USRE48461E1 - Modulation of androgen receptor expression - Google Patents

Modulation of androgen receptor expression Download PDF

Info

Publication number
USRE48461E1
USRE48461E1 US16/275,198 US201916275198A USRE48461E US RE48461 E1 USRE48461 E1 US RE48461E1 US 201916275198 A US201916275198 A US 201916275198A US RE48461 E USRE48461 E US RE48461E
Authority
US
United States
Prior art keywords
sugar
certain embodiments
modified oligonucleotide
wing segment
linked nucleosides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US16/275,198
Inventor
Robert A. MacLeod
Youngsoo Kim
Tianyuan Zhou
Susan M. Freier
Punit Seth
Eric Swayze
Brett Monia
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Lonis Pharmaceuticals Inc
Original Assignee
Lonis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=50475891&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=USRE48461(E1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Lonis Pharmaceuticals Inc filed Critical Lonis Pharmaceuticals Inc
Priority to US16/275,198 priority Critical patent/USRE48461E1/en
Application granted granted Critical
Publication of USRE48461E1 publication Critical patent/USRE48461E1/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41661,3-Diazoles having oxo groups directly attached to the heterocyclic ring, e.g. phenytoin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications

Definitions

  • Certain embodiments are directed to compounds and compositions targeted to human androgen receptor (AR) for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting cancer cell growth or proliferation.
  • AR human androgen receptor
  • Androgen receptor belongs to the superfamily of nuclear receptors and is activated by binding to its hormone ligands: androgen, testosterone, or DHT. Upon binding hormone ligand in the cytoplasm, androgen receptor trans-locates to the nucleus where it binds DNA and functions as a transcription factor to regulate expression of a number of target genes, such as prostate specific antigen (PSA) and TMPRSS2.
  • PSA prostate specific antigen
  • TMPRSS2 TMPRSS2.
  • Androgen receptor (AR) signaling is a critical survival pathway for prostate cancer cells, and androgen-deprivation therapy (ADT), also known as “chemical castration”, is a first-line treatment strategy against hormone-sensitive, androgen-dependent prostate cancer that reduces circulating androgen levels and thereby inhibits AR activity.
  • ADT also known as “chemical castration”
  • CRPC castrate-resistant prostate cancer
  • castrate (castration) resistance There are a number of mechanisms underlying the development of castrate (castration) resistance including an increase in the expression of AR protein which can sensitize cells to low levels of androgen, AR mutations that can alter transactivation or sensitize AR to alternative ligands and the emergence of alternatively spliced forms of AR, which lack the ligand binding domain but can nevertheless act to promote tumour growth in the absence of ligand stimulation. Additionally prostate tumors may also synthesize their own androgens thereby increasing the local intra-tumoral testosterone levels available to activate the AR.
  • Androgen receptor (AR) signaling is a critical survival pathway for prostate cancer cells, and androgen-deprivation therapy (ADT) remains the principal treatment for patients with locally advanced and metastatic disease. Although a majority of patients initially respond to ADT, most will eventually develop castrate resistance in which the disease progresses despite castrate levels of testosterone. This type of cancer is known as castrate-resistant prostate cancer (CRPC) (Karantos et al., Oncogene advance online: 1-13, 2013).
  • CRPC castrate-resistant prostate cancer
  • the present invention provides antisense oligonclueotides which by virtue of their design and mode of action (base-pair with the AR RNA target and mediate its destruction by RNase H, an enzyme that destroys the RNA in a DNA/RNA duplex) are aimed at inhibiting the major forms of AR
  • RNase H an enzyme that destroys the RNA in a DNA/RNA duplex
  • the antisense oligonucleotide will result in inhibition of the major forms (full length, splice variant and mutated forms) of androgen receptor proteins and therefore be suitable for the treatment of patients with CRPC.
  • AR is also implicated as a factor in the progression of other tumours such as breast cancer.
  • breast cancer In breast cancer AR is expressed in 70-80% of tumours which are also ER positive and in 12% cases which are known as triple negative (no expression of ER, PR and HER2) (Hickey et al., Molecular Endocrinology 26: 1252-1267, 2012).
  • the androgen receptor antagonist bicalutamide induces anti-proliferative responses in vitro in breast cancer cells and this is potentiated by addition of a Pi3K/mTOR inhibitor (Ni et al., Cancer Cell 20: 119-131, 2011).
  • the 2nd generation anti-androgen, enzalutamide inhibits dihydrotestosterone (DHT) mediated proliferation in ER+/AR+ breast cancer cells and is as effective as tamoxifen at inhibiting estrogen-stimulated breast cancer tumour growth in pre-clinical models in vivo (Cochrane et al., Cancer Res 72(24 Supplement): P2-14-02, 2012). Enzalutamide also inhibits proliferation in HER2 + and triple-negative breast cancer cells. It appears that in situations where estrogen action is reduced (eg. long-term estrogen deprivation or absence of ER) AR levels increase and can become oncogenic.
  • DHT dihydrotestosterone
  • AR antagonists may be best positioned in triple negative or hormone resistant breast cancer settings (Hickey et al., Molecular Endocrinology 26: 1252-1267, 2012).
  • AR targeted therapies are currently under investigation in clinical trials for breast cancer (NCT00468715, NCT01597193, NCT01381874, NCT00755886).
  • Several embodiments provided herein relate to the discovery of compounds and compositions for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting proliferation or growth of cancer cells, such as prostate, breast, ovarian, gastric or bladder cancer or cancer cells.
  • 2′-O-methoxyethyl refers to an O-methoxy-ethyl modification at the 2′ position of a sugar ring, e.g. a furanose ring.
  • a 2′-O-methoxyethyl modified sugar is a modified sugar.
  • 2′-substituted nucleoside means a nucleoside comprising a substituent at the 2′-position of the furanosyl ring other than H or OH.
  • 2′ substituted nucleosides include nucleosides with bicyclic sugar modifications.
  • 3′ target site refers to the nucleotide of a target nucleic acid which is complementary to the 3′-most nucleotide of a particular antisense compound.
  • 5′ target site refers to the nucleotide of a target nucleic acid which is complementary to the 5′-most nucleotide of a particular antisense compound.
  • 5-methylcytosine means a cytosine modified with a methyl group attached to the 5′ position.
  • a 5-methylcytosine is a modified nucleobase.
  • administering refers to routes of introducing an antisense compound provided herein to a subject to perform its intended function.
  • routes of administration includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
  • “Androgen-receptor positive” with respect to breast cancer or a breast cancer cell refers to a breast cancer or a breast cancer cell that expresses androgen receptor.
  • Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
  • Anti-androgenic agent refers to a therapeutic compound or drug which is an androgen synthesis inhibitor or an androgen receptor blocker.
  • Antisense activity means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
  • Antisense mechanisms are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
  • Antisense oligonucleotide means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
  • Cap structure or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • Crop-resistant prostate cancer or “Castration-resistant prostate cancer” and prostate cancer cells refer to the reduction of sensitivity of prostate cancer and prostate cancer cells to androgen deprivation therapy or an anti-androgenic agent.
  • cEt or “constrained ethyl” means a bicyclic sugar moiety comprising a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4-CH(CH 3 )—O-2′.
  • Consstrained ethyl nucleoside (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4′-CH(CH 3 )—O-2′ bridge.
  • Chimeric antisense compounds means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.
  • Contiguous nucleobases means nucleobases immediately adjacent to each other.
  • Deoxyribonucleotide means a nucleotide having a hydrogen at the 2′ position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.
  • Designing or “Designed to” refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
  • Downstream refers to the relative direction toward the 3′ end or C-terminal end of a nucleic acid.
  • Estrogen-receptor (ER) positive with respect to breast cancer or a breast cancer cell refers to breast cancer or a breast cancer cell that expresses estrogen receptor (ER).
  • Estrogen-receptor (ER) negative with respect to breast cancer or a breast cancer cell refers to breast cancer or a breast cancer cell that does not express estrogen receptor (ER).
  • “Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
  • “Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
  • Hybridization means the annealing of complementary nucleic acid molecules.
  • complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target.
  • complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
  • “Individual” means a human or non-human animal selected for treatment or therapy.
  • “Inhibiting the expression or activity” refers to a reduction, blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
  • Internucleoside linkage refers to the chemical bond between nucleosides.
  • “Lengthened” antisense oligonucleotides are those that have one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein.
  • Linked deoxynucleoside means a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.
  • Linked nucleosides means adjacent nucleosides linked together by an internucleoside linkage.
  • mismatch or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
  • Modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
  • Modified nucleobase means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
  • An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleoside means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
  • Modified nucleotide means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
  • Modified oligonucleotide means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.
  • Modified sugar means substitution and/or any change from a natural sugar moiety.
  • “Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.
  • Microtif means the pattern of unmodified and modified nucleosides in an antisense compound.
  • Natural sugar moiety means a sugar moiety found in DNA (2′-H) or RNA (2′-OH).
  • “Naturally occurring internucleoside linkage” means a 3′ to 5′ phosphodiester linkage.
  • Non-complementary nucleobase refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
  • Nucleic acid refers to molecules composed of monomeric nucleotides.
  • a nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • Nucleobase complementarity refers to a nucleobase that is capable of base pairing with another nucleobase.
  • adenine (A) is complementary to thymine (T).
  • adenine (A) is complementary to uracil (U).
  • complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid.
  • nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid
  • the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
  • Nucleobase sequence means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
  • Nucleoside means a nucleobase linked to a sugar.
  • Nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, e.g., non furanose sugar units.
  • Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by —N(H)—C( ⁇ O)—O— or other non-phosphodiester linkage).
  • Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only.
  • the tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.
  • “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • Nucleotide means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • “Oligomeric compound” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • Oligonucleoside means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.
  • Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • Phosphorothioate linkage means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
  • a phosphorothioate linkage is a modified inter-nucleoside linkage.
  • “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound
  • Progesterone receptor (PR) negative with respect to breast cancer or a breast cancer cell refers to breast cancer or a breast cancer cell that does not express progesterone receptor (PR).
  • Regular is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • “Ribonucleotide” means a nucleotide having a hydroxy at the 2′ position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
  • “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid.
  • Sites are defined as unique nucleobase positions within a target nucleic acid.
  • Specifically hybridizable refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.
  • “Stringent hybridization conditions” or “stringent conditions” refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
  • Subject means a human or non-human animal selected for treatment or therapy.
  • “Synergy” or “synergize” refers to an effect of a combination that is greater than additive of the effects of each component alone.
  • Target refers to a protein, the modulation of which is desired.
  • Target gene refers to a gene encoding a target.
  • Targeting means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
  • Target nucleic acid all mean a nucleic acid capable of being targeted by antisense compounds.
  • Target region means a portion of a target nucleic acid to which one or more antisense compounds is targeted.
  • Target segment means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
  • 5′ target site refers to the 5′-most nucleotide of a target segment.
  • 3′ target site refers to the 3′-most nucleotide of a target segment.
  • Treating cancer refers to performing actions that lead to amelioration of cancer or of the symptoms accompanied therewith. The combination of said actions is encompassed by the term “treatment.” Amelioration of cancer includes, but is not limited to, reducing the number of cancer cells in a subject or reducing the number of cancer cells in the subject. Said treatment as used herein also includes an entire restoration of the health with respect to cancer. It is to be understood that treatment as used in accordance with embodiments provided herein may not be effective in all subjects to be treated. However, a population of subjects suffering from cancer referred to herein can be successfully treated.
  • “treating cancer” can be described by a number of different parameters including, but not limited to, reduction in the size of a tumor in a subject having cancer, reduction in the growth or proliferation of a tumor in a subject having cancer, preventing metastasis or reducing the extent of metastasis, and/or extending the survival of a subject having cancer compared to control.
  • the cancer referred to in this definition can be any cancer including one selected from prostate cancer, breast cancer, ovarian cancer, gastric cancer and bladder cancer.
  • Unmodified nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Unmodified nucleotide means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and inter-nucleoside linkages.
  • an unmodified nucleotide is an RNA nucleotide (i.e. ⁇ -D-ribonucleosides) or a DNA nucleotide (i.e. ⁇ -D-deoxyribonucleoside).
  • Upstream refers to the relative direction toward the 5′ end or N-terminal end of a nucleic acid.
  • Certain embodiments provide methods, compounds, and compositions for inhibiting androgen receptor (AR) mRNA expression.
  • AR androgen receptor
  • the androgen receptor nucleic acid is the sequences set forth in GENBANK Accession No. NT_011669.17_TRUNC_5079000_5270000 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NM_000044.3 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. NM_001011645.2 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. FJ235916.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No.
  • FJ235917.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. FJ235918.1 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. FJ235919.1 (incorporated herein as SEQ ID NO: 7), or GENBANK Accession No. FJ235920.1 (incorporated herein as SEQ ID NO: 8).
  • the compounds or compositions comprise a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to AR.
  • the AR target can have a sequence recited in any one of SEQ ID NOs: 1-8 or a portion thereof or a variant thereof.
  • the AR target can have a sequence of known AR splicing variants including, but are not limited to, AR-V1, AR-V2, AR-V3, AR-V4, AR-V5, AR-V6, and AR-V7 (also referred to as AR3), which contain exons 1-3 but lack exons 4-8.
  • AR-V1, AR-V2, AR-V3, AR-V4, AR-V5, AR-V6, AR-V7, and additional splicing variants targetable by compounds provided herein are described in Hu et al., Cancer Res 2009; 69:16-22 and US Patent Application Publication No. US 2010/0068802, each of which is incorporated herein by reference in its entirety.
  • the compounds or compositions comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179.
  • one or more modified nucleosides in the wing segment have a modified sugar.
  • the modified sugar is a bicyclic sugar.
  • the modified nucleoside is an LNA nucleoside.
  • the modified nucleoside is a 2′-substituted nucleoside.
  • 2′ substituted nucleosides include nucleosides with bicyclic sugar modifications.
  • the modified nucleoside is a 2′-MOE nucleoside.
  • the modified nucleoside is a constrained ethyl (cEt) nucleoside.
  • the compounds or compositions comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence consisting of a nucleobase sequence of any of SEQ ID NOs: 12-179.
  • one or more modified nucleosides in the wing segment have a modified sugar.
  • the modified sugar is a bicyclic sugar.
  • the modified nucleoside is an LNA nucleoside.
  • the modified nucleoside is a 2′-substituted nucleoside.
  • 2′ substituted nucleosides include nucleosides with bicyclic sugar modifications.
  • the modified nucleoside is a 2′-MOE nucleoside.
  • the modified nucleoside is a constrained ethyl (cEt) nucleoside.
  • the compounds or compositions targeted to androgen receptor comprise a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175, or a pharmaceutically acceptable salt thereof.
  • the antisense compound targeted to human AR is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5′ wing segment consisting of linked nucleosides; and c) a 3′ wing segment consisting of linked nucleosides.
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and each nucleoside of each wing segment comprises a modified sugar.
  • the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of 10 linked deoxynucleosides, the 5′ wing segment consisting of five linked nucleosides, the 3′ wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 10 linked deoxynucleosides, a 5′ wing segment consisting of three linked nucleosides, a 3′ wing segment consisting of three linked nucleosides, each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.
  • cEt constrained ethyl
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 9 linked deoxynucleosides, a 5′ wing segment consisting of three linked nucleosides, a 3′ wing segment consisting of four linked nucleosides;
  • the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage;
  • each cytosine is a 5-methylcytosine.
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 8 linked deoxynucleosides, a 5′ wing segment consisting of five linked nucleosides, a 3′ wing segment consisting of three linked nucleosides; the five linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar; the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 8 linked deoxynucleosides, a 5′ wing segment consisting of four linked nucleosides, a 3′ wing segment consisting of four linked nucleosides;
  • the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 8 linked deoxynucleosides, a 5′ wing segment consisting of five linked nucleosides, a 3′ wing segment consisting of three linked nucleosides;
  • the five linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 7 linked deoxynucleosides, a 5′ wing segment consisting of seven linked nucleosides, a 3′ wing segment consisting of two linked nucleosides;
  • the seven linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the two linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar;
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 7 linked deoxynucleosides, a 5′ wing segment consisting of six linked nucleosides, a 3′ wing segment consisting of three linked nucleosides;
  • the six linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar;
  • each internucleoside linkage is a phosphorothioate link
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 7 linked deoxynucleosides, a 5′ wing segment consisting of five linked nucleosides, a 3′ wing segment consisting of four linked nucleosides;
  • the five linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-
  • the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 7 linked deoxynucleosides, a 5′ wing segment consisting of four linked nucleosides, a 3′ wing segment consisting of five linked nucleosides;
  • the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the five linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, and a 2′-
  • the compounds or compositions targeted to androgen receptor comprise a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises a gap segment consisting of deoxynucleosides; a 5′ wing segment; and a 3′ wing segment, wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and each nucleoside of each wing segment comprises a modified sugar.
  • each internucleoside linkage of the modified oligonucleotide is a phosphorothioate linkage.
  • each cytosine of the modified oligonucleotide is a 5′-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of three linked nucleosides
  • a 3′ wing segment consisting of four linked nucleosides
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage;
  • each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of three linked nucleosides
  • a 3′ wing segment consisting of four linked nucleosides
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage;
  • each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of four linked nucleosides
  • a 3′ wing segment consisting of four linked nucleosides
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of five linked nucleosides
  • a 3′ wing segment consisting of three linked nucleosides
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the five linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of four linked nucleosides
  • a 3′ wing segment consisting of five linked nucleosides
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the five linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcyto
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of six linked nucleosides
  • a 3′ wing segment consisting of three linked nucleosides
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the six linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 43, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of three linked nucleosides
  • a 3′ wing segment consisting of three linked nucleosides
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 124, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of three linked nucleosides
  • a 3′ wing segment consisting of three linked nucleosides
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 150, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of three linked nucleosides
  • a 3′ wing segment consisting of three linked nucleosides
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 155, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of three linked nucleosides
  • a 3′ wing segment consisting of three linked nucleosides
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 169, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of three linked nucleosides
  • a 3′ wing segment consisting of three linked nucleosides
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 175, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • a 5′ wing segment consisting of three linked nucleosides
  • a 3′ wing segment consisting of three linked nucleosides
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • an antisense compound or antisense oligonucleotide targeted to an androgen receptor nucleic acid is complementary within the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 40
  • an antisense compound or antisense oligonucleotide targeted to an androgen receptor nucleic acid target the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-40
  • antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid.
  • such compounds or oligonucleotides targeted to a region of an androgen receptor nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region.
  • the portion can be at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobases portion complementary to an equal length portion of a region recited herein.
  • such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 4056-4071,
  • an antisense compound or antisense oligonucleotide provided herein targets AR within exon 1, for example within nucleotide regions 2863-5593 (exon 1) or 27672-27853 (exon 1B) of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4047
  • an antisense compound or antisense oligonucleotide provided herein targets AR within exon 2, for example within nucleotide regions 102087-102238 (exon 2) or 139551-139834 (exon 2c) of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 102155-102170, 102156-102171, 139682-139697, 139762-139777, or 139782-139797.
  • an antisense compound or antisense oligonucleotide provided herein targets AR within exon 3, for example within nucleotide regions 144841-144957 (exon 3), 148380-148594 (exon 3b), or 153504-154908 (exon 3d) of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 3 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 144856-144871, 144938-144953, 148406-148421, 148443-148458, or 148520-148535.
  • an antisense compound or antisense oligonucleotide provided herein targets AR within exon 7, for example within nucleotide region 181658-181815 of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 7 of AR is complementary within nucleotide region 181695-181710 of SEQ ID NO: 1.
  • an antisense compound or antisense oligonucleotide provided herein targets AR within exon 8, for example within nucleotide region 182517-189455 of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 8 of AR is complementary within nucleotide regions 182958-182973 or 183049-183064 of SEQ ID NO: 1.
  • an antisense compound or antisense oligonucleotide provided herein targets AR within intron 1, for example within nucleotide regions 5594-27671 or 27854-102086 of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to intron 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070,
  • an antisense compound or antisense oligonucleotide provided herein targets AR within intron 2, for example within nucleotide regions 102239-139550 or 139835-144840 of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to intron 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 114874-114889, 115272-115287, 115365-115380, or 134971-134986.
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or antisense oligonucleotides, display at least 50% inhibition: 3099-3114, 3120-3135, 3351-3366, 3353-3368, 3361-3376, 3513-3528, 3519-3534, 3768-3783, 3799-3814, 3851-3866, 3888-3903, 4059-4074, 4534-4549, 4555-4570, 4571-4586, 4578-4593, 4655-4670, 4699-4714, 4750-4765, 4755-4770, 4865-4880, 5054-5069, 5060-5075, 5061-5076, 5062-5077, 5155-5170, 5265-5280, 5392-5407, 5448-5463, 5483-5498, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265,
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or antisense oligonucleotides, display at least 60% inhibition: 3799-3814, 3851-3866, 3888-3903, 4059-4074, 4534-4549, 4555-4570, 4571-4586, 4578-4593, 4655-4670, 4699-4714, 4755-4770, 4865-4880, 5060-5075, 5061-5076, 5062-5077, 5155-5170, 5265-5280, 5392-5407, 5448-5463, 5483-5498, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or antisense oligonucleotides, display at least 70% inhibition: 3799-3814, 3851-3866, 3888-3903, 4059-4074, 4534-4549, 4655-4670, 4699-4714, 4755-4770, 4865-4880, 5060-5075, 5062-5077, 5155-5170, 5265-5280, 5392-5407, 5448-5463, 5483-5498, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 33315-33330, 42017-42032, 58719-58734, 58
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or antisense oligonucleotides, display at least 80% inhibition: 3799-3814, 3851-3866, 3888-3903, 4059-4074, 4534-4549, 4655-4670, 4699-4714, 4755-4770, 4865-4880, 5060-5075, 5062-5077, 5155-5170, 5265-5280, 5392-5407, 5448-5463, 5483-5498, 8471-8486, 8638-8653, 9464-9479, 10865-10880, 11197-11212, 13189-13204, 16793-16808, 58719-58734, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58765, 58751-58766, 58752-58767, 5875
  • nucleotide regions of SEQ ID NO: 1 when targeted by antisense compounds or antisense oligonucleotides, display at least 90% inhibition: 4534-4549, 5060-5075, 5062-5077, 5155-5170, 5265-5280, 5448-5463, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 182958-182973, and 183049-183064.
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 50% inhibition of an androgen receptor mRNA, ISIS IDs: 549332, 549334, 549338, 549347, 549358, 549360, 549361, 549362, 549366, 549371, 549372, 549374, 549377, 549379, 549380, 549381, 549387, 549390, 549414, 549432, 549434, 549457, 549458, 549459, 560071, 560098, 560099, 560100, 560131, 560132, 560133, 560137, 569213, 569215, 569216, 569220, 569222, 569223, 569227, 569228, 569229, 569236, 569238, 583559, 583567, 583608, 583609, 583613
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 50% inhibition of an androgen receptor mRNA, SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 46, 49, 53, 54, 55, 57, 59, 63, 92, 93, 95, 101, 125, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, and 177.
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 60% inhibition of an androgen receptor mRNA, ISIS IDs: 549332, 549334, 549338, 549347, 549358, 549360, 549361, 549362, 549366, 549371, 549372, 549374, 549377, 549379, 549380, 549381, 549387, 549390, 549414, 549432, 549434, 549457, 549458, 549459, 560071, 560098, 560099, 560100, 560131, 560137, 569213, 569216, 569222, 569228, 569236, 583795, 583796, 583799, 584145, 584148, 584149, 584152, 584157, 584158, 584162, 584163, 584165, 584
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 60% inhibition of an androgen receptor mRNA, SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 38, 39, 40, 41, 42, 43, 92, 93, 95, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 170, 171, 173, 175, and 176.
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 70% inhibition of an androgen receptor mRNA, ISIS IDs: 549332, 549334, 549338, 549347, 549358, 549360, 549361, 549362, 549366, 549371, 549372, 549374, 549377, 549379, 549380, 549381, 549387, 549390, 549414, 549432, 549434, 549457, 549458, 549459, 560071, 560098, 560099, 560100, 560131, 560137, 569222, 584145, 584148, 584149, 584152, 584162, 584163, 584165, 584166, 584167, 584168, 584179, 584180, 584183, 584184, 584192, 584245, 584274
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 70% inhibition of an androgen receptor mRNA, SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 148, 149, 150, 151, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 167, 170, and 176.
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 80% inhibition of an androgen receptor mRNA, ISIS IDs: 549332, 549334, 549338, 549347, 549358, 549360, 549361, 549362, 549366, 549371, 549372, 549374, 549377, 549379, 549380, 549381, 549387, 549390, 549414, 549432, 549434, 549457, 549458, 549459, 560098, 560099, 560100, 560137, 584148, 584149, 584152, 584162, 584163, 584166, 584180, 586124, 586224, 586225, and 586227.
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 80% inhibition of an androgen receptor mRNA, SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 43, 149, 150, 151, 154, 155, 157, and 161.
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 90% inhibition of an androgen receptor mRNA, ISIS IDs: 549358, 549371, 549372, 549374, 549377, 549380, 549432, 549434, 549457, 549458, 549459, 560098, 560099, 560100, 560137, and 586224.
  • the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 90% inhibition of an androgen receptor mRNA, SEQ ID NOs: 16, 21, 22, 23, 24, 26, 33, 34, 35, 36, 37, 39, 40, and 41.
  • Percent inhibition of androgen receptor mRNA can be determined using standard methods known to those of skill in the art, such as described in Example 1.
  • antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • Antisense compounds described by ISIS number indicate a combination of nucleobase sequence, chemical modification, and motif.
  • the compounds or compositions as described herein are efficacious by virtue of having at least one of an in vitro IC 50 of less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55 nM, less than 50 nM, less than 45 nM, less than 40 nM, less than 35 nM, less than 30 nM, less than 25 nM, or less than 20 nM when delivered to HuVEC cells.
  • inhibition is measured with primer probe set RTS3559, as described herein.
  • the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an ALT or AST value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2%.
  • the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over saline treated animals.
  • the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over saline treated animals.
  • an antisense compound provided herein targets an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of exons 4-8 encoding the ligand binding domain.
  • An example of such an AR splicing variant includes, but is not limited to, AR-V7, which contains exons 1-3 but lacks exons 4-8. Additional examples of such AR splicing variants include, for example, AR3, AR4, AR4b, AR5, and AR6 (SEQ ID NOs: 4-8, respectively).
  • an antisense compound targeted to AR upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain is capable of inhibiting androgen receptor levels to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No. 7,737,125.
  • an antisense compound targets an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain. It will be understood that in certain embodiments an antisense compound can target an AR splicing variant that includes the entire or at least a functional portion of exon 1 encoding the N-terminal domain and the entire or at least a functional portion of exons 2 and 3 encoding the DNA binding domain, but does not include at least a functional portion of exon 4 encoding the short hinge region or at least a functional portion of exons 4-8 encoding the ligand binding domain.
  • certain AR splicing variants targeted by the antisense compounds provided herein substantially consisting of exons 1-3 may also include a non-functional portion of nucleic acid sequence from a genomic region or exons 4-8. It is contemplated that the splicing process may give rise to such AR splicing variants that retain DNA binding function but not ligand binding function.
  • an antisense compound targeted to an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain is capable of inhibiting growth or proliferation of prostate cancer cells that are castrate-resistant.
  • an antisense compound targeted to an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain is capable of inhibiting growth or proliferation of a prostate cancer cell resistant to a diarylhydantoin AR inhibitor of Formula XI to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No. 7,737,125.
  • an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound provided herein targets AR within exon 2, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within intron 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound provided herein is capable of reducing expression of both full-length AR and an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of any one of exons 4-8 encoding the ligand binding domain.
  • such an antisense compound targets human androgen receptor upstream of the ligand binding domain.
  • such antisense compounds target human androgen receptor upstream of the 3′ end of exon 3.
  • an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within exon 2, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within intron 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound provided herein targets an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of exons 4-8 encoding the ligand binding domain.
  • An example of such an AR splicing variant includes, but is not limited to, AR-V7, which contains exons 1-3 but lacks exons 4-8.
  • an antisense compound targeted to human androgen receptor (AR) upstream of the ligand binding domain that is capable of inhibiting growth or proliferation of the resistant prostate cancer cell to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No. 7,737,125.
  • an antisense compound targeted to human androgen receptor (AR) upstream of the ligand binding domain is targeted to a region of AR upstream of the 3′ end of exon 3.
  • an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within exon 2, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within intron 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • the nucleobase sequence of a modified oligonucleotide provided herein is at least 70%, 75%, 80%, 85%, 90%, 95% or 100% complementary to any one of SEQ ID NOs: 1-8, as measured over the entirety of the modified oligonucleotide.
  • an antisense compound is a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NOs: 1-8 as measured over the entirety of said modified oligonucleotide.
  • an antisense compound is a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence 100% complementary to any of SEQ ID NOs: 1-8 as measured over the entirety of said modified oligonucleotide.
  • a compound or modified oligonucleotide provided herein is single-stranded.
  • a modified oligonucleotide provided herein consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
  • At least one internucleoside linkage of a modified oligonucleotide provided herein is a modified internucleoside linkage.
  • each internucleoside linkage is a phosphorothioate internucleoside linkage.
  • At least one nucleoside of the modified oligonucleotide comprises a modified sugar.
  • at least one modified sugar comprises a 2′-O-methoxyethyl group (2′-O(CH 2 ) 2 —OCH 3 ).
  • the modified sugar comprises a 2′-O—CH 3 group.
  • At least one modified sugar is a bicyclic sugar.
  • the bicyclic sugar comprises a 4′-(CH 2 ) n —O-2′ bridge, wherein n is 1 or 2.
  • the bicyclic sugar comprises a 4′-CH 2 —O-2′ bridge.
  • the bicyclic sugar comprises a 4-CH(CH 3 )—O-2′ bridge.
  • At least one nucleoside of a modified oligonucleotide provided herein comprises a modified nucleobase.
  • the modified nucleobase is a 5-methylcytosine.
  • a modified oligonucleotide provided herein consists of a single-stranded modified oligonucleotide.
  • compounds or compositions provided herein comprise a salt of the modified oligonucleotide.
  • Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • An antisense compound targeted to an androgen receptor nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to an androgen receptor nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is water.
  • the antisense compound is an antisense oligonucleotide provided herein.
  • compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.
  • Certain aspects of the invention are directed to methods of treating cancer which comprises administering an antisense compound targeted to androgen receptor as provided herein.
  • the cancer is AR positive.
  • the cancer is prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • the antisense compound is single-stranded.
  • the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • the cancer is AR positive.
  • the cancer is prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • the antisense compound is single-stranded.
  • the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • an antisense compound targeted to androgen receptor provided herein for the manufacture of a medicament for treating cancer.
  • the cancer is AR positive.
  • the cancer is prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • the antisense compound is single-stranded.
  • the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • Certain aspects of the invention are directed to the use of an antisense compound targeted to human androgen receptor (AR) as described herein, for treating a cancer patient whose cancer has become resistant to treatment with an anti-androgenic agent (e.g. compound or drug).
  • an anti-androgenic agent e.g. compound or drug.
  • said cancer is prostate cancer.
  • said patient is one that has, or whose cancer has, developed resistance to treatment with an agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • the antisense compound targets AR within exon 1, for example within nucleotide regions 2863-5593 (exon 1) or 27672-27853 (exon 1B) of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049
  • an antisense compound provided herein targets AR within exon 2, for example within nucleotide regions 102087-102238 (exon 2) or 139551-139834 (exon 2c) of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 102155-102170, 102156-102171, 139682-139697, 139762-139777, or 139782-139797.
  • an antisense compound provided herein targets AR within exon 3, for example within nucleotide regions 144841-144957 (exon 3), 148380-148594 (exon 3b), or 153504-154908 (exon 3d) of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 3 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 144856-144871, 144938-144953, 148406-148421, 148443-148458, or 148520-148535.
  • an antisense compound provided herein targets AR within intron 1, for example within nucleotide regions 5594-27671 or 27854-102086 of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to intron 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032,
  • an antisense compound provided herein targets AR within intron 2, for example within nucleotide regions 102239-139550 or 139835-144840 of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to intron 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 114874-114889, 115272-115287, 115365-115380, or 134971-134986.
  • the antisense compound is single-stranded.
  • the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • resistant to treatment with a particular agent is meant that the agent is less or no longer effective in halting the growth or spread of the cancer and so the patient, or their cancer, has become less responsive or sensitive to it over time. Typically such patient would be classed as resistant to said agent and would no longer be treated with such agent.
  • a subject having prostate cancer resistant to an agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464 can include, for example, a patient who previously received said agent but whose prostate cancer has become less sensitive or responsive to a agent.
  • prostate cancer resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, can include prostate cancer that has increased in tumor volume, metastasis, or progression despite treatment with the agent.
  • prostate cancer resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464 can include prostate cancer that is refractory to the agent and is not decreasing in tumor volume, metastasis, or progression despite treatment.
  • Several embodiments relate to a method of treating prostate cancer resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, in a subject comprising identifying the subject as having prostate cancer resistant to the agent and administering to the subject an antisense compound targeted to human androgen receptor (AR) upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain, as described herein.
  • an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, in a subject comprising identifying the subject as having prostate cancer resistant to the agent and administering to the subject an antisense compound targeted to human androgen receptor (AR) upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain, as described herein.
  • Several embodiments relate to a method of treating prostate cancer resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, in a subject comprising administering to a subject identified or diagnosed as having prostate cancer resistant to said anti-androgenic agent an antisense compound targeted to human androgen receptor (AR) upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain, as described herein.
  • an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, in a subject comprising administering to a subject identified or diagnosed as having prostate cancer resistant to said anti-androgenic agent an antisense compound targeted to human androgen receptor (AR) upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain, as described
  • Certain aspects of the invention are directed to a method of treating a patient suffering from prostate cancer wherein the patient has, or their cancer has, developed or become resistant to treatment with an anti-androgenic agent (compound or drug) comprising administering to said patient an antisense compound targeted to human androgen receptor (AR) as described herein.
  • an anti-androgenic agent compound or drug
  • said patient is one that has developed resistance to treatment with an agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound is single-stranded.
  • the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • a prostate cancer that has developed or become resistant to treatment with an anti-androgenic agent is referred to as castrate-resistant prostate cancer (CRPC).
  • CRPC castrate-resistant prostate cancer
  • MDV3100 a prostate cancer cell resistant to an anti-androgenic agent, such as MDV3100, was previously exposed to the inhibitor and has become less responsive or sensitive to it over time.
  • MDV3100 might initially inhibit prostate cancer cell growth or proliferation in the patient, but over time such inhibitory effect may be diminished when the cells become resistant to the inhibitor.
  • Certain aspects of the invention are directed to the use of an antisense compound targeted to androgen receptor provided herein for the manufacture of a medicament for treating cancer in a patient whose cancer has become become resistant to treatment with an anti-androgenic agent (compound or drug).
  • the cancer is prostate cancer.
  • said patient is one that has, or whose cancer has, developed resistance to treatment with an agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound is single-stranded.
  • the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • MDV3100 also known as enzalutamide (XtandiTM) and by the IUPAC name 4-(3-(4-cyano-3-(trifluoromethyl)phenyl)-5,5-dimethyl-4-oxo-2-thioxoimidazolidin-1-yl)-2-fluoro-N-methylbenzamide, is an androgen receptor ligand binding inhibitor belonging to the diarylhydantoin class of androgen receptor inhibitors represented by Formula XI.
  • MDV3100 has the following chemical formula:
  • MDV3100 and additional diarylhydantoin androgen receptor inhibitors suitable for use in certain embodiments provided herein are described in U.S. Pat. No. 7,709,517, US Patent Application Publication No. US20100172975 and US Patent Application Publication No. US20100210665, which are incorporated herein by reference in their entireties.
  • the compound of Formula XII also known as ARN-509 and by the IUPAC name 4-(7-(6-Cyano-5-(trifluoromethyl)pyridin-3-yl)-6,8-dioxo-5,7-diazaspiro[3.4]octan-5-yl)-2-fluoro-N-methylbenzamide, is an androgen receptor ligand binding inhibitor.
  • ARN-509 and additional androgen receptor inhibitors suitable for use in certain embodiments provided herein are described in WO 2007126765, WO 2008119015 and US Patent Application Publication No. 2013/0116258, which are incorporated herein by reference in their entirety.
  • the compound of Formula XIII which is also known as Abiraterone acetate and ZYTIG-A® and by the IUPAC name [(3S,8R,9S,10R,13S,14S)-10,13-dimethyl-17-(3-pyridyl)-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl]acetate, is an androgen biosynthesis inhibitor and has the following chemical formula:
  • the compound of Formula XIV which is also known as TOK-001 and Galeterone, and by the IUPAC name (3S,10R,13S)-17-(1H-benzo[d]imidazol-1-yl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol, has the following chemical formula:
  • TOK-001 The structure and synthesis of TOK-001 is described in Handratta et al., (Journal of Medicinal Chemistry (2005), 48(8), 2972-84, 2005), which is incorporated herein by reference in its entirety:
  • the compound of Formula XV which is also known as TAK-700 and Orteronel and by the IUPAC name 6-[7(S)-hydroxy-6,7-dihydro-5H-pyrrolo[1,2-c]imidazol-7-yl]-N-methylnaphthalene-2-carboxamide, is an androgen biosynthesis inhibitor and has the following chemical formula:
  • TAK-700 The structure and synthesis of TAK-700 is described in Kaku et al., Bioorganic and Medicinal Chemistry (19(21), 6383-99, 2011).
  • a first agent comprising the compound described herein is co-administered with one or more secondary agents.
  • such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein.
  • such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein.
  • a first agent is designed to treat an undesired side effect of a second agent.
  • second agents are co-administered with the first agent to treat an undesired effect of the first agent.
  • such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein.
  • second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
  • one or more compounds or compositions provided herein are co-administered with one or more anti-androgenic agents. In certain embodiments, one or more compounds or compositions provided herein and one or more anti-androgenic agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more anti-androgenic agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more anti-androgenic agents, are prepared separately. In certain embodiments, an anti-androgenic agent is selected from MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • Certain aspects of the invention are directed to the use of an antisense compound targeted to human androgen receptor (AR) as described herein in combination with an anti-androgenic agent.
  • an anti-androgenic agent in particular embodiments such use is in a method of treating a patient suffering from cancer or in the manufacture of a medicament for treating cancer.
  • the cancer is selected from: prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer.
  • anti-androgenic agents are the second generation anti-hormonal agents such as: enzalutamide (MDV3100), ARN-059, ODM-201, abiraterone acetate, Galeterone (TOK001), orteronel (TAK700) and VT464 (see Yin et al. supra).
  • Certain aspects are drawn to a combination of an antisense compound targeted to human androgen receptor (AR) as described herein and an anti-androgenic agent, such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • an anti-androgenic agent such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • such a combination of an antisense compound targeted to androgen receptor (AR) as described herein and an anti-androgenic agent, such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, is useful for inhibiting cancer cell growth or proliferation and/or treating cancer.
  • the cancer is selected from: prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer.
  • the cancer is prostate cancer.
  • the cancer is breast cancer.
  • an antisense compound targeted to AR as described herein and an anti-androgenic agent such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, synergize in combination to inhibit growth or proliferation of a cancer cell.
  • the cancer cell is a prostate cancer cell which is or has become castration-resistant.
  • the cancer cell is a prostate cancer cell which is or has become resistant to a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179.
  • the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • a diarylhydantoin Androgen Receptor (AR) inhibitor is a compound of Formula XVI:
  • X is selected from the group consisting of trifluoromethyl and iodo
  • W is selected from the group consisting of O and NR5
  • R5 is selected from the group consisting of H, methyl
  • D is S or O and E is N or O and G is alkyl, aryl, substituted alkyl or substituted aryl; or D is S or a and E-G together are C1-C4 lower alkyl, wherein R1 and R2 together comprise eight or fewer carbon atoms and are selected from the group consisting of alkyl, substituted alkyl including haloalkyl, and, together with the carbon to which they are linked, a cycloalkyl or substituted cycloalkyl group, wherein R3 is selected from the group consisting of hydrogen, halogen, methyl, C1-C4 alkoxy, formyl, haloacetoxy, trifluoromethyl, cyano, nitro, hydroxyl, phenyl, amino, methylcarbamoyl, methoxycarbonyl, acetamido, methanesulfonamino, methanesulfonyl, 4-methanesulfonyl-1-pipe
  • such a combination of an antisense compound targeted to androgen receptor (AR) and a diarylhydantoin AR inhibitor of Formula XVI, such as MDV3100 is useful for inhibiting prostate cancer cell growth or proliferation and/or treating prostate cancer.
  • an antisense compound targeted to AR and a diarylhydantoin AR inhibitor of Formula XVI, such as MDV3100 synergize in combination to inhibit growth or proliferation of a prostate cancer cell.
  • the prostate cancer cell is castration-resistant.
  • the prostate cancer cell is resistant to a diarylhydantoin AR inhibitor of Formula XVI, such as MDV3100.
  • the prostate cancer cell or castration-resistant prostate cancer cell preferentially expresses an AR splicing variant over full-length AR.
  • the antisense compound targeted to AR as described herein and the other anti-androgenic agent are used in combination treatment by administering the two agents simultaneously, separately or sequentially.
  • the two agents are formulated as a fixed dose combination product.
  • the two agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially).
  • antisense compounds useful for inhibiting prostate cancer cell and/or castration-resistant prostate cancer cell growth or proliferation in combination with another anti-androgenic agent such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, target human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound provided herein targets AR within exon 1, exon 2, exon 3, intron 1, or intron 2 as described herein.
  • an antisense compound provided herein targets an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of exons 4-8 encoding the ligand binding domain.
  • An example of such an AR splicing variant includes, but is not limited to, AR-V7, which contains exons 1-3 but lacks exons 4-8. Additional examples of such AR splicing variants include, for example, AR3, AR4, AR4b, AR5, and AR6 (SEQ ID NOs: 4-8, respectively).
  • the prostate cancer cell which may be castration-resistant, preferentially expresses an AR splicing variant over full-length AR.
  • the prostate cancer cell is castration-resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464
  • an antisense compound targeted to AR upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain is capable of inhibiting growth or proliferation of a prostate cancer cell, including a castration-resistant prostate cancer cell, in combination with an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U
  • Pat. No. 7,737,125 in combination with the same anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • the combination of an antisense compound as described herein and the anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464 provides a synergistic (e.g.
  • a prostate cancer cell such as a castration-resistant prostate cancer cell
  • the amounts of either or both of the antisense compound and/or anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, when used in combination can be less than the corresponding amount of either the antisense compound alone or the anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, alone necessary to achieve an equivalent level of prostate cancer cell growth or proliferation inhibition.
  • an antisense compound can target an AR splicing variant that includes the entire or at least a functional portion of exon 1 encoding the N-terminal domain and the entire or at least a functional portion of exons 2 and 3 encoding the DNA binding domain, but does not include at least a functional portion of exon 4 encoding the short hinge region or at least a functional portion of exons 4-8 encoding the ligand binding domain. It is contemplated that certain AR splicing variants targeted by the antisense compounds provided herein substantially consisting of exons 1-3 may also include a non-functional portion of nucleic acid sequence from a genomic region or exons 4-8.
  • the prostate cancer cell which may be castrate-resistant, preferentially expresses an AR splicing variant over full-length AR.
  • the prostate cancer cell is castrate-resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound provided herein targets AR within exon 1, exon 2, exon 3, intron 1, or intron 2 as described herein.
  • an antisense compound targeted to an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain is capable of inhibiting growth or proliferation of a prostate cancer cell, including a castration-resistant prostate cancer cell, in combination with a an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No.
  • the combination of an antisense compound and anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, provides a synergistic (e.g. greater-than-additive) effect in inhibiting the growth or proliferation of a prostate cancer cell, such as a castration-resistant prostate cancer cell, compared to the antisense compound alone or the anti-androgenic agent alone.
  • the amounts of either or both of the antisense compound and/or anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, when used in combination can be less than the corresponding amount of either the antisense compound alone or anti-androgenic agent, alone necessary to achieve an equivalent level of prostate cancer cell growth or proliferation inhibition.
  • an antisense compound provided herein useful for inhibiting prostate cancer cell and/or castration-resistant prostate cancer cell growth or proliferation in combination with a anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464 is capable of reducing expression of both full-length AR and an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of any one of exons 4-8 encoding the ligand binding domain.
  • such an antisense compound targets human androgen receptor upstream of the ligand binding domain. In certain embodiments, such antisense compounds target human androgen receptor upstream of the 3′ end of exon 3. In certain embodiments, an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound targeted to human androgen receptor (AR) and a diarylhydantoin AR inhibitor of Formula XI, such as MDV3100 wherein the antisense compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • an antisense compound targeted to human androgen receptor AR
  • a diarylhydantoin AR inhibitor of Formula XI such as MDV3100
  • the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
  • a method of inhibiting prostate cancer cell growth or proliferation comprising contacting the prostate cancer cell with an antisense compound targeted to human androgen receptor (AR) and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • AR human androgen receptor
  • the antisense compound and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464 synergize in combination to inhibit the growth or proliferation of the prostate cancer cell.
  • the prostate cancer cell is castration-resistant.
  • the prostate cancer cell is castration-resistant by being resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • the prostate cancer cell or castration-resistant prostate cancer cell preferentially expresses an AR splicing variant over full-length AR.
  • antisense compounds useful for inhibiting prostate cancer cell growth or proliferation in combination with a diarylhydantoin AR inhibitor of Formula XVI, such as MDV3100 can target (i) human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain or (ii) an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain; and/or is capable of (i) reducing expression of both full-length AR and an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of any one of exons 4-8 encoding the ligand binding domain; with the proviso that the antisense compounds do not have a nucleobase sequence consisting of any of SEQ ID NOs: 194-215
  • antisense compounds useful for inhibiting growth or proliferation of a prostate cancer cell resistant to anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, can target (i) human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain or (ii) an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain; and/or is capable of (i) reducing expression of both full-length AR and an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of any one of exons 4-8 encoding the ligand binding domain; or (ii) inhibiting growth or proliferation of the resistant prostate
  • the breast cancer has one or more of the following characteristics: Androgen Receptor positive, dependent on androgen for growth, Estrogen Receptor (ER) negative, independent of estrogen for growth, Progesterone Receptor (PR) negative, independent of progesterone for growth, or Her2/neu negative.
  • the breast cancer or breast cancer cell is apocrine.
  • Certain embodiments are drawn to a method of treating breast cancer in a subject comprising administering to the subject an antisense compound targeted to human androgen receptor (AR). Certain embodiments are drawn to a method of treating breast cancer in a subject comprising identifying a subject having breast cancer and administering to the subject an antisense compound targeted to human androgen receptor (AR), thereby treating the subject's breast cancer. Certain embodiments are directed to a method of inhibiting growth or proliferation of a breast cancer cell comprising contacting the breast cancer cell with an antisense compound targeted to human androgen receptor (AR).
  • AR antisense compound targeted to human androgen receptor
  • Certain embodiments relate to a method of inhibiting AR expression in a subject having or at risk of having breast cancer comprising identifying a subject breast cancer, and administering to the subject an antisense compound targeted to human AR, wherein the antisense compound inhibits AR expression in the subject.
  • the breast cancer or breast cancer cell has one or more of the following characteristics: Androgen Receptor positive, dependent on androgen for growth, Estrogen Receptor (ER) negative, independent of estrogen for growth, Progesterone Receptor (PR) negative, independent of progesterone for growth, or Her2/neu negative.
  • the breast cancer or breast cancer cell is ER, PR, and HER2 triple negative and AR positive (ER ⁇ , PR ⁇ , HER2 ⁇ , AR+).
  • the breast cancer or breast cancer cell is ER negative and AR positive (ER ⁇ , AR+).
  • the breast cancer or breast cancer cell is ER positive and AR positive (ER+, AR+).
  • the breast cancer or breast cancer cell is apocrine.
  • Apocrine breast cancers are often “triple negative”, meaning that the cells do not express ER, PR, or HER2 receptors, and usually, but not necessarily, AR positive.
  • an apocrine breast cancer or breast cancer cell is ER, PR, and HER2 triple negative and AR positive (ER ⁇ , PR ⁇ , HER2 ⁇ , AR+).
  • an apocrine breast cancer or breast cancer cell is ER negative and AR positive (ER ⁇ , AR+).
  • an apocrine breast cancer or breast cancer cell originates from the sweat gland of the breast.
  • an apocrine breast cancer or breast cancer cell is a ductal cancer or cancer cell of the breast.
  • an apocrine breast cancer can have any one or more of the following features: a large amount of eosinophilic granular cytoplasm, well-defined margins, large vesicular nuclei, a nuclear to cytoplasmic ratio of about 1:2, and/or accumulations of secreted granules in the apical cytoplasm known as apical snouts.
  • the breast cancer or breast cancer cell is an ER negative and AR positive (ER ⁇ , AR+) molecular apocrine breast cancer or breast cancer cell.
  • an ER negative and AR positive (ER ⁇ , AR+) molecular apocrine breast cancer or breast cancer cell can further be PR positive, PR negative, HER2 negative, or HER2 positive.
  • Breast cancer can be identified as positive or negative with respect to hormone receptors, such as ER, PR, or HER2 by standard histological techniques.
  • histological breast cancer samples can be classified as “triple negative” (ER ⁇ , PR ⁇ , HER2 ⁇ ) when less than 1% of cells demonstrate nuclear staining for estrogen and progesterone receptors, and immunohistochemical staining for HER2 shows a 0, 1-fold, or a 2-fold positive score and a FISH ratio (HER2 gene signals to chromosome 17 signals) of less than 1.8 according to the relevant ASCO and CAP guidelines.
  • an antisense compound useful for treating breast cancer or inhibiting growth or proliferation of a breast cancer cell target targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound provided herein targets AR within exon 1, for example within nucleotide regions 2863-5593 (exon 1) or 27672-27853 (exon 1B) of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 3353-3368, 3361-3376, 3519-3534, 3735-3750, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3888-3903, 4047-4062, 4062-4077, 4109-4124, 4534-4549, 4537-4552, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4655-4670, 4750-4765, 4752-4767, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4872-4887, 4874-4889, 4876-4891, 4916-4931, 4918-4933, 5052-5067, 5054-5069, 5060-5075, 5061-5076, 5061-5076, 5062-50
  • an antisense compound provided herein targets AR within exon 2, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound useful for treating breast cancer or inhibiting growth or proliferation of a breast cancer cell target provided herein targets AR within exon 2, for example within nucleotide regions 102087-102238 (exon 2) or 139551-139834 (exon 2c) of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to exon 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 102155-102170 or 102156-107171.
  • an antisense compound useful for treating breast cancer or inhibiting growth or proliferation of a breast cancer cell targets AR within intron 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • an antisense compound provided herein targets AR within intron 1, for example within nucleotide regions 5594-27671 or 27854-102086 of SEQ ID NO: 1.
  • an antisense compound provided herein targeted to intron 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 5666-5681, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58725-58740, 58750-58765, 58751-58766, 58752-58767, 58753-58768,
  • antisense compounds useful for treating breast cancer or inhibiting growth or proliferation of a breast cancer cell target human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
  • antisense compounds provided herein can treat breast cancer or inhibiting growth or proliferation of a breast cancer cell to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176; with the proviso that the antisense compounds do not have a nucleobase sequence consisting of any of SEQ ID NOs: 194-215 described in U.S. Pat. No. 7,737,125 as SEQ ID NOs: 2-9, 49-50, 52-53, 55-56, and 86-93 (herein incorporated by reference), and identified in Table A.
  • Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs.
  • An oligomeric compound may be “antisense” to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
  • an antisense compound has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense oligonucleotide has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
  • an antisense compound is 10-30 subunits in length. In certain embodiments, an antisense compound is 12 to 30 subunits in length. In certain embodiments, an antisense compound is 12 to 22 subunits in length. In certain embodiments, an antisense compound is 14 to 30 subunits in length. In certain embodiments, an antisense compound is 14 to 20 subunits in length. In certain embodiments, an antisense compound is 15 to 30 subunits in length. In certain embodiments, an antisense compound is 15 to 20 subunits in length. In certain embodiments, an antisense compound is 16 to 30 subunits in length. In certain embodiments, an antisense compound is 16 to 20 subunits in length.
  • an antisense compound is 17 to 30 subunits in length. In certain embodiments, an antisense compound is 17 to 20 subunits in length. In certain embodiments, an antisense compound is 18 to 30 subunits in length. In certain embodiments, an antisense compound is 18 to 21 subunits in length. In certain embodiments, an antisense compound is 18 to 20 subunits in length. In certain embodiments, an antisense compound is 20 to 30 subunits in length.
  • antisense compounds are from 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively.
  • an antisense compound is 14 subunits in length.
  • an antisense compound is 16 subunits in length.
  • an antisense compound is 17 subunits in length.
  • an antisense compound is 18 subunits in length.
  • an antisense compound is 20 subunits in length. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits.
  • the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values.
  • the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleotides.
  • antisense oligonucleotides may be shortened or truncated.
  • a single subunit may be deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation).
  • a shortened or truncated antisense compound targeted to an Androgen Receptor nucleic acid may have two subunits deleted from the 5′ end, or alternatively may have two subunits deleted from the 3′ end, of the antisense compound.
  • the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5′ end and one nucleoside deleted from the 3′ end.
  • the additional subunit may be located at the 5′ or 3′ end of the antisense compound.
  • the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the antisense compound.
  • the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5′ end and one subunit added to the 3′ end.
  • an antisense compound such as an antisense oligonucleotide
  • an antisense oligonucleotide it is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity.
  • an antisense compound such as an antisense oligonucleotide
  • a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
  • Gautschi et al. demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
  • antisense compounds have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • a second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
  • Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect.
  • the amount and/or activity of the target nucleic acid is modulated.
  • the amount and/or activity of the target nucleic acid is reduced.
  • hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation.
  • hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation.
  • the presence of the antisense compound hybridized with the target nucleic acid results in a modulation of antisense activity.
  • antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms.
  • antisense compounds function through more than one mechanism and/or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by particular mechanism.
  • Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy based mechanisms. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.
  • antisense activity results at least in part from degradation of target RNA by RNase H.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are “DNA-like” elicit RNase H activity in mammalian cells. Accordingly, antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting in cleavage of the target nucleic acid.
  • antisense compounds that utilize RNase H comprise one or more modified nucleosides. In certain embodiments, such antisense compounds comprise at least one block of 1-8 modified nucleosides.
  • the modified nucleosides do not support RNase H activity.
  • such antisense compounds are gapmers, as described herein.
  • the gap of the gapmer comprises DNA nucleosides.
  • the gap of the gapmer comprises DNA-like nucleosides.
  • the gap of the gapmer comprises DNA nucleosides and DNA-like nucleosides.
  • Certain antisense compounds having a gapmer motif are considered chimeric antisense compounds.
  • a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
  • the gap segment In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides.
  • the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region.
  • sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include ⁇ -D-ribonucleosides, ⁇ -D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides may include 2′-MOE and 2′-O—CH 3 , among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl).
  • nucleosides in the wings may include several modified sugar moieties, including, for example 2′-MOE and bicyclic sugar moieties such as constrained ethyl or LNA.
  • wings may include several modified and unmodified sugar moieties.
  • wings may include various combinations of 2′-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2′-deoxynucleosides.
  • Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties.
  • the wing-gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5′-wing, “Y” represents the length of the gap, and “Z” represents the length of the 3′-wing. “X” and “Z” may comprise uniform, variant, or alternating sugar moieties.
  • “X” and “Y” may include one or more 2′-deoxynucleosides. “Y” may comprise 2′-deoxynucleosides.
  • a gapmer described as “X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5′-wing and the 3′ wing. Thus, no intervening nucleotides exist between the 5′-wing and gap, or the gap and the 3′-wing. Any of the antisense compounds described herein can have a gapmer motif.
  • “X” and “Z” are the same; in other embodiments they are different.
  • “Y” is between 8 and 15 nucleosides.
  • X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.
  • the antisense compound targeted to an Androgen Receptor nucleic acid has a gapmer motif in which the gap consists of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 linked nucleosides.
  • the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J) m -(B) n -(J) p -(B) r -(A) t -(D) g -(A) v -(B) w -(J) x -(B) y -(J) z
  • each A is independently a 2′-substituted nucleoside
  • each B is independently a bicyclic nucleoside
  • each J is independently either a 2′-substituted nucleoside or a 2′-deoxynucleoside
  • each D is a 2′-deoxynucleoside
  • At least one of m, n, and r is other than 0;
  • At least one of w and y is other than 0;
  • antisense compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). In certain embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.
  • RNAi interfering RNA compounds
  • siRNA double-stranded RNA compounds
  • ssRNAi compounds single-stranded RNAi compounds
  • antisense compounds including those particularly suited for use as single-stranded RNAi compounds (ssRNA) comprise a modified 5′-terminal end.
  • the 5′-terminal end comprises a modified phosphate moiety.
  • such modified phosphate is stabilized (e.g., resistant to degradation/cleavage compared to unmodified 5′-phosphate).
  • such 5′-terminal nucleosides stabilize the 5′-phosphorous moiety. Certain modified 5′-terminal nucleosides may be found in the art, for example in WO/2011/139702.
  • the 5′-nucleoside of an ssRNA compound has Formula IIc:
  • T 1 is an optionally protected phosphorus moiety
  • T 2 is an internucleoside linking group linking the compound of Formula IIc to the oligomeric compound
  • A has one of the formulas:
  • Q 1 and Q 2 are each, independently, H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or N(R 3 )(R 4 );
  • Q 3 is O, S, N(R 5 ) or C(R 6 )(R 7 );
  • each R 3 , R 4 R 5 , R 6 and R 7 is, independently, H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl or C 1 -C 6 alkoxy;
  • M 3 is O, S, NR 14 , C(R 15 )(R 16 ), C(R 15 )(R 16 )C(R 17 )(R 18 ), C(R 15 ) ⁇ C(R 17 ), OC(R 15 )(R 16 ) or OC(R 15 )(Bx 2 );
  • R 14 is H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • R 15 , R 16 , R 17 and R 18 are each, independently, H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • Bx 1 is a heterocyclic base moiety
  • Bx 2 is a heterocyclic base moiety and Bx 1 is H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • J 4 , J 5 , J 6 and J 7 are each, independently, H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • J 4 forms a bridge with one of J 5 or J 7 wherein said bridge comprises from 1 to 3 linked biradical groups selected from O, S, NR 19 , C(R 20 )(R 21 ), C(R 20 ) ⁇ C(R 21 ), C[ ⁇ C(R 20 )(R 21 )] and C( ⁇ O) and the other two of J 5 , J 6 and J 7 are each, independently, H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each R 19 , R 20 and R 21 is, independently, H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • G is H, OH, halogen or O—[C(R 8 )(R 6 )] n —[(C ⁇ O) m —X 1 ] j —Z;
  • each R 8 and R 9 is, independently, H, halogen, C 1 -C 6 alkyl or substituted C 1 -C 6 alkyl;
  • X 1 is O, S or N(E 1 );
  • Z is H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or N(E 2 )(E 3 );
  • E 1 , E 2 and E 3 are each, independently, H, C 1 -C 6 alkyl or substituted C 1 -C 6 alkyl;
  • n is from 1 to about 6;
  • n 0 or 1
  • j 0 or 1
  • each substituted group comprises one or more optionally protected substituent groups independently selected from halogen, OJ 1 , N(J 1 )(J 2 ), ⁇ NJ 1 , SJ 1 , N 3 , CN, OC( ⁇ X 2 )J 1 , OC( ⁇ X 2 )N(J 1 )(J 2 ) and C( ⁇ X 2 )N(J 1 )(J 2 );
  • X 2 is O, S or NJ 3 ;
  • each J 1 , J 2 and J 3 is, independently, H or C 1 -C 6 alkyl
  • said oligomeric compound comprises from 8 to 40 monomeric subunits and is hybridizable to at least a portion of a target nucleic acid.
  • M 3 is O, CH ⁇ CH, OCH 2 or OC(H)(Bx 2 ). In certain embodiments, M 3 is O.
  • J 4 , J 5 , J 6 and J 7 are each H. In certain embodiments, J 4 forms a bridge with one of J 5 or J 7 .
  • A has one of the formulas:
  • Q 1 and Q 2 are each, independently, H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy or substituted C 1 -C 6 alkoxy.
  • Q 1 and Q 2 are each H.
  • Q 1 and Q 2 are each, independently, H or halogen.
  • Q 1 and Q 2 is H and the other of Q 1 and Q 2 is F, CH 3 or OCH 3 .
  • T 1 has the formula:
  • R a and R c are each, independently, protected hydroxyl, protected thiol, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, protected amino or substituted amino; and
  • R b is O or S.
  • R b is O and R a and R c are each, independently, OCH 3 , OCH 2 CH 3 or CH(CH 3 ) 2 .
  • G is halogen, OCH 3 , OCH 2 F, OCHF 2 , OCF 3 , OCH 2 CH 3 , O(CH 2 ) 2 F, OCH 2 CHF 2 , OCH 2 CF 3 , OCH 2 —CH ⁇ CH 2 , O(CH 2 ) 2 —OCH 3 , O(CH 2 ) 2 —SCH 3 , O(CH 2 ) 2 —OCF 3 , O(CH 2 ) 3 —N(R 10 )(R 11 ), O(CH 2 ) 2 —ON(R 10 )(R 11 ), O(CH 2 ) 2 —O(CH 2 ) 2 —N(R 10 )(R 11 ), OCH 2 C( ⁇ O)—N(R 10 )(R 11 ), OCH 2 C( ⁇ O)—N(R 12 )—(CH 2 ) 2 —N(R 10 )(R 11 ) or O(CH 2 ) 2 —N(R 12 —N(R
  • G is halogen, OCH 3 , OCF 3 , OCH 2 CH 3 , OCH 2 CF 3 , OCH 2 —CH ⁇ CH 2 , O(CH 2 ) 2 —OCH 3 , O(CH 2 ) 2 —O(CH 2 ) 2 —N(CH 3 ) 2 , OCH 2 C( ⁇ O)—N(H)CH 3 , OCH 2 C( ⁇ O)—N(H)—(CH 2 ) 2 —N(CH 3 ) 2 or OCH 2 —N(H)—C( ⁇ NH)NH 2 .
  • G is F, OCH 3 or O(CH 2 ) 2 —OCH 3 .
  • G is O(CH 2 ) 2 —OCH 3 .
  • the 5′-terminal nucleoside has Formula IIe:
  • antisense compounds including those particularly suitable for ssRNA comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif
  • Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
  • the oligonucleotides comprise or consist of a region having uniform sugar modifications.
  • each nucleoside of the region comprises the same RNA-like sugar modification.
  • each nucleoside of the region is a 2′-F nucleoside.
  • each nucleoside of the region is a 2′-OMe nucleoside.
  • each nucleoside of the region is a 2′-MOE nucleoside.
  • each nucleoside of the region is a cEt nucleoside.
  • each nucleoside of the region is an LNA nucleoside.
  • the uniform region constitutes all or essentially all of the oligonucleotide.
  • the region constitutes the entire oligonucleotide except for 1-4 terminal nucleosides.
  • oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type.
  • nucleosides of both types are RNA-like nucleosides.
  • the alternating nucleosides are selected from: 2′-OMe, 2′-F, 2′-MOE, LNA, and cEt.
  • the alternating modificatios are 2′-F and 2′-OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.
  • the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB) x A y wheren A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1).
  • one or more alternating regions in an alternating motif includes more than a single nucleoside of a type.
  • oligonucleotides may include one or more regions of any of the following nucleoside motifs:
  • AABBAA ABBABB; AABAAB; ABBABAABB; ABABAA; AABABAB; ABABAA; ABBAABBABABAA; BABBAABBABABAA; or ABABBAABBABABAA;
  • oligonucleotides having such an alternating motif also comprise a modified 5′ terminal nucleoside, such as those of formula IIc or IIe.
  • oligonucleotides comprise a region having a 2-2-3 motif Such regions comprises the following motif: -(A) 2 -(B) x -(A) 2 -(C) y -(A) 3 -
  • A is a first type of modifed nucleosde
  • B and C are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another;
  • x and y are from 1 to 15.
  • A is a 2′-OMe modified nucleoside.
  • B and C are both 2′-F modified nucleosides.
  • A is a 2′-OMe modified nucleoside and B and C are both 2′-F modified nucleosides.
  • oligonucleosides have the following sugar motif: 5′-(Q)-(AB) x A y -(D) z wherein:
  • Q is a nucleoside comprising a stabilized phosphate moiety.
  • Q is a nucleoside having Formula IIc or IIe;
  • A is a first type of modifed nucleoside
  • B is a second type of modified nucleoside
  • D is a modified nucleoside comprising a modification different from the nucleoside adjacent to it. Thus, if y is 0, then D must be differently modified than B and if y is 1, then D must be differently modified than A. In certain embodiments, D differs from both A and B.
  • X is 5-15;
  • Z is 0-4.
  • oligonucleosides have the following sugar motif: 5′-(Q)-(A) x -(D) z wherein:
  • Q is a nucleoside comprising a stabilized phosphate moiety.
  • Q is a nucleoside having Formula IIc or IIe;
  • A is a first type of modifed nucleoside
  • D is a modified nucleoside comprising a modification different from A.
  • X is 11-30;
  • Z is 0-4.
  • A, B, C, and D in the above motifs are selected from: 2′-OMe, 2′-F, 2′-MOE, LNA, and cEt.
  • D represents terminal nucleosides. In certain embodiments, such terminal nucleosides are not designed to hybridize to the target nucleic acid (though one or more might hybridize by chance).
  • the nucleobase of each D nucleoside is adenine, regardless of the identity of the nucleobase at the corresponding position of the target nucleic acid. In certain embodiments the nucleobase of each D nucleoside is thymine.
  • antisense compounds comprising those particularly suited for use as ssRNA comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif.
  • oligonucleotides comprise a region having an alternating internucleoside linkage motif.
  • oligonucleotides comprise a region of uniformly modified internucleoside linkages.
  • the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages.
  • the oligonucleotide is uniformly linked by phosphoro-thioate internucleoside linkages.
  • each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate.
  • each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
  • the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages.
  • the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 12 consecutive phosphoro-thioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.
  • Oligonucleotides having any of the various sugar motifs described herein may have any linkage motif.
  • the oligonucleotides including but not limited to those described above, may have a linkage motif selected from non-limiting the table below:
  • antisense compounds are double-stranded RNAi compounds (siRNA).
  • siRNA double-stranded RNAi compounds
  • one or both strands may comprise any modification motif described above for ssRNA.
  • ssRNA compounds may be unmodified RNA.
  • siRNA compounds may comprise unmodified RNA nucleosides, but modified internucleoside linkages.
  • compositions comprising a first and a second oligomeric compound that are fully or at least partially hybridized to form a duplex region and further comprising a region that is complementary to and hybridizes to a nucleic acid target. It is suitable that such a composition comprise a first oligomeric compound that is an antisense strand having full or partial complementarity to a nucleic acid target and a second oligomeric compound that is a sense strand having one or more regions of complementarity to and forming at least one duplex region with the first oligomeric compound.
  • compositions of several embodiments modulate gene expression by hybridizing to a nucleic acid target resulting in loss of its normal function.
  • the target nucleic acid is Androgen Receptor.
  • the degradation of the targeted Androgen Receptor is facilitated by an activated RISC complex that is formed with compositions of the invention.
  • compositions of the present invention are directed to double-stranded compositions wherein one of the strands is useful in, for example, influencing the preferential loading of the opposite strand into the RISC (or cleavage) complex.
  • the compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes.
  • the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.
  • compositions of the present invention can be modified to fulfil a particular role in for example the siRNA pathway.
  • Using a different motif in each strand or the same motif with different chemical modifications in each strand permits targeting the antisense strand for the RISC complex while inhibiting the incorporation of the sense strand.
  • each strand can be independently modified such that it is enhanced for its particular role.
  • the antisense strand can be modified at the 5′-end to enhance its role in one region of the RISC while the 3′-end can be modified differentially to enhance its role in a different region of the RISC.
  • the double-stranded oligonucleotide molecules can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double-stranded oligonucleotide molecules can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e.
  • each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double-stranded structure, for example wherein the double-stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the double-stranded oligonucleotide molecule are complementary to the target nucleic acid or a portion thereof).
  • the double-stranded oligonucleotide is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
  • the double-stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double-stranded oligonucleotide can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNAi.
  • the double-stranded oligonucleotide comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions.
  • the double-stranded oligonucleotide comprises nucleotide sequence that is complementary to nucleotide sequence of a target gene.
  • the double-stranded oligonucleotide interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
  • double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides.
  • the short interfering nucleic acid molecules lack 2′-hydroxy (2′-OH) containing nucleotides.
  • short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2′-OH group).
  • double-stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2′-OH groups.
  • double-stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • siRNA short interfering oligonucleotide
  • short interfering nucleic acid short interfering modified oligonucleotide
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • sequence specific RNA interference such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • double-stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre-transcriptional level.
  • epigenetic regulation of gene expression by siRNA molecules of the invention can result from siRNA mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237).
  • compositions of several embodiments provided herein can target Androgen Receptor by a dsRNA-mediated gene silencing or RNAi mechanism, including, e.g., “hairpin” or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA.
  • a dsRNA-mediated gene silencing or RNAi mechanism including, e.g., “hairpin” or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA.
  • the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • the dsRNA or dsRNA effector molecule may be a single molecule with a region of self-complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule.
  • a dsRNA that consists of a single molecule consists entirely of ribonucleotides or includes a region of ribonucleotides that is complementary to a region of deoxyribonucleotides.
  • the dsRNA may include two different strands that have a region of complementarity to each other.
  • both strands consist entirely of ribonucleotides, one strand consists entirely of ribonucleotides and one strand consists entirely of deoxyribonucleotides, or one or both strands contain a mixture of ribonucleotides and deoxyribonucleotides.
  • the regions of complementarity are at least 70, 80, 90, 95, 98, or 100% complementary to each other and to a target nucleic acid sequence.
  • the region of the dsRNA that is present in a double-stranded conformation includes at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 75, 100, 200, 500, 1000, 2000 or 5000 nucleotides or includes all of the nucleotides in a cDNA or other target nucleic acid sequence being represented in the dsRNA.
  • the dsRNA does not contain any single stranded regions, such as single stranded ends, or the dsRNA is a hairpin.
  • the dsRNA has one or more single stranded regions or overhangs.
  • RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.
  • an antisense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid
  • RNA strand or region that is a sense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid
  • the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell.
  • the dsRNA is a single circular nucleic acid containing a sense and an antisense region, or the dsRNA includes a circular nucleic acid and either a second circular nucleic acid or a linear nucleic acid (see, for example, WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.)
  • Exemplary circular nucleic acids include lariat structures in which the free 5′ phosphoryl group of a nucleotide becomes linked to the 2′ hydroxyl group of another nucleotide in a loop back fashion.
  • the dsRNA includes one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group) or contains an alkoxy group (such as a methoxy group) which increases the half-life of the dsRNA in vitro or in vivo compared to the corresponding dsRNA in which the corresponding 2′ position contains a hydrogen or an hydroxyl group.
  • the dsRNA includes one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages.
  • the dsRNAs may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661.
  • the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • the dsRNA can be any of the at least partially dsRNA molecules disclosed in WO 00/63364, as well as any of the dsRNA molecules described in U.S. Provisional Application 60/399,998; and U.S. Provisional Application 60/419,532, and PCT/US2003/033466, the teaching of which is hereby incorporated by reference. Any of the dsRNAs may be expressed in vitro or in vivo using the methods described herein or standard methods, such as those described in WO 00/63364.
  • antisense compounds are not expected to result in cleavage or the target nucleic acid via RNase H or to result in cleavage or sequestration through the RISC pathway.
  • antisense activity may result from occupancy, wherein the presence of the hybridized antisense compound disrupts the activity of the target nucleic acid.
  • the antisense compound may be uniformly modified or may comprise a mix of modifications and/or modified and unmodified nucleosides.
  • Nucleotide sequences that encode human Androgen Receptor include, without limitation, the following: GENBANK Accession No. NT_011669.17_TRUNC_5079000_5270000 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NM_000044.3 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. NM_001011645.2 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. FJ235916.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. FJ235917.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No.
  • FJ235918.1 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. FJ235919.1 (incorporated herein as SEQ ID NO: 7), and GENBANK Accession No. FJ235920.1 (incorporated herein as SEQ ID NO: 8).
  • Androgen Receptor mRNA encodes several functional domains.
  • full-length Androgen Receptor mRNA includes exon 1 encoding the N-terminal domain, exons 2 and 3 encoding the DNA binding domain, exon 4 encoding the short hinge region, and exons 4-8 encoding the ligand binding domain.
  • Androgen Receptor splicing variants targetable by the antisense compounds provided herein include exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, or functional portions thereof, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of exons 4-8 encoding the ligand binding domain.
  • Examples of such AR splicing variants include, but are not limited to, AR-V1, AR-V2, AR-V3, AR-V4, AR-V5, AR-V6, and AR-V7 (also referred to as AR3), which contain exons 1-3 but lack exons 4-8.
  • AR-V1, AR-V2, AR-V3, AR-V4, AR-V5, AR-V6, AR-V7, and additional splicing variants targetable by the antisense compounds provided herein are described in Hu et al., Cancer Res 2009; 69:16-22 and US Patent Application Publication No. US 2010/0068802, each of which is incorporated herein by reference in its entirety.
  • Further examples of such AR splicing variants targetable by the antisense compounds provided herein include, but are not limited to, AR3, AR4, AR4b, AR5, and AR6 (SEQ ID NOs: 4-8, respectively) as described in Guo et al., Cancer Res. 2009; 69: 2305-13, which is incorporated herein by reference in its entirety.
  • hybridization occurs between an antisense compound disclosed herein and an Androgen Receptor.
  • the most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
  • Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
  • the antisense compounds provided herein are specifically hybridizable with Androgen Receptor.
  • An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as an Androgen Receptor nucleic acid).
  • Non-complementary nucleobases between an antisense compound and an Androgen Receptor nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid.
  • an antisense compound may hybridize over one or more segments of an Androgen Receptor nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
  • the antisense compounds provided herein, or a specified portion thereof are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an Androgen Receptor nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
  • an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • an antisense compound which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
  • the antisense compounds provided herein, or specified portions thereof are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof.
  • an antisense compound may be fully complementary to an Androgen Receptor nucleic acid, or a target region, or a target segment or target sequence thereof.
  • “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.
  • a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound.
  • Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid.
  • a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 nucleobases long.
  • the 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound.
  • the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
  • non-complementary nucleobase may be at the 5′ end or 3′ end of the antisense compound.
  • the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound.
  • two or more non-complementary nucleobases may be contiguous (i.e. linked) or non-contiguous.
  • a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
  • antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an Androgen Receptor nucleic acid, or specified portion thereof.
  • antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an Androgen Receptor nucleic acid, or specified portion thereof.
  • the antisense compounds provided also include those which are complementary to a portion of a target nucleic acid.
  • portion refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid.
  • a “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound.
  • the antisense compounds are complementary to at least an 8 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment.
  • the antisense compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
  • the antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof.
  • an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability.
  • a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine.
  • Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated.
  • the non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
  • the antisense compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • a portion of the antisense compound is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid.
  • an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
  • a nucleoside is a base-sugar combination.
  • the nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar.
  • Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • RNA and DNA The naturally occuring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
  • Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
  • antisense compounds targeted to an Androgen Receptor nucleic acid comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are phosphorothioate linkages.
  • each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
  • Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5′ and 2′ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R 1 )(R 2 ) (R, R 1 and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group) and combinations thereof.
  • Examples of chemically modified sugars include 2′-F-5′-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug.
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5′-vinyl, 5′-methyl (R or S), 4′-S, 2′-F, 2′-OCH 3 , 2′-OCH 2 CH 3 , 2′-OCH 2 CH 2 F and 2′-O(CH 2 ) 2 OCH 3 substituent groups.
  • the substituent at the 2′ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C 1 -C 10 alkyl, OCF 3 , OCH 2 F, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 —O—N(R m )(R n ), O—CH 2 —C( ⁇ O)—N(R m )(R n ), and O—CH 2 —C( ⁇ O)—N(R 1 )—(CH 2 ) 2 —N(R m )(R n ), where each R 1 , R m and R n is, independently, H or substituted or unsubstituted C 1 -C 10 alkyl.
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms.
  • antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge.
  • 4′ to 2′ bridged bicyclic nucleosides include but are not limited to one of the formulae: 4′-(CH 2 )—O-2′ (LNA); 4′-(CH 2 )—S-2; 4′-(CH 2 ) 2 —O-2′ (ENA); 4-CH(CH 3 )—O-2′ (also referred to as constrained ethyl or cEt) and 4′-CH(CH 2 OCH 3 )—O-2′ (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4′-C(CH 3 )(CH 3 )—O-2′ (and analogs thereof see published International Application WO/2009/006478, published Jan.
  • Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example ⁇ -L-ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).
  • bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4′ and the 2′ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from —[C(R a )(R b )] n —, —C(R a ) ⁇ C(R b )—, —C(R a ) ⁇ N—, —C( ⁇ O)—, —C( ⁇ NR a )—, —C( ⁇ S)—, —O—, —Si(R a ) 2 —, —S( ⁇ O) x —, and —N(R a )—;
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • each R a and R b is, independently, H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C 5 -C 7 alicyclic radical, substituted C 5 -C 7 alicyclic radical, halogen, OJ 1 , NJ 1 J 2 , SJ 1 , N 3 , COOJ 1 , acyl (C( ⁇ O)—H), substituted acyl, CN, sulfonyl (S( ⁇ O) 2 -J 1 ), or sulfoxyl (S( ⁇ O)-J 1 ); and
  • each J 1 and J 2 is, independently, H, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, acyl (C( ⁇ O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C 1 -C 12 aminoalkyl, substituted C 1 -C 12 aminoalkyl or a protecting group.
  • the bridge of a bicyclic sugar moiety is —[C(R a )(R b )] n —, —[C(R a )(R b )] n —O—, —C(R a R b )—N(R)—O— or —C(R a R b )—O—N(R)—.
  • the bridge is 4-CH 2 -2′, 4′-(CH 2 ) 2 -2′, 4′-(CH 2 ) 3 -2′, 4-CH 2 —O-2′, 4′-(CH 2 ) 2 —O-2′, 4-CH 2 —O—N(R)-2′ and 4-CH 2 —N(R)—O-2′- wherein each R is, independently, H, a protecting group or C 1 -C 12 alkyl.
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4′-2′ methylene-oxy bridge may be in the ⁇ -L configuration or in the ⁇ -D configuration.
  • ⁇ -L-methyleneoxy (4-CH 2 —O-2′) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
  • bicyclic nucleosides include, but are not limited to, (A) ⁇ -L-methyleneoxy (4′-CH 2 —O-2′) BNA, (B) ⁇ -D-methyleneoxy (4′-CH 2 —O-2′) BNA, (C) ethyleneoxy (4′-(CH 2 ) 2 —O-2′) BNA, (D) aminooxy (4′-CH 2 —O—N(R)-2′) BNA, (E) oxyamino (4′-CH 2 —N(R)—O-2′) BNA, and (F) methyl(methyleneoxy) (4′-CH(CH 3 )—O-2′) BNA, (G) methylene-thio (4′-CH 2 —S-2′) BNA, (H) methylene-amino (4′-CH 2 —N(R)-2′) BNA, (I) methyl carbocyclic (4′-CH 2 —CH(CH 3 )-2′) BNA, (J)
  • Bx is the base moiety and R is independently H, a protecting group, C 1 -C 12 alkyl or C 1 -C 12 alkoxy.
  • bicyclic nucleosides are provided having Formula I:
  • Bx is a heterocyclic base moiety
  • -Q a -Q b -Q c - is —CH 2 —N(R c )—CH 2 —, —C( ⁇ O)—N(R c )—CH 2 —, —CH 2 —O—N(R c )—, —CH 2 —N(R c )—O— or —N(R c )—O—CH 2 ;
  • R c is C 1 -C 12 alkyl or an amino protecting group
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
  • bicyclic nucleosides are provided having Formula II:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z a is C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 1 -C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
  • each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ c , NJ c J d , SJ c , N 3 , OC( ⁇ X)J c , and NJ c C( ⁇ X)NJ c J d , wherein each J c , J d and J c is, independently, H, C 1 -C 6 alkyl, or substituted C 1 -C 6 alkyl and X is O or NJ c .
  • bicyclic nucleosides are provided having Formula III:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • Z b is C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 1 -C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl or substituted acyl (C( ⁇ O)—).
  • bicyclic nucleosides are provided having Formula IV:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • R d is C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl;
  • each q a , q b , q c and q d is, independently, H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl, C 1 -C 6 alkoxyl, substituted C 1 -C 6 alkoxyl, acyl, substituted acyl, C 1 -C 6 aminoalkyl or substituted C 1 -C 6 aminoalkyl;
  • bicyclic nucleosides are provided having Formula V:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • q a , q b , q e and q f are each, independently, hydrogen, halogen, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 1 -C 12 alkoxy, substituted C 1 -C 12 alkoxy, OJ j , SJ j , SOJ j , SO 2 J j , NJ j J k , N 3 , CN, C( ⁇ O)OJ j , C( ⁇ O)NJ j J k , C( ⁇ O)J j , O—C( ⁇ O)—NJ j J k , N(H)C( ⁇ NH)NJ j J k , N(H)C( ⁇ O)NJ j J k or N
  • q g and q h are each, independently, H, halogen, C 1 -C 12 alkyl or substituted C 1 -C 12 alkyl.
  • BNAs methyleneoxy (4-CH 2 —O-2′) BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). Bicyclic nucleic acids (BNAs) and preparation thereof are also described in WO 98/39352 and WO 99/14226.
  • bicyclic nucleosides are provided having Formula VI:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
  • each q i , q j , q k and q 1 is, independently, H, halogen, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 1 -C 12 alkoxyl, substituted C 1 -C 12 alkoxyl, OJ j , SJ j , SOJ j , N 3 , CN, C( ⁇ O)OJ j , C( ⁇ O)NJ j J k , C( ⁇ O)J j , O—C( ⁇ O)NJ j J k , N(H)C( ⁇ NH)NJ j J k , N(H)C( ⁇ O)NJ j J k or N(H)C( ⁇ S)NJ j J k
  • 4′-2′ bicyclic nucleoside or “4′ to 2′ bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2′ carbon atom and the 4′ carbon atom of the sugar ring.
  • nucleosides refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties.
  • sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
  • 2′-modified sugar means a furanosyl sugar modified at the 2′ position.
  • modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl.
  • 2′ modifications are selected from substituents including, but not limited to: O[(CH 2 ) n O] m CH 3 , O(CH 2 ) n NH 2 , O(CH 2 ) n CH 3 , O(CH 2 ) n F, O(CH 2 ) n ONH 2 , OCH 2 C( ⁇ O)N(H)CH 3 , and O(CH 2 ) n ON[(CH 2 ) n CH 3 ] 2 , where n and m are from 1 to about 10.
  • 2′- substituent groups can also be selected from: C 1 -C 12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties.
  • modifed nucleosides comprise a 2′-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000).
  • 2′-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2′-O-methyl, O-propyl, and O-aminopropyl.
  • Oligonucleotides having the 2′-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim.
  • a “modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran “sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate).
  • Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyran ring system as illustrated below:
  • sugar surrogates are selected having Formula VII:
  • Bx is a heterocyclic base moiety
  • T a and T b are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T a and T b is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T a and T b is H, a hydroxyl protecting group, a linked conjugate group or a 5′ or 3′-terminal group;
  • q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each independently, H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; and each of R 1 and R 2 is selected from hydrogen, hydroxyl, halogen, subsitituted or unsubstituted alkoxy, NJ 1 J 2 , SJ 1 , N 3 , OC( ⁇ X)J 1 , OC( ⁇ X)NJ 1 J 2 , NJ 3 C( ⁇ X)NJ 1 J 2 and CN, wherein X is O, S or NJ 1 and each J 1 , J 2 and J 3 is, independently, H or C 1 -C 6 alkyl.
  • the modified THP nucleosides of Formula VII are provided wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R 1 and R 2 is fluoro. In certain embodiments, R 1 is fluoro and R 2 is H; R 1 is methoxy and R 2 is H, and R 1 is methoxyethoxy and R 2 is H.
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506).
  • morpholino means a sugar surrogate having the following formula:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are referred to herein as “modifed morpholinos.”
  • antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides.
  • Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem.
  • Bx is a heterocyclic base moiety
  • T 3 and T 4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T 3 and T 4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′- or 3′-terminal group; and
  • q 1 , q 2 , q 3 , q 4 , q 5 , q 6 , q 7 , q 8 and q 9 are each, independently, H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or other sugar substituent group.
  • 2′-modified or “2′-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2′ position other than H or OH.
  • 2′-modified nucleosides include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2′ carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2′substituents, such as allyl, amino, azido, thio, O-allyl, O—C 1 -C 10 alkyl, —OCF 3 , O—(CH 2 ) 2 —O—CH 3 , 2′-O(CH 2 ) 2 SCH 3 , O—(CH 2 ) 2 —O—N(R m )(R n ) or O—CH 2 —C( ⁇ O)—N(R m )(R n ), where
  • 2′-F refers to a nucleoside comprising a sugar comprising a fluoro group at the 2′ position of the sugar ring.
  • 2′-OMe or “2′-OCH 3 ” or “2′-O-methyl” each refers to a nucleoside comprising a sugar comprising an —OCH 3 group at the 2′ position of the sugar ring.
  • oligonucleotide refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
  • RNA ribonucleosides
  • DNA deoxyribonucleosides
  • bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.
  • nucleobase moieties In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • antisense compounds comprise one or more nucleosides having modified sugar moieties.
  • the modified sugar moiety is 2′-MOE.
  • the 2′-MOE modified nucleosides are arranged in a gapmer motif.
  • the modified sugar moiety is a bicyclic nucleoside having a (4′-CH(CH 3 )—O-2′) bridging group.
  • the (4-CH(CH 3 )—O-2′) modified nucleosides are arranged throughout the wings of a gapmer motif.
  • Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.
  • Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
  • Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C ⁇ C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substit
  • Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • antisense compounds targeted to an androgen receptor nucleic acid comprise one or more modified nucleobases.
  • shortened or gap-widened antisense oligonucleotides targeted to an androgen receptor nucleic acid comprise one or more modified nucleobases.
  • the modified nucleobase is 5-methylcytosine.
  • each cytosine is a 5-methylcytosine.
  • Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap), or at the 3′-terminus (3′-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.
  • antisense compounds are modified by attachment of one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance.
  • Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligonucleotide.
  • Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
  • Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
  • Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • An antisense compound targeted to an androgen receptor nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection.
  • employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to an androgen receptor nucleic acid and a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent is water.
  • the antisense compound is an antisense oligonucleotide provided herein.
  • compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • a prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
  • Cells may be treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, Calif.).
  • Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, Calif.).
  • Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
  • Yet another technique used to introduce antisense oligonucleotides into cultured cells includes free uptake of the oligonucleotides by the cells.
  • Cells are treated with antisense oligonucleotides by routine methods.
  • Cells may be harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
  • RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.
  • a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-179.
  • a compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 12-179.
  • E 3 A compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 12-179.
  • E 4 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • a compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • a compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
  • a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleotides 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 40, 40
  • a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-
  • E9 The compound of any one of E1, E7, or E8, wherein the compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within exon 1 nucleotides 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-39
  • E10 The compound of E9, wherein the compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within exon 1 nucleotides 5052-5067 of SEQ ID NO:1.
  • E11 The compound of any one of E1, E7, or E8, wherein the compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within intron 1 nucleotides 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58721-58736, 58722-58
  • E12 The compound of E11, wherein the compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within intron 1 nucleotides 8638-8653, 11197-11212, 40615-40630, 58719-58734, 58720-58735, or 58721-58736 of SEQ ID NO:1.
  • E13 The compound of any one of E1-12, wherein the modified oligonucleotide comprises at least one modified sugar.
  • E14 The compound of E13, wherein at least one modified sugar comprises a 2′-O-methoxyethyl group.
  • E15 The compound of E13, wherein the at least one modified sugar is a bicyclic sugar.
  • E16 The compound of E15, wherein the bicyclic sugar comprises a 4′-CH(CH 3 )—O-2′ group.
  • E17 The compound of E15, wherein the bicyclic sugar comprises a 4′-CH 2 —O-2′ or 4′-(CH 2 ) 2 —O-2′group.
  • E18 The compound of any one of E1-17, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
  • each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate internucleoside linkage.
  • E20 The compound of any one of E1-19, wherein the modified oligonucleotide comprises at least one modified nucleobase.
  • E21 The compound of E20, wherein the modified nucleobase is a 5-methylcytosine.
  • each nucleoside of each wing segment comprises a modified sugar
  • each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar or a constrained ethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage;
  • each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage;
  • each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the five linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the five linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcyto
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • the gap segment is positioned between the 5′ wing segment and the 3′ wing segment;
  • the six linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction;
  • the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar;
  • each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 43, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 124, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 150, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 155, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 169, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • a compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 175, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
  • each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar
  • each internucleoside linkage is a phosphorothioate linkage
  • each cytosine is a 5-methylcytosine.
  • E36 The compound of any one of E1-35, wherein the modified oligonucleotide is at least 90% complementary to a nucleic acid encoding androgen receptor.
  • E37 The compound of any one of E1-36, wherein the antisense oligonucleotide is 100% complementary to a nucleic acid encoding androgen receptor.
  • E38 The compound of E37, wherein the nucleic acid encoding androgen receptor comprises the nucleotide sequence of any one of SEQ ID NOs: 1-8.
  • a composition comprising the compound of any one of E1-38, or pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable diluent or carrier.
  • a composition comprising the compound of any one of E1-38 and a diarylhydantoin Androgen Receptor (AR) inhibitor of Formula XVI:
  • X is selected from the group consisting of trifluoromethyl and iodo
  • W is selected from the group consisting of O and NR5
  • R5 is selected from the group consisting of H, methyl
  • D is S or O and E is N or O and G is alkyl, aryl, substituted alkyl or substituted aryl; or D is S or O and E-G together are C1-C4 lower alkyl, wherein R1 and R2 together comprise eight or fewer carbon atoms and are selected from the group consisting of alkyl, substituted alkyl including haloalkyl, and, together with the carbon to which they are linked, a cycloalkyl or substituted cycloalkyl group, wherein R3 is selected from the group consisting of hydrogen, halogen, methyl, C1-C4 alkoxy, formyl, haloacetoxy, trifluoromethyl, cyano, nitro, hydroxyl, phenyl, amino, methylcarbamoyl, methoxycarbonyl, acetamido, methanesulfonamino, methanesulfonyl, 4-methanesulfonyl-1-piperaz
  • E41 The composition of E40, wherein the diarylhydantoin Androgen Receptor (AR) inhibitor is MDV3100.
  • E42 A composition comprising the compound of any one of E1-38 and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • a method of treating cancer comprising administering to a subject having cancer the compound of any one of E1-38 or composition of any one of E39-42, thereby treating cancer in the subject.
  • E45 The compound or composition of E44, wherein the cancer is prostate cancer, breast cancer, ovarian cancer, gastric cancer or bladder cancer.
  • E46 The compound or composition of E45, wherein the cancer is castrate-resistant prostate cancer.
  • E47 The compound or composition of E46, wherein the castrate-resistant prostate cancer is resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • E48 The method of E43, wherein the cancer is prostate cancer, breast cancer, ovarian cancer, gastric cancer or bladder cancer.
  • E49 The method of E48, wherein the cancer is castrate-resistant prostate cancer.
  • E50 The method of E49, wherein the castrate-resistant prostate cancer is resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • E51 The compound of E44-47 or the method of E49 or E50, wherein the antisense compound targets an AR splicing variant.
  • E52 The compound or method of E51, wherein the AR splicing variant lacks a functional ligand binding domain.
  • E53 The compound of E44-47 or the method of any one of E49-52, wherein the antisense compound is capable of reducing expression of full-length AR and an AR splicing variant lacking any one of exons 4-8.
  • E54 The compound or method of E51, wherein the AR splicing variant consists of exons 1-3.
  • E55 The compound of E44-47 or the method of any one of E49-52, wherein the antisense compound is targeted to AR upstream of the 3′ end of exon 3 and is capable of inhibiting growth or proliferation of the prostate cancer cell to a greater extent than an antisense compound targeted to a region of AR downstream of the 3′ end of exon 3.
  • E56 The compound or method of E55, wherein the antisense compound targeted to a region of AR downstream of the 3′ end of exon 3 is capable of reducing levels of full-length AR but not an AR splicing variant consisting of exons 1-3.
  • E58 The compound of E44-47 or the method of any one of E49-52, wherein the prostate cancer cell preferentially expresses an AR splicing variant over full-length AR.
  • E59 The compound or method of E58, wherein the AR splicing variant lacks a functional ligand binding domain.
  • a method of treating prostate cancer resistant to a anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464 in a subject comprising administering to the subject an antisense compound targeted to human androgen receptor (AR) upstream of the 3′ end of exon 3, thereby treating the prostate cancer.
  • a anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464
  • E61 The method of E60, wherein the subject is diagnosed as having prostate cancer resistant to the anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • the anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
  • E62 The method of E60 or E61, wherein the antisense compound targets an AR splicing variant.
  • E63 The method of E62, wherein the AR splicing variant lacks a functional ligand binding domain.
  • E64 The method of any one of E60-63, wherein the antisense compound is capable of reducing expression of full-length AR and an AR splicing variant lacking any one of exons 4-8.
  • E66 The method of any one of E60-65, wherein the antisense compound is targeted to AR upstream of the 3′ end of exon 3 and is capable of inhibiting growth or proliferation of a prostate cancer cell resistant to the diarylhydantoin Androgen Receptor (AR) inhibitor to a greater extent than an antisense compound targeted to a region of AR downstream of the 3′ end exon 3.
  • AR diarylhydantoin Androgen Receptor
  • E67 The method of E66, wherein the antisense compound targeted to a region of AR downstream of the 3′ end of exon 3 is capable of reducing levels of full-length AR but not an AR splicing variant lacking any one of exons 4-8.
  • E68 The method of E67, wherein the AR splicing variant consists of exons 1-3.
  • E70 The method of any one of E60-69, wherein the prostate cancer is castration-resistant.
  • E71 The method of any one of E60-70, wherein the prostate cancer comprises cells that preferentially express an AR splicing variant over full-length AR.
  • E74 The method of E72, wherein the AR splicing variant lacks a functional ligand binding domain.
  • a method of inhibiting prostate cancer cell growth or proliferation comprising contacting the prostate cancer cell with an antisense compound targeted to human androgen receptor (AR) and anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, wherein the antisense compound and the anti-androgenic agent synergize in combination to inhibit the growth or proliferation of the prostate cancer cell.
  • AR human androgen receptor
  • E77 The method of E75 or E76, wherein the prostate cancer cell is contacted with an amount of the antisense compound and an amount of anti-androgenic agent that are each or both less in combination than the amount of either the antisense compound or anti-androgenic agent alone effective in inhibiting the growth or proliferation of said prostate cancer cell.
  • E78 The method of any one of E75-77, wherein the antisense compound and anti-androgenic agent provide a greater-than-additive effect compared to the antisense compound alone or anti-androgenic agent alone in inhibiting the growth or proliferation of said prostate cancer cell.
  • E79 The method of any one of E75-78, wherein the antisense compound targets an AR splicing variant.
  • E80 The method of E79, wherein the AR splicing variant lacks a functional ligand binding domain.
  • E81 The method of any one of E75-80, wherein the antisense compound is capable of reducing expression of full-length AR and an AR splicing variant consisting of exons 1-3.
  • a method of inhibiting growth or proliferation of an androgen receptor (AR)-positive breast cancer cell comprising contacting the breast cancer cell with an antisense compound targeted to human androgen receptor (AR) wherein the growth or proliferation of the breast cancer cell is inhibited.
  • a method of inhibiting AR expression in a subject having or at risk of having an androgen receptor (AR)-positive breast cancer comprising:
  • antisense compound inhibits AR expression in the subject.
  • a method of treating AR-positive breast cancer in a subject comprising administering to the subject an antisense compound targeted to human androgen receptor (AR), thereby treating the breast cancer in the subject.
  • AR human androgen receptor
  • E85 The method of any one of E82-84, wherein the AR-positive breast cancer or breast cancer cell is dependent on androgen expression for growth.
  • E86 The method of any one of E82-85, wherein the breast cancer or breast cancer cell is estrogen receptor (ER)-negative, progesterone receptor (PR)-negative, or Her2/neu-negative.
  • ER estrogen receptor
  • PR progesterone receptor
  • Her2/neu-negative Her2/neu-negative.
  • E87 The method of any one of E82-85, wherein the breast cancer or breast cancer cell is ER-positive and AR-positive.
  • E88 The method of any one of E82-85, wherein the breast cancer or breast cancer cell is ER-negative and AR-positive.
  • E89 The method of any one of E82-88, wherein the breast cancer or breast cancer cell is an apocrine breast cancer or breast cancer cell.
  • E90 The method of any one of E60-88, wherein the antisense compound is the compound of any one of E1-38, or pharmaceutically acceptable salt thereof.
  • Antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR.
  • Human primer probe set RTS3559 (forward sequence TCCTTCACCAATGTCAACTCC, designated herein as SEQ ID NO: 9; reverse sequence GAGCCATCCAAACTCTTGAGA, designated herein as SEQ ID NO: 10; probe sequence AGTACCGCATGCACAAGTCCCG, designated herein as SEQ ID NO: 11) was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 155 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Tables 1 and 2.
  • the newly designed chimeric antisense oligonucleotides in Tables 1 and 2 were designed as 3-10-3 (S)-cET gapmers.
  • the gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides.
  • Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification.
  • the internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
  • “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in Tables 1 and 2 is targeted to either the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000) or the human AR mRNA sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NM_000044.3), or both.
  • ‘n/a.’ indicates that the oligonucleotide does not target that particular gene sequence.
  • Gapmers from the study described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells.
  • Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 18.5 nM, 55.6 nM, 166.7 nM, 500.0 nM and 1500.0 nM concentrations of antisense oligonucleotide, as specified in Tables 3 and 4.
  • RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR.
  • Human AR primer probe set RTS3559 was used to measure mRNA levels.
  • AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells.
  • the antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
  • IC 50 half maximal inhibitory concentration
  • Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro.
  • Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 82 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Table 5.
  • the newly designed chimeric antisense oligonucleotides in Table 5 were designed as 3-10-3 (S)-cET gapmers or 5-10-5 MOE gapmers.
  • the 3-10-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides.
  • Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification.
  • the 5-10-5 MOE gapmer is 20 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising five nucleosides each.
  • Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a 2′-MOE modification.
  • the internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in Table 5 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000)
  • Gapmers from the studies described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells.
  • Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 31.3 nM, 62.5 nM, 125.0 nM, 250.0 nM, 500.0 nM, and 1000.0 nM concentrations of antisense oligonucleotide, as specified in Table 6.
  • RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR.
  • Human AR primer probe set RTS3559 was used to measure mRNA levels.
  • AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells.
  • the antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
  • IC 50 half maximal inhibitory concentration
  • Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro.
  • Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 250 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 40 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Table 7.
  • the newly designed chimeric antisense oligonucleotides in Table 7 were designed as 3-10-3 (S)-cET gapmers or deoxy, MOE and (S)-cEt oligonucleotides.
  • the 3-10-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides.
  • Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification.
  • the deoxy, MOE and (S)-cEt oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification.
  • the ‘Chemistry’ column describes the sugar modifications of each oligonucleotide. ‘k’ indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; and ‘e’ indicates a MOE modification.
  • the internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
  • the SEQ ID NO listed in the table refers to the oligonucleotide sequence.
  • “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in Table 7 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000).
  • Gapmers from the studies described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells.
  • Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 31.3 nM, 62.5 nM, 125.0 nM, 250.0 nM, 500.0 nM, and 1000.0 nM concentrations of antisense oligonucleotide, as specified in Table 8.
  • RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR.
  • Human AR primer probe set RTS3559 was used to measure mRNA levels.
  • AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells.
  • the antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
  • IC 50 half maximal inhibitory concentration
  • oligonucleotides were designed as deoxy, MOE and (S)-cEt oligonucleotides targeting AR gene sequences and were tested at various doses in HuVEC cells.
  • the oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification.
  • the ‘Chemistry’ column describes the sugar modifications of each oligonucleotide. ‘k’ indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise ‘d’ indicates deoxyribose; and ‘e’ indicates a MOE modification.
  • the internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
  • the SEQ ID NO listed in the table refers to the oligonucleotide sequence. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Table 9 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000)
  • the antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
  • IC 50 half maximal inhibitory concentration
  • Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro.
  • Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 75 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Table 13.
  • the newly designed chimeric antisense oligonucleotides in Table 13 were designed as 3-10-3 (S)-cET gapmers, 3-9-4 (S)-cEt gapmers, 4-8-4 (S)-cEt gapmers, 4-9-3 (S)-cEt gapmers, 5-7-4 (S)-cEt gapmers, 5-8-3 (S)-cEt gapmers, 6-7-3 (S)-cEt gapmers, or deoxy, MOE and (S)-cEt oligonucleotides.
  • the 3-10-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides.
  • the 3-9-4 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of nine 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising three nucleotides and on the 3′ direction comprising four nucleosides.
  • the 4-8-4 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of eight 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising four nucleosides.
  • the 4-9-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of nine 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising four nucleotides and on the 3′ direction comprising three nucleosides.
  • the 5-7-4 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of seven 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising five nucleotides and on the 3′ direction comprising four nucleotides.
  • the 5-8-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of eight 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising five nucleotides and on the 3′ direction comprising three nucleosides.
  • the 6-7-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of seven 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising six nucleotides and on the 3′ direction comprising three nucleosides.
  • Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification.
  • the deoxy, MOE and (S)-cEt oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification.
  • the ‘Chemistry’ column describes the sugar modifications of each oligonucleotide.
  • ‘k’ indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise ‘d’ indicates deoxyribose; and ‘e’ indicates a MOE modification.
  • the internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
  • SEQ ID NO listed in the table refers to the oligonucleotide sequence.
  • Start site indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • Stop site indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in Table 13 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000).
  • Antisense oligonucleotides from the studies described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells.
  • Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 31.25 nM, 62.5 nM, 125.0 nM, 250.0 nM, 500.0 nM, and 1000.0 nM concentrations of antisense oligonucleotide, as specified in Table 14. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human AR primer probe set RTS3559 was used to measure mRNA levels.
  • AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
  • IC 50 half maximal inhibitory concentration
  • Gapmers from Example 8 exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells.
  • Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 46.9 nM, 187.5 nM, 750.0 nM, and 3000.0 nM concentrations of antisense oligonucleotide, as specified in Table 15.
  • RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR.
  • Human AR primer probe set RTS3559 was used to measure mRNA levels.
  • AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells.
  • IC 50 half maximal inhibitory concentration
  • Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro.
  • Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 616 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Tables 16-23.
  • the newly designed chimeric antisense oligonucleotides in Tables 16-23 were designed as 3-10-3 (S)-cET gapmers.
  • the gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides.
  • Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification.
  • the internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
  • the SEQ ID NO listed in the table refers to the oligonucleotide sequence.
  • Start site indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in Tables 16-23 is targeted to either the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000) or the human AR mRNA sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NM_000044.3), or both.
  • ‘n/a.’ indicates that the oligonucleotide does not target that particular gene sequence.
  • Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro.
  • Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 385 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Tables 24-28.
  • the newly designed chimeric antisense oligonucleotides in Tables 24-28 were designed as 3-10-3 (S)-cET gapmers.
  • the gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides.
  • Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification.
  • the internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
  • SEQ ID NO listed in the table refers to the oligonucleotide sequence.
  • Start site indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence.
  • Sttop site indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.
  • Each gapmer listed in Tables 24-28 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000)
  • Gapmers from the studies described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells.
  • Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 46.9 nM, 187.5 nM, 750.0 nM, and 3000.0 nM concentrations of antisense oligonucleotide, as specified in Tables 29-37.
  • RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR.
  • Human AR primer probe set RTS3559 was used to measure mRNA levels.
  • AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells.
  • IC 50 half maximal inhibitory concentration
  • AR-V7 and AR-V567es are major AR splice variants detected in cancer patients as described in Hornberg, E. et al., PLoS One 2011. Vol. 6.
  • ISIS 549372 which targets the human AR genomic sequence at exon 1
  • ISIS 549434 which targets the human AR genomic sequence at the 3′-end of exon 8 beyond the stop codon of AR
  • ISIS 560131 which targets the human AR genomic sequence at intron 1
  • ISIS 569236 which targets the human AR genomic sequence at intron 1.
  • ISIS 554221 ACCAAGTTTCTTCAGC, designated herein as SEQ ID NO: 178
  • SEQ ID NO: 178 was designed as a 3-10-3 LNA gapmer with phosphorothioate backbone targeted to exon 4, (i.e. the ligand binding domain) of AR identical to an antisense oligonucleotide designated as SEQ ID NO: 58 of U.S. Pat. No. 7,737,125 for use as a benchmark.
  • C4-2B cells are androgen-independent human prostate adenocarcinoma cells commonly used in the field of oncology and have been established as clinically relevant cultured cells (Thalmann, G. N. et al., Cancer Res. 1994. 54: 2577).
  • MDV3100 or Enzalutamide is an experimental androgen receptor antagonist drug developed by Medivation for the treatment of castration-resistant prostate cancer.
  • ISIS 549372, ISIS 554221, and ISIS 549434 were tested in MDV3100-resistant (MR) C4-2B cells.
  • the cells were cultured in the presence of 5 ⁇ M concentration of MDV3100 over the course of 2 months to induce MDV3100 resistance.
  • ISIS 549372, ISIS 549434, and ISIS 554221 at 1 ⁇ M concentration of antisense oligonucleotide were each added to the culture media at 1 ⁇ M concentration for free uptake by the cells.
  • cells were harvested in RIPA buffer containing protease inhibitors.
  • the presence of bands for full-length AR, as well as the variant form, AR-V7, was detected by western blot using AR antibody (N-20, Santa Cruz).
  • Treatment of the cells with ISIS 549372 reduced full-length AR and AR-V7 more extensively than treatment with either ISIS 554221 or ISIS 549434.
  • ISIS 549372, ISIS 549458, ISIS 554221, and ISIS 549434 were tested in C4-2B MR cells.
  • Cells were plated at a density of 40,000 cells per well in 96-well plates and cultured in RPMI1640 medium with 10% fetal bovine serum. The cells were cultured in the presence of 5 ⁇ M concentration of MDV3100 over the course of 2 months to induce MDV3100 resistance.
  • ISIS 549372, ISIS 549458, ISIS 549434, and ISIS 554221 were each added at 0.04 ⁇ M, 0.20 ⁇ M, 1.00 ⁇ M, and 5.00 ⁇ M concentrations of antisense oligonucleotide to culture media for free uptake by the cells.
  • Human AR primer probe set hAR_LTS00943 (forward sequence GCCCCTGGATGGATAGCTACT, designated herein as SEQ ID NO: 180; reverse sequence CCACAGATCAGGCAGGTCTTC, designated herein as SEQ ID NO: 181; probe sequence ACTGCCAGGGACCATGTTTTGCCC, designated herein as SEQ ID NO: 182) was used to measure AR-V7 mRNA levels. AR mRNA levels were adjusted to human actin mRNA levels. Results are presented in Table 38 as percent inhibition of total AR, relative to untreated control cells. Treatment of the cells with ISIS 549372, ISIS 549458, and ISIS 549434 reduced total AR transcript levels in a dose dependent manner more extensively than treatment with ISIS 554221.
  • the mRNA level of the AR target gene, KLK2 was measured using the primer probe set hKLK2_LTS00963 (forward sequence CTTGCGCCCCAGGAGTCT, designated herein as SEQ ID NO: 183; reverse sequence CTCAGAGTAAGCTCTAGCACACATGTC, designated herein as SEQ ID NO: 184; probe sequence AGTGTGTGAGCCTCCATCTCCTGTCCAA, designated herein as SEQ ID NO: 185).
  • the mRNA level of the AR target gene, KLK3 was measured using the primer probe set RTS1072 (forward sequence GCCAAGGAGGGAGGGTCTT, designated herein as SEQ ID NO: 186; reverse sequence CCCCCCATAGTGAATCAGCTT, designated herein as SEQ ID NO: 187; probe sequence ATGAAGTAAGGAGAGGGACTGGACCCCC, designated herein as SEQ ID NO: 188).
  • RTS1072 forward sequence GCCAAGGAGGGAGGGTCTT, designated herein as SEQ ID NO: 186
  • reverse sequence CCCCCCATAGTGAATCAGCTT designated herein as SEQ ID NO: 187
  • probe sequence ATGAAGTAAGGAGAGGGACTGGACCCCC designated herein as SEQ ID NO: 188.
  • treatment with I ISIS 549372, ISIS 549458, and ISIS 549434 reduced target gene levels in a dose dependent manner more extensively than treatment with ISIS 554221.
  • ISIS 549372, ISIS 549458, ISIS 554221, and ISIS 549434 were tested in C4-2B MR cells.
  • ISIS 549372, ISIS 549434, ISIS 549458, and ISIS 554221 were each added to the culture media at 0.04 ⁇ M, 0.20 ⁇ M, 1.00 ⁇ M, and 5.00 ⁇ M concentration of antisense oligonucleotide.
  • ISIS 347526 was included as a negative control.
  • the proliferative capacity of the cancer cells was measured with using CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Table 41 as percent inhibition of proliferation, relative to non-treated cells. Treatment of the cells with ISIS 549372, ISIS 549434, and ISIS 549458 reduced proliferation of the cells in a dose dependent manner more extensively than treatment with ISIS 554221.
  • LMR20 An MDV3100-resistant cell line, designated as LMR20, was created. The effect of antisense inhibition of AR on the proliferative ability and AR mRNA levels of LMR20 cells was analyzed. ISIS 560131, ISIS 549458, and ISIS 569236 were tested along with the LNA gapmer, ISIS 554221.
  • LnCaP cells were incubated with increasing concentrations of MDV3100 for approximately 6 months. A single clone was selected after extensive culturing in the presence of 20 ⁇ M MDV3100. The clone, LMR20, maintained the ability to allow free uptake of antisense oligonucleotides without lipid-mediated transfection, while demonstrating an approximately ten-fold increase in IC 50 when treated with MDV3100, compared to parental LnCaP cells.
  • LMR20 cells were plated at 1,500 cells per well in phenol red-free medium with charcoal-stripped fetal bovine serum (CSS), to remove any androgens from the medium (Life Technologies).
  • ISIS 560131, ISIS 549458, ISIS 569236, and ISIS 554221 were individually added to the culture media at 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M concentration.
  • ISIS 549148 which has no known human target sequence, was included as a control.
  • the synthetic androgen agonist, R1881, (Takeda, A. N. et al., Mol. Pharmacol. 2007.
  • 71: 473-82 was added on day 1 at 1 nM dose to a set of cells also treated with each of the antisense oligonucleotides.
  • DHT was added on day 1 at a dose of 10 nM to another set of cells also treated with each of the antisense oligonucleotides.
  • MDV3100 was added on day 1 at a dose of 10 nM to another set of cells untreated with antisense oligonucleotide, which served as a control. After a treatment period of 5 days, the proliferative ability of the cancer cells was measured by the standard MTT assay. Results are presented in Table 42 as percent inhibition of proliferation, relative to non-treated cells.
  • LMR20 cells were plated at 1,500 cells per well in phenol red-free medium with CSS.
  • ISIS 560131, ISIS 549458, ISIS 569236, and the LNA gapmer ISIS 554221 were individually added to the culture media at 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M concentration.
  • ISIS 549148, which has no known human target sequence, was included as a control.
  • MDV3100 was added on day 1 at a dose of 10 nM to a set of cells, and served as a control.
  • DHT was added on day 1 at a dose of 10 nM for 72 hrs to one set of cells also treated with each of the antisense oligonucleotides or MDV3100.
  • R1881 was added on day 1 at a dose of 10 nM for 72 hrs to another set of cells also treated with each of the antisense oligonucleotides or MDV3100.
  • mRNA levels of AR, prostate-specific antigen (PSA) and TMPRSS2, an androgen-regulated gene were measured. Results are presented in Tables 43-45 as mRNA levels expressed as a percentage of the baseline values. mRNA levels may be lowered or increased after treatment.
  • ISIS 560131, ISIS 549458, and ISIS 569236 reduced AR mRNA levels in LMR20 cells, treated with or without either AR agonist, in a dose dependent manner relative to the baseline.
  • Treatment with the LNA gapmer ISIS 554221 did not alter AR mRNA levels.
  • ISIS 560131, ISIS 549458, and ISIS 569236 reduced PSA levels and TMPRSS2 more extensively than the LNA gapmer ISIS 554221 or MDV3100.
  • Treatment with MDV3100 increased the levels of AR mRNA in cells treated with AR agonist, and did not reduce either PSA or TMPRSS2 mRNA levels.
  • ISIS 549372, ISIS 549434, ISIS 549458, and ISIS 554221 were tested in C4-2B cells.
  • C4-2B cells were plated at 1,500 cells per well.
  • ISIS 549372, ISIS 549434, ISIS 549458, or ISIS 554221 were individually added to the culture media at 0.1 ⁇ M concentration.
  • ISIS 347526 was included as a negative control.
  • MDV3100 was also added on day 1 at doses of 0.25 ⁇ M or 1.00 ⁇ M. After a treatment period of 6 days, the proliferative capacity of the cancer cells was measured with CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Table 46 as percent inhibition of proliferation, relative to non-treated cells.
  • ISIS 549372 or ISIS 549458 reduced proliferation of the cells more extensively than treatment with ISIS 554221. For instance, as presented in Table 46, treatment with ISIS 549372 alone reduced cell proliferation by 59% and treatment with ISIS 549458 reduced cell proliferation by 74% compared to ISIS 554221 alone, which reduced cell proliferation by 23%.
  • ISIS 549372 or ISIS 549458 in combination with MDV3100 inhibited prostate cancer cell proliferation to a greater extent than an equal molar concentration of ISIS 554221 in combination of MDV3100.
  • LNCaP cells were plated at 1,000 cells per well.
  • ISIS 560131 or ISIS 569236 was individually added to the culture media at 0.08 ⁇ M, 0.04 ⁇ M, 0.2 ⁇ M, or 1.0 ⁇ M concentration.
  • ISIS 549148 was included as a negative control.
  • MDV3100 was added to the ISIS oligonucleotide-treated cells on day 2 at doses of 0.016 ⁇ M, 0.08 ⁇ M, 0.4 ⁇ M, or 2.0 ⁇ M. After a treatment period of 5 days, the proliferative capacity of the cancer cells was measured with CellTiter 96® AQueous One or CellTiter-Glo® Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 48-52 as percent inhibition of proliferation, relative to non-treated cells.
  • ISIS 560131 or ISIS 569236 treatment with ISIS 560131 or ISIS 569236 was synergistic with MDV3100.
  • MDV3100 with control oligonucleotide, ISIS 549148, at 0.08 ⁇ M inhibited proliferation by an average of 7%; ISIS 560131 alone at 0.04 ⁇ M inhibited cell proliferation by 24%; in combination, cell proliferation was inhibited by 41%.
  • ISIS 569236 alone at 0.04 ⁇ M inhibited cell proliferation by 9%; in combination, cell proliferation was inhibited by 26%.
  • the combination of ISIS 560131 or ISIS 569236 and MDV3100 was synergistic (i.e. greater than additive) in terms of inhibition of prostate cancer cell proliferation.
  • C4-2B cells were plated at 1,000 cells per well.
  • ISIS 560131 or ISIS 569236 was individually added to the culture media at 0.08 ⁇ M, 0.04 ⁇ M, 0.2 ⁇ M, or 1.0 ⁇ M concentration.
  • ISIS 549148 was included as a negative control.
  • MDV3100 was added to the ISIS oligonucleotide-treated cells on day 2 at doses of 0.016 ⁇ M, 0.08 ⁇ M, 0.4 ⁇ M, or 2.0 ⁇ M. After a treatment period of 5 days, the proliferative capacity of the cancer cells was measured with CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 53-57 as percent inhibition of proliferation, relative to non-treated cells.
  • treatment with ISIS 560131 or ISIS 569236 was synergistic with MDV3100.
  • MDV3100 with control oligonucleotide, ISIS 549148, at 0.4 ⁇ M inhibited proliferation by an average of 6%; ISIS 560131 alone at 0.08 ⁇ M inhibited cell proliferation by 16%; in combination, cell proliferation was inhibited by 31%.
  • MDV3100 with control oligonucleotide, ISIS 549148, at 0.08 ⁇ M did not inhibit proliferation (0%); ISIS 569236 alone at 0.2 ⁇ M inhibited cell proliferation by 37%; in combination, cell proliferation was inhibited by 52%.
  • the combination of ISIS 560131 or ISIS 569236 and MDV3100 was synergistic (i.e. greater than additive) in terms of inhibition of prostate cancer cell proliferation.
  • 22RV1 cells were plated at 2,000 cells per well in 5% CSS medium for 48 hours.
  • Cells were transfected using RNAiMAX reagent with ISIS 560131 or ISIS 569236 at 0.4 nM, 1.34 nM, 4 nM, or 13.4 nM concentrations.
  • ISIS 549148 was included as a negative control.
  • DHT at 1 nM and/or MDV3100 at doses of 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M were added after 4 hours.
  • the proliferative capacity of the cancer cells was measured with CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 58-62 as percent inhibition of proliferation, relative to non-treated cells.
  • treatment with ISIS 560131 or ISIS 569236 was synergistic with MDV3100.
  • MDV3100 with control oligonucleotide, ISIS 549148 at 1.0 ⁇ M inhibited proliferation by an average of 5%; ISIS 560131 alone at 1.34 nM inhibited cell proliferation by 3%; in combination, cell proliferation was inhibited by 23%.
  • MDV3100 with control oligonucleotide, ISIS 549148 at 1.0 ⁇ M inhibited proliferation by 5%; ISIS 569236 alone at 1.0 ⁇ M inhibited cell proliferation by 17%; in combination, cell proliferation was inhibited by 30%.
  • the combination of ISIS 560131 or ISIS 569236 and MDV3100 was synergistic (i.e. greater than additive) in terms of inhibition of prostate cancer cell proliferation.
  • ISIS 549372, ISIS 549434, ISIS 549458, and ISIS 554221 were tested in CWR22-RV1 cells.
  • CWR22-RV1 cells were plated and transfected using RNAiMax reagent (Life Technologies) with ISIS oligonucleotides at 1.7 nM, 5.0 nM, 16.7 nM, or 50 nM concentrations.
  • ISIS 347526 was included as a negative control. After a treatment period of 6 days, the target reduction and proliferative capacity of the cancer cells was measured.
  • Antisense inhibition of AR full-length mRNA was measured with the RTS3559 primer probe set. The results are presented in Table 63 as percent inhibition relative to non-treated cells. The reduction in V7 splice variant of the AR mRNA was also measured by RT-PCR using SYBR Green staining (Hu, R. et al., Cancer Res. 2009. 69: 16-22). The results are presented in Table 64, as percent reduction, relative to non-treated cells. Cell proliferation was measured with CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Table 65 as percent inhibition of proliferation, relative to non-treated cells.
  • ISIS 549458, ISIS 549372, ISIS 549434, and ISIS 554221 were added individually at 0.04 ⁇ M, 0.20 ⁇ M, 1.00 ⁇ M, or 5.00 ⁇ M. After an incubation period of 24 hrs, mRNA levels were measured using hAR_LTS00943. The data is presented in Table 66. The results indicate that ISIS 549458, ISIS 549372, and ISIS 549434 inhibited AR mRNA expression more potently than ISIS 554221.
  • ISIS oligonucleotides were added individually at 0.02 ⁇ M, 0.10 ⁇ M, 0.50 ⁇ M, 2.50 ⁇ M, or 10.00 ⁇ M. After an incubation period of 24 hrs, mRNA levels were measured using primer probe set hAR_LTS00943. The data is presented in Table 68. The results indicate that most of the ISIS oligonucleotides inhibited AR mRNA expression more potently than ISIS 554221 at each concentration.
  • DHT Dihydrotestosterone
  • 22RV1cells were plated at 1,500 cells per well.
  • ISIS 560131 and ISIS 569236 were individually transfected into the cells using RNAiMAXTM reagent (Life Technologies) at 1.34 nM, 4.00 nM, 13.4 nM, or 40.0 nM concentration.
  • ISIS 549148 which has no known human target sequence, was included as a control.
  • Separate sets of cells, also treated with each of the antisense oligonucleotides, were treated with DHT added on day 1 at a final concentration of 1 nM. After a treatment period of 5 days, the proliferative ability of the cancer cells was measured using the standard MTT assay. Results are presented in Table 69 as percent inhibition of proliferation, relative to non-treated cells.
  • both ISIS 560131 and ISIS 569236 significantly inhibited prostate cancer cell proliferation even in the presence of AR activator, DHT, compared to the control.
  • the control oligonucleotide did not show any effect on proliferation, as expected.
  • C4-2B cells were plated at 1,000 cells per well in complete medium.
  • ISIS 560131 or ISIS 569236 was individually added to the culture media to the final concentrations of 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M concentrations without using transfection reagent.
  • ISIS 549148 was included as a negative control.
  • MDV3100 was added at dose of 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M in a separate set of cells. After a treatment period of 8 hours, 24 hours, and 48 hours, AR expression was measured with primer probe set hAR-LTS00943. Results are presented in Tables 70-72 as percent expression of AR, relative to non-treated cells. Treatment of the cells with ISIS 560131 or ISIS 569236 reduced AR expression in the cells relative to the control set. Treatment with MDV-3100 increased AR expression at the 48 hour time-point.
  • Protein levels in the cells were also analyzed.
  • the cells were harvested in RIPA buffer containing protease inhibitors.
  • the presence of bands for full-length AR was detected by western blot using AR antibody (N-20, SC-816, Santa Cruz Biotechnology).
  • Full-length AR was significantly reduced in cells treated with ISIS 560131 or ISIS 569236 for 24 hours and 48 hours, normalized to the levels of the house-keeping gene, GAPDH.
  • PSA prostate-specific antigen
  • TMPRSS2 TMPRSS2 expression
  • results are presented in Tables 73-75 as percent inhibition of PSA expression and Tables 76-78 as percent inhibition of TMPRSS2 expression, relative to non-treated cells.
  • Treatment of the cells with ISIS 560131 or ISIS 569236 reduced PSA and TMPRSS2 expression in the cells relative to the control set at the 24 hr and 48 hr time points.
  • Treatment with MDV-3100 also reduced downstream gene expressions but not as potently as that with the ISIS oligonucleotides.
  • ISIS 560131 or ISIS 569236 was added individually at 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M.
  • ISIS 549148 was included as a negative control.
  • MDV3100 was added a dose of 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M. ⁇ M in a separate set of cells. After an incubation period of 48 hours, RNA levels of AR, PSA and TMPRSS2 were measured. The data is presented in Tables 79-81.
  • Protein analysis of full-length AR also demonstrated a dose-dependent decrease of expression, normalized to levels of the house-keeping gene, GAPDH.
  • ISIS 560131 or ISIS 569236 was added individually at 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M to each cell set.
  • ISIS 549148 was included as a negative control.
  • MDV3100 was added at 0.04 ⁇ M, 0.2 ⁇ M, 1.0 ⁇ M, or 5.0 ⁇ M in a separate set of cells. After an incubation period of 4 hrs, DHT was added to the medium to a final concentration of 1 nM as indicated.
  • RNAs were collected 48 hrs later and levels of AR, PSA and TMPRSS2 were measured. The data is presented in Table 82-85. In the absence of DHT, AR expression in LNCaP cells was 95%, PSA expression was 7% and TMPRSS2 expression was 24% compared to the untreated control.
  • the proliferative capacity of the cancer cells was measured with using CellTiter 96® AQueous One Solution or CellTiter-Glo® solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 86 and 87 as percent inhibition of proliferation, relative to non-treated cells.
  • Treatment of the cells with ISIS 560131, ISIS 569236, and MDV-3100 reduced proliferation of the cells in a dose dependent compared to the control.
  • Treatment with ISIS oligonucleotides in CSS+DHT medium reduced the proliferative capacity to a greater extent than treatment with MVD-3100.
  • the proliferative capacity of cells cultured in CSS medium without DHT is 17% of untreated control levels.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Reproductive Health (AREA)
  • Endocrinology (AREA)
  • Urology & Nephrology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Steroid Compounds (AREA)

Abstract

Certain embodiments are directed to compounds and compositions targeted to human androgen receptor (AR) for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting cancer cell growth or proliferation.

Description

CROSS-REFERENCE TO RELATED PATENT APPLICATIONS
This application is a continuation of U.S. patent application Ser. No. 14/050,574, filed Oct. 10, 2013, which claims the benefit of priority to U.S. Provisional Patent Application No. 61/712,780 filed Oct. 11, 2012; U.S. Provisional Patent Application No. 61/712,756 filed Oct. 11, 2012; U.S. Provisional Patent Application No. 61/723,701 filed Nov. 7, 2012; U.S. Provisional Patent Application No. 61/777,813 filed Mar. 12, 2103; U.S. Provisional Patent Application No. 61/777,851 filed Mar. 12, 2103 and U.S. Provisional Patent Application No. 61/777,895 filed Mar. 12, 2103. The entire text of the above-referenced patent applications is incorporated herein by reference in their entirety.
SEQUENCE LISTING
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0212WOSEQ.txt created Sep. 17, 2013, which is approximately 556 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
FIELD
Certain embodiments are directed to compounds and compositions targeted to human androgen receptor (AR) for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting cancer cell growth or proliferation.
BACKGROUND
Androgen receptor (AR) belongs to the superfamily of nuclear receptors and is activated by binding to its hormone ligands: androgen, testosterone, or DHT. Upon binding hormone ligand in the cytoplasm, androgen receptor trans-locates to the nucleus where it binds DNA and functions as a transcription factor to regulate expression of a number of target genes, such as prostate specific antigen (PSA) and TMPRSS2. Knudsen et al. (Trends Endocrinol Metab 21: 315-24, 2010) Bennett et al. (Int J Biochem Cell Biol. 42:813-827, 201).
Androgen receptor (AR) signaling is a critical survival pathway for prostate cancer cells, and androgen-deprivation therapy (ADT), also known as “chemical castration”, is a first-line treatment strategy against hormone-sensitive, androgen-dependent prostate cancer that reduces circulating androgen levels and thereby inhibits AR activity. Although a majority of patients initially respond to ADT, most will eventually develop castrate resistance in which the disease progresses despite castrate levels of testosterone. This type of cancer is known as castrate-resistant prostate cancer (CRPC). There are a number of mechanisms underlying the development of castrate (castration) resistance including an increase in the expression of AR protein which can sensitize cells to low levels of androgen, AR mutations that can alter transactivation or sensitize AR to alternative ligands and the emergence of alternatively spliced forms of AR, which lack the ligand binding domain but can nevertheless act to promote tumour growth in the absence of ligand stimulation. Additionally prostate tumors may also synthesize their own androgens thereby increasing the local intra-tumoral testosterone levels available to activate the AR.
Androgen receptor (AR) signaling is a critical survival pathway for prostate cancer cells, and androgen-deprivation therapy (ADT) remains the principal treatment for patients with locally advanced and metastatic disease. Although a majority of patients initially respond to ADT, most will eventually develop castrate resistance in which the disease progresses despite castrate levels of testosterone. This type of cancer is known as castrate-resistant prostate cancer (CRPC) (Karantos et al., Oncogene advance online: 1-13, 2013). There are a number of mechanisms underlying the development of castration resistance including an increase in the expression of AR protein which can sensitize cells to low levels of androgen (Gregory et al., Cancer Res 61: 2892-2898, 2001; Linja et al., Cancer Res 61: 3550-3555, 2001), AR mutations that can alter transactivation or sensitize AR to alternative ligands (Scher et al., J Clin Oncol 23: 8253-8261, 2005) and the emergence of alternatively spliced forms of AR, which lack the ligand binding domain but can nevertheless act to promote tumour growth in the absence of ligand stimulation (Yingming et al., Cancer Res 73:483-489, 2013). Additionally prostate tumors may also synthesize their own androgens thereby increasing the local intratumoral testosterone levels available to activate the AR (Attard et al., Cancer Cell 16:458-462, 2009).
The fact that the androgen receptor remains active in castrate resistant prostate cancer has led to the development of new agents that inhibit the production of androgen ligands or block the actions of these ligands on the AR. These new agents include abiraterone acetate which inhibits 17-α-hydroxylase/17,20-lyase (CYP17) activity resulting in a reduction in residual androgens synthesized by the adrenals and in the prostate tumour itself deBono et al. (N Engl J Med 364: 1995-2006, 2011) and enzalutamide which prevents androgen ligand from binding to AR, translocating to the nucleus, and binding to DNA (Scher et al., N Engl J Med 367:1187-1197, 2012). A number of other androgen synthesis inhibitors or androgen receptor blockers are under development either pre-clinically or clinically and include for example, ARN509, ODM201, TOK001, VT464.
Although the activity of agents such as enzalutamide and abiraterone in CRPC is very encouraging, neither works in all patients and both are associated with the development of additional resistance through re-activation of the AR by the mechanisms described above (Yingming et al., Cancer Res 73:483-489, 2013). Thus, there is a continued need to identify alternative therapies for the treatment of CRPC, and in particular those that can either remove and/or inhibit the activity of all forms of AR including for example, wildtype, mutated and splice variant ARs.
The present invention provides antisense oligonclueotides which by virtue of their design and mode of action (base-pair with the AR RNA target and mediate its destruction by RNase H, an enzyme that destroys the RNA in a DNA/RNA duplex) are aimed at inhibiting the major forms of AR By targeting an appropriate region of the AR mRNA the antisense oligonucleotide will result in inhibition of the major forms (full length, splice variant and mutated forms) of androgen receptor proteins and therefore be suitable for the treatment of patients with CRPC.
Aside from prostate cancer, AR is also implicated as a factor in the progression of other tumours such as breast cancer. In breast cancer AR is expressed in 70-80% of tumours which are also ER positive and in 12% cases which are known as triple negative (no expression of ER, PR and HER2) (Hickey et al., Molecular Endocrinology 26: 1252-1267, 2012). In pre-clinical studies, the androgen receptor antagonist bicalutamide induces anti-proliferative responses in vitro in breast cancer cells and this is potentiated by addition of a Pi3K/mTOR inhibitor (Ni et al., Cancer Cell 20: 119-131, 2011). The 2nd generation anti-androgen, enzalutamide inhibits dihydrotestosterone (DHT) mediated proliferation in ER+/AR+ breast cancer cells and is as effective as tamoxifen at inhibiting estrogen-stimulated breast cancer tumour growth in pre-clinical models in vivo (Cochrane et al., Cancer Res 72(24 Supplement): P2-14-02, 2012). Enzalutamide also inhibits proliferation in HER2 + and triple-negative breast cancer cells. It appears that in situations where estrogen action is reduced (eg. long-term estrogen deprivation or absence of ER) AR levels increase and can become oncogenic. This would suggest that AR antagonists may be best positioned in triple negative or hormone resistant breast cancer settings (Hickey et al., Molecular Endocrinology 26: 1252-1267, 2012). AR targeted therapies are currently under investigation in clinical trials for breast cancer (NCT00468715, NCT01597193, NCT01381874, NCT00755886).
AR is also expressed in a variety of other tumours, including, but not limited to bladder, ovarian, gastric, lung and liver. Pre-clinical data support a similar role as in breast cancer, to promote tumour cell proliferation survival; thus blocking AR in these tumours could have therapeutic clinical benefit (Chang et al., Oncogene advance online: 1-10, 2013).
SUMMARY
Several embodiments provided herein relate to the discovery of compounds and compositions for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting proliferation or growth of cancer cells, such as prostate, breast, ovarian, gastric or bladder cancer or cancer cells.
DETAILED DESCRIPTION
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
Definitions
Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
Unless otherwise indicated, the following terms have the following meanings:
“2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH2)2—OCH3) refers to an O-methoxy-ethyl modification at the 2′ position of a sugar ring, e.g. a furanose ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.
“2′-MOE nucleoside” (also 2′-O-methoxyethyl nucleoside) means a nucleoside comprising a 2′-MOE modified sugar moiety.
“2′-substituted nucleoside” means a nucleoside comprising a substituent at the 2′-position of the furanosyl ring other than H or OH. In certain embodiments, 2′ substituted nucleosides include nucleosides with bicyclic sugar modifications.
“3′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3′-most nucleotide of a particular antisense compound.
“5′ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5′-most nucleotide of a particular antisense compound.
“5-methylcytosine” means a cytosine modified with a methyl group attached to the 5′ position. A 5-methylcytosine is a modified nucleobase.
“About” means within ±7% of a value. For example, if it is stated, “the compounds affected at least about 70% inhibition of Androgen Receptor”, it is implied that Androgen Receptor levels are inhibited within a range of 63% and 77%.
“Administration” or “administering” refers to routes of introducing an antisense compound provided herein to a subject to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
“Androgen-receptor positive” with respect to breast cancer or a breast cancer cell refers to a breast cancer or a breast cancer cell that expresses androgen receptor.
“Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
“Anti-androgenic agent” refers to a therapeutic compound or drug which is an androgen synthesis inhibitor or an androgen receptor blocker.
“Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
“Antisense compound” means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
“Antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
“Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
“Base complementarity” refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
“Bicyclic sugar moiety” means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2′-carbon and the 4′-carbon of the furanosyl.
Also included within the definition of LNA according to the invention are LNAs in which the 2′-hydroxyl group of the ribosyl sugar ring is connected to the 4′ carbon atom of the sugar ring, thereby forming a methyleneoxy (4-CH2—O-2′) bridge to form the bicyclic sugar moiety. The bridge can also be a methylene (—CH2—) group connecting the 2′ oxygen atom and the 4′ carbon atom, for which the term methyleneoxy (4-CH2—O-2′) LNA is used. Furthermore; in the case of the bicylic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4′-CH2CH2—O-2′) LNA is used. α-L-methyleneoxy (4-CH2—O-2′), an isomer of methyleneoxy (4-CH2—O-2′) LNA is also encompassed within the definition of LNA, as used herein.
“Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
“Castrate-resistant prostate cancer” or “Castration-resistant prostate cancer” and prostate cancer cells refer to the reduction of sensitivity of prostate cancer and prostate cancer cells to androgen deprivation therapy or an anti-androgenic agent.
“cEt” or “constrained ethyl” means a bicyclic sugar moiety comprising a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4-CH(CH3)—O-2′.
“Constrained ethyl nucleoside” (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4′-CH(CH3)—O-2′ bridge.
“Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2′-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2′-O-methoxyethyl modifications.
“Chimeric antisense compounds” means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.
“Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
“Comprise,” “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
“Contiguous nucleobases” means nucleobases immediately adjacent to each other.
“Deoxyribonucleotide” means a nucleotide having a hydrogen at the 2′ position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.
“Designing” or “Designed to” refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
“Downstream” refers to the relative direction toward the 3′ end or C-terminal end of a nucleic acid.
“Efficacy” means the ability to produce a desired effect.
“Estrogen-receptor (ER) positive” with respect to breast cancer or a breast cancer cell refers to breast cancer or a breast cancer cell that expresses estrogen receptor (ER).
“Estrogen-receptor (ER) negative” with respect to breast cancer or a breast cancer cell refers to breast cancer or a breast cancer cell that does not express estrogen receptor (ER).
“Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
“Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
“Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
“Her2/neu negative” with respect to breast cancer or a breast cancer cell refers to breast cancer or a breast cancer cell that does not express Her2/neu.
“Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
“Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.
“Individual” means a human or non-human animal selected for treatment or therapy.
“Induce”, “inhibit”, “potentiate”, “elevate”, “increase”, “decrease”, upregulate”, “downregulate”, or the like, generally denote quantitative differences between two states.
“Inhibiting the expression or activity” refers to a reduction, blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
“Internucleoside linkage” refers to the chemical bond between nucleosides.
“Lengthened” antisense oligonucleotides are those that have one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein.
“Linked deoxynucleoside” means a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.
“Linked nucleosides” means adjacent nucleosides linked together by an internucleoside linkage.
“Mismatch” or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
“Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
“Modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
“Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
“Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
“Modified oligonucleotide” means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.
“Modified sugar” means substitution and/or any change from a natural sugar moiety.
“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.
“Motif” means the pattern of unmodified and modified nucleosides in an antisense compound.
“Natural sugar moiety” means a sugar moiety found in DNA (2′-H) or RNA (2′-OH).
“Naturally occurring internucleoside linkage” means a 3′ to 5′ phosphodiester linkage.
“Non-complementary nucleobase” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.
“Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
“Nucleobase complementarity” refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
“Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
“Nucleoside” means a nucleobase linked to a sugar.
“Nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by —N(H)—C(═O)—O— or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
“Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
“Oligomeric compound” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
“Oligonucleoside” means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.
“Oligonucleotide” means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
“Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified inter-nucleoside linkage.
“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound
“Progesterone receptor (PR) negative” with respect to breast cancer or a breast cancer cell refers to breast cancer or a breast cancer cell that does not express progesterone receptor (PR).
“Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
“Ribonucleotide” means a nucleotide having a hydroxy at the 2′ position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
“Segments” are defined as smaller or sub-portions of regions within a target nucleic acid.
“Sites,” as used herein, are defined as unique nucleobase positions within a target nucleic acid.
“Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments. “Stringent hybridization conditions” or “stringent conditions” refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
“Subject” means a human or non-human animal selected for treatment or therapy.
“Synergy” or “synergize” refers to an effect of a combination that is greater than additive of the effects of each component alone.
“Target” refers to a protein, the modulation of which is desired.
“Target gene” refers to a gene encoding a target.
“Targeting” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
“Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by antisense compounds.
“Target region” means a portion of a target nucleic acid to which one or more antisense compounds is targeted.
“Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment. “3′ target site” refers to the 3′-most nucleotide of a target segment.
“Treating cancer” refers to performing actions that lead to amelioration of cancer or of the symptoms accompanied therewith. The combination of said actions is encompassed by the term “treatment.” Amelioration of cancer includes, but is not limited to, reducing the number of cancer cells in a subject or reducing the number of cancer cells in the subject. Said treatment as used herein also includes an entire restoration of the health with respect to cancer. It is to be understood that treatment as used in accordance with embodiments provided herein may not be effective in all subjects to be treated. However, a population of subjects suffering from cancer referred to herein can be successfully treated. In certain embodiments, “treating cancer” can be described by a number of different parameters including, but not limited to, reduction in the size of a tumor in a subject having cancer, reduction in the growth or proliferation of a tumor in a subject having cancer, preventing metastasis or reducing the extent of metastasis, and/or extending the survival of a subject having cancer compared to control. The cancer referred to in this definition can be any cancer including one selected from prostate cancer, breast cancer, ovarian cancer, gastric cancer and bladder cancer.
“Unmodified” nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
“Unmodified nucleotide” means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and inter-nucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).
“Upstream” refers to the relative direction toward the 5′ end or N-terminal end of a nucleic acid.
Certain Embodiments
Certain embodiments provide methods, compounds, and compositions for inhibiting androgen receptor (AR) mRNA expression.
Certain embodiments provide antisense compounds or compositions targeted to an androgen receptor nucleic acid. In certain embodiments, the androgen receptor nucleic acid is the sequences set forth in GENBANK Accession No. NT_011669.17_TRUNC_5079000_5270000 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NM_000044.3 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. NM_001011645.2 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. FJ235916.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. FJ235917.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. FJ235918.1 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. FJ235919.1 (incorporated herein as SEQ ID NO: 7), or GENBANK Accession No. FJ235920.1 (incorporated herein as SEQ ID NO: 8).
In certain embodiments, the compounds or compositions comprise a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to AR. The AR target can have a sequence recited in any one of SEQ ID NOs: 1-8 or a portion thereof or a variant thereof. In certain embodiments, the AR target can have a sequence of known AR splicing variants including, but are not limited to, AR-V1, AR-V2, AR-V3, AR-V4, AR-V5, AR-V6, and AR-V7 (also referred to as AR3), which contain exons 1-3 but lack exons 4-8. AR-V1, AR-V2, AR-V3, AR-V4, AR-V5, AR-V6, AR-V7, and additional splicing variants targetable by compounds provided herein are described in Hu et al., Cancer Res 2009; 69:16-22 and US Patent Application Publication No. US 2010/0068802, each of which is incorporated herein by reference in its entirety.
In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2′-substituted nucleoside. In certain embodiments, 2′ substituted nucleosides include nucleosides with bicyclic sugar modifications. In certain embodiments, the modified nucleoside is a 2′-MOE nucleoside. In certain embodiments, the modified nucleoside is a constrained ethyl (cEt) nucleoside.
In certain embodiments, the compounds or compositions comprise a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence consisting of a nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, one or more modified nucleosides in the wing segment have a modified sugar. In certain embodiments, the modified sugar is a bicyclic sugar. In certain embodiments, the modified nucleoside is an LNA nucleoside. In certain embodiments, the modified nucleoside is a 2′-substituted nucleoside. In certain embodiments, 2′ substituted nucleosides include nucleosides with bicyclic sugar modifications. In certain embodiments, the modified nucleoside is a 2′-MOE nucleoside. In certain embodiments, the modified nucleoside is a constrained ethyl (cEt) nucleoside.
In certain embodiments, the compounds or compositions targeted to androgen receptor comprise a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175, or a pharmaceutically acceptable salt thereof. In certain embodiments, the antisense compound targeted to human AR is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5′ wing segment consisting of linked nucleosides; and c) a 3′ wing segment consisting of linked nucleosides. The gap segment is positioned between the 5′ wing segment and the 3′ wing segment and each nucleoside of each wing segment comprises a modified sugar.
In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consisting of 10 linked deoxynucleosides, the 5′ wing segment consisting of five linked nucleosides, the 3′ wing segment consisting of five linked nucleosides, each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 10 linked deoxynucleosides, a 5′ wing segment consisting of three linked nucleosides, a 3′ wing segment consisting of three linked nucleosides, each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 9 linked deoxynucleosides, a 5′ wing segment consisting of three linked nucleosides, a 3′ wing segment consisting of four linked nucleosides; the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 8 linked deoxynucleosides, a 5′ wing segment consisting of five linked nucleosides, a 3′ wing segment consisting of three linked nucleosides; the five linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar; the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 8 linked deoxynucleosides, a 5′ wing segment consisting of four linked nucleosides, a 3′ wing segment consisting of four linked nucleosides; the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 8 linked deoxynucleosides, a 5′ wing segment consisting of five linked nucleosides, a 3′ wing segment consisting of three linked nucleosides; the five linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 7 linked deoxynucleosides, a 5′ wing segment consisting of seven linked nucleosides, a 3′ wing segment consisting of two linked nucleosides; the seven linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the two linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 7 linked deoxynucleosides, a 5′ wing segment consisting of six linked nucleosides, a 3′ wing segment consisting of three linked nucleosides; the six linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 7 linked deoxynucleosides, a 5′ wing segment consisting of five linked nucleosides, a 3′ wing segment consisting of four linked nucleosides; the five linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides, a gap segment consisting of 7 linked deoxynucleosides, a 5′ wing segment consisting of four linked nucleosides, a 3′ wing segment consisting of five linked nucleosides; the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the five linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, the compounds or compositions targeted to androgen receptor comprise a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises a gap segment consisting of deoxynucleosides; a 5′ wing segment; and a 3′ wing segment, wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, each internucleoside linkage of the modified oligonucleotide is a phosphorothioate linkage. In certain embodiments, each cytosine of the modified oligonucleotide is a 5′-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 9 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of four linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 9 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of four linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 8 linked deoxynucleosides;
a 5′ wing segment consisting of four linked nucleosides; and
a 3′ wing segment consisting of four linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 8 linked deoxynucleosides;
a 5′ wing segment consisting of five linked nucleosides; and
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the five linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 7 linked deoxynucleosides;
a 5′ wing segment consisting of four linked nucleosides; and
a 3′ wing segment consisting of five linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the five linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 7 linked deoxynucleosides;
a 5′ wing segment consisting of six linked nucleosides; and
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the six linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 43, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 10 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 124, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 10 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 150, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 10 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 155, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 10 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 169, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 10 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, a compound targeted to androgen receptor comprises a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 175, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
a gap segment consisting of 10 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
In certain embodiments, an antisense compound or antisense oligonucleotide targeted to an androgen receptor nucleic acid is complementary within the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 4056-4071, 4059-4074, 4062-4077, 4066-4081, 4070-4085, 4101-4116, 4103-4118, 4105-4120, 4109-4124, 4305-4320, 4405-4420, 4532-4547, 4534-4549, 4537-4552, 4539-4554, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4597-4612, 4632-4647, 4655-4670, 4656-4671, 4662-4677, 4699-4714, 4747-4762, 4750-4765, 4752-4767, 4754-4769, 4755-4770, 4769-4784, 4798-4813, 4804-4819, 4807-4822, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4868-4883, 4872-4887, 4874-4889, 4876-4891, 4887-4902, 4889-4904, 4916-4931, 4918-4933, 4938-4953, 4942-4957, 4944-4959, 4951-4966, 5050-5065, 5052-5067, 5054-5069, 5056-5071, 5060-5075, 5061-5076, 5062-5077, 5133-5148, 5141-5156, 5155-5170, 5265-5280, 5293-5308, 5308-5323, 5392-5407, 5448-5463, 5469-5484, 5481-5496, 5483-5498, 5486-5501, 5488-5503, 5494-5509, 5521-5536, 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58724-58739, 58725-58740, 58725-58740, 58725-58740, 58750-58769, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, 67454-67469, 102156-102171, 114874-114889, 115272-115287, 115365-115380, 134971-134986, 139682-139697, 139762-139777, 139782-139797, 144856-144871, 144938-144953, 148406-148421, 148443-148458, 148520-148535, 181695-181710, 182958-182973, or 183049-183064.
In certain embodiments, an antisense compound or antisense oligonucleotide targeted to an androgen receptor nucleic acid target the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 4056-4071, 4059-4074, 4062-4077, 4066-4081, 4070-4085, 4101-4116, 4103-4118, 4105-4120, 4109-4124, 4305-4320, 4405-4420, 4532-4547, 4534-4549, 4537-4552, 4539-4554, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4597-4612, 4632-4647, 4655-4670, 4656-4671, 4662-4677, 4699-4714, 4747-4762, 4750-4765, 4752-4767, 4754-4769, 4755-4770, 4769-4784, 4798-4813, 4804-4819, 4807-4822, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4868-4883, 4872-4887, 4874-4889, 4876-4891, 4887-4902, 4889-4904, 4916-4931, 4918-4933, 4938-4953, 4942-4957, 4944-4959, 4951-4966, 5050-5065, 5052-5067, 5054-5069, 5056-5071, 5060-5075, 5061-5076, 5062-5077, 5133-5148, 5141-5156, 5155-5170, 5265-5280, 5293-5308, 5308-5323, 5392-5407, 5448-5463, 5469-5484, 5481-5496, 5483-5498, 5486-5501, 5488-5503, 5494-5509, 5521-5536, 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58724-58739, 58725-58740, 58725-58740, 58725-58740, 58750-58769, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, 67454-67469, 102156-102171, 114874-114889, 115272-115287, 115365-115380, 134971-134986, 139682-139697, 139762-139777, 139782-139797, 144856-144871, 144938-144953, 148406-148421, 148443-148458, 148520-148535, 181695-181710, 182958-182973, or 183049-183064.
In certain embodiments, antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid. In certain embodiments, such compounds or oligonucleotides targeted to a region of an androgen receptor nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobases portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 4056-4071, 4059-4074, 4062-4077, 4066-4081, 4070-4085, 4101-4116, 4103-4118, 4105-4120, 4109-4124, 4305-4320, 4405-4420, 4532-4547, 4534-4549, 4537-4552, 4539-4554, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4597-4612, 4632-4647, 4655-4670, 4656-4671, 4662-4677, 4699-4714, 4747-4762, 4750-4765, 4752-4767, 4754-4769, 4755-4770, 4769-4784, 4798-4813, 4804-4819, 4807-4822, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4868-4883, 4872-4887, 4874-4889, 4876-4891, 4887-4902, 4889-4904, 4916-4931, 4918-4933, 4938-4953, 4942-4957, 4944-4959, 4951-4966, 5050-5065, 5052-5067, 5054-5069, 5056-5071, 5060-5075, 5061-5076, 5062-5077, 5133-5148, 5141-5156, 5155-5170, 5265-5280, 5293-5308, 5308-5323, 5392-5407, 5448-5463, 5469-5484, 5481-5496, 5483-5498, 5486-5501, 5488-5503, 5494-5509, 5521-5536, 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58724-58739, 58725-58740, 58725-58740, 58725-58740, 58750-58769, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, 67454-67469, 102156-102171, 114874-114889, 115272-115287, 115365-115380, 134971-134986, 139682-139697, 139762-139777, 139782-139797, 144856-144871, 144938-144953, 148406-148421, 148443-148458, 148520-148535, 181695-181710, 182958-182973, or 183049-183064.
In certain embodiments, an antisense compound or antisense oligonucleotide provided herein targets AR within exon 1, for example within nucleotide regions 2863-5593 (exon 1) or 27672-27853 (exon 1B) of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4047-4062, 4049-4064, 4056-4071, 4059-4074, 4062-4077, 4066-4081, 4070-4085, 4101-4116, 4103-4118, 4105-4120, 4109-4124, 4305-4320, 4405-4420, 4532-4547, 4534-4549, 4537-4552, 4539-4554, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4597-4612, 4632-4647, 4655-4670, 4656-4671, 4662-4677, 4699-4714, 4747-4762, 4750-4765, 4752-4767, 4754-4769, 4755-4770, 4769-4784, 4798-4813, 4804-4819, 4807-4822, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4868-4883, 4872-4887, 4874-4889, 4876-4891, 4887-4902, 4889-4904, 4916-4931, 4918-4933, 4938-4953, 4942-4957, 4944-4959, 4951-4966, 5050-5065, 5052-5067, 5054-5069, 5056-5071, 5060-5075, 5061-5076, 5062-5077, 5133-5148, 5141-5156, 5155-5170, 5265-5280, 5293-5308, 5308-5323, 5392-5407, 5448-5463, 5469-5484, 5481-5496, 5483-5498, 5486-5501, 5488-5503, 5494-5509, or 5521-5536.
In certain embodiments, an antisense compound or antisense oligonucleotide provided herein targets AR within exon 2, for example within nucleotide regions 102087-102238 (exon 2) or 139551-139834 (exon 2c) of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 102155-102170, 102156-102171, 139682-139697, 139762-139777, or 139782-139797.
In certain embodiments, an antisense compound or antisense oligonucleotide provided herein targets AR within exon 3, for example within nucleotide regions 144841-144957 (exon 3), 148380-148594 (exon 3b), or 153504-154908 (exon 3d) of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 3 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 144856-144871, 144938-144953, 148406-148421, 148443-148458, or 148520-148535.
In certain embodiments, an antisense compound or antisense oligonucleotide provided herein targets AR within exon 7, for example within nucleotide region 181658-181815 of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 7 of AR is complementary within nucleotide region 181695-181710 of SEQ ID NO: 1.
In certain embodiments, an antisense compound or antisense oligonucleotide provided herein targets AR within exon 8, for example within nucleotide region 182517-189455 of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 8 of AR is complementary within nucleotide regions 182958-182973 or 183049-183064 of SEQ ID NO: 1.
In certain embodiments, an antisense compound or antisense oligonucleotide provided herein targets AR within intron 1, for example within nucleotide regions 5594-27671 or 27854-102086 of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to intron 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58724-58739, 58725-58740, 58725-58740, 58725-58740, 58750-58769, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, or 67454-67469.
In certain embodiments, an antisense compound or antisense oligonucleotide provided herein targets AR within intron 2, for example within nucleotide regions 102239-139550 or 139835-144840 of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to intron 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 114874-114889, 115272-115287, 115365-115380, or 134971-134986.
In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or antisense oligonucleotides, display at least 50% inhibition: 3099-3114, 3120-3135, 3351-3366, 3353-3368, 3361-3376, 3513-3528, 3519-3534, 3768-3783, 3799-3814, 3851-3866, 3888-3903, 4059-4074, 4534-4549, 4555-4570, 4571-4586, 4578-4593, 4655-4670, 4699-4714, 4750-4765, 4755-4770, 4865-4880, 5054-5069, 5060-5075, 5061-5076, 5062-5077, 5155-5170, 5265-5280, 5392-5407, 5448-5463, 5483-5498, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58735, 58720-58739, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58765, 58750-58769, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, 67454-67469, 102156-102171, 114874-114889, 114874-114889, 115272-115287, 115365-115380, 134971-134986, 144856-144871, 181695-181710, 182958-182973, and 183049-183064.
In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or antisense oligonucleotides, display at least 60% inhibition: 3799-3814, 3851-3866, 3888-3903, 4059-4074, 4534-4549, 4555-4570, 4571-4586, 4578-4593, 4655-4670, 4699-4714, 4755-4770, 4865-4880, 5060-5075, 5061-5076, 5062-5077, 5155-5170, 5265-5280, 5392-5407, 5448-5463, 5483-5498, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 42017-42032, 56050-56065, 58719-58734, 58720-58735, 58720-58739, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58765, 58750-58769, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 67454-67469, 102156-102171, 115272-115287, 115365-115380, 144856-144871, 181695-181710, 182958-182973, and 183049-183064.
In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or antisense oligonucleotides, display at least 70% inhibition: 3799-3814, 3851-3866, 3888-3903, 4059-4074, 4534-4549, 4655-4670, 4699-4714, 4755-4770, 4865-4880, 5060-5075, 5062-5077, 5155-5170, 5265-5280, 5392-5407, 5448-5463, 5483-5498, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 33315-33330, 42017-42032, 58719-58734, 58720-58739, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58769, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 102156-102171, 115365-115380, 144856-144871, 181695-181710, 182958-182973, and 183049-183064.
In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or antisense oligonucleotides, display at least 80% inhibition: 3799-3814, 3851-3866, 3888-3903, 4059-4074, 4534-4549, 4655-4670, 4699-4714, 4755-4770, 4865-4880, 5060-5075, 5062-5077, 5155-5170, 5265-5280, 5392-5407, 5448-5463, 5483-5498, 8471-8486, 8638-8653, 9464-9479, 10865-10880, 11197-11212, 13189-13204, 16793-16808, 58719-58734, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 102156-102171, 144856-144871, 181695-181710, 182958-182973, and 183049-183064.
In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or antisense oligonucleotides, display at least 90% inhibition: 4534-4549, 5060-5075, 5062-5077, 5155-5170, 5265-5280, 5448-5463, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 182958-182973, and 183049-183064.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 50% inhibition of an androgen receptor mRNA, ISIS IDs: 549332, 549334, 549338, 549347, 549358, 549360, 549361, 549362, 549366, 549371, 549372, 549374, 549377, 549379, 549380, 549381, 549387, 549390, 549414, 549432, 549434, 549457, 549458, 549459, 560071, 560098, 560099, 560100, 560131, 560132, 560133, 560137, 569213, 569215, 569216, 569220, 569222, 569223, 569227, 569228, 569229, 569236, 569238, 583559, 583567, 583608, 583609, 583613, 583635, 583638, 583662, 583795, 583796, 583799, 583834, 583919, 584145, 584148, 584149, 584152, 584157, 584158, 584162, 584163, 584165, 584166, 584167, 584168, 584179, 584180, 584183, 584184, 584192, 584233, 584242, 584245, 584263, 584269, 584274, 584312, 584329, 584361, 584465, 584465, 584468, 584469, 584469, 584495, 584495, 585233, 585259, 585262, 585263, 585264, 585265, 585268, 585269, 585271, 585274, 586124, 586224, 586224, 586225, 586225, 586227, and 586227.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 50% inhibition of an androgen receptor mRNA, SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 46, 49, 53, 54, 55, 57, 59, 63, 92, 93, 95, 101, 125, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, and 177.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 60% inhibition of an androgen receptor mRNA, ISIS IDs: 549332, 549334, 549338, 549347, 549358, 549360, 549361, 549362, 549366, 549371, 549372, 549374, 549377, 549379, 549380, 549381, 549387, 549390, 549414, 549432, 549434, 549457, 549458, 549459, 560071, 560098, 560099, 560100, 560131, 560137, 569213, 569216, 569222, 569228, 569236, 583795, 583796, 583799, 584145, 584148, 584149, 584152, 584157, 584158, 584162, 584163, 584165, 584166, 584167, 584168, 584179, 584180, 584183, 584184, 584192, 584233, 584242, 584245, 584274, 584312, 584361, 584468, 584469, 585233, 585259, 585262, 585263, 585264, 585265, 585268, 585269, 585274, 586124, 586224, 586225, and 586227.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 60% inhibition of an androgen receptor mRNA, SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 38, 39, 40, 41, 42, 43, 92, 93, 95, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 170, 171, 173, 175, and 176.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 70% inhibition of an androgen receptor mRNA, ISIS IDs: 549332, 549334, 549338, 549347, 549358, 549360, 549361, 549362, 549366, 549371, 549372, 549374, 549377, 549379, 549380, 549381, 549387, 549390, 549414, 549432, 549434, 549457, 549458, 549459, 560071, 560098, 560099, 560100, 560131, 560137, 569222, 584145, 584148, 584149, 584152, 584162, 584163, 584165, 584166, 584167, 584168, 584179, 584180, 584183, 584184, 584192, 584245, 584274, 584469, 585259, 585262, 585268, 585269, 586124, 586224, 586225, and 586227.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 70% inhibition of an androgen receptor mRNA, SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 148, 149, 150, 151, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 167, 170, and 176.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 80% inhibition of an androgen receptor mRNA, ISIS IDs: 549332, 549334, 549338, 549347, 549358, 549360, 549361, 549362, 549366, 549371, 549372, 549374, 549377, 549379, 549380, 549381, 549387, 549390, 549414, 549432, 549434, 549457, 549458, 549459, 560098, 560099, 560100, 560137, 584148, 584149, 584152, 584162, 584163, 584166, 584180, 586124, 586224, 586225, and 586227.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 80% inhibition of an androgen receptor mRNA, SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 43, 149, 150, 151, 154, 155, 157, and 161.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 90% inhibition of an androgen receptor mRNA, ISIS IDs: 549358, 549371, 549372, 549374, 549377, 549380, 549432, 549434, 549457, 549458, 549459, 560098, 560099, 560100, 560137, and 586224.
In certain embodiments, the following antisense compounds or antisense oligonucleotides target a region of an androgen receptor nucleic acid and effect at least a 90% inhibition of an androgen receptor mRNA, SEQ ID NOs: 16, 21, 22, 23, 24, 26, 33, 34, 35, 36, 37, 39, 40, and 41.
Percent inhibition of androgen receptor mRNA can be determined using standard methods known to those of skill in the art, such as described in Example 1.
It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by ISIS number (ISIS #) indicate a combination of nucleobase sequence, chemical modification, and motif.
In certain embodiments, the compounds or compositions as described herein are efficacious by virtue of having at least one of an in vitro IC50 of less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55 nM, less than 50 nM, less than 45 nM, less than 40 nM, less than 35 nM, less than 30 nM, less than 25 nM, or less than 20 nM when delivered to HuVEC cells. In certain embodiments inhibition is measured with primer probe set RTS3559, as described herein.
In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an ALT or AST value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%, 12%, 10%, 5%, or 2%. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over saline treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over saline treated animals.
In certain embodiments, an antisense compound provided herein targets an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of exons 4-8 encoding the ligand binding domain. An example of such an AR splicing variant includes, but is not limited to, AR-V7, which contains exons 1-3 but lacks exons 4-8. Additional examples of such AR splicing variants include, for example, AR3, AR4, AR4b, AR5, and AR6 (SEQ ID NOs: 4-8, respectively). In certain embodiments, an antisense compound targeted to AR upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain is capable of inhibiting androgen receptor levels to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No. 7,737,125.
In certain embodiments, an antisense compound targets an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain. It will be understood that in certain embodiments an antisense compound can target an AR splicing variant that includes the entire or at least a functional portion of exon 1 encoding the N-terminal domain and the entire or at least a functional portion of exons 2 and 3 encoding the DNA binding domain, but does not include at least a functional portion of exon 4 encoding the short hinge region or at least a functional portion of exons 4-8 encoding the ligand binding domain. It is contemplated that certain AR splicing variants targeted by the antisense compounds provided herein substantially consisting of exons 1-3 may also include a non-functional portion of nucleic acid sequence from a genomic region or exons 4-8. It is contemplated that the splicing process may give rise to such AR splicing variants that retain DNA binding function but not ligand binding function. In certain embodiments, an antisense compound targeted to an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain, is capable of inhibiting growth or proliferation of prostate cancer cells that are castrate-resistant. In certain embodiments, an antisense compound targeted to an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain, is capable of inhibiting growth or proliferation of a prostate cancer cell resistant to a diarylhydantoin AR inhibitor of Formula XI to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No. 7,737,125. In certain embodiments, an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within exon 2, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within intron 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
In certain embodiments, an antisense compound provided herein is capable of reducing expression of both full-length AR and an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of any one of exons 4-8 encoding the ligand binding domain. In certain embodiments, such an antisense compound targets human androgen receptor upstream of the ligand binding domain. In certain embodiments, such antisense compounds target human androgen receptor upstream of the 3′ end of exon 3. In certain embodiments, an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within exon 2, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within intron 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
In certain embodiments, an antisense compound provided herein targets an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of exons 4-8 encoding the ligand binding domain. An example of such an AR splicing variant includes, but is not limited to, AR-V7, which contains exons 1-3 but lacks exons 4-8.
Certain embodiments are drawn to an antisense compound targeted to human androgen receptor (AR) upstream of the ligand binding domain that is capable of inhibiting growth or proliferation of the resistant prostate cancer cell to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No. 7,737,125. In certain embodiments, an antisense compound targeted to human androgen receptor (AR) upstream of the ligand binding domain is targeted to a region of AR upstream of the 3′ end of exon 3. In certain embodiments, an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within exon 2, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within intron 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
In certain embodiments, the nucleobase sequence of a modified oligonucleotide provided herein is at least 70%, 75%, 80%, 85%, 90%, 95% or 100% complementary to any one of SEQ ID NOs: 1-8, as measured over the entirety of the modified oligonucleotide.
In certain embodiments, an antisense compound is a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NOs: 1-8 as measured over the entirety of said modified oligonucleotide.
In certain embodiments, an antisense compound is a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence 100% complementary to any of SEQ ID NOs: 1-8 as measured over the entirety of said modified oligonucleotide. In certain embodiments, a compound or modified oligonucleotide provided herein is single-stranded.
In certain embodiments, a modified oligonucleotide provided herein consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
In certain embodiments, at least one internucleoside linkage of a modified oligonucleotide provided herein is a modified internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.
In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified sugar. In certain embodiments, at least one modified sugar comprises a 2′-O-methoxyethyl group (2′-O(CH2)2—OCH3). In certain embodiments, the modified sugar comprises a 2′-O—CH3 group.
In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a 4′-(CH2)n—O-2′ bridge, wherein n is 1 or 2. In certain embodiments, the bicyclic sugar comprises a 4′-CH2—O-2′ bridge. In certain embodiments, the bicyclic sugar comprises a 4-CH(CH3)—O-2′ bridge.
In certain embodiments, at least one nucleoside of a modified oligonucleotide provided herein comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.
In certain embodiments, a modified oligonucleotide provided herein consists of a single-stranded modified oligonucleotide.
In certain embodiments, compounds or compositions provided herein comprise a salt of the modified oligonucleotide.
Compositions and Methods for Formulating Pharmaceutical Compositions
Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
An antisense compound targeted to an androgen receptor nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to an androgen receptor nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the antisense compound is an antisense oligonucleotide provided herein.
Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent.
Certain Indications
Certain aspects of the invention are directed to methods of treating cancer which comprises administering an antisense compound targeted to androgen receptor as provided herein. In certain embodiments, the cancer is AR positive. In certain embodiments, the cancer is prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound is single-stranded. In certain embodiments, the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
Certain aspects are directed to an antisense compound targeted to androgen receptor provided herein for use in treating cancer. In certain embodiments, the cancer is AR positive. In certain embodiments, the cancer is prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound is single-stranded. In certain embodiments, the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
Certain aspects are directed to use of an antisense compound targeted to androgen receptor provided herein for the manufacture of a medicament for treating cancer. In certain embodiments, the cancer is AR positive. In certain embodiments, the cancer is prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound is single-stranded. In certain embodiments, the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
Certain aspects of the invention are directed to the use of an antisense compound targeted to human androgen receptor (AR) as described herein, for treating a cancer patient whose cancer has become resistant to treatment with an anti-androgenic agent (e.g. compound or drug). In certain embodiments, said cancer is prostate cancer. In certain embodiments, said patient is one that has, or whose cancer has, developed resistance to treatment with an agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound targets AR within exon 1, for example within nucleotide regions 2863-5593 (exon 1) or 27672-27853 (exon 1B) of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 4056-4071, 4059-4074, 4062-4077, 4066-4081, 4070-4085, 4101-4116, 4103-4118, 4105-4120, 4109-4124, 4305-4320, 4405-4420, 4532-4547, 4534-4549, 4537-4552, 4539-4554, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4597-4612, 4632-4647, 4655-4670, 4656-4671, 4662-4677, 4699-4714, 4747-4762, 4750-4765, 4752-4767, 4754-4769, 4755-4770, 4769-4784, 4798-4813, 4804-4819, 4807-4822, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4868-4883, 4872-4887, 4874-4889, 4876-4891, 4887-4902, 4889-4904, 4916-4931, 4918-4933, 4938-4953, 4942-4957, 4944-4959, 4951-4966, 5050-5065, 5052-5067, 5054-5069, 5056-5071, 5060-5075, 5061-5076, 5062-5077, 5133-5148, 5141-5156, 5155-5170, 5265-5280, 5293-5308, 5308-5323, 5392-5407, 5448-5463, 5469-5484, 5481-5496, 5483-5498, 5486-5501, 5488-5503, 5494-5509, or 5521-5536. In certain embodiments, an antisense compound provided herein targets AR within exon 2, for example within nucleotide regions 102087-102238 (exon 2) or 139551-139834 (exon 2c) of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 102155-102170, 102156-102171, 139682-139697, 139762-139777, or 139782-139797. In certain embodiments, an antisense compound provided herein targets AR within exon 3, for example within nucleotide regions 144841-144957 (exon 3), 148380-148594 (exon 3b), or 153504-154908 (exon 3d) of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 3 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 144856-144871, 144938-144953, 148406-148421, 148443-148458, or 148520-148535. In certain embodiments, an antisense compound provided herein targets AR within intron 1, for example within nucleotide regions 5594-27671 or 27854-102086 of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to intron 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58724-58739, 58725-58740, 58725-58740, 58725-58740, 58750-58769, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, or 67454-67469. In certain embodiments, an antisense compound provided herein targets AR within intron 2, for example within nucleotide regions 102239-139550 or 139835-144840 of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to intron 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 114874-114889, 115272-115287, 115365-115380, or 134971-134986. In certain embodiments, the antisense compound is single-stranded. In certain embodiments, the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
By resistant to treatment with a particular agent (e.g. compound or drug) is meant that the agent is less or no longer effective in halting the growth or spread of the cancer and so the patient, or their cancer, has become less responsive or sensitive to it over time. Typically such patient would be classed as resistant to said agent and would no longer be treated with such agent. A subject having prostate cancer resistant to an agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464 can include, for example, a patient who previously received said agent but whose prostate cancer has become less sensitive or responsive to a agent. For example, prostate cancer resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, can include prostate cancer that has increased in tumor volume, metastasis, or progression despite treatment with the agent. In certain embodiments, prostate cancer resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, can include prostate cancer that is refractory to the agent and is not decreasing in tumor volume, metastasis, or progression despite treatment. Several embodiments relate to a method of treating prostate cancer resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, in a subject comprising identifying the subject as having prostate cancer resistant to the agent and administering to the subject an antisense compound targeted to human androgen receptor (AR) upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain, as described herein. Several embodiments relate to a method of treating prostate cancer resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, in a subject comprising administering to a subject identified or diagnosed as having prostate cancer resistant to said anti-androgenic agent an antisense compound targeted to human androgen receptor (AR) upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain, as described herein. In certain embodiments, prostate cancer cells resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464, preferentially expresses an AR splicing variant over full-length AR.
Certain aspects of the invention are directed to a method of treating a patient suffering from prostate cancer wherein the patient has, or their cancer has, developed or become resistant to treatment with an anti-androgenic agent (compound or drug) comprising administering to said patient an antisense compound targeted to human androgen receptor (AR) as described herein. In certain embodiments, said patient is one that has developed resistance to treatment with an agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound is single-stranded. In certain embodiments, the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
A prostate cancer that has developed or become resistant to treatment with an anti-androgenic agent is referred to as castrate-resistant prostate cancer (CRPC). Thus, in several embodiments, a prostate cancer cell resistant to an anti-androgenic agent, such as MDV3100, was previously exposed to the inhibitor and has become less responsive or sensitive to it over time. For example, MDV3100 might initially inhibit prostate cancer cell growth or proliferation in the patient, but over time such inhibitory effect may be diminished when the cells become resistant to the inhibitor.
Certain aspects of the invention are directed to the use of an antisense compound targeted to androgen receptor provided herein for the manufacture of a medicament for treating cancer in a patient whose cancer has become become resistant to treatment with an anti-androgenic agent (compound or drug). In certain embodiments the cancer is prostate cancer. In certain embodiments, said patient is one that has, or whose cancer has, developed resistance to treatment with an agent selected from: MDV3100, ARN-059, ODM-201, abiraterone acetate, TOK001, TAK700 and VT464. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound is single-stranded. In certain embodiments, the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
Enzalutamide:
MDV3100, also known as enzalutamide (Xtandi™) and by the IUPAC name 4-(3-(4-cyano-3-(trifluoromethyl)phenyl)-5,5-dimethyl-4-oxo-2-thioxoimidazolidin-1-yl)-2-fluoro-N-methylbenzamide, is an androgen receptor ligand binding inhibitor belonging to the diarylhydantoin class of androgen receptor inhibitors represented by Formula XI. MDV3100 has the following chemical formula:
Figure USRE048461-20210309-C00001
MDV3100 and additional diarylhydantoin androgen receptor inhibitors suitable for use in certain embodiments provided herein are described in U.S. Pat. No. 7,709,517, US Patent Application Publication No. US20100172975 and US Patent Application Publication No. US20100210665, which are incorporated herein by reference in their entireties.
ARN-509:
Figure USRE048461-20210309-C00002
The compound of Formula XII, also known as ARN-509 and by the IUPAC name 4-(7-(6-Cyano-5-(trifluoromethyl)pyridin-3-yl)-6,8-dioxo-5,7-diazaspiro[3.4]octan-5-yl)-2-fluoro-N-methylbenzamide, is an androgen receptor ligand binding inhibitor. ARN-509 and additional androgen receptor inhibitors suitable for use in certain embodiments provided herein are described in WO 2007126765, WO 2008119015 and US Patent Application Publication No. 2013/0116258, which are incorporated herein by reference in their entirety.
Abiraterone Acetate
The compound of Formula XIII, which is also known as Abiraterone acetate and ZYTIG-A® and by the IUPAC name [(3S,8R,9S,10R,13S,14S)-10,13-dimethyl-17-(3-pyridyl)-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl]acetate, is an androgen biosynthesis inhibitor and has the following chemical formula:
Figure USRE048461-20210309-C00003
The structure and synthesis of Abiraterone acetate is described in Potter et al., Journal of Medicinal Chemistry (38(13), 2463-71, 1995), which is incorporated herein by reference in its entirety.
Galeterone:
The compound of Formula XIV, which is also known as TOK-001 and Galeterone, and by the IUPAC name (3S,10R,13S)-17-(1H-benzo[d]imidazol-1-yl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol, has the following chemical formula:
Figure USRE048461-20210309-C00004
The structure and synthesis of TOK-001 is described in Handratta et al., (Journal of Medicinal Chemistry (2005), 48(8), 2972-84, 2005), which is incorporated herein by reference in its entirety:
Orteronel:
The compound of Formula XV, which is also known as TAK-700 and Orteronel and by the IUPAC name 6-[7(S)-hydroxy-6,7-dihydro-5H-pyrrolo[1,2-c]imidazol-7-yl]-N-methylnaphthalene-2-carboxamide, is an androgen biosynthesis inhibitor and has the following chemical formula:
Figure USRE048461-20210309-C00005
The structure and synthesis of TAK-700 is described in Kaku et al., Bioorganic and Medicinal Chemistry (19(21), 6383-99, 2011).
Yin et al., (Int. J. Mol. Sci., 14(7):13958-13978, 2013) discusses recent progress with various pharmaceutical therapies, including ODM-21, VT464, ARN509, TAK700 and TOK-001, for castration-resistant prostate cancer.
Certain Combinations and Combination Therapies
In certain embodiments, a first agent comprising the compound described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect. In certain embodiments, the co-administration of the first and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy.
In certain embodiments, one or more compounds or compositions provided herein are co-administered with one or more anti-androgenic agents. In certain embodiments, one or more compounds or compositions provided herein and one or more anti-androgenic agents, are administered at different times. In certain embodiments, one or more compounds or compositions provided herein and one or more anti-androgenic agents, are prepared together in a single formulation. In certain embodiments, one or more compounds or compositions provided herein and one or more anti-androgenic agents, are prepared separately. In certain embodiments, an anti-androgenic agent is selected from MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
Certain aspects of the invention are directed to the use of an antisense compound targeted to human androgen receptor (AR) as described herein in combination with an anti-androgenic agent. In particular embodiments such use is in a method of treating a patient suffering from cancer or in the manufacture of a medicament for treating cancer. In certain embodiments the cancer is selected from: prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer. Particular classes of anti-androgenic agents are the second generation anti-hormonal agents such as: enzalutamide (MDV3100), ARN-059, ODM-201, abiraterone acetate, Galeterone (TOK001), orteronel (TAK700) and VT464 (see Yin et al. supra).
Certain aspects are drawn to a combination of an antisense compound targeted to human androgen receptor (AR) as described herein and an anti-androgenic agent, such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
In certain embodiments, such a combination of an antisense compound targeted to androgen receptor (AR) as described herein and an anti-androgenic agent, such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, is useful for inhibiting cancer cell growth or proliferation and/or treating cancer. In certain embodiments the cancer is selected from: prostate cancer, breast cancer, ovarian cancer, bladder cancer or gastric cancer. In certain embodiments the cancer is prostate cancer. In certain embodiments the cancer is breast cancer. In certain embodiments, an antisense compound targeted to AR as described herein and an anti-androgenic agent, such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, synergize in combination to inhibit growth or proliferation of a cancer cell. In several embodiments, the cancer cell is a prostate cancer cell which is or has become castration-resistant. In various embodiments, the cancer cell is a prostate cancer cell which is or has become resistant to a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, the antisense compound targeted to androgen receptor comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
Several embodiments are drawn to a combination of an antisense compound targeted to human androgen receptor (AR) and a diarylhydantoin AR inhibitor of Formula XI, such as MDV3100. In several embodiments, a diarylhydantoin Androgen Receptor (AR) inhibitor is a compound of Formula XVI:
Figure USRE048461-20210309-C00006
wherein X is selected from the group consisting of trifluoromethyl and iodo, wherein W is selected from the group consisting of O and NR5, wherein R5 is selected from the group consisting of H, methyl, and
Figure USRE048461-20210309-C00007

wherein D is S or O and E is N or O and G is alkyl, aryl, substituted alkyl or substituted aryl; or D is S or a and E-G together are C1-C4 lower alkyl,
wherein R1 and R2 together comprise eight or fewer carbon atoms and are selected from the group consisting of alkyl, substituted alkyl including haloalkyl, and, together with the carbon to which they are linked, a cycloalkyl or substituted cycloalkyl group,
wherein R3 is selected from the group consisting of hydrogen, halogen, methyl, C1-C4 alkoxy, formyl, haloacetoxy, trifluoromethyl, cyano, nitro, hydroxyl, phenyl, amino, methylcarbamoyl, methoxycarbonyl, acetamido, methanesulfonamino, methanesulfonyl, 4-methanesulfonyl-1-piperazinyl, piperazinyl, and C1-C6 alkyl or alkenyl optionally substituted with hydroxyl, methoxycarbonyl, cyano, amino, amido, nitro, carbamoyl, or substituted carbamoyl including methylcarbamoyl, dimethylcarbamoyl, and hydroxyethylcarbamoyl,
wherein R4 is selected from the group consisting of hydrogen, halogen, alkyl, and haloalkyl, and
wherein R3 is not methylaminomethyl or dimethylaminomethyl.
R5 may be
Figure USRE048461-20210309-C00008
In certain embodiments, such a combination of an antisense compound targeted to androgen receptor (AR) and a diarylhydantoin AR inhibitor of Formula XVI, such as MDV3100, is useful for inhibiting prostate cancer cell growth or proliferation and/or treating prostate cancer. In certain embodiments, an antisense compound targeted to AR and a diarylhydantoin AR inhibitor of Formula XVI, such as MDV3100, synergize in combination to inhibit growth or proliferation of a prostate cancer cell. In several embodiments, the prostate cancer cell is castration-resistant. In various embodiments, the prostate cancer cell is resistant to a diarylhydantoin AR inhibitor of Formula XVI, such as MDV3100. In certain embodiments, the prostate cancer cell or castration-resistant prostate cancer cell preferentially expresses an AR splicing variant over full-length AR. In certain embodiments the antisense compound targeted to AR as described herein and the other anti-androgenic agent are used in combination treatment by administering the two agents simultaneously, separately or sequentially. In certain embodiments the two agents are formulated as a fixed dose combination product. In other embodiments the two agents are provided to the patient as separate units which can then either be taken simultaneously or serially (sequentially).
In certain embodiments, antisense compounds useful for inhibiting prostate cancer cell and/or castration-resistant prostate cancer cell growth or proliferation in combination with another anti-androgenic agent, such as a second generation anti-hormonal agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, target human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within exon 1, exon 2, exon 3, intron 1, or intron 2 as described herein.
In certain embodiments, an antisense compound provided herein targets an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of exons 4-8 encoding the ligand binding domain. An example of such an AR splicing variant includes, but is not limited to, AR-V7, which contains exons 1-3 but lacks exons 4-8. Additional examples of such AR splicing variants include, for example, AR3, AR4, AR4b, AR5, and AR6 (SEQ ID NOs: 4-8, respectively). In certain embodiments, the prostate cancer cell, which may be castration-resistant, preferentially expresses an AR splicing variant over full-length AR. In particular embodiments the prostate cancer cell is castration-resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464 In certain embodiments, an antisense compound targeted to AR upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain is capable of inhibiting growth or proliferation of a prostate cancer cell, including a castration-resistant prostate cancer cell, in combination with an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No. 7,737,125, in combination with the same anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464. In certain embodiments, the combination of an antisense compound as described herein and the anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, provides a synergistic (e.g. greater-than-additive) effect in inhibiting the growth or proliferation of a prostate cancer cell, such as a castration-resistant prostate cancer cell, compared to the antisense compound alone or the anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464 alone. Accordingly, in certain embodiments the amounts of either or both of the antisense compound and/or anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, when used in combination can be less than the corresponding amount of either the antisense compound alone or the anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, alone necessary to achieve an equivalent level of prostate cancer cell growth or proliferation inhibition.
In certain embodiments, an antisense compound provided herein useful for inhibiting prostate cancer cell and/or castration-resistant prostate cancer cell growth or proliferation in combination with an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, targets an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain. It will be understood that in certain embodiments an antisense compound can target an AR splicing variant that includes the entire or at least a functional portion of exon 1 encoding the N-terminal domain and the entire or at least a functional portion of exons 2 and 3 encoding the DNA binding domain, but does not include at least a functional portion of exon 4 encoding the short hinge region or at least a functional portion of exons 4-8 encoding the ligand binding domain. It is contemplated that certain AR splicing variants targeted by the antisense compounds provided herein substantially consisting of exons 1-3 may also include a non-functional portion of nucleic acid sequence from a genomic region or exons 4-8. It is contemplated that the splicing process may give rise to such AR splicing variants that retain DNA binding function but not ligand binding function. In certain embodiments, the prostate cancer cell, which may be castrate-resistant, preferentially expresses an AR splicing variant over full-length AR. In certain embodiments the prostate cancer cell is castrate-resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464. In certain embodiments, an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within exon 1, exon 2, exon 3, intron 1, or intron 2 as described herein.
In certain embodiments, an antisense compound targeted to an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain, is capable of inhibiting growth or proliferation of a prostate cancer cell, including a castration-resistant prostate cancer cell, in combination with a an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176, which is targeted to exon 4 and corresponds to SEQ ID NO: 58 described in U.S. Pat. No. 7,737,125, in combination with a the same anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464. In certain embodiments, the combination of an antisense compound and anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, provides a synergistic (e.g. greater-than-additive) effect in inhibiting the growth or proliferation of a prostate cancer cell, such as a castration-resistant prostate cancer cell, compared to the antisense compound alone or the anti-androgenic agent alone. Accordingly, in certain embodiments the amounts of either or both of the antisense compound and/or anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, when used in combination can be less than the corresponding amount of either the antisense compound alone or anti-androgenic agent, alone necessary to achieve an equivalent level of prostate cancer cell growth or proliferation inhibition.
In certain embodiments, an antisense compound provided herein useful for inhibiting prostate cancer cell and/or castration-resistant prostate cancer cell growth or proliferation in combination with a anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464 is capable of reducing expression of both full-length AR and an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of any one of exons 4-8 encoding the ligand binding domain. In certain embodiments, such an antisense compound targets human androgen receptor upstream of the ligand binding domain. In certain embodiments, such antisense compounds target human androgen receptor upstream of the 3′ end of exon 3. In certain embodiments, an antisense compound provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain.
In certain embodiments, there is provided a combination of an antisense compound targeted to human androgen receptor (AR) as described herein and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, wherein the antisense compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOs: 12-179. In certain embodiments, there is provided a combination of an antisense compound targeted to human androgen receptor (AR) and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, wherein the antisense compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 12-179. In certain embodiments, there is provided a combination of an antisense compound targeted to human androgen receptor (AR) and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, wherein the antisense compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any of SEQ ID NOs: 12-179. In certain embodiments, there is provided a combination of an antisense compound targeted to human androgen receptor (AR) and a diarylhydantoin AR inhibitor of Formula XI, such as MDV3100, wherein the antisense compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175. In certain embodiments, there is provided a combination of an antisense compound targeted to human androgen receptor (AR) and a diarylhydantoin AR inhibitor of Formula XI, such as MDV3100, wherein the antisense compound targeted to androgen receptor is ISIS 560131, ISIS 569213, ISIS 569216, ISIS 569221, ISIS 569236, ISIS 579671, ISIS 586124, ISIS 583918, ISIS 584149, ISIS 584163, ISIS 584269, or ISIS 584468.
Several embodiments are drawn to a method of inhibiting prostate cancer cell growth or proliferation comprising contacting the prostate cancer cell with an antisense compound targeted to human androgen receptor (AR) and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464. In certain embodiments, the antisense compound and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, synergize in combination to inhibit the growth or proliferation of the prostate cancer cell. In several embodiments, the prostate cancer cell is castration-resistant. In various embodiments, the prostate cancer cell is castration-resistant by being resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464. In certain embodiments, the prostate cancer cell or castration-resistant prostate cancer cell preferentially expresses an AR splicing variant over full-length AR.
In certain aspects of any of the foregoing embodiments, antisense compounds useful for inhibiting prostate cancer cell growth or proliferation in combination with a diarylhydantoin AR inhibitor of Formula XVI, such as MDV3100, can target (i) human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain or (ii) an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain; and/or is capable of (i) reducing expression of both full-length AR and an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of any one of exons 4-8 encoding the ligand binding domain; with the proviso that the antisense compounds do not have a nucleobase sequence consisting of any of SEQ ID NOs: 194-215 identified in Table A below.
TABLE A
SEQ ID NO: Sequence
194 GAGAACCATCCTCACC
195 GGACCAGGTAGCCTGT
196 CCCCTGGACTCAGATG
197 GCACAAGGAGTGGGAC
198 GCTGTGAAGAGAGTGT
199 TTTGACACAAGTGGGA
200 GTGACACCCAGAAGCT
201 CATCCCTGCTTCATAA
202 TGGGGAGAACCATCCTCACCCTGC
203 TCCAGGACCAGGTAGCCTGTGGGG
204 TGTTCCCCTGGACTCAGATGCTCC
205 TGGGGCACAAGGAGTGGGACGCAC
206 TTCGGCTGTGAAGAGAGTGTGCCA
207 CGCTTTTGACACAAGTGGGACTGG
208 CATAGTGACACCCAGAAGCTTCAT
209 GAGTCATCCCTGCTTCATAACATT
210 CTGTGAAGAGAGTG
211 TGTGAAGAGAGT
212 TTGACACAAGTGGG
213 TGACACAAGTGG
214 TGACACCCAGAAGC
215 GACACCCAGAAG
In certain aspects of any of the foregoing embodiments, antisense compounds useful for inhibiting growth or proliferation of a prostate cancer cell resistant to anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, can target (i) human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain or (ii) an AR splicing variant that has a functional DNA binding domain, but not a functional ligand binding domain; and/or is capable of (i) reducing expression of both full-length AR and an AR splicing variant that includes exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of any one of exons 4-8 encoding the ligand binding domain; or (ii) inhibiting growth or proliferation of the resistant prostate cancer cell to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176; with the proviso that the antisense compounds do not have a nucleobase sequence consisting of any of SEQ ID NOs: 194-215 described in U.S. Pat. No. 7,737,125 as SEQ ID NOs: 2-9, 49-50, 52-53, 55-56, and 86-93 (herein incorporated by reference), and identified in Table A.
Certain aspects are directed to methods of treating breast cancer and methods of inhibiting breast cancer cell growth or proliferation with an antisense oligonucleotide targeted to human androgen receptor (AR) as described herein. In certain embodiments, the breast cancer has one or more of the following characteristics: Androgen Receptor positive, dependent on androgen for growth, Estrogen Receptor (ER) negative, independent of estrogen for growth, Progesterone Receptor (PR) negative, independent of progesterone for growth, or Her2/neu negative. In certain embodiments, the breast cancer or breast cancer cell is apocrine.
Certain embodiments are drawn to a method of treating breast cancer in a subject comprising administering to the subject an antisense compound targeted to human androgen receptor (AR). Certain embodiments are drawn to a method of treating breast cancer in a subject comprising identifying a subject having breast cancer and administering to the subject an antisense compound targeted to human androgen receptor (AR), thereby treating the subject's breast cancer. Certain embodiments are directed to a method of inhibiting growth or proliferation of a breast cancer cell comprising contacting the breast cancer cell with an antisense compound targeted to human androgen receptor (AR). Certain embodiments relate to a method of inhibiting AR expression in a subject having or at risk of having breast cancer comprising identifying a subject breast cancer, and administering to the subject an antisense compound targeted to human AR, wherein the antisense compound inhibits AR expression in the subject.
In certain embodiments, the breast cancer or breast cancer cell has one or more of the following characteristics: Androgen Receptor positive, dependent on androgen for growth, Estrogen Receptor (ER) negative, independent of estrogen for growth, Progesterone Receptor (PR) negative, independent of progesterone for growth, or Her2/neu negative. In certain embodiments, the breast cancer or breast cancer cell is ER, PR, and HER2 triple negative and AR positive (ER−, PR−, HER2−, AR+). In certain embodiments, the breast cancer or breast cancer cell is ER negative and AR positive (ER−, AR+). In certain embodiments, the breast cancer or breast cancer cell is ER positive and AR positive (ER+, AR+).
In certain embodiments, the breast cancer or breast cancer cell is apocrine. Apocrine breast cancers are often “triple negative”, meaning that the cells do not express ER, PR, or HER2 receptors, and usually, but not necessarily, AR positive. In certain embodiments, an apocrine breast cancer or breast cancer cell is ER, PR, and HER2 triple negative and AR positive (ER−, PR−, HER2−, AR+). In certain embodiments, an apocrine breast cancer or breast cancer cell is ER negative and AR positive (ER−, AR+). In certain embodiments, an apocrine breast cancer or breast cancer cell originates from the sweat gland of the breast. In certain embodiments, an apocrine breast cancer or breast cancer cell is a ductal cancer or cancer cell of the breast. In certain embodiments, an apocrine breast cancer can have any one or more of the following features: a large amount of eosinophilic granular cytoplasm, well-defined margins, large vesicular nuclei, a nuclear to cytoplasmic ratio of about 1:2, and/or accumulations of secreted granules in the apical cytoplasm known as apical snouts.
In certain embodiments, the breast cancer or breast cancer cell is an ER negative and AR positive (ER−, AR+) molecular apocrine breast cancer or breast cancer cell. In certain aspects, an ER negative and AR positive (ER−, AR+) molecular apocrine breast cancer or breast cancer cell can further be PR positive, PR negative, HER2 negative, or HER2 positive.
Breast cancer can be identified as positive or negative with respect to hormone receptors, such as ER, PR, or HER2 by standard histological techniques. For example, histological breast cancer samples can be classified as “triple negative” (ER−, PR−, HER2−) when less than 1% of cells demonstrate nuclear staining for estrogen and progesterone receptors, and immunohistochemical staining for HER2 shows a 0, 1-fold, or a 2-fold positive score and a FISH ratio (HER2 gene signals to chromosome 17 signals) of less than 1.8 according to the relevant ASCO and CAP guidelines. (Meyer, P. et al., PLoS ONE 7(5): e38361 (2012)).
In certain embodiments, an antisense compound useful for treating breast cancer or inhibiting growth or proliferation of a breast cancer cell target provided herein targets AR within exon 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within exon 1, for example within nucleotide regions 2863-5593 (exon 1) or 27672-27853 (exon 1B) of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 3353-3368, 3361-3376, 3519-3534, 3735-3750, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3888-3903, 4047-4062, 4062-4077, 4109-4124, 4534-4549, 4537-4552, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4655-4670, 4750-4765, 4752-4767, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4872-4887, 4874-4889, 4876-4891, 4916-4931, 4918-4933, 5052-5067, 5054-5069, 5060-5075, 5061-5076, 5061-5076, 5062-5077, 5155-5170, 5265-5280, 5293-5308, 5392-5407, 5448-5463, 5483-5498, 5486-5501, or 5494-5509.
In certain embodiments, an antisense compound provided herein targets AR within exon 2, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound useful for treating breast cancer or inhibiting growth or proliferation of a breast cancer cell target provided herein targets AR within exon 2, for example within nucleotide regions 102087-102238 (exon 2) or 139551-139834 (exon 2c) of SEQ ID NO: 1. In certain embodiments, an antisense compound provided herein targeted to exon 2 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 102155-102170 or 102156-107171.
In certain aspects, an antisense compound useful for treating breast cancer or inhibiting growth or proliferation of a breast cancer cell provided herein targets AR within intron 1, which is upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, an antisense compound provided herein targets AR within intron 1, for example within nucleotide regions 5594-27671 or 27854-102086 of SEQ ID NO: 1. In certain aspects, an antisense compound provided herein targeted to intron 1 of AR is complementary within any of the following nucleotide regions of SEQ ID NO: 1: 5666-5681, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58735, 58721-58736, 58722-58737, 58723-58738, 58725-58740, 58750-58765, 58751-58766, 58752-58767, 58753-58768, 58754-58769, or 58755-58770.
In certain aspects of any of the foregoing embodiments, antisense compounds useful for treating breast cancer or inhibiting growth or proliferation of a breast cancer cell target human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain. In certain embodiments, antisense compounds provided herein, including but not limited to those that target human androgen receptor upstream of the 3′ end of exon 3 and/or upstream of the ligand binding domain, can treat breast cancer or inhibiting growth or proliferation of a breast cancer cell to a greater extent than an antisense compound targeted to the ligand binding domain, such as EZN-4176; with the proviso that the antisense compounds do not have a nucleobase sequence consisting of any of SEQ ID NOs: 194-215 described in U.S. Pat. No. 7,737,125 as SEQ ID NOs: 2-9, 49-50, 52-53, 55-56, and 86-93 (herein incorporated by reference), and identified in Table A.
Antisense Compounds
Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be “antisense” to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
In certain embodiments, an antisense compound is 10-30 subunits in length. In certain embodiments, an antisense compound is 12 to 30 subunits in length. In certain embodiments, an antisense compound is 12 to 22 subunits in length. In certain embodiments, an antisense compound is 14 to 30 subunits in length. In certain embodiments, an antisense compound is 14 to 20 subunits in length. In certain embodiments, an antisense compound is 15 to 30 subunits in length. In certain embodiments, an antisense compound is 15 to 20 subunits in length. In certain embodiments, an antisense compound is 16 to 30 subunits in length. In certain embodiments, an antisense compound is 16 to 20 subunits in length. In certain embodiments, an antisense compound is 17 to 30 subunits in length. In certain embodiments, an antisense compound is 17 to 20 subunits in length. In certain embodiments, an antisense compound is 18 to 30 subunits in length. In certain embodiments, an antisense compound is 18 to 21 subunits in length. In certain embodiments, an antisense compound is 18 to 20 subunits in length. In certain embodiments, an antisense compound is 20 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively. In certain embodiments, an antisense compound is 14 subunits in length. In certain embodiments, an antisense compound is 16 subunits in length. In certain embodiments, an antisense compound is 17 subunits in length. In certain embodiments, an antisense compound is 18 subunits in length. In certain embodiments, an antisense compound is 20 subunits in length. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleotides.
In certain embodiments antisense oligonucleotides may be shortened or truncated. For example, a single subunit may be deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated antisense compound targeted to an Androgen Receptor nucleic acid may have two subunits deleted from the 5′ end, or alternatively may have two subunits deleted from the 3′ end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5′ end and one nucleoside deleted from the 3′ end.
When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5′ or 3′ end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5′ end and one subunit added to the 3′ end.
It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.
Certain Antisense Compound Motifs and Mechanisms
In certain embodiments, antisense compounds have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect. In certain embodiments, the amount and/or activity of the target nucleic acid is modulated. In certain embodiments, the amount and/or activity of the target nucleic acid is reduced. In certain embodiments, hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation. In certain embodiments, hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation. In certain such embodiments, the presence of the antisense compound hybridized with the target nucleic acid (occupancy) results in a modulation of antisense activity. In certain embodiments, antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms. In certain embodiments, antisense compounds function through more than one mechanism and/or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by particular mechanism.
Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy based mechanisms. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.
RNase H-Mediated Antisense
In certain embodiments, antisense activity results at least in part from degradation of target RNA by RNase H. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are “DNA-like” elicit RNase H activity in mammalian cells. Accordingly, antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting in cleavage of the target nucleic acid. In certain embodiments, antisense compounds that utilize RNase H comprise one or more modified nucleosides. In certain embodiments, such antisense compounds comprise at least one block of 1-8 modified nucleosides. In certain such embodiments, the modified nucleosides do not support RNase H activity. In certain embodiments, such antisense compounds are gapmers, as described herein. In certain such embodiments, the gap of the gapmer comprises DNA nucleosides. In certain such embodiments, the gap of the gapmer comprises DNA-like nucleosides. In certain such embodiments, the gap of the gapmer comprises DNA nucleosides and DNA-like nucleosides.
Certain antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides may include 2′-MOE and 2′-O—CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl). In certain embodiments, nucleosides in the wings may include several modified sugar moieties, including, for example 2′-MOE and bicyclic sugar moieties such as constrained ethyl or LNA. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2′-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2′-deoxynucleosides.
Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties. The wing-gap-wing motif is frequently described as “X-Y-Z”, where “X” represents the length of the 5′-wing, “Y” represents the length of the gap, and “Z” represents the length of the 3′-wing. “X” and “Z” may comprise uniform, variant, or alternating sugar moieties. In certain embodiments, “X” and “Y” may include one or more 2′-deoxynucleosides. “Y” may comprise 2′-deoxynucleosides. As used herein, a gapmer described as “X-Y-Z” has a configuration such that the gap is positioned immediately adjacent to each of the 5′-wing and the 3′ wing. Thus, no intervening nucleotides exist between the 5′-wing and gap, or the gap and the 3′-wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, “X” and “Z” are the same; in other embodiments they are different. In certain embodiments, “Y” is between 8 and 15 nucleosides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.
In certain embodiments, the antisense compound targeted to an Androgen Receptor nucleic acid has a gapmer motif in which the gap consists of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 linked nucleosides.
In certain embodiments, the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J)m-(B)n-(J)p-(B)r-(A)t-(D)g-(A)v-(B)w-(J)x-(B)y-(J)z
wherein:
each A is independently a 2′-substituted nucleoside;
each B is independently a bicyclic nucleoside;
each J is independently either a 2′-substituted nucleoside or a 2′-deoxynucleoside; each D is a 2′-deoxynucleoside;
m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14; provided that:
at least one of m, n, and r is other than 0;
at least one of w and y is other than 0;
the sum of m, n, p, r, and t is from 2 to 5; and
the sum of v, w, x, y, and z is from 2 to 5.
RNAi Compounds
In certain embodiments, antisense compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). In certain embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.
i. ssRNA Compounds
In certain embodiments, antisense compounds including those particularly suited for use as single-stranded RNAi compounds (ssRNA) comprise a modified 5′-terminal end. In certain such embodiments, the 5′-terminal end comprises a modified phosphate moiety. In certain embodiments, such modified phosphate is stabilized (e.g., resistant to degradation/cleavage compared to unmodified 5′-phosphate). In certain embodiments, such 5′-terminal nucleosides stabilize the 5′-phosphorous moiety. Certain modified 5′-terminal nucleosides may be found in the art, for example in WO/2011/139702.
In certain embodiments, the 5′-nucleoside of an ssRNA compound has Formula IIc:
Figure USRE048461-20210309-C00009

wherein:
T1 is an optionally protected phosphorus moiety;
T2 is an internucleoside linking group linking the compound of Formula IIc to the oligomeric compound;
A has one of the formulas:
Figure USRE048461-20210309-C00010
Q1 and Q2 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or N(R3)(R4);
Q3 is O, S, N(R5) or C(R6)(R7);
each R3, R4 R5, R6 and R7 is, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl or C1-C6 alkoxy;
M3 is O, S, NR14, C(R15)(R16), C(R15)(R16)C(R17)(R18), C(R15)═C(R17), OC(R15)(R16) or OC(R15)(Bx2);
R14 is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
R15, R16, R17 and R18 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
Bx1 is a heterocyclic base moiety;
or if Bx2 is present then Bx2 is a heterocyclic base moiety and Bx1 is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
J4, J5, J6 and J7 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
or J4 forms a bridge with one of J5 or J7 wherein said bridge comprises from 1 to 3 linked biradical groups selected from O, S, NR19, C(R20)(R21), C(R20)═C(R21), C[═C(R20)(R21)] and C(═O) and the other two of J5, J6 and J7 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
each R19, R20 and R21 is, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
G is H, OH, halogen or O—[C(R8)(R6)]n—[(C═O)m—X1]j—Z;
each R8 and R9 is, independently, H, halogen, C1-C6 alkyl or substituted C1-C6 alkyl;
X1 is O, S or N(E1);
Z is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or N(E2)(E3);
E1, E2 and E3 are each, independently, H, C1-C6 alkyl or substituted C1-C6 alkyl;
n is from 1 to about 6;
m is 0 or 1;
j is 0 or 1;
each substituted group comprises one or more optionally protected substituent groups independently selected from halogen, OJ1, N(J1)(J2), ═NJ1, SJ1, N3, CN, OC(═X2)J1, OC(═X2)N(J1)(J2) and C(═X2)N(J1)(J2);
X2 is O, S or NJ3;
each J1, J2 and J3 is, independently, H or C1-C6 alkyl;
    • when j is 1 then Z is other than halogen or N(E2)(E3); and
wherein said oligomeric compound comprises from 8 to 40 monomeric subunits and is hybridizable to at least a portion of a target nucleic acid.
In certain embodiments, M3 is O, CH═CH, OCH2 or OC(H)(Bx2). In certain embodiments, M3 is O.
In certain embodiments, J4, J5, J6 and J7 are each H. In certain embodiments, J4 forms a bridge with one of J5 or J7.
In certain embodiments, A has one of the formulas:
Figure USRE048461-20210309-C00011

wherein:
Q1 and Q2 are each, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy or substituted C1-C6 alkoxy. In certain embodiments, Q1 and Q2 are each H. In certain embodiments, Q1 and Q2 are each, independently, H or halogen. In certain embodiments, Q1 and Q2 is H and the other of Q1 and Q2 is F, CH3 or OCH3.
In certain embodiments, T1 has the formula:
Figure USRE048461-20210309-C00012

wherein:
Ra and Rc are each, independently, protected hydroxyl, protected thiol, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, protected amino or substituted amino; and
Rb is O or S. In certain embodiments, Rb is O and Ra and Rc are each, independently, OCH3, OCH2CH3 or CH(CH3)2.
In certain embodiments, G is halogen, OCH3, OCH2F, OCHF2, OCF3, OCH2CH3, O(CH2)2F, OCH2CHF2, OCH2CF3, OCH2—CH═CH2, O(CH2)2—OCH3, O(CH2)2—SCH3, O(CH2)2—OCF3, O(CH2)3—N(R10)(R11), O(CH2)2—ON(R10)(R11), O(CH2)2—O(CH2)2—N(R10)(R11), OCH2C(═O)—N(R10)(R11), OCH2C(═O)—N(R12)—(CH2)2—N(R10)(R11) or O(CH2)2—N(R12)—C(═NR13)[N(R10)(R11)] wherein R10, R11, R12 and R13 are each, independently, H or C1-C6 alkyl. In certain embodiments, G is halogen, OCH3, OCF3, OCH2CH3, OCH2CF3, OCH2—CH═CH2, O(CH2)2—OCH3, O(CH2)2—O(CH2)2—N(CH3)2, OCH2C(═O)—N(H)CH3, OCH2C(═O)—N(H)—(CH2)2—N(CH3)2 or OCH2—N(H)—C(═NH)NH2. In certain embodiments, G is F, OCH3 or O(CH2)2—OCH3. In certain embodiments, G is O(CH2)2—OCH3.
In certain embodiments, the 5′-terminal nucleoside has Formula IIe:
Figure USRE048461-20210309-C00013
In certain embodiments, antisense compounds, including those particularly suitable for ssRNA comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
In certain embodiments, the oligonucleotides comprise or consist of a region having uniform sugar modifications. In certain such embodiments, each nucleoside of the region comprises the same RNA-like sugar modification. In certain embodiments, each nucleoside of the region is a 2′-F nucleoside. In certain embodiments, each nucleoside of the region is a 2′-OMe nucleoside. In certain embodiments, each nucleoside of the region is a 2′-MOE nucleoside. In certain embodiments, each nucleoside of the region is a cEt nucleoside. In certain embodiments, each nucleoside of the region is an LNA nucleoside. In certain embodiments, the uniform region constitutes all or essentially all of the oligonucleotide. In certain embodiments, the region constitutes the entire oligonucleotide except for 1-4 terminal nucleosides.
In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2′-OMe, 2′-F, 2′-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2′-F and 2′-OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.
In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB)xAy wheren A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certain embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:
AABBAA;
ABBABB;
AABAAB;
ABBABAABB;
ABABAA;
AABABAB;
ABABAA;
ABBAABBABABAA;
BABBAABBABABAA;
or
ABABBAABBABABAA;
wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2′-F, 2′-OMe, BNA, and MOE.
In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified 5′ terminal nucleoside, such as those of formula IIc or IIe.
In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif Such regions comprises the following motif:
-(A)2-(B)x-(A)2-(C)y-(A)3-
wherein: A is a first type of modifed nucleosde;
B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another;
x and y are from 1 to 15.
In certain embodiments, A is a 2′-OMe modified nucleoside. In certain embodiments, B and C are both 2′-F modified nucleosides. In certain embodiments, A is a 2′-OMe modified nucleoside and B and C are both 2′-F modified nucleosides.
In certain embodiments, oligonucleosides have the following sugar motif:
5′-(Q)-(AB)xAy-(D)z
wherein:
Q is a nucleoside comprising a stabilized phosphate moiety. In certain embodiments, Q is a nucleoside having Formula IIc or IIe;
A is a first type of modifed nucleoside;
B is a second type of modified nucleoside;
D is a modified nucleoside comprising a modification different from the nucleoside adjacent to it. Thus, if y is 0, then D must be differently modified than B and if y is 1, then D must be differently modified than A. In certain embodiments, D differs from both A and B.
X is 5-15;
    • Y is 0 or 1;
Z is 0-4.
In certain embodiments, oligonucleosides have the following sugar motif:
5′-(Q)-(A)x-(D)z
wherein:
Q is a nucleoside comprising a stabilized phosphate moiety. In certain embodiments, Q is a nucleoside having Formula IIc or IIe;
A is a first type of modifed nucleoside;
D is a modified nucleoside comprising a modification different from A.
X is 11-30;
Z is 0-4.
In certain embodiments A, B, C, and D in the above motifs are selected from: 2′-OMe, 2′-F, 2′-MOE, LNA, and cEt. In certain embodiments, D represents terminal nucleosides. In certain embodiments, such terminal nucleosides are not designed to hybridize to the target nucleic acid (though one or more might hybridize by chance). In certain embodiments, the nucleobase of each D nucleoside is adenine, regardless of the identity of the nucleobase at the corresponding position of the target nucleic acid. In certain embodiments the nucleobase of each D nucleoside is thymine.
In certain embodiments, antisense compounds, including those particularly suited for use as ssRNA comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphoro-thioate internucleoside linkages. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 12 consecutive phosphoro-thioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.
Oligonucleotides having any of the various sugar motifs described herein, may have any linkage motif. For example, the oligonucleotides, including but not limited to those described above, may have a linkage motif selected from non-limiting the table below:
5’ most linkage Central region 3’-region
PS Alternating PO/PS 6 PS
PS Alternating PO/PS 7 PS
PS Alternating PO/PS 8 PS
ii. siRNA Compounds
In certain embodiments, antisense compounds are double-stranded RNAi compounds (siRNA). In such embodiments, one or both strands may comprise any modification motif described above for ssRNA. In certain embodiments, ssRNA compounds may be unmodified RNA. In certain embodiments, siRNA compounds may comprise unmodified RNA nucleosides, but modified internucleoside linkages.
Several embodiments relate to double-stranded compositions wherein each strand comprises a motif defined by the location of one or more modified or unmodified nucleosides. In certain embodiments, compositions are provided comprising a first and a second oligomeric compound that are fully or at least partially hybridized to form a duplex region and further comprising a region that is complementary to and hybridizes to a nucleic acid target. It is suitable that such a composition comprise a first oligomeric compound that is an antisense strand having full or partial complementarity to a nucleic acid target and a second oligomeric compound that is a sense strand having one or more regions of complementarity to and forming at least one duplex region with the first oligomeric compound.
The compositions of several embodiments modulate gene expression by hybridizing to a nucleic acid target resulting in loss of its normal function. In some embodiments, the target nucleic acid is Androgen Receptor. In certain embodiment, the degradation of the targeted Androgen Receptor is facilitated by an activated RISC complex that is formed with compositions of the invention.
Several embodiments are directed to double-stranded compositions wherein one of the strands is useful in, for example, influencing the preferential loading of the opposite strand into the RISC (or cleavage) complex. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. In some embodiments, the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.
Certain embodiments are drawn to double-stranded compositions wherein both the strands comprises a hemimer motif, a fully modified motif, a positionally modified motif or an alternating motif Each strand of the compositions of the present invention can be modified to fulfil a particular role in for example the siRNA pathway. Using a different motif in each strand or the same motif with different chemical modifications in each strand permits targeting the antisense strand for the RISC complex while inhibiting the incorporation of the sense strand. Within this model, each strand can be independently modified such that it is enhanced for its particular role. The antisense strand can be modified at the 5′-end to enhance its role in one region of the RISC while the 3′-end can be modified differentially to enhance its role in a different region of the RISC.
The double-stranded oligonucleotide molecules can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The double-stranded oligonucleotide molecules can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e. each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double-stranded structure, for example wherein the double-stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the double-stranded oligonucleotide molecule are complementary to the target nucleic acid or a portion thereof). Alternatively, the double-stranded oligonucleotide is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
The double-stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The double-stranded oligonucleotide can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNAi.
In certain embodiments, the double-stranded oligonucleotide comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions. In certain embodiments, the double-stranded oligonucleotide comprises nucleotide sequence that is complementary to nucleotide sequence of a target gene. In another embodiment, the double-stranded oligonucleotide interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
As used herein, double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides. In certain embodiments, the short interfering nucleic acid molecules lack 2′-hydroxy (2′-OH) containing nucleotides. In certain embodiments short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2′-OH group). Such double-stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2′-OH groups. Optionally, double-stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics. For example, double-stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre-transcriptional level. In a non-limiting example, epigenetic regulation of gene expression by siRNA molecules of the invention can result from siRNA mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237).
It is contemplated that compounds and compositions of several embodiments provided herein can target Androgen Receptor by a dsRNA-mediated gene silencing or RNAi mechanism, including, e.g., “hairpin” or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA. In various embodiments, the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. The dsRNA or dsRNA effector molecule may be a single molecule with a region of self-complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule. In various embodiments, a dsRNA that consists of a single molecule consists entirely of ribonucleotides or includes a region of ribonucleotides that is complementary to a region of deoxyribonucleotides. Alternatively, the dsRNA may include two different strands that have a region of complementarity to each other.
In various embodiments, both strands consist entirely of ribonucleotides, one strand consists entirely of ribonucleotides and one strand consists entirely of deoxyribonucleotides, or one or both strands contain a mixture of ribonucleotides and deoxyribonucleotides. In certain embodiments, the regions of complementarity are at least 70, 80, 90, 95, 98, or 100% complementary to each other and to a target nucleic acid sequence. In certain embodiments, the region of the dsRNA that is present in a double-stranded conformation includes at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 75, 100, 200, 500, 1000, 2000 or 5000 nucleotides or includes all of the nucleotides in a cDNA or other target nucleic acid sequence being represented in the dsRNA. In some embodiments, the dsRNA does not contain any single stranded regions, such as single stranded ends, or the dsRNA is a hairpin. In other embodiments, the dsRNA has one or more single stranded regions or overhangs. In certain embodiments, RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.
In various embodiments, the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. In other embodiments, a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell. In yet other embodiments, the dsRNA is a single circular nucleic acid containing a sense and an antisense region, or the dsRNA includes a circular nucleic acid and either a second circular nucleic acid or a linear nucleic acid (see, for example, WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.) Exemplary circular nucleic acids include lariat structures in which the free 5′ phosphoryl group of a nucleotide becomes linked to the 2′ hydroxyl group of another nucleotide in a loop back fashion.
In other embodiments, the dsRNA includes one or more modified nucleotides in which the 2′ position in the sugar contains a halogen (such as fluorine group) or contains an alkoxy group (such as a methoxy group) which increases the half-life of the dsRNA in vitro or in vivo compared to the corresponding dsRNA in which the corresponding 2′ position contains a hydrogen or an hydroxyl group. In yet other embodiments, the dsRNA includes one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The dsRNAs may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
In other embodiments, the dsRNA can be any of the at least partially dsRNA molecules disclosed in WO 00/63364, as well as any of the dsRNA molecules described in U.S. Provisional Application 60/399,998; and U.S. Provisional Application 60/419,532, and PCT/US2003/033466, the teaching of which is hereby incorporated by reference. Any of the dsRNAs may be expressed in vitro or in vivo using the methods described herein or standard methods, such as those described in WO 00/63364.
Occupancy
In certain embodiments, antisense compounds are not expected to result in cleavage or the target nucleic acid via RNase H or to result in cleavage or sequestration through the RISC pathway. In certain such embodiments, antisense activity may result from occupancy, wherein the presence of the hybridized antisense compound disrupts the activity of the target nucleic acid. In certain such embodiments, the antisense compound may be uniformly modified or may comprise a mix of modifications and/or modified and unmodified nucleosides.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
Nucleotide sequences that encode human Androgen Receptor include, without limitation, the following: GENBANK Accession No. NT_011669.17_TRUNC_5079000_5270000 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NM_000044.3 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. NM_001011645.2 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. FJ235916.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. FJ235917.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. FJ235918.1 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. FJ235919.1 (incorporated herein as SEQ ID NO: 7), and GENBANK Accession No. FJ235920.1 (incorporated herein as SEQ ID NO: 8).
Androgen Receptor mRNA encodes several functional domains. In certain embodiments, full-length Androgen Receptor mRNA includes exon 1 encoding the N-terminal domain, exons 2 and 3 encoding the DNA binding domain, exon 4 encoding the short hinge region, and exons 4-8 encoding the ligand binding domain.
In certain embodiments, Androgen Receptor splicing variants targetable by the antisense compounds provided herein include exon 1 encoding the N-terminal domain and exons 2 and 3 encoding the DNA binding domain, or functional portions thereof, but does not include at least a portion of exon 4 encoding the short hinge region or at least a portion of exons 4-8 encoding the ligand binding domain. Examples of such AR splicing variants include, but are not limited to, AR-V1, AR-V2, AR-V3, AR-V4, AR-V5, AR-V6, and AR-V7 (also referred to as AR3), which contain exons 1-3 but lack exons 4-8. AR-V1, AR-V2, AR-V3, AR-V4, AR-V5, AR-V6, AR-V7, and additional splicing variants targetable by the antisense compounds provided herein are described in Hu et al., Cancer Res 2009; 69:16-22 and US Patent Application Publication No. US 2010/0068802, each of which is incorporated herein by reference in its entirety. Further examples of such AR splicing variants targetable by the antisense compounds provided herein include, but are not limited to, AR3, AR4, AR4b, AR5, and AR6 (SEQ ID NOs: 4-8, respectively) as described in Guo et al., Cancer Res. 2009; 69: 2305-13, which is incorporated herein by reference in its entirety.
Hybridization
In some embodiments, hybridization occurs between an antisense compound disclosed herein and an Androgen Receptor. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with Androgen Receptor.
Complementarity
An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as an Androgen Receptor nucleic acid).
Non-complementary nucleobases between an antisense compound and an Androgen Receptor nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of an Androgen Receptor nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an Androgen Receptor nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to an Androgen Receptor nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
In certain embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an Androgen Receptor nucleic acid, or specified portion thereof.
In certain embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an Androgen Receptor nucleic acid, or specified portion thereof.
The antisense compounds provided also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.
Identity
The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
Modifications
A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
Modified Internucleoside Linkages
The naturally occuring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
In certain embodiments, antisense compounds targeted to an Androgen Receptor nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
Modified Sugar Moieties
Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5′ and 2′ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (R, R1 and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2′-F-5′-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5′,2′-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein 4′-(CH2)—O-2′ (LNA) is substituted with for example a 5′-methyl or a 5′-vinyl group).
Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5′-vinyl, 5′-methyl (R or S), 4′-S, 2′-F, 2′-OCH3, 2′-OCH2CH3, 2′-OCH2CH2F and 2′-O(CH2)2OCH3 substituent groups. The substituent at the 2′ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C1-C10 alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2—O—N(Rm)(Rn), O—CH2—C(═O)—N(Rm)(Rn), and O—CH2—C(═O)—N(R1)—(CH2)2—N(Rm)(Rn), where each R1, Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl.
As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge. Examples of such 4′ to 2′ bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4′-(CH2)—O-2′ (LNA); 4′-(CH2)—S-2; 4′-(CH2)2—O-2′ (ENA); 4-CH(CH3)—O-2′ (also referred to as constrained ethyl or cEt) and 4′-CH(CH2OCH3)—O-2′ (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4′-C(CH3)(CH3)—O-2′ (and analogs thereof see published International Application WO/2009/006478, published Jan. 8, 2009); 4-CH2—N(OCH3)-2′ (and analogs thereof see published International Application WO/2008/150729, published Dec. 11, 2008); 4-CH2—O—N(CH3)-2′ (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4-CH2—N(R)—O-2′, wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4-CH2—C—(H)(CH3)-2′ (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4-CH2—C(═CH2)-2′ (and analogs thereof see published International Application WO 2008/154401, published on Dec. 8, 2008).
Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; US2009-0012281; U.S. Patent Ser. Nos. 60/989,574; 61/026,995; 61/026,998; 61/056,564; 61/086,231; 61/097,787; and 61/099,844; Published PCT International applications WO 1994/014226; WO 2004/106356; WO 2005/021570; WO 2007/134181; WO 2008/150729; WO 2008/154401; and WO 2009/006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).
In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4′ and the 2′ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from —[C(Ra)(Rb)]n—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═O)—, —C(═NRa)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)x—, and —N(Ra)—;
wherein:
x is 0, 1, or 2;
n is 1, 2, 3, or 4;
each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and
each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.
In certain embodiments, the bridge of a bicyclic sugar moiety is —[C(Ra)(Rb)]n—, —[C(Ra)(Rb)]n—O—, —C(RaRb)—N(R)—O— or —C(RaRb)—O—N(R)—. In certain embodiments, the bridge is 4-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4-CH2—O-2′, 4′-(CH2)2—O-2′, 4-CH2—O—N(R)-2′ and 4-CH2—N(R)—O-2′- wherein each R is, independently, H, a protecting group or C1-C12 alkyl.
In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4′-2′ methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4-CH2—O-2′) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy (4′-CH2—O-2′) BNA, (B) β-D-methyleneoxy (4′-CH2—O-2′) BNA, (C) ethyleneoxy (4′-(CH2)2—O-2′) BNA, (D) aminooxy (4′-CH2—O—N(R)-2′) BNA, (E) oxyamino (4′-CH2—N(R)—O-2′) BNA, and (F) methyl(methyleneoxy) (4′-CH(CH3)—O-2′) BNA, (G) methylene-thio (4′-CH2—S-2′) BNA, (H) methylene-amino (4′-CH2—N(R)-2′) BNA, (I) methyl carbocyclic (4′-CH2—CH(CH3)-2′) BNA, (J) propylene carbocyclic (4′-(CH2)3-2′) BNA and (K) vinyl BNA as depicted below:
Figure USRE048461-20210309-C00014
Figure USRE048461-20210309-C00015
wherein Bx is the base moiety and R is independently H, a protecting group, C1-C12 alkyl or C1-C12 alkoxy.
In certain embodiments, bicyclic nucleosides are provided having Formula I:
Figure USRE048461-20210309-C00016

wherein:
Bx is a heterocyclic base moiety;
-Qa-Qb-Qc- is —CH2—N(Rc)—CH2—, —C(═O)—N(Rc)—CH2—, —CH2—O—N(Rc)—, —CH2—N(Rc)—O— or —N(Rc)—O—CH2;
Rc is C1-C12 alkyl or an amino protecting group; and
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
In certain embodiments, bicyclic nucleosides are provided having Formula II:
Figure USRE048461-20210309-C00017

wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Za is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJc, NJcJd, SJc, N3, OC(═X)Jc, and NJcC(═X)NJcJd, wherein each Jc, Jd and Jc is, independently, H, C1-C6 alkyl, or substituted C1-C6 alkyl and X is O or NJc.
In certain embodiments, bicyclic nucleosides are provided having Formula III:
Figure USRE048461-20210309-C00018

wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Zb is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(═O)—).
In certain embodiments, bicyclic nucleosides are provided having Formula IV:
Figure USRE048461-20210309-C00019

wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
Rd is C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;
each qa, qb, qc and qd is, independently, H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkoxyl, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl;
In certain embodiments, bicyclic nucleosides are provided having Formula V:
Figure USRE048461-20210309-C00020

wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
qa, qb, qe and qf are each, independently, hydrogen, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxy, substituted C1-C12 alkoxy, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(═O)OJj, C(═O)NJjJk, C(═O)Jj, O—C(═O)—NJjJk, N(H)C(═NH)NJjJk, N(H)C(═O)NJjJk or N(H)C(═S)NJjJk;
or qe and qf together are ═C(qg)(qh);
qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.
The synthesis and preparation of the methyleneoxy (4-CH2—O-2′) BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). Bicyclic nucleic acids (BNAs) and preparation thereof are also described in WO 98/39352 and WO 99/14226.
Analogs of methyleneoxy (4-CH2—O-2′) BNA and 2′-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2′-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2′-amino- and 2′-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.
In certain embodiments, bicyclic nucleosides are provided having Formula VI:
Figure USRE048461-20210309-C00021

wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;
each qi, qj, qk and q1 is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxyl, substituted C1-C12 alkoxyl, OJj, SJj, SOJj, N3, CN, C(═O)OJj, C(═O)NJjJk, C(═O)Jj, O—C(═O)NJjJk, N(H)C(═NH)NJjJk, N(H)C(═O)NJjJk or N(H)C(═S)NJjJk; and
    • qi and qj or q1 and qk together are ═C(qg)(qh), wherein qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.
One carbocyclic bicyclic nucleoside having a 4′-(CH2)3-2′ bridge and the alkenyl analog bridge 4′-CH═CH—CH2-2′ have been described (Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc., 2007, 129(26), 8362-8379).
As used herein, “4′-2′ bicyclic nucleoside” or “4′ to 2′ bicyclic nucleoside” refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2′ carbon atom and the 4′ carbon atom of the sugar ring.
As used herein, “monocylic nucleosides” refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
As used herein, “2′-modified sugar” means a furanosyl sugar modified at the 2′ position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2′ modifications are selected from substituents including, but not limited to: O[(CH2)nO]mCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nF, O(CH2)nONH2, OCH2C(═O)N(H)CH3, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other 2′- substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2′-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2′-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2′-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2′-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
As used herein, a “modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran “sugar” substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyran ring system as illustrated below:
Figure USRE048461-20210309-C00022
In certain embodiments, sugar surrogates are selected having Formula VII:
Figure USRE048461-20210309-C00023

wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of Ta and Tb is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of Ta and Tb is H, a hydroxyl protecting group, a linked conjugate group or a 5′ or 3′-terminal group;
q1, q2, q3, q4, q5, q6 and q7 are each independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and each of R1 and R2 is selected from hydrogen, hydroxyl, halogen, subsitituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2 and CN, wherein X is O, S or NJ1 and each J1, J2 and J3 is, independently, H or C1-C6 alkyl.
In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q1, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R1 and R2 is fluoro. In certain embodiments, R1 is fluoro and R2 is H; R1 is methoxy and R2 is H, and R1 is methoxyethoxy and R2 is H.
In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following formula:
Figure USRE048461-20210309-C00024
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modifed morpholinos.”
Combinations of modifications are also provided without limitation, such as 2′-F-5′-methyl substituted nucleosides (see PCT International Application WO 2008/101157 published on Aug. 21, 2008 for other disclosed 5′,2′-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4-CH2—O-2′ bicyclic nucleoside is further substituted at the 5′ position with a 5′-methyl or a 5′-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horváth et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have Formula X.
Figure USRE048461-20210309-C00025
wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X:
Bx is a heterocyclic base moiety;
T3 and T4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′- or 3′-terminal group; and
q1, q2, q3, q4, q5, q6, q7, q8 and q9 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or other sugar substituent group.
As used herein, “2′-modified” or “2′-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2′ position other than H or OH. 2′-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2′ carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2′substituents, such as allyl, amino, azido, thio, O-allyl, O—C1-C10 alkyl, —OCF3, O—(CH2)2—O—CH3, 2′-O(CH2)2SCH3, O—(CH2)2—O—N(Rm)(Rn) or O—CH2—C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl. 2′-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.
As used herein, “2′-F” refers to a nucleoside comprising a sugar comprising a fluoro group at the 2′ position of the sugar ring.
As used herein, “2′-OMe” or “2′-OCH3” or “2′-O-methyl” each refers to a nucleoside comprising a sugar comprising an —OCH3 group at the 2′ position of the sugar ring.
As used herein, “oligonucleotide” refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).
Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.
Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed Jun. 2, 2005 and published as WO 2005/121371 on Dec. 22, 2005, and each of which is herein incorporated by reference in its entirety.
In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2′-MOE. In certain embodiments, the 2′-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4′-CH(CH3)—O-2′) bridging group. In certain embodiments, the (4-CH(CH3)—O-2′) modified nucleosides are arranged throughout the wings of a gapmer motif.
Modified Nucleobases
Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
In certain embodiments, antisense compounds targeted to an androgen receptor nucleic acid comprise one or more modified nucleobases. In certain embodiments, shortened or gap-widened antisense oligonucleotides targeted to an androgen receptor nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.
Conjugated Antisense Compounds
Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap), or at the 3′-terminus (3′-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.
In certain embodiments, antisense compounds, including, but not limited to those particularly suited for use as ssRNA, are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligonucleotide. Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
For additional conjugates including those useful for ssRNA and their placement within antisense compounds, see e.g., PCT Publication No.; WO2013/033230.
Compositions and Methods for Formulating Pharmaceutical Compositions
Antisense oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
An antisense compound targeted to an androgen receptor nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to an androgen receptor nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the antisense compound is an antisense oligonucleotide provided herein.
Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
In Vitro Testing of Antisense Oligonucleotides
Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
Cells may be treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
Yet another technique used to introduce antisense oligonucleotides into cultured cells includes free uptake of the oligonucleotides by the cells.
Cells are treated with antisense oligonucleotides by routine methods. Cells may be harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.
RNA Isolation
RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.
EMBODIMENTS
E1. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-179.
E2. A compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 12-179.
E 3. A compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 12-179.
E 4. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
E 5. A compound comprising a modified oligonucleotide consisting of 16 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
E6. A compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 35, 39, 43, 124, 150, 155, 169, or 175.
E7. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleotides 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 4056-4071, 4059-4074, 4062-4077, 4066-4081, 4070-4085, 4101-4116, 4103-4118, 4105-4120, 4109-4124, 4305-4320, 4405-4420, 4532-4547, 4534-4549, 4537-4552, 4539-4554, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4597-4612, 4632-4647, 4655-4670, 4656-4671, 4662-4677, 4699-4714, 4747-4762, 4750-4765, 4752-4767, 4754-4769, 4755-4770, 4769-4784, 4798-4813, 4804-4819, 4807-4822, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4868-4883, 4872-4887, 4874-4889, 4876-4891, 4887-4902, 4889-4904, 4916-4931, 4918-4933, 4938-4953, 4942-4957, 4944-4959, 4951-4966, 5050-5065, 5052-5067, 5054-5069, 5056-5071, 5060-5075, 5061-5076, 5062-5077, 5133-5148, 5141-5156, 5155-5170, 5265-5280, 5293-5308, 5308-5323, 5392-5407, 5448-5463, 5469-5484, 5481-5496, 5483-5498, 5486-5501, 5488-5503, 5494-5509, 5521-5536, 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58769, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, 67454-67469, 114874-114889, 115272-115287, 115365-115380, 134971-134986, 102156-102171, 139682-139697, 139762-139777, 139782-139797, 144856-144871, 144938-144953, 148406-148421, 148443-148458, 148520-148535, 181695-181710, 182958-182973, or 183049-183064 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1.
E8. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 4056-4071, 4059-4074, 4062-4077, 4066-4081, 4070-4085, 4101-4116, 4103-4118, 4105-4120, 4109-4124, 4305-4320, 4405-4420, 4532-4547, 4534-4549, 4537-4552, 4539-4554, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4597-4612, 4632-4647, 4655-4670, 4656-4671, 4662-4677, 4699-4714, 4747-4762, 4750-4765, 4752-4767, 4754-4769, 4755-4770, 4769-4784, 4798-4813, 4804-4819, 4807-4822, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4868-4883, 4872-4887, 4874-4889, 4876-4891, 4887-4902, 4889-4904, 4916-4931, 4918-4933, 4938-4953, 4942-4957, 4944-4959, 4951-4966, 5050-5065, 5052-5067, 5054-5069, 5056-5071, 5060-5075, 5061-5076, 5062-5077, 5133-5148, 5141-5156, 5155-5170, 5265-5280, 5293-5308, 5308-5323, 5392-5407, 5448-5463, 5469-5484, 5481-5496, 5483-5498, 5486-5501, 5488-5503, 5494-5509, 5521-5536, 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58769, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, 67454-67469, 114874-114889, 115272-115287, 115365-115380, 134971-134986, 102156-102171, 139682-139697, 139762-139777, 139782-139797, 144856-144871, 144938-144953, 148406-148421, 148443-148458, 148520-148535, 181695-181710, 182958-182973, or 183049-183064 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is complementary to SEQ ID NO: 1.
E9. The compound of any one of E1, E7, or E8, wherein the compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within exon 1 nucleotides 2957-2972, 3079-3094, 3099-3114, 3109-3124, 3113-3128, 3120-3135, 3133-3148, 3224-3239, 3226-3241, 3351-3366, 3353-3368, 3361-3376, 3388-3403, 3513-3528, 3517-3532, 3519-3534, 3641-3656, 3735-3750, 3764-3779, 3768-3783, 3798-3813, 3799-3814, 3851-3866, 3870-3885, 3874-3889, 3876-3891, 3878-3893, 3884-3899, 3886-3901, 3888-3903, 3901-3916, 3956-3971, 3962-3977, 3964-3979, 3967-3982, 4019-4034, 4038-4053, 4049-4064, 4056-4071, 4059-4074, 4062-4077, 4066-4081, 4070-4085, 4101-4116, 4103-4118, 4105-4120, 4109-4124, 4305-4320, 4405-4420, 4532-4547, 4534-4549, 4537-4552, 4539-4554, 4555-4570, 4571-4586, 4573-4588, 4578-4593, 4597-4612, 4632-4647, 4655-4670, 4656-4671, 4662-4677, 4699-4714, 4747-4762, 4750-4765, 4752-4767, 4754-4769, 4755-4770, 4769-4784, 4798-4813, 4804-4819, 4807-4822, 4833-4848, 4837-4852, 4839-4854, 4865-4880, 4868-4883, 4872-4887, 4874-4889, 4876-4891, 4887-4902, 4889-4904, 4916-4931, 4918-4933, 4938-4953, 4942-4957, 4944-4959, 4951-4966, 5050-5065, 5052-5067, 5054-5069, 5056-5071, 5060-5075, 5061-5076, 5062-5077, 5133-5148, 5141-5156, 5155-5170, 5265-5280, 5293-5308, 5308-5323, 5392-5407, 5448-5463, 5469-5484, 5481-5496, 5483-5498, 5486-5501, 5488-5503, 5494-5509, or 5521-5536 of SEQ ID NO:1.
E10. The compound of E9, wherein the compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within exon 1 nucleotides 5052-5067 of SEQ ID NO:1.
E11. The compound of any one of E1, E7, or E8, wherein the compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within intron 1 nucleotides 5666-5681, 6222-6237, 6701-6716, 7543-7558, 8471-8486, 8638-8653, 9464-9479, 10217-10232, 10250-10265, 10865-10880, 11197-11212, 11855-11870, 13189-13204, 13321-13336, 13346-13361, 16555-16570, 16793-16808, 16968-16983, 17206-17221, 18865-18880, 29329-29344, 32290-32305, 33315-33330, 39055-39070, 40615-40630, 42017-42032, 56050-56065, 58719-58734, 58720-58739, 58721-58736, 58722-58737, 58723-58738, 58724-58739, 58725-58740, 58750-58769, 58751-58766, 58752-58767, 58753-58768, 58754-58769, 58755-58770, 60902-60917, 67454-67469, 114874-114889, 115272-115287, 115365-115380, or 134971-134986 of SEQ ID NO:1.
E12. The compound of E11, wherein the compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within intron 1 nucleotides 8638-8653, 11197-11212, 40615-40630, 58719-58734, 58720-58735, or 58721-58736 of SEQ ID NO:1.
E13. The compound of any one of E1-12, wherein the modified oligonucleotide comprises at least one modified sugar.
E14. The compound of E13, wherein at least one modified sugar comprises a 2′-O-methoxyethyl group.
E15. The compound of E13, wherein the at least one modified sugar is a bicyclic sugar.
E16. The compound of E15, wherein the bicyclic sugar comprises a 4′-CH(CH3)—O-2′ group.
E17. The compound of E15, wherein the bicyclic sugar comprises a 4′-CH2—O-2′ or 4′-(CH2)2—O-2′group.
E18. The compound of any one of E1-17, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
E19. The compound of E18, wherein each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate internucleoside linkage.
E20. The compound of any one of E1-19, wherein the modified oligonucleotide comprises at least one modified nucleobase.
E21. The compound of E20, wherein the modified nucleobase is a 5-methylcytosine.
E22. The compound of any one of E1-21, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of linked deoxynucleosides;
    • a 5′ wing segment consisting of linked nucleosides; and
    • a 3′ wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
E23. The compound of E22, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of ten linked deoxynucleosides;
    • a 5′ wing segment consisting of 3 linked nucleosides; and
    • a 3′ wing segment consisting of 3 linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar or a constrained ethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.
E24. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 9 linked deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of four linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E25. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 9 linked deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of four linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E26. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 8 linked deoxynucleosides;
    • a 5′ wing segment consisting of four linked nucleosides; and
    • a 3′ wing segment consisting of four linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E27. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 8 linked deoxynucleosides;
    • a 5′ wing segment consisting of five linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the five linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E28. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 39, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 7 linked deoxynucleosides;
    • a 5′ wing segment consisting of four linked nucleosides; and
    • a 3′ wing segment consisting of five linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the five linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E29. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 7 linked deoxynucleosides;
    • a 5′ wing segment consisting of six linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; the six linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; the three linked nucleosides of the 3′ wing segment are each a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E30. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 43, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 10 linked deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E31. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 124, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 10 linked deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E32. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 150, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 10 linked deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E33. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 155, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 10 linked deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E34. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 169, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 10 linked deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E35. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence of SEQ ID NO: 175, or a pharmaceutically acceptable salt thereof, wherein the modified oligonucleotide comprises:
    • a gap segment consisting of 10 linked deoxynucleosides;
    • a 5′ wing segment consisting of three linked nucleosides; and
    • a 3′ wing segment consisting of three linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; each nucleoside of each wing segment comprises a constrained ethyl (cEt) sugar; each internucleoside linkage is a phosphorothioate linkage; and each cytosine is a 5-methylcytosine.
E36. The compound of any one of E1-35, wherein the modified oligonucleotide is at least 90% complementary to a nucleic acid encoding androgen receptor.
E37. The compound of any one of E1-36, wherein the antisense oligonucleotide is 100% complementary to a nucleic acid encoding androgen receptor.
E38. The compound of E37, wherein the nucleic acid encoding androgen receptor comprises the nucleotide sequence of any one of SEQ ID NOs: 1-8.
E39. A composition comprising the compound of any one of E1-38, or pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable diluent or carrier.
E40. A composition comprising the compound of any one of E1-38 and a diarylhydantoin Androgen Receptor (AR) inhibitor of Formula XVI:
Figure USRE048461-20210309-C00026
wherein X is selected from the group consisting of trifluoromethyl and iodo, wherein W is selected from the group consisting of O and NR5, wherein R5 is selected from the group consisting of H, methyl, and
Figure USRE048461-20210309-C00027

wherein D is S or O and E is N or O and G is alkyl, aryl, substituted alkyl or substituted aryl; or D is S or O and E-G together are C1-C4 lower alkyl,
wherein R1 and R2 together comprise eight or fewer carbon atoms and are selected from the group consisting of alkyl, substituted alkyl including haloalkyl, and, together with the carbon to which they are linked, a cycloalkyl or substituted cycloalkyl group,
wherein R3 is selected from the group consisting of hydrogen, halogen, methyl, C1-C4 alkoxy, formyl, haloacetoxy, trifluoromethyl, cyano, nitro, hydroxyl, phenyl, amino, methylcarbamoyl, methoxycarbonyl, acetamido, methanesulfonamino, methanesulfonyl, 4-methanesulfonyl-1-piperazinyl, piperazinyl, and C1-C6 alkyl or alkenyl optionally substituted with hydroxyl, methoxycarbonyl, cyano, amino, amido, nitro, carbamoyl, or substituted carbamoyl including methylcarbamoyl, dimethylcarbamoyl, and hydroxyethylcarbamoyl,
wherein R4 is selected from the group consisting of hydrogen, halogen, alkyl, and haloalkyl, and
wherein R3 is not methylaminomethyl or dimethylaminomethyl.
R5 may be
Figure USRE048461-20210309-C00028
E41. The composition of E40, wherein the diarylhydantoin Androgen Receptor (AR) inhibitor is MDV3100.
E42. A composition comprising the compound of any one of E1-38 and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
E43. A method of treating cancer comprising administering to a subject having cancer the compound of any one of E1-38 or composition of any one of E39-42, thereby treating cancer in the subject.
E44. An antisense compound of any one of E1-38 or composition of any one of E39-42 for use in treating cancer
E45. The compound or composition of E44, wherein the cancer is prostate cancer, breast cancer, ovarian cancer, gastric cancer or bladder cancer.
E46. The compound or composition of E45, wherein the cancer is castrate-resistant prostate cancer.
E47. The compound or composition of E46, wherein the castrate-resistant prostate cancer is resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
E48. The method of E43, wherein the cancer is prostate cancer, breast cancer, ovarian cancer, gastric cancer or bladder cancer.
E49. The method of E48, wherein the cancer is castrate-resistant prostate cancer.
E50. The method of E49, wherein the castrate-resistant prostate cancer is resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
E51. The compound of E44-47 or the method of E49 or E50, wherein the antisense compound targets an AR splicing variant.
E52. The compound or method of E51, wherein the AR splicing variant lacks a functional ligand binding domain.
E53. The compound of E44-47 or the method of any one of E49-52, wherein the antisense compound is capable of reducing expression of full-length AR and an AR splicing variant lacking any one of exons 4-8.
E54. The compound or method of E51, wherein the AR splicing variant consists of exons 1-3.
E55. The compound of E44-47 or the method of any one of E49-52, wherein the antisense compound is targeted to AR upstream of the 3′ end of exon 3 and is capable of inhibiting growth or proliferation of the prostate cancer cell to a greater extent than an antisense compound targeted to a region of AR downstream of the 3′ end of exon 3.
E56. The compound or method of E55, wherein the antisense compound targeted to a region of AR downstream of the 3′ end of exon 3 is capable of reducing levels of full-length AR but not an AR splicing variant consisting of exons 1-3.
E57. The compound or method of E56, wherein the region downstream of the 3′ end of exon 3 comprises exon 4.
E58. The compound of E44-47 or the method of any one of E49-52, wherein the prostate cancer cell preferentially expresses an AR splicing variant over full-length AR.
E59. The compound or method of E58, wherein the AR splicing variant lacks a functional ligand binding domain.
E60. A method of treating prostate cancer resistant to a anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464 in a subject comprising administering to the subject an antisense compound targeted to human androgen receptor (AR) upstream of the 3′ end of exon 3, thereby treating the prostate cancer.
E61. The method of E60, wherein the subject is diagnosed as having prostate cancer resistant to the anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
E62. The method of E60 or E61, wherein the antisense compound targets an AR splicing variant.
E63. The method of E62, wherein the AR splicing variant lacks a functional ligand binding domain.
E64. The method of any one of E60-63, wherein the antisense compound is capable of reducing expression of full-length AR and an AR splicing variant lacking any one of exons 4-8.
E65. The method of E64, wherein the AR splicing variant consists of exons 1-3.
E66. The method of any one of E60-65, wherein the antisense compound is targeted to AR upstream of the 3′ end of exon 3 and is capable of inhibiting growth or proliferation of a prostate cancer cell resistant to the diarylhydantoin Androgen Receptor (AR) inhibitor to a greater extent than an antisense compound targeted to a region of AR downstream of the 3′ end exon 3.
E67. The method of E66, wherein the antisense compound targeted to a region of AR downstream of the 3′ end of exon 3 is capable of reducing levels of full-length AR but not an AR splicing variant lacking any one of exons 4-8.
E68. The method of E67, wherein the AR splicing variant consists of exons 1-3.
E69. The method of E68, wherein the region downstream of the 3′ end of exon 3 comprises exon 4.
E70. The method of any one of E60-69, wherein the prostate cancer is castration-resistant.
E71. The method of any one of E60-70, wherein the prostate cancer comprises cells that preferentially express an AR splicing variant over full-length AR.
E72. The method of E71, wherein the AR splicing variant lacks any one of exons 4-8.
E73. The method of E72, wherein the AR splicing variant consists of exons 1-3.
E74. The method of E72, wherein the AR splicing variant lacks a functional ligand binding domain.
E75. A method of inhibiting prostate cancer cell growth or proliferation comprising contacting the prostate cancer cell with an antisense compound targeted to human androgen receptor (AR) and anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464, wherein the antisense compound and the anti-androgenic agent synergize in combination to inhibit the growth or proliferation of the prostate cancer cell.
E76. The method of E75, wherein the antisense compound is targeted to AR upstream of the 3′ end of exon 3.
E77. The method of E75 or E76, wherein the prostate cancer cell is contacted with an amount of the antisense compound and an amount of anti-androgenic agent that are each or both less in combination than the amount of either the antisense compound or anti-androgenic agent alone effective in inhibiting the growth or proliferation of said prostate cancer cell.
E78. The method of any one of E75-77, wherein the antisense compound and anti-androgenic agent provide a greater-than-additive effect compared to the antisense compound alone or anti-androgenic agent alone in inhibiting the growth or proliferation of said prostate cancer cell.
E79. The method of any one of E75-78, wherein the antisense compound targets an AR splicing variant.
E80. The method of E79, wherein the AR splicing variant lacks a functional ligand binding domain.
E81. The method of any one of E75-80, wherein the antisense compound is capable of reducing expression of full-length AR and an AR splicing variant consisting of exons 1-3.
E82. A method of inhibiting growth or proliferation of an androgen receptor (AR)-positive breast cancer cell comprising contacting the breast cancer cell with an antisense compound targeted to human androgen receptor (AR) wherein the growth or proliferation of the breast cancer cell is inhibited.
E83. A method of inhibiting AR expression in a subject having or at risk of having an androgen receptor (AR)-positive breast cancer comprising:
identifying a subject having or at risk of having AR-positive breast cancer, and
administering to the subject an antisense compound targeted to human AR,
wherein the antisense compound inhibits AR expression in the subject.
E84. A method of treating AR-positive breast cancer in a subject comprising administering to the subject an antisense compound targeted to human androgen receptor (AR), thereby treating the breast cancer in the subject.
E85. The method of any one of E82-84, wherein the AR-positive breast cancer or breast cancer cell is dependent on androgen expression for growth.
E86. The method of any one of E82-85, wherein the breast cancer or breast cancer cell is estrogen receptor (ER)-negative, progesterone receptor (PR)-negative, or Her2/neu-negative.
E87. The method of any one of E82-85, wherein the breast cancer or breast cancer cell is ER-positive and AR-positive.
E88. The method of any one of E82-85, wherein the breast cancer or breast cancer cell is ER-negative and AR-positive.
E89. The method of any one of E82-88, wherein the breast cancer or breast cancer cell is an apocrine breast cancer or breast cancer cell.
E90. The method of any one of E60-88, wherein the antisense compound is the compound of any one of E1-38, or pharmaceutically acceptable salt thereof.
E91. The method of any one of E60-88, wherein the antisense compound is the compound of any one of E24-35, or pharmaceutically acceptable salt thereof.
EXAMPLES Non-Limiting Disclosure and Incorporation by Reference
While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.
Example 1 Antisense Inhibition of Human AR in HuVEC Cells
Antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 (forward sequence TCCTTCACCAATGTCAACTCC, designated herein as SEQ ID NO: 9; reverse sequence GAGCCATCCAAACTCTTGAGA, designated herein as SEQ ID NO: 10; probe sequence AGTACCGCATGCACAAGTCCCG, designated herein as SEQ ID NO: 11) was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 155 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Tables 1 and 2.
The newly designed chimeric antisense oligonucleotides in Tables 1 and 2 were designed as 3-10-3 (S)-cET gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Tables 1 and 2 is targeted to either the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000) or the human AR mRNA sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NM_000044.3), or both. ‘n/a.’ indicates that the oligonucleotide does not target that particular gene sequence.
TABLE 1
Target Target
Start Start
Site Site SEQ
for SEQ for SEQ ISIS % ID
ID NO: 1 ID NO: 2 No Sequence inhibition NO
  3799  937 549332 GCGCTCTGACAGCCTC 84  12
  3851  989 549334 CACCTGCGGGAAGCTC 83  13
  3888 1026 549338 GGCTGTGATGATGCGG 83  14
  4047 1185 549345 TCTGGAACAGATTCTG 82 191
  4059 1197 549347 CTTCGCGCACGCTCTG 84  15
  4534 1672 549358 ATGGTGCTGGCCTCGC 91  16
  4655 1793 549360 GGTCGAAGTGCCCCCT 89  17
  4699 1837 549361 GACACCGACACTGCCT 84  18
  4755 1893 549362 CCCGAAGCTGTTCCCC 85  19
  4865 2003 549366 CTTGCCTGCGCTGTCG 84  20
  5060 2198 549371 GTTGTAGTAGTCGCGA 93  21
  5062 2200 549372 AAGTTGTAGTAGTCGC 92  22
  5155 2293 549374 GCGCTGCCGTAGTCCA 93  23
  5265 2403 549377 AGGATGAGGAAGCGGC 90  24
  5392 2530 549379 GCTCCCGCCTCGCCGC 86  25
  5448 2586 549380 CGCTTTCCTGGCCCGC 94  26
  5483 2621 549381 GCCGCCAGGGTACCAC 89  27
n/a 2721 549383 CCAAACGCATGTCCCC 88  28
102155 2800 549386 GCTTCATCTCCACAGA 77 192
102156 2801 549387 AGCTTCATCTCCACAG 84  29
n/a 2871 549388 TCCCTTCAGCGGCTCT 88  30
144856 2801 549390 TTTCTGCTGGCGCACA 89  31
TABLE 2
Target Target
Start Start
Site Site SEQ
for SEQ for SEQ ISIS % ID
ID NO: 1 ID NO: 2 No Sequence inhibition NO
181695 3602 549414 GTTCATTCGAAGTTCA 81 32
182958 4164 549432 GAGGATCATCACAGAT 90 33
183049 4255 549434 CTAAACTTCCCGTGGC 96 34
 58721 n/a 549457 TTGATTTAATGGTTGC 98 35
 58751
 58722 n/a 549458 GTTGATTTAATGGTTG 95 36
 58752
 58725 n/a 549459 ATGGTTGATTTAATGG 96 37
 58755
Example 2 Dose-Dependent Antisense Inhibition of Human AR in HuVEC Cells
Gapmers from the study described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 18.5 nM, 55.6 nM, 166.7 nM, 500.0 nM and 1500.0 nM concentrations of antisense oligonucleotide, as specified in Tables 3 and 4. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human AR primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented in Tables 3 and 4. As illustrated, AR mRNA levels were reduced in a dose-dependent manner in the antisense oligonucleotide treated cells.
TABLE 3
18.5 55.6 166.7 500.0 1500.0 IC50
ISIS No nM nM nM nM nM (nM)
549358 0 29 63 85 95 141
549360 2 44 58 79 83 116
549361 0 12 30 52 66 525
549362 0 10 23 57 74 447
549371 0 30 52 83 88 148
549372 0 22 51 85 89 150
549374 15 40 59 83 92 108
549377 0 13 52 72 93 216
549379 9 11 51 68 88 237
549380 14 50 87 94 98 62
549381 4 14 33 71 91 261
549383 2 10 34 75 88 270
549388 0 15 42 36 86 428
549390 12 0 35 55 91 369
TABLE 4
18.5 55.6 166.7 500.0 1500.0 IC50
ISIS No nM nM nM nM nM (nM)
549332 24 35 57 79 79 104
549334 9 29 46 63 72 253
549338 30 32 47 67 78 154
549347 5 15 37 62 71 357
549366 8 44 58 72 91 129
549387 2 9 41 68 92 261
549414 0 21 35 53 76 366
549432 10 15 46 80 92 179
549434 27 38 60 86 96 85
549457 50 70 95 99 99 18
549458 22 48 84 97 98 57
549459 51 61 90 94 97 18
Example 3 Antisense Inhibition of Human AR in HuVEC Cells
Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 82 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Table 5.
The newly designed chimeric antisense oligonucleotides in Table 5 were designed as 3-10-3 (S)-cET gapmers or 5-10-5 MOE gapmers. The 3-10-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification. The 5-10-5 MOE gapmer is 20 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on the 5′ direction and the 3′ direction comprising five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a 2′-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Table 5 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000)
TABLE 5
Target Target
Start Stop ISIS % SEQ ID
Site Site No ISIS No Motif inhibition NO
58721 58736 549457 TTGATTTAATGGTTGC 3-10-3 98 35
58751 58766
58722 58737 549458 GTTGATTTAATGGTTG 3-10-3 94 36
58752 58767
58725 58740 549459 ATGGTTGATTTAATGG 3-10-3 92 37
58755 58770
58720 58739 560071 TGGTTGATTTAATGGTTGCA 5-10-5 73 38
58750 58769
58720 58735 560098 TGATTTAATGGTTGCA 3-10-3 99 39
58750 58765
58723 58738 560099 GGTTGATTTAATGGTT 3-10-3 95 40
58753 58768
58724 58739 560100 TGGTTGATTTAATGGT 3-10-3 91 41
58754 58769
58721 58736 560137 TTGATTTAATGGTTGC 3-10-3 95 35
58751 58766
Example 4 Dose-Dependent Antisense Inhibition of Human AR in HuVEC Cells
Gapmers from the studies described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 31.3 nM, 62.5 nM, 125.0 nM, 250.0 nM, 500.0 nM, and 1000.0 nM concentrations of antisense oligonucleotide, as specified in Table 6. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human AR primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented in Table 6. As illustrated, AR mRNA levels were reduced in a dose-dependent manner in the antisense oligonucleotide treated cells.
TABLE 6
31.25 62.5 125.0 250.0 500.0 1000.0 IC50
ISIS No nM nM nM nM nM nM (μM)
549457 40 57 78 89 96 96 0.03
549458 15 25 47 70 88 93 0.1
549459 16 23 50 71 85 92 0.1
560071 7 0 19 40 57 76 0.4
560098 20 41 64 83 94 94 0.1
560099 13 29 58 72 89 94 0.1
560100 16 24 53 69 81 93 0.1
560137 27 49 61 82 91 96 0.1
Example 5 Antisense Inhibition of Human AR in HuVEC Cells
Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 250 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 40 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Table 7.
The newly designed chimeric antisense oligonucleotides in Table 7 were designed as 3-10-3 (S)-cET gapmers or deoxy, MOE and (S)-cEt oligonucleotides. The 3-10-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification. The deoxy, MOE and (S)-cEt oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The ‘Chemistry’ column describes the sugar modifications of each oligonucleotide. ‘k’ indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; and ‘e’ indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. The SEQ ID NO listed in the table refers to the oligonucleotide sequence. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Table 7 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000).
TABLE 7
Target Target %
Start Stop ISIS inhibi- SEQ ID 
Site Site Sequence No Chemistry tion NO
58721 58736 TTGATTTAATGGTTGC 549457 kkk-10-kkk 67 35
58751 58766
58722 58737 GTTGATTTAATGGTTG 549458 kkk-10-kkk 71 36
58752 58767
58720 58735 TGATTTAATGGTTGCA 560098 kkk-10-kkk 69 39
58750 58765
58721 58736 TTGATTTAATGGTTGC 560131 kkk-9-kkke 74 35
58751 58766
58721 58736 TTGATTTAATGGTTGC 560137 ekkk-8-kkke 66 35
58751 58766
58720 58735 TGATTTAATGGTTGCA 569213 kkk-9-kkke 69 39
58750 58765
58720 58735 TGATTTAATGGTTGCA 569216 ekkk-8-kkke 68 39
58750 58765
58721 58736 TTGATTTAATGGTTGC 569222 eekkk-8-kkk 74 35
58751 58766
58721 58736 TTGATTTAATGGTTGC 569228 eekkk-7-kkke 67 35
58751 58766
58720 58735 TGATTTAATGGTTGCA 569236 ekkk-7-kkkee 66 39
58750 58765
Example 6 Dose-Dependent Antisense Inhibition of Human AR in HuVEC Cells
Gapmers from the studies described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 31.3 nM, 62.5 nM, 125.0 nM, 250.0 nM, 500.0 nM, and 1000.0 nM concentrations of antisense oligonucleotide, as specified in Table 8. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human AR primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented in Table 8. As illustrated, AR mRNA levels were reduced in a dose-dependent manner in the antisense oligonucleotide treated cells.
TABLE 8
31.25 62.5 125.0 250.0 500.0 1000.0 IC50
ISIS No nM nM nM nM nM nM (μM)
549457 34 44 75 82 93 96 0.06
549458 30 36 54 70 85 90 0.10
560098 30 54 65 78 89 97 0.07
560131 16 48 65 82 89 97 0.09
560137 35 39 64 73 89 94 0.08
569213 35 53 65 83 94 96 0.06
569216 38 51 68 83 91 96 0.05
569222 36 48 67 83 91 98 0.06
569228 26 43 62 78 88 92 0.09
569236 17 39 54 79 84 92 0.11
Example 7 Dose-Dependent Antisense Inhibition of Human AR in HuVEC Cells
Additional antisense oligonucleotides were designed as deoxy, MOE and (S)-cEt oligonucleotides targeting AR gene sequences and were tested at various doses in HuVEC cells. The oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The ‘Chemistry’ column describes the sugar modifications of each oligonucleotide. ‘k’ indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise ‘d’ indicates deoxyribose; and ‘e’ indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. The SEQ ID NO listed in the table refers to the oligonucleotide sequence. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Table 9 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000)
TABLE 9
Target Target
Start Stop ISIS SEQ
Site Site Sequence No Chemistry ID NO
58720 58735 TGATTTAATGGTTGCA 569221 eekkk-8-kkk 39
58750 58765
58720 58735 TGATTTAATGGTTGCA 569227 eekkk-7-kkke 39
58750 58765
58720 58735 TGATTTAATGGTTGCA 569236 ekkk-7-kkkee 39
58750 58765
58720 58735 TGATTTAATGGTTGCA 579666 ekkeekk-7-kk 39
58750 58765
58721 58736 TTGATTTAATGGTTGC 579667 ekkeekk-7-kk 35
58751 58766
58720 58735 TGATTTAATGGTTGCA 579670 ekkekk-7-kkk 39
58750 58765
58721 58736 TTGATTTAATGGTTGC 579671 ekkekk-7-kkk 35
58751 58766
58721 58736 TTGATTTAATGGTTGC 569228 eekkk-7-kkke 35
58751 58766
58723 58738 GGTTGATTTAATGGTT 579669 ekkeekk-7-kk 40
58753 58768
58722 58737 GTTGATTTAATGGTTG 579672 ekkekk-7-kkk 36
58752 58767
58722 58737 GTTGATTTAATGGTTG 569217 ekkk-8-kkke 36
58752 58767
58723 58738 GGTTGATTTAATGGTT 569214 kkk-9-kkke 40
58753 58768
58723 58738 GGTTGATTTAATGGTT 560099 kkk-10-kkk 40
58753 58768
Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 62.5 nM, 125.0 nM, 250.0 nM, 500.0 nM, and 1000.0 nM concentrations of antisense oligonucleotide, as specified in Tables 10-12. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human AR primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented in Tables 10-12. As illustrated, AR mRNA levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.
TABLE 10
62.5 125.0 250.0 500.0 1000.0 IC50
ISIS No nM nM nM nM nM (nM)
549458 25 46 55 64 78 203
569227 8 40 33 51 73 388
569228 29 44 63 77 87 158
569236 4 35 54 68 88 252
579666 33 34 47 64 80 229
579667 30 29 44 36 76 411
TABLE 11
62.5 125.0 250.0 500.0 1000.0 IC50
ISIS No nM nM nM nM nM (nM)
549458 16 22 44 64 74 324
579669 24 39 45 74 91 207
579670 27 28 55 75 70 236
579671 6 40 54 57 77 288
579672 9 30 50 72 86 258
TABLE 12
62.5 125.0 250.0 500.0 1000.0 IC50
ISIS No nM nM nM nM nM (nM)
549458 19 22 45 38 71 470
569214 20 26 61 62 76 265
569217 34 39 49 64 64 247
569221 12 32 59 57 73 294
Example 8 Antisense Inhibition of Human AR in HuVEC Cells
Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 75 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Table 13.
The newly designed chimeric antisense oligonucleotides in Table 13 were designed as 3-10-3 (S)-cET gapmers, 3-9-4 (S)-cEt gapmers, 4-8-4 (S)-cEt gapmers, 4-9-3 (S)-cEt gapmers, 5-7-4 (S)-cEt gapmers, 5-8-3 (S)-cEt gapmers, 6-7-3 (S)-cEt gapmers, or deoxy, MOE and (S)-cEt oligonucleotides. The 3-10-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides. The 3-9-4 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of nine 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising three nucleotides and on the 3′ direction comprising four nucleosides. The 4-8-4 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of eight 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising four nucleosides. The 4-9-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of nine 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising four nucleotides and on the 3′ direction comprising three nucleosides. The 5-7-4 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of seven 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising five nucleotides and on the 3′ direction comprising four nucleotides. The 5-8-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of eight 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising five nucleotides and on the 3′ direction comprising three nucleosides. The 6-7-3 (S)-cEt gapmers are 16 nucleosides in length, wherein the central gap segment comprises of seven 2′-deoxynucleosides and is flanked by a wing segment on the 5′ direction comprising six nucleotides and on the 3′ direction comprising three nucleosides. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification. The deoxy, MOE and (S)-cEt oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an (S)-cEt sugar modification, or a deoxy modification. The ‘Chemistry’ column describes the sugar modifications of each oligonucleotide. ‘k’ indicates an (S)-cEt sugar modification; the number indicates the number of deoxynucleosides; otherwise ‘d’ indicates deoxyribose; and ‘e’ indicates a MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
The SEQ ID NO listed in the table refers to the oligonucleotide sequence. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Table 13 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000).
TABLE 13
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No Chemistry inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 kkk-10-kkk 64 22
 5061  5076 AGTTGTAGTAGTCGCG 585233 kkk-8-keeee 69 42
 5062  5077 AAGTTGTAGTAGTCGC 585259 ekkk-9-kkk 71 22
 5062  5077 AAGTTGTAGTAGTCGC 585262 kkk-9-kkke 77 22
 5062  5077 AAGTTGTAGTAGTCGC 585263 kkk-8-kkkee 69 22
 5062  5077 AAGTTGTAGTAGTCGC 585264 kkk-7-kkkeee 62 22
 5062  5077 AAGTTGTAGTAGTCGC 585265 eekk-8-kkee 69 22
 5062  5077 AAGTTGTAGTAGTCGC 585268 keke-8-ekek 72 22
 5062  5077 AAGTTGTAGTAGTCGC 585269 ekek-8-ekek 73 22
 5062  5077 AAGTTGTAGTAGTCGC 585271 ekk-10-kke 57 22
 5062  5077 AAGTTGTAGTAGTCGC 585274 kkk-10-kke 65 22
58719 58734 GATTTAATGGTTGCAA 586124 kkk-10-kkk 82 43
58720 58735 TGATTTAATGGTTGCA 569227 eekkk-7-kkke 51 39
58750 58765
58722 58737 GTTGATTTAATGGTTG 560132 kkk-9-kkke 58 36
58752 58767
58722 58737 GTTGATTTAATGGTTG 569229 eekkk-7-kkke 57 36
58752 58767
58722 58737 GTTGATTTAATGGTTG 569238 ekkk-7-kkkee 51 36
58752 58767
58722 58737 GTTGATTTAATGGTTG 549458 kkk-10-kkk 87 36
58752 58767
58722 58737 GTTGATTTAATGGTTG 569223 eekkk-8-kkk 59 36
58752 58767
58724 58739 TGGTTGATTTAATGGT 569215 kkk-9-kkke 59 41
58754 58769
58725 58740 ATGGTTGATTTAATGG 560133 kkk-9-kkke 53 37
58755 58770
58725 58740 ATGGTTGATTTAATGG 569220 ekkk-8-kkke 58 37
58755 58770
58721 58736 TTGATTTAATGGTTGC 586224 kkkkk-8-kkk 90 35
58751 58766
58722 58737 GTTGATTTAATGGTTG 586225 kkkkk-8-kkk 88 36
58752 58767
58720 58735 TGATTTAATGGTTGCA 586227 kkkkk-8-kkk 87 39
58750 58765
Example 9 Dose-Dependent Antisense Inhibition of Human AR in HuVEC Cells
Antisense oligonucleotides from the studies described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 31.25 nM, 62.5 nM, 125.0 nM, 250.0 nM, 500.0 nM, and 1000.0 nM concentrations of antisense oligonucleotide, as specified in Table 14. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human AR primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented in Table 14. As illustrated, AR mRNA levels were reduced in a dose-dependent manner in the antisense oligonucleotide treated cells.
TABLE 14
31.25 62.5 125.0 250.0 500.0 1000.0 IC50
ISIS No nM nM nM nM nM nM nM
549372 2 17 31 51 61 80 271
549458 0 19 40 63 74 90 196
560132 8 19 21 53 65 85 252
560133 17 15 24 35 58 79 336
569215 12 2 26 55 71 90 234
569220 11 29 34 43 59 78 275
569223 21 20 30 59 73 87 191
569227 13 22 45 46 61 74 255
569229 16 14 36 47 74 84 220
569238 4 32 33 54 71 88 202
Example 10 Dose-Dependent Antisense Inhibition of Human AR in HuVEC Cells
Gapmers from Example 8 exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 46.9 nM, 187.5 nM, 750.0 nM, and 3000.0 nM concentrations of antisense oligonucleotide, as specified in Table 15. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human AR primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells.
The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented in Table 15. As illustrated, AR mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.
TABLE 15
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 9 41 66 87 0.29
549458 15 50 85 96 0.19
586124 28 47 84 94 0.13
586224 39 75 93 98 0.05
586225 17 61 89 97 0.13
586227 20 60 88 96 0.13
Example 11 Antisense Inhibition of Human AR in HuVEC Cells
Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 616 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Tables 16-23.
The newly designed chimeric antisense oligonucleotides in Tables 16-23 were designed as 3-10-3 (S)-cET gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
The SEQ ID NO listed in the table refers to the oligonucleotide sequence. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Tables 16-23 is targeted to either the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000) or the human AR mRNA sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NM_000044.3), or both. ‘n/a.’ indicates that the oligonucleotide does not target that particular gene sequence.
TABLE 16
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 47 22
58722 58737 GTTGATTTAATGGTTG 549458 60 36
58752 58767
 2957  2972 ACAGCACTGGAGCGGC 583542 45 44
 3079  3094 AACTTCACCGAAGAGG 583556 43 45
 3099  3114 AGTCTTTAGCAGCTTT 583559 52 46
 3109  3124 GCTTCCTCCGAGTCTT 583564 45 47
 3113  3128 CCTTGCTTCCTCCGAG 583566 47 48
 3120  3135 GCACTTTCCTTGCTTC 583567 52 49
 3133  3148 TCAGTCCTACCAGGCA 583571 43 50
 3224  3239 GACTGAGGCAGCTGCG 583583 45 51
 3226  3241 CCGACTGAGGCAGCTG 583584 44 52
TABLE 17
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 40 22
58722 58737 GTTGATTTAATGGTTG 549458 46 36
58752 58767
 3351  3366 GCTAGCTCGCCCGCTC 583608 51 53
 3353  3368 CAGCTAGCTCGCCCGC 583609 51 54
 3361  3376 GCAATGTGCAGCTAGC 583613 51 55
 3388  3403 GTCGCCTGGCTCCTAA 583620 41 56
 3513  3528 CTGGCTCCGCACTCGG 583635 50 57
 3517  3532 ATCTCTGGCTCCGCAC 583637 43 58
 3519  3534 TGATCTCTGGCTCCGC 583638 51 59
 3641  3656 AGTGTCCACTGAAGTA 583642 42 60
 3735  3750 AGGCTCACAGTCTGTC 583649 46 61
 3764  3779 GACACACGGTGGACAA 583660 44 62
 3768  3783 AGAAGACACACGGTGG 583662 51 63
 3798  3813 CGCTCTGACAGCCTCA 583667 42 64
TABLE 18
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 26 22
58722 58737 GTTGATTTAATGGTTG 549458 48 36
58752 58767
 3870  3885 GTCGCTGCAGCTAGCT 583685 47 65
 3874  3889 GGTAGTCGCTGCAGCT 583687 41 66
 3876  3891 GCGGTAGTCGCTGCAG 583688 38 67
 3878  3893 ATGCGGTAGTCGCTGC 583689 39 68
 3884  3899 GTGATGATGCGGTAGT 583692 41 69
 3886  3901 CTGTGATGATGCGGTA 583693 36 70
 3901  3916 GAAGAGTTCAACAGGC 583700 36 71
 3956  3971 GCTTGGCTGAATCTTC 583709 39 72
 3962  3977 CCTTGAGCTTGGCTGA 583712 37 73
 3964  3979 ATCCTTGAGCTTGGCT 583713 36 74
 3967  3982 TCCATCCTTGAGCTTG 583714 36 75
 4019  4034 GTAGGTCTTGGACGGC 583719 36 76
 4038  4053 GATTCTGGAAAGCTCC 583727 40 77
 4049  4064 GCTCTGGAACAGATTC 583728 45 78
 4056  4071 CGCGCACGCTCTGGAA 583731 34 79
 4062  4077 TCACTTCGCGCACGCT 583734 46 80
 4066  4081 TGGATCACTTCGCGCA 583736 47 81
 4070  4085 GTTCTGGATCACTTCG 583738 36 82
 4101  4116 CGCTCGCGGCCTCTGG 583745 40 83
 4103  4118 TGCGCTCGCGGCCTCT 583746 32 84
 4105  4120 GCTGCGCTCGCGGCCT 583747 35 85
TABLE 19
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 39 22
58722 58737 GTTGATTTAATGGTTG 549458 50 36
58752 58767
 4109  4124 AGGTGCTGCGCTCGCG 583749 36 86
 4305  4320 GCTGTTCCTCATCCAG 583759 38 87
 4405  4420 TGCTGCGGCAGCCCCT 583771 40 88
 4532  4547 GGTGCTGGCCTCGCTC 583787 37 89
 4537  4552 TGCATGGTGCTGGCCT 583789 39 90
 4539  4554 GTTGCATGGTGCTGGC 583790 39 91
 4555  4570 TGCTGTTGCTGAAGGA 583795 63 92
 4571  4586 GGATACTGCTTCCTGC 583796 65 93
 4573  4588 TCGGATACTGCTTCCT 583797 35 94
 4578  4593 TGCCTTCGGATACTGC 583799 65 95
 4597  4612 CTCGCTCTCCCGCTGC 583802 37 96
 4632  4647 TGTCCTTGGAGGAAGT 583809 45 97
 4656  4671 TGGTCGAAGTGCCCCC 583818 42 98
 4662  4677 CAGAAATGGTCGAAGT 583821 42 99
TABLE 20
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 23  22
58722 58737 GTTGATTTAATGGTTG 549458 54  36
58752 58767
 4747  4762 TGTTCCCCTGGACTCA 583833 37 100
 4750  4765 AGCTGTTCCCCTGGAC 583834 52 101
 4752  4767 GAAGCTGTTCCCCTGG 583835 44 102
 4754  4769 CCGAAGCTGTTCCCCT 583836 37 103
 4769  4784 GTACATGCAATCCCCC 583843 35 104
 4798  4813 ACAGCGGGTGGAACTC 583847 34 105
 4804  4819 GGACGCACAGCGGGTG 583850 38 106
 4807  4822 GTGGGACGCACAGCGG 583851 33 107
 4833  4848 TGCATTCGGCCAATGG 583853 33 108
 4837  4852 CCTTTGCATTCGGCCA 583855 44 109
 4839  4854 AACCTTTGCATTCGGC 583856 45 110
 4868  4883 GCTCTTGCCTGCGCTG 583862 32 111
 4872  4887 CAGTGCTCTTGCCTGC 583864 46 112
 4874  4889 TTCAGTGCTCTTGCCT 583865 45 113
 4876  4891 TCTTCAGTGCTCTTGC 583866 32 114
 4887  4902 ACTCAGCAGTATCTTC 583868 34 115
 4889  4904 ATACTCAGCAGTATCT 583871 47 116
 4916  4931 TTTGGTGTAACCTCCC 583880 39 117
 4918  4933 CCTTTGGTGTAACCTC 583881 47 118
 4938  4953 CTAGGCTCTCGCCTTC 583890 32 119
 4942  4957 CAGCCTAGGCTCTCGC 583892 35 120
 4944  4959 AGCAGCCTAGGCTCTC 583893 34 121
 4951  4966 CTGCCAGAGCAGCCTA 583896 37 122
TABLE 21
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 37  22
58722 58737 GTTGATTTAATGGTTG 549458 47  36
58752 58767
 5050  5065 TCGCGACTCTGGTACG 583917 37 123
 5052  5067 AGTCGCGACTCTGGTA 583918 47 124
 5054  5069 GTAGTCGCGACTCTGG 583919 55 125
 5056  5071 TAGTAGTCGCGACTCT 583920 42 126
 5061  5076 AGTTGTAGTAGTCGCG 583922 37  42
 5133  5148 TCTCCAGCTTGATGCG 583932 39 127
 5141  5156 CAGCGGGTTCTCCAGC 583933 38 128
 5293  5308 CCTTCTTCGGCTGTGA 583969 44 129
 5308  5323 GGTCCATACAACTGGC 583975 42 130
TABLE 22
Target Target
Start Start
Site on Site on
SEQ ID SEQ ID ISIS % SEQ ID
NO: 1 NO: 2 Sequence No inhibition NO
 5062 2200 AAGTTGTAGTAGTCGC 549372 46  22
58722 n/a GTTGATTTAATGGTTG 549458 39  36
58752 n/a
 5469 2607 ACACATCAGGTGCGGT 583990 30 131
 5481 2619 CGCCAGGGTACCACAC 583996 33 132
 5486 2624 CATGCCGCCAGGGTAC 583998 45 133
 5488 2626 ACCATGCCGCCAGGGT 583999 29 134
 5494 2632 CTGCTCACCATGCCGC 584002 30 135
 5521 2659 ACACAAGTGGGACTGG 584006 33 136
n/a 2870 CCCTTCAGCGGCTCTT 584044 29 137
TABLE 23
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No inhibition NO
  5062   5077 AAGTTGTAGTAGTCGC 549372 25  22
 58722  58737 GTTGATTTAATGGTTG 549458 51  36
 58752  58767
144938 144953 CAGAGTCATCCCTGCT 584069 36 138
148406 148421 CACCCTCAAGATTCTT 584100 36 139
148443 148458 AAGGTAGTCTTTAAGG 584106 30 140
148520 148535 GTTTTCAAATGCAGCC 584111 33 141
139682 139697 GCCATGAGACAGCTTT 584125 35 142
139762 139777 ATTCTTGACTGTCTGA 584128 38 143
139782 139797 GCATGCCAGCTGGCTC 584130 29 144
  5666   5681 CGCGCAGGTAGGAGCC 584138 35 145
  6222   6237 TCTAAACATGACGGTT 584139 37 146
  6701   6716 ATGCAATTGCCTGCCA 584141 39 147
Example 12 Antisense Inhibition of Human AR in HuVEC Cells
Additional antisense oligonucleotides were designed targeting an AR nucleic acid and were tested for their effects on AR mRNA in vitro. Cultured HuVEC cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells. A total of 385 oligonucleotides were tested. Only those oligonucleotides which were selected for further study are shown in Tables 24-28.
The newly designed chimeric antisense oligonucleotides in Tables 24-28 were designed as 3-10-3 (S)-cET gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2′-deoxynucleosides and is flanked by wing segments on both the 5′ direction and on the 3′ direction comprising three nucleosides. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has an (S)-cEt modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.
The SEQ ID NO listed in the table refers to the oligonucleotide sequence. “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in Tables 24-28 is targeted to the human AR genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NT_011669.17 truncated from nucleotides 5079000 to 5270000)
TABLE 24
Target Target
Start Stop ISIS % SEQ ID
Site Site Sequence No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 63  22
58722 58737 GTTGATTTAATGGTTG 549458 88  36
58752 58767
 7543  7558 ATGGGAGTAACTTTTG 584145 76 148
 8471  8486 CATATTATTGTGCTGC 584148 85 149
 8638  8653 GTCAATATCAAAGCAC 584149 85 150
 9464  9479 GAGTTGTGATTTCAGG 584152 88 151
10217 10232 TTGATGGAATGCTGAT 584157 69 152
10250 10265 GGTTAACTTTCTCTGA 584158 69 153
10865 10880 TGGATTGTAAATTACG 584162 82 154
11197 11212 GAACATTATTAGGCTA 584163 81 155
11855 11870 TCAATCTAGATACCAT 584165 70 156
13189 13204 CACATCAGAAGGAGTA 584166 89 157
13321 13336 GAGTGTTAATGAAGAC 584167 78 158
13346 13361 CTGATTAGCTATGACC 584168 70 159
16555 16570 ATGAGTCCTCAGAATC 584179 74 160
16793 16808 GTAGATTCTAGCTTTG 584180 81 161
16968 16983 ACAGGCTCTGACTAGG 584183 76 162
17206 17221 TGTGTGACCCTTGGAC 584184 78 163
18865 18880 AAGTATGAGCATGGTT 584192 73 164
TABLE 25
Target Target
Start Stop ISIS % SEQ ID
Site Site Sequence No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 59  22
58722 58737 GTTGATTTAATGGTTG 549458 76  36
58752 58767
29329 29344 GGATTCTCTACACACA 584233 62 165
32290 32305 CCATTTGTGCCAAACC 584242 62 166
33315 33330 AGGTTAGGGAGTAGGC 584245 70 167
39055 39070 TAGGGTTTGGTCAGAA 584263 56 168
40615 40630 CCTTATGGATGCTGCT 584269 57 169
42017 42032 GTTATCTTACTCTCCC 584274 70 170
TABLE 26
Target Target
Start Stop ISIS % SEQ ID
Site Site Sequence No inhibition NO
 5062  5077 AAGTTGTAGTAGTCGC 549372 58  22
58722 58737 GTTGATTTAATGGTTG 549458 79  36
58752 58767
56050 56065 GATTGTGTATAGCTGC 584312 65 171
60902 60917 GGTTATGGTTCTGTCT 584329 58 172
67454 67469 CTTCATTGCAGGTCTG 584361 61 173
TABLE 27
Target Target
Start Stop % SEQ ID
Site Site Sequence ISIS No inhibition NO
 5062   5077 AAGTTGTAGTAGTCGC 549372 70  22
 58722  58737 GTTGATTTAATGGTTG 549458 76  36
 58752  58767
114874 114889 TAGCCAACTTTCTTTA 584465 58 174
115272 115287 CATTGTACTATGCCAG 584468 64 175
115365 115380 TTTGGTAACATTAGGC 584469 74 176
134971 134986 ATGGTTGTCCTGTACA 584495 58 177
TABLE 28
Target Target
Start Stop ISIS % SEQ ID
Site Site Sequence No inhibition NO
  5062   5077 AAGTTGTAGTAGTCGC 549372 54  22
 58722  58737 GTTGATTTAATGGTTG 549458 65  36
 58752  58767
114874 114889 TAGCCAACTTTCTTTA 584465 54 174
115365 115380 TTTGGTAACATTAGGC 584469 63 176
134971 134986 ATGGTTGTCCTGTACA 584495 53 177
Example 13 Dose-Dependent Antisense Inhibition of Human AR in HuVEC Cells
Gapmers from the studies described above exhibiting significant in vitro inhibition of AR mRNA were selected and tested at various doses in HuVEC cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 46.9 nM, 187.5 nM, 750.0 nM, and 3000.0 nM concentrations of antisense oligonucleotide, as specified in Tables 29-37. After a treatment period of approximately 16 hours, RNA was isolated from the cells and AR mRNA levels were measured by quantitative real-time PCR. Human AR primer probe set RTS3559 was used to measure mRNA levels. AR mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of AR, relative to untreated control cells.
The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented in Tables 29-37. As illustrated, AR mRNA levels were reduced in a dose-dependent manner in some of the antisense oligonucleotide treated cells.
TABLE 29
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 7 41 70 91 0.32
549458 21 72 91 97 0.11
583542 9 28 47 66 0.90
583556 19 47 68 66 0.34
583559 30 49 63 80 0.22
583564 16 33 55 74 0.52
583566 0 28 50 74 0.73
583567 17 34 60 79 0.43
583571 18 36 53 59 0.80
583583 21 31 49 64 0.79
583584 24 44 52 73 0.41
583608 12 46 67 76 0.35
583609 16 48 63 73 0.36
583613 24 60 70 75 0.19
583635 35 56 69 78 0.13
583638 33 64 79 85 0.11
583649 28 50 68 84 0.20
583660 21 39 61 72 0.42
583662 27 59 75 75 0.15
TABLE 30
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 13 29 69 90 0.37
549458 22 62 92 97 0.13
583620 0 17 44 54 1.85
583637 22 32 59 75 0.45
583642 18 35 67 74 0.46
583667 35 55 73 82 0.14
583685 32 53 73 81 0.16
583687 34 67 83 81 0.08
583688 3 26 50 60 1.05
583689 20 34 62 74 0.44
583692 8 47 61 71 0.44
583709 8 50 70 84 0.29
583712 15 47 72 78 0.29
583727 18 49 70 76 0.29
583728 9 48 67 70 0.40
583734 29 60 74 75 0.12
583736 21 38 60 63 0.51
583738 16 40 56 71 0.51
583745 19 51 68 77 0.27
TABLE 31
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 5 36 69 88 0.36
549458 24 59 92 98 0.13
583693 12 39 64 80 0.38
583700 14 34 57 71 0.55
583713 29 51 67 74 0.22
583714 22 34 59 79 0.40
583719 22 46 65 72 0.32
583731 18 24 47 58 1.31
583746 24 44 65 67 0.35
583747 13 38 50 69 0.64
583771 17 27 47 69 0.77
583789 30 49 71 85 0.19
583790 17 42 65 81 0.32
583795 37 61 83 90 0.09
583796 38 69 83 90 0.07
583799 29 60 76 85 0.14
583809 13 37 68 81 0.36
583818 9 46 71 84 0.31
583821 11 35 61 77 0.46
TABLE 32
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 15 39 70 86 0.30
549458 19 58 89 96 0.15
583749 34 40 75 87 0.17
583759 5 28 61 67 0.63
583787 15 31 66 74 0.43
583797 21 50 74 82 0.22
583802 17 25 47 60 1.07
583834 34 54 73 84 0.13
583835 20 55 74 88 0.19
583836 11 27 67 86 0.39
583850 9 21 54 78 0.60
583855 22 50 81 91 0.18
583856 31 55 74 89 0.14
583864 30 49 72 85 0.17
583864 0 47 62 85 0.37
583865 33 42 68 85 0.19
583871 28 30 68 87 0.28
583880 13 52 78 92 0.22
583881 28 50 85 91 0.15
TABLE 33
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 14 33 64 90 0.34
549458 21 61 90 96 0.13
583833 26 43 70 74 0.26
583843 22 40 67 85 0.30
583847 8 30 60 84 0.46
583851 8 24 54 76 0.61
583853 24 51 70 80 0.21
583862 15 37 64 79 0.41
583866 17 48 71 91 0.24
583868 19 31 59 81 0.41
583890 0 0 17 33 >30
583892 22 38 68 83 0.27
583893 15 35 62 79 0.42
583896 13 17 49 69 0.86
583918 16 47 68 86 0.30
583919 27 60 85 91 0.14
583920 11 16 50 72 0.76
583969 12 26 66 86 0.44
583975 19 49 55 88 0.36
TABLE 34
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 14 36 64 88 0.32
549458 14 53 84 95 0.18
583917 6 30 50 70 0.64
583922 16 43 76 92 0.23
583932 9 35 64 81 0.38
583933 22 25 56 81 0.41
583990 0 9 33 56 1.92
583996 26 12 50 70 0.71
583998 4 25 38 70 0.89
583999 13 12 30 64 1.53
584002 12 46 70 92 0.25
584006 21 26 59 88 0.35
584044 23 30 51 78 0.44
584069 18 40 63 82 0.30
584100 6 5 20 44 7.79
584125 12 12 47 76 0.72
584128 20 22 41 72 0.74
584139 13 33 56 85 0.4
584141 22 37 61 85 0.29
TABLE 35
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 0 28 64 88 0.42
549458 13 49 84 91 0.19
584106 3 13 12 32 >30
584111 22 30 59 84 0.33
584130 0 10 11 37 >30
584138 2 40 62 89 0.37
584145 6 32 63 88 0.36
584148 16 48 79 95 0.20
584149 11 37 68 89 0.31
584152 28 59 87 95 0.11
584162 24 45 80 92 0.18
584163 19 37 74 90 0.25
584166 34 52 84 92 0.10
584167 13 45 76 93 0.21
584179 1 25 62 87 0.44
584180 26 56 84 96 0.12
584183 3 41 64 87 0.31
584184 9 42 76 93 0.23
584192 1 34 73 95 0.30
TABLE 36
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 2 26 61 85 0.42
549458 1 51 83 96 0.23
584157 6 6 52 82 0.59
584158 14 37 70 89 0.26
584165 12 34 66 89 0.30
584168 5 32 70 91 0.32
584233 0 30 66 86 0.39
584242 12 38 66 93 0.27
584245 4 33 69 90 0.32
584263 9 24 67 90 0.34
584269 6 26 69 92 0.34
584274 17 36 74 93 0.23
584312 17 37 65 93 0.26
584329 0 17 67 86 0.46
584361 0 18 71 87 0.41
584465 0 0 32 51 2.5 
584468 9 26 60 90 0.37
584469 13 46 73 89 0.22
584495 0 14 55 74 0.65
TABLE 37
46.9 187.5 750.0 3000.0 IC50
ISIS No nM nM nM nM (μM)
549372 9 41 66 87 0.29
549458 15 50 85 96 0.19
586124 28 47 84 94 0.13
586195 41 62 90 95 0.07
586197 27 47 77 94 0.14
586198 39 62 89 96 0.07
586199 25 56 89 97 0.13
586200 23 44 85 95 0.15
586205 34 67 89 95 0.07
586207 0 39 79 93 0.3 
586208 32 70 88 93 0.08
586212 20 60 86 94 0.13
586221 39 72 94 98 0.04
586224 39 75 93 98 0.05
586225 17 61 89 97 0.13
586227 20 60 88 96 0.13
586232 24 45 82 91 0.17
586240 14 49 83 93 0.18
586570 16 44 81 91 0.21
Example 14 Selection of Antisense Oligonucleotides Targeting Human Androgen Receptor (AR) mRNA for Assays with Prostate Cancer Cell Lines
Antisense oligonucleotides from those presented in the studies above, targeting different regions of the human AR genomic sequence, were selected for further studies in prostate cancer cell lines. AR-V7 and AR-V567es are major AR splice variants detected in cancer patients as described in Hornberg, E. et al., PLoS One 2011. Vol. 6.
The following ISIS oligonucleotides were selected for further studies: ISIS 549372, which targets the human AR genomic sequence at exon 1; ISIS 549434, which targets the human AR genomic sequence at the 3′-end of exon 8 beyond the stop codon of AR; ISIS 560131, which targets the human AR genomic sequence at intron 1; and ISIS 569236, which targets the human AR genomic sequence at intron 1. Another antisense oligonucleotide, ISIS 554221 (ACCAAGTTTCTTCAGC, designated herein as SEQ ID NO: 178), was designed as a 3-10-3 LNA gapmer with phosphorothioate backbone targeted to exon 4, (i.e. the ligand binding domain) of AR identical to an antisense oligonucleotide designated as SEQ ID NO: 58 of U.S. Pat. No. 7,737,125 for use as a benchmark.
Example 15 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA on Androgen Receptor Protein Levels in MDV3100-Resistant C4-2B Cells
C4-2B cells are androgen-independent human prostate adenocarcinoma cells commonly used in the field of oncology and have been established as clinically relevant cultured cells (Thalmann, G. N. et al., Cancer Res. 1994. 54: 2577). MDV3100 or Enzalutamide is an experimental androgen receptor antagonist drug developed by Medivation for the treatment of castration-resistant prostate cancer. ISIS 549372, ISIS 554221, and ISIS 549434 were tested in MDV3100-resistant (MR) C4-2B cells.
The cells were cultured in the presence of 5 μM concentration of MDV3100 over the course of 2 months to induce MDV3100 resistance. ISIS 549372, ISIS 549434, and ISIS 554221 at 1 μM concentration of antisense oligonucleotide were each added to the culture media at 1 μM concentration for free uptake by the cells. After a treatment period of 2 days, cells were harvested in RIPA buffer containing protease inhibitors. The presence of bands for full-length AR, as well as the variant form, AR-V7, was detected by western blot using AR antibody (N-20, Santa Cruz). Treatment of the cells with ISIS 549372 reduced full-length AR and AR-V7 more extensively than treatment with either ISIS 554221 or ISIS 549434.
Example 16 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA on AR-Target Genes in MDV3100-Resistant C4-2B Cells
The effect of antisense inhibition of AR on AR target genes was analyzed. ISIS 549372, ISIS 549458, ISIS 554221, and ISIS 549434 were tested in C4-2B MR cells.
Cells were plated at a density of 40,000 cells per well in 96-well plates and cultured in RPMI1640 medium with 10% fetal bovine serum. The cells were cultured in the presence of 5 μM concentration of MDV3100 over the course of 2 months to induce MDV3100 resistance. ISIS 549372, ISIS 549458, ISIS 549434, and ISIS 554221 were each added at 0.04 μM, 0.20 μM, 1.00 μM, and 5.00 μM concentrations of antisense oligonucleotide to culture media for free uptake by the cells. A control oligonucleotide, ISIS 347526 (sequence TCTTATGTTTCCGAACCGTT (SEQ ID NO: 179) 5-10-5 MOE gapmer) with no known target region in human gene sequences, was included as a negative control. After a treatment period of 24 hrs, total AR mRNA levels were measured by quantitative real-time PCR using primer probe set RTS3559. Human AR primer probe set hAR_LTS00943 (forward sequence GCCCCTGGATGGATAGCTACT, designated herein as SEQ ID NO: 180; reverse sequence CCACAGATCAGGCAGGTCTTC, designated herein as SEQ ID NO: 181; probe sequence ACTGCCAGGGACCATGTTTTGCCC, designated herein as SEQ ID NO: 182) was used to measure AR-V7 mRNA levels. AR mRNA levels were adjusted to human actin mRNA levels. Results are presented in Table 38 as percent inhibition of total AR, relative to untreated control cells. Treatment of the cells with ISIS 549372, ISIS 549458, and ISIS 549434 reduced total AR transcript levels in a dose dependent manner more extensively than treatment with ISIS 554221.
Western analysis of full-length AR, as well as the AR-V7 variant, was also conducted in a manner similar to the assay described above. The assay demonstrated that treatment with ISIS 549372 and ISSI 549458 reduced levels of full-length AR and AR-V7. Treatment with ISIS 549434 reduced levels of full-length AR but not that of AR-V7. Treatment with ISIS 554221 reduced levels of full-length AR less extensively compared to ISIS 549372, and did not reduce levels of AR-V7. The control oligonucleotide ISIS 347526 did not reduce protein levels, as expected.
The mRNA level of the AR target gene, KLK2 was measured using the primer probe set hKLK2_LTS00963 (forward sequence CTTGCGCCCCAGGAGTCT, designated herein as SEQ ID NO: 183; reverse sequence CTCAGAGTAAGCTCTAGCACACATGTC, designated herein as SEQ ID NO: 184; probe sequence AGTGTGTGAGCCTCCATCTCCTGTCCAA, designated herein as SEQ ID NO: 185). The mRNA level of the AR target gene, KLK3 was measured using the primer probe set RTS1072 (forward sequence GCCAAGGAGGGAGGGTCTT, designated herein as SEQ ID NO: 186; reverse sequence CCCCCCATAGTGAATCAGCTT, designated herein as SEQ ID NO: 187; probe sequence ATGAAGTAAGGAGAGGGACTGGACCCCC, designated herein as SEQ ID NO: 188). As presented in Tables 39 and 40, treatment with I ISIS 549372, ISIS 549458, and ISIS 549434 reduced target gene levels in a dose dependent manner more extensively than treatment with ISIS 554221.
TABLE 38
Percent inhibition of full-length AR mRNA in
C4-2B MR cells
ISIS No 0.04 μM 0.20 μM 1.00 μM 5.00 μM
549372 35 47 88 91
549434  9 36 66 88
549458 41 78 94 97
554221  0  0  0 23
347526 28 35 31 17
TABLE 39
Percent inhibition of KLK3 mRNA in C4-2B MR cells
ISIS No 0.04 μM 0.20 μM 1.00 μM 5.00 μM
549372 17 35 68 80
549434 10 47 42 64
549458  0 42 81 92
554221  0  0 47 56
347526  5 38 42 16
TABLE 40
Percent inhibition of KLK2 mRNA in C4-2B MR cells
ISIS No 0.04 μM 0.20 μM 1.00 μM 5.00 μM
549372 14 16 57 87
549434  5 27 49 68
549458 35 47 87 93
554221 24 25 56 66
347526 28 29 23 22
Example 17 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA on the Proliferative Ability of MDV3100-Resistant C4-2B Cells
The effect of antisense inhibition of AR on the proliferative ability of cancer cells was analyzed. ISIS 549372, ISIS 549458, ISIS 554221, and ISIS 549434 were tested in C4-2B MR cells.
ISIS 549372, ISIS 549434, ISIS 549458, and ISIS 554221 were each added to the culture media at 0.04 μM, 0.20 μM, 1.00 μM, and 5.00 μM concentration of antisense oligonucleotide. ISIS 347526 was included as a negative control. After a treatment period of 6 days, the proliferative capacity of the cancer cells was measured with using CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Table 41 as percent inhibition of proliferation, relative to non-treated cells. Treatment of the cells with ISIS 549372, ISIS 549434, and ISIS 549458 reduced proliferation of the cells in a dose dependent manner more extensively than treatment with ISIS 554221.
TABLE 41
Percent inhibition of C4-2B MR cell proliferation
ISIS No 0.04 μM 0.20 μM 1.00 μM 5.00 μM
549372  0  4 25 43
549434  0  0 21 22
549458  8 16 41 56
554221 11 12  0 24
347526 11 22  7 16
Example 18 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA on MDV3100-Resistant LMR20 Cells
An MDV3100-resistant cell line, designated as LMR20, was created. The effect of antisense inhibition of AR on the proliferative ability and AR mRNA levels of LMR20 cells was analyzed. ISIS 560131, ISIS 549458, and ISIS 569236 were tested along with the LNA gapmer, ISIS 554221.
LnCaP cells were incubated with increasing concentrations of MDV3100 for approximately 6 months. A single clone was selected after extensive culturing in the presence of 20 μM MDV3100. The clone, LMR20, maintained the ability to allow free uptake of antisense oligonucleotides without lipid-mediated transfection, while demonstrating an approximately ten-fold increase in IC50 when treated with MDV3100, compared to parental LnCaP cells.
Study 1
LMR20 cells were plated at 1,500 cells per well in phenol red-free medium with charcoal-stripped fetal bovine serum (CSS), to remove any androgens from the medium (Life Technologies). ISIS 560131, ISIS 549458, ISIS 569236, and ISIS 554221 were individually added to the culture media at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM concentration. ISIS 549148, which has no known human target sequence, was included as a control. The synthetic androgen agonist, R1881, (Takeda, A. N. et al., Mol. Pharmacol. 2007. 71: 473-82) was added on day 1 at 1 nM dose to a set of cells also treated with each of the antisense oligonucleotides. DHT was added on day 1 at a dose of 10 nM to another set of cells also treated with each of the antisense oligonucleotides. MDV3100 was added on day 1 at a dose of 10 nM to another set of cells untreated with antisense oligonucleotide, which served as a control. After a treatment period of 5 days, the proliferative ability of the cancer cells was measured by the standard MTT assay. Results are presented in Table 42 as percent inhibition of proliferation, relative to non-treated cells.
As presented in Table 42, in the presence of androgen agonists R1881 or DHT, ISIS 560131, ISIS 549458, and ISIS 569236 significantly inhibited MDV3100-resistant prostate cancer cell proliferation in a dose dependent manner more extensively than ISIS 554221 Inhibition of proliferation by the antisense oligonucleotides was also either comparable or more potent than with treatment with MDV3100.
TABLE 42
Percent inhibition of LMR20 cell proliferation
ASO ISIS ISIS ISIS ISIS
Treatment (μM) 560131 569236 549458 554221 MDV3100
CSS 0.04 0 0 0 0 0
0.20 0 10 0 1 5
1.0 9 0 0 2 0
5.0 16 12 5 16 11
CSS + 0.04 0 0 0 1 0
R1881 0.20 13 2 22 10 5
1.0 55 34 59 19 31
5.0 70 61 74 54 67
CSS + 0.04 0 0 0 0 0
DHT 0.20 13 10 25 0 1
1.0 57 32 60 10 13
5.0 71 57 70 36 41

Study 2
LMR20 cells were plated at 1,500 cells per well in phenol red-free medium with CSS. ISIS 560131, ISIS 549458, ISIS 569236, and the LNA gapmer ISIS 554221 were individually added to the culture media at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM concentration. ISIS 549148, which has no known human target sequence, was included as a control. MDV3100 was added on day 1 at a dose of 10 nM to a set of cells, and served as a control. DHT was added on day 1 at a dose of 10 nM for 72 hrs to one set of cells also treated with each of the antisense oligonucleotides or MDV3100. R1881 was added on day 1 at a dose of 10 nM for 72 hrs to another set of cells also treated with each of the antisense oligonucleotides or MDV3100. mRNA levels of AR, prostate-specific antigen (PSA) and TMPRSS2, an androgen-regulated gene (Lin, B., et al., Cancer Res. 1999. 59: 4180), were measured. Results are presented in Tables 43-45 as mRNA levels expressed as a percentage of the baseline values. mRNA levels may be lowered or increased after treatment.
As presented in Tables 43-45, ISIS 560131, ISIS 549458, and ISIS 569236 reduced AR mRNA levels in LMR20 cells, treated with or without either AR agonist, in a dose dependent manner relative to the baseline. Treatment with the LNA gapmer ISIS 554221 did not alter AR mRNA levels. ISIS 560131, ISIS 549458, and ISIS 569236 reduced PSA levels and TMPRSS2 more extensively than the LNA gapmer ISIS 554221 or MDV3100. Treatment with MDV3100 increased the levels of AR mRNA in cells treated with AR agonist, and did not reduce either PSA or TMPRSS2 mRNA levels.
TABLE 43
mRNA levels (% baseline value) of
cells without AR agonist treatment
ASO
Gene (μM) 560131 569236 549458 554221 MDV3100
AR 0.04 107 104 101 124 106
0.20 74 87 75 140 101
1.0 29 42 30 132 99
5.0 17 27 25 98 92
PSA 0.04 113 122 135 106 98
0.20 83 90 85 118 93
1.0 75 78 50 58 90
5.0 71 73 72 87 113
TMPRSS2 0.04 92 96 110 95 101
0.20 67 81 85 117 119
1.0 52 59 54 77 119
5.0 45 48 62 73 141
TABLE 44
mRNA levels (% baseline value) after treatment with DHT
ASO
Gene (μM) 560131 569236 549458 554221 MDV3100
AR 0.04 89 94 91 137 105
0.20 55 77 66 135 124
1.0 25 44 34 136 110
5.0 20 34 31 100 143
PSA 0.04 74 108 93 97 124
0.20 61 79 71 86 108
1.0 35 46 47 64 95
5.0 35 46 47 64 95
TMPRSS2 0.04 112 113 127 121 134
0.20 108 123 119 118 144
1.0 93 111 106 122 132
5.0 71 110 91 114 124
TABLE 45
mRNA levels (% baseline value) after treatment with R1881
ASO
Gene (μM) 560131 569236 549458 554221 MDV3100
AR 0.04 87 89 88 131 94
0.20 65 80 56 133 107
1.0 30 44 25 124 115
5.0 26 37 32 99 136
PSA 0.04 92 90 93 100 84
0.20 77 90 67 93 101
1.0 44 57 50 80 92
5.0 35 41 44 57 87
TMPRSS2 0.04 132 126 137 136 114
0.20 117 131 119 134 125
1.0 88 98 96 125 133
5.0 76 95 96 122 139
Example 19 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA in Combination with MDV3100 on the Proliferative Ability of C4-2B Cells
The effect of antisense inhibition of AR in combination with different doses of MDV3100 on the proliferative ability of cancer cells was analyzed. ISIS 549372, ISIS 549434, ISIS 549458, and ISIS 554221 were tested in C4-2B cells.
C4-2B cells were plated at 1,500 cells per well. ISIS 549372, ISIS 549434, ISIS 549458, or ISIS 554221 were individually added to the culture media at 0.1 μM concentration. ISIS 347526 was included as a negative control. MDV3100 was also added on day 1 at doses of 0.25 μM or 1.00 μM. After a treatment period of 6 days, the proliferative capacity of the cancer cells was measured with CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Table 46 as percent inhibition of proliferation, relative to non-treated cells. Treatment of the cells with ISIS 549372 or ISIS 549458 reduced proliferation of the cells more extensively than treatment with ISIS 554221. For instance, as presented in Table 46, treatment with ISIS 549372 alone reduced cell proliferation by 59% and treatment with ISIS 549458 reduced cell proliferation by 74% compared to ISIS 554221 alone, which reduced cell proliferation by 23%.
As presented in Tables 46 and 47, ISIS 549372 or ISIS 549458 in combination with MDV3100 inhibited prostate cancer cell proliferation to a greater extent than an equal molar concentration of ISIS 554221 in combination of MDV3100.
To find out whether treatment of the cells with ISIS 549372 or ISIS 549458 was synergistic with MDV3100, the assay was repeated at 0.1 μM ASO. As presented in Table 46, treatment with ISIS 549372 or ISIS 549458 was synergistic with MDV3100. For instance, MDV3100 alone at 0.25 μM inhibited proliferation by 4%; ISIS 549372 alone at 0.1 μM inhibited cell proliferation by 23%; in combination, cell proliferation was inhibited by 66%. Similarly, ISIS 549458 alone at 0.1 μM inhibited cell proliferation by 39%; in combination, cell proliferation was inhibited by 75%. Hence, the combination of ISIS 549372 or ISIS 549458 and MDV3100 was synergistic (i.e. greater than additive) in terms of inhibition of prostate cancer cell proliferation.
TABLE 46
Percent inhibition of C4-2B cell proliferation with 0.1 μM ASO
MDV3100
0 μM 0.25 μM 1 μM
PBS  0  9 38
ISIS 549372 23 44 66
ISIS 549458 39 59 75
ISIS 554221  9 29 59
ISIS 141923  0  4 38
TABLE 47
Percent inhibition of C4-2B cell proliferation with 0.2 μM ASO
MDV3100
0 μM 0.25 μM 1 μM
PBS  0 20 46
ISIS 549372 59 69 77
ISIS 549458 74 75 79
ISIS 554221 23 45 67
ISIS 141923  0  5 50
Example 20 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA in Combination with MDV3100 on the Proliferative Ability of LNCaP Cells
The effect of antisense inhibition of AR in combination with different doses of MDV3100 on the proliferative ability of cancer cells was analyzed. ISIS 560131 and ISIS 569236 were tested in LNCaP cells.
LNCaP cells were plated at 1,000 cells per well. ISIS 560131 or ISIS 569236 was individually added to the culture media at 0.08 μM, 0.04 μM, 0.2 μM, or 1.0 μM concentration. ISIS 549148 was included as a negative control. MDV3100 was added to the ISIS oligonucleotide-treated cells on day 2 at doses of 0.016 μM, 0.08 μM, 0.4 μM, or 2.0 μM. After a treatment period of 5 days, the proliferative capacity of the cancer cells was measured with CellTiter 96® AQueous One or CellTiter-Glo® Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 48-52 as percent inhibition of proliferation, relative to non-treated cells.
As presented in the Tables, treatment with ISIS 560131 or ISIS 569236 was synergistic with MDV3100. For instance, MDV3100 with control oligonucleotide, ISIS 549148, at 0.08 μM inhibited proliferation by an average of 7%; ISIS 560131 alone at 0.04 μM inhibited cell proliferation by 24%; in combination, cell proliferation was inhibited by 41%. Similarly, ISIS 569236 alone at 0.04 μM inhibited cell proliferation by 9%; in combination, cell proliferation was inhibited by 26%. Hence, the combination of ISIS 560131 or ISIS 569236 and MDV3100 was synergistic (i.e. greater than additive) in terms of inhibition of prostate cancer cell proliferation.
TABLE 48
Proliferation (% untreated control) in LNCaP without MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 106  76 50 26
ISIS 569236 106  91 60 35
ISIS 549148 104 101 91 82
TABLE 49
Proliferation (% untreated control) in LNCaP with
0.016 μM MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 103 71 49 25
ISIS 569236 104 92 58 29
ISIS 549148 106 86 83 59
TABLE 50
Proliferation (% untreated control) in LNCaP with
0.08 μM MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 99  59 48 27
ISIS 569236 98  74 51 31
ISIS 549148 93 101 89 90
TABLE 51
Proliferation (% untreated control) in LNCaP with
0.4 μM MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 68 50 40 26
ISIS 569236 61 48 41 27
ISIS 549148 65 57 50 48
TABLE 52
Proliferation (% untreated control) in LNCaP with
2.0 μM MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 45 42 38 23
ISIS 569236 44 41 35 23
ISIS 549148 39 42 41 32
Example 21 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA in Combination with MDV3100 on the Proliferative Ability of C4-2B Cells
The effect of antisense inhibition of AR in combination with different doses of MDV3100 on the proliferative ability of cancer cells was analyzed. ISIS 560131 and ISIS 569236 were tested in C4-2B cells.
C4-2B cells were plated at 1,000 cells per well. ISIS 560131 or ISIS 569236 was individually added to the culture media at 0.08 μM, 0.04 μM, 0.2 μM, or 1.0 μM concentration. ISIS 549148 was included as a negative control. MDV3100 was added to the ISIS oligonucleotide-treated cells on day 2 at doses of 0.016 μM, 0.08 μM, 0.4 μM, or 2.0 μM. After a treatment period of 5 days, the proliferative capacity of the cancer cells was measured with CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 53-57 as percent inhibition of proliferation, relative to non-treated cells.
As presented in the Tables, treatment with ISIS 560131 or ISIS 569236 was synergistic with MDV3100. For instance, MDV3100 with control oligonucleotide, ISIS 549148, at 0.4 μM inhibited proliferation by an average of 6%; ISIS 560131 alone at 0.08 μM inhibited cell proliferation by 16%; in combination, cell proliferation was inhibited by 31%. Similarly, MDV3100 with control oligonucleotide, ISIS 549148, at 0.08 μM did not inhibit proliferation (0%); ISIS 569236 alone at 0.2 μM inhibited cell proliferation by 37%; in combination, cell proliferation was inhibited by 52%. Hence, the combination of ISIS 560131 or ISIS 569236 and MDV3100 was synergistic (i.e. greater than additive) in terms of inhibition of prostate cancer cell proliferation.
TABLE 53
Proliferation (% untreated control) in C4-2B
without MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131  84  59  47  41
ISIS 569236 100  72  63  51
ISIS 549148 111 117 118 126
TABLE 54
Proliferation (% untreated control) in C4-2B with
0.016 μM MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 104  71  53  39
ISIS 569236 107  74  65  55
ISIS 549148 110 107 124 103
TABLE 55
Proliferation (% untreated control) in C4-2B with
0.08 μM MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 66  73  56  42
ISIS 569236 89  79  51  43
ISIS 549148 84 125 123 114
TABLE 56
Proliferation (% untreated control) in C4-2B with
0.4 μM MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 69  69 48 48
ISIS 569236 90  63 48 39
ISIS 549148 89 110 88 88
TABLE 57
Proliferation (% untreated control) in C4-2B with
2.0 μM MDV-3100
ASO Dose
0.08 μM 0.04 μM 0.2 μM 1.0 μM
ISIS 560131 37 42 49 43
ISIS 569236 44 45 48 46
ISIS 549148 47 40 52 59
Example 22 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA in Combination with MDV3100 on the Proliferative Ability of 22RV1 Cells
The effect of antisense inhibition of AR in combination with different doses of MDV3100 on the proliferative ability of cancer cells was analyzed. ISIS 560131 and ISIS 569236 were tested in 22RV1 cells.
22RV1 cells were plated at 2,000 cells per well in 5% CSS medium for 48 hours. Cells were transfected using RNAiMAX reagent with ISIS 560131 or ISIS 569236 at 0.4 nM, 1.34 nM, 4 nM, or 13.4 nM concentrations. ISIS 549148 was included as a negative control. DHT at 1 nM and/or MDV3100 at doses of 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM were added after 4 hours. After a treatment period of 3 days, the proliferative capacity of the cancer cells was measured with CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 58-62 as percent inhibition of proliferation, relative to non-treated cells.
As presented in the Tables, treatment with ISIS 560131 or ISIS 569236 was synergistic with MDV3100. For instance, MDV3100 with control oligonucleotide, ISIS 549148, at 1.0 μM inhibited proliferation by an average of 5%; ISIS 560131 alone at 1.34 nM inhibited cell proliferation by 3%; in combination, cell proliferation was inhibited by 23%. Similarly, MDV3100 with control oligonucleotide, ISIS 549148, at 1.0 μM inhibited proliferation by 5%; ISIS 569236 alone at 1.0 μM inhibited cell proliferation by 17%; in combination, cell proliferation was inhibited by 30%. Hence, the combination of ISIS 560131 or ISIS 569236 and MDV3100 was synergistic (i.e. greater than additive) in terms of inhibition of prostate cancer cell proliferation.
TABLE 58
Proliferation (% untreated control) in 22RV1
without MDV-3100
ASO Dose
0.4 nM 1.34 nM 4.0 nM 13.4 nM
ISIS 560131 103  97  77 57
ISIS 569236  97  83  69 37
ISIS 549148 109 109 109 99
TABLE 59
Proliferation (% untreated control) in 22RV1 cells with
0.04 μM MDV-3100
ASO Dose
0.4 nM 1.34 nM 4.0 nM 13.4 nM
ISIS 560131  96  80  65 39
ISIS 569236  83  70  61 24
ISIS 549148 106 106 100 85
TABLE 60
Proliferation (% untreated control) in 22RV1 cells with
0.2 μM MDV-3100
ASO Dose
0.4 nM 1.34 nM 4.0 nM 13.4 nM
ISIS 560131  95  90  76 51
ISIS 569236  93  77  60 20
ISIS 549148 101 115 110 96
TABLE 61
Proliferation (% untreated control) in 22RV1 cells with
1.0 μM MDV-3100
ASO Dose
0.4 nM 1.34 nM 4.0 nM 13.4 nM
ISIS 560131  96 77 63 40
ISIS 569236  79 70 52 18
ISIS 549148 106 95 98 82
TABLE 62
Proliferation (% untreated control) in 22RV1 cells with
5.0 μM MDV-3100
ASO Dose
0.4 nM 1.34 nM 4.0 nM 13.4 nM
ISIS 560131 91  76 63 41
ISIS 569236 82  72 52 24
ISIS 549148 96 102 98 85
Example 23 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA on CWR22-RV1 Cells
The effect of antisense inhibition of AR on the proliferative ability of cancer cells was analyzed. ISIS 549372, ISIS 549434, ISIS 549458, and ISIS 554221 were tested in CWR22-RV1 cells.
CWR22-RV1 cells were plated and transfected using RNAiMax reagent (Life Technologies) with ISIS oligonucleotides at 1.7 nM, 5.0 nM, 16.7 nM, or 50 nM concentrations. ISIS 347526 was included as a negative control. After a treatment period of 6 days, the target reduction and proliferative capacity of the cancer cells was measured.
Antisense inhibition of AR full-length mRNA was measured with the RTS3559 primer probe set. The results are presented in Table 63 as percent inhibition relative to non-treated cells. The reduction in V7 splice variant of the AR mRNA was also measured by RT-PCR using SYBR Green staining (Hu, R. et al., Cancer Res. 2009. 69: 16-22). The results are presented in Table 64, as percent reduction, relative to non-treated cells. Cell proliferation was measured with CellTiter 96® AQueous One Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Table 65 as percent inhibition of proliferation, relative to non-treated cells.
TABLE 63
Percent inhibition of AR full-length mRNA
Dose ISIS ISIS ISIS ISIS ISIS
(nM) 549372 549434 549458 554221 347526
 1.7 24 27 28 24 0
 5.0 53 46 41 41 3
16.7 64 69 61 67 4
50.0 78 86 78 72 0
TABLE 64
Percent inhibition of AR splice variant, V7
Dose ISIS ISIS ISIS ISIS ISIS
(nM) 549372 549434 549458 554221 347526
 1.7 23 0 18 25 17
 5.0 35 20 34  1  0
16.7 56  4 58  7  0
50.0 82 23 82 35 10
TABLE 65
Percent inhibition of cell proliferation
Dose ISIS ISIS ISIS ISIS ISIS
(nM) 549372 549434 549458 554221 347526
 1.7  0  8  0 17 0
 5.0  0 15  0 11 0
16.7 25 13 17 27 0
50.0 53 38 40 47 0
Example 24 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA by Free Uptake of Antisense Oligonucleotide by C4-2B Cells
The effect of free uptake of antisense oligonucleotides on AR mRNA levels was investigated. ISIS 549372, ISIS 549434, ISIS 549458, and ISIS 554221 were tested.
Cells were plated at a concentration of 1,000 cells/well in 96-well plates to measure cell proliferation, and at 4,000 cells/well to measure target reduction. ISIS 549458, ISIS 549372, ISIS 549434, and ISIS 554221 were added individually at 0.04 μM, 0.20 μM, 1.00 μM, or 5.00 μM. After an incubation period of 24 hrs, mRNA levels were measured using hAR_LTS00943. The data is presented in Table 66. The results indicate that ISIS 549458, ISIS 549372, and ISIS 549434 inhibited AR mRNA expression more potently than ISIS 554221.
On day 6, cells plated for measuring proliferation were incubated with MTT reagent until the development of color. Color intensity was measured using a spectrophotometer at 490 nm. The data is presented in Table 67.
TABLE 66
Percent inhibition of AR full-length mRNA
Dose (μM) ISIS 549372 ISIS 549434 ISIS 549458 ISIS 554221
0.04 10 10 16 0
0.20 36 35 48 0
1.00 73 52 80 0
5.00 80 55 86 0
TABLE 67
Percent inhibition of cell proliferation
Dose (μM) ISIS 549372 ISIS 549434 ISIS 549458 ISIS 554221
0.04 8 0 7 0
0.20 34 14 31 10
1.00 44 35 45 21
5.00 45 37 41 30
Example 25 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA by Free Uptake of Antisense Oligonucleotide by LnCaP Cells
The effect of free uptake of antisense oligonucleotides on AR mRNA levels was investigated.
Cells were plated at a concentration of 4,000 cells/well in 96-well plates. ISIS oligonucleotides, specified in Table 68, were added individually at 0.02 μM, 0.10 μM, 0.50 μM, 2.50 μM, or 10.00 μM. After an incubation period of 24 hrs, mRNA levels were measured using primer probe set hAR_LTS00943. The data is presented in Table 68. The results indicate that most of the ISIS oligonucleotides inhibited AR mRNA expression more potently than ISIS 554221 at each concentration.
TABLE 68
Percent inhibition of AR mRNA
ISIS No 0.02 μM 0.1 μM 0.5 μM 2.5 μM 10 μM
554221 0 0 0 0 17
549372 0 0 21 63 78
549458 4 14 67 86 89
560131 0 0 13 31 57
569213 3 0 31 59 78
569216 15 17 49 66 82
569221 18 31 49 78 91
569227 0 0 4 33 55
569236 3 2 21 43 70
579666 0 8 30 49 68
579667 0 0 8 12 40
579671 15 0 19 54 71
583918 8 0 0 0 13
584149 0 0 0 14 39
584163 0 0 19 41 70
584269 0 0 0 12 23
584468 0 0 10 44 73
586124 0 0 19 64 82
586227 0 0 14 44 59
Example 26 Effect of Antisense Inhibition of Human Androgen Receptor (AR) mRNA in the Presence of DHT on the Proliferative Ability of 22RV1 Cells
Dihydrotestosterone (DHT) is an androgen hormone and AR activator. The effect of antisense inhibition of AR on the proliferative ability of cancer cells treated with DHT was analyzed. ISIS 560131 and ISIS 569236 were tested in the human prostate carcinoma cell line, 22RV1.
22RV1cells were plated at 1,500 cells per well. ISIS 560131 and ISIS 569236 were individually transfected into the cells using RNAiMAX™ reagent (Life Technologies) at 1.34 nM, 4.00 nM, 13.4 nM, or 40.0 nM concentration. ISIS 549148, which has no known human target sequence, was included as a control. Separate sets of cells, also treated with each of the antisense oligonucleotides, were treated with DHT added on day 1 at a final concentration of 1 nM. After a treatment period of 5 days, the proliferative ability of the cancer cells was measured using the standard MTT assay. Results are presented in Table 69 as percent inhibition of proliferation, relative to non-treated cells.
As presented in Table 69, both ISIS 560131 and ISIS 569236 significantly inhibited prostate cancer cell proliferation even in the presence of AR activator, DHT, compared to the control. The control oligonucleotide did not show any effect on proliferation, as expected.
TABLE 69
Percent inhibition of 22RV1 cell proliferation
ASO (nM) ISIS 560131 ISIS 569236 ISIS 549148
−DHT 1.34 0 0 0
4.0 2 18 0
13.4 29 47 4
40.0 54 64 0
+DHT 1.34 0 0 0
4.0 1 6 0
13.4 13 32 3
40.0 34 56 0
Example 27 Time-Course Study of Treatment C4-2B Cells with ISIS Oligonucleotides Targeting AR
The effect of antisense inhibition of on C4-2B cancer cells on gene expression was analyzed. ISIS 560131 and ISIS 569236 were tested.
AR mRNA Analysis
C4-2B cells were plated at 1,000 cells per well in complete medium. ISIS 560131 or ISIS 569236 was individually added to the culture media to the final concentrations of 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM concentrations without using transfection reagent. ISIS 549148 was included as a negative control. MDV3100 was added at dose of 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM in a separate set of cells. After a treatment period of 8 hours, 24 hours, and 48 hours, AR expression was measured with primer probe set hAR-LTS00943. Results are presented in Tables 70-72 as percent expression of AR, relative to non-treated cells. Treatment of the cells with ISIS 560131 or ISIS 569236 reduced AR expression in the cells relative to the control set. Treatment with MDV-3100 increased AR expression at the 48 hour time-point.
TABLE 70
Percent expression of AR compared to the control group in 8 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 110 85 68 45
ISIS 569236 100 87 84 58
ISIS 549148 116 105 111 110
MDV-3100 99 100 92 103
TABLE 71
Percent expression of AR compared to the control group in 24 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 47 18 5 4
ISIS 569236 103 35 15 5
ISIS 549148 87 85 87 107
MDV-3100 88 99 96 84
TABLE 72
Percent expression of AR compared to the control group in 48 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 33 5 6 4
ISIS 569236 80 19 7 2
ISIS 549148 98 90 87 99
MDV-3100 94 94 113 126

AR Protein Analysis
Protein levels in the cells were also analyzed. The cells were harvested in RIPA buffer containing protease inhibitors. The presence of bands for full-length AR was detected by western blot using AR antibody (N-20, SC-816, Santa Cruz Biotechnology). Full-length AR was significantly reduced in cells treated with ISIS 560131 or ISIS 569236 for 24 hours and 48 hours, normalized to the levels of the house-keeping gene, GAPDH.
mRNA Expression Analysis of Downstream Genes
Expression analysis of prostate-specific antigen (PSA) and TMPRSS2 were also analyzed. Results are presented in Tables 73-75 as percent inhibition of PSA expression and Tables 76-78 as percent inhibition of TMPRSS2 expression, relative to non-treated cells. Treatment of the cells with ISIS 560131 or ISIS 569236 reduced PSA and TMPRSS2 expression in the cells relative to the control set at the 24 hr and 48 hr time points. Treatment with MDV-3100 also reduced downstream gene expressions but not as potently as that with the ISIS oligonucleotides.
TABLE 73
Percent inhibition of PSA expression
compared to the control group in 8 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 12 0 3 1
ISIS 569236 18 3 0 0
ISIS 549148 1 8 8 0
MDV-3100 0 3 23 33
TABLE 74
Percent inhibition of PSA expression
compared to the control group in 24 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 27 46 56 60
ISIS 569236 10 34 44 54
ISIS 549148 22 13 16 6
MDV-3100 24 24 53 65
TABLE 75
Percent inhibition of PSA expression
compared to the control group in 48 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 20 61 71 80
ISIS 569236 4 45 68 76
ISIS 549148 2 0 18 10
MDV-3100 5 5 32 63
TABLE 76
Percent inhibition of TMPRSS2 expression
compared to the control group in 8 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 0 0 6 0
ISIS 569236 0 0 0 0
ISIS 549148 5 0 0 0
MDV-3100 0 6 45 52
TABLE 77
Percent inhibition of TMPRSS2 expression
compared to the control group in 24 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 35 57 66 67
ISIS 569236 10 32 57 66
ISIS 549148 29 10 29 10
MDV-3100 23 31 63 72
TABLE 78
Percent inhibition of TMPRSS2 expression
compared to the control group in 48 hours
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 46 71 77 76
ISIS 569236 22 57 70 75
ISIS 549148 0 4 0 0
MDV-3100 5 16 46 59
Example 28 Antisense Inhibition of AR mRNA in LNCaP Cells Cultured in Complete Media and CSS Media
The effect of antisense inhibition of AR in LNCaP cells cultured in complete medium, as well as CSS medium with DHT, was investigated.
Gene Expression in Complete Medium
Cells were plated at 1,000 cells per well. ISIS 560131 or ISIS 569236 was added individually at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM. ISIS 549148 was included as a negative control. MDV3100 was added a dose of 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM. μM in a separate set of cells. After an incubation period of 48 hours, RNA levels of AR, PSA and TMPRSS2 were measured. The data is presented in Tables 79-81.
Protein analysis of full-length AR also demonstrated a dose-dependent decrease of expression, normalized to levels of the house-keeping gene, GAPDH.
TABLE 79
Percent expression of AR in LNCaP cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 101 53 17 7
ISIS 569236 98 90 47 20
ISIS 549148 102 111 109 109
MDV-3100 111 133 121 139
TABLE 80
Percent inhibition of PSA expression in LNCaP
cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 0 60 87 90
ISIS 569236 0 19 63 81
ISIS 549148 0 0 0 0
MDV-3100 0 35 84 87
TABLE 81
Percent inhibition of TMPRSS2 expression in
LNCaP cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 0 25 50 51
ISIS 569236 0 5 40 48
ISIS 549148 0 0 0 0
MDV-3100 0 0 34 39

Gene Expression in CSS Medium and CSS+DHT Media
Cells were plated at 2,000 cells per well and cultured in phenol red-free RPMI supplemented with 5% charcoal stripped serum (Gibco) media for 16 hours. ISIS 560131 or ISIS 569236 was added individually at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM to each cell set. ISIS 549148 was included as a negative control. MDV3100 was added at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM in a separate set of cells. After an incubation period of 4 hrs, DHT was added to the medium to a final concentration of 1 nM as indicated. RNAs were collected 48 hrs later and levels of AR, PSA and TMPRSS2 were measured. The data is presented in Table 82-85. In the absence of DHT, AR expression in LNCaP cells was 95%, PSA expression was 7% and TMPRSS2 expression was 24% compared to the untreated control.
TABLE 82
Percent expression of AR in LNCaP cells cultured in CSS medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 81 46 16 5
ISIS 569236 94 66 35 13
ISIS 549148 106 97 96 104
MDV-3100 91 67 64 77
TABLE 83
Percent expression of AR in LNCaP cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 101 71 27 10
ISIS 569236 104 86 55 21
ISIS 549148 98 102 96 111
MDV-3100 107 121 110 113
TABLE 84
Percent inhibition of PSA expression in
LNCaP cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 10 21 21 72
ISIS 569236 4 11 45 59
ISIS 549148 0 8 0 9
MDV-3100 15 38 81 82
TABLE 85
Percent inhibition of TMPRSS2 expression in
LNCaP cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 6 11 26 64
ISIS 569236 6 8 40 50
ISIS 549148 0 0 1 10
MDV-3100 8 24 60 69

Effect on Proliferation in CSS Medium and CSS+DHT Media
After a treatment period of 5 days in complete medium or CSS+1 nM DHT medium, the proliferative capacity of the cancer cells was measured with using CellTiter 96® AQueous One Solution or CellTiter-Glo® solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 86 and 87 as percent inhibition of proliferation, relative to non-treated cells. Treatment of the cells with ISIS 560131, ISIS 569236, and MDV-3100 reduced proliferation of the cells in a dose dependent compared to the control. Treatment with ISIS oligonucleotides in CSS+DHT medium reduced the proliferative capacity to a greater extent than treatment with MVD-3100. The proliferative capacity of cells cultured in CSS medium without DHT is 17% of untreated control levels.
TABLE 86
Proliferation (% untreated control) in LNCaP
cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 96 70 48 45
ISIS 569236 100 85 68 54
ISIS 549148 101 95 94 110
MDV-3100 107 88 65 45
TABLE 87
Proliferation (% untreated control) in
LNCaP cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 97 81 46 8
ISIS 569236 95 99 54 17
ISIS 549148 112 96 95 89
MDV-3100 112 95 74 33
Example 29 Antisense Inhibition of AR mRNA in C4-2 Cells Cultured in Complete Media and CSS Media
The effect of antisense inhibition of AR mRNA levels in C4-2 cells cultured in complete medium, as well as CSS medium with DHT, was investigated.
Gene Expression in Complete Medium
Cells were plated at 1,000 cells per well. ISIS 560131 or ISIS 569236 was added individually at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM. ISIS 549148 was included as a negative control. MDV3100 was added at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM in a separate set of cells. After an incubation period of 48 hrs, RNA levels of AR, PSA and TMPRSS2 were measured. The data is presented in Tables 88-90. Treatment with ISIS oligonucleotide inhibited AR expression, whereas treatment with MDV-3100 increased AR expression in the cells.
Protein analysis of full-length AR and PSA also demonstrated a dose-dependent decrease of expression, normalized to levels of the house-keeping gene, GAPDH.
TABLE 88
Percent expression of AR in C4-2 cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 48 13 8 8
ISIS 569236 72 27 11 9
ISIS 549148 89 90 84 86
MDV-3100 95 99 132 137
TABLE 89
Percent inhibition of PSA expression in C4-2
cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 48 78 88 89
ISIS 569236 35 62 83 88
ISIS 549148 15 24 24 23
MDV-3100 28 40 72 89
TABLE 90
Percent inhibition of TMPRSS2 expression in
C4-2 cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 29 62 76 71
ISIS 569236 17 54 67 67
ISIS 549148 2 7 10 0
MDV-3100 10 20 44 67

Gene Expression in CSS+DHT Media
Cells were plated at 2,000 cells per well and cultured in CSS media with 1 nM DHT. ISIS 560131 or ISIS 569236 was added individually at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM to each cell set. ISIS 549148 was included as a negative control. MDV3100 was added at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM in a separate set of cells. After an incubation period of 48 hrs, RNA levels of AR, PSA and TMPRSS2 were measured. The data is presented in Table 91-93. In the absence of DHT, AR expression in C4-2 cells was 153%, PSA expression was 42% and TMPRSS2 expression was 23% compared to the untreated control. Treatment with ISIS oligonucleotide inhibited AR expression, whereas treatment with MDV-3100 increased AR expression in the cells.
TABLE 91
Percent expression of AR in C4-2 cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 88 57 20 15
ISIS 569236 89 82 52 23
ISIS 549148 101 101 118 111
MDV-3100 101 109 156 148
TABLE 92
Percent inhibition of PSA expression in C4-2
cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 10 24 49 74
ISIS 569236 0 4 57 64
ISIS 549148 0 8 21 22
MDV-3100 9 8 51 73
TABLE 93
Percent inhibition of TMPRSS2 expression in C4-2
cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 10 17 51 78
ISIS 569236 0 11 61 67
ISIS 549148 3 0 22 28
MDV-3100 9 0 44 78

Effect on Proliferation in CSS Medium and CSS+DHT Media
After a treatment period of 5 days in complete medium or CSS+1 nM DHT medium, the proliferative capacity of the cancer cells was measured with using CellTiter 96® AQueous One Solution or CellTiter-Glo® Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 94 and 95 as percent inhibition of proliferation, relative to non-treated cells. Treatment of the cells with ISIS 560131, ISIS 569236, and MDV-3100 reduced proliferation of the cells in a dose dependent manner compared to the control. The proliferative capacity of cells cultured in CSS medium without DHT is 17% of untreated control levels.
TABLE 94
Proliferation (% untreated control) in C4-2
cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 104 82 70 51
ISIS 569236 103 81 57 58
ISIS 549148 106 112 91 94
MDV-3100 105 108 71 67
TABLE 95
Proliferation (% untreated control) in C4-2
cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 106 94 47 31
ISIS 569236 99 99 88 51
ISIS 549148 102 82 82 91
MDV-3100 122 124 87 22
Example 30 Antisense Inhibition of AR mRNA in C4-2B Cells Cultured in Complete Media and CSS Media
The effect of antisense inhibition of AR mRNA levels in C4-2B cells cultured in complete medium, as well as CSS medium with DHT, was investigated.
Gene Expression in Complete Medium
Cells were plated at 1,000 cells per well. ISIS 560131 or ISIS 569236 was added individually at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM. ISIS 549148 was included as a negative control. MDV3100 was added at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM in a separate set of cells. After an incubation period of 48 hrs, RNA levels of AR, PSA and TMPRSS2 were measured. The data is presented in Tables 96-98. Treatment with ISIS oligonucleotide inhibited AR expression, whereas treatment with MDV-3100 increased AR expression in the cells.
Protein analysis of full-length AR also demonstrated a dose-dependent decrease of expression, normalized to levels of the house-keeping gene, GAPDH.
TABLE 96
Percent expression of AR in C4-2B cells cultured in
complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131  34  15  14  14
ISIS 569236  61  23  20  16
ISIS 549148 101  91  88  87
MDV-3100 108 121 157 182
TABLE 97
Percent inhibition of PSA expression in C4-2B
cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 56 84 89 92
ISIS 569236 30 72 81 89
ISIS 549148  3 11 18 14
MDV-3100  8 27 73 88
TABLE 98
Percent inhibition of TMPRSS2 expression in C4-2B
cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 46 71 72 75
ISIS 569236 33 59 69 73
ISIS 549148  0  2  4  0
MDV-3100  3 24 55 71

Gene Expression in CSS+DHT Media
Cells were plated at 2,000 cells per well and cultured in CSS media with 1 nM DHT. ISIS 560131 or ISIS 569236 was added individually at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM to each cell set. ISIS 549148 was included as a negative control. MDV3100 was added at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM in a separate set of cells. After an incubation period of 48 hrs, RNA levels of AR, PSA and TMPRSS2 were measured. The data is presented in Tables 99-101. In the absence of DHT, AR expression in C4-2 cells was 188%, PSA expression was 43% and TMPRSS2 expression was 27% compared to the untreated control. Treatment with ISIS oligonucleotide inhibited AR expression, whereas treatment with MDV-3100 increased AR expression in the cells.
TABLE 99
Percent expression of AR in C4-2B cells cultured
in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131  55  31  15  13
ISIS 569236  67  49  24  19
ISIS 549148  91 104 101  95
MDV-3100 112 144 165 173
TABLE 100
Percent inhibition of PSA expression in C4-2B
cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 0 17 50 61
ISIS 569236 0  5 33 46
ISIS 549148 0  0  0  0
MDV-3100 0  0 37 45
TABLE 101
Percent inhibition of TMPRSS2 expression in
C4-2B cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 0 34 60 76
ISIS 569236 0  6 43 59
ISIS 549148 0  0  0  3
MDV-3100 0 11 48 66

Effect on Proliferation in CSS Medium and CSS+DHT Media
After a treatment period of 5 days in complete medium or CSS+1 nM DHT medium, the proliferative capacity of the cancer cells was measured with using CellTiter 96® AQueous One or CellTiter-Glo® Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 102 and 103 as percent inhibition of proliferation, relative to non-treated cells. Treatment of the cells with ISIS 560131, ISIS 569236, and MDV-3100 reduced proliferation of the cells in a dose dependent compared to the control. Treatment with ISIS oligonucleotides in CSS+DHT medium reduced the proliferative capacity to a greater extent than treatment with MVD-3100. The proliferative capacity of cells cultured in CSS medium without DHT is 12% of untreated control levels.
TABLE 102
Proliferation (% untreated control) in C4-2B
cells cultured in complete medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131  93  50  50 41
ISIS 569236  98  64  55 48
ISIS 549148 119  97 103 98
MDV-3100 131 105  72 60
TABLE 103
Proliferation (% untreated control) in C4-2B
cells cultured in CSS + DHT medium
0.04 μM 0.2 μM 1 μM 5.0 μM
ISIS 560131 111  75  49  40
ISIS 569236 109 109  67  39
ISIS 549148 109 131 119 114
MDV-3100 125 100  83  17
Example 31 Antisense Inhibition of AR mRNA in VCaP Cells Cultured in Complete Media and CSS Media
The effect of antisense inhibition of AR in VCaP prostate cancer cells (Korenchuk, S. et al., In Vivo. 2001. 15: 163-168) cultured in complete medium, as well as CSS medium with DHT, was investigated. VCaP cells express both full length AR, as well as the V7 variant.
Gene Expression in Complete Medium
Cells were plated at 10,000 cells per well. ISIS 560131 or ISIS 569236 was added individually at 1.34 nM, 4 nM, 13.4 nM, or 40 nM using RNAiMax transfection reagent. ISIS 549148 was included as a negative control. After an incubation period of 48 hrs, RNA levels of full length AR, the V7 variant, PSA and TMPRSS2 were measured. The data is presented in Tables 104-107.
Protein analysis of full-length AR and the V7 variant also demonstrated a dose-dependent decrease of expression of both compared to levels of the house-keeping gene, GAPDH.
TABLE 104
Percent inhibition of full-length AR in VCaP
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 0 59 77 84
ISIS 569236 0 41 49 74
ISIS 549148 0  8  5 17
TABLE 105
Percent inhibition of AR V7 variant in VCaP
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 0 57 78 84
ISIS 569236 0 40 53 80
ISIS 549148 0  8  0 14
TABLE 106
Percent inhibition of PSA expression in VCaP
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 2 24 35 46
ISIS 569236 7 19 40 52
ISIS 549148 2  0  0 20
TABLE 107
Percent inhibition of TMPRSS2 expression
in VCaP cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 0 0 0  4
ISIS 569236 0 0 0 36
ISIS 549148 0 0 0  0

A separate set of cells was treated with MDV-3100 at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM. After an incubation period of 48 hrs, RNA levels of full length AR, the V7 variant, PSA and TMPRSS2 were measured. The data is presented in Tables 108 expressed as percent expression of gene levels compared to the untreated control.
TABLE 108
Percent of gene expression in VCaP cells treated with
MDV-3100 and cultured in complete medium
0.04 μM 0.2 μM 1.0 μM 5.0 μM
Full length AR 136 135 160 178
AR V7 variant 172 179 244 237
PSA 105  76  75  61
TMPRSS2 131 121 135 141

Gene Expression in CSS+DHT Media
Cells were plated at 15,000 cells per well and cultured in CSS media for 16 hours. Cells were then transfected using RNAiMax reagent with ISIS 560131 or ISIS 569236 at 1.34 nM, 4 nM, 13.4 nM, or 40 nM to each cell set. ISIS 549148 was included as a negative control. After 4 hrs, 1 nM DHT was added. MDV3100 was added in a separate set of cells at doses of 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM. After an incubation period of 48 hrs, RNA levels of AR, PSA and TMPRSS2 were measured. The data is presented in Tables 109-113. In the absence of DHT, AR expression in VCaP cells was 555%, V7 variant expression was 656%, PSA expression was 11%, and TMPRSS2 expression was 22% compared to the untreated control.
TABLE 109
Percent inhibition of full-length AR in VCaP
cells cultured in CSS medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 12 16 37 38
ISIS 569236 23 21 38 35
ISIS 549148  0  0  0  0
TABLE 110
Percent inhibition of AR V7 variant in VCaP
cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 27 31 39 41
ISIS 569236 37 33 48 39
ISIS 549148 12  0  0  5
TABLE 111
Percent inhibition of PSA expression in VCaP
cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 0 35 69 73
ISIS 569236 8 25 62 74
ISIS 549148 0 3 9 0
TABLE 112
Percent inhibition of TMPRSS2 expression in VCaP
cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 0 21 49 57
ISIS 569236 6 19 40 54
ISIS 549148 0 0 0 0
TABLE 113
Percent of gene expression in VCaP cells treated with
MDV-3100 and cultured in CSS + DHT medium
0.04 μM 0.2 μM 1.0 μM 5.0 μM
Full length AR 114 94 142 233
AR V7 variant 82 65 101 181
PSA 90 72 57 30
TMPRSS2 115 96 70 42

Effect on Proliferation
After a treatment period of 5 days in complete medium or CSS+1 nM DHT medium, the proliferative capacity of the cancer cells was measured with using CellTiter 96® AQueous One or CellTiter-Glo® Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 114-116 as percent inhibition of proliferation, relative to non-treated cells. Treatment of the cells with ISIS 560131, ISIS 569236, and MDV-3100 reduced proliferation of the cells in a dose dependent compared to the control. Treatment with ISIS oligonucleotides in CSS+DHT medium reduced the proliferative capacity to a greater extent than treatment with MVD-3100. The proliferative capacity of cells cultured in CSS medium without DHT is 12% of untreated control levels.
TABLE 114
Proliferation (% untreated control) in VCaP
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 98 66 53 48
ISIS 569236 98 76 68 59
ISIS 549148 98 98 113 106
TABLE 115
Proliferation (% untreated control) in VCaP
cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 95 65 42 37
ISIS 569236 83 68 61 45
ISIS 549148 114 123 104 92
TABLE 116
Proliferation (% untreated control) in
VCaP cells treated with MDV-3100
Complete CSS + DHT
medium medium
0.04 μM 49 117
 0.2 μM 44 119
 1.0 μM 27 71
 5.0 μM 17 65

Effect on Apoptosis
After a treatment period of 72 hours in complete medium, apoptosis of the cancer cells was measured with Caspase-Glo 3/7 assay (Promega). Results are presented in Tables 117 and 118 as percent apoptosis of the cells, relative to non-treated cells. Treatment of the cells with ISIS 560131, ISIS 569236, and MDV-3100 increased apoptosis of the cells in a dose dependent compared to the control.
Apoptosis was also measured by protein western blot analysis of cleaved PARP levels, which were shown to be increased in a dose-dependent manner in cells treated with ISIS 560131, ISIS 569236, and MDV-3100.
TABLE 117
Apoptosis (% untreated control) in VCaP cells
cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 189 253 356 262
ISIS 569236 176 293 402 581
ISIS 549148 131 108 103 146
TABLE 118
Apoptosis (% untreated control) in VCaP cells treated with MDV-3100
%
0.04 μM 186
 0.2 μM 210
 1.0 μM 612
 5.0 nM 528
Example 32 Antisense Inhibition of AR mRNA in 22RV1 Cells Cultured in Complete Media and CSS Media
The effect of antisense inhibition of AR in 22RV1 cells cultured in complete medium, as well as CSS medium with DHT, was investigated.
Gene Expression in Complete Medium
Cells were plated at 1,000 cells per well. ISIS 560131 or ISIS 569236 was added individually at 1.34 nM, 4 nM, 13.4 nM, or 40 nM using RNAiMax transfection reagent. ISIS 549148 was included as a negative control. After an incubation period of 48 hrs, RNA levels of full length AR, the V7 variant, PSA and TMPRSS2 were measured. The data is presented in Tables 119-122.
Protein analysis of full-length AR and the V7 variant also demonstrated a dose-dependent decrease of expression compared to levels of the house-keeping gene, GAPDH.
TABLE 119
Percent inhibition of full-length AR in 22RV1
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 7 19 49 76
ISIS 569236 17 15 37 71
ISIS 549148 6 0 11 17
TABLE 120
Percent inhibition of AR V7 variant in 22RV1
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 12 29 57 81
ISIS 569236 30 2 46 81
ISIS 549148 0 0 22 26
TABLE 121
Percent inhibition of PSA expression in 22RV1
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 10 20 27 36
ISIS 569236 0 17 25 7
ISIS 549148 9 11 17 27
TABLE 122
Percent inhibition of TMPRSS2 expression in 22RV1
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 7 3 19 32
ISIS 569236 0 13 21 36
ISIS 549148 15 9 14 4

A separate set of cells was treated with MDV-3100 at 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM. After an incubation period of 48 hrs, RNA levels of full length AR, the V7 variant, PSA and TMPRSS2 were measured. The data is presented in Tables 123 expressed as percent expression of gene levels compared to the untreated control.
TABLE 123
Percent of gene expressionin 22RV1 cells treated
with MDV-3100 and cultured in complete medium
0.04 μM 0.2 μM 1.0 μM 5.0 μM
Full length AR 103 93 81 83
AR V7 variant 106 98 87 77
PSA 83 70 71 86
TMPRSS2 101 80 82 93

Gene Expression in CSS+DHT Media
Cells were plated at 2,000 cells per well and cultured in CSS media for 16 hours. Cells were then transfected using RNAiMax reagent with ISIS 560131 or ISIS 569236 at 1.34 nM, 4 nM, or 13.4 nM to each cell set. ISIS 549148 was included as a negative control. After 4 hrs, 1 nM DHT was added. MDV3100 was added in a separate set of cells at doses of 0.04 μM, 0.2 μM, 1.0 μM, or 5.0 μM. After an incubation period of 48 hrs, RNA levels of AR, AR V7 variant, PSA and TMPRSS2 were measured. The data is presented in Tables 124-128. In the absence of DHT, AR expression in VCaP cells was 555%, V7 variant expression was 656%, PSA expression was 11%, and TMPRSS2 expression was 22% compared to the untreated control.
Treatment with ISIS oligonucleotides resulted in significant inhibition of full length AR and the V7 variant, as well as downstream gene expression. Treatment with ISIS oligonucleotides resulted in inhibition of gene expression to a greater extent than treatment with MVD-3100.
TABLE 124
Percent inhibition of full-length AR in 22RV1
cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM
ISIS 560131 65 85 93
ISIS 569236 59 89 97
ISIS 549148 2 13 22
TABLE 125
Percent inhibition of AR V7 variant in 22RV1
cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM
ISIS 560131 63 83 93
ISIS 569236 54 88 97
ISIS 549148 19 19 32
TABLE 126
Percent inhibition of PSA expression in 22RV1
cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM
ISIS 560131  3 50 66
ISIS 569236 28 49 70
ISIS 549148  8 23 29
TABLE 127
Percent inhibition of TMPRSS2 expression in
22RV1 cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM
ISIS 560131 39 50 59
ISIS 569236 27 50 75
ISIS 549148  0  3  1
TABLE 128
Percent of gene expression in 22RV1 cells treated with
MDV-3100 and cultured in CSS + DHT medium
0.04 μM 0.2 μM 1.0 μM 5.0 μM
Full length AR  5 11  6 18
AR V7 variant 16 17 19 12
PSA 15 19 18 16
TMPRSS2 17  9 26 18

Effect on Proliferation
After a treatment period of 5 days in complete medium, the proliferative capacity of the cancer cells was measured with using CellTiter 96® AQueous One or CellTiter-Glo® Solution Cell Proliferation kit (Promega), following the manufacturer's instructions. Results are presented in Tables 129 and 130 as percent inhibition of proliferation, relative to non-treated cells. Treatment of the cells with ISIS 560131, ISIS 569236, and MDV-3100 reduced proliferation of the cells in a dose dependent compared to the control. Treatment with ISIS oligonucleotides in CSS+DHT medium reduced the proliferative capacity to a greater extent than treatment with MVD-3100. The proliferative capacity of cells cultured in CSS medium without DHT is 12% of untreated control levels.
TABLE 129
Proliferation (% untreated control) in 22RV1
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 94 72  50 17
ISIS 569236 92 53  20  7
ISIS 549148 97 97 101 83
TABLE 130
Proliferation (% untreated control) in
22RV1 cells treated with MDV-3100
%
0.04 μM 87
0.2 μM 83
1.0 μM 81
5.0 μM 74

Effect on Apoptosis
After a treatment period of 72 hours in complete medium or CSS+DHT medium, apoptosis of the cancer cells was measured with Caspase-glo 3/7 assay kit (Promega). Results are presented in Tables 131 and 132 as percent apoptosis of the cells, relative to non-treated cells. Treatment of the cells with ISIS 560131 and ISIS 569236 increased apoptosis of the cells in a dose dependent compared to the control.
TABLE 131
Apoptosis (% untreated control) in 22RV1
cells cultured in complete medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 99 127 131  566
ISIS 569236 91 141 333 1452
ISIS 549148 81  76  72  123
TABLE 132
Apoptosis (% untreated control) in 22RV1
cells cultured in CSS + DHT medium
1.34 nM 4.0 nM 13.4 nM 40 nM
ISIS 560131 121 113 172  518
ISIS 569236 127 106 257 1136
ISIS 549148 113  94 102  108
Example 33 Effect of ISIS Antisense Oligonucleotides Targeting Human Androgen Receptor in Cynomolgus Monkeys
Cynomolgus monkeys were treated with ISIS antisense oligonucleotides selected from studies described above. Antisense oligonucleotide efficacy and tolerability were evaluated. The human antisense oligonucleotides tested are cross-reactive with the rhesus genomic sequence (GENBANK Accession No. NW_001218131.1 truncated from nucleotides 134001 to 308000 and designated herein as SEQ ID NO: 189). The target start site and target region of each oligonucleotide to SEQ ID NO: 189, as well as the details of their chemistry and sequence, is presented in Table 133.
TABLE 133
Antisense oligonucleotides complementary to SEQ ID NO: 189
SEQ
Target Start Target ID
ISIS No Site Region Sequence Chemistry NO
560131 59450 Intron TTGATTTAATGGTTGC Deoxy, MOE, and (S)-cEt 35
569213 59449 Intron TGATTTAATGGTTGCA Deoxy, MOE, and (S)-cEt 39
59479 TGATTTAATGGTTGCA 39
569216 59449 Intron TGATTTAATGGTTGCA Deoxy, MOE, and (S)-cEt 39
59479 TGATTTAATGGTTGCA 39
569221 59449 Intron TGATTTAATGGTTGCA Deoxy, MOE, and (S)-cEt 39
59479 TGATTTAATGGTTGCA 39
569236 59449 Intron TGATTTAATGGTTGCA Deoxy, MOE, and (S)-cEt 39
59479 TGATTTAATGGTTGCA 39
579671 59450 Intron TTGATTTAATGGTTGC Deoxy, MOE, and (S)-cEt 35
586124 59448 Intron GATTTAATGGTTGCAA 3-10-3 (S)-cEt 43
583918 3754 Exon AGTCGCGACTCTGGTA 3-10-3 (S)-cEt 124
584149 7260 Intron GTCAATATCAAAGCAC 3-10-3 (S)-cEt 150
584163 9811 Intron GAACATTATTAGGCTA 3-10-3 (S)-cEt 155
584269 41322 Intron CCTTATGGATGCTGCT 3-10-3 (S)-cEt 169
584468 109552 Intron CATTGTACTATGCCAG 3-10-3 (S)-cEt 175

Treatment
Prior to the study, the monkeys were kept in quarantine for a 30-day period, during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed between 2 and 4 kg. Thirteen groups of four randomly assigned male cynomolgus monkeys each were injected subcutaneously with ISIS oligonucleotide or PBS. PBS solution or ISIS oligonucleotides, at a dose of 40 mg/kg, were administered with a loading regimen consisting of four doses on the first week of the study (days 1, 3, 5, and 7), followed by a maintenance regimen consisting of once weekly administration starting on Day 14 (weeks 2 to 6). Subcutaneous injections were performed in clock-wise rotations at 4 sites on the back; one site per dose. The injection sites were delineated by tattoo, while sedated using ketamine, and were separated by a minimum of 3 cm.
During the study period, the monkeys were observed a minimum of once daily for signs of illness or distress. The protocols described in the Example were approved by the Institutional Animal Care and Use Committee (IACUC).
Target Reduction
RNA Analysis
RNA was extracted from liver, heart, skeletal muscle, kidney, and prostate tissues for real-time PCR analysis of AR using primer probe set RTS3559. The results were normalized to RIBOGREEN®. Results are presented as percent inhibition of AR mRNA, relative to PBS control. As shown in Table 134, treatment with ISIS antisense oligonucleotides resulted in significant reduction of AR mRNA, relative to the PBS control. ‘n/a’ indicates that mRNA levels were not measured in that organ.
TABLE 134
Percent Inhibition of AR mRNA in the
cynomolgus monkey relative to the PBS control
Skeletal
ISIS No Heart Muscle Kidney Liver Prostate
560131 32 30 19 65 27
569221 52 35 31 60 n/a
569236 42 47 42 33 32
579671 24 31 53 33 n/a
583918 76 74 73 88 58
584149 33 63 77 93 45
584163 53 73 90 98 58
584269 72 76 92 96 41
584468 33 53 88 97 50

Protein Analysis
Serum testosterone protein levels were measured in the plasma with an ELISA kit (Enzo Life Sciences), following the manufacturer's instructions. The results are presented in Table 135, expressed in ng/mL. The results indicate that some of the ISIS oligonucleotides reduced testosterone protein levels.
TABLE 135
Testosterone protein levels
in the cynomolgus monkey
ng/mL
PBS 12.6
ISIS 560131 14.7
ISIS 569221  8.8
ISIS 569236 12.7
ISIS 579671  7.3
ISIS 584269 14.1
ISIS 584468 13.6

Tolerability Studies
Body and Organ Weight Measurements
To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body and organ weights were measured. Body weights were measured on day 42 and are presented in Table 136. Organ weights were measured at the time of euthanasia and the data is also presented in Table 136. Specifically, treatment with ISIS 560131 was well tolerated in terms of the body and organ weights of the monkeys.
TABLE 136
Final body and organ weights in cynomolgus monkeys
Mesenteric
Body Spleen Heart Kidney lymph Liver
Treatment Wt (kg) (g) (g) (g) nodes (g) (g)
PBS 2.5 2.6 8.5 13 1.4 58
ISIS 560131 2.4 2.5 9.8 12 2.0 58
ISIS 569213 2.4 5.3 8.3 16 2.4 69
ISIS 569216 2.6 4.9 9.3 15 2.7 71
ISIS 569221 2.5 3.3 8.5 14 3.5 68
ISIS 569236 2.4 3.2 8.4 12 2.4 56
ISIS 579671 2.4 3.2 8.8 14 2.5 62
ISIS 586124 2.5 3.3 9.4 14 2.8 58
ISIS 583918 2.5 4.6 8.9 12 3.5 60
ISIS 584149 2.5 2.2 9.3 13 2.1 60
ISIS 584163 2.5 3.2 8.4 15 3.3 54
ISIS 584269 2.5 4.7 8.7 13 3.6 60
ISIS 584468 2.5 4.1 8.3 13 3.8 60

Liver Function
To evaluate the effect of ISIS oligonucleotides on hepatic function, the monkeys were fasted overnight. Approximately, 1.5 mL of blood samples were collected on day 44 from all the study groups. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min. Levels of various liver function markers were measured using a Toshiba 120FR NEO chemistry analyzer (Toshiba Co., Japan). The results are presented in Table 137. Specifically, treatment with ISIS 560131 was well tolerated in terms of the liver function markers.
TABLE 137
Liver function markers in cynomolgus
monkey plasma
Albumin AST ALT
Treatment (g/dL) (IU/L) (IU/L)
PBS 4.2 37 39
ISIS 560131 4.0 87 68
ISIS 569213 3.7 80 47
ISIS 569216 3.7 93 75
ISIS 569221 4.0 73 48
ISIS 569236 4.1 45 35
ISIS 579671 4.0 53 56
ISIS 586124 3.9 94 56
ISIS 583918 4.1 73 75
ISIS 584149 4.5 58 57
ISIS 584163 4.2 68 50
ISIS 584269 4.0 81 75
ISIS 584468 4.0 52 46

Hematology
To evaluate any effect of ISIS oligonucleotides in cynomolgus monkeys on hematologic parameters, blood samples of approximately 0.5 mL of blood was collected day 44 from each of the available study animals in tubes containing K2-EDTA. Samples were analyzed for red blood cell (RBC) count, white blood cells (WBC) count, platelet count, hemoglobin content and hematocrit, using an ADVIA2120i hematology analyzer (SIEMENS, USA). The data is presented in Table 138.
The data indicate treatment with most of the oligonucleotides did not cause any changes in hematologic parameters outside the expected range for antisense oligonucleotides at this dose. Specifically, treatment with ISIS 560131 was well tolerated in terms of the hematology of the monkeys.
TABLE 138
Hematological parameters in cynomolgus monkeys
RBC Platelets WBC Hemo-
(×106 (×103 (×103 globin HCT
Treatment μL) μL) μL) (g/dL) (%)
PBS 5.3 426 13.6 13.2 43
ISIS 560131 5.8 392 11.3 13.1 44
ISIS 569213 5.6 426 12.9 12.5 42
ISIS 569216 5.6 504 12.2 12.8 43
ISIS 569221 5.6 406 11.1 12.9 45
ISIS 569236 5.7 358 14.4 13.1 44
ISIS 579671 5.4 438 10.0 12.5 42
ISIS 586124 5.8 391 10.4 13.6 45
ISIS 583918 5.8 435 12.7 13.3 46
ISIS 584149 5.7 478 11.3 13.7 45
ISIS 584163 5.5 461  9.1 12.8 44
ISIS 584269 5.2 522  9.8 12.4 41
ISIS 584468 5.9 408 11.1 13.5 45

Kidney Function
To evaluate the effect of ISIS oligonucleotides on kidney function, the monkeys were fasted overnight. Approximately, 1.5 mL of blood samples were collected from all the study groups on day 44. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min. Levels of BUN and creatinine were measured using a Toshiba 120FR NEO chemistry analyzer (Toshiba Co., Japan). Results are presented in Table 139, expressed in mg/dL. The plasma chemistry data indicate that most of the ISIS oligonucleotides did not have any effect on the kidney function outside the expected range for antisense oligonucleotides. Specifically, treatment with ISIS 560131 was well tolerated in terms of the kidney function of the monkeys.
Kidney function was also assessed by urinalysis. Fresh urine from all animals was collected on day 44 using a clean cage pan on wet ice. Food was removed overnight the day before fresh urine collection was done but water was supplied. The total protein and creatinine levels were measured using a Toshiba 120FR NEO automated chemistry analyzer (Toshiba Co., Japan) and the protein to creatinine ratio was calculated. The results are presented in Table 140.
TABLE 139
Plasma BUN and creatinine levels
(mg/dL) in cynomolgus monkeys
Treatment BUN Creatinine
PBS 30.5 0.78
ISIS 560131 23.7 0.84
ISIS 569213 29.4 0.91
ISIS 569216 28.4 0.81
ISIS 569221 20.2 0.86
ISIS 569236 24.9 0.87
ISIS 579671 22.7 0.74
ISIS 586124 23.8 0.87
ISIS 583918 24.5 0.87
ISIS 584149 26.4 0.85
ISIS 584163 22.4 0.82
ISIS 584269 21.8 0.89
ISIS 584468 22.2 0.78
TABLE 140
Urine protein/creatinine ratio
in cynomolgus monkeys
Treatment Ratio
PBS 0.00
ISIS 560131 0.02
ISIS 569213 0.02
ISIS 569216 0.08
ISIS 569221 0.00
ISIS 569236 0.02
ISIS 579671 0.00
ISIS 586124 0.01
ISIS 583918 0.01
ISIS 584149 0.01
ISIS 584163 0.01
ISIS 584269 0.00
ISIS 584468 0.00

C-Reactive Protein Level Analysis
To evaluate any inflammatory effect of ISIS oligonucleotides in cynomolgus monkeys, the monkeys were fasted overnight. Approximately, 1.5 mL of blood samples were collected from all the study groups on day 44. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 min and then centrifuged at 3,000 rpm for 10 min. C-reactive protein (CRP), which is synthesized in the liver and which serves as a marker of inflammation, was measured on day 43 using a Toshiba 120FR NEO chemistry analyzer (Toshiba Co., Japan). Complement C3 was also measured similarly, and the data is presented as a percentage of baseline values. The results are presented in Table 141 and indicate that treatment with most of the ISIS oligonucleotides did not cause any inflammation in monkeys.
TABLE 141
C-reactive protein and C3 levels
in cynomolgus monkey plasma
CRP C3 (% of
Treatment (mg/dL) baseline)
PBS 2.5 118
ISIS 560131 1.7 100
ISIS 569213 2.8  60
ISIS 569216 3.6  94
ISIS 569221 4.9  91
ISIS 569236 2.6 103
ISIS 579671 4.5 101
ISIS 586124 4.0  93
ISIS 583918 3.5  89
ISIS 584149 1.7 110
ISIS 584163 1.0 102
ISIS 584269 4.9 102
ISIS 584468 1.3 111

Pharmacokinetics Studies
The concentrations of the full-length oligonucleotide in the kidney and the liver of select treatment groups were measured. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. An internal standard (ISIS 355868, a 27-mer 2′-O-methoxyethyl modified phosphorothioate oligonucleotide, GCGTTTGCTCTTCTTCTTGCGTTTTTT, designated herein as SEQ ID NO: 190) was added prior to extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 μg/g.
The results are presented in Table 142, expressed as μg/g tissue. The kidney to liver ratio was also calculated and is presented in Table 142.
TABLE 142
Oligonucleotide concentration of in
cynomolgous monkeys
Treatment Liver Kidney K/L ratio
ISIS 560131 793 2029 2.6
ISIS 569221 966 1372 1.4
ISIS 569236 898 1282 1.4
ISIS 579671 871 2576 3.0
ISIS 584269 698 2823 4.0
ISIS 584468 474 2441 5.2
Example 34 Effect of Antisense Inhibition of Androgen Receptor (AR) on an Androgen Receptor-Dependent Breast Cancer Orthotopic Model
MDA-MB-453 cells express AR in the absence of estrogen receptors and progesterone receptor (Hall, R. E. et al., Eur. J. Cancer 1994. 30: 484-490). The effect of inhibition of AR mRNA expression with antisense oligonucleotides was examined in MDA-MB-453 tumor-bearing mice.
Study 1
ISIS 569216 (TGATTTAATGGTTGCA; SEQ ID NO: 39), which is the antisense oligonucleotide tested in the assay, was designed as a deoxy, MOE and (S)cEt oligonucleotide, and is 16 nucleosides in length. The chemistry of the oligonucleotide is 5′-Te Gk Ak Tk Td Td Ad Ad Td Gd Gd Td Tk Gk Ck A, where ‘e’ denotes a 2′-O-methoxyethyl ribose; ‘k’ denotes an (S)-cEt; ‘d’ denotes a 2′-deoxyribose. The internucleoside linkages throughout the oligonucleotide are phosphorothioate (P═S) linkages. All cytosine residues throughout the oligonucleotide are 5-methylcytosines. ISIS 569216 has two target start sites, 58720 and 58750, on the human AR genomic sequence (GENBANK Accession No. NT_011669.17 truncated from nucleosides 5079000 to 5270000, SEQ ID NO: 1).
Treatment
MDA-MB-453 breast carcinoma cells (5×106), mixed with 50% Matrigel, were injected into the mammary fat pad of 10 female NSG mice. Dihydrotestosterone (DHT) pellets, the active form of the major circulating androgen, testosterone, were implanted subcutaneously at the same time. Once the tumor reached a size of 100 mm3, the mice were randomly divided into two treatment groups. The first treatment group was injected with ISIS 569216 administered by subcutaneous injection at a dose of 50 mg/kg five times a week for 4 weeks. The second treatment group was injected with vehicle only, administered by subcutaneous injection five times a week for 4 weeks, and served as the control group. Tumor growth was monitored once a week and mice were sacrificed on day 32 after treatment. Tumor tissue and TB-interface samples were collected and processed for further analysis.
RNA Analysis
Tumors were excised and the tissue was processed for RNA extraction and qPCR analyses. AR mRNA expression was assessed at the TB-interface and normalized to actin mRNA expression. AR mRNA expression in mice treated with ISIS 569216 was inhibited by 48% compared to the control group.
Measurement of Tumor Volume
Tumor volumes were measured on a regular basis throughout the study period, using Vernier calipers. As shown in Table 143, tumor volumes were significantly decreased in mice treated with ISIS 569216 compared to the control group.
TABLE 143
Tumor volume on different days in the
MDA_MB-453 cancer orthotopic model
Day 16 Day 23 Day 30 Day 37 Day 44 Day 51
ISIS 569216 134 142 173 125 92 73
Control 111 141 155 195 287 347

Study 2.
Treatment
MDA-MB-453 cells obtained from ATCC were maintained in Leibovitz's L-15 media with 10% FBS. Female NSG mice (Jackson Laboratories) were implanted in the mammary fat pad with 5×106 tumor cells in growth-factor-reduced matrigel (1:1). DHT pellets were also implanted at the same time in the mice between the shoulder blades.
After 20 days, the mice were then randomly divided into treatment groups. Groups of mice were injected with 50 mg/kg of ISIS 569236 or ISIS 560131 administered subcutaneously 5 days per week for 2 weeks. A group of mice were similarly treated with control oligonucleotide, ISIS 549148 (a 3-10-3 (S)-cEt gapmer with sequence GGCTACTACGCCGTCA, designated herein as SEQ ID NO: 193, with no known human sequence). Another control group of mice was similarly treated with PBS.
Measurement of Tumor Growth
Tumor volumes were measured on a regular basis throughout the study period, using Vernier calipers. As shown in Table 144, tumor volumes were decreased in mice treated with antisense oligonucleotides targeting AR compared to the control group.
TABLE 144
Tumor volumes in the MDA-MB-453 model
Day Day Day
0 Day 8 Day 13 20 Day 23 Day 27 29
PBS 136 336 331 358 338 417 481
ISIS 549148 148 303 312 365 413 490 550
ISIS 560131 144 261 243 204 232 233 258
ISIS 569236 134 283 260 230 264 329 323

RNA Analysis
RNA extraction was performed using an RNA extraction kit from Qiagen. AR RNA expression was measured using primer probe set LTS00943 and normalized to human actin mRNA expression.
Human AR RNA expression was assessed in tumor tissue. AR RNA expression in mice treated with ISIS 560131 was inhibited by 35% and AR expression in mice treated with ISIS 569236 was inhibited by 19% compared to the control group.

Claims (50)

What is claimed:
1. A single-stranded modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising an at least 12 11 contiguous nucleobase portion of SEQ ID NO: 12 or 175, wherein the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1 and comprises:
a gap segment consisting of linked deoxynucleosides;
a 5′ wing segment consisting of linked nucleosides;
a 3′ wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
2. The single-stranded modified oligonucleotide of claim 1, wherein each internucleoside linkage is a phosphorothioate linkage.
3. The single-stranded modified oligonucleotide of claim 1, wherein the modified sugar comprises a 2′-O-methoxyethyl sugar.
4. The single-stranded modified oligonucleotide of claim 1, wherein the modified sugar comprises a bicyclic sugar.
5. The single-stranded modified oligonucleotide of claim 4, wherein the bicyclic sugar comprises a group selected from: 4′-CH(CH3)-O-2′ 4′-CH(CH3)—O-2′, 4′-CH2-O-2′ 4′-CH2—O-2′, and 4′-(CH2)2-O-2′ 4′-(CH2)2—O-2′.
6. The single-stranded modified oligonucleotide of claim 1, wherein each cytosine is a 5-methylcytosine.
7. The single-stranded modified oligonucleotide of claim 1, wherein the modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
8. The single-stranded modified oligonucleotide of claim 1, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked deoxynucleosides;
a 5′ wing segment consisting of linked nucleosides;
a 3′ wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, each nucleoside of each wing segment comprises a modified sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.
9. The single-stranded modified oligonucleotide of claim 8, wherein the modified sugar comprises a 2′-O-methoxyethyl sugar.
10. The single-stranded modified oligonucleotide of claim 8, wherein the modified sugar comprises a bicyclic sugar.
11. The single-stranded modified oligonucleotide of claim 10, wherein the bicyclic sugar comprises a group selected from: 4′-CH(CH3)-O-2′ 4′-CH(CH3)—O-2′, 4′-CH2-O-2′ 4′-CH2—O-2′, and 4′-(CH2)2-O-2′ 4′-(CH2)2—O-2′.
12. A single-stranded modified oligonucleotide consisting of 16 to 30 linked nucleosides having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 12, 13, 35, 39, 43, 124, 150, 155, 169, or 175, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked deoxynucleosides;
a 5′ wing segment consisting of linked nucleosides;
a 3′ wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
13. The single-stranded modified oligonucleotide of claim 12, wherein each internucleoside linkage is a phosphorothioate linkage.
14. The single-stranded modified oligonucleotide of claim 12, wherein the modified sugar comprises a 2′-O-methoxyethyl sugar.
15. The single-stranded modified oligonucleotide of claim 12, wherein the modified sugar comprises a bicyclic sugar.
16. The single-stranded modified oligonucleotide of claim 15, wherein the bicyclic sugar comprises a group selected from: 4′-CH(CH3)-O-2′ 4′-CH(CH3)—O-2′, 4′-CH2-O-2′ 4′-CH2—O-2′, and 4′-(CH2)2-O-2′ 4′-(CH2)2—O-2′.
17. The single-stranded modified oligonucleotide of claim 12, wherein each cytosine is a 5-methylcytosine.
18. The single-stranded modified oligonucleotide of claim 12, wherein the modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
19. The single-stranded modified oligonucleotide of claim 12, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked deoxynucleosides;
a 5′ wing segment consisting of linked nucleosides;
a 3′ wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, each nucleoside of each wing segment comprises a modified sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.
20. The single-stranded modified oligonucleotide of claim 12, wherein the modified oligonucleotide consists of 16 linked nucleosides having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 12, 13, 35, 39, 43, 124, 150, 155, 169, or 175.
21. The single-stranded modified oligonucleotide of claim 20, wherein each internucleoside linkage is a phosphorothioate linkage.
22. The single-stranded modified oligonucleotide of claim 20, wherein the modified sugar comprises a 2′-O-methoxyethyl sugar.
23. The single-stranded modified oligonucleotide of claim 20, wherein the modified sugar comprises a bicyclic sugar.
24. The single-stranded modified oligonucleotide of claim 23, wherein the bicyclic sugar comprises a group selected from: 4′-CH(CH3)-O-2′ 4′-CH(CH3)—O-2′, 4′-CH2-O-2′ 4′-CH2—O-2′, and 4′-(CH2)2-O-2′ 4′-(CH2)2—O-2′.
25. The single-stranded modified oligonucleotide of claim 20, wherein each cytosine is a 5-methylcytosine.
26. The single-stranded modified oligonucleotide of claim 20, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 43, 124, 150, 155, 169, or 175, and wherein the modified oligonucleotide comprises:
a gap segment consisting of ten linked deoxynucleosides;
a 5′ wing segment consisting of 3 linked nucleosides; and
a 3′ wing segment consisting of 3 linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein each nucleoside of each wing segment comprises a constrained ethyl nucleoside; wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate linkage; and wherein each cytosine of the modified oligonucleotide is a 5-methylcytosine.
27. A method of treating cancer in a subject comprising administering to the subject the compound of claim 26, thereby treating cancer in the subject.
28. The method of claim 27, wherein the cancer is prostate cancer, breast cancer, ovarian cancer, gastric cancer, or bladder cancer.
29. The method of claim 27, wherein the cancer is castrate-resistant prostate cancer.
30. The method of claim 29, wherein the castrate-resistant prostate cancer is resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700, and VT464.
31. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consisting of the sequence of SEQ ID NO: 35, and is a pharmaceutically acceptable salt selected from the group consisting of sodium and potassium salts, wherein the modified oligonucleotide comprises:
a gap segment consisting of 9 linked deoxynucleosides;
a 5′ wing segment consisting of three linked nucleosides; and
a 3′ wing segment consisting of four linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the sugars of the three linked nucleosides of the 5′ wing segment are each a constrained ethyl (cEt) sugar; wherein the sugars of the four linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
32. A compound comprising a single-stranded modified oligonucleotide consisting of 16 linked nucleosides, wherein the modified oligonucleotide has a nucleobase sequence consisting of the sequence of SEQ ID NO: 39 and is a pharmaceutically acceptable salt selected from the group consisting of sodium and potassium salts, wherein the modified oligonucleotide comprises:
a gap segment consisting of 7 linked deoxynucleosides;
a 5′ wing segment consisting of four linked nucleosides; and
a 3′ wing segment consisting of five linked nucleosides;
wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment; wherein the sugars of the four linked nucleosides of the 5′ wing segment are a 2′-O-methoxyethyl sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, and a constrained ethyl (cEt) sugar in the 5′ to 3′ direction; wherein the sugars of the five linked nucleosides of the 3′ wing segment are a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a constrained ethyl (cEt) sugar, a 2′-O-methoxyethyl sugar, and a 2′-O-methoxyethyl sugar in the 5′ to 3′ direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
33. A composition comprising the compound of claim 31 or claim 32, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable diluent or carrier.
34. A combination comprising the compound of claim 31 or claim 32, or a pharmaceutically acceptable salt thereof, and an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
35. The combination of claim 34, wherein the anti-androgenic agent is MDV3100.
36. A method of treating cancer comprising administering to a subject having cancer a compound or salt of claim 31 or claim 32, thereby treating cancer in the subject.
37. The method of claim 36, wherein the cancer is prostate cancer, breast cancer, ovarian cancer, gastric cancer or bladder cancer.
38. The method of claim 36, wherein the cancer is castrate-resistant prostate cancer.
39. The method of claim 38, wherein the castrate-resistant prostate cancer is resistant to an anti-androgenic agent selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
40. A method of treating prostate cancer in a patient in need thereof, comprising administering to the patient a compound or salt of claim 31 or claim 32 and an anti-androgenic agent.
41. The method of claim 40, wherein the anti-androgenic agent is selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
42. The method of claim 40, wherein the compound and the anti-androgenic agent synergize in combination to inhibit the growth or proliferation of the prostate cancer cell.
43. The method of claim 40, wherein the patient is administered an amount of the compound and an amount of anti-androgenic agent that are each or both less in combination than the amount of either the compound or anti-androgenic agent alone effective in inhibiting the growth or proliferation of said prostate cancer cell.
44. A method of inhibiting growth or proliferation of an androgen receptor (AR)-positive breast cancer cell comprising contacting the breast cancer cell with a compound or salt of claim 31 or claim 32 wherein the growth or proliferation of the breast cancer cell is inhibited.
45. A method of treating prostate cancer in a patient in need thereof, comprising administering to the patient a composition of claim 33 and an anti-androgenic agent.
46. The method of claim 45, wherein the anti-androgenic agent is selected from: MDV3100, ARN-059, ODM-201, abiraterone, TOK001, TAK700 and VT464.
47. The method of claim 41, wherein the anti-androgenic agent is MDV3100.
48. The method of claim 47, wherein the compound and the anti-androgenic agent synergize in combination to inhibit the growth or proliferation of the prostate cancer cell.
49. The method of claim 46, wherein the anti-androgenic agent is MDV3100.
50. The method of claim 49, wherein the compound and the anti-androgenic agent synergize in combination to inhibit the growth or proliferation of the prostate cancer cell.
US16/275,198 2012-10-11 2019-02-13 Modulation of androgen receptor expression Expired - Fee Related USRE48461E1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/275,198 USRE48461E1 (en) 2012-10-11 2019-02-13 Modulation of androgen receptor expression

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US201261712780P 2012-10-11 2012-10-11
US201261712756P 2012-10-11 2012-10-11
US201261723701P 2012-11-07 2012-11-07
US201361777895P 2013-03-12 2013-03-12
US201361777813P 2013-03-12 2013-03-12
US201361777851P 2013-03-12 2013-03-12
US14/050,574 US9175291B2 (en) 2012-10-11 2013-10-10 Modulation of androgen receptor expression
US14/854,281 US9567588B2 (en) 2012-10-11 2015-09-15 Modulation of androgen receptor expression
US16/275,198 USRE48461E1 (en) 2012-10-11 2019-02-13 Modulation of androgen receptor expression

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US14/854,281 Reissue US9567588B2 (en) 2012-10-11 2015-09-15 Modulation of androgen receptor expression

Publications (1)

Publication Number Publication Date
USRE48461E1 true USRE48461E1 (en) 2021-03-09

Family

ID=50475891

Family Applications (3)

Application Number Title Priority Date Filing Date
US14/050,574 Active US9175291B2 (en) 2012-10-11 2013-10-10 Modulation of androgen receptor expression
US14/854,281 Ceased US9567588B2 (en) 2012-10-11 2015-09-15 Modulation of androgen receptor expression
US16/275,198 Expired - Fee Related USRE48461E1 (en) 2012-10-11 2019-02-13 Modulation of androgen receptor expression

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US14/050,574 Active US9175291B2 (en) 2012-10-11 2013-10-10 Modulation of androgen receptor expression
US14/854,281 Ceased US9567588B2 (en) 2012-10-11 2015-09-15 Modulation of androgen receptor expression

Country Status (31)

Country Link
US (3) US9175291B2 (en)
EP (1) EP2906226B1 (en)
JP (2) JP6306598B2 (en)
KR (1) KR102124228B1 (en)
CN (2) CN108300718B (en)
AP (1) AP2015008368A0 (en)
AR (1) AR092982A1 (en)
AU (2) AU2013329070A1 (en)
BR (1) BR112015007878A2 (en)
CA (1) CA2887867C (en)
CL (1) CL2015000901A1 (en)
CO (1) CO7400882A2 (en)
DK (1) DK2906226T3 (en)
DO (1) DOP2015000083A (en)
EC (1) ECSP15012462A (en)
ES (1) ES2706387T3 (en)
IL (2) IL237855A0 (en)
MX (1) MX369207B (en)
NI (1) NI201500051A (en)
NZ (1) NZ706151A (en)
PE (1) PE20150722A1 (en)
PH (1) PH12015500788A1 (en)
PL (1) PL2906226T3 (en)
PT (1) PT2906226T (en)
RU (1) RU2670486C9 (en)
SG (1) SG11201502505UA (en)
TN (1) TN2015000140A1 (en)
TW (1) TW201420594A (en)
UY (1) UY35078A (en)
WO (1) WO2014059238A2 (en)
ZA (1) ZA201503203B (en)

Families Citing this family (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2843417C (en) 2011-07-29 2018-08-21 Medivation Prostate Therapeutics, Inc. Treatment of breast cancer
MY193914A (en) 2012-03-05 2022-11-01 Oy Arctic Partners Ab Methods and apparatuses for predicting risk of prostate cancer and prostate gland volume
AR092982A1 (en) * 2012-10-11 2015-05-13 Isis Pharmaceuticals Inc MODULATION OF THE EXPRESSION OF ANDROGEN RECEIVERS
US12326453B2 (en) 2014-03-28 2025-06-10 Opko Diagnostics, Llc Compositions and methods for active surveillance of prostate cancer
DK3123381T3 (en) 2014-03-28 2023-11-27 Opko Diagnostics Llc COMPOSITIONS AND METHODS RELATED TO THE DIAGNOSIS OF PROSTATE CANCER
CN107109488A (en) 2014-12-12 2017-08-29 麦迪韦逊前列腺治疗股份有限公司 The method predicted the method for the reaction to breast cancer treatment agent and treat breast cancer
AU2016222546B2 (en) * 2015-02-26 2020-01-23 Ionis Pharmaceuticals, Inc. Allele specific modulators of P23H rhodopsin
WO2016160545A1 (en) 2015-03-27 2016-10-06 Opko Diagnostics, Llc Prostate antigen standards and uses thereof
US10722527B2 (en) 2015-04-10 2020-07-28 Capsugel Belgium Nv Abiraterone acetate lipid formulations
CN105492632B (en) * 2015-07-01 2021-08-06 深圳市第二人民医院 A primer pair to detect genetic markers associated with idiopathic azoospermia
JP2018528783A (en) * 2015-09-25 2018-10-04 アイオーニス ファーマシューティカルズ, インコーポレーテッドIonis Pharmaceuticals,Inc. Conjugate antisense compounds and uses thereof
US10682362B2 (en) * 2015-10-14 2020-06-16 Wayne State University Treatments and diagnostics for cancers
CN105541991B (en) * 2015-12-16 2019-05-31 中国医科大学 Application of BAP18 in promoting prostate cancer
WO2017123996A1 (en) 2016-01-15 2017-07-20 City Of Hope Targeting glioblastoma stem cells through the tlx-tet3 axis
US20190040395A1 (en) * 2016-02-18 2019-02-07 Ionis Pharmaceuticals, Inc. Modulators of klk3 erna
EP3464623B1 (en) * 2016-06-02 2021-09-01 Sint-Augustinus Androgen receptor splice variants and androgen deprivation therapy
CA3043768A1 (en) 2016-11-29 2018-06-07 PureTech Health LLC Exosomes for delivery of therapeutic agents
US10933134B2 (en) * 2017-03-16 2021-03-02 Memorial Sloan Kettering Cancer Center Combination therapies for treatment of cancer
WO2019157531A1 (en) 2018-02-12 2019-08-15 Ionis Pharmaceuticals, Inc. Modified compounds and uses thereof
EP3775172A4 (en) 2018-03-26 2021-12-29 Duke University Splice-switching oligonucleotides and methods of use
CN109321569B (en) * 2018-10-29 2022-04-12 迈杰转化医学研究(苏州)有限公司 Primer probe composition and application thereof
TW202028222A (en) 2018-11-14 2020-08-01 美商Ionis製藥公司 Modulators of foxp3 expression
US20220002723A1 (en) * 2018-11-14 2022-01-06 Board Of Regents, The University Of Texas System Methods for the treatment of small round cell tumors
KR102473989B1 (en) 2018-11-28 2022-12-07 (주)바이오니아 Double-stranded oligo nucleotide structure comprising androgen receptor specific sequences and composition comprising the same for preventing hair loss and hair growth
WO2020148400A1 (en) * 2019-01-16 2020-07-23 Stichting Katholieke Universiteit Antisense oligonucleotides for use in the treatment of crpc
CN109880931A (en) * 2019-04-11 2019-06-14 江苏省农业科学院 A SLAF-SNP molecular marker method and application of the main QTL of loofah against cucumber mosaic virus CMV
US20220323444A1 (en) * 2019-07-29 2022-10-13 The Medical College Of Wisconsin, Inc. Methods of Treating Advanced Prostate Cancer
EP3791930A1 (en) * 2019-09-13 2021-03-17 Secarna Pharmaceuticals GmbH & Co. KG Inhibitor of metadherin expression
JP2023501352A (en) * 2019-11-08 2023-01-18 アイオーニス ファーマシューティカルズ, インコーポレーテッド Compounds and methods for reducing SPDEF expression
CN116370491A (en) * 2021-09-22 2023-07-04 北京瑞博开拓医药科技有限公司 Application of antisense oligonucleotide agents in the treatment of coronavirus-related diseases
CN116270710B (en) * 2023-02-16 2025-01-28 南方医科大学珠江医院 Application of circRBM33 as a target in the diagnosis and treatment of prostate cancer
WO2024220955A2 (en) * 2023-04-21 2024-10-24 Memorial Sloan Kettering Cancer Center Combining induction of ferroptosis with targeted agents for cancer therapy
CN121065176A (en) * 2025-04-14 2025-12-05 羿美诚健(上海)生物医药有限公司 Androgen receptor targeting small nucleic acid, pharmaceutical composition and application thereof

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002000716A2 (en) 2000-06-28 2002-01-03 Bristol-Myers Squibb Company Cell lines and cell-based assays for identification of androgen receptor modulators
US20050246794A1 (en) * 2002-11-14 2005-11-03 Dharmacon Inc. Functional and hyperfunctional siRNA
WO2011005765A1 (en) 2009-07-06 2011-01-13 Alnylam Pharmaceuticals, Inc. Bioprocessing
WO2012006241A2 (en) * 2010-07-06 2012-01-12 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of androgen receptor by double-stranded rna
WO2012012467A2 (en) 2010-07-19 2012-01-26 Isis Pharmaceuticals, Inc. Modulation of nuclear-retained rna
WO2012087983A1 (en) 2010-12-20 2012-06-28 The General Hospital Corporation Polycomb-associated non-coding rnas
WO2012120374A2 (en) 2011-03-10 2012-09-13 Oslo Universitetssykehus Hf Methods and biomarkers for detection of gastrointestinal cancers
WO2014059238A2 (en) 2012-10-11 2014-04-17 Isis Pharmaceuticals Inc Modulation of androgen receptor expression

Family Cites Families (140)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2699808A (en) 1944-10-06 1955-01-18 Mark W Lowe Apparatus for peeling tomatoes
US2699508A (en) 1951-12-21 1955-01-11 Selectronics Inc Method of mounting and construction of mounting for low frequency piezoelectric crystals
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
FR2567892B1 (en) 1984-07-19 1989-02-17 Centre Nat Rech Scient NOVEL OLIGONUCLEOTIDES, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS AS MEDIATORS IN DEVELOPING THE EFFECTS OF INTERFERONS
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5506337A (en) 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
DE69034150T2 (en) 1989-10-24 2005-08-25 Isis Pharmaceuticals, Inc., Carlsbad 2'-modified oligonucleotides
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
ES2116977T3 (en) 1990-05-11 1998-08-01 Microprobe Corp SOLID SUPPORTS FOR NUCLEIC ACID HYBRIDIZATION TESTS AND METHODS TO IMMOBILIZE OLIGONUCLEOTIDES IN A COVALENT WAY.
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US5877160A (en) 1991-05-31 1999-03-02 Genta Incorporated Compositions and methods of treatment of androgen-associated baldness using antisense oligomers
US7517644B1 (en) 1991-08-23 2009-04-14 Larry J. Smith Method and compositions for cellular reprogramming
EP0538194B1 (en) 1991-10-17 1997-06-04 Novartis AG Bicyclic nucleosides, oligonucleotides, their method of preparation and intermediates therein
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
FR2687679B1 (en) 1992-02-05 1994-10-28 Centre Nat Rech Scient OLIGOTHIONUCLEOTIDES.
EP0577558A2 (en) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclic nucleosides having bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
JPH08504559A (en) 1992-12-14 1996-05-14 ハネウエル・インコーポレーテッド Motor system with individually controlled redundant windings
AU692148B2 (en) 1993-02-19 1998-06-04 Genta Incorporated Treatment of androgen-associated baldness using antisense oligomers
CA2159631A1 (en) 1993-03-30 1994-10-13 Sanofi Acyclic nucleoside analogs and oligonucleotide sequences containing them
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5556956A (en) 1993-11-04 1996-09-17 Board Of Regents, The University Of Texas System Methods and compositions relating to the androgen receptor gene and uses thereof
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
CA2239976A1 (en) 1995-09-20 1997-03-27 Paul A. Zamecnik Antisense oligonucleotide chemotherapy for benign hyperplasia or cancer of the prostate
US6300060B1 (en) 1995-11-09 2001-10-09 Dana-Farber Cancer Institute, Inc. Method for predicting the risk of prostate cancer morbidity and mortality
US5656408A (en) 1996-04-29 1997-08-12 Xerox Corporation Coated carrier particles
US6489163B1 (en) 1996-05-08 2002-12-03 Board Of Regents, The University Of Texas System Ribozyme mediated inactivation of the androgen receptor
US20080119427A1 (en) 1996-06-06 2008-05-22 Isis Pharmaceuticals, Inc. Double Strand Compositions Comprising Differentially Modified Strands for Use in Gene Modulation
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
JP3756313B2 (en) 1997-03-07 2006-03-15 武 今西 Novel bicyclonucleosides and oligonucleotide analogues
US5994076A (en) 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
JP4236812B2 (en) 1997-09-12 2009-03-11 エクシコン エ/エス Oligonucleotide analogues
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6043352A (en) 1998-08-07 2000-03-28 Isis Pharmaceuticals, Inc. 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
WO2000015834A2 (en) 1998-09-15 2000-03-23 Signalgene Inc. Marker at the androgen receptor gene for determining breast cancer susceptibility
KR20070118315A (en) 1999-04-21 2007-12-14 와이어쓰 Compositions for Inhibiting the Function of Polynucleotide Sequences
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6525191B1 (en) 1999-05-11 2003-02-25 Kanda S. Ramasamy Conformationally constrained L-nucleosides
EP1244667B1 (en) 1999-12-30 2006-04-05 K.U. Leuven Research & Development Cyclohexene nucleic acids
US6255110B1 (en) 2000-01-21 2001-07-03 Isis Pharmaceuticals, Inc. Antisense modulation of ARA70 expression
WO2001073116A2 (en) 2000-03-28 2001-10-04 Signalgene Inc. Method for determining osteoporosis susceptibility and/or low bone density and reagents therefor
EP1268856A2 (en) 2000-04-07 2003-01-02 Epigenomics AG Detection of single nucleotide polymorphisms (snp's) and cytosine-methylations
US6784291B2 (en) 2000-05-04 2004-08-31 Avi Biopharma, Inc. Splice-region antisense composition and method
MXPA02012605A (en) 2000-06-28 2003-05-14 Squibb Bristol Myers Co Selective androgen receptor modulators and methods for their identification, design and use.
RU2003102390A (en) * 2000-06-28 2004-05-27 Бристол-Маерс Сквибб Компани (Us) SELECTIVE ANDROGEN RECEPTOR MODULATORS AND METHODS FOR THEIR IDENTIFICATION, MANUFACTURE AND APPLICATION
WO2002010452A2 (en) 2000-07-27 2002-02-07 University Of Rochester Methods and compositions for predicting prostate cancer
US20020165381A1 (en) 2000-11-30 2002-11-07 Isabelle Ahrens-Fath Human androgen receptor variants
JP2002247986A (en) 2001-02-23 2002-09-03 Mitsui Chemicals Inc Cell useful for evaluation of sex hormone receptor action
AU2002256359A1 (en) 2001-04-24 2002-11-05 Epigenesis Pharmaceuticals, Inc. Antisense and anti-inflammatory based compositions to treat respiratory disorders
US20050159376A1 (en) 2002-02-20 2005-07-21 Slrna Therapeutics, Inc. RNA interference mediated inhibition 5-alpha reductase and androgen receptor gene expression using short interfering nucleic acid (siNA)
CA2452458A1 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US6680342B2 (en) 2001-09-20 2004-01-20 Mayo Foundation For Medical Education And Research Methods and compositions for inhibiting the proliferation of prostate cancer cells
FR2832154B1 (en) 2001-11-09 2007-03-16 Centre Nat Rech Scient OLIGONUCLEOTIDES INHIBITORS AND THEIR USE FOR SPECIFICALLY REPRESSING A GENE
US6861432B2 (en) 2001-11-23 2005-03-01 Schering Aktiengesellschaft Piperazine derivatives that destabilize androgen receptors
JP2004008140A (en) 2002-06-10 2004-01-15 Sumitomo Chem Co Ltd Mutant androgen receptor and cells for evaluating its activity
EP1540004A4 (en) 2002-07-31 2007-10-03 Nucleonics Inc Double stranded rna structures and constructs, and methods for generating and using the same
CA2502649A1 (en) 2002-10-18 2004-04-29 Nucleonics Inc. Double-stranded rna structures and constructs, and methods for generating and using the same
US7622592B2 (en) 2002-11-01 2009-11-24 Merck & Co., Inc. Carbonylamino-benzimidazole derivatives as androgen receptor modulators
WO2004041889A2 (en) 2002-11-05 2004-05-21 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
AU2003291755A1 (en) 2002-11-05 2004-06-07 Isis Pharmaceuticals, Inc. Oligomers comprising modified bases for binding cytosine and uracil or thymine and their use
US6673661B1 (en) 2002-12-20 2004-01-06 Taiwan Semiconductor Manufacturing Co., Ltd. Self-aligned method for forming dual gate thin film transistor (TFT) device
WO2004063331A2 (en) 2003-01-03 2004-07-29 Gencia Corporation SiRNA MEDIATED POST-TRANSRIPTIONAL GENE SILENCING OF GENES INVOLVED IN ALOPECIA
BRPI0406778A (en) 2003-01-17 2006-01-17 Warner Lambert Co Androgen Receptor Antagonists
JP2004254601A (en) 2003-02-26 2004-09-16 Sumitomo Chem Co Ltd Mutant androgen receptor and cells for evaluating its activity
JP2004254600A (en) 2003-02-26 2004-09-16 Sumitomo Chem Co Ltd Mutant androgen receptor and cells for evaluating its activity
DE10322108B4 (en) 2003-05-09 2008-12-11 Bayer Schering Pharma Aktiengesellschaft Antiandrogenic pyrrolidines with antitumor activity
WO2004106356A1 (en) 2003-05-27 2004-12-09 Syddansk Universitet Functionalized nucleotide derivatives
EP1661905B9 (en) 2003-08-28 2012-12-19 IMANISHI, Takeshi Novel artificial nucleic acids of n-o bond crosslinkage type
CA2538252C (en) 2003-09-18 2014-02-25 Isis Pharmaceuticals, Inc. 4'-thionucleosides and oligomeric compounds
US20050164970A1 (en) 2003-12-22 2005-07-28 University Of Kansas Medical Center Method for treating prostate cancer using siRNA duplex for androgen receptor
US20050244851A1 (en) 2004-01-13 2005-11-03 Affymetrix, Inc. Methods of analysis of alternative splicing in human
WO2005080410A1 (en) 2004-02-20 2005-09-01 Genesis Research And Development Corporation Limited Targeted delivery of rna interference molecules for the treatment of ige-mediated disorders
US7696241B2 (en) 2004-03-04 2010-04-13 Bristol-Myers Squibb Company Bicyclic compounds as modulators of androgen receptor function and method
WO2005116204A1 (en) 2004-05-11 2005-12-08 Rnai Co., Ltd. Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same
EP1756101A2 (en) 2004-05-17 2007-02-28 Acadia Pharmaceuticals Inc. Androgen receptor modulators and method of treating disease using the same
DE102004025881A1 (en) 2004-05-19 2006-01-05 Beiersdorf Ag Oligoribonucleotides for influencing hair growth
EP1791567B1 (en) 2004-08-10 2015-07-29 Alnylam Pharmaceuticals Inc. Chemically modified oligonucleotides
WO2006047842A2 (en) 2004-11-08 2006-05-11 K.U. Leuven Research And Development Modified nucleosides for rna interference
US20070248535A1 (en) 2005-02-07 2007-10-25 The Trustees Of Columbia University In The City Of New York Methods to treat or prevent hormone-resistant prostate cancer using siRNA specific for protocadherin-PC, or other inhibitors of protocadherin-PC expression or activity
US8795987B2 (en) 2005-02-11 2014-08-05 International Business Machines Corporation Ribonucleic acid interference molecules of Oryza sativa
US8912317B2 (en) 2005-02-11 2014-12-16 International Business Machines Corporation Ribonucleic acid interference molecules of Arabidopsis thaliana
US20070154896A1 (en) 2005-02-11 2007-07-05 International Business Machines Corporation System and method for identification of MicroRNA target sites and corresponding targeting MicroRNA sequences
US20070213293A1 (en) 2005-04-08 2007-09-13 Nastech Pharmaceutical Company Inc. Rnai therapeutic for respiratory virus infection
US7709517B2 (en) 2005-05-13 2010-05-04 The Regents Of The University Of California Diarylhydantoin compounds
WO2007014370A2 (en) 2005-07-28 2007-02-01 University Of Delaware Small regulatory rnas and methods of use
US7700567B2 (en) 2005-09-29 2010-04-20 Supergen, Inc. Oligonucleotide analogues incorporating 5-aza-cytosine therein
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
JP4961549B2 (en) 2006-02-16 2012-06-27 国立大学法人愛媛大学 SiRNA specific for androgen receptor gene
US8178503B2 (en) 2006-03-03 2012-05-15 International Business Machines Corporation Ribonucleic acid interference molecules and binding sites derived by analyzing intergenic and intronic regions of genomes
SI2656842T1 (en) 2006-03-27 2016-10-28 The Regents Of The University Of California Androgen receptor modulator for the treatment of prostate cancer and androgen receptor-associated diseases
JP2007282598A (en) 2006-04-19 2007-11-01 Japan Health Science Foundation Sexual differentiation disorder diagnostic marker
AU2007249349B2 (en) 2006-05-11 2012-03-08 Isis Pharmaceuticals, Inc. 5'-Modified bicyclic nucleic acid analogs
JP4798093B2 (en) 2006-08-04 2011-10-19 日産自動車株式会社 Fluid reforming apparatus and fluid reforming method using the same
AR055648A1 (en) 2006-09-21 2007-08-29 Gen Med Sa A DOUBLE-CHAIN RNA OLIGONUCLEOTIDE A PHARMACEUTICAL OR COSMETIC COMPOSITION THAT UNDERSTANDS AND USES IT IN THE PREPARATION OF A MEDICINAL PRODUCT FOR THE TREATMENT OF DISEASES RELATED TO ANDROGEN METABOLISM
WO2008070862A2 (en) 2006-12-07 2008-06-12 Biocept, Inc. Non-invasive prenatal genetic screen
WO2008076918A2 (en) 2006-12-15 2008-06-26 University Of Maryland, Baltimore Anti-cancer agents and androgen inhibition activity compound
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
WO2008119015A2 (en) 2007-03-27 2008-10-02 Sloan-Kettering Institute For Cancer Research Synthesis of thiohydantoins
CA2688321A1 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
DK2173760T4 (en) 2007-06-08 2016-02-08 Isis Pharmaceuticals Inc Carbocyclic bicyclic nukleinsyreanaloge
AU2008272918B2 (en) 2007-07-05 2012-09-13 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2009046141A2 (en) * 2007-10-01 2009-04-09 Isis Pharmaceuticals, Inc. Antisense modulation of fibroblast growth factor receptor 4 expression
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2009068033A2 (en) * 2007-11-26 2009-06-04 Santaris Pharma A/S Lna antagonists targeting the androgen receptor
US8450290B2 (en) 2007-11-26 2013-05-28 Enzon Pharmaceuticals, Inc. Methods for treating androgen receptor dependent disorders including cancers
CA2709514A1 (en) 2007-12-21 2009-07-02 Astrazeneca Ab Bicyclic derivatives for use in the treatment of androgen receptor associated conditions
WO2009100320A2 (en) 2008-02-07 2009-08-13 Isis Pharmaceuticals, Inc. Bicyclic cyclohexitol nucleic acid analogs
EP2255190A4 (en) 2008-02-12 2011-05-04 Brigham & Womens Hospital FISH ASSAY TO DETECT FUSION BETWEEN EML4 AND ALK IN LUNG CANCER
FR2929292A1 (en) 2008-03-28 2009-10-02 Exonhit Therapeutics S A Sa In vitro or ex vivo process, useful e.g. for detecting the presence of Alzheimer's disease or the risk of developing Alzheimer's disease in a mammal, comprises determination of the presence of alteration in one or more genes or RNA
US20090282496A1 (en) 2008-04-04 2009-11-12 University Of Rochester Medical Center Androgen Receptor Related Methods for Treating Bladder Cancer
ES2836128T3 (en) 2008-04-16 2021-06-24 Univ Johns Hopkins Method to determine androgen receptor variants in prostate cancer
NZ601660A (en) 2008-08-25 2014-05-30 Excaliard Pharmaceuticals Inc Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
US8133724B2 (en) 2008-09-17 2012-03-13 University Of Maryland, Baltimore Human androgen receptor alternative splice variants as biomarkers and therapeutic targets
DK2361256T3 (en) 2008-09-24 2013-07-01 Isis Pharmaceuticals Inc Cyclohexenyl-nucleic acid analogues
DK2356129T3 (en) 2008-09-24 2013-05-13 Isis Pharmaceuticals Inc Substituted alpha-L bicyclic nucleosides
WO2010062914A1 (en) 2008-11-26 2010-06-03 The Johns Hopkins University Methods for identifying cancer risk
US8202690B2 (en) 2008-11-28 2012-06-19 Hisamitsu Pharmaceutical Co., Inc. Cancer marker and therapeutic agent for cancer
US20140004565A1 (en) 2009-07-06 2014-01-02 Alnylam Pharmaceuticals, Inc. Cell-based bioprocessing
AU2011218173C1 (en) 2010-02-16 2015-04-16 Aragon Pharmaceuticals, Inc. Androgen receptor modulators and uses thereof
US20130130241A1 (en) 2010-03-08 2013-05-23 Regents Of The University Of Minnesota Androgen receptor isoforms and methods
US9068185B2 (en) 2010-03-12 2015-06-30 Sarepta Therapeutics, Inc. Antisense modulation of nuclear hormone receptors
EP2601204B1 (en) 2010-04-28 2016-09-07 Ionis Pharmaceuticals, Inc. Modified nucleosides and oligomeric compounds prepared therefrom
KR20200133284A (en) 2010-05-28 2020-11-26 사렙타 쎄러퓨틱스, 인코퍼레이티드 Oligonucleotide analogues having modified intersubunit linkages and/or terminal groups
WO2012005898A2 (en) 2010-06-15 2012-01-12 Alnylam Pharmaceuticals, Inc. Chinese hamster ovary (cho) cell transcriptome, corresponding sirnas and uses thereof
WO2012018881A2 (en) 2010-08-03 2012-02-09 Alnylam Pharmaceuticals, Inc. Methods and compositions for the regulation of rna
AU2011326034B2 (en) 2010-11-12 2016-02-04 Roche Innovation Center Copenhagen A/S Compositions and methods for treating androgen receptor dependent disorders including cancers
PT2670411T (en) 2011-02-02 2019-06-18 Excaliard Pharmaceuticals Inc Antisense compounds targeting connective tissue growth factor (ctgf) for use in a method of treating keloids or hypertrophic scars
EP2673361B1 (en) 2011-02-08 2016-04-13 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013120003A1 (en) 2012-02-08 2013-08-15 Isis Pharmaceuticals, Inc. Modulation of rna by repeat targeting
US9778706B2 (en) 2012-02-24 2017-10-03 Blackberry Limited Peekable user interface on a portable electronic device
US9984408B1 (en) 2012-05-30 2018-05-29 Amazon Technologies, Inc. Method, medium, and system for live video cooperative shopping

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002000716A2 (en) 2000-06-28 2002-01-03 Bristol-Myers Squibb Company Cell lines and cell-based assays for identification of androgen receptor modulators
US20050246794A1 (en) * 2002-11-14 2005-11-03 Dharmacon Inc. Functional and hyperfunctional siRNA
WO2011005765A1 (en) 2009-07-06 2011-01-13 Alnylam Pharmaceuticals, Inc. Bioprocessing
WO2012006241A2 (en) * 2010-07-06 2012-01-12 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of androgen receptor by double-stranded rna
US8927515B2 (en) * 2010-07-06 2015-01-06 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of androgen receptor by double-stranded RNA
WO2012012467A2 (en) 2010-07-19 2012-01-26 Isis Pharmaceuticals, Inc. Modulation of nuclear-retained rna
WO2012087983A1 (en) 2010-12-20 2012-06-28 The General Hospital Corporation Polycomb-associated non-coding rnas
WO2012120374A2 (en) 2011-03-10 2012-09-13 Oslo Universitetssykehus Hf Methods and biomarkers for detection of gastrointestinal cancers
WO2014059238A2 (en) 2012-10-11 2014-04-17 Isis Pharmaceuticals Inc Modulation of androgen receptor expression

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
Aartsma-Rus A "Overview on AON design" Methods Mol Biol. (2012) 867:117-29.
Chan et al., "Antisense oligonucleotides: from design to therapeutic application" Clin Exp Pharmacol Physiol. (2006) 33(5-6):533-40.
GenBank Accession No. AL158016 (2009).
Hamy et al., "Specific block of androgen receptor activity by antisense oligonucleotides" Prostate Cancer Prostatic Dis. (2003) 6(1):27-33.
I.E. Eder et al. Inhibition of LNCaP prostate cancer cells by means of androgen receptor antisense oligonucleotides Cancer Gene Therapy, vol. 7, No. 7, 2000: pp. 997-1007 (Year: 2000). *
J. K. Watts et al. Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic Pathol. Jan. 2012 ; 226(2): 365-379 (Year: 2012). *
N Souleimanian et al. Antisense 2′-Deoxy, 2′-Fluoroarabino Nucleic Acid (2′F-ANA) Oligonucleotides: In Vitro Gymnotic Silencers of Gene Expression Whose Potency Is Enhanced by Fatty Acids Molecular Therapy—Nucleic Acids (2012) 1, e43; (Year: 2012). *
Zhang et al., "Reduced Expression of the Androgen Receptor by Third Generation of Antisense Shows Antitumor Activity in Models of Prostate Cancer" Molecular Cancer Therapeutics (2011) 10(12): 2309-2319.

Also Published As

Publication number Publication date
WO2014059238A3 (en) 2014-06-19
ZA201503203B (en) 2016-09-28
US9175291B2 (en) 2015-11-03
DOP2015000083A (en) 2015-06-15
NZ706151A (en) 2018-11-30
WO2014059238A8 (en) 2015-04-16
IL262218A (en) 2018-11-29
PL2906226T3 (en) 2019-04-30
AU2013329070A1 (en) 2015-04-16
KR20150064210A (en) 2015-06-10
US20160068846A1 (en) 2016-03-10
CO7400882A2 (en) 2015-09-30
CN104703610A (en) 2015-06-10
IL262218B (en) 2020-08-31
MX369207B (en) 2019-10-31
EP2906226A2 (en) 2015-08-19
AU2017200759A1 (en) 2017-03-02
CA2887867A1 (en) 2014-04-17
UY35078A (en) 2014-03-31
CL2015000901A1 (en) 2016-02-26
ECSP15012462A (en) 2015-12-31
ES2706387T3 (en) 2019-03-28
RU2670486C9 (en) 2019-04-01
PT2906226T (en) 2019-02-25
JP6306598B2 (en) 2018-04-04
IL237855A0 (en) 2015-05-31
CN108300718A (en) 2018-07-20
AP2015008368A0 (en) 2015-04-30
HK1258404A1 (en) 2019-11-08
CN104703610B (en) 2018-03-23
JP2018126141A (en) 2018-08-16
SG11201502505UA (en) 2015-04-29
WO2014059238A2 (en) 2014-04-17
TW201420594A (en) 2014-06-01
PE20150722A1 (en) 2015-06-03
HK1213774A1 (en) 2016-07-15
RU2015111672A (en) 2016-12-10
BR112015007878A2 (en) 2017-11-28
PH12015500788A1 (en) 2015-06-15
JP6599497B2 (en) 2019-10-30
EP2906226B1 (en) 2018-11-21
EP2906226A4 (en) 2016-06-08
AU2017200759B2 (en) 2018-07-19
KR102124228B1 (en) 2020-06-17
DK2906226T3 (en) 2019-02-18
JP2016501513A (en) 2016-01-21
US9567588B2 (en) 2017-02-14
TN2015000140A1 (en) 2016-10-03
US20140107180A1 (en) 2014-04-17
CN108300718B (en) 2022-02-22
AR092982A1 (en) 2015-05-13
CA2887867C (en) 2019-09-24
NI201500051A (en) 2016-02-15
RU2670486C2 (en) 2018-10-23
MX2015004641A (en) 2015-07-14

Similar Documents

Publication Publication Date Title
USRE48461E1 (en) Modulation of androgen receptor expression
US11926830B2 (en) Modulators of Complement Factor B
US9546368B2 (en) Methods for modulating metastasis-associated-in-lung-adenocarcinoma-transcript-1 (MALAT-1) expression
AU2014284398B2 (en) Modulators of growth hormone receptor
US20200190522A1 (en) Compounds and methods for modulating tmprss6 expression
US9523094B2 (en) Methods of treating kennedy's disease
WO2013130868A1 (en) Methods for modulating fibrinogen expression
HK1258404B (en) Modulation of androgen receptor expression
HK1213774B (en) Modulation of androgen receptor expression
HK1223652B (en) Modulators of growth hormone receptor

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY