleotide
Coded polynucleotide	Corresponding matrix polynucleotide	SEQ?ID?NO：7 AAAAAAAAAAATCCTGGAGCTAAGTCCGTA?	SEQ?ID?NO：8 AAAAAAAAAATACGGACTTAGCTCCAGGAT?
SEQ?ID?NO：9 AAAAAAAAAAGCCTCATTGAATCATGCCTA?	SEQ?ID?NO：10 AAAAAAAAAATAGGCATGATTCAATGAGGC?	SEQ?ID?NO：7 AAAAAAAAAAATCCTGGAGCTAAGTCCGTA?	SEQ?ID?NO：8 AAAAAAAAAATACGGACTTAGCTCCAGGAT?
SEQ?ID?NO：9 AAAAAAAAAAGCCTCATTGAATCATGCCTA?	SEQ?ID?NO：10 AAAAAAAAAATAGGCATGATTCAATGAGGC?	SEQ?ID?NO：11 AAAAAAAAAAAGCACTCGTCTACTATCGCTA?	SEQ?ID?NO：12 AAAAAAAAAATAGCGATAGTAGACGAGTGC?
SEQ?ID?NO：13 AAAAAAAAAAATGGTCGAGATGTCAGAGTA?	SEQ?ID?NO：14 AAAAAAAAAATACTCTGACATCTCGACCAT?	SEQ?ID?NO：11 AAAAAAAAAAAGCACTCGTCTACTATCGCTA?	SEQ?ID?NO：12 AAAAAAAAAATAGCGATAGTAGACGAGTGC?
SEQ?ID?NO：13 AAAAAAAAAAATGGTCGAGATGTCAGAGTA?	SEQ?ID?NO：14 AAAAAAAAAATACTCTGACATCTCGACCAT?	SEQ?ID?NO：15 AAAAAAAAAAATGTGAAGTGGCAGTATCTA?	SEQ?ID?NO：16 AAAAAAAAAATAGATACTGCCACTTCACAT?
SEQ?ID?NO：17 AAAAAAAAAAATCAGGTAAGGTTCACGGTA?	SEQ?ID?NO：18 AAAAAAAAAATTACCGTGAACCTTACCTGAT?	SEQ?ID?NO：15 AAAAAAAAAAATGTGAAGTGGCAGTATCTA?	SEQ?ID?NO：16 AAAAAAAAAATAGATACTGCCACTTCACAT?

The technician can discern other irrelevantization processing polynucleotide after reading present disclosure.

Embodiment 9: cell capture, separation and sorting method

Show that by the antibody that uses dna marker polynucleotide encoding protein is used for the optimization and the purposes of multichannel cell sorting.

Use standard retrovirus transduction scheme is with two kinds of mouse cell line VL-3T cells (thymic lymphoma oncocyte system (Groves, T.; Katis, P.; Madden, Z.; Manickam, K.; Ramsden, D.; Wu, G.; Guidos, C.J.J.Immunol.1995,154,5011-5022)) and A20 B cell (mouse B cell lymphoma (Kim, K.J.; Langevin, C.K.; Merwin, R.M.; Sachs, D.H.; Asfsky, R.J.Immunol.1979 is 122,549-554), available from ATCC) be designed to express respectively mRFP and EGFP.As mentioned above, will at these clones separately the antibody of surface marker (VL-3 is anti-CD90.2, and A20 is anti-B220 (eBioscience)) respectively with DNA chain A1 ' and B1 ' coding.

For the sorting experiment, with 10 ⁶The concentration of individual cell/100 μ l substratum with passage to fresh substratum [RPMI.1640 (ATCC), be supplemented with 10% foetal calf serum, 0.1mM non-essential amino acid and 0.05mM beta-mercaptoethanol], and hatched 30 minutes on ice with DNA-antibody conjugates (0.5 μ g/100 μ l).Excessive conjugate is removed in centrifugal back from supernatant liquor, afterwards cell is resuspended in the fresh culture.Before cell is hatched, by with 10mM methyl-PEO among remaining amido and the pH=7.4PBS ₁₂-NHS ester (Pierce) at room temperature reacted 4 hours and with the passivation of microarray slide, to reduce nonspecific cell adhesion.Cell is coated on the microarray surface equably, and it was located on ice 1 hour.During this period of time, at room temperature with containing 1mM MgCl ₂The Tris buffer salt solution softly wash, remove not adherent cell.Similarly carry out cell enrichment experiment, just (each 10 at T cell and B cell for incubation step ⁶Individual/100 μ l) the two 1:1 mixture carries out under existing.

The negative selection scheme of use standard magnetic bead and BD IMagTM cellular segregation system, former generation CD4+ of purifying and CD8+T cell from EGFP and dsRed transgenic mice (deriving from Jackson Laboratories) respectively.Before classification,, find that it is higher than 80% by the purity of these colonies of facs analysis based on polynucleotide encoding.

With previous described similar, on the microarray mechanism of PEGization, carry out cell, gene and experimental protein simultaneously.

In brief, after with anti-B220-B1 ' (0.5 μ g/100 μ l) mark, the B cell (10 of GFP will be expressed ⁶Individual/100 μ l) be positioned on the B1 point.After removing not adherent cell, will have ELISA pair of A1 ' introducing of TNF-α of the second antibody of the first antibody of C1 ' coding and APC mark, and it was at room temperature hybridized 30 minutes with 0.5ng/ μ l FITC mark.Use TBS+MgCl then ₂The flushing slide also develops by the bright visual field and fluorescent microscopy.

Parallel homogeneous cell experiment and the elutriation cell experiment of carrying out.For homogeneous cell capture process, with 5 * 10 ⁶Individual Jurkats (ATCC) is suspended in the 1mlRPMI substratum with the anti-CD3/C3 ' conjugate of 5 μ g, and hatches 1 hour on ice.By the excessive conjugate of centrifugal removal, and Jurkats is resuspended in the 200 μ l fresh cultures, contacts with dna microarray afterwards.After hatching 1 hour on ice, mildly wash slide with TBS.The parallel cell that carries out is eluriated experiment; On ice the anti-CD3/C3 ' conjugate of 5 μ g among the 1ml RPMI was hatched on microarray 1 hour, in 0.5 * PBS, wash afterwards, in deionized water, wash then.Do not dry up slide, but the tapping slide to remove most of excessive solution, keeps array moistening.On ice with Jurkats (5 * 10 ⁶Individual/200 μ L) placed immediately array last 1 hour.Washing subsequently is identical with development step.

These result of experiment are shown in Figure 10, wherein scheme a and b and show bright field-of-view image, and it shows the efficient according to the homogeneous cell capture process of the embodiment of method and system disclosed herein.

Particularly, in figure a, described homogeneous mensuration, wherein will then mixture have been introduced on the DNA array microchip of point sample with the antibody and the cell combination of dna marker.In figure b, at first assembling is introduced cell then with the antibody of dna marker on the DNA of point sample array.These heterogeneous processes are similar with the tradition elutriation method of using surface bonding antibody trapping specific cells.

By result shown in comparison diagram a and the b,, will compare based on proteinic cell sorting of polynucleotide encoding and elutriation by estimating homogeneous cell capture (solution phase cell capture) and heterogeneous body cell capture (surface limits cell capture).The dna encoding protein method of homogeneous shows higher cell capture efficient.

The raising of capture rate may be because some factors.In the homogeneous cell capture, the DNA-antibody conjugates can correct orientation and is combined with cell surface marker in the solution.Cell capture is not to be driven by the interaction of antibody and cell surface marker, but combines improve affine power-actuated by complementary dna chain on multivalent dna-antibody conjugates and the microarray by working in coordination with, and this has significantly improved capture rate.Nano particle, DNA crossing scheme similar trend (Taton, T.A. have been reported; Mirkin, C.A.; Letsinger, R.L.Science 2000,289,1757-1760).When using elutriation method (its array to heterogeneous body DNA-antibody definition disclosed herein is similar), trapping agent is restricted to takes random direction from the teeth outwards.The activity of antibody is lowered, be exactly because with the interactional incorrect orientation of cell surface marker, reduced maximum avidity and with the cooperating of adjacent antibody.

The bright visual field and the fluorescence microscope images that in figure c, have shown the experiment of multichannel cell sorting, the 1:1 mixture of wherein expressing the T cell (red channel) of mRFP and expressing the B cell (green channel) of EGFP is stacked on an A1 and the C1 these 2 codings that correspond respectively to A1 ' and C1 ' antagonism CD90.2 and anti-B220 antibody by space layer.Particularly, in the experiment of Figure 10 c, the DNA chain of two uniquenesses with put together at the antibody of T cell sign thing CD90.2 (Thy1.2) and B cell sign thing CD45R (B220) generation respectively.By expressing monomer red fluorescent protein (Campbell, R.E.; Tour, O.; Palmer, A.E.; Steinbach, P.A.; Baird, G.S.; Zacharias, D.A.; Tsien, R.Y.Proc.Natl Acad.Sci.2002,99, the 7877-7882) T cell (VL-3 of (mRFP), mouse thymic lymphoma knurl) separates with 1: 1 mixture space of the B cell (mouse B cell lymphoma) of expressing EGFP, showed multichannel cell sorting based on DNA-antibody.This mixture with hatching at the two the DNA-antibody conjugates of unique code of T and B cell sign thing, and is introduced the microarray of suitable point sample.The result shows that the bright visual field and false color fluorescence micrograph all show the T cell of expressing mRFP in an A1 enrichment, and the B cellular localization of expression EGFP is in B1, and is consistent with the dna encoding of antibody separately.

In figure d, showed from the fluorescence micrograph of the primary cell multichannel sorting of mouse collection.By using respectively with the anti-CD4-A1 ' of the conjugate of polynucleotide encoding and anti-CD8-C1 ', will from the CD4+ cell of EGFP transgenic mice and from the 1:1 mixture separation of the CD8+ cell of dsRed transgenic mice to putting A1 and C1.Primary cell is more fragile more than the clone of having set up usually.This is because they must extract (usually by enzymic digestion) from surrounding tissue, and this is the process that can cause viability to reduce.In addition, often to select feature be the clone that viability and proliferation potential significantly improve to culturing process.Therefore, the cell sorting technology of general (generalized) also must be applicable to primary cell with the sample preparation of minimum.In order to show the effectiveness that is used for the primary cell sorting with the protein method of polynucleotide encoding, by the negative synthetic mixture of separation of C D4+ and CD8+T cell from EGFP-and dsRED-transgenic mice respectively of getting rid of of magnetic.Use anti-CD4 and anti-CD8DNA-antibody conjugates to make mixture stratification (stratified).As shown in Figure 10 d, these two kinds of cell types are separated to different locus according to additional dna encoding.

Embodiment 10: use and carry out the analysis of multiparameter multichannel with the antibody of dna encoding and the combination of DNA printed array

Carry out multiparametric analysis (cell, mRNA and protein) according to strategy shown in Figure 12.

Figure 11 shown be used for cell sorting and detect protein altogether and cDNA (mRNA) with polynucleotide encoding protein method.With antibody or other protein (comprise cell surface marker) of different DNA oligomer marks at protein (being used for cell sorting).Then with these conjugates and biological sample (cell, tissue etc.) combination, their its corresponding antigen combinations there.When introducing on the dna microarray, the parallel self-assembly of carrying out according to the Watson-Crick base pairing is positioned to specific locus with bonded material (bound species), allows to carry out the multichannel multiparametric analysis.

Carried out the ability that the multiple target of polynucleotide encoding protein detection disclosed herein (comprising the target that chemical property is different) is showed in immunoassay.Particularly, carrying out this measures and detects albumen target IL4 and polynucleotide B1.For this purpose, albumen target IL4 is had specific antibody with polynucleotide C1 coding, and preparation and polynucleotide B1 complementary polynucleotide.To hatch with the anti-IL4 of polynucleotide B1 complementary polynucleotide and C1 ' coding as mentioned above.Specificity in conjunction with after, introduce fluorophore second antibody, and detect when carrying out albumen target IL4 and oligonucleotide B1 as shown in Figure 12 at IL4.

In order to emphasize the general diversity of platform shown in Figure 11, the B cell of expressing GFP is carried out mark with the antibody conjugates of B1 ' dna encoding, on the point (B1) that union space is positioned to encode with complementary oligonucleotide.After the cellular localization, be combined into the A1 ' DNA of FITC mark and, and introduce in the identical microarray platform with the immune interlayer of the TNF-α of C1 ' coding.The bright visual field of gained shown in Figure 13 and fluorescence microscope images have shown that the platform of an embodiment of method and system disclosed herein is used for extending to simultaneously the validity of different biological complexity level.

Particularly, Figure 13 shows micro-image, and its gene and protein multiparameter that has shown that simultaneous B1 point cell capture and A1 and C1 point carry out respectively detects.Bright field-of-view image show the expression EGFP that is positioned at a B1 B cell (green channel), the FITC of A1 place mark (green) cDNA and be encoding to the TNF-α interlayer immunoassay (blueness) of the APC mark of C1.The scale line segment is corresponding to 300 μ m.

The efficient of the polynucleotide encoding protein method and system of this paper example may be owing to used antibody is anchored on polynucleotide specificity combination on the substrate.Be used for protein detection or be used to eluriate conventional antibody array (Wysocki, the L.J. of cell; Sato, V.L., Proc.N α tl.Acad.Sci.1978,75, (6) 2844-2848) need be fixed on antibody (Liu, X. on aldehyde, epoxy, maleimide or the hydrophobic solid upholder; Wang, H.; Herron, J.; Prestwich, G., BioconjugateChem.2000,11, (755-761) .Macbeath, G; Schreiber, S.L.Science2000,289,1760-1763.Pal5 M.; Moffa, A.; Sreekumar, A.; Ethier, S.; Barder, T.; Chinnaiyan, A.; Lubman, D.Anal.Chem.2006,78,702-710.Thirumalapura, N.R.; Morton, R.J.; Ramachandran, A.; Malayef, J.R.Journal of Immunological Methods 2005,298,73-81).Because the sex change of spatial induction, be difficult to keep (active) antibody conformation of folding usually, many variablees are depended in described sex change, comprise pH, ionic strength, temperature and concentration (Seigel, R.R.; Harder, P.; Dahint, R.; Grunze, M.; Josse, F.; Mrksich, M.; Whitesides, G.M.Anal.Chem.1997,69,3321-3328.Ramsden, J.J.Chem.Soc.Rev.1995,24,73-78.Fainerman, V.B.; Lucassen-Reynders, E.; Miller, R.Colloids Surf.A 1998,143,141).The exploitation that this has promoted the alternative method that keeps the protein native conformation comprises 3 dimension substrate such as hydrogel and polyacrylamide (Arenkov, P.; Kukhtin, A.; Gemmel, A.; Voloshchuk, S.; Chupeeva, V.; Mirzabekov, A.Anal.Biochem.2000,278,123-131.Kiyonaka, S.; Sada, K.; Yoshimura, l.; Shinkai, S.; Kato, N.; Hamachi, I.Nature Materials 2004,3,58-64.), at instructs fixing (Kwon, the Y. of antibody on SAM; Han, Z.; Karatan, E.; Mrksich, M.; Kay, B.K.Anal.Chem.2004,76,5713-5720) and biotinylated antibody at the Streptavidin bag by lip-deep coupling (Peluso, P.; Wilson, D.; Do, D.; Tran, H.; Venkatasubbaiah, M.; Quincy, D.; Heidecker, B.; Poindexter, K.; Tolani, N.; Phelan, M.; Witte, K.; Jung, L.; Wagner, P.; Nock, S.Anal.Biochem.2003,312,113-124).In addition, array needs to keep all the time moistening in whole manufacturing process, to prevent protein denaturation (Macbeath, G.; Schreiber, S.L.Science2000,289,1760-1763).On the other hand, dna microarray usually by electrostatic adhesion (passing through point sample) on the amine surface.

Detecting DNA and proteinic a kind of selection on the same slide simultaneously can be to be formed for fixed dna and proteinic two kinds of functional groups on same substrate, but this can significantly improve the complicacy and the design of system.Perhaps, compatible surface can be the Acibenzolar slide glass, and amine-DNA and protein is covalent attachment with it all.Yet the contriver finds, compares with DNA on the amine slide that is printed on the covalency preparation, and these slides reduce the loading capacity of DNA, cause relatively poor strength of signal.In addition, unreacted ester is hydrolyzed into carboxylic acid, and it is electronegative in normal hybridization buffer (pH7), has reduced the DNA interaction by electrostatic interaction.In addition, in order to study cell and protein, reducing the cell non-specific binding and keeping the functional best surface of complete antibody simultaneously is acrylamide (Soen, Y.; Chen, D.S.; Kraft, D.L.; Davis, M.M.; Brown, P.O.PLoSBiology2003,1, (3), 429-438.Boozer, C; Ladd, J.; Chen, S.; Yu, Q.; Homola, J.; Jiang, S.Anal.Chem.2004,76,6967-6972), itself and DNA are incompatible.

In addition, by using DNA as being used for cell, cDNA and proteinic general assemble strategy, can optimize the substrate condition that is used for high DNA load on the point sample substrate and is used for complementary DNA load on the antibody.This causes being used for the highly sensitive sandwich assay and the efficient cell sorting (comparing with the tradition elutriation) of protein detection.

Embodiment 11: make microfluidic device

Mensuration based on microfluid provides advantage, as sample and the reagent volume that reduces, and the minute (Breslauer, the D.N. that shorten; Lee, P.J.; Lee, L.P.MoI.BioSyst.2006,2,97-112).For example under some operational condition, surface bonding is measured kinetics mainly by analyte (protein) concentration and analyte/antigen avidity decision, rather than by diffusion decision (Zimmermann, M.; Delamarche, E.; Wolf, M.; Hunziker, P.Biomedical Microdevices 2005,7, (2), 99-110).Estimate polynucleotide encoding protein approach by being combined in the dna microarray top based on microfluid based on the microfluidic channel of polydimethylsiloxane (PDMS).

Particularly, use conventional soft lithographic (soft lithographic) technology to make microfluidic channel by polydimethylsiloxane (PDMS).Target is to make firm microfluidic channel, and it can disintegrate after surface measurements is finished and be used for optical analysis.Make main mould by photoetching process (photolithographically) by the transparent covert of high resolving power (CadArt), the fluid network that obtains is made up of 20 parallel passages, and every passage has cross-sectional profiles and the long 2cm of being of 10 * 600 μ m.This is corresponding to the channel volume of 120nl.Mix silicone elastomer (Dow Corning Sylgard 184 ^TM) and it is poured over the top of mould.Solidify the back and remove PDMS also with No. 20 draw point (Technical Innovations from mould ^TM) sting out sample input aperture and delivery port.Then microfluidic channel is aimed at the microarray top and combine with substrate and spend the night at 80 ℃ of baking boxs.

Embodiment 12: use antibody with dna encoding to carry out determination step based on microfluid

With No. 23 draw points and Tygon ^TMThe pipe coupling microfluidic device allows to produce～0.5 μ l/ minute pneumatic control flow velocity.In Tris buffer saline (TBS), carry out multiple mensuration, found that TBS is better than 1 * SSC and PBS aspect the reduction background noise.Seal each passage with 1.0% BSA among the TBS, then under flow condition with DNA-antibody conjugates or immunoassay to contacting 10 minutes.Under flow condition,,, and described microfluid member taken off from slide glass passage washing 2 minutes with damping fluid, to be used for scanning with after conjugate or antigen contact 10 minutes.Before facing imaging, whole slide is simply washed in TBS, dries up and imaging on aforesaid array scanning instrument.

In first series is measured, use two kinds of anti-human IgGs of goat of oligomer A1 ' and B1 ' mark (with Alexa594 or Alexa647 mark) respectively, and be introduced in the microfluidic device that is combined in microarray DNA top, described microarray has corresponding complementary strand A1 and B1 and incomplementarity chain C1.Do not add the conjugate of the polynucleotide encoding that is encoding to a C1.After flowing 10 minutes in～0.5 μ l/ minute, remove microfluid PDMS plate and to the slide glass imaging.Result shown in Figure 14 shows that antibody conjugates self-assembly in＜10 minutes is hybridized time scale consistent (Erickson, the D. that is reported with DNA in the microfluid on the coded accurate locus of additional oligonucleotide (seeing Figure 14); Li, D.; Krull, U.Anal.Biochem.2003,317,186-200.Bunimovich, Y.; Shin, Y.; Yeo, W.; Amori, M.; Kwong, G.; Heath, J.J.Am, December 1 2006 Chem.Soc.2006 network time of disclosure) DOI:10.1021/ia065923u.Wei, C; Cheng, J.; Huang, C; Yen, M.; Young, T.Nucleic Acids Research2005,33, (8), 1-11).In order to confirm to be used for the polynucleotide encoding protein strategy of protein detection, carried out other mensuration, wherein utilize encoding antibody in the multiple standards immunoassay, to detect related antigen.

Measure (Engvall, E. at standard immunoassay; Perlmann, P.O.J.Immunol.1972,109,129-135) in, first antibody is attracted on the solid support, introduces successively then to contain second " reading antibody " of antigen samples and mark and hatch, and carries out rinse step therebetween.In order to simplify the five steps formula immunoassay of this routine, use the code capacity of the coded antibody of DNA that whole sandwich complex is positioned to the appropriate location that is used for the multichannel reading, this mensuration is reduced to single stage.

Particularly, with first antibody non-fluorescence, dna encoding and antigen and the combination of fluorescently-labeled (no DNA) second antibody.Under these conditions, have only when antibody-Ag-Ab interlayer successfully forms in homogeneous solution and is positioned on the microarray, could the spatial encoding fluorescent signal.

Particularly, in other first series is measured, introduce antibody, corresponding antigens and fluorescently-labeled second antibody at the dna encoding of two kinds of cytokines (people IFN-γ and TNF-α).The antibody sandwich of dna encoding is measured self-assembly to its specific locus, and detected there, shown in Figure 15 a.Finish this polyprotein matter immunoassay and also need 10 minutes.

In measuring, the second series that uses the 3rd interleukin I L-2 studied sensitivity limit based on the interlayer immunoassay of microfluid dna encoding antibody.The results are shown among Figure 15 b and Figure 15 c, wherein use (figure b) development of fluorescence second antibody and use golden non-electro-deposition respectively as developing and amplifying strategy (figure c).

Use fluorescence reading strategy, this assay method reaches the sensitivity limit peak value (data not shown) of about 1nM on the slide of printing with the complementary DNA of 5 μ M saturation concentrations.For human IL-2-concentration series, at first a DNA-antibody conjugates is layered on the surface, contact with second antibody with antigen then.This be because under lower antigen concentration signal weakening because the first antibody of a high proportion of not conjugated antigen be combined with competition of antigenic first antibody and DNA hybridization array.By earlier array being contacted with a DNA-antibody conjugates, subsequently with antigen with washed excessive thing off before second antibody contacts, strengthened signal.

Used multiple strategy to improve sensitivity.At first, the applicant infers, improves slide glass and can improve the density of localized polynucleotide encoding conjugate to the loading capacity of DNA, thereby improve possible capturing events number.Conventional dna microarray be printed on amino containing silane and glass reaction and on the primary amine surface that produces (Pirrung, M.Angew.Chem.Int.Ed.2002,41,1276-1289).By the negative charge on the DNA phosphate backbone and from the electrostatic interaction between the positive charge of protonated amines, fixed dna chain under condition of neutral pH.In order to improve the loading capacity of slide, produced the poly-lysine surface, thereby improve electric density and with the interactional surface-area of DNA.By adopting these to change, might on slide glass, print complementary DNA with the saturation concentration of 100 μ M.Correspondingly, the sensitivity based on the assay method of fluorescence is increased to 10pM (Figure 15 b).

In a kind of different development approach, use second antibody with the gold nano grain mark, use non-electro-deposition deposition (Hainfeld, J.F. then; Powell, R.D., Silver-and Gold-BasedAutometallography of Nanogold.Gold and Silver Staining:Techniques inMolecular Morphology, Hacker, G.W.; Gu, J., Eds.CRC Press:Washington, DC, 2002; The 29-46 page or leaf) further amplifying signal, and will be converted into photoreading based on the reading of fluorescence.This is possible, because used the demultiplexing of space rather than colorimetric.

Particularly, with to above disclose similar mode and carry out golden amplification test based on microfluid, important difference is to use vitamin H-second antibody to replace fluorescently-labeled antibody.In every passage (3ng/ μ l), introduce gold-Streptavidin (Nanoprobes) subsequently and kept 10 minutes, afterwards with damping fluid with the passage cleaning down.After removing PDMS, with gold enhancing test kit (Nanoprobes) whole slide is amplified according to the scheme of manufacturers.

After adopting these to improve, can be lower than exist (Figure 15 c) that easily detects the IL-2 interleukin under the concentration limit of 10fM, this representative is higher than the sensitivity based at least 1000 times of the microfluid immunoassays of fluorescence.Comparatively speaking, this method is than the conventional highly sensitive 100-1000 of ELISA times (Crowther, J.R., ELISA; Theory and Practice.In Methods in MolecularBiology, Humana Press Inc.:Totowa, New Jersey, 1995), recently from highly sensitive 150 times of (the http://www.bdbiosciences.com/ptProduct.isp of the corresponding human IL-2 of manufacturers ELISA data? prodId=6725).

These result of experiment show, compare with 1 step formula immunoassay, particularly under low antigen concentration, by contacting the sensitivity that the assay method of carrying out has raising successively with reagent.This is likely owing to the competitiveness combination to hybridizing on lower floor's dna microarray between the dna antibody conjugate that has or do not have load.By array is contacted with conjugate, the antigen of polynucleotide encoding successively, contact with second antibody then, improved sensitivity.Only method must be according to selecting in result desired aspect convenience and the sensitivity.Yet still to emphasize, under the microfluidic flow condition each step still reached peak signal in 10 minutes.Therefore in full automatic equipment, can in 1 hour (comprising 30 minutes golden amplification procedure), obtain complete microfluid immunoassay with the sensitivity that is low to moderate 10fM.

Embodiment 13: it is quantitative to use dna encoding antibody with the metal nanoparticle mark to carry out target

Use detects digital proteomics situation with the antibody and the DNA array combination of dna encoding according to strategy described in Figure 16 and 17.Particularly, measure and detect some cytokine (IL2, TNF-α and IFN-γ).Carry out all experiments in the mode similar to above-mentioned 3 steps formula immunoassay, it is dark-field scattering of light microscope that important difference is to use 40nm gold grain and detection scheme.

Particularly, in numerical approach, with 40nm gold nano grain mark second antibody, described gold nano grain can easily detect by dark-field scattering of light microscopy.More specifically, use the detection probes of the gold nano grain-Streptavidin conjugate of 40 nanometers as numeral mensuration.

Carry out the detection of correlated digital immunoassay with method shown in Figure 180.According to method shown in Figure 180, use the object lens of dark-field microscope to measure scattered light.Also easily choose and detect even if the plasmon of very little gold nano grain is replied.Automation package manual or the use grain count is counted individual particles.Notice that all particulate scattering colors are very similar-yellow extremely greens.This is because gold nano grain (10) has the size range (～60 nanometer diameter) that is rather narrow.In the scattering of light microscope, can use spectral filter to eliminate all other scattering colors, thereby reduce background.

Experimental result is shown among Figure 19 to 22, wherein uses the Reyleith scanttering light scattering conjugate that develops.

In Figure 19 and 20, shown the sensitivity of the digital assay method of carrying out, wherein represented the concentration series of TNF-α according to an embodiment of method and system disclosed herein.Can easily be identified being low to moderate under the concentration of 100aM from this proteinic signal.Figure 19 and 20 shows the representative dark-field image of the TNF-α numeral immunoassay of carrying out with method and system disclosed herein under different concentration.Use is counted granule number automatically by a kind of science image processing software ImageJ TM that NIH provides.Gold nano grain and TNF-α concentration are plotted in the histogram of Figure 20.

In order further to estimate the ability of this new technology in serum measurement, in human serum (available from Sigma-Aldrich), add above-mentioned three kinds of cytokine albumen (IL2, TNF-α and IFN-γ) and carry out the assay method based on gold nano grain same as above.The results are shown among Figure 21.Particularly, the image of figure a is collected from added following three kinds of proteinic serum samples: IFN-γ, TNF-α and IL-2.The image of figure b is from digital immunoassay, and its a kind of embodiment according to method and system disclosed herein is measured from healthy human serum.All these three kinds of protein all are present in the human serum to be lower than detectable concentration usually.TNF-α is lower than detectability, but IFN-γ and IL-2 fly mol (10 with number ^-15M) concentration level exists.This protein content is far below conventional absorbancy or fluorescence ELISA or even the detectability of the immunodetection of carrying out with another embodiment of method and system disclosed herein.

Discovery has highly sensitive and very little background noise according to method operational excellence in serum of embodiment mentioned above.Importantly, digital immunoassay embodiment is a sensitive to such cytokine, and described cytokine is the bioinformation molecule, but is present in the pure healthy human serum with trace.Show as Figure 21 right side, have signal, but do not detect TNF-α corresponding to people IFN-γ and IL-2.This result has shown the ability of wherein using the method and system disclosed herein that metal nanoparticle detects.

Tested the proteic detection of above-mentioned three-type-person's cytokine (Figure 22) that all prepares with same concentrations.Particularly, with three kinds of different ssDNA ' molecule point samples to substrate, each ssDNA ' be marked at first antibody (anti-IFN-γ; Anti-TNF-α and anti-IL-2) on the complementation of ssDNA oligomer.With after serum/protein mixture contacts, introduce second antibody at substrate with 60 nanometer diameter gold nano grain marks.Use dark-field scattering of light microscope development nano particle.

Result shown in Figure 22 can show clearly, and with based on the mensuration of fluorescence consistent be since with the high-affinity of the first anti-TNF-Alpha antibodies, TNF-α shows optimum signal intensity.

Should be noted that background near zero, and detect proteinic dynamicrange and be at least 10 ⁶The mensuration of these types has been used to detect some cytokine (IL2, TNF-α and IFN-γ) from healthy human serum.This is impossible before, because only there be (by our measurement) in these protein with the level that 1-5 flies mol.In case should be noted that to have characterized antibody/protein avidity, then the mensuration of these types is exactly absolute and quantitative, means that they do not need calibration.

With method and system disclosed herein the digital detection of molecule is easy to be applicable to microfluidic environment (result from Figure 21 carries out) in microfluidic environment.Except sample size and time scale benefit that these class microfluid immunoassay bring, also there is other advantage.For example, because whole being determined in the solution carried out before reading, so protein denaturation (problem of point sample antibody microarray) does not reduce joint efficiency.In addition, relating to substrate supports any mensuration of antibody all can't bear micro-fluid chip assembling (it relates to the long-time baking at 80 ℃).This method is designed to obtain firm PDMS microfluidic channel, and it can disintegrate subsequently and be used for the optical readings step.

Carry out another benefit that solution measures mutually and be that antigen and antibody are all enjoyed orientation is free, guarantee solid support can the restriction analysis thing approaching to the trapping agent binding pocket.

Embodiment 14: diagnostic method and system

Be used for analyzing that some of method and system disclosed herein of biomarker are preliminary proofreaies and correct and quantitatively carry out at the PI3K path, this path especially is chaotic in glioblastoma in many cancers.Particularly, shown a kind of embodiment in Figure 23, wherein used this technology for detection biomarker pten, it is the important symbol thing in the glioblastoma (cancer of the brain).

Method and system disclosed herein at first is used in the mensuration based on fluorescence, with by using pten as standard substance correcting device (Figure 23, figure a and b).The calibration of albumen pten represents that with 7 lattice in left side scope is from 25nM to 375pM.Three lattice in right side are represented the positive and pten barren sample of pten.By comparing with the calibration lattice.Can interpolation obtain the concentration of pten near 1nM.The contriver continues the pten expression level (figure a and c) among the quantitative glioblastoma clone U87 subsequently.Obviously, as shown in figure 23, reasonably pten level (1nM) use method and system disclosed herein is detectable.

Use method and system disclosed herein can also in serum, carry out the detection and the correlation analysis of biomarker, as the indication of individual health state.Particularly, can use method and system disclosed herein to carry out liver toxicity research.Result in the liver is significant especially, because liver is the organ (the firstth, skin) second largest in the human body, and continues to contact with blood.Confusion in therefore very possible this organ can cause significantly change of existing liver-specific protein matter biomarker quantity generation in the serum.

The exemplary approach that is found to clinical affirmation from the serum biomarker is shown in Figure 24.

First step that the serum biomarker is found relates to by existing method carries out proteome analysis to protein in the blood in tandem mass spectrometry.Therefore, use tandem mass spectrometry to find after mouse model being used high-level paracetamol (acetomaniphen), about 25 kinds of proteinic preliminary protein tabulations are upward or downward (the figure a (1) of Figure 24).Particularly, the peptide that is detected is replied mapping (map back), produce the tabulation of candidate albumen matter biomarker.The existing method of use is screened in surperficial plasmon resonance and is verified these biomarkers and relevant trapping agent (antibody) thereof.Particularly, use SPR to confirm that especially effectively antibody is to (the figure b (2) of Figure 24).At last, in order to carry out the monitoring of highly sensitive multichannel, these attested protein capture agent are converted to microfluid system according to embodiment disclosed herein, make and to monitor serum biomarker in the blood.Particularly, design and test chip are to detect 4 kinds of liver specificity serum proteins and the 3 kinds of immunologic opsonin albumen (the figure c (3) of Figure 24) from whole serum.Result shown in Figure 24 shows, has detected all targets from serum without difficulty.

All above-mentioned confirmations are all finished in mouse or people or the serum sample of the two.

Generally speaking, this paper provides the method and system that is used at sample detection and/or sorting targets, and it is based on being used in combination polynucleotide encoding protein and substrate polynucleotide.Described protein with polynucleotide encoding is made up of in conjunction with the coded polynucleotide of pre-determined target target protein and specificity bonded substrate polynucleotide specificity, and wherein said substrate polynucleotide are attached to substrate.

Provide above disclosed embodiment how those of ordinary skills' complete disclosure and description being made and used the equipment of present disclosure, the embodiment of system and method, and be not intended to limit the scope of the disclosure that the contriver thinks.The modification that is used to implement the above-mentioned pattern of present disclosure it will be apparent to those skilled in the art that, and is intended to be contained in the following claim scope.All patents mentioned in the specification sheets and publication have been represented present disclosure one of ordinary skill in the art's state of the art.All reference of quoting in the present disclosure are all incorporated into by reference, and its degree is equivalent to each reference and incorporates into its integral body by reference individually.

Whole disclosures of every piece of document quoting in background technology, detailed Description Of The Invention and embodiment (comprising patent, patent application, magazine article, summary, laboratory manual, books or other disclosures) are all incorporated this paper by reference into.In addition, the hard copy of the sequence table of submitting to this paper and corresponding calculated machine readable form all by reference integral body incorporate this paper into.

Should be appreciated that present disclosure is not limited to concrete composition or biosystem, they certainly change.It is also understood that nomenclature used herein only is used to describe the purpose of specific embodiments, be not intended to restriction.The noun that the countless measure word that use in this specification sheets and the appended claims are modified includes its plural implication, is not like this unless context clearly shows.Term " a plurality of " comprises that two or more refer to thing, is not like this unless context clearly shows.Except as otherwise noted, otherwise all scientific and technical terminologies used herein all have the common identical meanings of understanding with the present disclosure one skilled in the art.Although can use in the practice and similar or all methods and the material that are equal to disclosed herein, describe the suitable material and the method that are used to test specific examples in this article.

A large amount of embodiments of present disclosure have been described.However, should be appreciated that design and the scope that to carry out multiple modification and not depart from present disclosure.Therefore, other embodiments are also within the scope of following claims.

Sequence table

＜110〉Caltech

Kwong，Gabe

Bailey，Ryan

Fan，Rog

Heath，James?R.

＜120〉be used to detect and/or the method and system of sorting bag quilt

<130>P017-CIT

＜140〉to be determined

<141>2007-08-01

<150>60/834,823

<151>2006-08-02

<150>60/959,665

<151>2007-07-16

<160>18

<170>PatentIn?version?3.4

<210>1

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>1

<210>2

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>2

<210>3

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>3

<210>4

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>4

<210>5

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>5

<210>6

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>6

<210>7

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>7

<210>8

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>8

<210>9

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>9

<210>10

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>10

<210>11

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>11

<210>12

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>12

<210>13

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>13

<210>14

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>14

<210>15

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>15

<210>16

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>16

<210>17

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>17

<210>18

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>18

Bailey?Ryan

Fan，Rong

Heath，James?R.

＜120〉be used to detect and/or the method and system of sorting bag quilt

<130>P017-CIT

＜140〉to be determined

<141>2007-08-01

<150>60/834,823

<151>2006-08-02

<150>60/959,665

<151>2007-07-16

<160>18

<170>PatentIn?version3.4

<210>1

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>1

<210>2

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>2

<210>3

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic oligonucleotide

<400>3

<210>4

<211>26

Claims

1. the test sample calibration method that hits, this method comprises:

To be attached to the substrate polynucleotide of substrate with combined with the protein of polynucleotide encoding, should comprise protein with the protein of polynucleotide encoding and be attached to this proteinic coded polynucleotide, wherein said protein combines with described target specificity, and described coded polynucleotide combines with described substrate polynucleotide specificity; With

Detect the protein with the polynucleotide encoding-target complex body that combines with the substrate polynucleotide that are attached to substrate.

2. the process of claim 1 wherein following substrate polynucleotide that are attached to substrate and proteinic combination with polynucleotide encoding:

The substrate that is attached to substrate polynucleotide are provided;

Protein with polynucleotide encoding is provided, and it comprises protein and is attached to this proteinic coded polynucleotide, and wherein said protein combines with described target specificity, and described coded polynucleotide combines with described substrate polynucleotide specificity; With

This protein with polynucleotide encoding is contacted certain hour with sample under certain condition with substrate, allowing described protein in protein-target complex body, to combine, and allow described coded polynucleotide to combine with described substrate polynucleotide with target with polynucleotide encoding with polynucleotide encoding.

3. the method for claim 2, wherein following carry out described protein with polynucleotide encoding and sample with the contacting of substrate:

Described protein with polynucleotide encoding is contacted certain hour under certain condition with sample, in protein-target complex body, combine with target with polynucleotide encoding to allow this protein with polynucleotide encoding; With

Described protein with polynucleotide encoding-target complex body is contacted certain hour under certain condition with substrate, combine with described substrate polynucleotide to allow described coded polynucleotide.

4. the method for claim 2, wherein following carry out described protein with polynucleotide encoding and sample with the contacting of substrate:

Described protein with polynucleotide encoding is contacted certain hour under certain condition with described substrate, combine with described substrate polynucleotide to allow described coded polynucleotide; With

Described protein with polynucleotide encoding is contacted certain hour under certain condition with sample, to allow described protein combination in the protein-target complex body of polynucleotide encoding with polynucleotide encoding.

5. each method in the claim 1 to 4, wherein followingly detect the above protein with polynucleotide encoding of substrate-target complex body:

Molecule through mark is provided, and it comprises and target specificity bonded molecule and the tagged compound that is attached to this molecule, and this tagged compound provides marking signal;

Described molecule through mark is contacted certain hour under certain condition with described protein with polynucleotide encoding-target complex body, combine with described protein-target complex body with polynucleotide encoding to allow described molecule through mark; With

Detection from substrate on the marking signal that combines with the protein-target complex body of polynucleotide encoding through tagged molecule.

6. the method for claim 5, wherein said tagged compound is a metal nanoparticle.

7. each method in the claim 1 to 6, wherein said protein with polynucleotide encoding is antibody.

8. each method in the claim 1 to 4, wherein said target is multiple target, and the wherein following substrate polynucleotide that will be attached to substrate are with combined with the protein of polynucleotide encoding:

The multiple substrate polynucleotide that are attached to substrate are provided, and various substrate polynucleotide are sequence-specific, and can be distinguished from each other on the position;

Multiple protein with polynucleotide encoding is provided, every kind of protein with polynucleotide encoding comprises protein and is attached to this proteinic coded polynucleotide, wherein said protein combines with target in the described multiple target, and differentiable substrate polynucleotide specificity combines on sequence-specific in described coded polynucleotide and the described multiple substrate polynucleotide and the position, range protein and coded polynucleotide in conjunction with aspect can be distinguished from each other; With

Described multiple protein with polynucleotide encoding is contacted certain hour with sample under certain condition with described multiple substrate polynucleotide, allowing described protein in multiple protein-target complex body, to combine, and allow described coded polynucleotide to combine with described substrate polynucleotide with polynucleotide encoding with target molecule.

9. the method for claim 8, wherein following detecting to multiple protein-target complex body on the substrate with polynucleotide encoding:

Multiple molecule through mark is provided, every kind of molecule through mark comprises and a kind of target specificity bonded molecule of described multiple target and the tagged compound that marking signal is provided, this tagged compound is attached to described molecule through mark, and various molecules through mark can be distinguished from each other in context of detection;

Described multiple molecule through mark is contacted certain hour under certain condition with described multiple protein with polynucleotide encoding-target complex body, combine with described multiple molecule through mark to allow described multiple target complex body with polynucleotide encoding; With

Detection from substrate on the marking signal of the multiple multiple tagged molecule of target complex body bonded with polynucleotide encoding.

10. the method for claim 9, wherein said tagged compound is a metal nanoparticle.

11. each method in the claim 8 to 10, wherein said is antibody with the protein component in the protein of polynucleotide encoding.

12. each method in the claim 1 to 4, wherein said target are multiple targets, this target comprises at least a target polynucleotide, and the wherein following substrate polynucleotide that will be attached to substrate are with combined with the protein of polynucleotide encoding:

The multiple substrate polynucleotide that are attached to substrate are provided, and various substrate polynucleotide are sequence-specific and can be distinguished from each other on the position;

At least a polynucleotide through mark are provided, and its specificity is in conjunction with at least a target polynucleotide, various mark polynucleotide in conjunction with aspect can be distinguished from each other;

Described at least a polynucleotide through mark are contacted certain hour under certain condition with sample, thereby provide at least a target polynucleotide through mark to allow described polynucleotide to combine with target polynucleotide through mark, wherein said at least a target polynucleotide through mark is made up of such sequence, and described sequence combines with differentiable substrate polynucleotide specificity on sequence-specific and the position;

At least a protein with polynucleotide encoding is provided, it comprises protein and is attached to this proteinic coded polynucleotide, wherein said protein combines with target specificity in the described multiple target, and described coded polynucleotide combines with differentiable substrate polynucleotide specificity on sequence-specific and the position, range protein and coded polynucleotide in conjunction with aspect can be distinguished from each other, range protein in conjunction with aspect can distinguish with various polynucleotide through mark, various with polynucleotide encoding protein in conjunction with aspect can distinguish with various target polynucleotides through mark;

Described at least a protein with polynucleotide encoding is contacted certain hour under certain condition with sample, combine at least a protein-target complex body with target with polynucleotide encoding to allow described protein; With

Described at least a target polynucleotide through mark is contacted certain hour with described at least a protein with polynucleotide encoding-target complex body under certain condition with multiple substrate polynucleotide, allowing described at least a target polynucleotide through mark to combine, and allow described at least a coded polynucleotide to combine with substrate polynucleotide accordingly with corresponding substrate polynucleotide;

This method also comprises:

Detect the described target polynucleotide that combines with multiple sterically defined substrate polynucleotide on the substrate through mark.

13. the method for claim 12 wherein followingly detects the above protein with polynucleotide encoding of substrate-target complex body:

Multiple protein through mark is provided, and every kind of molecule through mark comprises and a kind of target specificity bonded molecular components of described multiple target and the tagged compound that marking signal is provided; This tagged compound is attached to described molecule through mark;

Detection from substrate on the multiple described multiple marking signal that combines with the target complex body of polynucleotide encoding through labelled protein.

14. the method for claim 13, wherein said tagged compound are to be attached to this proteinic metal nanoparticle.

15. each method in the claim 12 to 14, wherein said is antibody with the protein component in the protein of polynucleotide encoding.

16. be used for the system of the target molecule of test sample, this system comprises

Substrate has the substrate polynucleotide that are attached on this substrate; With

With the protein of polynucleotide encoding, it comprises protein and is attached to this proteinic coded polynucleotide, and wherein said protein combines with the target specificity, and described coded polynucleotide combines with described substrate polynucleotide specificity.

17. the system of claim 16, this system also comprises:

Through the molecule of mark, it comprises specificity in conjunction with the molecule of target be attached to described proteinic tagged compound, and this tagged compound provides marking signal.

18. the system of claim 16, wherein target is multiple target, and this system comprises:

Substrate, it has the multiple substrate polynucleotide that are attached on this substrate, and the various polynucleotide in the described multiple substrate polynucleotide that are attached on the substrate are sequence-specific and can be distinguished from each other on the position; With

Multiple protein with polynucleotide encoding, every kind of protein with polynucleotide encoding comprises protein and is attached to this proteinic coded polynucleotide, wherein said protein combines with predetermined target specificity in the described multiple target, and in described coded polynucleotide and the described multiple polynucleotide that are attached on the substrate sequence-specific and on the position differentiable polynucleotide specificity combine, range protein and coded polynucleotide in conjunction with aspect can be distinguished from each other.

19. the system of claim 18, this system also comprises:

Multiple molecule through mark, every kind of molecule through mark comprise with described multiple target in a kind of target specificity bonded molecule and the tagged compound that is attached to this protein component, this tagged compound provides marking signal, and various molecules through mark can be distinguished from each other in context of detection.

20. the system of claim 16, wherein said target is multiple target, and described multiple target comprises at least a target polynucleotide, and this system comprises:

Substrate, it has the multiple substrate polynucleotide that are attached to this substrate, and various substrate polynucleotide are sequence-specific and can be distinguished from each other on the position;

At least a polynucleotide through mark, it combines with described at least a target polynucleotide specificity, various mark polynucleotide in conjunction with aspect can be distinguished from each other, various polynucleotide through mark are used to produce the target polynucleotide through mark, in described target polynucleotide through mark and the described multiple sterically defined substrate polynucleotide sequence-specific and on the position differentiable substrate polynucleotide specificity combine;

At least a protein with polynucleotide encoding, it comprises protein and is attached to this proteinic coded polynucleotide, wherein said protein combines with the target specificity of described multiple target, and described coded polynucleotide and sequence-specific and on the position differentiable substrate polynucleotide specificity combine, range protein and coded polynucleotide in conjunction with aspect can be distinguished from each other;

Range protein in conjunction with aspect can distinguish with various polynucleotide through mark;

Various protein with polynucleotide encoding in conjunction with aspect can distinguish with various target polynucleotides through mark.

21. the system of claim 20, this system also comprises:

At least a molecule through mark, it comprises and at least a target specificity bonded molecule and the tagged compound that is attached to this molecule, and this tagged compound provides marking signal.

22. the method for sorting targets from multiple target, this method comprises:

Multiple protein with polynucleotide encoding is provided, every kind of protein with polynucleotide encoding comprises protein and is attached to this proteinic coded polynucleotide, wherein this protein combines with predetermined target specificity in the described multiple target, and in described coded polynucleotide and the described multiple substrate polynucleotide sequence-specific and on the position differentiable substrate polynucleotide specificity combine, range protein and coded polynucleotide in conjunction with aspect can be distinguished from each other;

Described multiple antibody with polynucleotide encoding is contacted certain hour under certain condition with sample, combine with target, thereby multiple protein with polynucleotide encoding-target complex body is provided to allow described antibody; With

Described multiple protein with polynucleotide encoding-target complex body is contacted certain hour under certain condition with described multiple substrate polynucleotide, combine with the substrate polynucleotide that are attached to substrate to allow described coded polynucleotide;

Thus with the multiple protein of substrate bonded-target complex body with polynucleotide encoding in the described multiple target of sorting.

23. the method for claim 22, wherein said target is a cell.

24. the system of the multiple target of sorting, this system comprises:

Substrate, it has the multiple substrate polynucleotide that are attached to this substrate, and the various polynucleotide in the described multiple substrate polynucleotide that are attached to substrate are sequence-specific and can be distinguished from each other on the position; With

Multiple protein with polynucleotide encoding, every kind of protein with polynucleotide encoding comprises protein and is attached to this proteinic coded polynucleotide, wherein said protein combines with predetermined target specificity in the described multiple target, and in described coded polynucleotide and the described multiple polynucleotide that are attached to substrate sequence-specific and on the position differentiable polynucleotide specificity combine, range protein in conjunction with aspect can be distinguished from each other, various coded polynucleotides in conjunction with aspect can be distinguished from each other.

25. be used for detecting at sample fluid the microfluidic arrays of one or more targets, it comprises:

Have the microfluid component that is used for load sample fluidic microfluid member and

Substrate assembly, it has the multiple substrate polynucleotide that are attached to this substrate assembly, and these substrate polynucleotide are sequence-specific and can distinguish that this substrate assembly is effectively related with the microfluid member that is used for analytic sample fluidic microfluid component on the position;

Wherein every kind of described substrate polynucleotide are made up of the sequence that the sequence with other substrate polynucleotide is independent of each other.

26. in sample fluid, detect the method for one or more targets, comprise in carry out claim 1 to 7 with the microfluidic arrays of claim 25 each method.

27. in sample fluid, detect the method for one or more targets, comprise in carry out claim 8 to 11 with the microfluidic arrays of claim 25 each method.

28. in sample fluid, detect the method for one or more targets, comprise in carry out claim 12 to 15 with the microfluidic arrays of claim 25 each method.