US7820142B2 - Immunogenic glycopeptides, screening, preparation and uses - Google Patents

Immunogenic glycopeptides, screening, preparation and uses Download PDF

Info

Publication number
US7820142B2
US7820142B2 US10/953,095 US95309504A US7820142B2 US 7820142 B2 US7820142 B2 US 7820142B2 US 95309504 A US95309504 A US 95309504A US 7820142 B2 US7820142 B2 US 7820142B2
Authority
US
United States
Prior art keywords
apa
tuberculosis
glycopeptide
seq
lymphocytes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related, expires
Application number
US10/953,095
Other languages
English (en)
Other versions
US20060067888A1 (en
Inventor
Gilles Marchal
Félix Romain
Pascale Pescher
Françoise Baleux
Daniel Scott-Algara
Laurence Mulard
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut Pasteur de Lille
Original Assignee
Institut Pasteur de Lille
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut Pasteur de Lille filed Critical Institut Pasteur de Lille
Priority to US10/953,095 priority Critical patent/US7820142B2/en
Assigned to INSTITUT PASTEUR reassignment INSTITUT PASTEUR ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SCOTT-ALGARA, DANIEL, BALEUX, FRANCOISE, MARCHAL, GILLES, MULARD, LAURENCE, PESCHER, PASCALE, ROMAIN, FELIX
Priority to DE602005012530T priority patent/DE602005012530D1/de
Priority to US11/576,203 priority patent/US20080293620A1/en
Priority to PCT/IB2005/003303 priority patent/WO2006035317A2/fr
Priority to AU2005288678A priority patent/AU2005288678A1/en
Priority to EP05804673A priority patent/EP1810033B1/fr
Priority to ES05804673T priority patent/ES2321322T3/es
Priority to AT05804673T priority patent/ATE421695T1/de
Priority to CA002582833A priority patent/CA2582833A1/fr
Publication of US20060067888A1 publication Critical patent/US20060067888A1/en
Priority to HK08100063.4A priority patent/HK1106027A1/xx
Publication of US7820142B2 publication Critical patent/US7820142B2/en
Application granted granted Critical
Expired - Fee Related legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911—Bacteria
    • G01N33/5695—Mycobacteria

Definitions

  • the present invention relates to immunogenic glycopeptides derived from pathogenic microorganisms, which can be used for immunization and diagnosing infections due to such pathogenic microorganisms (bacteria or fungi), and also to the methods for the selection and for the preparation thereof.
  • the means implemented for preventing and treating these infections comprise, firstly, screening which enables the infection to be monitored and treated and, secondly, immunization.
  • BCG has been used to immunize more than 3 billion individuals against tuberculosis, without any particular side effects.
  • BCG has been used to immunize more than 3 billion individuals against tuberculosis, without any particular side effects.
  • bacilli of attenuated virulence.
  • Cellular immunity is induced. It causes delayed-type hypersensitivity (HSR) directed against the proteins or antigens of mycobacteria (reaction to tuberculin), and increased resistance to infection with M. tuberculosis .
  • HSR delayed-type hypersensitivity
  • BCG protects well against the acute forms of the infection (tubercular meningitis in children, for example). Its effectiveness is more variable in adults.
  • the existence of a cross-reactivity between BCG and other mycobacteria which do not belong to the tuberculosis complex, and also the absence, in the BCG genome, of certain immunogenic antigens of Mycobacterium tuberculosis , or a different expression profile for these antigens during the infection, may explain the variable effectiveness of BCG.
  • BCG is a live strain of attenuated virulence. It therefore has a residual pathogenic power which prohibits the use thereof in immunodepressed individuals, in particular in individuals acknowledged to be infected with the human immunodeficiency virus (HIV).
  • HIV human immunodeficiency virus
  • antigens are present either in the form of surface antigens, such as the mannoproteins of C. albicans (Buurman et al., PNAS, 1998, 95, 7670-7675), or in the form of secreted antigens, in M. tuberculosis : MPT59 (30 kDa), 85A (32 kDa), MPT64 (23 kDa), hsp71 (71 kfla), MPT51 (24 kDa), MPT63 (16 kDa) and ESAT-6 (6 kDa), (Andersen, Infect. Immun., 1994, 62, 2536-2544; Horwitz et al., PNAS, 1995, 92, 1530-1534).
  • surface antigens such as the mannoproteins of C. albicans (Buurman et al., PNAS, 1998, 95, 7670-7675)
  • secreted antigens in M. tuberculosis : MPT
  • M. tuberculosis antigens have already been proposed as potential candidates for an immunization composition since they are preferentially recognized by CD4+ T lymphocytes (Andersen, et al., mentioned above; Horwitz et al., mentioned above).
  • a protein secreted by M. tuberculosis is the product of the Rv 1860 gene (Laqueyrerie et al. Infect. Immun. 1995, 63: 4003-4010).
  • the second molecule is an internal peptide of a putative serine protease encoded by the Rv 1796 gene.
  • this protein which represents only 2% of the proteins secreted by the bacilli of the tuberculosis group ( M. tuberculosis, M. bovis and BCG) in culture, is an immunodominant antigen which is very effectively recognized by specific CD4+ T lymphocytes originating from animals infected with M. tuberculosis or immunized with BCG (Romain et al., Inf. Immun., 1999, 67, 5567-5572; Horn et al., J. Biol. Chem., 1999, 274, 32023-32030).
  • this M. tuberculosis Apa molecule contains 6 to 9 mannose residues linked, via a glycosidic bond of the ⁇ -(1,2) type, to 4 threonine residues (T 10 , T 18 , T 27 and T 277 ) in the following way: a dimannose (T 10 and T 18 ), a mannose (T 27 ), a mannose, a dimannose or a trimannose (T 277 ) (Dobos et al., J. Bacteriol., 1996, 178, 2498-2506).
  • this saccharide structure which contains mono-, di- or trimannoses resembles that of mannoproteins from yeast, in particular from Candida albicans , and is different from that of proteins from F. meningosepticum , which have longer oligomannose chains.
  • the loss of Apa antigenicity, observed after demannosylation, may be due to a decrease in the phagocytosis and processing of this antigen, or alternatively in the recognition of the latter by CD4+ T lymphocytes.
  • the mannose receptor of macrophages and of dendritic cells which bind specifically to hexoses, in particular of mannoproteins from C.
  • albicans and of mannolipids such as lipoarabinomannan from mycobacteria plays a role in the phagocytosis and processing of antigens which are present at the surface of these cells in the form of a peptide/class II MHC molecule complex (Stahl et al., Current Opinion in Immunology, 1998, 10, 50-55). It has also been shown that a mannosylated peptide (mannosylated on lysine residues in the N-terminal position) is phagocytosed and processed by dendritic cells much more effectively than a non-glycosylated peptide with the same sequence (Tan et al., Eur. J. Immunol., 1997, 27, 2426-2435).
  • the inventors have set themselves the aim of preparing immunodominant antigens capable of inducing a protective humoral and/or cellular immune response, which, on the one hand, when administered alone or in combination with other antigens, may constitute a vaccine which can be used in all individuals, including immunodepressed individuals (disappearance of the risk linked to the use of a live vaccine) and, on the other hand, may be used for diagnostic purposes.
  • glycopeptides derived from pathogenic microorganisms which synthesize glycoproteins exhibit an antigenic activity which is at least equal, if not greater than, that of the deglycosylated native protein or of the recombinant protein produced in E. coli.
  • a subject of the present invention is immunogenic glycopeptides selected from the group consisting of:
  • glycopeptides essentially consisting of a glycosylated T epitope, comprising from 14 to 25 amino acids, among which at least one neutral amino acid is bonded to a disaccharide or to a trisaccharide (glycosidic bond) and at least 15% of said amino acids are prolines, one of the prolines being located in position -1 to -4, relative to the position of said neutral amino acid, which glycopeptides, derived from a pathogenic microorganism, are:
  • glycopeptides which have a sequence of 15 to 39 amino acids including the sequence of the glycopeptide as defined in a 1 ), excluding the glycopeptide of sequence SEQ ID NO:11, derived from the Apa which is described by Dobos et al. ( J. Bacteriol., 1996, 178, 2498-2506).
  • glycopeptides consisting essentially of a glycosylated T epitope are recognized by CD4+ T lymphocytes via this glycosylated T epitope. Specifically, after immunization with live bacilli of the tuberculosis group, there are many more T lymphocytes specific for these glycopeptides than T lymphocytes specific for the non-glycosylated peptides with the same sequence.
  • said glycopeptides have an antigenic activity which is at least 10 times greater, preferably at least 30 times greater, than that of a control peptide with the same sequence.
  • said neutral amino acids are selected from the group consisting of serine and threonine.
  • glycopeptides they contain from 1 to 7 threonine residues bonded to a disaccharide or to a trisaccharide.
  • said disaccharide or trisaccharide is a dimer or a trimer of hexose, preferably a mannose.
  • said glycosidic bond is an ⁇ -(1,2) bond.
  • said glycopeptides are derived from a pathogenic microorganism capable of O-glycosylating proteins, preferably Mycobacterium tuberculosis or Candida albicans.
  • glycopeptides are preferably derived:
  • said glycopeptide is selected from the group consisting of:
  • a subject of the invention is also a method for synthesizing a glycopeptide as defined above, characterized in that it comprises the following steps:
  • said neutral amino acid is selected from the group consisting of serine and threonine.
  • glycopeptides have the following sequences (T represents an O-glycosylated threonine functionalized with 2 or 3 glycosidic residues, and Ac represents an acetate function):
  • SEQ ID NO: 1 H 2 N-DPEPAPPVP T TAASPPS T AAAPPAPA T PVAPPPPAPAAAT-CONH 2
  • SEQ ID NO: 2 AcNH-PAPAPAPAGEVAPTPT T PTPQRTLPA-COOH
  • SEQ ID NO: 3 AcNH-TIP T T E T PPPPQ T V T LSPVPPQ T V T VIPAPPPEEG-CONH 2 , said method comprises the following steps:
  • step ii) synthesizing the peptides corresponding to the sequences SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 mentioned above, on a solid support, using the amino acids required for producing these sequences and the O-glycosylated threonines obtained in step i),
  • the synthesis of the peptides SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 therefore corresponds to a conventional solid-phase peptide synthesis during which glycosylated amino acids are introduced.
  • the amino acids used are suitably protected and, if necessary, activated before being incorporated one after the other into the peptide sequence.
  • the hydroxyls present on the glycosidic residues borne by the threonines must be suitably protected during the peptide synthesis.
  • the peptides are separated from the solid support and deprotected. They can be purified by reverse-phase High Performance Liquid Chromatography.
  • the glycosidic residues borne by the O-glycosylated threonines prepared in step i) are hexoses, preferably mannoses, the mannose residues advantageously being bonded to one another via ⁇ -(1,2) bonds.
  • threonines functionalized with mannose residues are prepared as follows:
  • P 1 and P 2 which may be identical or different, represent groups which protect a hydroxyl function
  • X represents an activated function, such as a bromine atom
  • P 3 represents a group which protects a primary amine function and P 4 represents a group which protects a hydroxyl function
  • the protective groups P 1 , P 2 , P 3 and P 4 may be chosen from those described in the work Protective Groups in Organic Synthesis , T. W. GREENE and P. G. M. WUTS, Second Edition, 1991, J. WILEY and Sons.
  • P 1 and P 2 may represent acetyl or benzoyl groups
  • P 3 may represent an Fmoc (9-fluorenylmethoxycarbonyl) group
  • P 4 may represent a pentafluorophenyl group.
  • a subject of the present invention is also a method for selecting and screening immunogenic glycopeptides using the peptide sequence of the proteins of a pathogenic microorganism, which may advantageously be carried out concomitantly with the method for synthesizing the glycopeptides in accordance with the invention, as defined above, which method is characterized in that it comprises at least the following steps:
  • a 3 searching for and selecting, in and from the peptide sequence of said proteins, at least one 14 to 25 amino acid sequence containing at least one neutral amino acid bonded to a disaccharide or a trisaccharide and at least 15% of proline, one of the prolines being located in position -1 to -4, relative to the position of said neutral amino acid,
  • step a 3 preparing the glycopeptide(s) selected in step a 3 ), in accordance with the method of synthesis defined above, and
  • glycopeptides the antigenic activity of which is at least 10 times greater, preferably at least 30 times greater, than that of a control peptide with the same sequence.
  • step a 3 prior to step a 3 ), it comprises a step for preselecting at least one antigenic glycoprotein.
  • step c 3 the antigenic activity of said glycopeptide is evaluated by measuring the activity of the CD4+ T lymphocytes of animals immunized with said attenuated pathogenic microorganism or with an antigenic fraction of said pathogenic microorganism.
  • T lymphocyte proliferation assays assays for the cytokines (protein or mRNA) synthesized by activated CD4+ T lymphocytes (immunoassay (ELISA) or polymerization chain reaction of the RT-PCR type) or, in the case of M. tuberculosis , delayed-type hypersensitivity assays.
  • the present invention also encompasses the glycopeptides which can be obtained using the selection and screening method as defined above.
  • a subject of the present invention is also the use of at least one glycopeptide in accordance with the invention or of a glycopeptide of sequence SEQ ID NO:11, for preparing an immunogenic or immunization composition or a diagnostic reagent.
  • glycopeptides according to the invention which detect very specifically the cellular and/or humoral immunity induced by infection with a pathogenic microorganism, in particular M. tuberculosis , may advantageously be used for the diagnosis of tuberculosis by any technique which allows the detection of cellular immunity, this technique being known to those skilled in the art, per se.
  • T-lymphocyte proliferation assays and immunoenzymatic assays for cytokines specific for CD4+ T lymphocytes, in particular ⁇ -IFN are examples of T-lymphocyte proliferation assays and immunoenzymatic assays for cytokines specific for CD4+ T lymphocytes, in particular ⁇ -IFN.
  • a subject of the present invention is also an immunogenic composition capable of inducing humoral and/or cellular immunity, characterized in that it comprises at least one glycopeptide as defined above, combined with at least one pharmaceutically acceptable vehicle.
  • the glycopeptides of the invention may advantageously be used as a transport protein (carrier) for any other immunization antigen in order to increase the effectiveness of the immunization against said antigen.
  • This antigen/carrier combination advantageously makes it possible to facilitate the selection and the amplification of the B and T lymphocytes specific for the immunization antigen.
  • a subject of the present invention is also an immunization composition which is capable of inducing humoral and/or cellular immunity, characterized in that it comprises at least one glycopeptide as defined above, combined with at least one pharmaceutically acceptable vehicle and, optionally, with at least one adjuvant.
  • said glycopeptide is combined with a protein or a protein fragment comprising at least one B epitope, one T epitope of the CF4+ type or one T epitope of the CD8+ type.
  • B epitope For the purposes of the present invention, the terms “B epitope”, “T epitope of the CD4+ type” and “T epitope of the CD8+ type”, relative to the sequence of a protein, is intended to mean the fragment of this sequence which is capable of binding, respectively, to an antibody, to a T receptor of CD4+ lymphocytes and to a T receptor of CD8+ lymphocytes.
  • the expression “combination of the glycopeptide with a protein” is intended to mean both mixing and coupling by any physical or chemical means, for example the expression of a fusion between the sequence of the glycopeptide and that of the protein or of the protein fragment.
  • the adjuvants used are conventionally used adjuvants; advantageously, they are chosen from the group consisting of aluminium hydroxide and squalene.
  • Said glycopeptide may optionally be combined with any other means, known per se to those skilled in the art, which makes it possible to increase the immunogenicity of a peptide.
  • any other means known per se to those skilled in the art, which makes it possible to increase the immunogenicity of a peptide.
  • coupling to a carrier peptide which enables the production of a branched multimerized peptide, such as that described by Wilkinson et al., 1999, Eur. J. Immunol., 29, 2788-2796.
  • a subject of the present invention is also antibodies, characterized in that they are directed against one or more of the glycopeptides according to the present invention.
  • said antibodies are selected from monoclonal antibodies and polyclonal antibodies.
  • a subject of the present invention is also a diagnostic reagent, characterized in that it is selected from the group consisting of the glycopeptides and the antibodies according to the invention.
  • a subject of the present invention is also a method for detecting an infection with a pathogenic microorganism, characterized in that it comprises bringing a biological sample from a patient likely to be infected with said pathogenic microorganism into contact with a diagnostic reagent as defined above (antibodies or glycopeptides, depending on the case) and detecting the formation of an antibody/microorganism present in the biological sample complex or a glycopeptide(s)/antibodies present in the sample complex.
  • a diagnostic reagent as defined above (antibodies or glycopeptides, depending on the case)
  • a subject of the present invention is also a method for diagnosing an infection in a patient likely to be infected with a pathogenic microorganism, comprising the detection of CD4+ T lymphocytes recognizing at least one glycopeptide as defined above.
  • the CD4+ T lymphocytes detection is carried out by any conventional immunology technique which measures the T cell response to an antigen, this technique being known to those skilled in the art.
  • said detection is performed by using a lymphocyte proliferation assay, a cytokine assay (protein or mRNA), or a delayed-type hypersensitivity assay.
  • the proliferation assay may be based on Cell-Specific-Fluorescence-Extinction (CSFE) or tritiated thymidine incorporation.
  • the cytokine assay may be carried out by ELISPOT, intracellular cytokine staining, ELISA or RT-PCR.
  • the cytokine which are assayed include: IFN- ⁇ , IL-2, IL-4, IL-5, IL-10, IL-12, IL-15.
  • the biological sample is a cell suspension containing T CD4+ positive cells.
  • it is a suspension of peripheral blood mononuclear cells (PBMCs).
  • PBMCs peripheral blood mononuclear cells
  • Said biological sample may be depleted of CD8+ positive cells or pre-enriched in T lymphocytes via a preliminary step of in vitro culturing of the cells in the presence of one or more glycopeptide(s) according to the invention.
  • said glycopeptide is derived from M. tuberculosis , preferably from the Apa or the Rv1796 protein, more preferably, said glycopeptide is selected from the group consisting of SEQ ID NO: 1, 2 or 3.
  • the M. tuberculosis derived glycopeptide(s) are advantageously administered to the patient, and the CD4+ T lymphocytes recognizing said glycopeptide(s) are detected by a delayed-type hypersensitivity assay.
  • a biological sample from said patient likely to be infected with M. tuberculosis preferably a PBMCs suspension
  • a biological sample from said patient likely to be infected with M. tuberculosis is brought into contact with said glycopeptide(s), and the CD4+ T lymphocytes recognizing said glycopeptide(s) are detected by a proliferation assay or a cytokine assay.
  • Another subject of the present invention is a kit for diagnosing an infection in a patient likely to be infected with a pathogenic microorganism, comprising at least a glycopeptide as defined above.
  • kit for diagnosing tuberculosis, comprising a glycopeptide derived from M. tuberculosis , as defined above.
  • FIG. 1 illustrates the measurement, using a delayed-type hypersensitivity assay, of the antigenic activity of the native Apa purified from M. tuberculosis , as a function of the kinetics of digestion of the Apa protein by ⁇ -mannosidase. The results are expressed in tuberculin units per mg of protein as a function of time in hours,
  • FIG. 2 illustrates the mass spectrometry analysis of the mannose composition of the Apa molecules, as a function of the kinetics of digestion of the Apa protein with ⁇ -mannosidase.
  • the number of mannose residues corresponding to each peak of the Apa protein is indicated and the overall antigenic activity of the product of the Apa digestion is indicated at the various times studied,
  • FIG. 3 illustrates the measurement, using a delayed-type hypersensitivity assay, of the antigenic activity of a glycopeptide, termed Lip, derived from the Rv 1796 protein (SEQ ID NO:3).
  • the standard purified proteins from M. tuberculosis (PPD) are used as a positive control at the dose of 0.25 ⁇ g in 0.1 ml.
  • the Lip peptide is used at the dose of 0.02 ⁇ g in 0.1 ml.
  • the Lip peptides treated with ⁇ -mannosidase or subtilisin are negative at the same doses. The results are expressed by the erythema reaction diameter,
  • FIG. 4 illustrates the antigenic activity of the Lip peptide using an in vitro lymphocyte proliferation assay.
  • the recognition of the glycosylated Lip peptide (native Lip) by the T lymphocytes is compared to that of the deglycosylated peptide (Lip+ ⁇ -mannosidase) or of the Lip peptide combined with an anti-T-lymphocyte CD4+ receptor antibody (Lip+anti Cd4),
  • FIG. 5 illustrates the measurement, using a delayed-type hypersensitivity assay, of the antigenic activity of the native Apa purified from M. tuberculosis (native Apa) or of the deglycosylated recombinant Apa produced in E. coli ( E. coli rApa), as a function of the immunization of guinea pigs.
  • the latter were immunized beforehand with live BCG injected intradermally or with the plasmids pAG831 or pAG832, containing the coding sequence of Apa, placed under the control of the cytomegalovirus early promoter.
  • the immunization of the guinea pigs with the plasmids produces a sensitization which can be revealed by a delayed-type hypersensitivity reaction.
  • the two types of antigen are equivalent for engendering this reaction, whereas, after an immunization with BCG, only the glycosylated native Apa is antigenic,
  • FIG. 6 represents the preparation of units comprising two or three mannose residues bonded via ⁇ -(1,2) bonds
  • FIG. 7 ( 7 a and 7 b ) represents the preparation of threonines functionalized with two or three mannose units.
  • FIG. 8 illustrates CD4+ lymphocytes proliferation of vaccinated subjects (controls) or tuberculosis patients (patients), in the presence of the Apa derived glycopeptide SEQ ID NO: 1, by comparison with native or deglycosylated Apa, and standard purified proteins from M. tuberulosis (PPD), measured by cellular specific fluorescence extinction (CSFE).
  • PPD M. tuberulosis
  • CSFE cellular specific fluorescence extinction
  • 450 ⁇ g of Apa protein purified from the culture supernatant of M. tuberculosis are diluted in a 450 ⁇ l volume of buffer A (100 mM CH 3 COO ⁇ Na + , 2 mM ZnCl 2 ).
  • the Apa digestion products are separated from the ⁇ -mannosidase on a reverse-phase chromatography column (Ressource RPC, Pharmacia), using a gradient of 0 to 90% acetonitrile in solution B, in 90 min.
  • the fractions corresponding to the Apa are collected, lyophilized, resuspended in a solution of butanol at 5% in water (solution C) and then dried under vacuum.
  • the purified samples are then resuspended in 100 ⁇ l of solution C.
  • the oligosaccharide composition of each sample is analysed by mass spectrometry under the conditions described in Horn et al., mentioned above.
  • the absorption at 210 nm is measured in order to evaluate the relative amount of protein present in each sample.
  • the antigenic activity is measured using a delayed-type hypersensitivity assay on guinea pigs immunized 3 months beforehand by an intradermal injection of 2 mg of live BCG at 2 injection points.
  • Each sample is diluted to a concentration of 2 ⁇ g/ml in buffer D and 100 ⁇ l of this dilution (0.2 ⁇ g) are injected intradermally into batches of 2 previously immunized guinea pigs.
  • the mean of the erythema reaction diameter is measured for the various batches of animals and the tuberculin titre of the samples is determined with respect to the PPD standard.
  • FIGS. 1 and 2 The results are illustrated by FIGS. 1 and 2 .
  • FIG. 1 The analysis of the antigenic activity of the Apa as a function of the kinetics of digestion with ⁇ -mannosidase ( FIG. 1 ) shows that the antigenic activity of the Apa is gradually lost during the digestion with ⁇ -mannosidase: 66% in 1 h, 86% in 4 h and 97 to 99% for the longer digestions.
  • oligomannose composition of Apa is as follows: a dimannose (T 10 and T 18 ), a mannose (T 27 ), a mannose, a dimannose or a trimannose (T 277 ), Dobos et al., mentioned above.
  • ⁇ -mannosidase is an exomannosidase.
  • H37Rv Mycobacterium tuberculosis
  • H37Rv Mycobacterium tuberculosis
  • the molecules secreted into the medium are concentrated on an ultrafiltration membrane (PM10, AMICON) in such as way as to retain only the molecules of molecular mass greater than 10 000 Da, and then they are lyophilized. Approximately 10 g of lyophilisate are obtained for 60 litres of culture medium.
  • a preparative column is filled with Sup75 prepgrade matrix, Pharmacia. This 50 ⁇ 750 mm column is equilibrated with a phosphate buffer (50 mM Na 2 /K PO 4 , pH 7.1; 100 mM NaCl; 4% butanol) at a flow rate of 1 ml/min.
  • the crude material above is taken up in the equilibration buffer at a final concentration of 10 g per 100 ml and clarified by centrifugation at 43 000 g for 4 h, then by filtration over a 0.22 ⁇ m filter. Injections of 13 ml are performed and the various fractions detected via their absorbence at 280 nm are concentrated on a PM10 membrane and then lyophilized.
  • the fraction eluted between 700 and 800 ml is very antigenic: delayed-type hypersensitivity is observed in guinea pigs immunized with live BCG; this fraction is, on the other hand, relatively inactive in guinea pigs immunized with heat-inactivated BCG.
  • a 24 ⁇ 250 mm Pharmacia Source 15Q preparative column (15 ⁇ m) is equilibrated with a 20 mM tris/HCl, pH 8, 4% butanol buffer at a flow rate of 5 ml/min with a maximum pressure of 8 bar.
  • a linear. NaCl gradient of 0 to 150 mM in the same buffer is applied after injecting 500 mg of the fraction above dissolved in 10 ml of initial buffer. The fractions eluted are detected by absorption at 280 nm, concentrated on a PM10 membrane and then lyophilized.
  • the fraction eluted between 40 and 75 mM NaCl is very antigenic; delayed-type hypersensitivity is observed in guinea pigs immunized with live BCG; this fraction is, on the other hand, relatively inactive in guinea pigs immunized with heat-inactivated BCG.
  • the fraction eluted between the acetonitrile concentrations of 18 and 22% is very antigenic in terms of revealing delayed-type hypersensitivity in guinea pigs immunized with live BCG and relatively inactive in guinea pigs immunized with heat-inactivated BCG.
  • a C18 reverse-phase microbore column (Browlec lab. 1 ⁇ 250 mm) is equilibrated with a 20 mM CH 3 COO ⁇ NH 4 + buffer, pH 6.5, at a flow rate of 1 ml/min.
  • a nonlinear acetonitrile gradient of 0 to 90% is applied after injecting the fraction above onto the column.
  • a fraction detected only at 220 nm is eluted with a concentration of approximately 11% of acetonitrile. This fraction (3 mg) is very active in terms of revealing delayed-type hypersensitivity reactions in guinea pigs immunized with live bacteria and relatively inactive in guinea pigs immunized with heat-inactivated BCG.
  • the fraction obtained in the final purification step was sequenced using a modified Edman technique (Applied Biosystems 473A), according to the manufacturer's instructions.
  • composition of each sample is analysed by mass spectrometry (MALDI-TOF spectrometer) under the conditions described by Horn et al., mentioned above.
  • the mass measurement performed on the purified glycopeptide indicates the presence of complex molecules probably glycosylated with mannoses, given the presence of measurements which differ by a value of 162 mass units.
  • the N-terminal sequence of the purified glycopeptide indicates the presence of a major sequence TIPTT . . . and of a minor sequence IPTTE . . . .
  • Lip mannosylated glycopeptide
  • SEQ ID NO:3 the sequence (SEQ ID NO:3) of which is that of an N-terminal fragment of a peptide derived from the protein encoded by the Rv1796 gene of M. tuberculosis , which extends from positions 169 to 239 of said protein, with reference to the annotation of the sequence of the genome of M. tuberculosis strain H37Rv from the Sanger bank.
  • glycopeptide is very active in terms of revealing delayed-type hypersensitivity reactions in guinea pigs immunized with live bacteria, on the other hand it is relatively inactive in guinea pigs immunized with heat-inactivated BCG.
  • the antigenic activity of the glycopeptide increases during the purification steps:
  • the results illustrated in FIG. 4 show that the T-lymphocyte proliferation is dependent on the peptide concentration. This proliferation is marginal when the T lymphocytes are treated with an antibody directed against CD4 molecules or when the glycopeptide is treated with ⁇ -mannosidase.
  • the plasmid pS65T (Clontech) containing the sequence of the cytomegalovirus early promoter is cleaved with the NheI and BspEI restriction enzymes, repaired with the Klenow enzyme and then ligated so as to obtain the plasmid pAG800.
  • the plasmid pAG800 is cleaved with the ApaI enzyme and ligated with the oligonucleotide 12M48 (5′ CAACGTTGGGCC 3′; SEQ ID NO:4) hybridized to itself, so as to give the plasmid pAG802.
  • PCR polymerase chain reaction
  • a Psp1046 ISS sequence is inserted at the BamHI site of the plasmid pAG803 by cloning the oligonucleotide 25M45 (5′ GATCCGGGGGGGAACGTTGGGGGGG 3′; SEQ ID NO:7) hybridized with the oligonucleotide 25M46 (5′ GATCCCCCCCCAACGTTCCCCCCCG 3′; SEQ ID NO:8), so as to obtain the plasmid pAG831.
  • An IL-12p40 ISS sequence is inserted at the BamHI site of the plasmid pAG803 by cloning the oligonucleotide 24M63 (5′ AGCGCTATGACGTTCCAAGGGCCC 3′; SEQ ID NO:9) hybridized with the oligonucleotide 24M64 (5′ GGGCCCTTGGAACGTCATAGCGCT 3′; SEQ ID NO:10), so as to obtain the plasmid pAG832.
  • the plasmids above are amplified in LB culture medium (Sambrook et al., Molecular cloning: A laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) containing 25 ⁇ g/ml of kanamycin.
  • LB culture medium Standardbrook et al., Molecular cloning: A laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989
  • Triton X-114 1%
  • the plasmid DNA is purified on MaxiPrep QIA filter columns (QIAGEN) according to the manufacturer's indications.
  • Guinea pigs (Hartley) weighing 300 to 400 g are immunized with 50 ⁇ g of the DNA of the plasmids pAG831 or pAG832, prepared and purified as indicated above, by giving 2 intradermal injections into the flanks.
  • the control consists of a group of guinea pigs immunized with live BCG under the conditions described in Example 1 or in Example 2.
  • the delayed-type hypersensitivity reactions are measured with respect to the native Apa protein or to the recombinant Apa protein produced in a transformed strain of Escherichia coli , which proteins are purified according to the protocol described in Horn et al., mentioned above.
  • the native Apa and the recombinant Apa are injected intradermally at the dose of 0.2 ⁇ g in 100 ⁇ l of titration buffer (buffer D).
  • the antigenic activity is measured as described in Example 2.
  • glycosylated synthons i.e. threonines functionalized with two or three mannose residues
  • the commercial peracetylated mannose 1 i.e. 1,2,3,4,5-penta-O-acetyl- ⁇ -D-mannopyranose
  • the activated intermediate 2 is cyclized to the orthoester 3 in a 2,6-dimethylpyridine/methanol mixture.
  • the regioselective opening of the orthoester by acid hydrolysis at 0° C. in a 10% aqueous trifluoroacetic acid/acetonitrile mixture produces 1,3,4,6-tetra-O-acetyl- ⁇ -D-mannopyranose (5).
  • the regioisomer 4 is also isolated.
  • the commercial mannose 6 is perbenzoylated to 7 by the action of benzoyl chloride in pyridine.
  • the latter is activated to 8 by the action of hydrogen bromide in acetic acid.
  • activation methods other than by the action of hydrogen bromide may, however, be used, such as they are known to those skilled in the art.
  • the preparation of the compounds 10 and 12 is described by A. JANSSON et al. in J. Chem. Soc. Perkin Trans. 1, 1992, 1699-1707 and by H. FRANZYK et al. (ibid), respectively.
  • the compounds 2 and 5 are condensed in the presence of silver trifluoromethanesulphonate (or any other condensation reaction promoter) in dichloromethane so as to produce the peracetylated disaccharide 9, which is then activated to the brominated precursor 10 by the action of hydrogen bromide in acetic acid.
  • the compounds 5 and 8 are condensed to give the compound 11, itself activated to 12.
  • the activated disaccharide 12 is condensed onto the monosaccharide acceptor 5, in the presence of silver trifluoromethanesulphonate in dichloromethane, so as to produce the peracetylated trisaccharide 17, which is then activated to the brominated precursor 18 by the action of hydrogen bromide in acetic acid.
  • the preparation of the synthons 15 and 16 is described by A. JANSSON et al. (ibid) and by H. FRANZYK et al. (ibid), respectively.
  • the condensation of the compound 14 with the activated trisaccharide 18 produces the synthon 19.
  • the peptides are synthesized in solid phase using Fmoc chemistry.
  • the peptide synthesis is performed on an automatic synthesizer, using the amino acids required for producing the desired sequences, while incorporating the glycosylated synthons, which are in the form of activated esters of pentafluorophenol (synthons 15, 16 and 19).
  • the peptides are purified by reverse-phase High Performance Liquid Chromatography (HPLC). Their structure is controlled using techniques known to those skilled in the art, such as mass spectrometry and amino acid analysis.
  • HPLC High Performance Liquid Chromatography
  • amide functions in the C-terminal position of the peptides SEQ ID NO:1 and SEQ ID NO:3, and acetate functions (in the N-terminal position of the peptides SEQ ID NO:2 and SEQ ID NO:3) are then introduced by chemical synthesis, using organic chemistry techniques known to those skilled in the art.
  • a peptide corresponding to positions 250 to 280 of Apa was produced in E. coli , in the form of a fusion with a fragment of Bordetella pertussis cyclase, according to the conventional techniques of cloning, expression and purification of recombinant proteins in E. coli which are well known to those skilled in the art (cf. for example, the protocols described in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and Son Inc, Library of Congress, USA).
  • the delayed hypersensitivity reactions of the guinea pigs immunized either with the Apa fusion peptide or with the live BCG were measured with respect to the native Apa protein, to the recombinant Apa protein produced in E. coli and to the deglycosylated Apa protein.
  • the results expressed by the diameter of the erythema reaction (mm) are given in table I below:
  • the delayed hypersensitivity reactions observed in the guinea pigs immunized with live BCG are considerable after injection of native Apa molecules.
  • the reactions are very weak or absent after injection of the chemically deglycosylated molecules or of the molecules produced in E. coli .
  • the sensitizations are identical with respect to the native or deglycosylated molecules.
  • All the monoclonal antibodies are from BECKMAN COULTER: CD45/CD4/CD8/CD3 (# 6607013); CD8-PC5 (# 6607011); CD4-ECD (# 6604727); CD25-RD1 (# 6604422); CD45RO-PE (# IM1307); CD45RA-ECD (# IM2711); TCR PAN-PC5 ⁇ (# IM2661); TCR PAN-PC5 ⁇ (#IM2662); CD3-PE (IM 1282); Flow Count (# 7547053); Immunoprep (# 7546999).
  • Peripheral blood mononuclear cells were isolated by Ficoll gradient centrifugation, according to standard protocols. Mononuclear cells numeration, and T lymphocytes, T CD4+ and T CD8+ percentages determination, were determined by flow cytometry, using a panel of antibody, directed to the following cell surface antigens: CD45, CD4, CD8 and CD3.
  • the isolated mononuclear cells were cultured for six days in RPMI (GIBCO) supplemented with 20% AB serum (VALBIOTECH), at 37° C., in a 9% CO 2 incubator, in the presence or in the absence of one of the following antigen preparations:
  • CD3-PE/CD4-ECD/CD8-PC5 CD45-RA-ECD/CD45-RO-PE/TCR ⁇ b-PC5
  • CD25-PE/TCR6-PC5 CD25-PE/TCR6-PC5 and fixed with PBS-2% paraformaldehyde.
  • CD4+ T lymphocytes proliferation was evaluated by measuring the loss of the CFSE fluorescence by flow cytometry.
  • the culture supernatant was harvested and the cytokines (IFN- ⁇ , IL-2, IL-4, IL-5, IL-10, IL-12 and IL-15) were assayed by ELISA using commercial kits.
  • cytokines IFN- ⁇ , IL-2, IL-4, IL-5, IL-10, IL-12 and IL-15
  • Stimulation with PPD does not allow to differentiate the response from the vaccinated and the tuberculosis patients.
  • the native Apa antigen stimulates more frequently the response from the patients as compared with the vaccinate controls (8 positive/18 patients); this difference between the groups is lost with the deglycosylated antigen.
  • glycosylated Apa peptide stimulates the CD4+ T lymphocytes from the majority of patients (13/18) and does not stimulate the CD4+ lymphocytes from the controls.
  • the glycopeptide is useful for diagnosing active tuberculosis or primo-infections with M. tuberculosis , in a T CD4+ proliferation assay or in a cytokine production assay.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
US10/953,095 2004-09-30 2004-09-30 Immunogenic glycopeptides, screening, preparation and uses Expired - Fee Related US7820142B2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
US10/953,095 US7820142B2 (en) 2004-09-30 2004-09-30 Immunogenic glycopeptides, screening, preparation and uses
ES05804673T ES2321322T3 (es) 2004-09-30 2005-09-29 Glicopetidos inmunogenicos para el diagnostico de infecciones por microorganismos patogenos.
CA002582833A CA2582833A1 (fr) 2004-09-30 2005-09-29 Glycopetides immunogenes pour le diagnostic d'infections par des micro-organismes pathogenes
PCT/IB2005/003303 WO2006035317A2 (fr) 2004-09-30 2005-09-29 Glycopetides immunogenes pour le diagnostic d'infections par des micro-organismes pathogenes
AU2005288678A AU2005288678A1 (en) 2004-09-30 2005-09-29 Immunogenic glycopeptides for diagnosing pathogenic microorganisms infections
EP05804673A EP1810033B1 (fr) 2004-09-30 2005-09-29 Glycopetides immunogenes pour le diagnostic d'infections par des micro-organismes pathogenes
DE602005012530T DE602005012530D1 (de) 2004-09-30 2005-09-29 Immunogene glykopeptide zur diagnose von infektionen pathogener mikroorganismen
AT05804673T ATE421695T1 (de) 2004-09-30 2005-09-29 Immunogene glykopeptide zur diagnose von infektionen pathogener mikroorganismen
US11/576,203 US20080293620A1 (en) 2004-09-30 2005-09-29 Immunogenic Glycopeptides for Diagnosing Pathogenic Microorganisms Infections
HK08100063.4A HK1106027A1 (en) 2004-09-30 2008-01-03 Immunogenic glycopeptides for diagnosing pathogenic microorganisms infections

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US10/953,095 US7820142B2 (en) 2004-09-30 2004-09-30 Immunogenic glycopeptides, screening, preparation and uses

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/576,203 Continuation-In-Part US20080293620A1 (en) 2004-09-30 2005-09-29 Immunogenic Glycopeptides for Diagnosing Pathogenic Microorganisms Infections

Publications (2)

Publication Number Publication Date
US20060067888A1 US20060067888A1 (en) 2006-03-30
US7820142B2 true US7820142B2 (en) 2010-10-26

Family

ID=35759307

Family Applications (1)

Application Number Title Priority Date Filing Date
US10/953,095 Expired - Fee Related US7820142B2 (en) 2004-09-30 2004-09-30 Immunogenic glycopeptides, screening, preparation and uses

Country Status (9)

Country Link
US (1) US7820142B2 (fr)
EP (1) EP1810033B1 (fr)
AT (1) ATE421695T1 (fr)
AU (1) AU2005288678A1 (fr)
CA (1) CA2582833A1 (fr)
DE (1) DE602005012530D1 (fr)
ES (1) ES2321322T3 (fr)
HK (1) HK1106027A1 (fr)
WO (1) WO2006035317A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110201044A1 (en) * 1998-11-04 2011-08-18 Isis Innovation Limited Tuberculosis diagnostic test

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2818647B1 (fr) * 2000-12-21 2006-09-29 Pasteur Institut Glycopeptides immunogenes, criblage, preparation et applications
WO2005044861A1 (fr) * 2003-10-31 2005-05-19 Wyeth Holdings Corporation Polysaccharides de helicobacter pylori
US20080293620A1 (en) * 2004-09-30 2008-11-27 Institut Pasteur Immunogenic Glycopeptides for Diagnosing Pathogenic Microorganisms Infections
CN108165560B (zh) * 2017-12-01 2021-06-08 北京蛋白质组研究中心 结核分枝杆菌H37Rv编码基因及其应用
CN108165562B (zh) * 2017-12-01 2021-06-08 北京蛋白质组研究中心 结核分枝杆菌H37Rv编码基因及其应用
CN108165561B (zh) * 2017-12-01 2021-06-18 北京蛋白质组研究中心 结核分枝杆菌H37Rv编码基因及其应用
CN110408632B (zh) * 2018-04-28 2021-01-19 北京蛋白质组研究中心 结核分枝杆菌H37Rv编码基因及其应用
CN110408629B (zh) * 2018-04-28 2020-11-20 北京蛋白质组研究中心 结核分枝杆菌H37Rv编码基因及其应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996023885A1 (fr) 1995-02-01 1996-08-08 Institut Pasteur Proteines de mycobacteries, microorganismes les produisant et leurs utilisations vaccinales et pour la detection de la tuberculose
WO1998016646A2 (fr) 1996-10-11 1998-04-23 Corixa Corporation Composes et methodes utilises pour l'immunotherapie et le diagnostic de la tuberculose
WO1998029132A1 (fr) 1996-12-31 1998-07-09 New York University Depistage precoce des maladies mycobacteriennes
US7361348B2 (en) * 2000-12-21 2008-04-22 Institut Pasteur Immunogenic glycopeptides, screening, preparation and uses

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996023885A1 (fr) 1995-02-01 1996-08-08 Institut Pasteur Proteines de mycobacteries, microorganismes les produisant et leurs utilisations vaccinales et pour la detection de la tuberculose
WO1998016646A2 (fr) 1996-10-11 1998-04-23 Corixa Corporation Composes et methodes utilises pour l'immunotherapie et le diagnostic de la tuberculose
WO1998029132A1 (fr) 1996-12-31 1998-07-09 New York University Depistage precoce des maladies mycobacteriennes
US7361348B2 (en) * 2000-12-21 2008-04-22 Institut Pasteur Immunogenic glycopeptides, screening, preparation and uses

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Felix Romain, et al., "Deglycosylation of the 45/47-Kilodalton Antigen Complex of Mycobacterium tuberculosis Decreases Its Capacity to Elicit in Vivo or in Vitro Cellular Immune Responses", Infection and Immunity, Nov. 1999, pp. 5567-5572, vol. 67, No. 11.
Henrikl Franzyk, et al., "Synthesis of aliphatic O-dimannosyl amino acid building blocks for solid-phase assembly of glycopeptide libraries", J. Chem. Soc. Perkin Trans.1, (1995), pp. 2883-2898.
Karen M. Dobos, et al., "Definition of the Full Extent of Glycosylation of the 45-Kilodalton Glycoprotein of Mycobacterium tuberculosis" Journal of Bacteriology, May 1996, pp. 2498-2506.
U.S. Appl. No. 11/576,203, filed Mar. 28, 2007, Marchal et al.
U.S. Appl. No. 12/034,926, filed Feb. 21, 2008, Marchal, et al.

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110201044A1 (en) * 1998-11-04 2011-08-18 Isis Innovation Limited Tuberculosis diagnostic test
US8216795B2 (en) * 1998-11-04 2012-07-10 Isis Innovation Limited Tuberculosis diagnostic test

Also Published As

Publication number Publication date
EP1810033B1 (fr) 2009-01-21
AU2005288678A1 (en) 2006-04-06
WO2006035317A2 (fr) 2006-04-06
US20060067888A1 (en) 2006-03-30
EP1810033A2 (fr) 2007-07-25
WO2006035317A3 (fr) 2006-08-17
ATE421695T1 (de) 2009-02-15
DE602005012530D1 (de) 2009-03-12
CA2582833A1 (fr) 2006-04-26
HK1106027A1 (en) 2008-02-29
ES2321322T3 (es) 2009-06-04

Similar Documents

Publication Publication Date Title
JP6637921B2 (ja) 結核菌感染の診断及び防止のためのマイコバクテリウム・ツベルクローシス由来のアミノ酸配列又はその対応する核酸の使用、並びにそれらに由来する診断キット及びワクチン
US9040233B2 (en) Methods for detecting a Mycobacterium tuberculosis infection
AU2005288678A1 (en) Immunogenic glycopeptides for diagnosing pathogenic microorganisms infections
US6410720B1 (en) Compounds and methods for treatment and diagnosis of mycobacterial infections
US7579141B2 (en) Proteins expressed by Mycobacterium tuberculosis and not by BCG and their use as diagnostic reagents and vaccines
DK2417456T3 (en) DIAGNOSTIC TEST Mycobacterium tuberculosis
EP1144447B1 (fr) Test de diagnostic de la tuberculose
US7658929B2 (en) Immunogenic glycopeptides, screening, preparation and uses
WO2008135067A1 (fr) Procédé de diagnostic de la tuberculose
KR102305770B1 (ko) 결핵의 개선된 생체내 또는 시험관내 세포-매개 면역학적 진단을 위한 진단 시약
US20080293620A1 (en) Immunogenic Glycopeptides for Diagnosing Pathogenic Microorganisms Infections
JP2011102299A5 (fr)

Legal Events

Date Code Title Description
AS Assignment

Owner name: INSTITUT PASTEUR, FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MARCHAL, GILLES;ROMAIN, FELIX;PESCHER, PASCALE;AND OTHERS;SIGNING DATES FROM 20050222 TO 20050228;REEL/FRAME:016458/0313

Owner name: INSTITUT PASTEUR, FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MARCHAL, GILLES;ROMAIN, FELIX;PESCHER, PASCALE;AND OTHERS;REEL/FRAME:016458/0313;SIGNING DATES FROM 20050222 TO 20050228

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20141026