USRE37343E1 - Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences - Google Patents

Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences Download PDF

Info

Publication number
USRE37343E1
USRE37343E1 US09/140,858 US14085898A USRE37343E US RE37343 E1 USRE37343 E1 US RE37343E1 US 14085898 A US14085898 A US 14085898A US RE37343 E USRE37343 E US RE37343E
Authority
US
United States
Prior art keywords
yeast
factor
precursor
alpha
encodes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US09/140,858
Inventor
Patricia Tekamp-Olson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chiron Corp filed Critical Chiron Corp
Priority to US09/140,858 priority Critical patent/USRE37343E1/en
Assigned to CHIRON CORPORATION reassignment CHIRON CORPORATION CROSS-REFERENCING OF ASSIGNMENT FROM PARENT U.S. SERIAL NO. 139,682, REEL 4846-488 Assignors: TEKAMP-OLSON, PATRICIA
Application granted granted Critical
Publication of USRE37343E1 publication Critical patent/USRE37343E1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/62Insulins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/65Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the present invention is directed to a yeast cell comprising a DNA construct that provides for the expression and secretion of a non-yeast protein, said DNA construct comprising a coding sequence under the control of yeast-recognized transcription initiation and termination sequences, said coding sequence encoding a precursor polypeptide comprised of a leader sequence and said non-yeast protein linked by a processing site that provides for the cleavage of said non-yeast protein from said precursor polypeptide, wherein said leader sequence is about 25 to about 50 N-terminal residues of said precursor polypeptide and comprises the signal peptide of a yeast ⁇ -factor precursor and a single glycosylation site.
  • Gene* encodes a non-yeast protein
  • S encodes a processing site that provides for cleavage of said precursor polypeptide.
  • FIG. 2 is the nucleotide and amino acid sequence of a synthetic oligonucleotide encoding a modified ⁇ -factor leader and the first 13 amino acids of the proinsulin gene used to construct pYGAI3 in Example I.
  • the modified ⁇ -factor leader has had the glycosylation sites removed by changing the codons for Asn 23,57,67 to encode Gln (boxed).
  • the arrow denotes the junction between the sequence encoding the KEX2 endopeptidase site and the N-terminus of human proinsulin.
  • FIG. 4 is a restriction map of yeast shuttle vector pAB24.
  • FIG. 7 is a restriction map of pYLUIGF1-24, an expression vector described in Example III encoding IGF1 under the control of a full-length ⁇ -factor leader with three glycosylation sites.
  • a “replicon” is any genetic element (e.g., plasmid, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo—i.e., capable of replication under its own control.
  • a “vector” is a replicon such as a plasmid, phage, or cosmid to which another DNA segment may be attached so as to bring about the replication of the attached segment.
  • double-stranded DNA molecule refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymidine, or cytosine) in its normal, double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes.
  • linear DNA molecules e.g., restriction fragments
  • viruses e.g., plasmids, and chromosomes.
  • sequences will be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the nontranscribed strand of DNA, i.e., the strand having a sequence homologous to the mRNA produced from a particular coding sequence.
  • a DNA “coding sequence” is DNA sequence which can be transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by and include the translation start codon at the 5′ (amino) terminus, and a translation stop codon at the 3′ (carboxy) terminus.
  • a coding sequence can include, but is not limited to, procaryotic DNA sequences, vital DNA sequences, cDNA or genomic DNA sequences from eucaryotic sources (e.g., mammalian), and even synthetic DNA sequences.
  • yeast-recognized transcription initiation and termination sequences refer to DNA regulatory regions which flank a coding sequence and are responsible for the transcription in yeast of an mRNA homologous to the coding sequence which can then be translated into the polypeptide encoded by the coding sequence.
  • Transcription initiation sequences include yeast promoter sequences, which are DNA regulatory sequences capable of binding yeast RNA polymerase in a cell and initiating transcription of a downstream (3′ direction) coding sequence.
  • the promoter sequence is bounded (and excludes) at its 3′ terminus by the translation start codon of a coding sequence and extends upstream (5′ direction) to include the minimum number of nucleotides or elements necessary to initiate transcription at levels detectable above background.
  • Promoters useful in the present invention include the wild-type ⁇ -factor promoter, as well as other yeast promoters.
  • a coding sequence is “under the control” of transcription initiation and termination sequences when RNA polymerase binds the transcription initiation sequence and transcribes the coding sequence into mRNA terminating at the transcription termination sequence, and the mRNA is then translated into the polypeptide encoded by the coding sequence (i.e., “expression”).
  • the precursor polypeptide encoded by the coding sequences of the present invention is “secreted” when at least a portion (usually the non-yeast protein in the absence of the leader sequence) is transported extracellularly where it is found in the cell growth medium. Usually, only the portion of precursor protein downstream from the lead sequence is secreted, and this downstream portion may also be subjected to additional processing during secretion, such as proteolytic cleavage, glycosylation, folding, disulfide bond formation, etc.
  • Two DNA sequences are “substantially homologous” when at least about 60% (preferably at least about 75%, and most preferably at least about 90%) of the nucleotides match over a defined length of the molecules. Sequences that are substantially homologous can be identified in a Southern hybridization experiment under conditions of a selected stringency as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
  • a “heterologous region” of a DNA molecule is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature.
  • the heterologous region when the heterologous region encodes a mammalian protein, the heterologous region will usually be flanked by DNA that does not flank the mammalian DNA sequence in the genome of the source organism.
  • Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different from organisms which encode the same or similar protein). Allelic variations or naturally occurring mutational events do not give rise to a “heterologous” region of DNA as used herein.
  • yeast includes ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts and yeast belonging to the Fungi imperfecti (Blastomycetes).
  • the scosporogenous yeasts are divided into two families, Spermophthoraceae and Saccharomycetaceae. The latter is comprised of four subfamilies, Schizosaccharomycoideae (e.g., genus Schizosaccharomyces), Nadsonioideae, Lipomycoideae and Saccharomycoideae (e.g., genera Pichia, Klyveromyces and Saccharomyces).
  • Schizosaccharomycoideae e.g., genus Schizosaccharomyces
  • Nadsonioideae e.g., Lipomycoideae
  • Saccharomycoideae e.g., genera Pichia, Klyveromyces and Saccharomyces.
  • the basidiosporogenous yeasts include the genera Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium and Filobasidiella.
  • Yeast belonging to the Fungi Imperfecti are divided into two families, Sporobolomycetaceae (e.g., genera Sporobolomyces, Bullera) and Cryptococcaceae (e.g., genus Candida).
  • Sporobolomycetaceae e.g., genera Sporobolomyces, Bullera
  • Cryptococcaceae e.g., genus Candida
  • species within the genera Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces and Candida Of particular interest are the Saccharomyces species S. cerevisiae, S. carlsbergensis , S. diastaticus, S.
  • the present invention employs truncated leader sequences from a yeast ⁇ -factor gene.
  • ⁇ -factor is an oligopeptide mating pheromone about 13 residues in length produced from a large precursor polypeptide between about 100 and 200 residues (typically about 120-160) in length (prepro- ⁇ -factor).
  • the precursor is comprised of a hydrophobic “signal sequence” of about 20 residues (e.g., about 19-23, typically about 20-22) followed by an additional leader region of about 60 hydrophilic residues (the “pro” region), which is then linked to several tandem repeats of the mature pheromone sequence (typically about 2-6) separated by short oligopeptide spacer regions (typically about 6-8 residues) which provide for proteolytic processing to the mature pheromone.
  • a hydrophobic “signal sequence” of about 20 residues (e.g., about 19-23, typically about 20-22) followed by an additional leader region of about 60 hydrophilic residues (the “pro” region), which is then linked to several tandem repeats of the mature pheromone sequence (typically about 2-6) separated by short oligopeptide spacer regions (typically about 6-8 residues) which provide for proteolytic processing to the mature pheromone.
  • ⁇ -factor may also be purified from a yeast species, sequenced and probes designed to clone the prepro- ⁇ -factor gene. See, e.g., McCullough et al. (1979) J. Bacteriol. 138:146-154; Sato et al. (1981) Agric. Biol. Chem. 44:1451-1453; Singh et al. (1983), supra. It has also been determined that the ⁇ -factor leader sequence from one yeast species can be functional in another yeast species. See, e.g., U.S. Ser. No. 078,551, supra. Thus, the present invention contemplates not only the use of ⁇ -factor leader sequences from yeast in general, but the use of such leader sequences in heterologous yeast species.
  • the leader retain a functional ⁇ -factor signal sequence.
  • the signal peptide is usually about 20 amino acids in length, and characteristic features including a hydrophobic core. See, e.g., von Heijne, (1984) J. Mol. Biol. 173:243-251. All of the prepro- ⁇ -factor sequences examined today encode for a hydrophobic peptide of about 20 residues in length. While the exact length of a signal peptide necessary to direct the precursor polypeptide to the secretory pathway is not defined, it will usually require between about 19 and about 23 residues, the minimum sequence required being readily definable by the testing of deletion mutants.
  • the leader sequence of the present invention has immediately 3′ thereto a processing site which allows for the cleavage of the leader from the non-yeast protein sequence to which it is fused in the precursor polypeptide.
  • the processing site employed in the present invention is defined as the codons defining the minimum number of amino acid residues which are specifically recognized for cleavage by the selected process (e.g., chemical, enzymatic, etc.).
  • Various processing sites are known in the art, including both those active in vivo and in vitro.
  • the processing site may provide for in vitro processing by encoding a cleavage site for a proteolytic enzyme which does not occur in the yeast host.
  • the recovered precursor polypeptide would then be treated with the enzyme to cleave the non-yeast protein from the precursor.
  • Another in vitro processing site is a methionine codon which can be cleaved by post-expression treatment with cyanogen bromide. See, e.g., U.S. Pat. No. 4,366,246.
  • the endopeptidase encoded by the KEX2 gene cleaves basic dipeptides comprised of Lys and Arg residues; i.e., Lys-Arg, Arg-Arg, Arg-Lys and Lys-Lys. Fuller et al., Microbiology 1986, pp. 273-278 (1986).
  • yeast the ⁇ -factor precursor is first cleaved by the KEX2 endopeptidase, and then the N-termini are trimmed by DPAPase A to provide mature ⁇ -factor pheromone.
  • DNA sequences encoding the non-yeast proteins can be sequences cloned from non-yeast organisms, or they can be synthetic sequences, usually prepared using yeast-preferred codons.
  • the non-yeast proteins will be at least about 8 amino acids in length and can include polypeptides up to about 100,000 daltons or higher.
  • the non-yeast polypeptide sequence will be less than about 300,000 daltons, and more usually less than about 150,000 daltons. Of particular interest are polypeptides of from about 5,000 to about 150,000 daltons, more particularly of about 5,000 to about 100,000 daltons.
  • AF encodes a yeast alpha-factor signal peptide
  • CHO encodes a glycosylation site
  • X n encodes a polypeptide of n amino acids in length that does not contain a glycosylation site or processing site that will cause the precursor polypeptide to be cleaved in vivo by the yeast host
  • n is an integer from 0 to about 30
  • Gene* encodes a non-yeast protein
  • S encodes a processing site that provides for cleavage of said precursor polypeptide.
  • the following example provides a comparison of the levels of expression and secretion obtained with modified ⁇ -factor constructs used to express human proinsulin.
  • Three constructs employ full-length ⁇ -factor leaders; one having ⁇ -factor leader with the three native glycosylation sites, one having all three of the glycosylation sites eliminated, and one having all of the sites, except the one at Asn 23 , removed.
  • the fourth construct is a truncated ⁇ -factor leader which retains a single glycosylation site at Asn 23 .
  • This plasmid encodes an ⁇ -factor leader [Brake et al. (1984) Proc. Natl. Acad. Sci. USA 81:4642-4646; EPO Publication No. 116,201] linked to human proinsulin.
  • the proinsulin is encoded by a synthetic gene made with yeast preferred codons (FIG. 1 ).
  • the ⁇ -factor leader sequence, the synthetic proinsulin gene and the ⁇ -factor terminator sequence are from pYBCA5, the construction of which is shown in FIG. 1 . Transcription is mediated by the 404 bp BamHI-NcoI GAPDH promoter fragment. Travis et al. (1985) J. Biol. Chem. 260:4384-4389.
  • Plasmid pAB24 (FIG. 4) is a yeast shuttle vector which contains the complete 2 ⁇ sequence [Broach, in: Molecular Biology of the Yeast Saccharomyces, Vol., 1, p. 445 (1981)] and pBR322 sequences. It also contains the yeast URA3 gene derived from plasmid YEp24 [Botstein et al. (1979) Gene 8:17] and the yeast LEU2d gene derived from plasmid pC1/1. EPO Publication No. 116,201. Plasmid pAB24 was constructed by digesting YEp24 with EcoRI and religating the vector to remove the partial 2 ⁇ sequences.
  • the resulting plasmid, YEp24 ⁇ RI was linearized by digestion with ClaI and ligated with the complete 2 ⁇ plasmid which had been linearized with ClaI.
  • the resulting plasmid, pCBou was then digested with XbaI and the 8605 bp vector fragment was gel isolated. This isolated XbaI fragment was ligated with a 4460 bp XbaI fragment containing the LEU2d gene isolated from pC1/1; the orientation of the LEU2d gene is in the same direction as the URA3 gene.
  • Plasmid pYGAI3 differs from pYGAI1 in that it encodes a modified ⁇ -factor leader wherein the codons for Asn at residues 23, 57 and 67 have been changed to encode Gln, thereby eliminating all three signals for N-linked glycosylation.
  • the 294 bp synthetic DNA (NcoI-HindIII) fragment was substituted for the comparable fragment of pGAI1 and pYGAI1-C1/1 which gave the plasmids pGAI3 and pYGAI3, respectively.
  • the 1.2 kb expression cassette from pGAI8 was removed by cutting with BamHI and then gel isolating the fragment. It was ligated into BamHI-cut and phosphatase-treated yeast shuttle vector pAB24. Insertion of the expression cassette was in the unique BamHI site of the pBR322 sequences such that the GAPDH promoter was proximal to the unique SalI site of the vector. This plasmid was pYGAI8.
  • the linearized plasmid was cut with BamHI, and a 558 bp HpaII-BamHI fragment was gel isolated. This fragment contains the codons for residues 34-35 of the ⁇ -factor leader linked directly to a Lys-Arg processing site and the proinsulin sequence. There are no intervening sequences between the codon for residue 35 of the ⁇ -factor leader and the processing site directly adjacent to the proinsulin sequence.
  • pGAI1 was cut with HpaII and BamHI, and a 504 bp fragment gel isolated.
  • This fragment contains the GAPDH promoter and nucleotides encoding amino acids 1-33 of the ⁇ -factor leader, the 3′ end terminating in an HpaII overhang complementary to the 5′ end of the above-described 558 bp HpaII-BamHI fragment.
  • These two fragments were ligated together and cut with BamHI to provide an expression cassette containing the GAPDH promoter, sequences encoding a modified ⁇ -factor leader containing residues 1-35 directly linked to a Lys-Arg processing site, the proinsulin gene, and the ⁇ -factor terminator.
  • the cassette was then ligated into a BamHI site of pBR322( ⁇ EcoRI-SalI)BamHI, as described above, to give plasmid pGAI7 and cloned in E. coli.
  • pGAI7 was then cut with BamHI, and the 1062 bp expression cassette gel isolated. The expression cassette was then ligated into the BamHI site of pAB24 to give plasmid pYGAI7.
  • Table 2 compares transformants of pYGAI1-pAB24 (full-length native ⁇ -factor leader), pYGAI8 (full-length ⁇ -factor leader with only one glycosylation site at Asn 23 ) and pYGAI7 (truncated ⁇ -factor leader containing a single glycosylation site at Asn 23 ) for their ability to secrete insulin-like-material.
  • Inoculum cultures of the indicated transformants ( ⁇ 2 ml) in SD-Leu grown for ⁇ 48 hr at 30° C. were pelleted by centrifugation washed and diluted 20-50 fold into ura ⁇ medium. This medium contains 0.67% yeast nitrogen base, 1% succinic acid, 0.35% NaOH, 0.5% casamino acids, 2% glucose, 0.005% adenine, 0.01% tryptophan and 0.02% threonine.
  • ILM 1 Transformant OD 650 ⁇ g/ml ⁇ g/ml, OD 650 AB103.1[pYGAI1-C1/1] ⁇ 1 5.9 .24 .04 ⁇ 2 5.9 .24 .04 ⁇ 3 2.1 .08 .04 AB103.1[pYGAI3] ⁇ 1 ND .003 — ⁇ 2 ND .007 — 1
  • Cross-reactive insulin-like-material (ILM) as determined by a competition radioimmune assay with 125 I-labeled insulin and insulin standards. Data is reported as ILM secreted per ml of culture and in some cases as ILM secreted per ml normalized to a culture cell density with an absorbance at wavelength 650 m ⁇ of 1.
  • ILM 1 Transformant OD 650 ⁇ g/ml ⁇ g/ml, OD 650 AB103.1[pYGAI1-C1/1] ⁇ 1 5.9 .24 .04 ⁇ 2 5.9 .24 .04 ⁇ 3 2.1 .08 .04 AB103.1[pYGAI3] ⁇ 1 ND .003 — ⁇ 2 ND .007 — 1
  • Cross-reactive insulin-like-material (ILM) as determined by a competition radioimmune assay with 125 I-labeled insulin and insulin standards. Data is reported as ILM secreted per ml of culture and in some cases as ILM secreted per ml normalized to a culture cell density with an absorbance at wavelength 650 m ⁇ of 1.
  • Plasmid pGAIC3 was digested with BamHI, and the 1107 bp BamHI expression cassette containing the GAPDH promoter, the sequence encoding ⁇ -factor leader linked to proinsulin analog, and the ⁇ -factor transcription terminator was isolated and ligated into BamHI digested and phosphatase-treated pAB24, and then cloned in E. coli. Plasmid pYGAIC3 was obtained, in which the expression cassette was oriented such that the GAPDH promoter was proximal to the unique SalI site of the vector.
  • Plasmid pY ⁇ F L 7C3 contains DNA encoding the truncated ⁇ -factor leader described above for pYGAI7 linked to the sequence for the proinsulin analog, also described above (pYGAIC3). This plasmid was constructed as follows.
  • Strain AB103.1 has been described in Example I.
  • Strain AB110-4 is a derivative of Saccharomyces cerevisiae strain AB110 (Mat ⁇ , leu2, ura3-52, pep4-3, his4-580[cir°]) in which a deletion has been engineered into the pep4 gene.
  • These strains were transformed as described above with plasmids pYGAIC3, and pY ⁇ f L 7C3, and ura prototrophs were selected. Inoculum cultures were grown in SD-leu [Sherman et al., supra.] at 30° C.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • General Engineering & Computer Science (AREA)
  • Endocrinology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

A yeast alpha-factor expression system is provided comprised of a truncated leader sequence, containing the alpha-factor signal peptide and one glycosylation site, linked by a processing site to a non-yeast protein-encoding sequence.

Description

This application is a continuation of application Ser. No. 07/864,206, filed 3 Apr. 1992, now abandoned, which is a continuation of application Ser. No. 07/670,352, filed 13 Mar. 1991, now abandoned, which is a continuation of application Ser. No. 07/530,477, filed 29 May 1990, now abandoned, which is a continuation of application Ser. No. 07/139,682, filed 30 Dec. 1987, now abandoned.
Related U.S. Application Data
This is a reissue of U.S. Pat. No. 5,602,034, Issued, Feb. 11, 1997, incorporated herein by reference in its entirety.
TECHNICAL FIELD
The present invention relates to the production of recombinant proteins in yeast. More particularly, the present invention is directed to an improved α-factor expression system which provides for the secretion of heterologous proteins from yeast host cells.
BACKGROUND
Kurjan et al. (1982) Cell 30:933-943 discloses the first cloning and sequencing of a gene encoding a yeast α-factor precursor gene. Kurjan et al., U.S. Pat. No. 4,546,082, also reports the cloning of this gene, and suggests that the α-factor leader sequence can be employed to direct the secretion of heterologous proteins in yeast. The patent, however, does not contain data which would indicate that the patentees ever successfully employed the α-factor leader to express and secrete a heterologous protein in yeast.
EPO Publication No. 116,201 discloses the first successful application of the α-factor leader to direct the expression and secretion of an heterologous protein, epidermal growth factor, from a transformed yeast. Subsequent to this work, there have been additional reports of the expression of heterologous proteins in yeast employing the α-factor leader. See, e.g., Elliott et al. (1983) Proc. Nat'l Acad. Sci. USA 80:7080-7084; Bitter et al. (1984) Proc. Nat'l Acad. Sci. USA 81:5330-5334; Smith et al. (1985) Science 229:1219-1229; EPO Publication Nos. 114,695; 123,228; 123,294; 123,544; 128,773; and 206,783. See also Brake et al. in Protein Transport and Secretion, p. 103 (J. M. Gething ed. 1984).
The expression systems in the above reports produce a full-length α-factor leader fused to a heterologous protein. While the above work demonstrates that the α-factor expression system is widely useful, it is not generally predictable prior to performing the experiment whether a particular heterologous protein will be successfully secreted, processed and biologically active. See, e.g., EPO 206,783, supra, pp. 2-5; Rothblatt et al. (1987) EMBO J. 6:3455-3463; V. L. MacKay, “Secretion of Heterologous Proteins in Yeast” (in press).
There have been several reports, based on unpublished data, that deletions from the “pro” region of the α-factor leader (between the signal peptide and the first spacer) causes substantial declines in the amount of non-yeast protein secreted by yeast transformed the heterologous constructs. Sidhu et al. (1987) Gene 54:175-184, reports that yeast acid phosphatase (PHO5) is secreted into the medium from a heterologous construct employing both a full-length α-factor leader, and a truncated α-factor leader, but that expression levels are 3-4× less than for the PHO5 gene under the control of its homologous leader. It has also been reported that deletions in the prepro-α-factor precursor gene results in substantial declines in secretion of the native α-factor peptide. See, e.g., V. L. MacKay, supra; Rothblatt et al., supra.
A need exists, therefore, to improve the α-factor expression system, particularly for applications to non-yeast proteins that are not efficiently produced by current α-factor expression constructs.
SUMMARY OF THE INVENTION
It has been surprisingly discovered that a truncated form of the α-factor leader sequence can efficiently direct the expression and secretion of heterologous polypeptides in yeast. Particularly surprising is the discovery that truncated α-factor leader sequences can substantially improve the efficiency of expression of such heterologous proteins in relation to expression systems using the full-length α-factor leader; i.e., higher levels of correct N-terminal processing, secretion of heterologous proteins wherein a greater percentage of the molecules are biologically active, etc. These results are particularly surprising in view of reports that deletions from the leader sequence of the α-factor precursor result in decreased levels of secretion of active α-factor.
The present invention provides, therefore, for alternative α-factor-based expression constructs, which are particularly useful for the expression of heterologous polypeptides which are either inefficiently expressed by full-length α-factor leader constructs, or are not expressed at all by such full-length constructs.
In one embodiment, the present invention is directed to a yeast cell comprising a DNA construct that provides for the expression and secretion of a non-yeast protein, said DNA construct comprising a coding sequence under the control of yeast-recognized transcription initiation and termination sequences, said coding sequence encoding a precursor polypeptide comprised of a leader sequence and said non-yeast protein linked by a processing site that provides for the cleavage of said non-yeast protein from said precursor polypeptide, wherein said leader sequence is about 25 to about 50 N-terminal residues of said precursor polypeptide and comprises the signal peptide of a yeast α-factor precursor and a single glycosylation site.
In another embodiment, the present invention is directed to a double-stranded DNA molecule comprising a region encoding a precursor polypeptide secretable by a yeast host, said region, with reference to one of the DNA strands, having the structure:
5′-AF-CHO-Xn-S-Gene*-3′
wherein
AF encodes a yeast α-factor signal peptide; CHO encodes a glycosylation site;
Xn encodes a polypeptide of n amino acids in length that does not contain a glycosylation site or a processing site that provides for cleavage of said precursor polypeptide in vivo by yeast;
n is an integer from 0 to about 30;
Gene* encodes a non-yeast protein; and
S encodes a processing site that provides for cleavage of said precursor polypeptide.
The present invention is also directed to methods of employing the above cells and DNA constructs to produce recombinant proteins, as well as the compositions of recombinant proteins produced by the above methods. Other embodiments will also be readily apparent to those of ordinary skill in the art.
DESCRIPTION OF THE FIGURES
FIG. 1 is a flow diagram showing the construction of pYBCA5, and both the nucleotide and amino acid sequences of the synthetic proinsulin gene employed in Example I. The various synthetic oligonucleotides used in construct are delineated by black dots. Arrows above the sequence show the beginning and end of the B, C and A proinsulin chains. The boxes mark the dibasic processing sites.
FIG. 2 is the nucleotide and amino acid sequence of a synthetic oligonucleotide encoding a modified α-factor leader and the first 13 amino acids of the proinsulin gene used to construct pYGAI3 in Example I. The modified α-factor leader has had the glycosylation sites removed by changing the codons for Asn23,57,67 to encode Gln (boxed). The arrow denotes the junction between the sequence encoding the KEX2 endopeptidase site and the N-terminus of human proinsulin.
FIG. 3 shows the synthetic gene of fragment of pYGAIC3 encoding the proinsulin analog, where a KEX2 endopeptidase site has replaced the C peptide (boxed). The synthetic 133 bp fragment referred to in Example II is defined by the vertical and horizontal lines thru the nucleotide sequence.
FIG. 4 is a restriction map of yeast shuttle vector pAB24.
FIG. 5 shows the DNA sequence of the synthetic gene encoding IGF1 described in Example III.
FIG. 6 is a restriction map of pYLUIGF1-55, an expression vector described in Example III encoding IGF1 under the control of a truncated α-factor leader.
FIG. 7 is a restriction map of pYLUIGF1-24, an expression vector described in Example III encoding IGF1 under the control of a full-length α-factor leader with three glycosylation sites.
DETAILED DESCRIPTION
The practice of the present invention will employ, unless otherwise indicated, conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are fully explained in the literature. See, e.g., Maniatis, Fritsch & Sambrook, Molecular Cloning: A Laboratory Manual (1982); DNA Cloning, Vols. I & II (D. N. Glover, ed. 1985); Oligonucleotide Synthesis (M. J. Gait, ed. 1984); Transcription and Translation (B. D. Hames & S. J. Higgins, eds. 1984); Immobilized Cells and Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide to Molecular Cloning (1984).
In describing the present invention, the following terminology will be used in accordance with the definitions set out below.
A “replicon” is any genetic element (e.g., plasmid, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo—i.e., capable of replication under its own control.
A “vector” is a replicon such as a plasmid, phage, or cosmid to which another DNA segment may be attached so as to bring about the replication of the attached segment.
A “double-stranded DNA molecule” refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymidine, or cytosine) in its normal, double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of a particular double-stranded DNA molecule, sequences will be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the nontranscribed strand of DNA, i.e., the strand having a sequence homologous to the mRNA produced from a particular coding sequence.
A DNA “coding sequence” is DNA sequence which can be transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by and include the translation start codon at the 5′ (amino) terminus, and a translation stop codon at the 3′ (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic DNA sequences, vital DNA sequences, cDNA or genomic DNA sequences from eucaryotic sources (e.g., mammalian), and even synthetic DNA sequences.
“Yeast-recognized transcription initiation and termination sequences” refer to DNA regulatory regions which flank a coding sequence and are responsible for the transcription in yeast of an mRNA homologous to the coding sequence which can then be translated into the polypeptide encoded by the coding sequence. Transcription initiation sequences include yeast promoter sequences, which are DNA regulatory sequences capable of binding yeast RNA polymerase in a cell and initiating transcription of a downstream (3′ direction) coding sequence. For the purposes of defining the present invention, the promoter sequence is bounded (and excludes) at its 3′ terminus by the translation start codon of a coding sequence and extends upstream (5′ direction) to include the minimum number of nucleotides or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S1), as well as protein-binding domains (consensus sequences) responsible for the binding of the yeast RNA polymerase. Promoters useful in the present invention include the wild-type α-factor promoter, as well as other yeast promoters. Particularly preferred are promoters involved with the enzymes in the glycolytic pathway, e.g., phosphoglucoisomerase, phosphofructokinase, phosphotrioseisomerase, phosphoglucomutase, enolase, pyruvic kinase, glyceraldehyde-3-phosphate dehydrogenase, alcohol dehydrogenase, as well as hybrids of these promoters. See, e.g., EPO Publication Nos. 120,551; 164,556. Transcription initiation sequences can also include other regulatory regions responsible for promoter regulation or enhancement. In like manner, a transcription terminator sequence located 3′ to the translation stop codon can be either the wild-type α-factor transcription termination sequence, or another yeast-recognized termination sequence, such as those from the genes for the above glycolytic enzymes.
A coding sequence is “under the control” of transcription initiation and termination sequences when RNA polymerase binds the transcription initiation sequence and transcribes the coding sequence into mRNA terminating at the transcription termination sequence, and the mRNA is then translated into the polypeptide encoded by the coding sequence (i.e., “expression”). The precursor polypeptide encoded by the coding sequences of the present invention is “secreted” when at least a portion (usually the non-yeast protein in the absence of the leader sequence) is transported extracellularly where it is found in the cell growth medium. Usually, only the portion of precursor protein downstream from the lead sequence is secreted, and this downstream portion may also be subjected to additional processing during secretion, such as proteolytic cleavage, glycosylation, folding, disulfide bond formation, etc.
A cell has been “transformed” by exogenous DNA when such exogenous DNA has been introduced inside the cell wall. Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell. The exogenous DNA may be maintained extrachromosomally on a replicon such as a plasmid. When the exogenous DNA has become integrated to the chromosome, it is inherited by daughter cells through chromosome replication. A cell which has been transformed by exogenous DNA which is integrated into the chromosome is referred to as a “stably” transformed cell. A “clone” or “clonal population” is a population of cells derived from a single cell or common ancestor by mitosis.
Two DNA sequences are “substantially homologous” when at least about 60% (preferably at least about 75%, and most preferably at least about 90%) of the nucleotides match over a defined length of the molecules. Sequences that are substantially homologous can be identified in a Southern hybridization experiment under conditions of a selected stringency as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
A “heterologous region” of a DNA molecule is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian protein, the heterologous region will usually be flanked by DNA that does not flank the mammalian DNA sequence in the genome of the source organism. Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different from organisms which encode the same or similar protein). Allelic variations or naturally occurring mutational events do not give rise to a “heterologous” region of DNA as used herein.
As used herein, “yeast” includes ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts and yeast belonging to the Fungi imperfecti (Blastomycetes). The scosporogenous yeasts are divided into two families, Spermophthoraceae and Saccharomycetaceae. The latter is comprised of four subfamilies, Schizosaccharomycoideae (e.g., genus Schizosaccharomyces), Nadsonioideae, Lipomycoideae and Saccharomycoideae (e.g., genera Pichia, Klyveromyces and Saccharomyces). The basidiosporogenous yeasts include the genera Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium and Filobasidiella. Yeast belonging to the Fungi Imperfecti are divided into two families, Sporobolomycetaceae (e.g., genera Sporobolomyces, Bullera) and Cryptococcaceae (e.g., genus Candida). Of particular interest to the present invention are species within the genera Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces and Candida. Of particular interest are the Saccharomyces species S. cerevisiae, S. carlsbergensis, S. diastaticus, S. douglasii, S. kluyveri, S. norbensis and S. oviformis. Species of particular interest in the genus Kluyveromyces include K. lactis. Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (F. A. Skinner, S. M. Passmore & R. R. Davenport eds. 1980) (Soc. App. Bacteriol. Symp. Series No. 9). In addition to the foregoing, those of ordinary skill in the art are presumably familiar with the biology of yeast and the manipulation of yeast genetics. See, e.g., Biochemistry and Genetics of Yeast (M. Bacila, B. L. Horecker & A. O. M. Stoppani eds. 1978); The Yeasts (A. H. Rose & J. S. Harrison eds., 2nd ed., 1987); The Molecular Biology of the Yeast Saccharomyces (Strathern et al. eds. 1981). The disclosures of the foregoing references are incorporated herein by reference.
The present invention employs truncated leader sequences from a yeast α-factor gene. α-factor is an oligopeptide mating pheromone about 13 residues in length produced from a large precursor polypeptide between about 100 and 200 residues (typically about 120-160) in length (prepro-α-factor). The precursor is comprised of a hydrophobic “signal sequence” of about 20 residues (e.g., about 19-23, typically about 20-22) followed by an additional leader region of about 60 hydrophilic residues (the “pro” region), which is then linked to several tandem repeats of the mature pheromone sequence (typically about 2-6) separated by short oligopeptide spacer regions (typically about 6-8 residues) which provide for proteolytic processing to the mature pheromone.
The cloning of various prepro-α-factor genes has been reported. See, e.g., Kurjan et al., U.S. Pat. No. 4,546,082; Singh et al. (1983) Nucleic Acids Res. 11:4049-4063; commonly owned U.S. patent application Ser. No. 078,551, filed 28 Jul. 1987, now U.S. Pat. No. 5,010,182, the disclosure of which is incorporated herein by reference. In addition, DNA sequences encoding the prepro-α-factor gene can be identified by hybridization with probes from known prepro-α-factor sequences. See, e.g., Brake et al. (1983) Molec. & Cell Biol. 3:1440-1450. α-factor may also be purified from a yeast species, sequenced and probes designed to clone the prepro-α-factor gene. See, e.g., McCullough et al. (1979) J. Bacteriol. 138:146-154; Sato et al. (1981) Agric. Biol. Chem. 44:1451-1453; Singh et al. (1983), supra. It has also been determined that the α-factor leader sequence from one yeast species can be functional in another yeast species. See, e.g., U.S. Ser. No. 078,551, supra. Thus, the present invention contemplates not only the use of α-factor leader sequences from yeast in general, but the use of such leader sequences in heterologous yeast species. For ease of presentation, however, the invention will be discussed in terms of the prepro-α-factor gene MFα1 from S. cerevisiae. See, e.g., Kurjan et al., U.S. Pat. No. 4,546,083; Singh et al. (1983), supra.
The present invention employs chimetic DNA constructs encoding hybrid precursor polypeptides comprised of a leader sequence and a non-yeast polypeptide. For purposes Of this invention, the leader sequence DNA is defined as beginning at the N-terminal start codon (methionine) of the precursor polypeptide through the codon encoding the last amino acid residue before the processing site that intervenes between the leader sequence and the sequence encoding the non-yeast protein. The leader sequence of the present invention is comprised of a truncated form of a yeast α-factor leader sequence, typically about 25 to about 50 amino acid residues in length. Thus, the leader sequence of the present invention is approximately 30 amino acid residues shorter than the typical full-length α-factor leader. MFα1, for example, contains a leader sequence of 83 amino acid residues followed by a hexapeptide spacer sequence which is cleaved by yeast processing enzymes. In making deletions from the leader sequence, it is important that at least one glycosylation site (-Asn-Y-Thr/Ser-) is retained to provide for efficient secretion.
It is also necessary that the leader retain a functional α-factor signal sequence. As indicated above, the signal peptide is usually about 20 amino acids in length, and characteristic features including a hydrophobic core. See, e.g., von Heijne, (1984) J. Mol. Biol. 173:243-251. All of the prepro-α-factor sequences examined today encode for a hydrophobic peptide of about 20 residues in length. While the exact length of a signal peptide necessary to direct the precursor polypeptide to the secretory pathway is not defined, it will usually require between about 19 and about 23 residues, the minimum sequence required being readily definable by the testing of deletion mutants.
Thus, with reference to MFα1, deletions within the range of about 30 to about 60 residues, typically between about 33 and about 58 residues, and more typically between about 48 and about 58 residues, is contemplated by the present invention. These deletions will generally occur in the region between and including residues 26 through 83. It is preferred that the deletions include the glycosylation sites at residues 57-59 and 67-69. The deleted α-factor leader sequences may be replaced, in part, by non-α-factor leader sequences, if desired. The sequences should generally encode hydrophilic amino acid residues, should not encode glycosylation or processing sites, and preferably should be selected to maintain the overall length of the leader to be about 50 residues or less, preferably about 23 to 40 residues, and most preferably about 25 to 35 residues.
As indicated above, the leader sequence of the present invention has immediately 3′ thereto a processing site which allows for the cleavage of the leader from the non-yeast protein sequence to which it is fused in the precursor polypeptide. The processing site employed in the present invention is defined as the codons defining the minimum number of amino acid residues which are specifically recognized for cleavage by the selected process (e.g., chemical, enzymatic, etc.). Various processing sites are known in the art, including both those active in vivo and in vitro. For example, the processing site may provide for in vitro processing by encoding a cleavage site for a proteolytic enzyme which does not occur in the yeast host. The recovered precursor polypeptide would then be treated with the enzyme to cleave the non-yeast protein from the precursor. Another in vitro processing site is a methionine codon which can be cleaved by post-expression treatment with cyanogen bromide. See, e.g., U.S. Pat. No. 4,366,246.
In vivo processing sites can be selected from any peptide signals recognized by a yeast proteolytic enzyme which will provide for expression of the desired non-yeast protein sequence. Particularly preferred processing sites are those for the enzymes involved in processing of native prepro-α-factor. For example, dipeptidyl aminopeptidase A (DPAPase A) removes terminal -X-Ala- sequences, where X is Glu or Asp. See, e.g., Julius et al. (1983) Cell 32:839-852. The endopeptidase encoded by the KEX2 gene cleaves basic dipeptides comprised of Lys and Arg residues; i.e., Lys-Arg, Arg-Arg, Arg-Lys and Lys-Lys. Fuller et al., Microbiology 1986, pp. 273-278 (1986). In yeast, the α-factor precursor is first cleaved by the KEX2 endopeptidase, and then the N-termini are trimmed by DPAPase A to provide mature α-factor pheromone. Since it appears that the latter proteolytic process is a rate limiting step, it is preferred to eliminate the signals for DPAPase A, such that the processing site is comprised only of the signal for the KEX2 endopeptidase. In such an embodiment, therefore, the leader sequence will be joined to the non-yeast protein sequence by the dibasic peptide recognition site for KEX2 endopeptidase, such as Lys-Arg or Arg-Arg.
The carboxy-terminal portion of the precursor polypeptide of the present invention is a non-yeast protein. The DNA sequence encoding this portion is defined herein as beginning with the first codon downstream (3′ direction) from the last codon of the processing site through to the translation stop codon which defines the carboxy-terminal of the precursor polypeptide. This DNA sequence will be considered to encode a “non-yeast protein” when, over its entire sequence, it defines a polypeptide that is not substantially homologous to a polypeptide expressed by yeast. In general, the preferred non-yeast proteins will be mammalian protein sequence (including their analogs; i.e., “muteins”, fragments, etc) As defined herein, non-yeast proteins can include, therefore, a fusion protein comprised of mammalian and yeast sequences, as well as “pro” forms of the mature mammalian protein.
DNA sequences encoding the non-yeast proteins can be sequences cloned from non-yeast organisms, or they can be synthetic sequences, usually prepared using yeast-preferred codons. Usually, the non-yeast proteins will be at least about 8 amino acids in length and can include polypeptides up to about 100,000 daltons or higher. Usually, the non-yeast polypeptide sequence will be less than about 300,000 daltons, and more usually less than about 150,000 daltons. Of particular interest are polypeptides of from about 5,000 to about 150,000 daltons, more particularly of about 5,000 to about 100,000 daltons. Illustrative non-yeast proteins of interest include hormones and factors, such as growth hormone, somatomedins, epidermal growth factor, luteinizing hormone, thyroid-stimulating hormone, oxytocin, insulin, vasopressin, renin, calcitonin, follicle-stimulating hormone, prolactin, erythropoietin, colony-stimulating factors, lymphokines such as interleukin-2, globins, immunoglobulins, interferons (e.g., α, β or γ), enzymes, β-endorphin enkephalin, dynorphin, insulin-like growth factors, etc.
In a preferred embodiment of the present invention, DNA constructs encoding the above-described precursor polypeptides have the structure:
5′-AF-CHO-Xn-S-Gene*-3′
wherein AF encodes a yeast alpha-factor signal peptide; CHO encodes a glycosylation site; Xn encodes a polypeptide of n amino acids in length that does not contain a glycosylation site or processing site that will cause the precursor polypeptide to be cleaved in vivo by the yeast host; n is an integer from 0 to about 30; Gene* encodes a non-yeast protein; and S encodes a processing site that provides for cleavage of said precursor polypeptide.
The signal peptide encoded by AF is the same α-factor signal peptide described above. It is approximately 20 residues in length (e.g., about 19-23) and is of sufficient length to direct the precursor polypeptide into the yeast secretory pathway. The precise minimum or maximum length can be determined for a particular α-factor by screening a series of deletion constructs.
The DNA sequence defined by CHO encodes a glycosylation site. It will generally be nine nucleotides in length, including three codons for the amino acids Asn-Y-Y′-, wherein Y is any amino acid residue, and Y′ is Thr or Set Ser.
Xn, if present, encodes, for example, portions of the α-factor leader which are not deleted or unrelated amino acid sequences. In general, Xn will be a maximum of about 30 amino acid residues, more preferably a maximum of about 20 residues, and most preferably a maximum of about 10 residues. While it may not be necessary for Xn to encode any polypeptides (i.e., n=0), it may be desired to provide some spacing between the glycosylation site CHO, and the processing site S in the event that carbohydrate additions at the glycosylation site sterically hinder access of the agent which cleaves the processing sites. In such case, n will usually be a minimum of about 1, more preferably a minimum of about 2, while most preferably a minimum of about 3.
It is preferred that Xn, if present, not contain any functional glycosylation sites or processing sites recognized and cleaved by the yeast host. Further, when departing from sequences found in an α-factor leader, it is preferred to select hydrophilic amino acid residues. It is possible that the length of Xn will affect the efficiency of expression and secretion of the non-yeast protein. Selection of the appropriate length of Xn to optimize expression can be done through screening constructs of various sizes.
The non-yeast protein encoded by Gene* and the processing site encoded by S are as described above.
The DNA constructs of the present invention will normally be maintained in a replicon capable of stable maintenance in a host, particularly a yeast host. The replicons, usually plasmids, will include one or more replication systems, desirably two replication systems, allowing for maintenance of the replicon in both a yeast host for expression, and in a procaryotic host for cloning. Examples of such yeast-bacteria shuttle vectors include YEp24 [Botstein et al. (1979) Gene 8:17-24], pC1/1 [Brake et al. (1984) Proc. Natl. Acad. Sci. USA 81:4642-4646], and YRp17 [Stnichomb et al. (1982) J. Mol. Biol. 158:157]. Furthermore, a plasmid expression vector may be a high or low copy number plasmid, the copy number generally ranging from about 1 to about 200. With high copy number yeast vectors, there will generally be at least 10, preferably at least 20, and usually not exceeding about 150 copies in a single host. Depending upon the non-yeast protein selected, either a high or low copy number vector may be desirable, depending upon the effect of the vector and the foreign protein on the host. See, e.g., Brake et al., supra. DNA constructs of present invention can also be integrated into the yeast genome by an integrating vector. Examples of such vectors are known in the art. See, e.g., Botstein et al., supra.
The selection of suitable yeast and other microorganism hosts for the practice of the present invention is within the skill of the art. When selecting yeasts hosts for expression, suitable hosts may include those shown to have, inter alia, good secretion capacity, low proteolytic activity, and overall robustness. Yeast and other microorganisms are generally available from a variety of sources, including the Yeast Genetic Stock Center, Department of Biophysics and Medical Physics, University of California, Berkeley, Calif.; and the American Type Culture Collection, Rockville, Md.
Methods of introducing exogenous DNA into yeast hosts are well known in the art. There is a wide variety of ways to transform yeast. For example, spheroplast transformation is taught, for example, by Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA 75:1919-1933, and Stinchcomb et al., EPO Publication No. 45,573. Transformants are grown in an appropriate nutrient medium, and, where appropriate, maintained under selective pressure to insure retention of endogenous DNA. Where expression is inducible, growth can be permitted of the yeast host to yield a high density of cells, and then expression is induced. The secreted, processed non-yeast protein can be harvested by any conventional means, and purified by chromatography, electrophoresis, dialysis, solvent-solvent extraction, and the like.
EXAMPLES
The following examples are provided for illustrative purposes only, and are not intended to limit the scope of the present invention. It is believed that the deposit of the starting biological materials is not necessary for the practice of the present invention since either the same or equivalent materials are publicly available.
Example I
The following example provides a comparison of the levels of expression and secretion obtained with modified α-factor constructs used to express human proinsulin. Three constructs employ full-length α-factor leaders; one having α-factor leader with the three native glycosylation sites, one having all three of the glycosylation sites eliminated, and one having all of the sites, except the one at Asn23, removed. The fourth construct is a truncated α-factor leader which retains a single glycosylation site at Asn23.
A. pYGAI1
This plasmid encodes an α-factor leader [Brake et al. (1984) Proc. Natl. Acad. Sci. USA 81:4642-4646; EPO Publication No. 116,201] linked to human proinsulin. The proinsulin is encoded by a synthetic gene made with yeast preferred codons (FIG. 1). The α-factor leader sequence, the synthetic proinsulin gene and the α-factor terminator sequence are from pYBCA5, the construction of which is shown in FIG. 1. Transcription is mediated by the 404 bp BamHI-NcoI GAPDH promoter fragment. Travis et al. (1985) J. Biol. Chem. 260:4384-4389. The 1206 bp BamHI expression cassette consisting of the GAPDH promoter, the sequence encoding the α-factor leader linked to proinsulin and the α-factor terminator was cloned into the unique BamHI site of the yeast shuttle vector pAB24 (below) or pC1/1 such that the GAPDH promoter sequence was proximal to the SalI site of the vector to give the plasmids pYGAI1-AB24 or pYGAI1-C1/1, respectively. The 1206 bp BamHI expression cassette was also subcloned into the unique BamHI site of a derivative of pBR322 [pBR322(ΔEcoRI-SalI)BamHI; Travis et al. supra.] This plasmid was called pGAI1.
Plasmid pAB24 (FIG. 4) is a yeast shuttle vector which contains the complete 2μ sequence [Broach, in: Molecular Biology of the Yeast Saccharomyces, Vol., 1, p. 445 (1981)] and pBR322 sequences. It also contains the yeast URA3 gene derived from plasmid YEp24 [Botstein et al. (1979) Gene 8:17] and the yeast LEU2d gene derived from plasmid pC1/1. EPO Publication No. 116,201. Plasmid pAB24 was constructed by digesting YEp24 with EcoRI and religating the vector to remove the partial 2μ sequences. The resulting plasmid, YEp24ΔRI, was linearized by digestion with ClaI and ligated with the complete 2μ plasmid which had been linearized with ClaI. The resulting plasmid, pCBou, was then digested with XbaI and the 8605 bp vector fragment was gel isolated. This isolated XbaI fragment was ligated with a 4460 bp XbaI fragment containing the LEU2d gene isolated from pC1/1; the orientation of the LEU2d gene is in the same direction as the URA3 gene.
B. pYGAI3
Plasmid pYGAI3 differs from pYGAI1 in that it encodes a modified α-factor leader wherein the codons for Asn at residues 23, 57 and 67 have been changed to encode Gln, thereby eliminating all three signals for N-linked glycosylation.
The α-factor leader and the N-terminal 13 amino acids of proinsulin encoded by this plasmid were constructed by ligation of synthetic oligonucleotides to give a 294 bp fragment with a 5′ NcoI overhang and a 3′ HindIII overhang, the sequence which is shown in FIG. 2. The sequence of appropriate oligonucleotides was altered during the synthesis so that codons which specified Asn at positions 23, 57 and 67 of the natural α-factor leader now specified Gln at the same positions. The DNA sequence specifying the N-terminal 13 amino acids of proinsulin was identical to that in pYGAI1. The 294 bp synthetic DNA (NcoI-HindIII) fragment was substituted for the comparable fragment of pGAI1 and pYGAI1-C1/1 which gave the plasmids pGAI3 and pYGAI3, respectively.
C. pYGAI8
Plasmid pYGAI8 contains DNA encoding an α-factor leader which eliminates two of the three glycosylation sites. Asn57,67 have been modified to Gln57,67. The resulting plasmid has only a single glycosylation site at position Asn23. pYGAI8 was prepared as follows.
First, a 5′ fragment was isolated from the expression cassette of pGAI1 by cutting with HpaII, followed by cutting with BamHI, and then gel isolating a 504 bp fragment containing the GAPDH promoter and the sequence encoding residues 1-33 of the α-factor leader. Next, plasmid pYGAI3 encoding an α-factor leader lacking glycosylation sites was also sequentially cut with HpaII and BamHI, and a 702 bp fragment isolated containing sequences encoding modified α-factor leader residues 34-83, the LysArg processing site, the proinsulin sequence and the α-factor termination sequence. This fragment was then ligated to the 504 bp fragment from pGAI1, cut with BamHI and a 1206 bp fragment isolated.
The above 1.2 kb BamHI fragment which contained a complete GAPDH promoter/α-factor leader/proinsulin/α-factor terminator expression cassette was then ligated into BamHI-cut and phosphatase-treated pBR322(AEcoRI-SalI-)BamHI to give plasmid pGAI8, which was cloned in E. coli.
The 1.2 kb expression cassette from pGAI8 was removed by cutting with BamHI and then gel isolating the fragment. It was ligated into BamHI-cut and phosphatase-treated yeast shuttle vector pAB24. Insertion of the expression cassette was in the unique BamHI site of the pBR322 sequences such that the GAPDH promoter was proximal to the unique SalI site of the vector. This plasmid was pYGAI8.
D. pYGAI7
Plasmid pYGAI7 contains the DNA encoding a truncated α-factor leader and the synthetic gene for human proinsulin. The α-factor leader has been truncated so that it encodes only amino acids 1-35 of the α-factor leader and therefore contains a single site for glycosylation at Asn23. This yeast expression vector was constructed as follows.
First, pGAI1 was cut with HindIII. An HPalI-HindIII linker was added of the following structure:
5′-CGGCTAAAAGATTCGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGA
     CGATTTTCTAAGCAATTGGTTGTGAACACACCAAGAGTGAACCAACTTCGA-5′
After adding the linker, the linearized plasmid was cut with BamHI, and a 558 bp HpaII-BamHI fragment was gel isolated. This fragment contains the codons for residues 34-35 of the α-factor leader linked directly to a Lys-Arg processing site and the proinsulin sequence. There are no intervening sequences between the codon for residue 35 of the α-factor leader and the processing site directly adjacent to the proinsulin sequence.
Second, pGAI1 was cut with HpaII and BamHI, and a 504 bp fragment gel isolated. This fragment contains the GAPDH promoter and nucleotides encoding amino acids 1-33 of the α-factor leader, the 3′ end terminating in an HpaII overhang complementary to the 5′ end of the above-described 558 bp HpaII-BamHI fragment. These two fragments were ligated together and cut with BamHI to provide an expression cassette containing the GAPDH promoter, sequences encoding a modified α-factor leader containing residues 1-35 directly linked to a Lys-Arg processing site, the proinsulin gene, and the α-factor terminator. The cassette was then ligated into a BamHI site of pBR322(ΔEcoRI-SalI)BamHI, as described above, to give plasmid pGAI7 and cloned in E. coli.
pGAI7 was then cut with BamHI, and the 1062 bp expression cassette gel isolated. The expression cassette was then ligated into the BamHI site of pAB24 to give plasmid pYGAI7.
E. Comparative Expression
Plasmids pYGAI1-G1/1, pYGAI3, pYGAI1-AB24, pYGAI7 and pYGAI8 were transformed into Saccharomyces cerevisiae strain AB103.1 (Matα, leu2-3,112,ura3-52, his4-580, pep4-3[cir°]) essentially as described by Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA 75:1929-1933. Transformants of pYGAI1-C1/1 and pYGAI3 were selected for leucine prototrophy, transformants of the other plasmids were selected for ura prototrophy.
Data shown in Table 1 compares secretion of proinsulin mediated by the natural α-factor leader (pYGAI1-C1/1) or the α-factor leader with Gln substituted for Asn at positions 23, 57 and 67 (pYGAI3). Inoculum cultures (−2 ml of individual transformants) were grown for 48 hr in synthetic complete medium lacking leucine [SD-leu; Sherman et al., Methods in Yeast Genesis, p. 62 (Cold Spring Harbor Laboratory, 1982)] and diluted 20-fold into the same medium. Cultures were grown 48-72 hrs, culture supernatants were prepared by centrifugation and were assayed for immunoreactive cross-reacting insulin-like material (ILM) in a competition radioimmune assay with 125I-labeled insulin. As can be seen in Table 1, elimination of the three glycosylation sites from the α-factor leader resulted in essentially no secretion of insulin-like-material compared to that mediated by the native α-factor leader.
Data presented in Table 2 compares transformants of pYGAI1-pAB24 (full-length native α-factor leader), pYGAI8 (full-length α-factor leader with only one glycosylation site at Asn23) and pYGAI7 (truncated α-factor leader containing a single glycosylation site at Asn23) for their ability to secrete insulin-like-material. Inoculum cultures of the indicated transformants (˜2 ml) in SD-Leu grown for ˜48 hr at 30° C. were pelleted by centrifugation washed and diluted 20-50 fold into ura medium. This medium contains 0.67% yeast nitrogen base, 1% succinic acid, 0.35% NaOH, 0.5% casamino acids, 2% glucose, 0.005% adenine, 0.01% tryptophan and 0.02% threonine.
Cultures were grown at 30° C. for 48-72 hr, and culture supernatants prepared and assayed as described above. Data presented in Table 2 show that the transformants carrying the construct employing the truncated α-factor leader retaining a single glycosylation site at Asn23 secreted generally more immunoreactive insulin-like-material than did transformants bearing the construct with the full-length native α-factor leader. Transformants bearing the construct with the full-length α-factor leader with the same single glycosylation site (Asn23) secreted much less insulin cross-reactive material than did transformants bearing the full-length native α-factor leader or the truncated α-factor leader.
TABLE 1
Effect of Elimination of α-Factcr Leader
Glycosylation Sites on Secretion of
Insulin-Like-Material
ILM1
Transformant OD650 μg/ml μg/ml, OD650
AB103.1[pYGAI1-C1/1] −1 5.9 .24 .04
−2 5.9 .24 .04
−3 2.1 .08 .04
AB103.1[pYGAI3] −1 ND .003
−2 ND .007
1Cross-reactive insulin-like-material (ILM) as determined by a competition radioimmune assay with 125I-labeled insulin and insulin standards. Data is reported as ILM secreted per ml of culture and in some cases as ILM secreted per ml normalized to a culture cell density with an absorbance at wavelength 650 mμ of 1.
TABLE 1
Effect of Elimination of α-Factcr Leader
Glycosylation Sites on Secretion of
Insulin-Like-Material
ILM1
Transformant OD650 μg/ml μg/ml, OD650
AB103.1[pYGAI1-C1/1] −1 5.9 .24 .04
−2 5.9 .24 .04
−3 2.1 .08 .04
AB103.1[pYGAI3] −1 ND .003
−2 ND .007
1Cross-reactive insulin-like-material (ILM) as determined by a competition radioimmune assay with 125I-labeled insulin and insulin standards. Data is reported as ILM secreted per ml of culture and in some cases as ILM secreted per ml normalized to a culture cell density with an absorbance at wavelength 650 mμ of 1.
Example II
This example compares the expression of a full-length α-factor leader construct, retaining all glycosylation sites, to an expression construct employing a truncated α-factor sequence retaining only a single glycosylation site at Asn23. The non-yeast protein employed in this example is a human proinsulin analog wherein the connecting “C” peptide has been replaced by a yeast KEX2 endopeptidase cleavage site.
A. pYGAIC3
The plasmid pGAIC3 was made by replacing the 231 bp HindIII-SalI fragment of pGAI1 which encodes amino acids 14 through 30 of the B chain, the C-peptide, the A chain and 2 translation stop codons with a 132 bp synthetic HindIII-SalI gene fragment (shown in FIG. 3) which encodes amino acids 14 through 30 of the B chain, a Lys-Arg KEX2 endopeptidase cleavage site, the A chain, and translation stop codons. The plasmid pYGAIC3 was prepared from pGAIC3 as follows.
Plasmid pGAIC3 was digested with BamHI, and the 1107 bp BamHI expression cassette containing the GAPDH promoter, the sequence encoding α-factor leader linked to proinsulin analog, and the α-factor transcription terminator was isolated and ligated into BamHI digested and phosphatase-treated pAB24, and then cloned in E. coli. Plasmid pYGAIC3 was obtained, in which the expression cassette was oriented such that the GAPDH promoter was proximal to the unique SalI site of the vector.
B. pYαfL7C3
Plasmid pYαFL7C3 contains DNA encoding the truncated α-factor leader described above for pYGAI7 linked to the sequence for the proinsulin analog, also described above (pYGAIC3). This plasmid was constructed as follows.
First, pGAIC3 was cut with HindIII and SalI, and a 132 bp fragment was gel isolated. This fragment contains sequences encoding all but the first 12 codons of the proinsulin analog. It was ligated into a gel isolated 4640 bp fragment from HindIII- and Sail-digested pGAI7 to provide plasmid pαfL7C3. After cloning in E. coli, this plasmid was cut with BamHI and a 1062 bp BamHI fragment was gel isolated. This expression cassette contains the truncated α-factor leader construct of pGAI7 with the proinsulin analog in place of the normal proinsulin sequence. The expression cassette was then ligated into the BamHI site of pAB24, as described above, to give pYαfL7C3.
Comparative Expression
Expression levels were determined for pYGAIC3 and pYαfL7C3 in two strains of S. cerevisiae. Strain AB103.1 has been described in Example I. Strain AB110-4 is a derivative of Saccharomyces cerevisiae strain AB110 (Matα, leu2, ura3-52, pep4-3, his4-580[cir°]) in which a deletion has been engineered into the pep4 gene. These strains were transformed as described above with plasmids pYGAIC3, and pYαfL7C3, and ura prototrophs were selected. Inoculum cultures were grown in SD-leu [Sherman et al., supra.] at 30° C. for 24-48 hours then pelleted by centrifugation, washed and diluted 20 fold into ura medium (described above) and grown for 48-72 hours at 30° C. Cell-free conditioned culture medium was prepared by centrifugation for assay in a competition insulin radioimmune assay.
The results are shown in Table 3. As can be seen the truncated α-factor construct mediates increased secretion of immunoreactive proinsulin analog, compared to the natural α-factor leader sequence.
TABLE 3
Secretion of ILM from a Proinsulin Analog
Construct Mediated by a Truncated
α-Factor Leader or Natural α-Factor
Leader
ILM2
No. of μg/ml μg/ml OD650
Transformant Tests1 Range Mean Std. dev. Range Mean Std. dev.
AB103.1 6   1-2.75 1.66 .65 .11-.20 .14 .04
[pYGA1C3]
AB103.1 6  1.5-6.63 4.46 2.15 .14-.60 .40 .19
[pyαfL7C3]
AB110.4 3 1.15-1.4  1.28 .13 .10-.12 .11 .01
[pYGAIC3]
AB110.4 3 2.15-4.12 3.46 1.14 .19-.38 .31  10
[pyαfL7C3]
1A minimum of three independent transformants were tested.
2Secreted cross-reactive insulin-like-material (ILM) was determined by a competition radioimmune assay with 125I-labeled insulin and insulin standards. Results are reported as amounts of ILM per ml of culture and as amount secreted per ml normalized to a cell density with an absorbance at 650 mμ wavelength = 1.
Example III
This example describes the construction of a truncated α-factor expression vector which mediates increased levels of active insulin-like growth factor-1.
First, a DNA sequence encoding a truncated α-factor leader and a coding sequence for IFG1 was prepared. A synthetic sequence was prepared by standard procedures employing an Applied Biosystems 380A DNA synthesis machine according to manufacturer's direction. Fourteen DNA sequences were synthesized ranging from 22 to 57 bases in length, purified by PAGE, and phosphorylated individually by T4 kinase in the presence of ATP. The sequences were then annealed and ligated by standard procedures.
The sequence of the synthetic gene is shown in FIG. 5. The purified synthetic gene fragment was cloned into NcoI/SalI digested pBS100 (described below). The resulting plasmid was called pBS100 TαfL IGF1.
Plasmid pBS100 contains a yeast expression cassette cloned into a pBR322 derivative, pAB12. The expression cassette contains the hybrid ADH-2/GAPDH promoter and the GAPDH terminator flanking a non-essential gene segment. The ADH-2/GADPH promoter is a 1200 bp BamHI-NcoI fragment isolated from pJS103 (see below) and the GAPDH terminator is a 900 bp SalI-BamHI fragment isolated from plasmid pPAG1. EPO Publication No. 164,556. Plasmid pBS100 also contains a non-essential fragment between NcoI and SalI sites which is replaced by gene fragments of interest. The expression cassette can be removed from pBS100 by digestion with BamHI and cloned into yeast shuttle vectors for introduction into yeast cells.
Plasmid pJS103, which contains the hybrid ADH-2/GAPDH promoter employed above, was constructed as follows. The ADH-2 portion of the promoter was constructed by cutting a plasmid containing the wild-type ADH2 gene from plasmid pADR2 [Beier et al. (1982) Nature 300:724-728] with restriction enzyme EcoR5, which cuts at position +66 relative to the ATG start codon, as well as in two other sites in pADR2, outside of the ADH2 region. The resulting mixture of a vector fragment and two smaller fragments was reacted with Ba131 exonuclease to remove about 300 bp. Synthetic XhoI linkers were ligated onto the Ba131-treated DNA. The resulting DNA linker vector fragment (about 5 kb) was separated from the linkers by column chromatography, cut with restriction enzyme XhoI, religated, and used to transform E. coli to ampicillin resistance. The positions of the XhoI linker were determined by DNA sequencing. One plasmid which contained an XhoI linker within the 5′ nontranscribed region of the ADH2 gene (position −232 from ATG) was cut with the restriction enzyme XhoI, treated with nuclease S1, and subsequently treated with the restriction enzyme EcoRI to create a linear vector molecule having 1 blunt end at the site of the XhoI linker and an EcoRI end. The GAPDH portion of the promoter was constructed by cutting plasmid pPGAP [EPO Publication No. 164,556] with the enzymes BamHI and EcoRI, followed by the isolation of the 0.4 Kbp DNA fragment. This purified fragment was then completely digested with the enzyme AluI and an approximately 200 bp fragment was isolated. This GAPDH promoter fragment was ligated to the ADH-2 fragment present on the linear vector described above to give plasmid JS103.
A BamHI fragment was then isolated from pBS100 TαfL IGF1. This fragment contains the ADH2/GAPDH promoter, a truncated α-factor leader (AA 1-25, 81-83) a LysArg processing site, a coding sequence for IGF1, and the GAPDH terminator sequence. This BamHI fragment was then cloned into pAB24, previously digested with BamHI. A positive clone was selected, and while initially called plasmid 18.5, it was subsequently named pYLUIGF1-55. (See FIG. 6.)
A second expression vector, pYLUIGF1-24 was also prepared by analogous methods. A restriction map is shown in FIG. 7. This vector is similar to pYLUIGF1-55, except that it has a full-length α-factor leader directing secretion with three glycosylation sites (compare Example I.A.) and the α-factor terminator.
Yeast strain AB110 (EPO Publication No. 164,556) was transformed with pYLUIGF1-55 and pYLUIGF1-24 by conventional spheroplasting techniques [Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA 75:1919-1933], and expression compared.
The expression of IGF1 from AB110 (pYLUIGF1-55) and AB110 (pYLUIGF1-24) is non-constitutive. Induction of IGF1 expression was achieved by bringing about a low concentration of glucose in the growth medium. Under standard conditions, shake flask cultures (25 ml) fully utilize the glucose in the medium by 18-24 hours post inoculation. Thus, 25 ml cultures of AB110 (pYLUIGF1-55) and AB110 (pXLUIGF1-24) were grown under standard conditions for 72 hours. Supernatant samples were taken at 49 and 72 hours post inoculation and assayed for IGF1 biological activity (RigA) and for immunoreactivity (RIA) with anti-IGF1 antibodies. As can be seen, pYLUIGF1-55, with a truncated α-factor leader, secreted protein of which a substantially greater fraction was biologically active. Although pYLUIGF1-24 secreted more protein that showed reactivity with IGF1 antibodies, relatively little of this protein was biologically active.
The results are shown in Table 4. The radioreceptor assay (RRA) measures the ability of IGF-1 to bind to its receptor. This is a measure of the biological activity of recombinant polypeptide since it is believed that IGF-1 exerts all of its activity through its receptor. The receptor assay is described in Marshall et al. (1974) J. Clin. Endorinol. Metab. 19:283-292. The radioimmunoassay (RIA) is a competitive assay that measures the amount of protein antigenically cross-reactive with native IGF-1, whether or not it is biologically active. The assay is described in Zapf et al. (1981) J. Clin. Invest. 68:1321-1330.
TABLE 4
Secretion of IGF1 Mediated by a Truncated
α-Factor Leader or a Natural α-Factor
Leader
Transformant 49 hrs
72 hrs RRA1 RIA2 RRA RIA
AB110 1.0 14 1.3 14
(pYLUIGF1-55)
AB110 1.3 54 2.7 66
(pYLUIGF1-24)
1μg/ml
2μg/ml
Deposit of Biological Materials
The following expression vectors were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md., U.S.A., and will be maintained under the provisions of the Budapest Treaty. The accession numbers and dates of deposit are listed below.
Deposited Material ATCC Number Deposit Date
E. coli (pYGAI7) 67597 12/29/87
E. coli (pYαfL7C3) 67596 12/29/87
E. coli (pYLUIGFI-55) 67595 12/29/87
These deposits are provided for the convenience of those skilled in the art. These deposits are neither an admission that such deposits are required to practice the present invention nor that equivalent embodiments are not within the skill of the art in view of the present disclosure. The public availability of these deposits is not a grant of a license to make, use or sell the deposited materials under this or any other patent. The nucleic acid sequences of the deposited materials are incorporated in the present disclosure by reference, and are controlling if in conflict with any sequences described herein.
Although the foregoing invention has been described in some detail for the purpose of illustration, it will be obvious that changes and modifications may be practiced within the scope of the appended claims by those of ordinary skill in the art.

Claims (75)

I claim:
1. A yeast cell comprising a DNA construct that provides for the expression and secretion of a non-yeast protein, said DNA construct comprising
a yeast recognized transcription initiation sequence, linked 5′ to
a coding sequence under the control of both said yeast recognized transcription initiation sequence and
a yeast-recognized termination sequence, said yeast-recognized termination sequence being 3′ to said coding sequence,
wherein said coding sequence encodes a precursor polypeptide comprised of a leader sequence and said non-yeast protein linked by a processing site that provides for the cleavage of said non-yeast protein from said precursor polypeptide,
wherein said leader sequence is about the first 25 to about the first 50 N-terminal residues of a yeast alpha-factor leader polypeptide,
comprises a single yeast alpha-factor precursor glycosylation site and comprises a single peptide of a yeast alpha-factor precursor comprising the first about 19 to about 23 N-terminal residues of said alpha-factor precursor.
2. The cell of claim 1 wherein said non-yeast protein is a mammalian protein.
3. The cell of claim 2 wherein said mammalian protein is a precursor of human insulin.
4. The cell of claim 3 wherein said precursor of human insulin is human proinsulin.
5. The cell of claim 3 1wherein said precursor of human insulinnon-yeast protein comprises insulin a chain and insulin b chain linked by a yeast-recognized processing site cleaved in vivo.
6. The cell of claim 5 wherein said processing site is cleaved by the KEX2 gene product of Saccharomyces.
7. The cell of claim 2 wherein said mammalian protein is insulin-like growth factor I.
8. The cell of claim 1 wherein said yeast cell is from the genus Saccharomyces.
9. The cell of claim 8 wherein said yeast cell is S. cerevisiae.
10. The cell of claim 8 wherein yeast α-factor precursor is S. cerevisiae MFα1.
11. The cell of claim 1 wherein said leader sequence is about 28 to about 40 N-terminal residues of said precursor polypeptide.
12. The cell of claim 1 wherein said leader sequence is about 35 contiguous N-terminal residues of a yeast alpha-factor precursor polypeptide.
13. A double-stranded DNA molecule comprising a region encoding a precursor polypeptide secretable by a yeast host, said region, with reference to one of the strands, having comprising the structure:
5′-AF-CHO-Xn-S-Gene*-3′
wherein
AF encodes a yeast alpha-factor signal peptide;
CHO encodes a yeast alpha-factor precursor glycosylation site comprising the amino acid sequence Asn-Y-Y′ wherein Y is any amino acid and Y′ is Thr or Ser;
Xn encodes a spacer polypeptide of n amino acids in length that does not contain a glycosylation site or a processing site that provides for cleavage of said precursor polypeptide in vivo by yeast;
n is an integer from 0 to 30;
Gene* encodes a non-yeast protein; and
S encodes a processing site that provides for cleavage of said precursor polypeptide.
14. The DNA molecule of claim 13 wherein AF encodes a polypeptide of about 19 to 23 amino acids in length.
15. The DNA molecule of claim 13 wherein n is an integer from about 0 to about 20.
16. The DNA molecule of claim 13 wherein n is an integer from about 0 to about 10.
17. The DNA molecule of claim 13 wherein n is an integer from about 3 to about 10.
18. The DNA molecule of claim 13 wherein said yeast host is a Saccharomyces.
19. The DNA molecule of claim 13 wherein said yeast α-factor signal peptide is a Saccharomyces signal peptide.
20. The DNA molecule of claim 13 wherein S encodes a processing site recognized in vivo by said yeast host.
21. The DNA molecule of claim 20 wherein S encodes a dipeptide recognized by the KEX2 endopeptidase.
22. The DNA molecule of claim 21 wherein said dipeptide is 5′-Lys-Arg-3′ or 5′-Arg-Arg-3′.
23. The DNA molecule of claim 13 comprising a replicon.
24. The DNA molecule of claim 23 wherein said region encoding said precursor polypeptide is under the control of yeast-recognized transcription initiation and termination sequences, and said replicon is a yeast replicon.
25. The DNA molecule of claim 24 wherein said replicon is a plasmid.
26. The DNA molecule of claim 24 wherein said replicon is a chromosome.
27. A DNA molecule comprising a nucleotide sequence that encodes about the first 25 to about the first 50 contiguous N-terminal amino acids of a yeast alpha-factor precursor leader sequence that includes a single yeast alpha-factor precursor leader sequence glycosylation site and no other yeast alpha-factor precursor leader sequence glycosylation site.
28. The DNA molecule of claim 27 wherein the nucleotide sequence encodes about the first 25 to about the first 40 contiguous N-terminal amino acids of a yeast alpha-factor precursor leader sequence that includes a single yeast alpha-factor precursor leader sequence glycosylation site and no other yeast alpha-factor precursor leader sequence glycosylation site.
29. The DNA molecule of claim 27 wherein the nucleotide sequence encodes about the first 35 contiguous N-terminal amino acids of a yeast alpha-factor precursor leader sequence that includes a single yeast alpha-factor precursor leader sequence glycosylation site and not other yeast alpha-factor precursor leader sequence glycosylation site.
30. The DNA molecule of claim 27 wherein the nucleotide sequence encodes about the first 28 contiguous N-terminal amino acids of a yeast alpha-factor precursor leader sequence that includes a single yeast alpha-factor precursor leader sequence glycosylation site and no other yeast alpha-factor precursor leader sequence glycosylation site.
31. The DNA molecule of claim 27 wherein the nucleotide sequence encodes amino acids 1-25 and 81-83 of a yeast alpha-factor precursor leader sequence.
32. A method for producing a recombinant protein, said method comprising:
providing a yeast cell as defined in claim 1, and
culturing said yeast cell under conditions that provide for expression and secretion of said non-yeast protein.
33. The method of claim 32 wherein said non-yeast protein is a mammalian protein.
34. The method of claim 32 wherein said non-yeast protein is a precursor of human insulin.
35. The method of claim 34 wherein said precursor of human insulin is human proinsulin.
36. The method of claim 34 wherein said precursor of human insulin comprises insulin a chain and insulin b chain linked by a yeast-recognized processing site cleaved in vivo.
37. The method of claim 36 wherein said processing site is cleaved by the KEX2 gene product of Saccharomyces.
38. The method of claim 33 wherein said mammalian protein is insulin-like growth factor I.
39. The method of claim 32 wherein said yeast cell is from the genus Saccharomyces.
40. The method of claim 39 wherein said yeast cell is S. cerevisiae.
41. The method of claim 39 wherein said yeast alpha-factor leader polypeptide is from S. cerevisiae MFα1.
42. The method of claim 32 wherein said leader sequence is about the first 28 to about the first 40 N-terminal amino acid residues of a yeast alpha-factor leader polypeptide.
43. The method of claim 32 wherein said leader sequence is about the first 35 contiguous N-terminal residues of a yeast alpha-factor leader polypeptide.
44. A method of producing a recombinant protein, said method comprising:
transforming a yeast cell with a DNA construct that provides for the expression and secretion of a non-yeast protein, wherein said DNA construct comprises the double-stranded DNA molecule as defined in claim 13, and
culturing said transformed yeast cell under conditions that provide for expression and secretion of said non-yeast protein.
45. The method of claim 44 wherein AF encodes a polypeptide of about 19 to 23 amino acids in length.
46. The method of claim 44 wherein n is an integer from about 0 to about 20.
47. The method of claim 44 wherein n is an integer from about 0 to about 10.
48. The method of claim 44 wherein n is an integer from about 3 to about 10.
49. The method of claim 44 wherein said yeast host is a Saccharomyces.
50. The method of claim 44 wherein said yeast alpha-factor signal peptide is a Saccharomyces signal peptide.
51. The method of claim 44 wherein S encodes a processing site recognized in vivo by said yeast host.
52. The method of claim 51 wherein S encodes a dipeptide recognized by the KEX2 endopeptidase.
53. The method of claim 52 wherein said dipeptide is 5′-Lys-Arg- 3′ or 5-Arg-Arg- 3′.
54. The method of claim 44 wherein said DNA molecule comprises a replicon.
55. The method of claim 54 wherein said region encoding said precursor polypeptide is under the control of yeast-recognized transcription initiation and termination sequences, and said replicon is a yeast replicon.
56. The method of claim 55 wherein said replicon is a plasmid.
57. The method of claim 55 wherein said replicon is a chromosome.
58. A method of producing a recombinant protein, said method comprising:
transforming a yeast cell with a DNA construct that provides for the expression and secretion of a non-yeast protein, wherein said DNA construct comprises the double-stranded DNA molecule as defined in claim 27, and
culturing said transformed yeast cell under conditions that provide for expression and secretion of said non-yeast protein.
59. The method of claim 58 wherein the nucleotide sequence encodes about the first 25 to about the first 40 contiguous N-terminal amino acids of a yeast alpha-factor precursor leader sequence that includes a single yeast alpha-factor precursor leader sequence glycosylation site and no other yeast alpha-factor precursor leader sequence glycosylation site.
60. The method of claim 58 wherein the nucleotide sequence encodes about the first 35 contiguous N-terminal amino acids of a yeast alpha-factor precursor leader sequence that includes a single yeast alpha-factor precursor leader sequence glycosylation site and no other yeast alpha-factor precursor leader sequence glycosylation site.
61. The method of claim 58 wherein the nucleotide sequence encodes about the first 28 contiguous N-terminal amino acids of a yeast alpha-factor precursor leader sequence that includes a single yeast alpha-factor precursor leader sequence glycosylation site and no other yeast alpha-factor precursor leader sequence glycosylation site.
62. The method of claim 59 wherein the nucleotide sequence encodes amino acids 1-25 linked to amino acids 81-83 of a yeast alpha-factor precursor leader sequence.
63. The method of claim 44 wherein CHO encodes a yeast alpha-factor precursor glycosylation site.
64. The DNA molecule of claim 13 wherein CHO encodes a yeast alpha-factor precursor glycosylation site.
65. The method of claim 49 wherein said yeast host is S. cerevisiae.
66. The method of claim 49 wherein the leader construct AF-CHO-X n-S is about the first 25 to about the first 40 contiguous N-terminal residues of a yeast alpha-factor signal peptide.
67. The method of claim 49 wherein the leader construct AF-CHO-X n-S is about the first 28 to about the first 40 contiguous N-terminal residues of a yeast alpha-factor signal peptide.
68. The method of claim 49 wherein the leader construct AF-CHO-X n-S is about the first 35 to about the first 40 contiguous N-terminal residues of yeast alpha-factor signal peptide.
69. The method of claim 68 wherein said non-yeast protein is a human proinsulin.
70. The method of claim 69 wherein said DNA construct is plasmid pYGAI7 (ATCC Accession Number 67597 ).
71. The method of claim 69 wherein said human proinsulin comprises insulin a chain and insulin b chain linked by a yeast-recognized processing site cleaved in vivo by the KEX2 gene product of Saccharomyces.
72. The method of claim 71 wherein said DNA construct is plasmid pYαfL 7C3 (ATCC Accession Number 67596 ).
73. The method of claim 49 wherein the leader construct AF-CHO-X n-S is amino acids 1-25 linked to amino acids 81-83 of a yeast alpha-factor signal peptide.
74. The method of claim 73 wherein said non-yeast protein is insulin-like growth factor I.
75. The method of claim 74 wherein said DNA construct is plasmid pYLUIGFI- 55 (ATCC Accession Number 67595 ).
US09/140,858 1987-12-30 1998-08-27 Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences Expired - Lifetime USRE37343E1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US09/140,858 USRE37343E1 (en) 1987-12-30 1998-08-27 Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US13968287A 1987-12-30 1987-12-30
US53047790A 1990-05-29 1990-05-29
US67035291A 1991-03-13 1991-03-13
US86420692A 1992-04-03 1992-04-03
US08/313,540 US5602034A (en) 1987-12-30 1994-09-27 Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences
US09/140,858 USRE37343E1 (en) 1987-12-30 1998-08-27 Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/313,540 Reissue US5602034A (en) 1987-12-30 1994-09-27 Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences

Publications (1)

Publication Number Publication Date
USRE37343E1 true USRE37343E1 (en) 2001-08-28

Family

ID=22487825

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/313,540 Ceased US5602034A (en) 1987-12-30 1994-09-27 Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences
US09/140,858 Expired - Lifetime USRE37343E1 (en) 1987-12-30 1998-08-27 Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/313,540 Ceased US5602034A (en) 1987-12-30 1994-09-27 Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences

Country Status (15)

Country Link
US (2) US5602034A (en)
EP (1) EP0324274B1 (en)
JP (1) JP2793215B2 (en)
AT (1) ATE97441T1 (en)
AU (1) AU616228B2 (en)
CA (1) CA1340772C (en)
DE (1) DE3885728T2 (en)
DK (2) DK175910B1 (en)
ES (1) ES2059547T3 (en)
FI (1) FI100995B (en)
HK (1) HK139994A (en)
IE (1) IE62087B1 (en)
IL (1) IL88802A0 (en)
NO (1) NO178829C (en)
PT (1) PT89367B (en)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6642029B1 (en) 1983-04-25 2003-11-04 Chiron Corporation Hybrid DNA synthesis of mature insulin-like growth factors
WO2006069246A2 (en) 2004-12-22 2006-06-29 Ambrx, Inc. Compositions containing, methods involving, and uses of non-natural amino acids and polypeptides
US20060183198A1 (en) * 2004-12-22 2006-08-17 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone
US20060281070A1 (en) * 2005-06-01 2006-12-14 University Of Pittsburgh Of The Commonwealth System Of Higher Education Method of amidated peptide biosynthesis and delivery in vivo: endomorphin-2 for pain therapy
WO2008030558A2 (en) 2006-09-08 2008-03-13 Ambrx, Inc. Modified human plasma polypeptide or fc scaffolds and their uses
US20090123971A1 (en) * 2004-12-22 2009-05-14 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
WO2009067636A2 (en) 2007-11-20 2009-05-28 Ambrx, Inc. Modified insulin polypeptides and their uses
US7632924B2 (en) 2004-06-18 2009-12-15 Ambrx, Inc. Antigen-binding polypeptides and their uses
US7632823B2 (en) 2005-08-18 2009-12-15 Ambrx, Inc. Compositions of tRNA and uses thereof
US7638299B2 (en) 2004-07-21 2009-12-29 Ambrx, Inc. Biosynthetic polypeptides utilizing non-naturally encoded amino acids
WO2010011735A2 (en) 2008-07-23 2010-01-28 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
WO2010037062A1 (en) 2008-09-26 2010-04-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US7816320B2 (en) 2004-12-22 2010-10-19 Ambrx, Inc. Formulations of human growth hormone comprising a non-naturally encoded amino acid at position 35
EP2284191A2 (en) 2004-12-22 2011-02-16 Ambrx, Inc. Process for the preparation of hGH
EP2327724A2 (en) 2004-02-02 2011-06-01 Ambrx, Inc. Modified human growth hormone polypeptides and their uses
US8012931B2 (en) 2007-03-30 2011-09-06 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US8093356B2 (en) 2005-06-03 2012-01-10 Ambrx, Inc. Pegylated human interferon polypeptides
US8114630B2 (en) 2007-05-02 2012-02-14 Ambrx, Inc. Modified interferon beta polypeptides and their uses
WO2012024452A2 (en) 2010-08-17 2012-02-23 Ambrx, Inc. Modified relaxin polypeptides and their uses
US20120213728A1 (en) * 2009-10-30 2012-08-23 Merck Granulocyte-colony stimulating factor produced in glycoengineered pichia pastoris
EP2497478A2 (en) 2003-12-05 2012-09-12 Children's Hospital Medical Center Oligosaccaride compositions and use thereof in the treatment of infection
US8278418B2 (en) 2008-09-26 2012-10-02 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US8420792B2 (en) 2006-09-08 2013-04-16 Ambrx, Inc. Suppressor tRNA transcription in vertebrate cells
EP2805965A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified porcine somatotropin polypeptides and their uses
EP2805964A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified bovine somatotropin polypeptides and their uses
US9133495B2 (en) 2006-09-08 2015-09-15 Ambrx, Inc. Hybrid suppressor tRNA for vertebrate cells
US9434778B2 (en) 2014-10-24 2016-09-06 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US9488660B2 (en) 2005-11-16 2016-11-08 Ambrx, Inc. Methods and compositions comprising non-natural amino acids
EP3103880A1 (en) 2008-02-08 2016-12-14 Ambrx, Inc. Modified leptin polypeptides and their uses
US9567386B2 (en) 2010-08-17 2017-02-14 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
US10266578B2 (en) 2017-02-08 2019-04-23 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof
US11273202B2 (en) 2010-09-23 2022-03-15 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof

Families Citing this family (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5170964A (en) * 1974-12-16 1976-06-19 Hohnen Oil HAISUINO SHORIHO
US5010182A (en) * 1987-07-28 1991-04-23 Chiron Corporation DNA constructs containing a Kluyveromyces alpha factor leader sequence for directing secretion of heterologous polypeptides
EP0548267A4 (en) * 1990-09-04 1994-11-23 Salk Inst Biotech Ind Production of insulin-like growth factor-1 in methylotrophic yeast cells
US5612198A (en) * 1990-09-04 1997-03-18 The Salk Institute Production of insulin-like growth factor-1 in methylotrophic yeast cells
ATE177472T1 (en) * 1990-09-14 1999-03-15 Chiron Corp EXPRESSION OF MACROPHAGE-INDUCABLE PROTEINS (MIPS) IN YEAST CELLS
ATE158816T1 (en) 1990-11-26 1997-10-15 Genetics Inst EXPRESSION OF PACE IN HOST CELLS AND METHODS OF USE THEREOF
DK300090D0 (en) * 1990-12-19 1990-12-19 Novo Nordisk As PROCEDURE FOR PREPARING LEADER SEQUENCES
ATE220105T1 (en) * 1991-04-01 2002-07-15 Merck & Co Inc GENES AFFECTING THE PROTEOLYTIC ACTIVITY OF PICHIA AND THEIR USE
US6348327B1 (en) 1991-12-06 2002-02-19 Genentech, Inc. Non-endocrine animal host cells capable of expressing variant proinsulin and processing the same to form active, mature insulin and methods of culturing such cells
DK0682710T3 (en) * 1993-02-10 2004-03-01 Unilever Nv Isolation method using immobilized proteins with specific capacities
US5538863A (en) * 1993-07-01 1996-07-23 Immunex Corporation Expression system comprising mutant yeast strain and expression vector encoding synthetic signal peptide
US6451562B1 (en) 1993-12-22 2002-09-17 Human Genome Sciences, Inc. Polypeptides encoding myeloid progenitor inhibitory factor-1 (MPIF-1) polynucleotides
US6495129B1 (en) 1994-03-08 2002-12-17 Human Genome Sciences, Inc. Methods of inhibiting hematopoietic stem cells using human myeloid progenitor inhibitory factor-1 (MPIF-1) (Ckbeta-8/MIP-3)
US5629167A (en) 1994-04-19 1997-05-13 Biocine S.P.A. Detection of antibodies against Chlamydia trachomatis pgp3 antigen in patient sera by enzyme-linked immunosorbent assay
RU2167939C2 (en) * 1994-06-16 2001-05-27 Ново Нордиск А/С Method of polypeptide producing in yeast
US5639642A (en) * 1994-06-16 1997-06-17 Novo Nordisk A/S Synthetic leader peptide sequences
US6500645B1 (en) 1994-06-17 2002-12-31 Novo Nordisk A/S N-terminally extended proteins expressed in yeast
IL114160A (en) * 1994-06-17 2006-12-31 Novo Nordisk As Dna constructs encoding heterologous proteins and processes for the heterologous protein production in yeast
HRP940432B1 (en) * 1994-08-05 2003-10-31 Pliva Pharm & Chem Works Dna sequences encoding biosynthetic insulin precursors and process for preparation of insulin
EP0779927A1 (en) * 1994-09-08 1997-06-25 Chiron Corporation A method of improved production of insulin-like growth factor
GB9513967D0 (en) * 1995-07-08 1995-09-06 Univ Leicester Insulin
ZA9610456B (en) * 1995-12-20 1997-06-20 Novo Nordisk As N-terminally extended proteins expressed in yeast
AU733007B2 (en) * 1996-09-24 2001-05-03 Cadus Pharmaceutical Corporation Methods and compositions for identifying receptor effectors
AU4977697A (en) 1996-09-25 1998-04-17 Vanderbilt University Genetically engineered yeast with modified signal peptidase complex
EP1935901A1 (en) * 1996-12-13 2008-06-25 Novartis Vaccines and Diagnostics, Inc. Analysis and separation of platelet-derived growth factor proteins
KR100381494B1 (en) * 1997-06-30 2003-07-22 바이오 테크놀로지 제네랄 코오포레이션 Generation of human insulin
US6068993A (en) * 1997-07-02 2000-05-30 Biobras Sa Vector for expression of heterologous protein and methods for extracting recombinant protein and for purifying isolated recombinant insulin
JP2001512684A (en) 1997-08-05 2001-08-28 カイロン コーポレイション Novel Pichiapastoris Gene Sequences and Methods of Use Thereof
CA2671261A1 (en) 1997-11-06 1999-05-20 Novartis Vaccines And Diagnostics S.R.L. Neisserial antigens
EP1047784B2 (en) 1998-01-14 2015-03-18 Novartis Vaccines and Diagnostics S.r.l. Neissera meningitidis antigens
AU2149899A (en) * 1998-01-23 1999-08-09 Novo Nordisk A/S Process for making desired polypeptides in yeast
GB9808932D0 (en) 1998-04-27 1998-06-24 Chiron Spa Polyepitope carrier protein
EP2261338A3 (en) 1998-05-01 2012-01-04 Novartis Vaccines and Diagnostics, Inc. Neisseria meningitidis antigens and compositions
AU5504999A (en) * 1998-07-20 2000-02-14 Frenken, Leon Gerardus Joseph Production of proteins
DE69932247T2 (en) 1998-08-21 2007-05-31 Immunex Corp., Thousand Oaks HUMAN IL-1 EPSILON DNA AND POLYPEPTIDE
WO2000066741A2 (en) 1999-04-30 2000-11-09 Chiron S.P.A. Conserved neisserial antigens
GB9911683D0 (en) 1999-05-19 1999-07-21 Chiron Spa Antigenic peptides
GB9916529D0 (en) 1999-07-14 1999-09-15 Chiron Spa Antigenic peptides
JP2004508801A (en) 1999-10-29 2004-03-25 カイロン ソチエタ ア レスポンサビリタ リミタータ Neisseria antigenic peptide
PT2289545T (en) 2000-01-17 2016-09-06 Glaxosmithkline Biologicals Sa Supplemented omv vaccine against meningococcus
DE60120372T2 (en) 2000-03-24 2007-07-05 Genentech Inc., San Francisco USE OF INSULIN FOR THE TREATMENT OF CORTICAL DISEASES
US6605450B1 (en) 2000-05-25 2003-08-12 Chiron Corporation Iron regulation of the PpSEC10 transcriptional regulatory region of Pichia pastoris and methods of use
US7132273B1 (en) 2000-07-26 2006-11-07 Korea Research Institute Of Bioscience And Biotechnology Cell wall anchor proteins derived from yeast, genes thereof and cell surface expression systems using the same
CA2881568C (en) 2000-10-27 2019-09-24 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups a & b
GB0107658D0 (en) 2001-03-27 2001-05-16 Chiron Spa Streptococcus pneumoniae
GB0107661D0 (en) 2001-03-27 2001-05-16 Chiron Spa Staphylococcus aureus
KR101054735B1 (en) * 2001-07-06 2011-08-05 잇판자이단호진 가가쿠오요비겟세이료호겐쿠쇼 Genetically modified ecarin and how to prepare the same
RU2331435C2 (en) 2001-12-12 2008-08-20 Чирон Срл. Immunisation against chlamydia trachomatis
AU2003243316A1 (en) * 2002-05-24 2003-12-12 Nps Allelix Corp. Method for enzymatic production of glp-2(1-33) and glp-2-(1-34) peptides
DK1521767T3 (en) * 2002-05-24 2010-04-12 Medtronic Inc Methods and Constructs for Expressing High Yield Clostripain
WO2004024885A2 (en) 2002-09-13 2004-03-25 Cornell Research Foundation, Inc. Using mutations to improve aspergillus phytases
EP1562982B1 (en) 2002-11-15 2010-05-05 Novartis Vaccines and Diagnostics S.r.l. Unexpected surface proteins in neisseria meningitidis
GB0308198D0 (en) 2003-04-09 2003-05-14 Chiron Srl ADP-ribosylating bacterial toxin
EP2133362B1 (en) 2003-07-25 2012-04-18 Amgen, Inc Methods relating to LDCAM and CRTAM
HRP20120315T1 (en) * 2003-11-21 2012-05-31 Nps Pharmaceuticals Production of glucagon like peptide 2 and analogs
CN101400646A (en) * 2005-11-08 2009-04-01 Ambrx公司 Promoters for modifying unnatural amino acids and unnatural amino acid polypeptides
WO2007070659A2 (en) * 2005-12-14 2007-06-21 Ambrx, Inc. Compositions containing, methods involving, and uses of non-natural amino acids and polypeptides
PT2054431E (en) 2006-06-09 2011-11-03 Novartis Ag Conformers of bacterial adhesins
WO2008032659A1 (en) * 2006-09-14 2008-03-20 National Institute Of Advanced Industrial Science And Technology Secretion signal peptide having improved efficiency, and method for production of protein by using the same
EP2258855A1 (en) 2009-05-28 2010-12-08 Universität für Bodenkultur Wien Expression sequences
WO2013016220A1 (en) 2011-07-22 2013-01-31 Amgen Inc. Il-17 receptor a is required for il-17c biology
KR102079293B1 (en) 2012-10-29 2020-02-19 론자 리미티드 Expression sequences
EP2999712B1 (en) 2013-04-30 2018-11-21 Donald Danforth Plant Science Center Antifungal plant proteins, peptides, and methods of use
WO2015128507A1 (en) 2014-02-28 2015-09-03 Novo Nordisk A/S Mating factor alpha pro-peptide variants
CN111094572B (en) * 2018-02-09 2023-04-04 江苏恒瑞医药股份有限公司 Codon-optimized human insulin analogue precursor gene and signal peptide gene
US20210388037A1 (en) 2018-11-19 2021-12-16 Basf Se Leader sequence for yeast
CN110028562B (en) * 2019-04-25 2023-03-03 福州量衍科技有限公司 Optimized Komagataella pastoris yeast alpha-factor signal peptide and application
US12331302B2 (en) 2019-11-08 2025-06-17 The Regents Of The University Of California Fungal autoinducible expression system
BR102019026867A2 (en) * 2019-12-16 2021-06-29 Petróleo Brasileiro S.A. - Petrobras GENETICALLY MODIFIED MICROORGANISMS THAT CARRY OUT THE HETEROLOGOUS PRODUCTION OF MODIFIED VERSIONS OF SURFACTANT PROTEIN LV-RANASPUMINA-1 (LV-RSN-1), MODIFIED VERSIONS OF SURFACTANT PROTEIN, SYNTHETIC GENES THAT CODIFY SURFACTANT PROTEIN, EXPRESSES THIS PROTEIN SYNTHETICS, AND THE EXPRESSION VECTORS CONTAINING THESE SYNTHETIC GENES
WO2026009000A1 (en) 2024-07-04 2026-01-08 Solasta Bio Limited Methods for production of insecticidal neuropeptides

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0088632A2 (en) * 1982-03-08 1983-09-14 Genentech, Inc. Expression, processing and secretion of heterologous protein by yeast
EP0123228A2 (en) 1983-04-25 1984-10-31 Chiron Corporation Hybrid DNA synthesis of mature insulin-like growth factors
EP0123294A1 (en) 1983-04-22 1984-10-31 Amgen Inc. Yeast cell transformation vectors
US4546082A (en) 1982-06-17 1985-10-08 Regents Of The Univ. Of California E. coli/Saccharomyces cerevisiae plasmid cloning vector containing the alpha-factor gene for secretion and processing of hybrid proteins
EP0171000A2 (en) 1984-07-27 1986-02-12 Suntory Limited Process for producing heterologous matured protein or peptide
EP0206783A2 (en) 1985-06-20 1986-12-30 The Salk Institute Biotechnology Industrial Associates, Inc. Expression and secretion of polypeptides from saccharomyces cerevisiae
EP0214826A2 (en) 1985-08-30 1987-03-18 Novo Nordisk A/S Insulin analogues and method of preparing the same
US4870008A (en) 1983-08-12 1989-09-26 Chiron Corporation Secretory expression in eukaryotes
US5302697A (en) 1988-07-23 1994-04-12 Delta Biotechnology Limited Peptide and DNA sequences

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4366246A (en) 1977-11-08 1982-12-28 Genentech, Inc. Method for microbial polypeptide expression
IL63270A0 (en) 1980-08-05 1981-10-30 Univ Leland Stanford Junior Eukaryotic autonomously replicating segment
EP0116201B1 (en) 1983-01-12 1992-04-22 Chiron Corporation Secretory expression in eukaryotes
CA1341302C (en) 1983-02-22 2001-10-09 Rae Lyn Burke Yeast expression systems with vectors having gapdh or pyk promoters and synthesis of foreign protein
US4546083A (en) 1983-04-22 1985-10-08 Stolle Research & Development Corporation Method and device for cell culture growth
NZ207926A (en) * 1983-04-25 1988-04-29 Genentech Inc Use of yeast #a#-factor to assist in expression of proteins heterologus to yeast
ATE102250T1 (en) 1984-05-11 1994-03-15 Chiron Corp INCREASED YEAST TRANSCRIPTION USING A HYBRID CONSTRUCTION OF THE PROMOTER REGION.
WO1986001515A1 (en) * 1984-08-29 1986-03-13 Chiron Corporation Expression of human connective tissue activator and related peptides
DK129385A (en) * 1985-03-22 1986-09-23 Novo Industri As PEPTIDES AND PREPARATION THEREOF
US5010182A (en) 1987-07-28 1991-04-23 Chiron Corporation DNA constructs containing a Kluyveromyces alpha factor leader sequence for directing secretion of heterologous polypeptides

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0088632A2 (en) * 1982-03-08 1983-09-14 Genentech, Inc. Expression, processing and secretion of heterologous protein by yeast
US4546082A (en) 1982-06-17 1985-10-08 Regents Of The Univ. Of California E. coli/Saccharomyces cerevisiae plasmid cloning vector containing the alpha-factor gene for secretion and processing of hybrid proteins
EP0123294A1 (en) 1983-04-22 1984-10-31 Amgen Inc. Yeast cell transformation vectors
EP0123228A2 (en) 1983-04-25 1984-10-31 Chiron Corporation Hybrid DNA synthesis of mature insulin-like growth factors
US4870008A (en) 1983-08-12 1989-09-26 Chiron Corporation Secretory expression in eukaryotes
EP0171000A2 (en) 1984-07-27 1986-02-12 Suntory Limited Process for producing heterologous matured protein or peptide
EP0206783A2 (en) 1985-06-20 1986-12-30 The Salk Institute Biotechnology Industrial Associates, Inc. Expression and secretion of polypeptides from saccharomyces cerevisiae
EP0214826A2 (en) 1985-08-30 1987-03-18 Novo Nordisk A/S Insulin analogues and method of preparing the same
US5302697A (en) 1988-07-23 1994-04-12 Delta Biotechnology Limited Peptide and DNA sequences

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
Barr, P.J. et al. (eds.), Yeast Genetic Engineering, 1989, 239 and 272.
Brake et al., Mol. Cell. Biol., 1983, 3(8), 1440-1450.
Fuller et al., Microbiology, 1986, 273-278.
Hitzeman et al., Science, 1983, 219, 620-625.
Julius et al., Cell, 1983, 32, 839-852.
Rothblatt et al., EMBO J., 1987, 6(11), 3455-3463.
Sidhu et al., Gene, 1987, 54, 175-184.
Singh et al., "Saccharomyces cerevisiae contains two discrete genes coding for the alpha-factor pheromone," Nucl. Acids Res., 1983, 11(12), 4049-4063.
Singh et al., "Saccharomyces cerevisiae contains two discrete genes coding for the α-factor pheromone," Nucl. Acids Res., 1983, 11(12), 4049-4063.
Zsebo, K.M. et al., J. Biol. Chem., 1986, 261(13), 5858-5865.

Cited By (103)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6642029B1 (en) 1983-04-25 2003-11-04 Chiron Corporation Hybrid DNA synthesis of mature insulin-like growth factors
EP2497478A2 (en) 2003-12-05 2012-09-12 Children's Hospital Medical Center Oligosaccaride compositions and use thereof in the treatment of infection
US8906676B2 (en) 2004-02-02 2014-12-09 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
EP2327724A2 (en) 2004-02-02 2011-06-01 Ambrx, Inc. Modified human growth hormone polypeptides and their uses
US8778880B2 (en) 2004-02-02 2014-07-15 Ambrx, Inc. Human growth hormone modified at position 35
US8907064B2 (en) 2004-02-02 2014-12-09 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
US8232371B2 (en) 2004-02-02 2012-07-31 Ambrx, Inc. Modified human interferon polypeptides and their uses
US8119603B2 (en) 2004-02-02 2012-02-21 Ambrx, Inc. Modified human interferon polypeptides and their uses
US8097702B2 (en) 2004-02-02 2012-01-17 Ambrx, Inc. Modified human interferon polypeptides with at least one non-naturally encoded amino acid and their uses
US9260472B2 (en) 2004-02-02 2016-02-16 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
US9175083B2 (en) 2004-06-18 2015-11-03 Ambrx, Inc. Antigen-binding polypeptides and their uses
US7632924B2 (en) 2004-06-18 2009-12-15 Ambrx, Inc. Antigen-binding polypeptides and their uses
US7638299B2 (en) 2004-07-21 2009-12-29 Ambrx, Inc. Biosynthetic polypeptides utilizing non-naturally encoded amino acids
EP2399893A2 (en) 2004-12-22 2011-12-28 Ambrx, Inc. Compositions containing, methods involving, and uses of non-natural amino acids and polypeptides
US8163695B2 (en) 2004-12-22 2012-04-24 Ambrx Formulations of human growth hormone comprising a non-naturally encoded amino acid
WO2006069246A2 (en) 2004-12-22 2006-06-29 Ambrx, Inc. Compositions containing, methods involving, and uses of non-natural amino acids and polypeptides
US7829310B2 (en) 2004-12-22 2010-11-09 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7838265B2 (en) 2004-12-22 2010-11-23 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7846689B2 (en) 2004-12-22 2010-12-07 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7858344B2 (en) 2004-12-22 2010-12-28 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7883866B2 (en) 2004-12-22 2011-02-08 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
EP2284191A2 (en) 2004-12-22 2011-02-16 Ambrx, Inc. Process for the preparation of hGH
US20060183198A1 (en) * 2004-12-22 2006-08-17 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone
US7939496B2 (en) 2004-12-22 2011-05-10 Ambrx, Inc. Modified human growth horomone polypeptides and their uses
US20090123971A1 (en) * 2004-12-22 2009-05-14 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7947473B2 (en) 2004-12-22 2011-05-24 Ambrx, Inc. Methods for expression and purification of pegylated recombinant human growth hormone containing a non-naturally encoded keto amino acid
US7736872B2 (en) 2004-12-22 2010-06-15 Ambrx, Inc. Compositions of aminoacyl-TRNA synthetase and uses thereof
US7959926B2 (en) 2004-12-22 2011-06-14 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone mutants
US8178494B2 (en) 2004-12-22 2012-05-15 Ambrx, Inc. Modified human growth hormone formulations with an increased serum half-life
US8178108B2 (en) 2004-12-22 2012-05-15 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone
US7816320B2 (en) 2004-12-22 2010-10-19 Ambrx, Inc. Formulations of human growth hormone comprising a non-naturally encoded amino acid at position 35
US8143216B2 (en) 2004-12-22 2012-03-27 Ambrx, Inc. Modified human growth hormone
US8080391B2 (en) 2004-12-22 2011-12-20 Ambrx, Inc. Process of producing non-naturally encoded amino acid containing high conjugated to a water soluble polymer
US8003622B2 (en) 2005-06-01 2011-08-23 Darren Wolfe Peptide biosynthesis and pain therapy
US7825231B2 (en) 2005-06-01 2010-11-02 Darren P. Wolfe Method of amidated peptide biosynthesis and delivery in vivo: endomorphin-2 for pain therapy
US20060281070A1 (en) * 2005-06-01 2006-12-14 University Of Pittsburgh Of The Commonwealth System Of Higher Education Method of amidated peptide biosynthesis and delivery in vivo: endomorphin-2 for pain therapy
US8846889B2 (en) 2005-06-01 2014-09-30 Darren P. Wolfe Peptide biosynthesis and pain therapy
US20110112175A1 (en) * 2005-06-01 2011-05-12 Darren P. Wolfe Peptide biosynthesis and pain therapy
US8093356B2 (en) 2005-06-03 2012-01-10 Ambrx, Inc. Pegylated human interferon polypeptides
US7632823B2 (en) 2005-08-18 2009-12-15 Ambrx, Inc. Compositions of tRNA and uses thereof
US9488660B2 (en) 2005-11-16 2016-11-08 Ambrx, Inc. Methods and compositions comprising non-natural amino acids
US7919591B2 (en) 2006-09-08 2011-04-05 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US20080125574A1 (en) * 2006-09-08 2008-05-29 Ambrx, Inc. Modified Human Plasma Polypeptide or Fc Scaffolds and Their Uses
US9133495B2 (en) 2006-09-08 2015-09-15 Ambrx, Inc. Hybrid suppressor tRNA for vertebrate cells
US8053560B2 (en) 2006-09-08 2011-11-08 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US8022186B2 (en) 2006-09-08 2011-09-20 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
WO2008030558A2 (en) 2006-09-08 2008-03-13 Ambrx, Inc. Modified human plasma polypeptide or fc scaffolds and their uses
US8618257B2 (en) 2006-09-08 2013-12-31 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US8420792B2 (en) 2006-09-08 2013-04-16 Ambrx, Inc. Suppressor tRNA transcription in vertebrate cells
US8012931B2 (en) 2007-03-30 2011-09-06 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US8383365B2 (en) 2007-03-30 2013-02-26 Ambrx, Inc. Methods of making FGF-21 mutants comprising non-naturally encoded phenylalanine derivatives
US9975936B2 (en) 2007-03-30 2018-05-22 Ambrx, Inc. Nucleic acids encoding modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US10377805B2 (en) 2007-03-30 2019-08-13 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally encoding amino acids and their uses
US9517273B2 (en) 2007-03-30 2016-12-13 Ambrx, Inc. Methods of treatment using modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US10961291B2 (en) 2007-03-30 2021-03-30 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US11993637B2 (en) 2007-03-30 2024-05-28 Ambrx, Inc. Modified FGF-21 polypeptides with non-naturally encoded amino acids
US9079971B2 (en) 2007-03-30 2015-07-14 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US8114630B2 (en) 2007-05-02 2012-02-14 Ambrx, Inc. Modified interferon beta polypeptides and their uses
EP2930182A1 (en) 2007-11-20 2015-10-14 Ambrx, Inc. Modified insulin polypeptides and their uses
US8946148B2 (en) 2007-11-20 2015-02-03 Ambrx, Inc. Modified insulin polypeptides and their uses
WO2009067636A2 (en) 2007-11-20 2009-05-28 Ambrx, Inc. Modified insulin polypeptides and their uses
US9938333B2 (en) 2008-02-08 2018-04-10 Ambrx, Inc. Modified leptin polypeptides and their uses
EP3103880A1 (en) 2008-02-08 2016-12-14 Ambrx, Inc. Modified leptin polypeptides and their uses
EP3225248A1 (en) 2008-07-23 2017-10-04 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
US10138283B2 (en) 2008-07-23 2018-11-27 Ambrx, Inc. Modified bovine G-CSF polypeptides and their uses
WO2010011735A2 (en) 2008-07-23 2010-01-28 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
US8569233B2 (en) 2008-09-26 2013-10-29 Eli Lilly And Company Modified animal erythropoietin polypeptides and their uses
US8278418B2 (en) 2008-09-26 2012-10-02 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US10428333B2 (en) 2008-09-26 2019-10-01 Ambrx Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US9156899B2 (en) 2008-09-26 2015-10-13 Eli Lilly And Company Modified animal erythropoietin polypeptides and their uses
US9121025B2 (en) 2008-09-26 2015-09-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US9121024B2 (en) 2008-09-26 2015-09-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
WO2010037062A1 (en) 2008-09-26 2010-04-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US9644014B2 (en) 2008-09-26 2017-05-09 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
EP3216800A1 (en) 2008-09-26 2017-09-13 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US20120213728A1 (en) * 2009-10-30 2012-08-23 Merck Granulocyte-colony stimulating factor produced in glycoengineered pichia pastoris
EP2805964A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified bovine somatotropin polypeptides and their uses
EP2805965A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified porcine somatotropin polypeptides and their uses
US11786578B2 (en) 2010-08-17 2023-10-17 Ambrx, Inc. Modified relaxin polypeptides and their uses
US10751391B2 (en) 2010-08-17 2020-08-25 Ambrx, Inc. Methods of treatment using modified relaxin polypeptides comprising a non-naturally encoded amino acid
US9962450B2 (en) 2010-08-17 2018-05-08 Ambrx, Inc. Method of treating heart failure with modified relaxin polypeptides
US11311605B2 (en) 2010-08-17 2022-04-26 Ambrx, Inc. Methods of treating heart failure and fibrotic disorders using modified relaxin polypeptides
US10253083B2 (en) 2010-08-17 2019-04-09 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
EP4302783A2 (en) 2010-08-17 2024-01-10 Ambrx, Inc. Modified relaxin polypeptides and their uses
US9567386B2 (en) 2010-08-17 2017-02-14 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
US11439710B2 (en) 2010-08-17 2022-09-13 Ambrx, Inc. Nucleic acids encoding modified relaxin polypeptides
US9452222B2 (en) 2010-08-17 2016-09-27 Ambrx, Inc. Nucleic acids encoding modified relaxin polypeptides
US10702588B2 (en) 2010-08-17 2020-07-07 Ambrx, Inc. Modified relaxin polypeptides comprising a non-naturally encoded amino acid in the A chain
US8735539B2 (en) 2010-08-17 2014-05-27 Ambrx, Inc. Relaxin polypeptides comprising non-naturally encoded amino acids
WO2012024452A2 (en) 2010-08-17 2012-02-23 Ambrx, Inc. Modified relaxin polypeptides and their uses
US11273202B2 (en) 2010-09-23 2022-03-15 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
US12138296B2 (en) 2010-09-23 2024-11-12 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
US10377806B2 (en) 2014-10-24 2019-08-13 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides and uses thereof
US11248031B2 (en) 2014-10-24 2022-02-15 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides
US9434778B2 (en) 2014-10-24 2016-09-06 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US10189883B2 (en) 2014-10-24 2019-01-29 Bristol-Myers Squibb Company Therapeutic uses of modified FGF-21 polypeptides
US9631004B2 (en) 2014-10-24 2017-04-25 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US12247058B2 (en) 2014-10-24 2025-03-11 Bristol-Myers Squibb Company Nucleic acids encoding modified FGF-21 polypeptides, vectors and cells containing, and use thereof
US11364281B2 (en) 2017-02-08 2022-06-21 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and pharmaceutical compositions thereof
US11185570B2 (en) 2017-02-08 2021-11-30 Bristol-Myers Squibb Company Method of treating cardiovascular disease and heart failure with modified relaxin polypeptides
US10266578B2 (en) 2017-02-08 2019-04-23 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof
US12097242B2 (en) 2017-02-08 2024-09-24 Bristol-Myers Squibb Company Treatment of fibrosis, cardiovascular disease and heart failure with modified relaxin polypeptides
US12097241B2 (en) 2017-02-08 2024-09-24 Bristol-Myers Squibb Company Methods of treating kidney failure, and/or improving or stablizing renal function using modified relaxin polypeptides

Also Published As

Publication number Publication date
NO178829B (en) 1996-03-04
DK728588A (en) 1989-07-01
DK200500130A (en) 2005-01-27
HK139994A (en) 1994-12-16
DE3885728D1 (en) 1993-12-23
PT89367A (en) 1989-12-29
EP0324274B1 (en) 1993-11-18
AU2765088A (en) 1989-07-06
FI886008L (en) 1989-07-01
CA1340772C (en) 1999-09-28
EP0324274A1 (en) 1989-07-19
NO885786D0 (en) 1988-12-28
NO885786L (en) 1989-07-03
IE62087B1 (en) 1994-12-14
JPH022339A (en) 1990-01-08
IL88802A0 (en) 1989-07-31
ATE97441T1 (en) 1993-12-15
AU616228B2 (en) 1991-10-24
FI100995B (en) 1998-03-31
US5602034A (en) 1997-02-11
PT89367B (en) 1993-09-30
ES2059547T3 (en) 1994-11-16
DK728588D0 (en) 1988-12-29
NO178829C (en) 1996-06-12
DE3885728T2 (en) 1994-03-10
IE883896L (en) 1989-06-30
DK175910B1 (en) 2005-06-13
JP2793215B2 (en) 1998-09-03
DK176075B1 (en) 2006-04-10

Similar Documents

Publication Publication Date Title
USRE37343E1 (en) Expression and secretion of heterologous proteins in yeast employing truncated alpha-factor leader sequences
US7166446B2 (en) Method for expression of heterologous proteins in yeast
US6183985B1 (en) High level expression of proteins in yeast
JP2523562B2 (en) Use of BAR1 for secreting foreign protein
JP2708518B2 (en) Synthetic yeast leader peptide
US5674706A (en) High level expression of proteins in yeast
US6642029B1 (en) Hybrid DNA synthesis of mature insulin-like growth factors
US6410264B1 (en) Pichia pastoris gene sequences and methods for their use
US20160115216A1 (en) Method for Making Mature Insulin Polypeptides
EP0220689B1 (en) Method of using bar1 for secreting foreign proteins
Egel-Mitani et al. Competitive expression of two heterologous genes inserted into one plasmid in Saccharomyces cerevisiae

Legal Events

Date Code Title Description
AS Assignment

Owner name: CHIRON CORPORATION, CALIFORNIA

Free format text: CROSS-REFERENCING OF ASSIGNMENT FROM PARENT U.S. SERIAL NO. 139,682, REEL 4846-488;ASSIGNOR:TEKAMP-OLSON, PATRICIA;REEL/FRAME:011184/0082

Effective date: 19880216

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12