USH2258H1 - Development of novel germplasm using segregates from transgenic crosses - Google Patents

Development of novel germplasm using segregates from transgenic crosses Download PDF

Info

Publication number
USH2258H1
USH2258H1 US11/490,708 US49070806A USH2258H US H2258 H1 USH2258 H1 US H2258H1 US 49070806 A US49070806 A US 49070806A US H2258 H USH2258 H US H2258H
Authority
US
United States
Prior art keywords
elite
line
transgene
individual
progeny
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/490,708
Other languages
English (en)
Other versions
US20070136836A1 (en
Inventor
Cindy L. Arnevik
Raymond Dobert
Qingyi Zeng
Jennifer Listello
Gregory R. Heck
John Soteres
Kunsheng Wu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Monsanto Technology LLC
Original Assignee
Monsanto Technology LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Monsanto Technology LLC filed Critical Monsanto Technology LLC
Priority to US11/490,708 priority Critical patent/USH2258H1/en
Assigned to MONSANTO TECHNOLOGY LLC reassignment MONSANTO TECHNOLOGY LLC ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: WU, KUNSHENG, HECK, GREGORY R., ZENG, QINGYI, DOBERT, RAYMOND, LISTELLO, JENNIFER, ARNEVIK, CINDY L., SOTERES, JOHN
Publication of US20070136836A1 publication Critical patent/US20070136836A1/en
Application granted granted Critical
Publication of USH2258H1 publication Critical patent/USH2258H1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275—Glyphosate

Definitions

  • the invention in the field of plant breeding provides a method for the development of plant germplasm using segregates from a transgenic line.
  • a method of zygosity testing to evaluate for the absence of a transgene is also disclosed.
  • Widely planted crop germplasm often represents the most elite lines containing a combination of the yield, agronomic, and pest and disease resistance traits most desired by growers. Because of its combination of elite traits, this germplasm may serve to generate commercially available seed, and may also be used as a source or future plant breeding efforts. In some cases, this germplasm may often comprise a transgenic trait in addition to the elite traits it exhibits. Thus, there exists a need in the field of plant breeding for methods to use the full complement of the existing germplasm base of a crop in plant breeding, regardless of whether a transgene is present in any of the elite varieties that might be used for breeding experiments. Methods to further apply zygosity testing to improve the efficiency of plant breeding efforts are also needed.
  • qRT-PCR real-time quantitative TAQMANTM PCR
  • This technique can allow detection and quantization of the copy number of a given DNA sequence in a plant genome, and requires only a small amount of plant tissue.
  • the technique is much less labor intensive per sample the previously employed methods, such as Southern blotting, for detecting and quantitating transgene copy numbers. Nevertheless, it is notoriously sensitive to the concentration and purity of the starting template DNA, among other variables.
  • transgenic plant line If a transgenic plant line is to be used in a breeding program, efficient methods for removing a transgene, or screening for its loss are desirable. Specific removal of transgene sequences, such as a gene encoding a selectable marker, has been reported, including the Cre/lox recombinase system (Hare and Chua Nature Biotechnol. 20:575-580(2002)). This method can specifically lead to removal of inserted transgenic DNA sequences from a transgenic plant, but lox site sequences necessarily still remain, flanking the site of the excised sequence. Screening for loss of a transgene by genetic segregation in progeny is another method that is widely known but requires substantial time and effort to achieve. Thus, more efficient methods to screen for loss of specific sequences are desirable, especially methods that ensure the complete removal of all inserted transgenic sequences.
  • ROUNDUP READY® lines that retain the elite agronomic traits of the parental line except for glyphosate resistance derived from the transgene insert of event 40 - 3 - 2 and the associated transgenic sequences found in event 40 - 3 - 2 .
  • sequences of the functional transgene of soybean event 40 - 3 - 2 and its associated flanking plant DNA can be used to detect the presence of the transgene in progeny of 40 - 3 - 2 .
  • the DNA sequence flanking the functional transgenic insert in soybean event 40 - 3 - 2 has been characterized (Padgette et al. Crop Sci. 35:1451-1461 (1995); Windels et al. Eur. Food Res. Technol. 213:107-112(2001).
  • transgenic plant event may require disclosure of genomic DNA sequences flanking an inserted DNA, and a method to detect DNA specific or the event. Accordingly, some sequences flanking the functional insertion in soybean event 40 - 3 - 2 have been reported previously (Monsanto MSL-16646, available at http link for //archive.food.gov.uk/pdf_files/acnfp/dossier.pdf).
  • a method of detection for corn comprising transgenic event NK 603 has also been reported at http link //gmo-crl.jrc.it/detectionmethods.htm.
  • Plant breeders may utilize a set of “elite” cultivars exhibiting superior traits related to growth, adaptability, pest and disease resistance, seed yield, lodging resistance, emergence, maturity, late season plant intactness, plant height and shattering resistance among others, as a basis to develop new improved crop cultivars. These packages of traits can then be introduced into new breeding lines with one or more additional desired traits in order to efficiently improve the breeding germplasm. If the elite cultivar that is being used as a basis for further breeding already comprises a transgene, it is useful to be able to identify the presence or absence of the transgene among many segregating progeny while these progeny are being screened by classical plant breeding methods for their other agronomy qualities.
  • Recurrent selection is a breeding procedure designed to accumulate favorable genes for a trait or traits in a population. Parent lines are crossed, their progeny are evaluated for one or more traits, and the progenies which best express the trait are intercrossed to repeat the process over successive generations. Variations on recurrent selection include, among others, full-sib selection, half-sib family selection, and S 1 progeny recurrent selection. Techniques such as backcross breeding, mass selection, and marker-assisted breeding may also be employed. These techniques may be used to select for traits of interest in self-pollinated and cross-pollinated crops, as appropriate.
  • This invention relates to, in part, a method for developing an elite crop variety, comprising crossing a first elite line exhibiting a useful trait and comprising a transgene that encodes the useful trait, and which exhibits additional elite traits or characteristics, with a second line that exhibits a useful trait; obtaining individual F 1 hybrid lines; selecting at least one F 1 hybrid individual that exhibits a useful trait from the first or second line; deriving at least one further progeny generation of seeds or plants from the selected F 1 hybrid individual; screening F 2 or later progeny exhibiting at least one of the additional elite traits or characteristics of the first line for the presence of the transgene; and identifying at least one individual lacking the transgene, wherein the useful trait is derived from the second line.
  • a method of determining the zygosity of the hybrid progeny comprising: (a) contacting a sample comprising DNA derived from the progeny with a primer set comprising SEQ ID NO: 3 , SEQ ID NO: 4 and SEQ ID NO: 6 , that when used in a nucleic-acid amplification reaction with genomic DNA from the progeny, produces a first amplicon that is diagnostic for the trangenic event; and (b) performing a nucleic acid amplification reaction, thereby producing the first amplicon; and (c) detecting the first amplicon; and (d) contacting the sample comprising progeny DNA with a primer set comprising SEQ ID NOs: 4 , 5 , and 7 , that when used in a nucleic-acid amplification reaction with genomic DNA from progeny plants produces a second amplicon comprising the native genomic DNA homologous to the genomic region in which the transgene is inserted; and (e) performing a nucle
  • Corn breeding for instance encompassing conversion of a corn line comprising a first event such as GA 21 to a second event such as one comprising NK 603 , is also a subject of the present invention.
  • Identification of a GA 21 -null segregant line that comprises event NK 603 and lacks the presence of sequences associated with the GA 21 event, following a cross between transgenic corn lines comprising events GA 21 and NK 603 is also a subject of the present invention.
  • mutagenesis can be used to create viable reproducible soybeans or other species of plant with unique genetic profiles string with transgenic lines from which the transgene is to be removed.
  • mutagenesis of transgenic soybean or other species can be induced by treatment with a variety of mutagenic agents known in the art, including physical mutagens such as X-rays, gamma rays, fast or thermal neutrons, protons, and chemical mutagens such as ethyl methanesulfonate (EMS), diethyl sulfate (DES), ethyleneimine (EI), propane sultane, N-methyl-N-nitrosourethane (MNW, N-nitroso-N-methylurea (NMU), N-ethyl-N-nitrosourea (ENU) and sodium azide.
  • physical mutagens such as X-rays, gamma rays, fast or thermal neutrons, protons
  • chemical mutagens such as ethyl
  • soybeans can also be obtained, for example, by oligonucleotide-directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like. See, for example, Ausubel, pages 8.0.3-8.5.9..
  • This invention relates to a plant breeding method for identifying a transgenic plant, or cells or tissues thereof, which method is based on identifying the presence or absence of at least one transgenic DNA sequence.
  • the method for identifying in progeny of a transgenic plant, or cells or tissues thereof comprises amplifying a sequence of a nucleic acid present in biological samples, using a polymerase chain reaction, with at least two primers, one of which recognizes, or hybridizes with, the plant DNA in the 5′ or 3′ flanking region of an insertion event, the other which recognizes a sequence within the inserted transgenic DNA.
  • the genomic DNA is analyzed according to the PCR identification protocol described here whereby one primer recognizes a sequence within the respective 5′ or 3′ flanking region comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or its complement.
  • the primers used may recognize a sequence within the insert comprising the nucleotide sequence of SEQ ID NO: 3
  • the primer recognizing a sequence within the 3′ flanking region comprises the nucleotide sequence of SEQ ID NO: 5 , so that at least one specific amplified fragment is detected.
  • This invention also relates to a method for producing a non-transgenic elite crop variety, comprising crossing an elite line, comprising a transgene and exhibiting one or more transgenically-derived elite traits and one or more conventionally-derived elite traits or characteristics with a conventional non-transgenic line; obtaining individual F 1 hybrid lines; selecting at least one F 1 hybrid individual exhibiting elite characteristics of the elite line; deriving at least one further progeny generation of seeds or plants from the selected F 1 hybrid individual; screening F 2 or later progeny of the hybrid individual exhibiting the conventionally- derived elite traits or characteristics of the elite line for the presence of the transgene; and selecting progeny exhibiting the conventionally-derived elite traits or characteristics of the elite line wherein the transgene is absent from the progeny genome.
  • the invention also relates to a method for identifying null segregate for a transgene in a plant breeding program, comprising crossing a first line containing a transgene that encodes a useful trait inserted into its genome with a second line; obtaining F 1 hybrid individuals; deriving at least one further progeny generation of seeds or plants from the F 1 individual; performing zygosity analysis on the further progeny generation, and optionally Southern or western analyses; selecting progeny wherein elements of the transgene are absent and the insertion site of the transgene is restored to approximate its native state, and deriving further generations of the selected progeny wherein the removal of transgene is not caused by the presence of a transgenic recombined.
  • the present invention also relates to methods for identifying the presence or absence of DNA sequences in biological samples from progeny of a parent that comprises a transgene, the methods being based on primers or probes that specifically recognize the 5′ and 3′ plant DNA flanking sequence of the insert(s) of the transgenic event. Depending on the presence or absence of a transgene, an amplification product of a specific size can be detected.
  • the invention thus also relates to a kit for following the segregation of transgenic sequences in segregating progeny of an elite transgenic event, the kit comprising at least one primer or probe that specifically recognizes the 5′ or 3′ flanking region of the event, such that the presence, absence, or copy number of a given event may be followed during the plant breeding process.
  • the kit of the invention comprises, in addition to a primer that specifically recognizes the 5′ or 3′ flanking region of a given event, a second primer that specifically recognizes a sequence within the inserted DNA of the event, for use in a PCR identification protocol.
  • the kit of the invention comprises two (or more) specific primers, one of which recognizes a sequence within the 5′ flanking region of an event, for instance a sequence within the plant DNA region of SEQ ID NO: 1 or SEQ ID NO: 2 , and another which recognizes a sequence within the inserted DNA.
  • the primer recognizing the plant DNA sequence within a 5′ flanking region comprises the nucleotide sequence of SEQ ID NO: 4
  • the primer recognizing the inserted DNA comprises the nucleotide sequence of SEQ ID NO: 3 .
  • FIG. 1 is a schematic map of 40 - 3 - 2 event and amplification result.
  • FIG. 2 illustrates a soybean breeding process
  • FIG. 3 provides a verification scheme of nulls.
  • the present invention is based, in part, on preserving elite germplasm by the identification of a genomic region comprising a transgene insert in the genome of a genetically modified crop first parent elite plant and the homologous region in the genome of a second parent plant of the same species not having the identical transgene insert, and utilizing DNA molecules in a DNA detection method to select progeny plants resulting from a cross of the parent plants, wherein the selected progeny plants do not contain the specific transgene insert of the first parent plant and contain some or all of the elite germplasm characteristics of the first parent.
  • the following descriptions are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention.
  • DNA segment refers to a DNA molecule that has been isolated free of total genomic DNA of a particular species.
  • soybean means “Glycine max” or soybean and includes all plant varieties that can be bred with soybean, including wild soybean species.
  • An “elite line” can refer, for example, to a crop genotype displaying one or more molecular or agronomic or quality or industrial traits of interest.
  • Glyphosate refers to N-phosphonomethylglycine and its' salts
  • Glyphosate is the active ingredient of ROUNDUP® herbicide (Monsanto Co.).
  • Plant treatments with “glyphosate” refer to treatments with the ROUNDUP® or ROUNDUP ULTRA® herbicide formulation, unless otherwise stated.
  • Glyphosate as N-phosphonomethylglycine and its' salts are components of synthetic culture media used for the selection of bacteria and plant tolerance to glyphosate or used to determine enzyme resistance in in vitro biochemical assays.
  • Examples of commercial formulations of glyphosate include, without restriction, those sold by Monsanto Company as ROUNDUP®, ROUNDUP® ULTRA, ROUNDUP® ULTRAMAX, ROUNDUP® WEATHERMAX, ROUNDUP® CT, ROUNDUP® EXTRA, ROUNDUP® BIACTIVE, ROUNDUP® BIOFORCE, RODEO®, POLARIS®, SPARK® and ACCORD® herbicides, all of which contain glyphosate as its isopropylammonium salt; those sold by Monsanto Company as ROUNDUP® DRY and RIVAL® herbicides, which contain glyphosate as its ammonium salt; that sold by Monsanto Company as ROUNDUP® GEOFORCE, which contains glyphosate as its sodium salt; and that sold by Zeneca Limited as TOUCHDOWN® herbicide, which contains glyphosate as its trimethylsulfonium salt.
  • Glyphosate herbicide formulations can be safely used over the top of glyphosate tolerant crops to control weeds in a field at rates as low as 8ounces/acre upto 64ounces/acre.
  • glyphosate has been applied to glyphosate tolerant crops at rates as low as 4ounces/acre and upto or exceeding 128ounces/acre with no substantial damage to the crop plant.
  • probe is an isolated nucleic acid to which is attached a conventional detectable label or reporter molecule, e.g., a radioactive isotope, ligand, photoluminescent agent, or enzyme.
  • a conventional detectable label or reporter molecule e.g., a radioactive isotope, ligand, photoluminescent agent, or enzyme.
  • Such a probe is complementary to a strand of a target nucleic acid, in the case of the present invention, to a strand of genomic DNA from soybean event 40 - 3 - 2 whether from a soybean plant or from a sample that includes DNA from the event.
  • Probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence.
  • primer refers to isolated nucleic acids that are annealed to a complementary target DNA stand by nucleic acid hybridization to form a hybrid between the primer and the target DNA stand, then extended along the target DNA stand by a polymerase, e.g., a DNA polymerase.
  • Primer pairs of the present invention refer to their use for amplification of a target nucleic acid sequence, e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-acid amplification methods.
  • DNA amplification can be accomplished by any of the various polynucleic acid amplification methods known in the art, including PCR.
  • a variety of amplification methods are known in the art and are described, inter alia, in U.S. Patent Nos. 4,683,195and 4,683,202and in PCR Protocols: A Guide to Methods and Applications, ed. Innis et al., Academic Press, San Diego, 1990.
  • PCR amplification methods have been developed to amplify up to 22kb (kilobase) of genomic DNA and up to 42kb of bacteriophage DNA (Chang et al., Proc. Natl. Acad. Sci. USA 91:5695-5699, 1994). These methods, as well as other methods known in the art of DNA amplification may be used in the practice of the present invention.
  • the nucleic acid probes and primers of the present invention hybridize under stringent conditions to a target DNA sequence.
  • Hybridization refers to the ability of a strand of nucleic acid to join with a complementary strand via base pairing. Hybridization occurs when complementary sequences in the two nucleic acid strands bind to one another.
  • Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances.
  • two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure.
  • a nucleic acid molecule is said to be the “complement” of another nucleic acid molecule if they exhibit complete complementarity.
  • molecules are said to exhibit “complete complementarity” when every nucleotide of one of the molecules is complementary to a nucleotide of the other.
  • Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions.
  • the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high-stringency” conditions.
  • a “substantially homologous DNA molecule” is a polynucleic acid molecule that will specifically hybridize to the complement of the polynucleic acid to which it is being compared under high stringency conditions.
  • stringent conditions is functionally defined with regard to the hybridization of a nucleic-acid probe to a target nucleic acid (i.e., to a particular nucleic-acid sequence of interest) by the specific hybridization procedure discussed in Sambrook et al., 1989, at 9.52-9.55. See also, Sambrook et al., 1989at 9.47-9.52, 9.56-9.58; Kanehisa, (Nucl. Acids Res.
  • nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of DNA fragments.
  • relatively high stringent conditions e.g., one will select relatively low salt and/or high temperature conditions, such as provided by about 0.02M to about 0.15M NaCl at temperatures of about 50° C. to about 70° C.
  • a high stringent condition is to wash the hybridization filter at least twice with high-stringency wash buffer (0.2X SSC, 0.1% SDS, 65° C).
  • high-stringency wash buffer 0.2X SSC, 0.1% SDS, 65° C.
  • Appropriate moderate stringency conditions that promote DNA hybridization for example, 6.0 ⁇ sodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2.0 ⁇ SSC at 50° C., are known to those skilled in the art or can be found in Current protocols in Moloecular Biology , John Wiley & Sons, N.Y. ( 1989), 6.3.1-6.3.6.
  • the salt concentration in the wash step can be selected from a low stringency of about 2.0 ⁇ SSC at 50° C. to a high stringency of about 0.2 ⁇ SSC at 50° C.
  • the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22° C., to high stringency conditions at about 65° C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed. Such selective conditions tolerate little mismatch between the probe and the template or target strand. Detection of DNA sequences via hybridization is well known to those of skill in the art, and the teachings of U.S. Patent Nos. 4,965,188 and 5,176,995 are exemplary of the methods of hybridization analyses.
  • the diagnostic amplicon produced by these methods may be detected by a plurality of techniques.
  • One such method is Genetic Bit Analysis (Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994) where a DNA oligonucleotide is designed that overlaps both the adjacent flanking genomic DNA sequence and the inserted DNA sequence.
  • the oligonucleotide is immobilized in wells of a microtiter plate.
  • a single- stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA polymerase and labelled dideoxmucleotide triphosphates (ddNTPs) specific for the expected next base.
  • ddNTPs dideoxmucleotide triphosphates
  • Readout may be fluorescent or ELISA-based. A signal indicates presence of the transgene/genomic sequence due to successful amplification, hybridization, and single base extension.
  • Another method is the Pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00:18-24, 2000).
  • an oligonucleotide is designed that overlaps the adjacent genomic DNA and insert DNA junction.
  • the oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking genomic sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5′ phosphosulfate and luciferin.
  • DNTPS are added individually and the incorporation results in a light signal that is measured.
  • a light signal indicates the presence of the transgene/genomic sequence due to successful amplification, hybridization, and single or multi-base extension.
  • Fluorescence Polarization as described by Chen, et al., (Genome Res. 9:492-498, 1999) is a method that can be used to detect the amplicon of the present invention.
  • an oligonucleotide is desired that overlaps the genomic flanking and inserted DNA junction.
  • the oligonucleotide is hybridized to single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking genomic DNA sequence) and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP. Incorporation can be measured as a change in polarization using a fluorometer. A change in polarization indicates the presence of the transgene/genomic sequence due to successful amplification, hybridization, and single base extension.
  • TAQMANTM PE Applied Biosystems, Foster City, CA
  • a FRET oligonucleotide probe is desired that overlaps the genomic flanking and insert DNA junction.
  • the FRET probe and PCR primers are cycled in the presence of a thermostable polymerase and dNTPs.
  • Hybridization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe.
  • a fluorescent signal indicates the presence of the transgene/genomic sequence due to successful amplification and hybridization.
  • Molecular Beacons have been described for use in sequence detection as described in Tyangi, et al. (Nature Biotech. 14:303- 308, 1996). Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking genomic and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity.
  • the FRET probe and PCR primers are cycled in the presence of a thermostable polymerase and dNTPS.
  • hybridization of the FRET probe to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties.
  • a fluorescent signal results. A fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.
  • Transgenic crops for which the method of the present invention can be applied include, but are not limited to herbicide tolerant crops, for example, ROUNDUP READY® Cotton 1445 and 88913; ROUNDUP READY® corn GA21 , NK603 , MON802 , MON809 ; ROUNDUP READY® Sugarbeet GTSB77 and H7-1 ; ROUNDUP READY® Canola RT73 and GT200 ; oilseed rape ZSR500 , ROUNDUP READY® Soybean 40 -3 -2 , ROUNDUP READY® Bentgrass ASR368 , HCN10 , HCN28 and HCN92 canola, MS1 and RF1 canola, OXY-235 canola, PHY14 , PHY35 and PHY36 canola, RM3-3 ,RM3 -4 and RM3 -6 chicory, A2704-12 , A2704 -21 , A5547 -35 , A5547
  • Herbicides for which transgenic plant tolerance has been demonstrated and the method of the present invention can be applied include but are not limited to: glyphosate, glufosinate, sulfonylureas, imidazolinones, bromoxynil, dalapon, cyclohezanedione, protoporphyrinogen oxidase inhibitors, and isoxaflutole herbicides.
  • Polynucleotide molecules encoding proteins involved in herbicide tolerance are known in the art, and include, but are not limited to, a polynucleotide molecule encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) described in U.S. Pat. No.
  • EPSPS 5-enolpyruvylshikimate-3-phosphate synthase
  • the promoter of the present invention can express genes that encode for phosphinothricin acetyltransferase, glyphosate resistant EPSPS, aminoglycoside phosphotransferase, hydroxyphenyl pyruvate dehydrogenase, hygromycin phosphotransferase, neomycin phosphotransferase, dalapon dehalogenase, bromoxynil resistant nitrilase, anthranilate synthase, glyphosate oxidoreductase and glyphosate-N-acetyl transferase.
  • Transgenic crops for which the method of the present invention can be applied to include, but are not limited to, insect resistant crops, for example, cotton events, such as MON 15985 , 281 - 24 - 236 , 3006 - 210 - 23 , MON 531 , MON 757 , MON 1076 , and COT 102 ; or corn events, such as 176 , BT 11 , CBH- 351 , DAS- 06275 - 8 , DBT 418 , MON 80100 , MON 810 , MON 863 , TC 1507 , MIR 152 V, 3210 M, and 3243 M.
  • insect resistant crops for example, cotton events, such as MON 15985 , 281 - 24 - 236 , 3006 - 210 - 23 , MON 531 , MON 757 , MON 1076 , and COT 102 ; or corn events, such as 176 , BT 11 , CBH- 351
  • Example 1 Progeny of 40 - 3 - 2 lacking inserted DNA
  • An elite soybean cultivar comprising ROUNDUP READY® event 40 - 3 - 2 is crossed with a conventional (non-transgenic) cultivar, and segregation of traits and the transgene is followed by PCR zygosity testing.
  • the presence of 5′ or 3′ junction sequences may be followed as shown schematically in FIG. 1 .
  • the PCR assay may be either singleplex, or multiplex.
  • An internal quantitation control may be included.
  • the inserted DNA consists of, in the 5′ to 3′ direction, a functional insert, an intervening (rearranged) genomic DNA, a non-functional 72 bp fragment of the gene encoding CP 4 EPSPS, and additional genomic sequence. Referring to FIG.
  • primer set A-B-C on template DNA derived from progeny of a cross of soybean event 40 - 3 - 2 with another plant, for instance, allows one to positively differentiate between progeny that are homozygous for the inserted DNA, homozygous for the inserted DNA, or lack the inserted DNA.
  • PCR primer design based on known DNA sequences is well known in the art. Exemplary primers in this example include SEQ ID NO: 3 (primer B), SEQ ID NO: 4 (primer A), and SEQ ID NO: 5 (primer C).
  • Template DNA is extracted from plant leaf tissues or round seed from progeny of the cross noted above.
  • a 7-mm hole punch may be used to harvest tissue of a newly formed leaf of a young plant (less than 1 month old). The tissue is lyophilized and stored in a tube until needed. Three 3 mm glass beads are added to the tissue, and the tube is agitated to grind the tissue into a fine powder. 600 ⁇ l of extraction buffer (100 mM Tris; 1 mM KCl; 10 mM EDTA; pH 9.5) is added and after the tube is agitated to resuspend the powdered tissue it is incubated at 65° C. for 1 hour, followed by centrifugation for 1 minute at 1500 RPM.
  • extraction buffer 100 mM Tris; 1 mM KCl; 10 mM EDTA; pH 9.5
  • 200 ⁇ l of precipitation buffer (5 M KAc; pH 7.0) is added and the tube is agitated to thoroughly mix, followed by centrifugation at 3000 RPM for 10 minutes.
  • 600 ⁇ l of supernatant containing DNA is transferred to a new tube containing 500 ⁇ l isopropanol, mixed, and left at room temperature for 10 minutes.
  • the tube is centrifuged for 5 minutes at 3000 RPM to pellet the DNA and supernatant is removed.
  • the DNA pellet is dried at 65° C. for 30 minutes, and then 200 ⁇ l of TE (10 mM Tris; 1 mM EDTA) buffer is added and incubated at room temperature for at least 30 minutes.
  • the pellet is agitated for 1 minute, centrifuged for 1 minute at 1000 RPM, and stored at 4° C.
  • TAQMANTM PCR multiplex amplification reaction is performed on each sample. 3 ⁇ l of extracted template DNA is mixed with 0.2 ⁇ l WT VICTM internal control probe [SEQ ID NO: 7 ] suspended in 18 megohm purified water [Sigma Catalog No.
  • W-4502 (0.2 ⁇ M final concentration); 0.2 ⁇ l Event 6-FAMTM MGB probe [SEQ ID NO: 6 ] suspended in 18 megohm purified water (0.2 ⁇ M final concentration); 0.5 ⁇ l of zygosity probe primer mix suspended in 18 megohm purified water (1.0 ⁇ M final concentration prepared by suspending each primer [SEQ ID NO: 3 , SEQ ID NO: 4 , and SEQ ID NO: 5 ] in 18 megohm water at a concentration of 20 ⁇ M; and 5 ⁇ l of 2X universal master buffer mix [Applied Biosystems part No. 4304437].
  • Final volume is adjusted to 10 ⁇ l with 18 megohm water, and PCR is performed in an Applied Biosystems GeneAmp PCR System 9700 or an MJ Research DNA Engine PTC-225 thermal cycler by using the following parameters; 1 cycle 50° C., 2 minutes; 1 cycle 95° C., 10 minutes; 10 cycles of 95° C., 15 seconds, followed by 64° C., 1 minute, ⁇ 1° C./cycle; 30 cycles of 95° C., 15 seconds, followed by 54° C., 1 minute; and 1 cycle of 10° C., hold temperature.
  • the following positive controls are used: template DNA from known homozygous 40 - 3 - 2 transgenic soybean; template DNA from known hemizygous 40 - 3 - 2 transgenic soybean.
  • the following negative controls are used: template DNA from known non-transgenic soybean; no template DNA control.
  • FAM probe fluorescence is read at 520 nM; VICTM probe fluorescence is read at 550 nM.
  • Fluorogenic MGB TAQMANTM probes are PB65 (6FAM-CCTTTTCCATTTGGG; SEQ ID NO: 6 ) and PB1172 (VICTM-ACCTCGTTTCTATGCTAATTAC; SEQ ID NO: 7 ).
  • progeny lines are identified that lack a detectable amplified insert sequence, and are screened for glyphosate sensitivity and traits of interest. Marker-assisted breeding may be employed in this process. The presence of a transgene may also be assessed in progeny by means of other methods such as other PCR-based methods, Southern blots, northern blots, western blots, or ELISA analysis.
  • Example 2 Trangenic progeny of 40 - 3 - 2 that comprose a different glyphosate tolerance transgene, and do not contain the functional 40 - 3 - 2 insertion
  • An elite soybean cultivar comprising ROUNDUP READY® event 40 - 3 - 2 may be crossed with a soybean cultivar comprising a different transgenic event that confers glyphosate tolerance, and segregation of the two transgenic inserts and additional agronomic traits is followed.
  • the PCR-based zygosity test for sequences specific to event 40 - 3 - 2 is performed as described in Example 1 . Similar zygosity testing may optionally be performed to identify progeny homozygous or hemizygous for the other transgenic event or events. Progeny are screened by the PCR-based zygosity test for loss of the 40 - 3 - 2 insertion, and selected for glyphosate resistance and other traits of interest.
  • the methods used to identify heterozygous from homozygous progeny containing 40 - 3 - 2 insertion DNA are described in a zygosity assay for which examples of conditions are described in Table 2 and Table 3.
  • the DNA primers used in the zygosity assay are primers (SEQ ID NO: 3 ), (SEQ ID NO: 4 ), (SEQ ID NO: 5 ), 6FAMTM labeled primer (SEQ ID NO: 6 ) and VICTM labeled primer (SEQ ID NO: 7 ), 6FAM and VIC are florescent dye products of Applied Biosystems (Foster City, Calif.) attached to the DNA primer.
  • SEQ ID NO: 3 , SEQ ID NO: 4 and SEQ ID NO: 5 when used in these reaction methods produce one DNA amplicon for non-transgenic soybean, two DNA amplicons for heterozygous soybean containing event 40 - 3 - 2 DNA, and one DNA amplicon for homozygous 40 - 3 - 2 soybean plant.
  • the controls for this analysis should include a positive control from homozygous and heterozygous soybean containing event 40 - 3 - 2 DNA, a negative control from non-transgenic soybean, and a negative control that contains no template DNA.
  • This assay is optimized for use with a Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermocycler. Other methods and apparatus known to those skilled in the art that produce amplicons that identify the zygosity of the progeny of crosses made with 40 - 3 - 2 plants is within the skill of the art.
  • thermocycler conditions Proceed with the DNA amplification in a Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycles Gradient thermocycler using the following cycling parameters. When running the PCR in the Eppendorf Mastercycler Gradient or MJ Engine, the thermocycler should be run in the calculated mode. When running the PCR in the Perkin-Elmer 9700, run the thermocycler with the ramp speed set at maximum.
  • the present invention may be applied to corn breeding.
  • An inbred corn line comprising event GA 21 was crossed to another inbred line comprising event NK 603 , and segregation of progeny was followed in order to efficiently identify progeny that lack sequences associated with the GA 21 event, comprise the NK 603 event, and exhibit other DNA markers of the original parent line that comprises GA 21 .
  • the recurrent parent corn inbred line RR 728 - 18 GA 21 was crossed with donor parent 9034 ( 5 )NK 603 , and backcrossed to the recurrent parent.
  • the BC 1 S 0 was crossed to the recurrent parent, and its genotype was screened by PCR-based assay. Lines exhibiting probable heterozygosity at both transgenic loci were selected and ranked according to the number of PCR markers present for the recurrent parent (RP). Selected lines (BC 2 S 0 generation) were backcrossed to the recurrent parent again (BC 3 S 0 ), selfed, and screened by Taqman PCR.
  • 165 comprised the NK 603 event, and 38 of those 165 were deemed highly probable as being heterozygous for GA 21 based on the GA 21 event assay and co-dominant linked marked.
  • This generation was selfed to yield a BC 3 F 2 generation, and progeny were again screened with respect to GA 21 -linked PCR markers, NK 603 PCR-based zygosity assay, and percentage of recurrent parent markers (PCR-based). Lines selected for further breeding at this stage comprised up to almost 95% recurrent parent markers, were heterozygous for GA 21 , and comprised NK 603 (table 4).
  • the BC 3 F 2 generation was selfed, and progeny were grown and selected for tolerance to ROUNDUP®; marker-assisted selection for presence of homozygous null GA 21 and homozygous NK 603 , and highest percentage of recurrent parent markers.
  • 15 out of 251 screened lines were homozygous null GA 21 (i.e. lack the GA 21 event) and homozygous for the NK 603 event.
  • Sixty pools of 5 progeny each of selected lines were subjected to Southern blot analysis of EcoRV-digested genomic DNA. Control lanes included genomic DNA from known GA 21 and NK 603 corn lines, and a sample of GA 21 genomic DNA spiked 1:9 into NK 603 genomic DNA to stimulate the presence of hemizygous GA 21 -containing plant in a five plant pool.
  • a rice actin promoter probe was used.
  • the probe was prepared by PCR synthesis using pDPG 434 as template DNA, and primers ract-F TCGAGGTCATTCATATGCTTGAGAAG [SEQ ID NO: 8 ] and ract-R AAGCTCCGCACGAGGCTGCATTTG [SEQ ID NO: 9 ] followed by digoxigenin labeling.
  • pDPG 434 is the plasmid construct used to give rise to the GA 21 event (U.S. Pat. No. 6,040,497, incorporated herein by reference), and contains elements in common with the plasmid construct used to give rise to the NK 603 event.
  • the probe is a 1.4 Kb DNA fragment spanning the rice actin 1 promoter, intron, and 5 ′ untranslated region (UTR).
  • UTR untranslated region
  • NK 603 -containing genomic DNA yields a hybridizing band of 4 Kb
  • GA 21 - containing genomic DNA yields a hybridizing band of about 21 Kb.
  • the resulting hybridization pattern indicated detectable NK 603 -specific signal and no detectable GA 21 -specific signal in experimental lanes. Control lanes yielded expected size GA 21 and NK 603 specific signals, confirming that the assay was sensitive enough to identify a single hemizygous GA 21 individual in a pool of five plants.
  • the converted inbred line is identified as 9034 (NK 603 ).
  • This method may also be used to identify non-transgenic progeny (i.e. null segregate for both transgenic events) in a cross such as that described above.
  • null segregate would, in this case, comprise neither the GA 21 nor NK 603 events, but may comprise genetic markers and agronomic qualities of either or both parent lines.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
US11/490,708 2005-07-29 2006-07-21 Development of novel germplasm using segregates from transgenic crosses Abandoned USH2258H1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/490,708 USH2258H1 (en) 2005-07-29 2006-07-21 Development of novel germplasm using segregates from transgenic crosses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US70391705P 2005-07-29 2005-07-29
US11/490,708 USH2258H1 (en) 2005-07-29 2006-07-21 Development of novel germplasm using segregates from transgenic crosses

Publications (2)

Publication Number Publication Date
US20070136836A1 US20070136836A1 (en) 2007-06-14
USH2258H1 true USH2258H1 (en) 2011-06-07

Family

ID=37625704

Family Applications (1)

Application Number Title Priority Date Filing Date
US11/490,708 Abandoned USH2258H1 (en) 2005-07-29 2006-07-21 Development of novel germplasm using segregates from transgenic crosses

Country Status (10)

Country Link
US (1) USH2258H1 (es)
EP (2) EP1910547A2 (es)
CN (1) CN101278053A (es)
AR (1) AR054597A1 (es)
AU (1) AU2006276110A1 (es)
BR (1) BRPI0614693A2 (es)
CA (1) CA2616535A1 (es)
UY (1) UY29706A1 (es)
WO (1) WO2007015945A2 (es)
ZA (1) ZA200800790B (es)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9303270B2 (en) 2011-07-22 2016-04-05 Ricetec Aktiengesellschaft Rice resistant to HPPD and accase inhibiting herbicides
US9370149B2 (en) 2011-07-22 2016-06-21 Ricetec Aktiengesellschaft Methods and compositions to produce rice resistant to accase inhibitors
US11130959B2 (en) 2016-08-05 2021-09-28 Ricetec, Inc. Methods and compositions for combinations of mutations associated with herbicide resistance/tolerance in rice

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BRPI0614693A2 (pt) * 2005-07-29 2011-04-12 Monsanto Technology Llc desenvolvimento de germoplasma usando segregados de cruzamentos transgênicos
CN101319996B (zh) * 2007-07-20 2010-05-19 中国科学院海洋研究所 一种适用于饲料的转基因大豆检测试剂盒及检测方法
US20110151441A1 (en) * 2009-12-18 2011-06-23 Dow Agrosciences Llc Endpoint taqman methods for determining zygosity of corn comprising tc1507 events
EP2575431B1 (en) * 2010-06-04 2018-03-14 Monsanto Technology LLC Transgenic brassica event mon 88302 and methods of use thereof
AU2011311955B9 (en) * 2010-10-07 2015-08-06 Corteva Agriscience Llc Endpoint TaqMan methods for determining zygosity of cotton comprising Cry 1F event 281-24-236
WO2012092327A2 (en) * 2010-12-29 2012-07-05 Dow Agrosciences Llc Methods to determine zygosity in a bulked sample
CN102168103B (zh) * 2011-02-24 2013-01-16 中华人民共和国上海出入境检验检疫局 特异性检测转基因油菜rt73的标准分子及其应用
AR093979A1 (es) * 2012-12-13 2015-07-01 Dow Agrosciences Llc Metodos de deteccion de adn para actividad de nucleasa especifica de sitio
CA2935570A1 (en) * 2013-12-31 2015-07-09 The Board of Governors of Higher Education, State of Rhode Island and Providence Plantations The use of transgenic plant for recovery of non-transgenic hybrids
AU2015231804B2 (en) 2014-03-20 2021-02-25 Monsanto Technology Llc Transgenic maize event MON 87419 and methods of use thereof
CN104255443B (zh) * 2014-10-22 2016-08-24 天津市农作物研究所 一种聚合含抗三种病害基因的水稻选育方法
CN106244587A (zh) * 2015-06-15 2016-12-21 创世纪种业有限公司 抗草甘膦棉花事件以及用于其检测的引物和方法
CN105505981B (zh) * 2015-12-30 2018-12-25 中国农业科学院作物科学研究所 一种抗草甘膦转基因大豆及其制备方法与应用

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992001370A1 (en) 1990-07-19 1992-02-06 The Regents Of The University Of California Biologically safe plant transformation system
US6040497A (en) 1997-04-03 2000-03-21 Dekalb Genetics Corporation Glyphosate resistant maize lines
US6353026B1 (en) 1999-03-18 2002-03-05 Brigham And Women's Hospital Regulation of phospholipase D activity
US6468747B1 (en) 1998-11-03 2002-10-22 Plant Genetic System, N.V. Glufosinate tolerant rice
WO2003003816A2 (en) 2001-07-06 2003-01-16 Monsanto Technology Llc Methods for enhancing segregation of transgenes in plants and compositions thereof
US20030024005A1 (en) * 2000-11-17 2003-01-30 Hillyard Jeanna R. Cotton event PV-GHBK04 (757) and compositions and methods for detection thereof
WO2003064696A2 (en) 2002-01-31 2003-08-07 The Procter & Gamble Company Methods for reducing contamination by genetically modified plant products
US6740488B2 (en) 2000-10-25 2004-05-25 Monsanto Technology Llc Cotton event PV-GHGT07(1445) compositions and methods for detection thereof
US6818807B2 (en) 2001-08-06 2004-11-16 Bayer Bioscience N.V. Herbicide tolerant cotton plants having event EE-GH1
US6825400B2 (en) 2000-06-22 2004-11-30 Monsanto Technology Llc Corn plants comprising event PV-ZMGT32(nk603)
US20050132437A1 (en) 2003-12-11 2005-06-16 Monsanto Technology Llc High lysine maize compositions and methods for detection thereof
US6927319B2 (en) * 2002-04-10 2005-08-09 Natural Genes, Inc. Natural herbicide resistance in soybeans
US20070136836A1 (en) * 2005-07-29 2007-06-14 Arnevik Cindy L Development of novel germplasm using segregates from transgenic crosses

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5094945A (en) 1983-01-05 1992-03-10 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5176995A (en) 1985-03-28 1993-01-05 Hoffmann-La Roche Inc. Detection of viruses by amplification and hybridization
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4810648A (en) 1986-01-08 1989-03-07 Rhone Poulenc Agrochimie Haloarylnitrile degrading gene, its use, and cells containing the gene
US20020007053A1 (en) * 1989-02-06 2002-01-17 Barry Gerard Francis Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
WO1992000377A1 (en) 1990-06-25 1992-01-09 Monsanto Company Glyphosate tolerant plants
US5633435A (en) 1990-08-31 1997-05-27 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
DK0546090T4 (da) * 1990-08-31 2006-11-20 Monsanto Co Glyphosattolerante enolpyruvylshikimat-3-phosphat-synthaser
US6506963B1 (en) 1999-12-08 2003-01-14 Plant Genetic Systems, N.V. Hybrid winter oilseed rape and methods for producing same
US6768044B1 (en) 2000-05-10 2004-07-27 Bayer Cropscience Sa Chimeric hydroxyl-phenyl pyruvate dioxygenase, DNA sequence and method for obtaining plants containing such a gene, with herbicide tolerance
WO2002036782A2 (en) 2000-10-30 2002-05-10 Maxygen, Inc. Novel glyphosate n-acetyltransferase (gat) genes

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5792924A (en) 1990-07-19 1998-08-11 The Regents Of The University Of California Biologically safe plant transformation system
WO1992001370A1 (en) 1990-07-19 1992-02-06 The Regents Of The University Of California Biologically safe plant transformation system
US6040497A (en) 1997-04-03 2000-03-21 Dekalb Genetics Corporation Glyphosate resistant maize lines
US6468747B1 (en) 1998-11-03 2002-10-22 Plant Genetic System, N.V. Glufosinate tolerant rice
US6353026B1 (en) 1999-03-18 2002-03-05 Brigham And Women's Hospital Regulation of phospholipase D activity
US6825400B2 (en) 2000-06-22 2004-11-30 Monsanto Technology Llc Corn plants comprising event PV-ZMGT32(nk603)
US6740488B2 (en) 2000-10-25 2004-05-25 Monsanto Technology Llc Cotton event PV-GHGT07(1445) compositions and methods for detection thereof
US20030024005A1 (en) * 2000-11-17 2003-01-30 Hillyard Jeanna R. Cotton event PV-GHBK04 (757) and compositions and methods for detection thereof
WO2003003816A2 (en) 2001-07-06 2003-01-16 Monsanto Technology Llc Methods for enhancing segregation of transgenes in plants and compositions thereof
US6818807B2 (en) 2001-08-06 2004-11-16 Bayer Bioscience N.V. Herbicide tolerant cotton plants having event EE-GH1
WO2003064696A2 (en) 2002-01-31 2003-08-07 The Procter & Gamble Company Methods for reducing contamination by genetically modified plant products
US6927319B2 (en) * 2002-04-10 2005-08-09 Natural Genes, Inc. Natural herbicide resistance in soybeans
US20050132437A1 (en) 2003-12-11 2005-06-16 Monsanto Technology Llc High lysine maize compositions and methods for detection thereof
US20070136836A1 (en) * 2005-07-29 2007-06-14 Arnevik Cindy L Development of novel germplasm using segregates from transgenic crosses

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
"DNA Sequences Flanking the 3' End of the Functional Insert of Roundup Ready Soybean Event 40-3-2 are Identical to DNA Sequences from the Wild-type Soybean Lines A5403 and A3244," 2002, Report No. MSL-17561, [www.food.gov.uk/multimedia/pdfs/soygenome_clean_MSL17561.pdf] pp. 1-7, (XP002422924).
"DNA Sequences Flanking the 3′ End of the Functional Insert of Roundup Ready Soybean Event 40-3-2 are Identical to DNA Sequences from the Wild-type Soybean Lines A5403 and A3244," 2002, Report No. MSL-17561, [www.food.gov.uk/multimedia/pdfs/soygenome_clean_MSL17561.pdf] pp. 1-7, (XP002422924).
"Updated Molecular Characterization and Safety Assessment of Roundup Ready® Soybean Event 40-3-2," 2000, Monsanto Report MSL-16712, [www.agbios.com/docroot/decdocs/gts40-3-3-update.pdf] pp. 1-20, (XP-002422923).
Ben Bubner et al., "Two-Fold Differences are the Detection Limit for Determing Transgene Copy Numbers in Plants by Real-Time PCR," BMC Biotechnology, 4:14 (2004).
Ben Bubner et al., "Use of Real-Time PCR for Determing Copy Number and Zygosity in Transgenic Plants," Plant Cell Rep., 23:263-271 (2004).
Berdal et al 2001, Eur. Food Res. Techol. 213: 432-438. *
Berdal, Knut et al., "Roundup Ready® soybean event-specific real-time quantitive PCR assay and estimation of the practical detection and quantification limits in GMO analyses," 2001, European Food Research and Technology, vol. 213, No. 6, pp. 432-438, (XP001097294).
Hernández, Marta et al., "Development of real-time PCR systems based on SYBR® Green I, Amplifluor(TM) and Tagman ® technologies for specific quantitative detection of the transgenic maize event GA21," 2004, Journal of Cereal Science, vol. 39, No. 1, pp. 99-107, (XP-002422925).
Hernández, Marta et al., "Development of real-time PCR systems based on SYBR® Green I, Amplifluor™ and Tagman ® technologies for specific quantitative detection of the transgenic maize event GA21," 2004, Journal of Cereal Science, vol. 39, No. 1, pp. 99-107, (XP-002422925).
Honda et al 2002, J. Exp. Bot. 53: 1515-1520. *
Lopez et al, Presentation at the Xth EAAE Congress Exploring Diversity in the European Agri-Food System, Zaragoza (Spain), 28031 Aug. 2002, 13 pages plus cover page. *
M.A. Schmidt et al., "Quantitative Detection of Transgenes in Soybean [Glycine max ( L.) Merrill] and Peanut (Arachis hypogaea L.) by Real-Time Polymerase Chain Reaction," Plant Cell Rep., 20:422-428 (2001).
Monsanto Company Study #: 99-01-30-22, Report MSL-16646, [www.food.gov.uk/multimedia/pdfs/monsantodossier.pdf] pp. 1-47, (XP002422922).
Office Action regarding Argentine Application No. P20060113316, dated Apr. 13, 2010.
P. Song et al., "Quantitative Real-Time PCR as a Screening Tool for Estimating Transgene Copy Number in WHISKERS(TM)-Derived Transgenic Maize," Plant Cell Rep., 20:948-954 (2002).
P. Song et al., "Quantitative Real-Time PCR as a Screening Tool for Estimating Transgene Copy Number in WHISKERS™-Derived Transgenic Maize," Plant Cell Rep., 20:948-954 (2002).
P. Windels et al., "Development of a Line Specific GMO Detection Method: A Case Study," Med. Fac. Landbouww, XP-001032975, (1999).
Peter D. Hare et al., "Excision of Selectable Marker Genes from Transgenic Plants," Nature Biotechnology, 20:575-580 (2002).
Pieter Windels et al., "Characterisation of the Roundup Ready Soybean Insert," Eur. Food Res. Technol., 213:107-112 (2001).
S.R. Padgette et al., "Development, Identification, and Characterization of Glyphosate-Tolerant Soybean Line," Crop Sci., 35:1451-1461 (1995).
Spencer et al 1992, Plant Molecular Biology 18: 201-210. *
Taverniers, Isabel et al., "Event-Specific Plasmid Standards and Real-Time PCR Methods for Transgenic Bt11, Bt176, and GA21 Maize and Transgenic GT73 Canola," 2005, Journal of Agricultural and Food Chemistry, vol. 53, No. 8, pp. 3041-3052, (XP002422926).
Taverniers, Isabel et al., "Use of cloned DNA fragments for event-specific quantification of genetically modified organisms in pure and mixed food products," 2001, European Food Research and Technology, vol. 213, No. 6, pp. 417-424, (XP008072736).
Terry, Catherine F et al., "Event-specific detection of Roundup Ready Soya using two different real time PCR detection chemistries," 2001, European Food Research and Technology, vol. 213, No. 6, pp. 425-431, (XP-001097295).

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9303270B2 (en) 2011-07-22 2016-04-05 Ricetec Aktiengesellschaft Rice resistant to HPPD and accase inhibiting herbicides
US9370149B2 (en) 2011-07-22 2016-06-21 Ricetec Aktiengesellschaft Methods and compositions to produce rice resistant to accase inhibitors
US9994862B2 (en) 2011-07-22 2018-06-12 Ricetec, Inc. Rice resistant to HPPD and ACCase inhibiting herbicides
US11130959B2 (en) 2016-08-05 2021-09-28 Ricetec, Inc. Methods and compositions for combinations of mutations associated with herbicide resistance/tolerance in rice

Also Published As

Publication number Publication date
AR054597A1 (es) 2007-06-27
WO2007015945A3 (en) 2007-10-04
EP1910547A2 (en) 2008-04-16
CA2616535A1 (en) 2007-02-08
UY29706A1 (es) 2007-02-28
BRPI0614693A2 (pt) 2011-04-12
ZA200800790B (en) 2008-12-31
WO2007015945A2 (en) 2007-02-08
AU2006276110A1 (en) 2007-02-08
EP2112224A2 (en) 2009-10-28
US20070136836A1 (en) 2007-06-14
EP2112224A3 (en) 2010-09-01
CN101278053A (zh) 2008-10-01

Similar Documents

Publication Publication Date Title
USH2258H1 (en) Development of novel germplasm using segregates from transgenic crosses
US12018268B2 (en) Soybean event MON89788 and methods for detection thereof
US20170327838A1 (en) CORN EVENT PV-ZMGT32(nk603) AND COMPOSITIONS AND METHODS FOR DETECTION THEREOF
US7179965B2 (en) Cry1F and Cry1Ac transgenic cotton lines and event-specific identification thereof
JP5762400B2 (ja) イネ遺伝子組換え事象１７０５３およびその使用方法
CA2771581C (en) Detection of aad-1 event das-40278-9 in corn
US7964348B2 (en) Cotton event PV-GHBK04 (531) and compositions and methods for detection thereof
US20020120964A1 (en) Cotton event PV-GHGT07(1445) and compositions and methods for detection thereof
EP1587931A2 (en) Glyphosate tolerant alfalfa events and methods for detection thereof
KR20120004964A (ko) 벼의 17314 트랜스제닉 사건 및 이의 이용 방법
JP2012070734A (ja) トウモロコシ植物ｍｏｎ８８０１７および組成物ならびにその検出方法
EP1417318A2 (en) Canola event pv-bngt04(rt73) and compositions and methods for detection thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: MONSANTO TECHNOLOGY LLC, MISSOURI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ARNEVIK, CINDY L.;DOBERT, RAYMOND;ZENG, QINGYI;AND OTHERS;REEL/FRAME:018615/0848;SIGNING DATES FROM 20060928 TO 20061017

Owner name: MONSANTO TECHNOLOGY LLC, MISSOURI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ARNEVIK, CINDY L.;DOBERT, RAYMOND;ZENG, QINGYI;AND OTHERS;SIGNING DATES FROM 20060928 TO 20061017;REEL/FRAME:018615/0848

STCF Information on status: patent grant

Free format text: PATENTED CASE