This invention was made with Government support under Contract No. NACA-58-6062-6 awarded by the U.S. Department of Agriculture. The Government has certain rights in the invention.
The Sequence Listing for this application is labeled “Seq-List.txt” which was created on Oct. 29, 2019 and is 4 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
The present invention relates to a new and distinct cultivar of flowering dogwood tree with a mixture of both fully dark red and lighter red bracts. This new cultivar was the result of a controlled cross that produced a few seeds, which were planted in a greenhouse in Knoxville, Tenn. This new cultivar was discovered among the resulting seedlings. This dogwood tree is botanically known as Cornus florida L. and is hereinafter referred to by the following cultivar name: ‘Erica's Appalachian Sunrise’. Analysis has shown that this new dogwood cultivar is the result of self-pollination of the dogwood cultivar ‘Cherokee Brave’ (U.S. Plant Pat. No. 10,166). The seedling of ‘Erica's Appalachian Sunrise’ was harvested on its own rootstock. Results have shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetative generations.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Photograph of one type of bracts and flowers of the dogwood cultivar ‘Erica's Appalachian Sunrise’. This bract has fully dark red coloration and is less than about 5% of the bracts produced by the cultivar. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIG. 2. Photograph of ‘Erica's Appalachian Sunrise’ dogwood cultivar showing the other type of bract and flowers produced more than about 95% of the time on the dogwood tree, which has lighter red or more pink bracts. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIG. 3. Photograph of new leaf growth on ‘Erica's Appalachian Sunrise’. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIG. 4. Photographs of the bracts and flowers of dogwood cultivars ‘Cherokee Brave’ and ‘Karen's Appalachian Blush’, (U.S. Plant Pat. No. 13,165), which were initially crossed. Results show that the resulting F1 cultivar, ‘Erica's Appalachian Sunrise’, is not, as was expected, related to ‘Karen's Appalachian Blush’, but is the result of self-pollination of ‘Cherokee Brave’ (U.S. Plant Pat. No. 10,166). It can be seen that the lighter red or pink bracts of ‘Erica's Appalachian Sunrise’ (shown in FIG. 2) closely resemble the bracts of the parent, ‘Cherokee Brave’.
FIG. 5. Photograph of the less commonly produced bracts and flowers, less than about 5%, of the dogwood cultivar ‘Erica's Appalachian Sunrise’ (top—fully dark, red bracts), and those of ‘Karen's Appalachian Blush’ (bottom left) and ‘Cherokee Brave’ (bottom right).
DETAILED DESCRIPTION OF THE NEW VARIETY
A new and distinct cultivar of flowering dogwood tree producing both fully dark red bracts and lighter red or pink bracts. Both types of bracts are significantly smaller than the bracts of the parent cultivar, ‘Cherokee Brave’. This dogwood tree cultivar is botanically known as Cornus florida and referred to by the following cultivar name: ‘Erica's Appalachian Sunrise’. This cultivar appears to be highly resistant to powdery mildew caused by Erisphe pulchra.
This new and distinct dogwood tree cultivar is a product of self-pollination of the dogwood cultivar ‘Cherokee Brave’. The subject dogwood tree cultivar differs from ‘Cherokee Brave’ in that the instant cultivar produces significantly smaller and both fully dark red bracts and lighter red bracts and also exhibits greater resistance to powdery mildew.
DETAILED BOTANICAL DESCRIPTION
The following observations, measurements and comparisons describe this cultivar grown in Maryville, Tenn. Trees used for this description were about ten (10) years old. Both the fully dark red bracts and lighter red to pink bracts are substantially the same size, though significantly smaller than the bracts produced by the parent cultivar. Plant hardiness is expected to be zones 4-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart, The Royal Horticultural Society, London, UK, 4th Edition, 2001, except where general terms of ordinary dictionary significance are used.
A bee-mediated pollination between the dogwood cultivars ‘Cherokee Brave’ and ‘Karen's Appalachian Blush’ was conducted in April of 2009. Seeds were collected from both cultivars and planted in a greenhouse in Knoxville, Tenn. This new and distinct dogwood tree cultivar was discovered among the planting and germination of the seeds harvested from ‘Cherokee Brave’. The following Table 1 shows the alleles at nine (9) loci compared between the cultivars ‘Karen's Appalachian Blush’ (U.S. Plant Pat. No. 13,165), ‘Cherokee Brave’, and the new cultivar ‘Erica's Appalachian Sunrise’. As seen in Table 1, the alleles for ‘Erica's Appalachian Sunrise’ are identical at all nine (9) loci to those of ‘Cherokee Brave’ and have no alleles that match ‘Karen's Appalachian Blush’. This demonstrates conclusively that dogwood cultivar ‘Erica's Appalachian Sunrise’ was the result of self-pollination of ‘Cherokee Brave’. Asexual reproduction of ‘Erica's Appalachian Sunrise’ by grafting of axillary buds onto seedling rootstocks has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetatively propagated generations.
| TABLE 1 |
| |
| Allelic Comparisons at Nine (9) loci for dogwood cultivars |
| ‘Karen's Appalachian Blush’ (KAB),‘Cherokee Brave’ (CB), |
| and ‘Erica's Appalachian Sunrise’ (EAS) |
| |
| |
| Cultivar |
CF213 |
CF191 |
CF273 |
CF322 |
CT585 |
| |
| KAB |
270:270 |
132:169 |
140:144 |
137:173 |
167:187 |
| (as base- |
|
|
|
|
|
| pair size) |
|
|
|
|
|
| CB |
267:278 |
144:144 |
133:142 |
154:154 |
174:174 |
| (as base- |
|
|
|
|
|
| pair size) |
|
|
|
|
|
| EAS |
267:278 |
144:144 |
133:142 |
154:154 |
174:174 |
| (F1) |
|
|
|
|
|
| (as base- |
|
|
|
|
|
| pair size) |
| |
| Cultivar |
CF597 |
CF634 |
CF713 |
CF562 |
| |
| KAB |
114:126 |
120:126 |
154:154 |
208:208 |
| (as base-pair size) |
|
|
|
|
| CB |
105:120 |
113:113 |
144:144 |
212:225 |
| (as base-pair size) |
|
|
|
|
| EAS (F1) |
105:120 |
113:113 |
144:144 |
212:225 |
| (as base-pair size) |
| |
| TABLE 2 |
| |
| Simple Sequence Repeats and Associated Primers |
| for Nine Loci shared by the Dogwood Cultivars |
| ‘Erica's Appalachian Sunrise’ and ‘Cherokee Brave’ |
| GenBank |
|
|
Re- |
| acces- |
|
Forward and Reverse Primer |
peated |
| sion no. |
Locus |
Sequences (5′-3′) |
Seq. |
| |
| ED651856 |
CF191 |
F: AACCTGCATCTTCCCCAAGT |
(AG)20 |
| |
|
(SEQ ID NO: 1) |
T(GA)12 |
| |
|
R: CCTTTTACCAACCCAACACG |
(GAA)4 |
| |
|
(SEQ ID NO: 2) |
|
| ED651874 |
CF213 |
F: TGCAAATGGTTATTGATTGCTCTC |
(CT)9 |
| |
|
(SEQ ID NO: 3) |
(GT)12 |
| |
|
R: ATTTGTTTCCCATGACCTGAAAGA |
|
| |
|
(SEQ ID NO: 4) |
|
| ED651920 |
CF273 |
F: TCATATTTATGCTTTCCTTGCCGT |
(AC)14 |
| |
|
(SEQ ID NO: 5) |
|
| |
|
R: GTGATCCTCTCCTAAGGACTTCCA |
|
| |
|
(SEQ ID NO: 6) |
|
| ED651957 |
CF322 |
F: CTAACCTGCATCTTCCCCAAG |
(AG)20 |
| |
|
(SEQ ID NO: 7) |
TG(AG)12 |
| |
|
R: TTTACCAACCCAACACGACAC |
|
| |
|
(SEQ ID NO: 8) |
|
| ER870584 |
CF562 |
F: CCAGAGGTATGAATTCTGTGT |
(GT)16 |
| |
|
(SEQ ID NO: 9) |
|
| |
|
R: CTTGCAAATTGTTGTAATGAA |
|
| |
|
(SEQ ID NO: 10) |
|
| ER870607 |
CF585 |
F: AACGAAGCAAGCAAAACAATC |
(AT)7 |
| |
|
(SEQ ID NO: 11) |
(GT)11 |
| |
|
R: ACCCCACCACTTCATCTCTC |
|
| |
|
(SEQ ID NO: 12) |
|
| ER870619 |
CF597 |
F: AAGTCAGATCATTTCAGATTAACA |
(AC)13 |
| |
|
(SEQ ID NO: 13) |
|
| |
|
R: CGAATTGACGATAAATACAAAATA |
|
| |
|
(SEQ ID NO: 14) |
|
| ER870656 |
CF634 |
F: GAAATTCAAATTTTAAAGAAGTCC |
(AG)14 |
| |
|
(SEQ ID NO: 15) |
|
| |
|
R: TTGTATAGTACTTCAAGGCCACT |
|
| |
|
(SEQ ID NO: 16) |
|
| ER870735 |
CF713 |
F: GATACTTATGCAATTAGGACACAA |
(TC)18 |
| |
|
(SEQ ID NO: 17) |
|
| |
|
R: GTAACAATGGTGGAAGGAAG |
|
| |
|
(SEQ ID NO: 18) |
| |
The cultivar ‘Erica's Appalachian Sunrise’ has some phenotypic similarities to the cultivar ‘Cherokee Brave’, but also distinct differences. The following Table 3 provides a comparison of those characteristics for each cultivar that have been observed. Measurements are provided as averages (with ranges also provided as indicated):
| TABLE 3 |
| |
| Comparison of Characteristics for Three Dogwood Tree Cultivars |
| |
| |
| |
|
‘Erica's |
|
| |
|
Appalachian |
|
| |
Character |
Sunrise’ |
‘Cherokee Brave’ |
| |
| 1 |
Tree Height |
2 meters |
2-3 meters |
| |
(observation) |
(at 8 years) |
(10-15 years) |
| 2 |
Tree Form |
Branching/ |
Branching/ |
| |
|
Spreading |
Spreading |
| 3 |
Growth Rate |
Slow 16 cm/year |
Moderate 24 cm/year |
| 4 |
Spread of |
1.5 meters |
2.0 meters |
| |
Tree |
|
|
| 5 |
Trunk Diam. |
6.5 cm |
8 cm |
| |
at 1 meter |
|
|
| 6 |
Trunk Texture |
Smooth |
Smooth |
| 7 |
Primary |
144A New |
144A New |
| |
Trunk |
Growth |
Growth |
| |
Color/New |
Older Mature |
Older Mature |
| |
Branches/ |
201B/196B |
201B/196B |
| |
Texture |
Smooth |
Smooth |
| 8 |
Presence of |
Red with Green |
Red with Green |
| |
anthocyanin |
Mainly 61B |
Mainly 61B |
| |
(observation) |
with some |
with some |
| |
Coloration by |
143C |
143C |
| |
anthocyanin |
|
|
| |
on the |
|
|
| |
immature leaf |
|
|
| |
upper side |
|
|
| 9 |
Color of |
Green |
Green Group |
| |
mature leaf |
143C and some |
136C, with very |
| |
upper surface/ |
61B More red |
little red |
| |
lower surface |
than ‘Cherokee |
(mostly Green |
| |
|
Brave’ and red |
136C for the |
| |
|
is persistent |
growing |
| |
|
through growing |
season) |
| |
|
season/Green |
|
| |
|
143C |
|
| 10 |
Color of |
Red-Purple 71A |
Red-Purple 71A |
| |
leaves in |
|
|
| |
autumn |
|
|
| |
(observation) |
|
|
| 11 |
Leaf shape |
Ovate |
Ovate |
| 12 |
Leaf Margin |
Entire |
Entire |
| 13 |
Leaf Tip |
Cuspidate |
Cuspidate |
| 14 |
Leaf Base |
Cuneate |
Cuneate |
| 15 |
Leaf |
Palmate/Smooth |
Palmate/Smooth |
| |
Venation/ |
with hairs |
with hairs |
| |
Texture |
|
|
| 16 |
Leaf Length |
4.1-6.25 cm |
5.0-7.2 cm |
| 17 |
Leaf Width |
0.8-1.2 cm |
1.0-2.0 cm |
| 18 |
Petiole Length |
<1 cm |
<1 cm |
| 19 |
Petiole Color |
134C |
134C |
| 20 |
Petiole Texture |
Smooth |
Smooth |
| 21 |
Flower |
6.5 mm open |
6.5 mm open |
| |
diameter |
|
|
| |
(measurement) |
|
|
| 22 |
Floret color |
Yellow Green |
Yellow Green |
| |
when open |
150A-150B with |
150A-150B with |
| |
(observation) |
some purple |
some purple |
| |
|
76A to 76B |
76A to 76B |
| |
|
on top |
on top |
| 23 |
Uniformity of |
See 24-29 |
See 24-29 |
| |
bract size |
|
|
| |
(observation) |
|
|
| 24 |
Bract over- |
Overlapping |
Slightly |
| |
lapping |
tips and edges |
overlap |
| |
(observation |
|
|
| |
for both types) |
|
|
| 25 |
Whole shape |
Spade-shaped |
Tear-drop with |
| |
of bracts |
with point |
blunt tip |
| |
(observation) |
at the base |
|
| 26 |
Inner Bract |
23.1 mm |
38.8 mm |
| |
length |
|
|
| |
(measure- |
(both types) |
|
| |
ment) |
|
|
| 27 |
Inner Bract |
16.8 mm |
35.9 mm |
| |
width |
(both types) |
|
| |
(measure- |
|
|
| |
ment) - |
|
|
| |
modified cleft |
|
|
| 28 |
Outer Bract |
18.9 mm |
38.5 mm |
| |
width |
(both types) |
|
| |
(measure) |
|
|
| 29 |
Outer Bract |
15.3 mm |
30.3 mm |
| |
length |
(both types) |
|
| |
(measurement) |
|
|
| 30 |
Number of |
4 |
4 |
| |
bracts |
|
|
| 31 |
Bract color |
63C - striated |
63C - striated |
| |
(light red) |
red-veined, |
red-veined, |
| |
|
on white |
on white, pure |
| |
|
(95%) |
white base of |
| |
|
|
bract |
| 32 |
Bract color |
182A to 181B |
63C striated |
| |
(dark red) |
(mostly solid |
red-veined, |
| |
|
color with some |
on white, pure |
| |
|
white striation |
white base |
| |
|
near the base |
of bract |
| |
|
(<5%)) |
|
| 33 |
Cleft in Bract |
Yellow Green |
Some are almost |
| |
|
145C (<5%) |
pure white, |
| |
|
|
others have same |
| |
|
|
color as the bracts |
| 34 |
Bract duration |
Most bracts |
Most bracts |
| |
(both types) |
gone by mid- |
gone by mid- |
| |
|
late April |
late April |
| 35 |
Pedicel Length |
23.8 mm |
25.2 mm |
| 36 |
Bract |
None |
None |
| |
variegation |
|
|
| |
(observation) |
|
|
| 37 |
Pistil color |
Yellow Green |
Yellow Green |
| |
(observation) |
150A-150B |
150A-150B |
| 38 |
Fruit shape |
Broadly oval |
Broadly oval |
| |
(observation) |
|
|
| 39 |
Fruit length |
About 1.5 cm |
About 1.5 cm |
| |
(measurement) |
|
|
| 40 |
Fruit color |
Red when |
Red when |
| |
(observation) |
mature in fall |
mature in fall |
| |
|
45A to 45B |
45A to 45B |
| 41 |
Fragrance |
None |
None |
| |
(observation) |
|
|
| 42 |
Flowering |
Spring |
Spring |
| |
season |
|
|
| |
(observation) |
|
|
| 43 |
Flowering time |
April |
April |
| |
(observation) |
|
|
| 44 |
Deciduous or |
Deciduous |
Deciduous |
| |
evergreen |
|
|
| |
(observation) |
|
|
| 45 |
Disease |
Highly resistant |
Moderately |
| |
resistance |
to powdery |
resistance to |
| |
(observation) |
mildew caused |
powdery mildew |
| |
|
by Erisphe |
caused by |
| |
|
pulchra but some |
Erisphe
pulchra
|
| |
|
Spot Anthracnose |
but some Spot |
| |
|
spotting by |
Anthracnose by |
| |
|
Elsinoe
cornii
|
Elsinoe cornii
|
| 46 |
Bark color |
144A (mottled) |
144A (mottled) |
| |
(mature) |
|
|
| 47 |
Flower/ |
19.7 |
25.0 |
| |
inflorescence |
|
|
| |
number |
|
|
| 48 |
Anther color |
Purple 86A |
Purple 86A |
| 49 |
Flower petal |
3-5 mm |
3-5 mm |
| |
length |
|
|
| 50 |
Flower petal |
Purple 76A to |
Yellow Green |
| |
color (closed) |
76B on top and |
group 149B |
| |
|
Yellow Green |
(no purple) |
| |
|
150A-150B |
|
| |
|
near bottom |
|
| 51 |
Flower petal |
150A to 150B |
150A to 150B |
| |
color (open) |
| |
| |
|
|
‘Karen's |
| |
|
|
Appalachian |
| |
|
Character |
Blush’ |
| |
| |
1 |
Tree Height |
2-3 meters |
| |
|
(observation) |
(10-15 years) |
| |
2 |
Tree Form |
Narrow few |
| |
|
|
branches |
| |
3 |
Growth Rate |
Slow 12 cm/ |
| |
|
|
year |
| |
4 |
Spread of Tree |
0.8 meters |
| |
5 |
Trunk Diam. |
5 cm |
| |
|
at 1 meter |
|
| |
6 |
Trunk Texture |
Smooth |
| |
7 |
Primary Trunk |
144C New |
| |
|
Color/New |
Growth |
| |
|
Branches/ |
Older Mature |
| |
|
Texture |
202A/196B |
| |
|
|
Smooth |
| |
8 |
Presence of |
Green 143B |
| |
|
anthocyanin (observation) |
|
| |
|
Coloration by |
|
| |
|
anthocyanin on the |
|
| |
|
immature leaf |
|
| |
|
upper side |
|
| |
9 |
Color of mature leaf |
144C to 144B |
| |
|
upper surface/ |
Both surfaces |
| |
|
lower surface |
|
| |
10 |
Color of leaves in |
71C to 71D |
| |
|
autumn (observation) |
|
| |
11 |
Leaf shape |
Ovate |
| |
12 |
Leaf Margin |
Entire |
| |
13 |
Leaf Tip |
Cuspidate |
| |
14 |
Leaf Base |
Cuneate |
| |
15 |
Leaf Venation/Texture |
Palmate/Smooth |
| |
|
|
with hairs |
| |
16 |
Leaf Length |
5.0-8.0 cm |
| |
17 |
Leaf Width |
2.0-2.5 cm |
| |
18 |
Petiole Length |
1.0-1.3 cm |
| |
19 |
Petiole Color |
149A |
| |
20 |
Petiole Texture |
Smooth |
| |
21 |
Flower diameter |
6.5 mm open |
| |
|
(measurement) |
|
| |
22 |
Floret color |
Yellow Green |
| |
|
when open |
150A-150B with |
| |
|
(observation) |
some purple |
| |
|
|
76A to 76B on top |
| |
23 |
Uniformity of bract |
See 24-29 |
| |
|
size (observation) |
|
| |
24 |
Bract overlapping |
Very little overlap |
| |
|
(observation |
|
| |
|
for both types) |
|
| |
25 |
Whole shape of bracts |
Linear |
| |
|
(observation) |
|
| |
26 |
Inner Bract length |
29.3 mm |
| |
|
(measurement) |
|
| |
27 |
Inner Bract width |
20.4 mm |
| |
|
(measurement) - |
|
| |
|
modified cleft |
|
| |
28 |
Outer Bract width |
23.8 mm |
| |
|
(measure) |
|
| |
29 |
Outer Bract length |
31.8 mm |
| |
|
(measurement) |
|
| |
30 |
Number of bracts |
4 |
| |
31 |
Bract color |
White 155B |
| |
|
(light red) |
|
| |
32 |
Bract color |
Some pink 49D |
| |
|
(dark red) |
around margins |
| |
|
|
bleeding towards |
| |
|
|
center |
| |
33 |
Cleft in Bract |
Reduced and |
| |
|
|
Violet purple 93B |
| |
|
|
to Blush purple |
| |
|
|
group N74C or |
| |
|
|
creamy white with |
| |
|
|
purple/red 84D |
| |
34 |
Bract duration |
Most bract gone by |
| |
|
(both types) |
mid-late April |
| |
35 |
Pedicel Length |
19.5 mm |
| |
36 |
Bract variegation |
None |
| |
|
(observation) |
|
| |
37 |
Pistil color |
Yellow Green |
| |
|
(observation) |
150A-150B |
| |
38 |
Fruit shape |
Broadly oval |
| |
|
(observation) |
|
| |
39 |
Fruit length |
About 1.5 cm |
| |
|
(measurement) |
|
| |
40 |
Fruit color |
Red when |
| |
|
(observation) |
mature in fall |
| |
|
|
45A to 45B |
| |
41 |
Fragrance |
None |
| |
|
(observation) |
|
| |
42 |
Flowering season |
Spring |
| |
|
(observation) |
|
| |
43 |
Flowering time |
April |
| |
|
(observation) |
|
| |
44 |
Deciduous or evergreen |
Deciduous |
| |
|
(observation) |
|
| |
45 |
Disease resistance |
Highly resistant |
| |
|
|
to powdery |
| |
|
(observation) |
mildew caused |
| |
|
|
by Erisphe |
| |
|
|
pulchra but |
| |
|
|
some Spot |
| |
|
|
Anthracnose |
| |
|
|
Elsinoe cornii
|
| |
46 |
Bark color (mature) |
144C |
| |
47 |
Flower/inflorescence |
16.4 |
| |
|
number |
|
| |
48 |
Anther color |
Purple 86A |
| |
49 |
Flower petal length |
3-5 mm |
| |
50 |
Flower petal |
Purple 76A to |
| |
|
color (closed) |
76B on top and |
| |
|
|
Yellow Green |
| |
|
|
150A-150B |
| |
|
|
near bottom |
| |
51 |
Flower petal |
150C |
| |
|
color (open) |
| |
- Botanical classification: Cornus florida ‘Erica's Appalachian Sunrise’.
- Unique features: A mixture of two types of bracts, a first one being less than about 5% of the bracts produced that is fully dark red and a second type being more than about 95% of the bracts produced that is similar in color to the bracts produced by the parent ‘Cherokee Brave’. Both types of bracts on ‘Erica's Appalachian Sunset’ are similar in size and significantly smaller than the bracts produced by the parent ‘Cherokee Brave’. Fewer flowers per inflorescence of ‘Erica's Appalachian Sunset’ than on ‘Cherokee Brave’.
- Disease susceptibility: ‘Erica's Appalachian Sunrise’ has a strong resistance to Powdery mildew caused by Erisphe pulchra and only some spotting caused by Elsinoe corni, a cosmetic disease with little damage.
- Insect damage: None noted.