US20230279397A1 - Compositions and methods comprising engineered short nuclear rna (snrna) - Google Patents
Compositions and methods comprising engineered short nuclear rna (snrna) Download PDFInfo
- Publication number
- US20230279397A1 US20230279397A1 US18/179,110 US202318179110A US2023279397A1 US 20230279397 A1 US20230279397 A1 US 20230279397A1 US 202318179110 A US202318179110 A US 202318179110A US 2023279397 A1 US2023279397 A1 US 2023279397A1
- Authority
- US
- United States
- Prior art keywords
- seq
- sequence
- rna
- targeting
- esnrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- the disclosure is directed to molecular biology, gene therapy, and compositions and methods for modifying expression and activity of RNA molecules.
- snRNA Small nuclear RNA
- snRNAs are functional non-coding RNAs. Eucaryotic genomes code for a variety of non-coding RNA such as snRNA, a class of highly abundant RNA, localized in the nucleus with important functions in intron splicing and RNA processing. snRNA, in the pre-mRNA splicing process, are capable of forming ribonucleoprotein particles (snRNPs) along with other proteins. These snRNPs and additional proteins form a large particulate complex (spliceosome) bound to the unspliced pre-mRNA transcripts.
- snRNA small nuclear RNA
- snRNAs function in nuclear maturation of nascent transcripts, gene expression regulation, as a splice donor in non-canonical systems, and in 3′ end processing of replication-dependent histone mRNAs.
- U7 snRNA can be programmed to bind and modulate mRNA without exogenous protein expression but there still exists a need to develop a highly specific mRNA-targeting therapeutic that minimizes immunogenic risk.
- the small size of these programmed snRNAs creates an opportunity to develop single vector, highly specific (allele-specific), single target and multi-targeting gene therapy approaches.
- compositions and methods comprising a new therapeutic RNA-targeting platform comprised of engineered snRNAs.
- the disclosure provides gene therapy compositions comprising a new therapeutic RNA-targeting platform comprised of engineered snRNA (esnRNA) comprising an engineered snRNA stem loop (eSL).
- esnRNA engineered snRNA
- eSL engineered snRNA stem loop
- compositions comprising nucleic acid molecules, and vectors comprising the engineered snRNA (esnRNA).
- esnRNA engineered snRNA
- RNA-targeting nucleic acid molecule comprising an engineered snRNA (esnRNA) system, wherein the esnRNA system comprises an engineered stem loop (eSL).
- esnRNA engineered snRNA
- eSL engineered stem loop
- the esnRNA comprises a 5′ interaction stabilizer domain (5′ISD).
- 5′ISD 5′ interaction stabilizer domain
- the esnRNA comprises a targeting sequence (TS) (or spacer) that targets an RNA of interest.
- the target RNA of interest is a microsatellite repeat RNA or a non-repeat RNA.
- the microsatellite repeat RNA of interest is selected from the group consisting of CUG, CAG, GGGGCC, and CCCCGG.
- the esnRNA comprises a targeting sequence (TS) that targets two target RNAs of interest which are GGGGCC and CCCCGG.
- the two target RNAs of interest are a microsatellite repeat RNA and a non-repeat RNA.
- the non-repeat RNA is a flanking sequence to the microsatellite repeat RNA.
- the esnRNA comprises a targeting sequence (TS) that targets two or more RNAs of interest.
- the esnRNA comprises two or more targeting sequence (TS) that targets two or more RNAs of interest.
- the esnRNA comprises a fusion of the two or more TSs.
- the esnRNA comprises an Sm binding domain (SmBD).
- SmBD is selected from the group consisting of U1, U2, U4, and U5 snRNAs.
- the SmBD is derived from a pseudo snRNA.
- the esnRNA is operably linked to an snRNA promoter.
- the snRNA promoter is a U7 promoter.
- the U7 promoter is an endogenous U7 promoter.
- the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7).
- the U7 promoter is an endogenous human U7 promoter of SEQ ID NO: 43.
- the snRNA promoter is a U1 promoter.
- the U1 promoter is a human U1 promoter or a mouse U1 promoter.
- the snRNA promoter is selected from the group consisting of: a human U7 promoter, a human U1 promoter, a human U2 promoter, a human U4 promoter, a human U5 promoter, a human U6 promoter, a human 7sk promoter, a tRNA(Val) promoter, a mouse U1 promoter, and a mouse U7 promoter.
- the vector comprises one or more esnRNAs, or one or more copies of the esnRNA driven by one or more snRNA promoters. In one embodiment, the vector comprises two copies (2 ⁇ ) of the esnRNA.
- the vector comprises two snRNA promoters, wherein each promoter drives a copy of the 2 ⁇ esnRNA.
- the two snRNA promoters are the U7 promoter and the U1 promoter.
- the two snRNA promoters are selected from the group consisting of: a human U7 promoter, a human U1 promoter, a human U2 promoter, a human U4 promoter, a human U5 promoter, a human U6 promoter, a human 7sk promoter, a tRNA(Val) promoter, a mouse U1 promoter, a mouse U2 promoter, a mouse U5 promoter, a mouse U6 promoter, a mouse U7 promoter, and a mouse H1 promoter.
- the two snRNA promoters are a mouse U7 promoter and a mouse U1 promoter.
- the esnRNA is operably linked to an snRNA downstream terminator (DT).
- the snRNA DT is a U7 DT.
- the esnRNA comprises the eSL, the U7 promoter, the TS, the SmBD, the 5′ISD, and the DT. In another embodiment, the esnRNA comprises the eSL, the U7 promoter, the U1 promoter, the TS, the SmBD, the 5′ISD, and the DT.
- the esnRNA comprises the eSL, the U7 promoter, the TS, the SmBD, the 5′ISD, and the DT. In another embodiment, the esnRNA comprises the eSL, the U7 promoter, the U1 promoter, the TS, the SmBD, the 5′ISD, and the DT.
- a vector comprising the esnRNA.
- the vector comprises multiple copies of the esnRNA.
- the multiple copies of the esnRNA is 2, 3, or 4 copies (2 ⁇ , 3 ⁇ , or 4 ⁇ ) of the esnRNA.
- the multiple copies of the esnRNA is 4 or more copies (4 ⁇ or more) of the esnRNA.
- each esnRNA of the multiple copies of esnRNA is separated by a nucleic acid buffer sequence derived from human non-coding genomic sequences downstream of an snRNA.
- the buffer sequence is derived from human genomic sequences downstream of U7.
- the buffer sequence is selected from the group consisting of: buffer 1 (30 bp, 100 bp, or 500 bp), buffer 2 (30 bp, 100 bp, or 500 bp), buffer 3 (30 bp, 100 bp, or 500 bp), and a combination thereof.
- the vector is a viral vector or a non-viral vector.
- the viral vector is an AAV vector.
- the AAV vector is an scAAV vector or a ssAAV vector.
- the AAV vector is an AAV9 vector.
- the AAV9 vector is an ssAAV9 vector or an scAAV9 vector.
- Also disclosed herein is a method of targeting one or more target RNAs of interest and blocking, knocking down, editing, exon-skipping, exon inclusion or splicing the one or more target RNAs, comprising contacting an esnRNA of the disclosure with a cell comprising the one or more target RNAs.
- the disclosure provides aa RNA-targeting nucleic acid molecule comprising an engineered snRNA esnRNA, wherein the esnRNA system comprises an engineered stem loop (eSL) comprising one or more nucleic acid sequences selected from SEQ ID NO: 1-SEQ ID NO: 11, SEQ ID NO: 146-SEQ ID NO: 148, SEQ ID NO: 163, or SEQ ID NO: 186-205.
- eSL engineered stem loop
- the esnRNA comprises a targeting sequence (TS) that targets a target RNA of interest.
- TS targeting sequence
- the target RNA is a pre-mRNA or mRNA sequence.
- the target RNA of interest is a microsatellite repeat RNA.
- the microsatellite repeat RNA is selected from the group consisting of CUG, CAG, and GGGGCC+CCCCGG.
- the target RNA is a sequence encoding DMD.
- the targeting sequence is selected from SEQ ID NO: 206 or SEQ ID NO: 207.
- the targeting sequence comprises one or more nucleic acid sequences set forth in SEQ ID NO: 208-SEQ ID NO: 227.
- the esnRNA comprises two targeting sequences that target two RNAs of interest.
- the two TSs are a fusion sequence.
- the esnRNA comprises an Sm binding domain (SmBD) selected from the group consisting of a U1, U2, U4, and U5 SmBD.
- SmBD Sm binding domain
- the SmBD comprises a nucleic acid sequence set forth in any one of SEQ ID NO: 31-SEQ ID NO: 38, or SEQ ID NO: 164.
- the esnRNA comprises a 5′ interaction stabilizer domain (5′ISD) comprising a nucleotide sequence selected any one of SEQ ID NO: 12-SEQ ID NO: 23.
- 5′ISD 5′ interaction stabilizer domain
- the esnRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NO: 65-SEQ ID NO: 119 or SEQ ID NO: 179-SEQ ID NO: 185.
- the disclosure provides a vector comprising one or more esnRNA of the disclosure.
- the viral vector is an AAV vector.
- the esnRNA is operably linked to a promoter.
- the esnRNA is operably linked to a U7 promoter or a U1 promoter.
- the esnRNA is operably linked to a downstream terminator (DT). In some embodiments, the esnRNA is operably linked to a U7 downstream terminator or a U1 downstream terminator.
- the vector comprises at least one, at least two, at least three, at least four, or at least five esnRNA. In some embodiments, the least one, at least two, at least three, at least four, or at least five esnRNA each target the same target RNA sequences.
- each esnRNA is separated by a buffer sequence.
- the buffer sequence comprises a nucleic acid sequence set forth in any one SEQ ID NO: 24-SEQ ID NO: 30.
- the vector comprises a nucleic acid sequence set forth in any one of SEQ ID NO: 123-SEQ ID NO: 143, SEQ ID NO: 168-SEQ ID NO: 178, or SEQ ID NO: 231-SEQ ID NO: 233.
- a DMD exon 51 RNA-targeting nucleic acid molecule comprising a spacer sequence set forth in any one of SEQ ID NO: 206-SEQ ID NO: 230.
- the disclosure provides a method of treating a disease or disorder in a subject comprising administering an RNA-targeting nucleic acid molecule of the disclosure or an AAV vector of the disclosure.
- the disease or disorder is associated with a toxic repeat RNA sequence.
- the toxic repeat RNA sequence is a CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeat.
- the disease or disorder is myotonic dystrophy (DM1) or Huntington's disease (HD).
- DM1 myotonic dystrophy
- HD Huntington's disease
- the disease or disorder is Duchenne Muscular Dystrophy.
- the RNA-targeting nucleic acid molecule or AAV vector targets an RNA sequence encoding dystrophin (DMD).
- DMD RNA sequence encoding dystrophin
- the RNA sequence encoding DMD comprises an intronic or exonic sequence.
- the exonic sequence comprises exon 51, or a flanking region thereof, of DMD.
- the administration is administration is intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and/or parenteral administration.
- FIG. 1 A-D shows a tape station image of PCR products which increase in abundance for the engineered SL indicating increased stability of an esnRNA disclosed herein. Predicted PCR product size is shown below the image.
- FIG. 1 B illustrates a schematic of the engineered snRNA (esnRNA) comprising the engineered stem loop (eSL) disclosed herein alongside non-engineered stem loops.
- FIG. 1 C shows alternative mechanisms to protect the 5′ end of the snRNA which forego the use of an interaction stabilizer domain (ISD).
- FIG. 1 D shows the approximate size of an snRNA cassette.
- FIG. 2 A-C shows FISH quantification and images of CUG RNA Foci of an esnRNA targeting CUG disclosed herein compared to NT (non-targeting) esnRNA.
- Y axis depicts percentage average foci per cell normalized to NT, and x axis depicts treatment.
- Cell nuclei was stained with DAPI and CUG RNA foci labeled with a specific labeled probe.
- FIG. 2 C shows a schematic of the esnRNA MOA targeting and blocking CUG repeat expansions releasing MBLN and restoring splicing defects characteristic in DM1 disease.
- FIG. 3 A-C shows qPCR results of a dose-dependent knockdown of CAG80 reporter mRNA to baseline levels.
- Y axis depicts CAG repeat RNA expression levels relative to reference gene GAPDH
- x axis depicts snRNA treatment CAG targeting (CUG15) or non-targeting (nt) (using different doses 250 ng, 500 ng or 1000 ng).
- FIG. 3 B shows a Western blot for CAG80 reporter poly-Q protein expression. Top lanes show CAG reporter poly-Q expression and bottom lane GAPDH loading control.
- FIG. 3 C shows CAG repeat expansions in mutant HTT in Huntington's disease and the esnRNA MOA blocking the CAG repeats.
- FIG. 4 A-D shows a tape station image of the PCR product to detect USH2A exon 13 inclusion (top band) or exclusion (bottom band) after treatment with esnRNA.
- FIG. 4 C shows the quantification of percentage of exon 13 exclusion after esnRNA treatment compared to NT esnRNA control (shown in A).
- FIG. 4 B shows a schematic of the engineered snRNA comprising the eSL compared to the non-engineered snRNAs.
- FIG. 4 D shows a schematic of splicing modulation in Usher's Syndrome and DMD (Duchenne Muscular Dystrophy).
- FIG. 5 A-F shows PCR results for restoration of splicing isoforms for BIN1, DMD and LBD3 (mispliced in DM1 patient cells) after treatment with esnRNAs to target CUG repeats in DM1 patient derived myotubes.
- Figures A-C show quantitation of the percentage restoration to the healthy splice isoform from the tape station images shown in Figures D-F.
- Y axis depicts percentage of correction
- x axis depicts treatment (knt, refers to non-targeting negative control; CAGx15 refers to CUG targeting esnRNA; unt refers to untreated).
- FIG. 6 A- 6 B shows quantification of efficacy of esnRNA with alternative 5′ interaction stabilizing domain (ISD) in knocking down CUG RNA foci, synthetic snRNA transfection in CTG480 HeLa cells followed by fluorescent in-situ hybridization for CUG RNA foci.
- ISD 5′ interaction stabilizing domain
- FIG. 7 A- 7 B shows that different ISDs lead to varying levels of stability over time.
- FIGS. 7 A and B show the relative abundance over time of synthetic engineered snRNAs with alternative 5′ stabilizing domains. RNA was collected at 24 hr, 48 hr, and 72 hr time points after transfection of synthetic snRNAs with varying stabilizing domains to determine the relative stability of the snRNA.
- FIG. 8 shows levels of snRNA expression by qPCR in CTG480 HeLa cells when snRNAs are expressed under distinct PolIII and PoIII promoters.
- Y axis depicts snRNA expression levels relative to GAPDH reference gene
- x axis depicts the different snRNAs promoters used to express snRNAs (Pol II U1 and U7 promoters or PolIII: U6, tRNA and 7SK). Plasmids with varying promoters were transfected at two different doses (250 and 500 ng).
- FIG. 9 A- 9 B shows quantification of CUG foci by RNA FISH in CTG480 HeLa cells after transfection of 500 ng (A) or 250 ng (B) engineered snRNA constructs with varying Pol III and Pol II promoters and respective DT sequences.
- Constructs with Pol II promoters (P02225 and P03557) driving expression of engineered snRNAs are more effective at depleting microsatellite repeat-containing foci than constructs with Pol III promoters driving snRNAs.
- Gray bars represent NT esnRNA and blue bars represent CUG targeting esnRNAs.
- FIG. 10 shows levels of snRNA expression by qPCR in HEK293T cells when snRNAs are expressed under PolIII (U6, tRNA and 7SK) or PolII promoters (U7 and U1) and contain the SmOpt or the U1 Sm binging sites.
- FIG. 11 A- 11 B shows levels of snRNA expression relative to GAPDH reference gene after transfection into HEK293 cells.
- Primers specific for each snRNA (z) were used for qPCR to determine relative promoter strength.
- Y axis depicts snRNA expression levels relative to GAPDH and
- x axis depicts the snRNA spacer znt (non-targeting control, in A) and z38 (targeting spacer, B) when they are expressed under snRNA distinct promoters (U1, U2, U4, U5 and U7; unt refers to untreated).
- Primer sets specific to z-nt (FIG A) or z-38 (FIG B) were used.
- FIG. 12 A- 12 B shows results for exon 51 skipping after transduction of human delta exon 52 myotubes with snRNA disclosed herein (A03980: 2 ⁇ z38/42 fusion snRNA cassettes; A03981: 2 snRNA cassettes, one with z42 TS and the other with z38 TS).
- FIG. 12 A shows a tape station image of PCR products representing the exon 51 included and excluded isoforms and a schematic showing expected fragment sizes.
- FIG. 12 B shows the quantification of the band intensities in FIG. 12 A semi-quantitative PCR.
- Y axis depicts percentage of exon 51 skipping and x axis the treatment (either synthetic snRNA or AAV transduced for A03980 of A03981 with different MOIs).
- FIG. 13 A- 13 B shows dystrophin staining and restoration of human delta exon 52 myotubes after treatment with snRNAs for exon 51 skipping.
- FIG. 13 A shows immunofluorescence for desmin or dystrophin in untreated myotubes, myotubes treated with synthetic snRNAs or myotubes treated with MOI of 1e6 or 5e6 of A03980 (2 ⁇ z38/z42 fusion snRNA cassettes).
- FIG. 13 B shows immunofluorescence for desmin or dystrophin in myotubes transduced with MOI of 1e6 or 5e6 of A03981 (2 snRNA cassettes with z42 TS and z38 TS).
- FIG. 14 A illustrates the vector genome of A04569, which expresses 2 fusion snRNAs of identical sequence, as depicted in FIG. 14 B .
- FIG. 14 C shows that exon 51 Exon Splicing Enhancer (ESE)-targeting fusion snRNAs can be constructed such z38-targeting sequence is in the 5′-most position in the antisense sequence with z42-targeting sequence downstream of the z38 sequence (z73) or in the opposite orientation with z42-targeting sequence in the 5′-most position and z38 downstream (z187).
- ESE Exon Splicing Enhancer
- FIG. 15 A-D show the activity of exon 51 ESE-targeting fusion snRNAs in human skeletal myotubes with exon 52 deleted and de152hDMD/mdx mice.
- A tape station image and quantification of exon 51 skipping in human skeletal myotubes with DMD exon 52 deleted 24 hours after transfection of a low dose of synthetic snRNAs carrying the fusion antisense sequences z73 (z38/z42) and z187 (z42/z38). At a low dose, transfection of synthetic snRNA z187 induces higher levels of exon 51 skipping than z73.
- FIG. 15 B shows quantification of exon 51 skipping in human skeletal myotubes with DMD exon 52 deleted after transduction with AAV9-A04526 (carrying two esnRNA cassettes each expressing z73) and A04569 (carrying two cassettes each expressing z187) for 7 days with MOIs of 2.5e4, 1e5 and 5e5.
- FIG. 15 C shows quantification of exon 51 skipping in the humanized exon 52-deleted DMD (de152hDMD/mdx) mouse model. Mice we injected retro-orbitally with 3e12 vector genomes of A04526 and A04569.
- FIG. 15 D shows the quantification of dystrophin positive fibers 4 weeks after intramuscular delivery of a 3e11 vg/muscle dose of A04526 or an ESE-targeting Vivo-Morpholino (ViM) to the Gastrocnemius of de152hDMD/mdx mice.
- hDMD/mdx mice (gray bar) which expresses wildtype human dystrophin serves as a positive control for dystrophin expression.
- U untreated.
- FIG. 16 A-D show splicing reversal of DMD and LBD3 splice isoforms and knockdown of DMPK after treatment with snRNA targeting CUG repeats in patient derived myotubes (containing 1700 CUG repeats).
- DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD Adenovirus vector (for 5 days). Then cells were transduced with multiple MOIs of A04233 and A04234 (scAAV9 dual snRNAs targeting CUG repeats) and harvested 7 days post-transduction.
- FIG. 16 A shows a tape station image of RT-PCR products using specific primers to detect DMD exon 78 inclusion (top band) and LBD3 exon 11 exclusion (bottom band) which are markers of splicing correction seem in normal WT cells.
- Quantification of DMD exon 78 inclusion FIG. 16 B
- LBD3 exon 11 exclusion FIG. 16 C
- the x-axis depicts the treatment (vector and MOI).
- the y-axis depicts the percentage of splice correction, either exon inclusion for DMD exon 78 or exclusion for LBD3 exon 11.
- 16 D shows levels of DMPK RNA expression by ddPCR after treatment with snRNAs (AAV9 A04233 and AAV9 A04234) with different MOIs.
- the x-axis depicts the treatment.
- the y-axis depicts DMPK copies per 1000 copies of GAPDH reference gene normalized to UNT (untreated cells).
- FIG. 17 A-B shows images and quantification of nuclear RNA foci from patient-derived myotubes transduced with different MOIs of AAV9 A04233 and AAV9 A04234.
- DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD Adenovirus vector (for 5 days). Then cells were transduced with multiple MOIs of A04233 and A04234 (scAAV9 dual snRNAs targeting CUG repeats) and harvested 7 days post-transduction for RNA FISH (to detect CUG Foci).
- FIG. 17 A shows images of CUG RNA foci obtained from untreated and treated myotubes with AAV9 snRNA vectors A04233 and A04234.
- FIG. 17 B shows quantification for the average number of CUG foci per cell.
- the x-axis depicts the treatment and MOI used.
- the y-axis depicts average of CUG foci per cell normalized to UNT (untreated cells).
- FIG. 18 A-C depicts the treatment, timeline and quantification of HTT mutant soluble protein after treatment with AAV-snRNA targeting CAG repeats.
- FIG. 18 A shows the experimental design for the vector used AAV-A04390 (2 ⁇ hU7/hU1 snRNA targeting CAG repeats), the 2 MOIs and the end point assay to detect mutant (mut) HTT soluble protein.
- FIG. 18 B depicts the timeline for this experiment.
- HD patient iPSc (containing 66 CAG repeats) were differentiated into cortical neurons for 2 weeks and then transduced with AAV-A04390 snRNA vector for an additional 2 weeks.
- cortical neurons were harvested and mutant soluble HTT protein quantified by Meso scale discovery immunoassay (MSD, shown in FIG. 18 C ).
- MSD Meso scale discovery immunoassay
- the y-axis depicts fmol of mutant soluble HTT per mg of protein lysate, and the x-axis the treatment and MOI.
- FIG. 19 A-B depicts the in vivo study design to target CAG repeats on R6/2 HD mouse model and quantification of mutant HTT soluble protein after treatment with AAV-snRNA targeting CAG repeats (A03081).
- FIG. 19 A diagram shows dosage (2e10 vector genomes) of AAVrh10-snRNA (4 ⁇ CAGx15 targeting snRNAs vector) administered by intrastriatal injection. Untreated or uninjected contralateral striatal side was used as a control.
- MSD Meso scale discovery immunoassay
- FIG. 20 A depicts the differences between the snRNAs expressed from A04527 and A04526 with A04526 expressing engineered snRNAs that have a 5′ISD and engineered mouse SL and A04527 which has no 5′ISD and a mouse native SL.
- FIG. 20 B shows a bar graph of the expression of z38/42 (in snRNA copies/nanogram) 2 days after transduction of CHO-Lec2 cells at an MOI of 1e6 for with AAV9-A04527 or A04526 virus.
- the disclosure provides gene therapy compositions comprising a new therapeutic RNA-targeting platform comprised of engineered snRNA (esnRNA) comprising an engineered snRNA stem loop (eSL).
- esnRNA engineered snRNA
- eSL engineered snRNA stem loop
- compositions comprising nucleic acid molecules, and vectors comprising the engineered snRNA (esnRNA).
- esnRNA engineered snRNA
- snRNAs small nuclear ribonucleic acids
- snRNPs small nuclear ribonucleoprotein complexes
- the spliceosome is responsible for precursor mRNA splicing; the process that removes introns from RNA transcripts before protein production.
- An individual snRNA is generally about 250 nucleotides or less in size.
- U1 snRNA is 164 nucleotides in length and is encoded by genes that occur in several copies within the human genome.
- U1 snRNA represents the ribonucleic component of the nuclear particle U1 snRNP.
- the U1 snRNA has a stem and loop tridimensional structure and within the 5′ region there is a single-stranded sequence, generally about 9 nucleotides in length, capable of binding by complementary base pairing to the splicing donor site on the pre-mRNA molecule.
- the various spliceosomal snRNAs have been designated as U1, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, U11 and U12, due to the generous amount of uridylic acid they contain.
- U1, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, U11 and U12 due to the generous amount of uridylic acid they contain.
- snRNA systems can be used for treating toxic mutations.
- antisense oligonucleotides that interfere with splice sites and regulatory elements within an exon containing toxic mutations can induce skipping of specific exons at the pre-RNA level.
- antisense sequences can be packaged in an snRNA sequence delivered using viral vectors carrying a nucleic acid sequence from which the snRNA can be transcribed.
- U7 snRNA is endogenously involved in histone pre-mRNA 3′-end processing, but can be converted into a versatile tool for splicing modulation by a small change in the binding site for Sm/Lsm proteins.
- U7 snRNP Most U-rich snRNPs are complexes that mediate the splicing of pre-mRNAs.
- U7 snRNP is an exception. U7 is not involved in splicing but rather is a key factor in the unique 3′-end processing of replication-dependent histone mRNAs. By modifying the U7 snRNA histone binding sequence and the Sm motif, U7 can no longer be involved in processing the histone pre-mRNA and instead targets pre-mRNAs or smRNA for blocking or splicing modulation. In this manner, U7 snRNA can be used as an effective gene therapy platform.
- a U7 snRNA platform also has the additional advantages of being a compact size, having the capability to accumulate in the nucleus without causing cellular toxicity, and possesses little to no immunoreactivity. (Gadgil et al., 2021, J Gene Med, 23(4): e3321.)
- a newly engineered and redesigned snRNA platform (or known herein as an esnRNA platform) comprising an 1) engineered stem loop (eSL).
- eSL engineered stem loop
- ISD snRNA interaction stabilization domain
- U7 snRNAs have been previously shown to be programmable to modulate mRNAs.
- programmed engineered snRNA improvements which are capable of being used as a gene therapy tool.
- these engineered snRNA systems are shown herein to lead to blocking microsatellite repeat expansions (shown herein for treating myotonic dystrophy (DM1) or Huntington's disease (HD)), exon skipping (for treating DMD) and splicing modulation (shown herein for treating USH2A (Usher Syndrome type 2).
- these snRNAs are human snRNAs.
- these snRNAs are mouse snRNAs.
- the snRNAs are a combination of human and mouse snRNAs.
- the U7 is a human U7 or a mouse U7.
- engineered snRNA comprises varying types of snRNAs (U1-U12, etc.) by combining domains of endogenous snRNAs to fine tune stabilization of the platform and/or to reduce off-target effects.
- the engineered snRNA system comprises a combination of human or mouse U7 and human or mouse U1 snRNA components.
- Additional elements that can tune the processing and abundance of the RNA can be further engineered into the esnRNAs comprising eSLs. See FIG. 1 C .
- additional elements that can tune the processing, stability, and abundance of the esnRNA can be further engineered into the esnRNAs at the 5′ or 3′ ends.
- such elements may include but are not limited to stem loops, hairpins, G-C clamps, kissing loops, triplexes, quadruplexes, and protein binding sites.
- esnRNA platform and portions thereof disclosed herein can be used in any therapeutic setting and context so long as a suitable spacer(s) (or TS(s)) is included in the design of the esnRNA therapeutic composition.
- a therapeutic esnRNA composition is used to treat a disease selected from the group consisting of Duchenne Muscular Dystrophy, DM1, and HD.
- the esnRNA composition is used to treat DMD caused by exon 51 mutations
- the engineered snRNA (esnRNA) system disclosed herein comprises an engineered stem loop (eSL) which includes compensatory modifications to a native snRNA stem loop. These modifications result in increased stability of the esnRNP compared to snRNP comprising an unmodified stem loop.
- An eSL disclosed herein can be derived from any snRNP such as U1-U12.
- the eSL is a human or mouse U7 eSL.
- the eSL is a human or mouse eSL.
- the eSL is a human and mouse eSL.
- the eSL is a non-human eSL selected from the group consisting of mouse, pig, sheep, goat, cow, dog, cat, horse, or a combination thereof. In some embodiments, the eSL is an eSL selected from the group consisting of human, mouse, pig, sheep, goat, cow, dog, cat, horse, or a combination thereof. In some embodiments, the eSL sequence is not a native stem loop sequence. In some embodiments, the nucleic acid sequence of the eSL is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) is not a native stem loop sequence.
- a human eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- a murine eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- a human or murine eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- a dog or cat eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- a cow, sheep, or goat eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- a pig eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- a horse eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- a sheep eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- engineered stem loops provide for enhanced stability of an snRNA relative to an snRNA comprising a native stem loop.
- a native snRNA stem loop comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences:
- the eSL disclosed herein possesses more effective folding and annealing properties with a 5′ interaction stability domain (5′ISD) and this in turn results in increased stability of the esnRNA compared to a non-engineered snRNA.
- the 5′ ISD has nucleotides that are complementary to the nucleotides within the engineered SL, and without wishing to be bound by theory, an interaction between the 5′ISD and eSL is predicted to form secondary structure that protects the 5′ end of an snRNA.
- the 5′ ISD anneals and/or hybridizes to an eSL of the disclosure.
- the 5′ISD is a sequence having complementarity and/or reverse complementarity to a sequence present in an eSL of the disclosure.
- a 5′ISD disclosed herein can be one of the 5′ISDs selected from the following nucleotide sequences:
- the esnRNA systems can be programmed to comprise a targeting sequence (TS) (also termed spacer).
- the targeting sequence is a 5′ targeting sequence (5′TS) (also termed spacer) that targets one or more RNAs of interest.
- 5′ is in reference to the snRNA insert's 5′ end and not necessarily to the overall vector configuration comprising the snRNA insert or inserts.
- the TS can be located in or near the 5′ end of the snRNA.
- the targeting sequence(s) (TS) can be located in or near a 3′ position in the snRNA construct, thereby generating a 3′ targeting sequence (3′ TS), particularly if the snRNA construct is not a U7-based snRNA.
- Targeting sequences of the disclosure can be between about 1 and about 200 nucleotides in length. In some aspects, targeting sequences of the disclosure are between about 10 and about 150 nucleotides in length. In some aspects, targeting sequences of the disclosure are between about 10 and about 100 nucleotides in length. In some aspects, targeting sequences of the disclosure are between about 20 and about 60 nucleotides in length. In some aspects, targeting sequences of the disclosure are at least about 10, 20, 30, 40, 50, 60, or about 70 nucleotides in length.
- U7 snRNA can be programmed by replacing the histone mRNA binding sequence with a sequence complementary to a target of interest.
- esnRNA systems of the disclosure bind a target mRNA or pre-mRNA sequence of interest.
- the exemplary esnRNA systems shown herein lead to blocking or knocking down microsatellite repeat expansions (for treating myotonic dystrophy (DM1) or Huntington's disease (HD), hexanucleotide repeat expansion (for treating C9/ALS), splicing modulation (for treating USH2A (Usher Syndrome type 2)), or targeting one or more exon splicing enhancers (ESE) to induce exon skipping (for treating DMD, e.g., DMD exon 51 skipping).
- the target RNA of interest is a microsatellite or hexanucleotide repeat RNA or a non-repeat RNA.
- the repeat RNA of interest is selected from the group consisting of CUG, CAG, GGGGCC, and CCCCGG.
- the esnRNA comprises a targeting sequence (TS) that targets two target RNAs of interest are GGGGCC and CCCCGG.
- the two target RNAs of interest are a microsatellite repeat RNA and a non-repeat RNA.
- the non-repeat RNA is a flanking sequence to the repeat RNA.
- esnRNA of the disclosure target a pre-mRNA or mRNA sequence encoding the DMD gene.
- DMD is a gene encoding the protein dystrophin. Mutations in DMD are associated with Duchene muscular dystrophy.
- the DMD RNA sequence targeted by esnRNA compositions of the disclosure is an exon 51 DMD RNA sequence.
- Target sequences that bind DMD can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of the following nucleotide sequences set forth in the table which follows:
- RNA Targeting Sequences SEQ ID UID Targeting Sequences NO: z38 TACCTCCAACATCAAGGAAGATGGCA 206 z42 GTAACCACAGGTTGTGTCACCAGAGTAACA 207 Fusion Sequences z70 catacCTTCTGCTTGATGATCATCTCGCACCAGAGTAACAGTCTGAGTAGGAGc 208 taaa z71 catacCTTCTGCTTGATGATCATCTCGTGCCGCTGCCCAATGCCATCCTGGAG 209 z72 catacCTTCTGCTTGATGATCATCTCGGCCCAATGCCATCCTGGAGTTCctg 210 z73 TACCTCCAACATCAAGGAAGATGGCAGTAACCACAGGTTGTGTCACCAGAG 211 (z38/z42) TAACA z74 AACATCAAGGAAGATGGCATTTCTAGGTAACCACAGGTTGTGTCACCAGAG 212 TAACA z75 AACATCAAGGAAGATGGCATTTCTAG
- TSs which are a fusion as in the above table can be a single TS sequence comprised within the fusion sequence.
- the targeting sequences that target two or more RNAs of interest.
- the TSs which target two or more RNAs of interest are different sequences which target the same pre-mRNA molecule.
- the spacers or TSs are a fusion sequence.
- the fusion sequence is a spacer targeting DMD exon 51, wherein the fusion sequence is set forth in the table above.
- CUG repeat targeting sequences comprise the nucleic acid sequence:
- CAG repeat targeting sequences comprise the nucleic acid sequence:
- the esnRNA systems disclosed herein utilize an Sm binding domain (SmBD).
- SmBD Sm binding domain
- the Sm protein ring that assembles around the Sm binding domain (SmBD) to form an snRNP includes SmB/B′, SmD1, SmD2, SmD3, SmE, SmF, and SmG.
- the U7 Sm binding site recruits endogenous RNA binding factors and can be replaced with a non-U7 snRNA to make the esnRNA more stable.
- the SmBD is selected from the group consisting of U1, U2, U4, and U5 snRNAs.
- the SmBD is derived from a pseudo snRNA.
- the SmBD is a nucleotide sequence comprising SEQ ID NO: 31 (ATTTTT).
- the SmBD comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 32 (AATTTTTGG), SEQ ID NO: 33 (AATTTGTGG), SEQ ID NO: 34 (AATTTGTGG), SEQ ID NO: 35 (AATTTCTGG), SEQ ID NO: 36 (GATTTTTGG), SEQ ID NO: 37 (AATTTTTGA), SEQ ID NO: 38 (AATTTTTTG), SEQ ID NO: 161 (AATTTTTGGAGCA), and SEQ ID NO: 163 (AATTTTTGGAGTA).
- the esnRNA systems disclosed herein comprise an snRNA promoter from any of U1-U12.
- the snRNA promoter is a U7 promoter.
- the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7).
- the U7 promoter is an endogenous human U7 promoter comprising SEQ ID NO: 39:
- the snRNA promoter is a U1 promoter.
- the U1 promoter is a human U1 promoter or a mouse U1 promoter.
- an snRNA promoter drives a copy of an snRNA insert.
- each copy of an snRNA insert is the same.
- different snRNA promoters drive each copy of an snRNA insert.
- a 2 ⁇ snRNA comprises a mouse U7 promoter driving one copy of an snRNA insert and a mouse U1 promoter drives the other copy of an snRNA insert.
- the snRNA promoter is a PolII promoter or a PolIII promoter.
- the snRNA promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to a promoter and/or promoter sequence listed in the Exemplary Promoter Table which follows:
- the esnRNA systems disclosed herein comprise an snRNA downstream terminator (DT). Downstream terminators define the end of a transcriptional unit, such as an esnRNA or snRNA.
- a transcriptional unit such as an esnRNA or snRNA.
- the snRNA DT is a U7 DT comprising:
- the esnRNA comprises the eSL, one or more promoters, the TS, the SmBD, the 5′ISD, and the DT.
- promoter and DT combinations are be mixed and matched.
- the DT is selected from the exemplary DTs and/or DT sequences listed in the Exemplary DT Table below:
- the esnRNA is delivered in an AAV vector.
- the AAV vector comprises multiple copies of the esnRNA. In some embodiments, the multiple copies of the esnRNA are 2, 3, or 4 copies (2 ⁇ , 3 ⁇ , or 4 ⁇ ) of the esnRNA. In some embodiments, the multiple copies of the esnRNA are 4 or more copies of the esnRNA.
- each esnRNA of the multiple copies of esnRNA is separated by a nucleic acid buffer sequence derived from human non-coding genomic sequences downstream of an snRNA.
- the buffer sequence is derived from human genomic sequences downstream of U7.
- the buffer sequence is selected from the group consisting of the following nucleic acid sequence:
- buffer 1 (30 bp) (SEQ ID NO: 24) CAAACTACAGAGCCAAGTGCTATCCACAGA buffer 2 (30 bp) (SEQ ID NO: 25) GAGCTTTCTGGGTTGCCATCTCAAGCAGAC, buffer 3 (30 bp) (SEQ ID NO: 26) TACAAGGCCATCAGCTCATACTCACAATTG, and a combination thereof.
- the buffer sequence is selected from the group consisting of the following nucleic acid sequence:
- buffer 1 (100 bp) (SEQ ID NO: 27) CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCAT CTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAG AG
- buffer 2 (100 bp) (SEQ ID NO: 28) TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAG TAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGC TC, and a combination thereof.
- the buffer sequence is selected from the group consisting of the following nucleic acid sequence:
- the 100 bp and 500 bp buffer 1 sequences are derived from a sequence starting 100 bp downstream of the Mus musculus U7 pseudogene 8 (Location Chromosome 14: 4,409,359-4,409,421 reverse strand. GRCm39:CM001007.3).
- the 100 bp and 500 bp buffer 2 sequences are derived from the sequence starting 130 bp downstream of human U7 pseudogene 5 (Chromosome X: 140,451,148-140,451,208 forward strand.
- Both 100 bp buffers are the first 100 bp of the corresponding 500 bp buffer.
- the 30 bp buffers 1, 2, and 3, are sequential 30 bp sequences within “100 bp buffer 1”, downstream of the Mus musculus U7 pseudogene 8. These downstream sequences were selected due to the lack of any known regulatory sites or genes within or nearby to the sequence (using Gencode/Ensembl), in addition to lack of repetitive sequence, 40-60% GC content for total buffer, 40-60% GC content in the 20 bp region at both ends of the buffer, and minimal sequence complexity.
- Exemplary esnRNA sequences of the disclosure can comprise any combination of esnRNA features described herein.
- the esnRNA comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to an esnRNA listed in the esnRNA Table which follows:
- operably linked is intended to mean that the hybrid promoter is linked to an NOI in a manner permitting expression of the nucleotide sequence in, for example, a host cell when the vector is introduced into (or in contact with) the host cell.
- a vector comprises the engineered snRNA.
- the therapeutic snRNA is in a single or unitary vector.
- the RNA-binding snRNA systems are capable of targeting toxic CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeats (or flanking sequences thereof) are in a single vector.
- the RNA-targeting systems are capable of targeting a non-repeat RNA of interest.
- the RNA-targeting systems are capable of targeting one or more sequences of DMD.
- the snRNA systems are capable of targeting multiple (i.e., two or more) RNAs of interest.
- the two or more RNAs of interest can be the same pre-mRNA molecule but different sequences within the pre-mRNA molecule.
- vector refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
- viral vector wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses).
- Viral vectors also include polynucleotides carried by a virus for transfection into a host cell.
- the vector is a lentivirus (such as an integration-deficient lentiviral vector) or adeno-associated viral (AAV) vector.
- Vectors are capable of autonomous replication in a host cell into which they are introduced such as e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors and other vectors such as, e.g., non-episomal mammalian vectors, are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
- vectors such as e.g., expression vectors
- Common expression vectors are often in the form of plasmids.
- recombinant expression vectors comprise a nucleic acid provided herein such as e.g., an esnRNA in a form suitable for expression of a protein in a host cell.
- Recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed.
- operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence such as e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell. Certain embodiments of a vector depend on factors such as the choice of the host cell to be transformed, and the level of expression desired.
- a vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein such as, e.g., snRNAs, CRISPR transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.
- a vector of the disclosure is a viral vector.
- the viral vector comprises a sequence isolated or derived from a retrovirus.
- the viral vector comprises a sequence isolated or derived from a lentivirus.
- the viral vector comprises a sequence isolated or derived from an adenovirus.
- the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
- AAV adeno-associated virus
- the viral vector is replication incompetent.
- the viral vector is isolated or recombinant.
- the viral vector is self-complementary.
- AAV vector refers to a vector comprising, consisting essentially of, or consisting of one or more nucleic acid molecules and one or more AAV inverted terminal repeat sequences (ITRs).
- the nucleic acid molecule encodes for an esnRNA of the disclosure.
- AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that provides the functionality of rep and cap gene products, for example, by transfection of the host cell.
- AAV vectors contain a promoter, at least one nucleic acid that may encode at least one protein or RNA, and/or an enhancer and/or a terminator within the flanking ITRs that is packaged into the infectious AAV particle.
- the encapsidated nucleic acid portion may be referred to as the AAV vector genome.
- Plasmids containing AAV vectors may also contain elements for manufacturing purposes, e.g., antibiotic resistance genes, origin of replication sequences etc., but these are not encapsidated and thus do not form part of the AAV particle.
- an AAV vector can comprise at least one nucleic acid encoding an esnRNA composition of the disclosure. In some aspects, an AAV vector can comprise at least one regulatory sequence. In some aspects, an AAV vector can comprise at least one AAV inverted terminal (ITR) sequence. In some aspects, an AAV vector can comprise a first ITR sequence and a second ITR sequence. In some aspects, an AAV vector can comprise at least one promoter sequence. In some aspects, an AAV vector can comprise at least one enhancer sequence. In some aspects, an AAV vector can comprise at least one terminator sequence. In some aspects, an AAV vector can comprise at least one polyA sequence. In some aspects, an AAV vector can comprise at least one linker sequence. In some aspects, an AAV vector can comprise at least one buffer sequence. In some aspects, an AAV vector of the disclosure can comprise at least one nuclear localization signal, or nuclear export signal and/or both.
- an AAV vector can comprise a first AAV ITR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence and a second AAV ITR sequence.
- an AAV vector can comprise, in the 5′ to 3′ direction, a first AAV ITR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence.
- an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, second esnRNA sequence, and a second AAV ITR sequence.
- an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, a third promoter sequence, a third esnRNA sequence, and a second AAV ITR sequence.
- an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, second esnRNA sequence, and a second AAV ITR sequence.
- an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, a third promoter sequence, a third esnRNA sequence, a fourth promoter sequence, a fourth esnRNA sequence, and a second AAV ITR sequence.
- Adeno-associated virus refers to a member of the class of viruses associated with this name and belonging to the genus Dependoparvovirus, family Parvoviridae.
- Adeno-associated virus is a single-stranded DNA virus that grows in cells in which certain functions are provided by a co-infecting helper virus.
- General information and reviews of AAV can be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York).
- the degree of relatedness is further suggested by heteroduplex analysis which reveals extensive cross-hybridization between serotypes along the length of the genome; and the presence of analogous self-annealing segments at the termini that correspond to “inverted terminal repeat sequences” (ITRs).
- ITRs inverted terminal repeat sequences
- the similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control. Multiple serotypes of this virus are known to be suitable for gene delivery; all known serotypes can infect cells from various tissue types.
- AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy.
- AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic.
- AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo.
- AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element).
- the AAV proviral genome is inserted as cloned DNA in plasmids, which makes construction of recombinant genomes feasible.
- AAV AAV genome encapsidation
- some or all of the internal approximately 4.3 kb of the genome encoding replication and structural capsid proteins, rep-cap
- the rep and cap proteins may be provided in trans.
- Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56° to 65° C. for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized.
- AAV-infected cells are not resistant to superinfection.
- Recombinant AAV (rAAV) genomes of the invention comprise, consist essentially of, or consist of a nucleic acid molecule encoding at least one esnRNA and one or more AAV ITRs flanking the nucleic acid molecule.
- Production of pseudotyped rAAV is disclosed in, for example, WO2001083692.
- Other types of rAAV variants, for example rAAV with capsid mutations, are also contemplated. See, e.g., Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014).
- the nucleotide sequences of the genomes of various AAV serotypes are known in the art.
- the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
- AAV adeno-associated virus
- the viral vector comprises an inverted terminal repeat sequence or a capsid sequence that is isolated or derived from an AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAV11 or AAV12.
- the AAV serotype is AAVrh.74.
- the AAV vector comprises a modified capsid.
- the AAV vector is an AAV2-Tyr mutant vector.
- the AAV vector comprises a capsid with a non-tyrosine amino acid at a position that corresponds to a surface-exposed tyrosine residue in position Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730 or Tyr673 of wild-type AAV2. See also WO 2008/124724 incorporated herein in its entirety.
- the AAV vector comprises an engineered capsid.
- AAV vectors comprising engineered capsids include without limitation, AAV2.7m8, AAV9.7m8, AAV2 2tYF, and AAV8 Y733F).
- the capsid is a ubiquitination resistant capsid.
- the ubiquitination capsid is an AAV2 capsid comprising tyrosine (Y) and serine (S) mutations.
- the AAV2 capsid comprises Y, S and threonine (T) mutations.
- the AAV2 capsid includes, without limitation, AAV2 capsid mutants such as T455V, T491V, T550V, T659V, Y444+500+730F, and Y444+500+730F+T491V.
- the viral vector is replication incompetent.
- the viral vector is isolated or recombinant (rAAV).
- the viral vector is self-complementary (scAAV).
- the viral vector is single-stranded (ssAAV).
- an AAV inverted terminal repeat sequence can comprise any AAV ITR sequence known in the art.
- an AAV ITR sequence can comprise or consist of an AAV1 ITR sequence, an AAV2 ITR sequence, an AAV3 ITR sequence, an AAV4 ITR sequence, an AAV5 ITR sequence, an AAV6 ITR sequence, an AAV7 ITR sequence, an AAV8 ITR sequence, an AAV9 ITR sequence, an AAV10 ITR sequence, an AAVrh10 ITR sequence, an AAV11 ITR sequence, an AAV12 ITR sequence, an AAV13 ITR sequence, or an AAVrh74 ITR sequence.
- the ITR sequence can comprise a modified AAV ITR sequence.
- an AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 162, or SEQ ID NO: 166.
- a first AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 162, or SEQ ID NO: 166 and a second AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 162, or SEQ ID NO: 166.
- the first AAV ITR sequence is positioned at the 5′ of a AAV vector.
- the second AAV ITR is positioned at the 5′
- the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
- AAV adeno-associated virus
- a vector of the disclosure is a non-viral vector.
- the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex or a dendrimer.
- the vector is an expression vector or recombinant expression system.
- the term “recombinant expression system” refers to a genetic construct for the expression of certain genetic material formed by recombination.
- Exemplary esnRNA AAV vectors of the disclosure can comprise one or more esnRNA sequences of the disclosure.
- the esnRNA AAV vector comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to a an esnRNA AAV vector listed in the esnRNA AAV vector Table which follows:
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04569 encoding DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 168.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04526 encoding DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 169.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04771 encoding DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 170.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04525 encoding DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 171.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04527 encoding DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 172.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04528 encoding DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 173.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04529 encoding DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 174.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04537 encoding DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 175.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04233 encoding CUG repeat targeting snRNA sequences comprises SEQ ID NO: 176.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04234 encoding CUG repeat targeting snRNA sequences comprises SEQ ID NO: 177.
- A04234 scAAV-hU7-CUGx15-hU1-CUGx15 (5′ mot ITR) Plasmid Element Nucleotide Sequence 5′ to 3′ 5′ mut ITR ctgcgcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcag tgagcgagcgcgcagagagggagtggggttt (SEQ ID NO: 162) human U7 TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTGTGACTGGC promoter TGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTT CGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCT ACTGAAAGTTACCACATGCGT
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04390 encoding CAG repeat targeting snRNA sequences comprises SEQ ID NO: 178.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04530 encoding CUG repeat targeting snRNA sequences comprises SEQ ID NO: 231.
- A04530 scAAV-mU7p-CUGx15-mU1p-CUGx15; mouseloop with ISD and eSL Plasmid Element Nucleotide Sequence 5′ to 3′ 5′ mut ITR ctgcgcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtc gcccggcctcagtgagcgagcgcgcgcagagagggagtggggtt (SEQ ID NO: 162) mouse U7 promoter taacaacataggagctgtgattggctgttttcagccaatcagcactgActcatttgcatagcctttac aagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaatatatat
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04940 encoding CUG repeat targeting snRNA sequences comprises SEQ ID NO: 232.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04533 encoding CAG repeat targeting snRNA sequences comprises SEQ ID NO: 233.
- A04533 scAAV-mU7p-CAGx15-mU1p-CAGx15; mouseloop with ISD and eSL Plasmid Element Nucleotide Sequence 5′ to 3′ 5′ mut ITR ctgcgcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtc gcccggcctcagtgagcgagcgcgcgcagagagggagtggggtt (SEQ ID NO: 162) mouse U7 promoter taacaacataggagctgtgattggctgttttcagccaatcagcactgActcatttgcatagcctttac aagcggtcacaaactcaagaaacgagcggttttaatagtcttttagaat
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A02962 encoding CUG repeat targeting snRNA sequences comprises SEQ ID NO: 120.A02962 ss pAAV-4X U7(15XCUG) (derivative of P00369) targeting CUG repeats
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A03079 encoding a CUG repeat targeting snRNA sequences comprises SEQ ID NO: 123.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A02888 encoding a CUG repeat targeting snRNA sequence comprises SEQ ID NO: 126.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A02889 encoding a non-targeting repeat targeting snRNA sequence comprises SEQ ID NO: 127.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A02925 encoding a CAG repeat targeting repeat targeting snRNA sequence comprises SEQ ID NO: 128.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A02894 encoding a CUG repeat targeting repeat targeting snRNA sequence comprises SEQ ID NO: 129.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A02895 encoding a non-targeting snRNA sequence comprises SEQ ID NO: 130.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A02968 encoding a CAG repeat targeting repeat targeting snRNA sequence comprises SEQ ID NO: 131.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A02896 encoding a CUG repeat targeting repeat targeting snRNA sequence comprises SEQ ID NO: 132.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A02897 encoding a non-targeting repeat targeting snRNA sequence comprises SEQ ID NO: 133.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A02969 encoding a CAG repeat targeting repeat targeting snRNA sequence comprises SEQ ID NO: 134.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A03980 encoding a DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 135.
- A03980 U7promoter-esnRNA-z38/42-U7 termination-U1promoter- esnRNAz38/z42-U1 termination ITR cctgcaggcagctgcgcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcc tcagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: 59) U7 promoter TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTG TGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGG GCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTA AGTTCCTTAGAATATTATTTTTCCTACT
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A03981 encoding a DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 136.
- A03981 pAAV(ssAAV)_U7promoter-esnRNA-z42-U7termination-U1promoter- esnRNA-z38-U1 termination ITR cctgcaggcagctgcgcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcc tcagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: (59) U7 promoter TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTG TGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGG GCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTA AGTTCCTTAGAATATTATTTTTCCTACTGAA
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04229 encoding a DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 137.
- A04229 pAAV(scAAV) U7promoter-esnRNA-z38/42-U7 termination- U1promoter-esnRNAz38/z42-U1 termination-mut ITR ITR cctgcaggcagctgcgcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggc ctcagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: 59) U7 promoter TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCT GTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCAT GGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAA GTAAGTTCCTTAGAATATTATTTT
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a DMD exon 51 targeting U7 esnRNA sequence, a U1 downstream terminator sequence, a buffer sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A04184 encoding a DMD exon 51 targeting snRNA sequences comprises SEQ ID NO: 138.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A03681 encoding a CUG repeat targeting snRNA sequences comprises SEQ ID NO: 139.
- A03681 pAAV(ssAAV)-U7 promoter-zCUGx15-U7 term_U1 promoter-zCUGx15-U1 term-eCMV-eGFP ITR cctgcaggcagctgcgcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcct cagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: 59) U7 TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTG promoter TGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGG GCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTA AGTTCCTTAGAATATTATTTTTCCTACTGAAAG
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U1 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A03682 encoding a CUG repeat targeting snRNA sequences comprises SEQ ID NO: 140.
- A03682 pAAV(ssAAV)-U1 promoter-zCUGx15-U1 term_U7 promoter-zCUGx15-U7 term-eCMV-eGFP ITR cctgcaggcagctgcgcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcc tcagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: 59) U1 promoter TAAGGACCAGCTTCTTTGGGAGAACAGACGCAGGGGCGGGAGG GAAAAAGGGAGAGGCAGACGTCACTTCCCCTTGGCGGCTCTGGCAG CAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGGGGGACTGGGCA AGGCACTGTCGGTGACATCACGGACAGGGCA AGGCACTGTCGGTG
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a non-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a polyA sequence, and a second ITR sequence.
- a nucleic acid sequence encoding AAV vector A03683 encoding a non-targeting snRNA sequences comprises SEQ ID NO: 141.
- A03683 pAAV(ssAAV)-U7 promoter-znt-U7 term_U1 promoter-znt-U1 term-eCMV- eGFP ITR cctgcaggcagctgcgcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcc tcagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: 59) U7 promoter TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTG TGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGG GCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTA AGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACC
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A03684 encoding a CUG repeat targeting snRNA sequences comprises SEQ ID NO: 142.
- An exemplary AAV vector of the disclosure comprises from 5′ to 3′: a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence.
- ITR inverted terminal repeat
- a nucleic acid sequence encoding AAV vector A04233 encoding a CUG repeat targeting snRNA sequences comprises SEQ ID NO: 143.
- A04233 pAAV(scAAV)-U7promoter-zCUGx15-U7termination-U1promoter-zCUGx15- U1termination (derivative of A03681 no GFP in scAAV) ITR cctgcaggcagctgcgcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctc tcagtgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: 59) U7 promoter TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTG TGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGG GCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTA A
- Gene therapy and RNA-targeting snRNA gene therapy compositions of the disclosure comprise promoter sequences derived from an snRNA.
- a “promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors.
- an expression vector, viral vector or non-viral vector provided herein includes without limitation, an expression control element.
- An “expression control element” as used herein refers to any sequence that regulates the expression of a coding sequence, such as a gene.
- Exemplary expression control elements include but are not limited to promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. Expression control elements may be constitutive, inducible, repressible, or tissue-specific, for example.
- a “promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors.
- An “enhancer” is a region of DNA that can be bound by activating proteins to increase the likelihood or frequency of transcription.
- an expression vector, viral vector or non-viral vector includes without limitation, vector elements such as a buffer sequence derived human genomic sequences downstream from an snRNA and as such will have the capability to encoding multiple snRNAs from a single construct.
- multicistronic vectors can simultaneously express two or more separate proteins from the same mRNA.
- the two strategies most widely used for constructing multicistronic configurations are through the use of an IRES or a 2A self-cleaving site.
- An “IRES” refers to an internal ribosome entry site or portion thereof of viral, prokaryotic, or eukaryotic origin which are used within polycistronic vector constructs.
- an IRES is an RNA element that allows for translation initiation in a cap-independent manner.
- self-cleaving peptides or “sequences encoding self-cleaving peptides” or “2A self-cleaving site” refer to linking sequences which are used within vector constructs to incorporate sites to promote ribosomal skipping and thus to generate two polypeptides from a single promoter, such self-cleaving peptides include without limitation, T2A, and P2A peptides or other sequences encoding the self-cleaving peptides.
- the vector configurations can comprise linker(s), signal sequence(s), and/or tag(s).
- the vector is a viral vector.
- the vector is an adenoviral vector, an adeno-associated viral (AAV) vector, or a lentiviral vector.
- the vector is a retroviral vector, an adenoviral/retroviral chimera vector, a herpes simplex viral I or II vector, a parvoviral vector, a reticuloendotheliosis viral vector, a polioviral vector, a papillomaviral vector, a vaccinia viral vector, or any hybrid or chimeric vector incorporating favorable aspects of two or more viral vectors.
- the vector further comprises one or more expression control elements operably linked to the polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector does not incorporate into the host genome, thereby having a low probability of causing insertional mutagenesis. In some embodiments, the AAV vector can encode a range of total polynucleotides from 4.5 kb to 4.75 kb.
- exemplary AAV vectors that may be used in any of the herein described compositions, systems, methods, and kits can include an AAV1 vector, a modified AAV1 vector, an AAV2 vector, a modified AAV2 vector, an AAV2-Tyr mutant vector, an AAV3 vector, a modified AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, an AAV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector, an AAVrh8 vector, an AAV9 vector, an AAV. rh10 vector, a modified AAV.
- the lentiviral vector is an integrase-competent lentiviral vector (ICLV).
- the lentiviral vector can refer to the transgene plasmid vector as well as the transgene plasmid vector in conjunction with related plasmids (e.g., a packaging plasmid, a rev expressing plasmid, an envelope plasmid) as well as a lentiviral-based particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.
- related plasmids e.g., a packaging plasmid, a rev expressing plasmid, an envelope plasmid
- Lentiviral vectors are well-known in the art (see, e.g., Trono D. (2002) Lentiviral vectors, New York: Spring-Verlag Berlin Heidelberg and Durand et al. (2011) Viruses 3(2):132-159 doi: 10.3390/v3020132).
- exemplary lentiviral vectors that may be used in any of the herein described compositions, systems, methods, and kits can include a human immunodeficiency virus (HIV) 1 vector, a modified human immunodeficiency virus (HIV) 1 vector, a human immunodeficiency virus (HIV) 2 vector, a modified human immunodeficiency virus (HIV) 2 vector, a sooty mangabey simian immunodeficiency virus (SIV SM ) vector, a modified sooty mangabey simian immunodeficiency virus (SIV SM ) vector, a African green monkey simian immunodeficiency virus (SIV AGM ) vector, a modified African green monkey simian immunodeficiency virus (SIV AGM ) vector, an equine infectious anemia virus (EIAV) vector, a modified equine infectious anemia virus (EIAV) vector, a feline immunodeficiency virus (FIV)
- HBV
- An NOI includes, without limitation, any nucleotide sequence or transgene capable of being delivered by a vector.
- NOIs can be synthetic, derived from naturally occurring DNA or RNA, codon optimized, recombinant RNA/DNA, cDNA, partial genomic DNA, and/or combinations thereof.
- the NOI can be a coding region or partial coding region, but need not be a coding region.
- An NOI can be RNA/DNA in a sense or anti-sense orientation.
- An NOI can be an snRNA.
- NOIs are also referred herein, without limitation, as transgenes, heterologous sequences, genes, therapeutic genes.
- An NOI may also encode an RNA (ribonucleoprotein complex) a POI (protein of interest), a partial POI, a mutated version or variant of a POI.
- a POI may be analogous to or correspond to a wild-type protein.
- a POI may also be a fusion protein or ribonucleoprotein complex such as an snRNP.
- RNA sequences disclosed herein may be represented as DNA sequences and it is within the ability of the skilled artisan to derive the sequence of an RNA sequence from a DNA sequence.
- NOIs or transgenes or GOIs such as nucleic acid sequences encoding RNA-targeting snRNAs of the disclosure are codon optimized nucleic acid sequences.
- the codon optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased transcription or translation in a human subject relative to a wild-type or non-codon optimized nucleic acid sequence.
- a codon optimized nucleic acid sequence exhibits increased stability. In some aspects, a codon optimized nucleic acid sequence exhibits increased stability through increased resistance to hydrolysis. In some embodiments, the codon optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased stability relative to a wild-type or non-codon optimized nucleic acid sequence.
- the codon optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased resistance to hydrolysis in a human subject relative to a wild-type or non-codon optimized nucleic acid sequence.
- a codon optimized nucleic acid sequence can comprise no donor splice sites. In some aspects, a codon optimized nucleic acid sequence can comprise no more than about one, or about two, or about three, or about four, or about five, or about six, or about seven, or about eight, or about nine, or about ten donor splice sites. In some aspects, a codon optimized nucleic acid sequence comprises at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten fewer donor splice sites as compared to a non-codon optimized nucleic acid sequence.
- the removal of donor splice sites in the codon optimized nucleic acid sequence can unexpectedly and unpredictably increase expression of protein of interest in vivo, as cryptic splicing is prevented.
- cryptic splicing may vary between different subjects, meaning that the expression level of a protein comprising donor splice sites may unpredictably vary between different subjects. Such unpredictability is unacceptable in the context of human therapy.
- the codon optimized nucleic acid sequences which lacks donor splice sites unexpectedly and surprisingly allows for increased expression of the protein in human subjects and regularizes expression of the protein across different human subjects.
- a codon optimized nucleic acid sequence can have a GC content that differs from the GC content of the non-codon optimized nucleic acid sequence encoding the RNA-targeting snRNA. In some aspects, the GC content of a codon optimized nucleic acid sequence is more evenly distributed across the entire nucleic acid sequence, as compared to the non-codon optimized nucleic acid sequence.
- the codon optimized nucleic acid sequence exhibits a more uniform melting temperature (“Tm”) across the length of the transcript.
- Tm melting temperature
- a codon optimized nucleic acid sequence can have fewer repressive microRNA target binding sites as compared to the non-codon optimized nucleic acid sequence.
- a codon optimized nucleic acid sequence can have at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten, or at least ten fewer repressive microRNA target binding sites as compared to the non-codon optimized nucleic acid sequence.
- the codon optimized nucleic acid sequence unexpectedly exhibits increased expression in a human subject.
- nucleic acid sequences encoding the gene therapy compositions or RNA-targeting snRNA systems for use in gene transfer and expression techniques described herein. It should be understood, although not always explicitly stated that the sequences provided herein can be used to provide the expression product as well as substantially identical sequences that encode an RNA or express and produce a protein that has the same biological properties. These “biologically equivalent” or “biologically active” or “equivalent” polypeptides are encoded by equivalent polynucleotides as described herein.
- They may possess at least 60%, or alternatively, at least 65%, or alternatively, at least 70%, or alternatively, at least 75%, or alternatively, at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95% or alternatively at least 98%, identical primary amino acid sequence to the reference polypeptide when compared using sequence identity methods run under default conditions.
- Specific polypeptide sequences are provided as examples of particular embodiments. Modifications to the sequences to amino acids with alternate amino acids that have similar charge.
- an equivalent polynucleotide is one that hybridizes under stringent conditions to the reference polynucleotide or its complement or in reference to a polypeptide, a polypeptide encoded by a polynucleotide that hybridizes to the reference encoding polynucleotide under stringent conditions or its complementary strand.
- an equivalent polypeptide or protein is one that is expressed from an equivalent polynucleotide.
- the NOIs or nucleic acid sequences may be codon-optimized which is a technique well known in the art. Codon optimization refers to the fact that different cells differ in their usage of particular codons. This codon bias corresponds to a bias in the relative abundance of particular tRNAs in the cell type. By altering the codons in the sequence to match with the relative abundance of corresponding tRNAs, it is possible to increase expression. It is also possible to decrease expression by deliberately choosing codons for which the corresponding tRNAs are known to be rare in a particular cell type. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms.
- nucleic acid sequences coding for, e.g., an esnRNA, esnRNA can be generated.
- a sequence is optimized for expression in a host or target cell, such as a host cell used to express the esnRNA or a cell in which the disclosed methods are practiced (such as in a mammalian cell, e.g., a human cell).
- Codon preferences and codon usage tables for a particular species can be used to engineer isolated nucleic acid molecules encoding an esnRNA that takes advantage of the codon usage preferences of that particular species.
- the esnRNA disclosed herein can be designed to have codons that are preferentially used by a particular organism of interest.
- an esnRNA nucleic acid sequence is optimized for expression in human cells, such as one having at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to its corresponding wild-type or originating nucleic acid sequence.
- an isolated nucleic acid molecule encoding at least one esnRNA (which can be part of a vector) includes at least one esnRNA coding sequence that is codon optimized for expression in a eukaryotic cell, or at least one esnRNA coding sequence codon optimized for expression in a human cell.
- such a codon optimized esnRNA coding sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to its corresponding wild-type or originating sequence.
- a eukaryotic cell codon optimized nucleic acid sequence encodes esnRNA having at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to its corresponding wild-type or originating sequence.
- a variety of clones containing functionally equivalent nucleic acids may be routinely generated, such as nucleic acids which differ in sequence but which encode the same esnRNA sequence. Silent mutations in the coding sequence result from the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue.
- leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, for example, Stryer, 1988, Biochemistry, 3.sup.rd Edition, W.H. 5 Freeman and Co., NY).
- Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
- the hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner.
- the complex may comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these.
- a hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
- Examples of stringent hybridization conditions include: incubation temperatures of about 25° C. to about 37° C.; hybridization buffer concentrations of about 6 ⁇ SSC to about 10 ⁇ SSC; formamide concentrations of about 0% to about 25%; and wash solutions from about 4 ⁇ SSC to about 8 ⁇ SSC.
- Examples of moderate hybridization conditions include: incubation temperatures of about 40° C. to about 50° C.; buffer concentrations of about 9 ⁇ SSC to about 2 ⁇ SSC; formamide concentrations of about 30% to about 50%; and wash solutions of about 5 ⁇ SSC to about 2 ⁇ SSC.
- Examples of high stringency conditions include: incubation temperatures of about 55° C.
- hybridization incubation times are from 5 minutes to 24 hours, with 1, 2, or more washing steps, and wash incubation times are about 1, 2, or 15 minutes.
- SSC is 0.15 M NaCl and 15 mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be employed.
- “Homology” or “identity” or “similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention.
- a cell of the disclosure is a prokaryotic cell.
- a cell of the disclosure is a eukaryotic cell.
- the cell is a mammalian cell.
- the cell is a bovine, murine, feline, equine, porcine, canine, simian, or human cell.
- the cell is a non-human mammalian cell such as a non-human primate cell.
- a cell of the disclosure is a somatic cell. In some embodiments, a cell of the disclosure is a germline cell. In some embodiments, a germline cell of the disclosure is not a human cell.
- a cell of the disclosure is a stem cell.
- a cell of the disclosure is an embryonic stem cell.
- an embryonic stem cell of the disclosure is not a human cell.
- a cell of the disclosure is a multipotent stem cell or a pluripotent stem cell.
- a cell of the disclosure is an adult stem cell.
- a cell of the disclosure is an induced pluripotent stem cell (iPSC).
- a cell of the disclosure is a hematopoietic stem cell (HSC).
- a somatic cell of the disclosure is a neuronal cell.
- a cell or cells of a patient treated with compositions disclosed herein include, without limitation, central nervous system (neurons), peripheral nervous system (neurons), peripheral motor neurons, and/or sensory neurons.
- a neuronal cell is a glial cell.
- a somatic cell of the disclosure is a fibroblast or an epithelial cell.
- an epithelial cell of the disclosure forms a squamous cell epithelium, a cuboidal cell epithelium, a columnar cell epithelium, a stratified cell epithelium, a pseudostratified columnar cell epithelium or a transitional cell epithelium.
- an epithelial cell of the disclosure forms a gland including, but not limited to, a pineal gland, a thymus gland, a pituitary gland, a thyroid gland, an adrenal gland, an apocrine gland, a holocrine gland, a merocrine gland, a serous gland, a mucous gland and a sebaceous gland.
- an epithelial cell of the disclosure contacts an outer surface of an organ including, but not limited to, a lung, a spleen, a stomach, a pancreas, a bladder, an intestine, a kidney, a gallbladder, a liver, a larynx or a pharynx.
- an epithelial cell of the disclosure contacts an outer surface of a blood vessel or a vein.
- a somatic cell is an ocular cell.
- An ocular cell includes, without limitation, corneal epithelial cells, keratyocytes, retinal pigment epithelial (RPE) cells, lens epithelial cells, iris pigment epithelial cells, conjunctival fibroblasts, non-pigmented ciliary epithelial cells, trabecular meshwork cells, ocular choroid fibroblasts, conjunctival epithelial cells,
- an ocular cell is a retinal cell or a corneal cell.
- a retinal cell is a photoreceptor cell or a retinal pigment epithelial cell.
- a retinal cell is a ganglion cell, an amacrine cell, a bipolar cell, a horizontal cell, a Müller glial cell, a rod cell, or a cone cell.
- a somatic cell of the disclosure is a primary cell.
- a somatic cell of the disclosure is a cultured cell.
- a somatic cell of the disclosure is in vivo, in vitro, ex vivo or in situ.
- a somatic cell of the disclosure is autologous or allogeneic.
- the disclosure provides a method of encoding an RNA or expressing an NOI in a cell using the snRNA systems disclosed herein.
- the disclosure provides a method of modifying an RNA or the activity of a protein encoded by an RNA molecule comprising contacting the composition of the disclosure and the target RNA molecule under conditions suitable for binding to the RNA molecule.
- the disclosure provides a method of modifying the level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule comprising contacting the composition of the disclosure and a cell comprising the RNA molecule under conditions suitable for binding to the RNA molecule.
- the cell is in vivo, in vitro, ex vivo or in situ.
- the composition of the disclosure comprises a vector comprising snRNA sequences.
- the vector is an AAV.
- the disclosure provides a method of modifying the level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule comprising contacting the composition of the disclosure and the RNA molecule under conditions suitable for knocking down, blocking, splicing, multi-targeting, or editing the target RNA.
- the vector is an AAV.
- the disclosure provides a method of modifying a target RNA or an activity of a protein encoded by an RNA molecule comprising contacting the composition and a cell comprising the RNA molecule under conditions suitable knocking down, blocking, splicing, multi-targeting, or editing the target RNA.
- the cell is in vivo, in vitro, ex vivo or in situ.
- the composition comprises a vector comprising the snRNA sequences disclosed herein.
- the vector is an AAV.
- the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of an snRNA composition of the disclosure.
- the disclosure provides a method of treating a disease in a patient in need of such treatment comprising administering to the patient a therapeutically effective amount of an snRNA composition of the disclosure, wherein the composition comprises a vector comprising snRNA sequences disclosed herein, wherein the composition modifies, reduces, destroys, knocks down or ablates a level of expression of a toxic repeat RNA (compared to the level of expression of a toxic repeat RNA treated with a non-targeting (NT) control or compared to no treatment).
- the level of reduction is 1-fold or greater.
- the level of reduction is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold.
- the level of reduction is 10-fold or greater. In another embodiment, the level of reduction is between 10-fold and 20-fold. In another embodiment, the level of reduction is 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold.
- the gene therapy compositions disclosed herein when administered to a patient lead to 20%-100% destruction of the toxic repeat RNA.
- the % elimination of the toxic repeat RNA is any of 20-99%, 25%-99%, 50%-99%, 80%-99%, 90%-99%, 95%-99%. In one embodiment, the % elimination is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In another embodiment, % elimination is complete elimination or 100% elimination of the toxic repeat RNA.
- the disease or disorder is associated with a toxic repeat RNA sequence.
- the toxic repeat RNA sequence is a CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeat.
- the disease or disorder is myotonic dystrophy (DM1) or Huntington's disease (HD).
- DM1 myotonic dystrophy
- HD Huntington's disease
- the disease or disorder is Duchenne Muscular Dystrophy.
- the RNA-targeting nucleic acid molecule or AAV vector targets an RNA sequence encoding dystrophin (DMD).
- the RNA sequence encoding DMD comprises an intronic or exonic sequence.
- the exonic sequence comprises exon 51, or a flanking region thereof, of DMD.
- a subject of the disclosure has been diagnosed with a disease to be treated. In some embodiments, the subject of the disclosure presents at least one sign or symptom of a disorder or disease to be treated. In some embodiments, the subject of the disclosure presents at least one sign or symptom of a disease.
- a subject of the disclosure is female. In some embodiments of the methods of the disclosure, a subject of the disclosure is male. In some embodiments, a subject of the disclosure has two XX or XY chromosomes. In some embodiments, a subject of the disclosure has two XX or XY chromosomes and a third chromosome, either an X or a Y.
- a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or any number of years or partial years in between of age.
- a subject of the disclosure is a mammal. In some embodiments, a subject of the disclosure is a non-human mammal.
- a subject of the disclosure is a human.
- a therapeutically effective amount comprises a single dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises at least one dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises one or more dose(s) of a composition of the disclosure.
- a therapeutically effective amount eliminates a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount reduces a severity of a sign or symptom of the disease or disorder.
- a therapeutically effective amount eliminates the disease or disorder.
- a therapeutically effective amount prevents an onset of a disease or disorder. In some embodiments, a therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, a therapeutically effective amount reduces the severity of a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount improves a prognosis for the subject.
- a composition of the disclosure is administered to the subject via intracerebral administration. In some embodiments, the composition of the disclosure is administered to the subject by an intrastriatal route. In some embodiments, the composition of the disclosure is administered to the subject by a stereotaxic injection or an infusion. In some embodiments, the composition is administered to the brain. In some embodiments of the methods of the disclosure, a composition of the disclosure is administered to the subject locally.
- compositions disclosed herein are formulated as pharmaceutical compositions.
- pharmaceutical compositions for use as disclosed herein may comprise a protein(s) or a polynucleotide encoding the protein(s), optionally comprised in an AAV, which is optionally also immune orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.
- compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
- buffers such as neutral buffered saline, phosphate buffered saline and the like
- carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol
- proteins such as glucose, mannose, sucrose or dextrans, mannitol
- proteins such as glucose, mannose, sucrose or dextrans, mannitol
- proteins such as glucose, mannose, sucrose or dextrans, mannitol
- proteins such as glucose, mannose, sucrose or dextrans, mannitol
- proteins such as glucose, mannose
- compositions of the disclosure may be formulated for routes of administration, such as e.g., oral, enteral, topical, transdermal, intranasal, and/or inhalation; and for routes of administration via injection or infusion such as, e.g., intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and/or parenteral administration.
- the compositions of the present disclosure are formulated for intracerebral or intrastriatal administration.
- CTG480 HeLa cells were seeded at 100,000 cells/ml in 12 well plate. Next day snRNAs were transfected using lipofectamine (2 ⁇ L P3000 and 2.5 ⁇ l lipofectamine per sample). 24 h our later cells were trypsinized and 1 ⁇ 2 of the cells seeded in chamber slides for FISH and the other 1 ⁇ 2 in a 24-well plate for RNA analysis.
- FISH FISH CUG foci was labeled with CUG fluorescent probe, and the cell nuclei was stained with DAPI.
- the U7 snRNA can be programmed to target mRNAs by replacing its histone mRNA annealing sequence with a sequence complementary to a target of interest.
- U7 with 15 ⁇ CAG repeats has been shown by others to reduce CUG repeat expansions, which cause DM1 (Francois et al NSMB 2011).
- SEQ ID NO: 1 was optimized by engineering the stem loop (SEQ ID NO: 1) to better stabilize the secondary structure of U7 snRNA in cells.
- the constructs contain 15 ⁇ CAG repeats and an optimized Sm binding domain, which further helps to stabilize the programmed U7.
- the CUG-targeting constructs were tested to determine whether they can deplete CUG foci by binding to and blocking CUG repeats in an appropriate cell model and compared to U7s that contained a non-targeting (NT) sequence. See FIGS. 1 A-D and 2 A-C.
- NT non-targeting
- Constructs and controls were transiently transfected into HeLa(CTG480) which has 480 CTG repeats inserted into its genome by CRISPR to model DM1 and express CUG foci as shown by in-situ hybridization.
- Cells were seeded and fixed onto chamber slides, and RNA in-situ hybridization was performed on the cells using a probe for CUG and dapi for nuclear staining. The co-localization of the CUG probe and DAPI signal was quantified using Halo.
- the non-engineered snRNA and esnRNA constructs led to a 39% and 68% reduction in average #foci/cell, respectively.
- HEK293T cells were seeded at 150,000 cells/ml in a 12 well plate. Next day snRNAs were transfected using lipofectamine (2 ⁇ L P3000 and 2.5 ⁇ l lipofectamine per sample). Cells were transfected with the CAG reporter construct (containing 80 CAG repeats) and increasing doses (from 100 to 1000 ng) of the snRNA plasmids targeting CAG repeats (referred as CUG-15) or the control non-targeting (nt).
- Another set of cells was used for Western blot analysis with a myc tag antibody to detect the protein levels of Poly-Q CAG containing reporter. GAPDH was used as loading control.
- Mutant HTT is caused by the existence of microsatellite repeats in exon one of HTT.
- engineered snRNPs comprising the engineered stem loop are capable of knocking down CAG microsatellite repeat RNA in a CAG80 reporter assay.
- the U7 snRNA can be programmed to target mRNAs by replacing its histone mRNA annealing sequence with a sequence complementary to a target of interest.
- the esnRNA system reprogrammed to target CAG repeats comprises an eSL of SEQ ID NO: 1 to better stabilize the secondary structure of U7 snRNA in cells.
- the constructs contain 15 ⁇ CUG repeats to target CAG expansions. These constructs also contained an optimized Sm binding domain, which further helps to stabilize the programmed U7.
- the CAG-targeting constructs were tested to determine whether they can knock down CAG repeats and poly-Q containing protein compared to eSLs that contained a non-targeting sequence.
- HEK293T cells were seeded at 150,000/ml in 12 well plate. Next day cells were transfected with 50 ng of USH2A minigene with a total of 250 ng, 500 ng, 1 ug of pcDNA expressing non-targeting esnRNA or USH2A exon 13-targeting esnRNA with lipofectamine.
- Quantitation of U7 was performed by PCR with primers annealing to the non-targeting esnRNA.
- Exon 13 is an in-frame exon and a therapeutic strategy includes skipping exon 13.
- esnRNAs comprising an eSL disclosed herein that target and anneal to exon splicing enhancers on exon 13 of USH2A and block the inclusion of exon 13.
- Our programmed esnRNA system to target USH2A exon 13 results in efficient exon 13 skipping on minigene.
- PCR results suggest higher steady state levels of the esnRNA system compared to non-engineered SL. See FIGS. 4 A- 4 D . See also FIG. 1 A .
- DM1 patient myotubes containing 2600 CUG repeats in the 3′UTR of DMPK were differentiated for 13 days before introduction of esnRNA comprising eSL disclosed herein targeting 15 ⁇ CUG repeats.
- RNA was extracted from cells 24 hours after treatment, RNA was reverse transcribed and semiquantitative PCR was performed to DM1 disease splicing biomarkers LDB3 exon 11, BIN1 exon 11 and DMD exon 78. Analysis of splicing isoforms was performed by calculating the percentage of the healthy splice isoform (LDB3 exon 11 excluded, BIN1 exon 11 included and DMD exon 78 included) over the total signal from both the disease and healthy isoforms.
- DM1 is caused by CUG repeat expansions in the 3′UTR of the DMPK gene that sequesters MBNL protein and as a result lead to dysregulation of alternative splicing.
- esnRNAs comprising an eSL disclosed herein were programmed to target CUG (15 ⁇ CUGs) and this resulted in a dose dependent increase in healthy splice isoforms for all three tested disease splicing biomarkers compared to the non-targeting control. See FIGS. 5 A- 5 F . See also FIG. 2 C .
- sR220004 had the highest expression at all time points.
- sR220088 had no detectable expression.
- eSL/5′ISD found in 004 was selected for future constructs.
- sR220004 and sR220091 had the highest retention of expression at 48 hr and 72 hr time points.
- snRNA expression was evaluated by qPCR in CTG480 HeLa cells when snRNA expression was driven by different human PolIII and PolII promoters. See FIG. 8 .
- the U1 promoter drives the highest level of snRNAs, followed by the U7 promoter.
- the PolIII promoters U6 and 7SK had low expression, and the PolIII tRNA promoter had lowest expression.
- UID Promoter target P03490 tRNA (CUGx15) P03462 U6 (CUGx15) P03465 7SK (CUGx15) P03557 U1 (CUGx15) P02225 U7 (CUGx15) P03491 tRNA (nt) P03463 U6 (nt) P03466 7SK (nt) P03561 U1 (nt) P02313 U7 (nt)
- snRNA expression was determined by qPCR in HEK293T cells (see FIG. 10 ). Expression of U7 snRNAs under PolIII promoters increased up to 25 ⁇ when SmOpt was converted to U1 Sm binding site. Expression by PolII U1 and U7 promoters decreased when Sm site was converted to U1 Sm. Expression by U1 and U7 promoters are superior to Pol III promoters.
- snRNA transfection into HEK293T cells was conducted. See FIG. 11 A- 11 B . Here znt esnRNA and z38 esnRNA expression was driven by distinct snRNA promoters. Those constructs were transfected into HEK293T cells. 48 h post-transfection RNA was extracted and cDNA was made. Primers specific for each snRNA (z) were used for qPCR to determine snRNA expression and relative promoter strength.
- Example 7 esnRNA Constructs Result in DMD Exon Skippin2 of Exon 51 in Patient Myotubes
- Human delta exon 52 myotubes were transduced with AAV9 carrying snRNAs disclosed herein. Immunofluorescence was performed to desmin and dystrophin. Dystrophin can be detected after treatment with exon 51-targeting snRNAs. See FIG. 13 A- 13 B .
- Example 8 Exon 51 Skippin2 Skeletal Myotubes and a DMD Mouse Model
- ESEs target exon splicing enhancers
- exon 51 skipping was quantified.
- FIG. 15 B Mice carrying hDMD with exon 52 deleted (de152hDMD/mdx) were injected retro-orbitally with 3e12 vector genomes of A04526 and A04569. Following 3-week survival, RNA was extracted from the tibialis anterior muscle (TA), the Gastrocnemius (Gc) and the heart. Semi-quantitative RT-PCR was performed to detect exon 51 included and excluded bands.
- FIG. 15 C shows quantification of exon 51 skipping in the humanized DMD mouse model.
- FIG. 1 . 5 D shows the quantification of dystrophin positive fibers after 4 weeks.
- hDMD/mdx mice (gray bar) which expresses wildtype human dystrophin serves as a positive control for dystrophin expression.
- U untreated.
- Example 9 AAV9-based Splicing Reversal and CUG Repeat Knockdown in DM1 Patient-Derived Myotubes
- DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD Adenovirus vector (for 5 days).
- Myotubes were transduced with MOIs of 5e4, 2e5 and 1e6 of A04233 and A04234 (scAAV9 with dual snRNA cassettes targeting CUG repeats) and harvested 7 days post-transduction.
- FIGS. 16 A-D Cell nuclei were stained with DAPI and CUG FISH was performed with a CUG labeled probe. Cells were processed 7 days post-transduction for quantification of average number of CUG foci per cell. See FIGS. 17 A-B .
- HD patient iPSc (containing 66 CAG repeats) were differentiated into cortical neurons for 2 weeks and then transduced with 2 different MOIs of AAV-A04390 snRNA vector (2 ⁇ snRNA cassette targeting CAG repeats) for an additional 2 weeks. Then cortical neurons were harvested and mutant soluble HTT quantified by Meso scale discovery immunoassay. See FIGS. 18 A- 18 C . Then, an in vivo study was designed to target CAG repeats in an R6/2 HD mouse model.
- Example 11 Hither Levels of Expression with Engineered Stem Loop snRNA Vectors Compared to Native Stem Loop snRNA Vectors
- CHO-Lec2 cells were transduced at an MOI of 1e6 with AAV9-A04527 vector (native stem loop expressing z38/42 targeting DMD exon 51 ESEs) or AAV9-A04526 vector (engineered stem loop expressing z38/42 targeting DMD exon 51 ESEs).
- Expression of z38/42 is higher in cells transduced with engineered snRNA vector compared to expression of z38/42 in cells transduced with native stem loop snRNA vector. See FIGS. 20 A-B .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Neurology (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurosurgery (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Virology (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
- Epidemiology (AREA)
- Psychology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/179,110 US20230279397A1 (en) | 2022-03-04 | 2023-03-06 | Compositions and methods comprising engineered short nuclear rna (snrna) |
| US18/447,651 US12037588B2 (en) | 2022-03-04 | 2023-08-10 | Compositions and methods comprising engineered short nuclear RNA (snRNA) |
| US18/733,477 US20250136981A1 (en) | 2022-03-04 | 2024-06-04 | Compositions and methods comprising engineered short nuclear rna (snrna) |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263316659P | 2022-03-04 | 2022-03-04 | |
| US202263379983P | 2022-10-18 | 2022-10-18 | |
| US18/179,110 US20230279397A1 (en) | 2022-03-04 | 2023-03-06 | Compositions and methods comprising engineered short nuclear rna (snrna) |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/447,651 Continuation US12037588B2 (en) | 2022-03-04 | 2023-08-10 | Compositions and methods comprising engineered short nuclear RNA (snRNA) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20230279397A1 true US20230279397A1 (en) | 2023-09-07 |
Family
ID=85792399
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/179,110 Pending US20230279397A1 (en) | 2022-03-04 | 2023-03-06 | Compositions and methods comprising engineered short nuclear rna (snrna) |
| US18/447,651 Active US12037588B2 (en) | 2022-03-04 | 2023-08-10 | Compositions and methods comprising engineered short nuclear RNA (snRNA) |
| US18/733,477 Pending US20250136981A1 (en) | 2022-03-04 | 2024-06-04 | Compositions and methods comprising engineered short nuclear rna (snrna) |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/447,651 Active US12037588B2 (en) | 2022-03-04 | 2023-08-10 | Compositions and methods comprising engineered short nuclear RNA (snRNA) |
| US18/733,477 Pending US20250136981A1 (en) | 2022-03-04 | 2024-06-04 | Compositions and methods comprising engineered short nuclear rna (snrna) |
Country Status (10)
| Country | Link |
|---|---|
| US (3) | US20230279397A1 (https=) |
| EP (1) | EP4486888A1 (https=) |
| JP (1) | JP2025507958A (https=) |
| KR (1) | KR20240164824A (https=) |
| CN (1) | CN119137273A (https=) |
| AU (1) | AU2023228712A1 (https=) |
| CA (1) | CA3245423A1 (https=) |
| IL (1) | IL315378A (https=) |
| MX (1) | MX2024010833A (https=) |
| WO (1) | WO2023168458A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12037588B2 (en) | 2022-03-04 | 2024-07-16 | Locanabio, Inc. | Compositions and methods comprising engineered short nuclear RNA (snRNA) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2023364059A1 (en) | 2022-10-18 | 2025-05-08 | Regeneron Pharmaceuticals, Inc. | Compositions and methods comprising programmable snrnas for rna editing |
| KR20250115422A (ko) | 2022-12-01 | 2025-07-30 | 리제너론 파마슈티칼스 인코포레이티드 | 반복적 요소의 적절한 패키징을 위한 아데노 연관 바이러스 벡터 |
| WO2025072530A2 (en) | 2023-09-26 | 2025-04-03 | Regeneron Pharmaceuticals, Inc. | Compositions and methods comprising small nuclear rna (snrna) for treating dmd |
| WO2025090633A1 (en) | 2023-10-23 | 2025-05-01 | Regeneron Pharmaceuticals, Inc. | Compositions and methods comprising small nuclear rna (snrna) for treating genetic epilepsies |
| WO2025126158A2 (en) | 2023-12-15 | 2025-06-19 | Regeneron Pharmaceuticals, Inc. | Compositions and methods comprising small nuclear rna (snrna) targeting sod1 |
| WO2025160364A2 (en) | 2024-01-26 | 2025-07-31 | Regeneron Pharmaceuticals, Inc. | Compositions and methods comprising small nuclear rna (snrna) for the treatment of pompe disease |
Family Cites Families (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IT1283876B1 (it) | 1996-01-12 | 1998-05-07 | Univ Roma | Molecole chimeriche ribozima-snrna ad attivita' catalitica per rna a localizzazione nucleare |
| US5814500A (en) | 1996-10-31 | 1998-09-29 | The Johns Hopkins University School Of Medicine | Delivery construct for antisense nucleic acids and methods of use |
| US6692910B2 (en) | 1997-07-28 | 2004-02-17 | The University Of Connecticut | Inhibition of a target messenger RNA with a modified U1 small nuclear RNA |
| US7056502B2 (en) | 2000-04-28 | 2006-06-06 | The Trustees Of The University Of Pennsylvania | Recombinant aav vectors with AAV5 capsids and AAV5 vectors pseudotyped in heterologous capsids |
| WO2002083908A1 (es) | 2001-03-30 | 2002-10-24 | Fundacion Para La Investigacion Medica Aplicada | Procedimiento de inhibicion reversible de la expresion genica mediante ribonucleoproteinas modificadas |
| ITRM20020253A1 (it) | 2002-05-08 | 2003-11-10 | Univ Roma | Molecole chimeriche di snrna con sequenze antisenso per le giunzioni di splicing del gene della distrofina e applicazioni terapeutiche. |
| FR2874384B1 (fr) | 2004-08-17 | 2010-07-30 | Genethon | Vecteur viral adeno-associe pour realiser du saut d'exons dans un gene codant une proteine a domaines dispensables |
| US8822168B2 (en) | 2005-03-11 | 2014-09-02 | The Trustees Of The University Of Pennsylvania | Assays for detecting small nuclear ribonucleoprotein particle assembly and survival of motor neurons activity |
| US9040491B2 (en) | 2006-08-30 | 2015-05-26 | The Trustees Of The University Of Pennsylvania | Compositions, methods and kits based on small nuclear RNAs |
| US8343941B2 (en) | 2007-03-30 | 2013-01-01 | Rutgers, The State University Of New Jersey | Compositions and methods for gene silencing |
| US9441221B2 (en) | 2007-03-30 | 2016-09-13 | Rutgers, The State University Of New Jersey | Compositions and methods for gene silencing |
| EP2142672B1 (en) | 2007-03-30 | 2012-09-05 | Rutgers, The State University of New Jersey | Compositions and methods for gene silencing |
| US8907075B2 (en) | 2007-03-30 | 2014-12-09 | Samuel Ian Gunderson | Compositions and methods for gene silencing |
| ES2714007T3 (es) | 2007-04-09 | 2019-05-24 | Univ Florida | Composiciones de vectores rAAV que tienen proteínas de la cápside modificadas en tirosina y métodos para su uso |
| US9080170B2 (en) | 2010-03-17 | 2015-07-14 | Association Institut De Myologie | Modified U7 snRNAs for treatment of neuromuscular diseases |
| IT1400425B1 (it) | 2010-06-08 | 2013-05-31 | Amsterdam Molecular Therapeutics Bv | Modified snrnas for use in therapy. |
| IT1405793B1 (it) | 2010-10-15 | 2014-01-24 | Univ Ferrara | Molecola di u1snrna umano modificato, gene codificante per la molecola di u1snrna umano modificato, vettore di espressione includente il gene, e loro uso in terapia genica |
| US9303258B2 (en) | 2011-04-05 | 2016-04-05 | The Regents Of The University Of California | Method and compositions comprising small RNA agonist and antagonists to modulate inflammation |
| MX388221B (es) | 2013-04-20 | 2025-03-19 | Res Institute At Nationwide Children´S Hospital | ADMINISTRACIÓN DE VIRUS ADENO-ASOCIADO RECOMBINANTE DE CONSTRUCCIONES DE POLINUCLÉOTIDOS U7snRNA DIRIGIDA AL EXÓN 2. |
| CA2957661A1 (en) | 2014-08-09 | 2016-02-18 | Kevin FLANIGAN | Methods and materials for activating an internal ribosome entry site in exon 5 of the dmd gene |
| US9669109B1 (en) | 2015-11-24 | 2017-06-06 | Universita Di Ferrara | Modified human U1snRNA molecule, a gene encoding for the modified human U1snRNA molecule, an expression vector including the gene, and the use thereof in gene therapy of familial dysautonomia and spinal muscular atrophy |
| FR3044926B1 (fr) | 2015-12-09 | 2020-01-31 | Genethon | Outils de therapie genique efficaces pour le saut de l'exon 53 de la dystrophine |
| JP6966463B2 (ja) | 2016-02-26 | 2021-11-17 | リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル | 組換えウイルス産物及びdux4エクソンスキッピングを誘導するための方法 |
| JP2021534755A (ja) | 2018-08-22 | 2021-12-16 | リサーチ インスティチュート アット ネイションワイド チルドレンズ ホスピタル | 筋強直性ジストロフィープロテインキナーゼの発現を抑制および/またはdmpk遺伝子の3’非翻訳領域におけるトリヌクレオチドリピート伸長に干渉するための組換えウイルス産物および方法 |
| CN113924364A (zh) | 2019-03-08 | 2022-01-11 | 罗格斯新泽西州立大学 | 治疗亨廷顿病的组合物和方法 |
| CA3134683A1 (en) | 2019-03-26 | 2020-10-01 | Rutgers, The State University Of New Jersey | Compositions and methods for treating neurodegenerative disorders |
| WO2020214763A1 (en) * | 2019-04-18 | 2020-10-22 | Sarepta Therapeutics, Inc. | Compositions for treating muscular dystrophy |
| US20220348958A1 (en) | 2019-07-23 | 2022-11-03 | Oxford Biomedica (Uk) Limited | Enhancing Production of Lentiviral Vectors |
| WO2021026075A1 (en) | 2019-08-02 | 2021-02-11 | Research Institute At Nationwide Children's Hospital | Exon 44-targeted nucleic acids and recombinant adeno-associated virus comprising said nucleic acids for treatment of dystrophin-based myopathies |
| US20230059753A1 (en) | 2019-12-09 | 2023-02-23 | Astellas Pharma Inc. | Antisense guide rna with added functional region for editing target rna |
| CN115777020A (zh) * | 2020-04-22 | 2023-03-10 | 塑造治疗公司 | 使用snrna组分的组合物和方法 |
| AU2021349277A1 (en) | 2020-09-28 | 2023-05-11 | Research Institute At Nationwide Children's Hospital | Products and methods for treating muscular dystrophy |
| IL303230A (en) | 2020-11-30 | 2023-07-01 | Res Inst Nationwide Childrens Hospital | Compositions and methods for treating facioscapulohumeral muscular dystrophy (fshd) |
| AU2022262420A1 (en) | 2021-04-23 | 2023-11-16 | Research Institute At Nationwide Children's Hospital | Products and methods for treating muscular dystrophy |
| AU2023228712A1 (en) | 2022-03-04 | 2024-10-17 | Regeneron Pharmaceuticals, Inc. | Compositions and methods comprising engineered small nuclear rna (snrna) |
-
2023
- 2023-03-06 AU AU2023228712A patent/AU2023228712A1/en active Pending
- 2023-03-06 KR KR1020247032973A patent/KR20240164824A/ko active Pending
- 2023-03-06 CA CA3245423A patent/CA3245423A1/en active Pending
- 2023-03-06 IL IL315378A patent/IL315378A/en unknown
- 2023-03-06 WO PCT/US2023/063798 patent/WO2023168458A1/en not_active Ceased
- 2023-03-06 EP EP23714451.4A patent/EP4486888A1/en active Pending
- 2023-03-06 CN CN202380037529.8A patent/CN119137273A/zh active Pending
- 2023-03-06 JP JP2024552401A patent/JP2025507958A/ja active Pending
- 2023-03-06 US US18/179,110 patent/US20230279397A1/en active Pending
- 2023-08-10 US US18/447,651 patent/US12037588B2/en active Active
-
2024
- 2024-06-04 US US18/733,477 patent/US20250136981A1/en active Pending
- 2024-09-04 MX MX2024010833A patent/MX2024010833A/es unknown
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12037588B2 (en) | 2022-03-04 | 2024-07-16 | Locanabio, Inc. | Compositions and methods comprising engineered short nuclear RNA (snRNA) |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4486888A1 (en) | 2025-01-08 |
| IL315378A (en) | 2024-11-01 |
| US12037588B2 (en) | 2024-07-16 |
| US20250136981A1 (en) | 2025-05-01 |
| WO2023168458A1 (en) | 2023-09-07 |
| JP2025507958A (ja) | 2025-03-21 |
| US20240018521A1 (en) | 2024-01-18 |
| KR20240164824A (ko) | 2024-11-20 |
| CN119137273A (zh) | 2024-12-13 |
| CA3245423A1 (en) | 2023-09-07 |
| AU2023228712A1 (en) | 2024-10-17 |
| MX2024010833A (es) | 2024-12-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12037588B2 (en) | Compositions and methods comprising engineered short nuclear RNA (snRNA) | |
| WO2023154807A2 (en) | Compositions and methods for modulating pre-mrna splicing | |
| US20240108751A1 (en) | Rna-targeting compositions and methods for treating myotonic dystrophy type 1 | |
| US20240000972A1 (en) | Rna-targeting compositions and methods for treating cag repeat diseases | |
| CN113557243A (zh) | 用于神经变性疾病的基因疗法 | |
| WO2024086650A1 (en) | Compositions and methods comprising programmable snrnas for rna editing | |
| EP4627093A1 (en) | Adeno-associated viral vectors for proper packaging of repetitive elements | |
| WO2023205637A1 (en) | Rna-targeting compositions and methods for treating c9/orf72 diseases | |
| WO2022221278A1 (en) | Compositions and methods comprising hybrid promoters | |
| WO2025072530A2 (en) | Compositions and methods comprising small nuclear rna (snrna) for treating dmd | |
| EA052057B1 (ru) | КОМПОЗИЦИИ И СПОСОБЫ, ВКЛЮЧАЮЩИЕ СКОНСТРУИРОВАННУЮ МАЛУЮ ЯДЕРНУЮ РНК (snРНК) | |
| CN117320741A (zh) | 用于治疗cag重复疾病的靶向rna的组合物和方法 | |
| WO2025090633A1 (en) | Compositions and methods comprising small nuclear rna (snrna) for treating genetic epilepsies | |
| WO2025126158A2 (en) | Compositions and methods comprising small nuclear rna (snrna) targeting sod1 | |
| WO2025160364A2 (en) | Compositions and methods comprising small nuclear rna (snrna) for the treatment of pompe disease | |
| WO2025155722A1 (en) | Muscle selective hybrid regulatory combinations and methods of use thereof for the treatment of myotonic dystrophy type 1 | |
| CN116801901A (zh) | 用于治疗1型强直性肌营养不良的靶向rna的组合物和方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: LOCANABIO, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LARDELLI MARKMILLER, REA;BATRA, RANJAN;ADAMS, RACHEL A.;AND OTHERS;SIGNING DATES FROM 20230310 TO 20230428;REEL/FRAME:063553/0249 |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
| AS | Assignment |
Owner name: REGENERON PHARMACEUTICALS, INC., NEW YORK Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:LOCANABIO, INC.;REEL/FRAME:069815/0213 Effective date: 20241028 |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION COUNTED, NOT YET MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |