US20220389445A1 - Novel insecticidal proteins and methods for their use - Google Patents
Novel insecticidal proteins and methods for their use Download PDFInfo
- Publication number
- US20220389445A1 US20220389445A1 US17/805,704 US202217805704A US2022389445A1 US 20220389445 A1 US20220389445 A1 US 20220389445A1 US 202217805704 A US202217805704 A US 202217805704A US 2022389445 A1 US2022389445 A1 US 2022389445A1
- Authority
- US
- United States
- Prior art keywords
- xaa
- ser
- accession
- thr
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/21—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/24—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a MBP (maltose binding protein)-tag
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named “4208-US-DIV2_SequenceListing_Revised” created on May 19, 2020, and having a size of 471 kilobytes and is filed concurrently with the specification.
- sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.
- This disclosure relates to the field of molecular biology. Provided are novel genes that encode pesticidal proteins. These pesticidal proteins and the nucleic acid sequences that encode them are useful in preparing pesticidal formulations and in the production of transgenic pest-resistant plants.
- biopesticides Biological control of insect pests of agricultural significance using a microbial agent, such as fungi, bacteria or another species of insect affords an environmentally friendly and commercially attractive alternative to synthetic chemical pesticides.
- a microbial agent such as fungi, bacteria or another species of insect affords an environmentally friendly and commercially attractive alternative to synthetic chemical pesticides.
- biopesticides present a lower risk of pollution and environmental hazards, and biopesticides provide greater target specificity than is characteristic of traditional broad-spectrum chemical insecticides.
- biopesticides often cost less to produce and thus improve economic yield for a wide variety of crops.
- Bacillus Certain species of microorganisms of the genus Bacillus are known to possess pesticidal activity against a range of insect pests including Lepidoptera, Diptera, Coleoptera, Hemiptera and others.
- Bacillus thuringiensis (Bt) and Bacillus popilliae are among the most successful biocontrol agents discovered to date. Insect pathogenicity has also been attributed to strains of B. larvae, B. lentimorbus, B. sphaericus and B. cereus .
- Microbial insecticides particularly those obtained from Bacillus strains, have played an important role in agriculture as alternatives to chemical pest control.
- Crop plants have been developed with enhanced insect resistance by genetically engineering crop plants to produce pesticidal proteins from Bacillus .
- corn and cotton plants have been genetically engineered to produce pesticidal proteins isolated from strains of Bt.
- These genetically engineered crops are now widely used in agriculture and have provided the farmer with an environmentally friendly alternative to traditional insect-control methods. While they have proven to be very successful commercially, these genetically engineered, insect-resistant crop plants provide resistance to only a narrow range of the economically important insect pests. In some cases, insects can develop resistance to different insecticidal compounds, which raises the need to identify alternative biological control agents for pest control.
- insecticidal proteins with different ranges of insecticidal activity against insect pests, e.g., insecticidal proteins which are active against a variety of insects in the order Lepidoptera and the order Hemiptera including but not limited to species belonging to the family Pentatomidae, the family Plataspidae and the family Cydnidae.
- biopesticides having activity against a variety of insect pests that have developed resistance to existing pesticides.
- compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided.
- Compositions include nucleic acid molecules encoding sequences for pesticidal and insecticidal polypeptides, vectors comprising those nucleic acid molecules, and host cells comprising the vectors.
- Compositions also include the pesticidal polypeptide sequences and antibodies to those polypeptides.
- the nucleic acid sequences can be used in DNA constructs or expression cassettes for transformation and expression in organisms, including microorganisms and plants.
- the nucleotide or amino acid sequences may be synthetic sequences that have been designed for expression in an organism including, but not limited to, a microorganism or a plant.
- Compositions also comprise transformed bacteria, plants, plant cells, tissues and seeds.
- Pseudomonas Insecticidal Protein-1 Pseudomonas Insecticidal Protein-1 (PIP-1) polypeptides including amino acid substitutions, amino acid deletions, amino acid insertions, and fragments thereof, and combinations thereof. Additionally, amino acid sequences corresponding to the PIP-1 polypeptides are encompassed.
- an isolated or recombinant nucleic acid molecule capable of encoding a PIP-1 polypeptide of SEQ ID NO: 2, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267
- exemplary PIP-1 polypeptides comprise a sequence set forth in of SEQ ID NO: 2, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, and 269 as well as amino
- exemplary nucleic acid molecules comprise a sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, and 244 as well as variants and fragments thereof encoding PIP-1 polypeptides
- transgenic plants of the embodiments express one or more of the pesticidal sequences disclosed herein.
- the transgenic plant further comprises one or more additional genes for insect resistance, for example, one or more additional genes for controlling coleopteran, lepidopteran, hemipteran or nematode pests. It will be understood by one of skill in the art that the transgenic plant may comprise any gene imparting an agronomic trait of interest.
- kits for detecting the presence of a PIP-1 polypeptide or detecting the presence of a nucleotide sequence encoding a PIP-1 polypeptide in a sample is provided.
- a kit for detecting the presence of nucleotide sequence encoding a PIP-1 polypeptide may comprise a nucleic acid probe that comprises at least 20 contiguous nucleotides of the nucleotide sequence encoding the PIP-1 polypeptide or a complement thereof.
- a kit for detecting the presence of a PIP-1 polypeptide may comprise an antibody that specifically binds to the PIP-1 polypeptide.
- the kit is provided along with all reagents and control samples necessary for carrying out a method for detecting the intended agent, as well as instructions for use.
- compositions and methods of the embodiments are useful for the production of organisms with enhanced pest resistance or tolerance. These organisms and compositions comprising the organisms are desirable for agricultural purposes.
- compositions of the embodiments are also useful for generating altered or improved proteins that have pesticidal activity or for detecting the presence of PIP-1 polypeptides or nucleic acids in products or organisms.
- a recombinant nucleic acid molecule encoding a PIP-1 polypeptide 1.
- nucleic acid molecule of embodiment 1, 2, 3, 4 or 5 wherein the nucleic acid molecule is from a Pseudomonas chlororaphis strain.
- PIP-1 polypeptide comprises a polypeptide having at least 80% identity to the amino acid sequence of SEQ ID NO: 2.
- a plant or progeny thereof comprising the recombinant nucleic acid molecule of embodiment 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
- a plant or progeny thereof stably transformed with the recombinant nucleic acid molecule of embodiment 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
- An expression cassette comprising the recombinant nucleic acid molecule of embodiment 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19, wherein the nucleic acid is operably linked to one or more regulatory sequences directing expression of the PIP-1 polypeptide.
- a plant cell comprising the expression cassette of embodiment 27.
- a recombinant microbial cell comprising the expression cassette of embodiment 27.
- the seed of embodiment 32, wherein the one or more seed treatment is selected from a herbicide, an insecticide, a fungicide, a germination inhibitor, a germination enhancer, a plant growth regulator, a bactericide, and a nematocide.
- a recombinant microorganism comprising a recombinant nucleic acid molecule of embodiment 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19.
- microorganism of embodiment 35 wherein the microorganism is selected from a bacteria, baculovirus, algae, and fungi.
- microorganism of embodiment 36 wherein the bacteria is selected from a Bacillus , a Pseudomonas , a Clavibacter , a Rhizobium and E. coli.
- a method for producing a polypeptide with insecticidal activity comprising culturing the microorganism of embodiment 35, 36 or 37 under conditions in which the nucleic acid molecule encoding the polypeptide is expressed.
- a method for expressing in a plant a PIP-1 polypeptide comprising the steps of:
- the plant of embodiment 42, wherein the one or more additional transgenic trait is selected from insect resistance, herbicide resistance, fungal resistance, viral resistance, stress tolerance, disease resistance, male sterility, stalk strength, increased yield, modified starches, improved oil profile, balanced amino acids, high lysine or methionine, increased digestibility, improved fiber quality, flowering, ear and seed development, enhancement of nitrogen utilization efficiency, altered nitrogen responsiveness, drought resistance or tolerance, cold resistance or tolerance, salt resistance or tolerance, and increased yield under stress.
- PIP-1 polypeptide of embodiment 49 wherein the PIP-1 polypeptide has insecticidal activity against an insect selected from Nezara viridula, Halyomorpha halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare, Euschistus heros, Euschistus tristigmus, Acrosternum hilare, Dichelops furcatus, Dichelops melacanthus, Bagrada hilaris, Megacopta cribraria, Scaptocoris castanea, Helicoverpa zea Boddie, Pseudoplusia includens Walker, and Anticarsia gemmatalis.
- PIP-1 polypeptide of embodiment 52 wherein the PIP-1 polypeptide is produced by a Pseudomonas chlororaphis strain having a 16S ribosomal DNA having at least about 96.9% identity to SEQ ID NO: 216.
- PIP-1 polypeptide of embodiment 55 further comprising any one or more amino acid motifs as represented by positions 149-159 of SEQ ID NO: 213, and positions 64-79 of SEQ ID NO: 213.
- PIP-1 polypeptide of embodiment 55 comprising an amino acid sequence of SEQ ID NO: 2 or a fragment thereof.
- the plant of embodiment 66 wherein the plant is selected from barley, corn, oat, rice, rye, sorghum, turf grass, sugarcane, wheat, alfalfa, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, a cucurbit, eucalyptus , flax, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, tomato ornamental, shrub, nut, chickpea, pigeon pea, millets, hops, and pasture grasses.
- the one or more additional transgenic trait is selected insect resistance, herbicide resistance, fungal resistance, viral resistance, stress tolerance, disease resistance, male sterility, stalk strength, increased yield, modified starches, improved oil profile, balanced amino acids, high lysine or methionine, increased digestibility, improved fiber quality, flowering, ear and seed development, enhancement of nitrogen utilization efficiency, altered nitrogen responsiveness, drought resistance or tolerance, cold resistance or tolerance, and salt resistance or tolerance, and increased yield under stress.
- composition comprising an insecticidally-effective amount of the recombinant PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65.
- composition of embodiment 72 further comprising an agriculturally suitable carrier.
- composition of embodiment 73, wherein the carrier is selected from a powder, a dust, pellets, granules, spray, emulsion, colloid, and solution.
- composition of embodiment 75, wherein the one or more insecticides are pesticidal proteins.
- composition of embodiment 76, wherein the one or more pesticidal proteins are selected from a Cry1 protein, a Cry2 protein, a Cry3 protein, a Cry4 protein, a Cry5 protein, a Cry6 protein, a Cry7 protein, a Cry8 protein, a Cry9 protein, a Cry15 protein, Cry22 protein, a Cry23 protein, a Cry32 protein, a Cry34 protein, a Cry35 protein, a Cry36 protein, a Cry37 protein, a Cry43 protein, a Cry46 protein, a Cry51 protein, a Cry55 protein, a Cry binary toxin, a Cyt protein, a VIP toxin, a SIP protein, an insecticidal lipase, an insecticidal chitinase, and a snake venom protein.
- the one or more pesticidal proteins are selected from a Cry1 protein, a Cry2 protein,
- a method for controlling an insect pest population comprising contacting the insect pest population with an insecticidally-effective amount of the recombinant PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65.
- a method of inhibiting growth or killing an insect pest comprising contacting the insect pest with a insecticidally-effective amount of recombinant PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65.
- a method for controlling an insect pest population resistant to a pesticidal protein comprising contacting the resistant insect pest population with a insecticidally-effective amount of the recombinant PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65.
- the method of controlling an insect pest population resistant to an pesticidal protein comprising contacting the population with a insecticidally-effective amount of the recombinant PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65, wherein the pesticidal protein is selected from Cry1Ac, Cry1Ab, Cry1A.105, Cry1Ac, Cry1F, Cry1Fa2, Cry1F, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, Cry9c, eCry3.1Ab and CBI-Bt.
- a method for protecting a plant from an insect pest comprising expressing in the plant or cell thereof a recombinant PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65.
- a method of isolating a polypeptide having insecticidal activity from a Pseudomonas chlororaphis strain comprising
- a method of identifying a PIP-1 polypeptide in a biological sample comprising contacting the biological sample with the receptor of embodiment 85 or 86.
- a method of detecting a PIP-1 polypeptide in a biological sample comprising, contacting the protein with the antibody of embodiment 88.
- a method of isolating a PIP-1 polypeptide in a biological sample comprising, contacting the protein with the antibody of embodiment 88.
- one of the at least two insecticidal proteins comprises a PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65 insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- one of the at least two insecticidal proteins comprises a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- a method of reducing likelihood of emergence of Lepidoptera and/or Hemiptera insect resistance to transgenic plants expressing in the plants insecticidal proteins to control the insect species comprising expressing a PIP-1A polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65 insecticidal to the insect species in combination with an insecticidal protein to the insect species having a different modes of action compared to the PIP-1A polypeptide.
- a means for effective Lepidoptera and/or Hemiptera insect resistance management comprising co-expressing at high levels in transgenic plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or killing activity, wherein the two or more insecticidal proteins comprise a PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65 and a Cry protein.
- a method for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera comprising the step of referring to, submitting or relying on insect assay binding data showing that the PIP-1 polypeptide of embodiment 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64 or 65 does not compete with binding sites for Cry proteins in such insects.
- a plant or progeny thereof stably transformed with the recombinant nucleic acid molecule of SEQ ID NO: 3.
- the plant or progeny thereof of embodiment 97 or 98 wherein the plant is selected from barley, corn, oat, rice, rye, sorghum, turf grass, sugarcane, wheat, alfalfa, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, a cucurbit, eucalyptus , flax, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, tomato ornamental, shrub, nut, chickpea, pigeon pea, millets, hops, and pasture grasses.
- An expression cassette comprising the recombinant nucleic acid molecule of SEQ ID NO: 3 or SEQ ID NO: 331, wherein the nucleic acid is operably linked to one or more regulatory sequences directing expression of the polypeptide of SEQ ID NO: 4 or SEQ ID NO: 332.
- a plant comprising the expression cassette of embodiment 103.
- a plant cell comprising the expression cassette of embodiment 103.
- a method for expressing in a plant a insecticidal protein comprising
- a plant capable of expressing a recombinant protein of SEQ ID NO: 4.
- a method for controlling an insect pest population comprising contacting the insect pest population with a insecticidally-effective amount of a recombinant protein of SEQ ID NO: 4.
- a method of inhibiting growth or killing an insect pest comprising contacting the insect pest with a insecticidally-effective amount of a recombinant protein of SEQ ID NO: 4.
- a method for controlling an insect pest population resistant to a pesticidal protein comprising contacting the insect pest population with a insecticidally-effective amount of a recombinant protein of SEQ ID NO: 4.
- a method for protecting a plant from an insect pest comprising expressing in the plant or cell thereof a recombinant insecticidal protein of SEQ ID NO: 4.
- a recombinant nucleic acid molecule encoding a insecticidal protein comprising a polypeptide having at least 80% identity to the amino acid sequence of SEQ ID NO: 6.
- nucleic acid molecule of embodiment 117, 118, 119, 120 or 121, wherein the nucleic acid molecule is produced by a Pseudomonas entomophila strain.
- insecticidal protein comprises an amino acid motif as represented by positions 171-183 of SEQ ID NO: 6 or positions 171-183 of SEQ ID NO: 213.
- the recombinant nucleic acid molecule of embodiment 123, wherein the insecticidal protein further comprises any one or more amino acid motifs as represented by positions 149-159 of SEQ ID NO: 213 and positions 69-79 of SEQ ID NO: 213.
- a recombinant insecticidal protein comprising a polypeptide having at least 80% identity to the amino acid sequence of SEQ ID NO: 6.
- insecticidal protein of embodiment 125 or 126 wherein the insecticidal protein has insecticidal activity against an insect pest in the order Hemiptera.
- insecticidal protein of embodiment 125 wherein the insecticidal protein comprises an amino acid motif as represented by positions 171-183 of SEQ ID NO: 213.
- insecticidal protein of embodiment 131 wherein the insecticidal protein further comprises any one or more amino acid motifs as represented by positions 149-159 of SEQ ID NO: 213, and positions 69-79 of SEQ ID NO: 213.
- a plant or progeny thereof stably transformed with the recombinant nucleic acid molecule of embodiment 117, 118, 119, 120, 121, 122, 123 or 124.
- the plant or progeny thereof of embodiment 133 or 134 wherein the plant is selected from barley, corn, oat, rice, rye, sorghum, turf grass, sugarcane, wheat, alfalfa, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, a cucurbit, eucalyptus , flax, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, tomato ornamental, shrub, nut, chickpea, pigeon pea, millets, hops, and pasture grass plant cells.
- An expression cassette comprising the recombinant nucleic acid molecule encoding the insecticidal protein of embodiment 117, 118, 119, 120, 121, 122, 123 or 124, wherein the nucleic acid is operably linked to one or more regulatory sequences directing expression of the insecticidal protein.
- a plant comprising the expression cassette of embodiment 139.
- a plant cell comprising the expression cassette of embodiment 139.
- a method for expressing in a plant a insecticidal protein comprising
- a method for controlling an insect pest population comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- a method of inhibiting growth or killing an insect pest comprising contacting the insect pest with a insecticidally-effective amount of a recombinant insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- a method for controlling an insect pest population resistant to a pesticidal protein comprising contacting the insect pest population with a pesticidally-effective amount of a recombinant protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- a method for protecting a plant from an insect pest comprising expressing in the plant or cell thereof a recombinant pesticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- a method of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and providing insect resistance management comprising expressing in the plant at least two different insecticidal proteins having different modes of action, wherein one of the at least two insecticidal proteins comprises a insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132, insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- one of the at least two insecticidal proteins comprises a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- a method of reducing likelihood of emergence of Lepidoptera and/or Hemiptera insect species resistance to transgenic plants expressing in the plants insecticidal proteins to control the insect species comprising expressing a first insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132, insecticidal to the insect species in combination with a second insecticidal protein insecticidal to the insect species having a different mode of action compared to the first insecticidal protein.
- a means for effective Lepidoptera and/or Hemiptera insect resistance management comprising co-expressing at high levels in transgenic plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or killing activity, wherein one of the two or more insecticidal proteins comprise a insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132 and one of the two or more insecticidal proteins comprise a Cry protein.
- a method for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera comprising the step of referring to, submitting or relying on insect assay binding data showing that the insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132 does not compete with binding sites for a Cry protein in the insects.
- a method of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and providing insect resistance management comprising expressing in the plant at least two different insecticidal proteins having different modes of action, wherein one of the at least two insecticidal proteins comprises the amino acid sequence of SEQ ID NO: 4, insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- one of the at least two insecticidal proteins comprises a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- a method of reducing likelihood of emergence of Lepidoptera and/or Hemiptera insect species resistance to transgenic plants expressing in the plants insecticidal proteins to control the insect species comprising expressing the insecticidal protein of SEQ ID NO: 4 insecticidal to the insect species in combination with an insecticidal protein insecticidal to the insect species having a different modes of action compared to the protein of SEQ ID NO: 4.
- a means for effective Lepidoptera and/or Hemiptera insect resistance management comprising co-expressing at high levels in transgenic plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or killing activity, wherein one of the two or more insecticidal proteins comprise the insecticidal protein of SEQ ID NO: 4 and one of the two or more insecticidal proteins comprise a Cry protein.
- a method for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera comprising the step of referring to, submitting or relying on insect assay binding data showing that the insecticidal protein of SEQ ID NO: 4 does not compete with binding sites for a Cry protein in the insects.
- FIG. 1 shows the alignment of PIP-1A (SEQ ID NO: 2); the active insecticidal protein orthologs PSEEN3174 (SEQ ID NO: 6) and PIP-1B (SEQ ID NO: 4); and the inactive homologs AECFG_592740 (SEQ ID NO: 12); Pput_1063 (SEQ ID NO: 8); and Pput_1064 (SEQ ID NO: 10).
- the motifs [amino acids 64-79 of SEQ ID NO: 2 (motif 1), amino acids 149-159 of SEQ ID NO: 2 (motif 2), amino acids 171-183 of SEQ ID NO: 2 (motif 3), and amino acids 240-249 of SEQ ID NO: 2 (motif 4)] are indicated in bold and underline in the PIP-1A sequence.
- the predicted secondary structures of selected beta-sheets are indicated with “B” above the sequence.
- FIG. 2 illustrates a generalized sewing and rescuing PCR mutagenesis strategy using degenerate oligonucleotides to generate partially or fully saturated amino acid substitutions at positions in the PIP-1A protein.
- FIG. 3 A- 3 C shows the alignment of Pseudomonas chlororaphis strain SS44C4 16S ribosomal DNA (SEQ ID NO: 216) and Pseudomonas entomophila L48 16S ribosomal DNA (SEQ ID NO: 217) having 96.8% identity. Differences between the sequences are indicated in Bold and Underlined.
- FIG. 4 shows the results of the Lygus insecticidal activity screening of PIP-1A polypeptide variants having multiple amino acid substitutions at residues 240-249 of SEQ ID NO: 2 (motif 4). The insecticidal activity was scored from 0 to 8 with 8 being the most active.
- FIG. 5 shows the sequence alignment of PIP-1A (SEQ ID NO: 2), PIP-1B (SEQ ID NO: 4), PIP-1C (SEQ ID NO: 332) and PSEEN3174 (SEQ ID NO: 6).
- compositions and methods for controlling pests involve transforming organisms with a nucleic acid sequence encoding a PIP-1 polypeptide.
- the nucleic acid sequences of the embodiments are useful for preparing plants and microorganisms that possess pesticidal activity.
- transformed bacteria, plants, plant cells, plant tissues and seeds are provided.
- Compositions are pesticidal nucleic acids and proteins of bacterial species.
- the nucleic acid sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other homologous (or partially homologous) genes, and for the generation of altered PIP-1 polypeptides by methods known in the art, such as site directed mutagenesis, domain swapping or DNA shuffling.
- the PIP-1 polypeptides find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran, and nematode pest populations and for producing compositions with pesticidal activity.
- Insect pests of interest include, but are not limited to, the superfamily of stink bugs and other related insects including, but not limited to, species belonging to the family Pentatomidae ( Nezara viridula, Halyomorpha halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare, Euschistus heros, Euschistus tristigmus, Acrosternum hilare, Dichelops furcatus, Dichelops melacanthus , and Bagrada hilaris ( Bagrada Bug)), the family Plataspidae ( Megacopta cribraria —Bean plataspid), and the family Cydnidae ( Scaptocoris castanea —Root stink bug) and Lepidoptera species including but not limited to: diamond-back moth, e.g., Helicoverpa zea Boddie; soybean looper, e.g., Pseudoplusia includens
- Pesticidal toxin or “pesticidal protein” is intended a toxin that has toxic activity against one or more pests, including, but not limited to, members of the Lepidoptera, Diptera, Hemiptera and Coleoptera orders or the Nematoda phylum or a protein that has homology to such a protein. Pesticidal proteins have been isolated from organisms including, for example, Bacillus sp., Pseudomonas sp., Photorhabdus sp., Xenorhabdus sp., Clostridium bifermentans and Paenibacillus popilliae .
- Pesticidal proteins include but are not limited to: insecticidal proteins from Pseudomonas sp. such as PSEEN3174 (Monalysin, (2011) PLoS Pathogens, 7:1-13), from Pseudomonas protegens strain CHAO and Pf-5 (previously fluorescens ) (Pechy-Tarr, (2008) Environmental Microbiology 10:2368-2386: GenBank Accession No. EU400157); from Pseudomonas taiwanensis (Liu, et al., (2010) J. Agric. Food Chem.
- Pseudomonas sp. such as PSEEN3174 (Monalysin, (2011) PLoS Pathogens, 7:1-13), from Pseudomonas protegens strain CHAO and Pf-5 (previously fluorescens ) (Pechy-Tarr, (2008) Environmental Microbiology 10:2368-2386: GenBank
- B. thuringiensis insecticidal proteins include, but are not limited to Cry1Aa1 (Accession #Accession #M11250), Cry1Aa2 (Accession #M10917), Cry1Aa3 (Accession #D00348), Cry1Aa4 (Accession #X13535), Cry1Aa5 (Accession #D17518), Cry1Aa6 (Accession #U43605), Cry1Aa7 (Accession #AF081790), Cry1Aa8 (Accession #126149), Cry1Aa9 (Accession #AB026261), Cry1Aa10 (Accession #AF154676), Cry1Aa11 (Accession #Y09663), Cry1Aa12 (Accession #AF384211), Cry1Aa13 (Accession #AF510713), Cry1Aa14
- Examples of ⁇ -endotoxins also include but are not limited to Cry1A proteins of U.S. Pat. Nos. 5,880,275 and 7,858,849; a DIG-3 or DIG-11 toxin (N-terminal deletion of ⁇ -helix 1 and/or ⁇ -helix 2 variants of Cry proteins such as Cry1A) of U.S. Pat. Nos. 8,304,604 and 8,304,605, Cry1B of U.S. patent application Ser. No. 10/525,318; Cry1C of U.S. Pat. No. 6,033,874; Cry1F of U.S. Pat. Nos. 5,188,960, 6,218,188; Cry1A/F chimeras of U.S. Pat.
- a Cry2 protein such as Cry2Ab protein of U.S. Pat. No. 7,064,249
- a Cry3A protein including but not limited to an engineered hybrid insecticidal protein (eHIP) created by fusing unique combinations of variable regions and conserved blocks of at least two different Cry proteins (US Patent Application Publication Number 2010/0017914); a Cry4 protein; a Cry5 protein; a Cry6 protein; Cry8 proteins of U.S. Pat. Nos.
- eHIP engineered hybrid insecticidal protein
- a Cry9 protein such as such as members of the Cry9A, Cry9B, Cry9C, Cry9D, Cry9E, and Cry9F families; a Cry15 protein of Naimov, et al., (2008) Applied and Environmental Microbiology 74:7145-7151; a Cry22, a Cry34Ab1 protein of U.S. Pat. Nos. 6,127,180, 6,624,145 and 6,340,593; a CryET33 and CryET34 protein of U.S. Pat. Nos.
- Cry proteins are well known to one skilled in the art (for review, see, van Frannkenhuyzen, (2009) J. Invert. Path. 101:1-16).
- the use of Cry proteins as transgenic plant traits is well known to one skilled in the art and Cry-transgenic plants including but not limited to Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105, Cry1F, Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, mCry3A, Cry9c and CBI-Bt have received regulatory approval (see, Sanahuja, (2011) Plant Biotech Journal 9:283-300 and the CERA (2010) GM Crop Database Center for Environmental Risk Assessment (CERA), ILSI Research Foundation, Washington D.C.
- More than one pesticidal proteins well known to one skilled in the art can also be expressed in plants such as Vip3Ab & Cry1Fa (US2012/0317682), Cry1BE & Cry1F (US2012/0311746), Cry1CA & Cry1AB (US2012/0311745), Cry1F & CryCa (US2012/0317681), Cry1DA & Cry1BE (US2012/0331590), Cry1DA & Cry1Fa (US2012/0331589), Cry1AB & Cry1BE (US2012/0324606), and Cry1Fa & Cry2Aa, Cry1I or Cry1E (US2012/0324605).
- Vip3Ab & Cry1Fa US2012/0317682
- Cry1BE & Cry1F US2012/0311746
- Cry1CA & Cry1AB US2012/0311745
- Cry1F & CryCa
- Pesticidal proteins also include insecticidal lipases including lipid acyl hydrolases of U.S. Pat. No. 7,491,869, and cholesterol oxidases such as from Streptomyces (Purcell et al. (1993) Biochem Biophys Res Commun 15:1406-1413). Pesticidal proteins also include VIP (vegetative insecticidal proteins) toxins of U.S. Pat. Nos. 5,877,012, 6,107,279, 6,137,033, 7,244,820, 7,615,686, and 8,237,020, and the like.
- VIP vegetable insecticidal proteins
- Pesticidal proteins are well known to one skilled in the art (see, lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html which can be accessed on the world-wide web using the “www” prefix).
- Pesticidal proteins also include toxin complex (TC) proteins, obtainable from organisms such as Xenorhabdus, Photorhabdus and Paenibacillus (see, U.S. Pat. Nos. 7,491,698 and 8,084,418).
- Some TC proteins have “stand alone” insecticidal activity and other TC proteins enhance the activity of the stand-alone toxins produced by the same given organism.
- TC protein from Photorhabdus, Xenorhabdus or Paenibacillus , for example
- TC protein “potentiators” derived from a source organism of a different genus.
- TC protein “potentiators” derived from a source organism of a different genus.
- Class B proteins are TcaC, TcdB, XptB1Xb and XptC1Wi.
- Class C proteins are TccC, XptC1Xb and XptB1Wi.
- Pesticidal proteins also include spider, snake and scorpion venom proteins. Examples of spider venom peptides include but are not limited to lycotoxin-1 peptides and mutants thereof (U.S. Pat. No. 8,334,366).
- the PIP-1 polypeptides include amino acid sequences deduced from the full-length nucleic acid sequences disclosed herein, and amino acid sequences that are shorter than the full-length sequences, either due to the use of an alternate downstream start site or due to processing that produces a shorter protein having pesticidal activity. Processing may occur in the organism after the protein is expressed in or in the pest after ingestion of the protein.
- novel isolated or recombinant nucleic acid sequences encoding polypeptides that confer pesticidal activity.
- amino acid sequences of PIP-1 polypeptides are also provided. The protein resulting from translation of these PIP-1 polypeptide genes allows cells to control or kill pests that ingest it.
- the bacterial strain is a Pseudomonas chlororaphis strain.
- the bacterial strain is a biologically pure culture of a Pseudomonas chlororaphis strain SS44C4, deposited on Dec. 1, 2011 under Accession Number NRRLB-50613 with the Agricultural Research Service Culture Collection (NRRL).
- the bacterial strain is a biologically pure culture of a Pseudomonas chlororaphis strain having a 16S ribosomal DNA having at least about 96.9%, 97%, 97.1%, 97.2%, 97.3%.
- nucleic acid molecules comprising nucleic acid sequences encoding PIP-1 polypeptides and polypeptides or biologically active portions thereof, as well as nucleic acid molecules sufficient for use as hybridization probes to identify nucleic acid molecules encoding proteins with regions of sequence homology.
- nucleic acid molecule is intended to include DNA molecules (e.g., recombinant DNA, cDNA, genomic DNA, plastid DNA, mitochondrial DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs.
- the nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA.
- an “isolated” or “recombinant” nucleic acid molecule (or DNA) is used herein to refer to a nucleic acid sequence (or DNA) that is no longer in its natural environment, for example in an in vitro or in a recombinant bacterial or plant host cell.
- an “isolated” or “recombinant” nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5′ and 3′ ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
- isolated or “recombinant” when used to refer to nucleic acid molecules excludes isolated chromosomes.
- the recombinant nucleic acid molecule encoding a PIP-1 polypeptide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleic acid sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
- polynucleotides that encode PIP-1 polypeptides or related proteins are contemplated. Such polynucleotides are useful for production of PIP-1 polypeptides in host cells when operably linked to suitable promoter, transcription termination and/or polyadenylation sequences. Such polynucleotides are also useful as probes for isolating homologous or substantially homologous polynucleotides that encode PIP-1 polypeptides or related proteins.
- Pseudomonas chlororaphis strain which contains the PIP-1A polynucleotide of SEQ ID NO: 1 encoding the PIP-1A polypeptide of SEQ ID NO: 2.
- This polynucleotide sequence was isolated from a Pseudomonas chlororaphis host and is thus suitable for expression of the encoded PIP-1A polypeptide in other bacterial hosts.
- SEQ ID NO: 1 can be used to express the PIP-1A protein in bacterial hosts that include but are not limited to an Agrobacterium , an Alcaligenes , a Bacillus , an Escherichia , a Salmonella , a Pseudomonas and a Rhizobium bacterial host cells.
- the polynucleotides are also useful as probes for isolating homologous or substantially homologous polynucleotides that encode PIP-1 polypeptides or related proteins. Such probes can be used to identify homologous or substantially homologous polynucleotides derived from Pseudomonas or other bacterial strains.
- Polynucleotides that encode a PIP-1 polypeptide can also be synthesized de novo from a PIP-1 polypeptide sequence.
- the sequence of the polynucleotide gene can be deduced from a PIP-1A polypeptide sequence through use of the genetic code.
- Computer programs such as “BackTranslate” (GCGTM Package, Acclerys, Inc. San Diego, Calif.) can be used to convert a peptide sequence to the corresponding nucleotide sequence encoding the peptide.
- Examples of PIP-1 polypeptide sequences that can be used to obtain corresponding nucleotide encoding sequences include, but are not limited to, the PIP-1 polypeptide sequence of SEQ ID NO: 2.
- synthetic PIP-1A polynucleotide sequences of the invention can be designed so that they will be expressed in plants.
- U.S. Pat. No. 5,500,365 describes a method for synthesizing plant genes to improve the expression level of the protein encoded by the synthesized gene. This method relates to the modification of the structural gene sequences of the exogenous transgene, to cause them to be more efficiently transcribed, processed, translated and expressed by the plant.
- genes that are expressed well in plants include elimination of sequences that can cause undesired intron splicing or polyadenylation in the coding region of a gene transcript while retaining substantially the amino acid sequence of the toxic portion of the insecticidal protein.
- a similar method for obtaining enhanced expression of transgenes in monocotyledonous plants is disclosed in U.S. Pat. No. 5,689,052.
- the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having the sequence set forth in SEQ ID NO: 1, 3 or 331 and variants, fragments and complements thereof.
- complement is intended a nucleic acid sequence that is sufficiently complementary to a given nucleic acid sequence such that it can hybridize to the given nucleic acid sequence to thereby form a stable duplex.
- the nucleic acid molecule encoding a PIP-1 polypeptide is a nucleic acid molecule having the sequence set forth in SEQ ID NO: 1, 3 or 331.
- the corresponding amino acid sequences for the insecticidal protein encoded by these nucleic acid sequences are set forth in SEQ ID NO: 2, 4 and 332.
- the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO:4 or SEQ ID NO: 332, wherein the polypeptide has pesticidal activity.
- nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 2, wherein the polypeptide has pesticidal activity.
- nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 4, wherein the polypeptide has pesticidal activity.
- the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 332, wherein the polypeptide has pesticidal activity.
- the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence of (SEQ ID NO: 211), wherein Xaa at position 2 is Pro or Thr; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser
- the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence of a sequence of SEQ ID NO: 212, wherein Xaa at position 2 is Pro or Thr; Xaa at position 3 is lie or Thr; Xaa at position 6 is Glu or Gly; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 28 is
- the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) amino acids 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 2, amino
- the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid as represented by positions 171-183 of SEQ ID NO: 213 wherein at least one amino acid at positions 171-183 of SEQ ID NO: 213 are not identical to amino acids at positions 171-183 of SEQ ID NO: 6.
- the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO:4 and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids
- the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO:4 and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 211, amino
- the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity to the amino acid sequence set forth in SEQ ID NO: 2 and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213,
- the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2 and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 2 and
- the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity to the amino acid sequence set forth in SEQ ID NO: 2, and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2 or amino acids 171-183 of SEQ ID NO: 213 and iv) amino acids 240-249 of SEQ ID NO: 2 or amino acids 240-2
- the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2, and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2 or amino acids 171-183 of SEQ ID NO: 213 and iv) amino acids 240-249 of SEQ ID NO: 2 or amino acids 240-249 of SEQ ID NO: 213.
- exemplary nucleic acid molecules encode a PIP-1 polypeptide of SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 298, 299,
- exemplary nucleic acid molecules encode a PIP-1 polypeptide of SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, and 269 as well as amino acid
- exemplary nucleic acid molecules comprise a sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 270, 271, 272, 273, 274, 275, 276, 277, 27
- exemplary nucleic acid molecules comprise a sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, and 244 as well as variants and fragments thereof encoding PIP-1 polypeptides
- nucleic acid molecules encode a PIP-1 polypeptide of Table 4, Table 6, Table 9, Table 12, Table 13, Table 14 and/or Table 16, combinations of the amino acid substitutions thereof and deletions and/or insertions thereof.
- nucleic acid molecules that encode transcription and/or translation products that are subsequently spliced to ultimately produce functional PIP-1 polypeptide.
- Splicing can be accomplished in vitro or in vivo, and can involve cis- or trans-splicing.
- the substrate for splicing can be polynucleotides (e.g., RNA transcripts) or polypeptides.
- An example of cis-splicing of a polynucleotide is where an intron inserted into a coding sequence is removed and the two flanking exon regions are spliced to generate a PIP-1 polypeptide encoding sequence.
- trans splicing would be where a polynucleotide is encrypted by separating the coding sequence into two or more fragments that can be separately transcribed and then spliced to form the full-length pesticidal encoding sequence.
- the use of a splicing enhancer sequence which can be introduced into a construct, can facilitate splicing either in cis or trans-splicing of polypeptides (U.S. Pat. Nos. 6,365,377 and 6,531,316).
- the polynucleotides do not directly encode a full-length PIP-1 polypeptide, but rather encode a fragment or fragments of a PIP-1 polypeptide.
- polynucleotides can be used to express a functional PIP-1 polypeptide through a mechanism involving splicing, where splicing can occur at the level of polynucleotide (e.g., intron/exon) and/or polypeptide (e.g., intein/extein).
- splicing can occur at the level of polynucleotide (e.g., intron/exon) and/or polypeptide (e.g., intein/extein).
- This can be useful, for example, in controlling expression of pesticidal activity, since functional pesticidal polypeptide will only be expressed if all required fragments are expressed in an environment that permits splicing processes to generate functional product.
- introduction of one or more insertion sequences into a polynucleotide can facilitate recombination with a low homology polynucleotide; use of an intron or intein for the insertion sequence facilitates the removal of the intervening sequence, thereby restoring function of the encoded variant.
- Nucleic acid molecules that are fragments of these nucleic acid sequences encoding PIP-1 polypeptides are also encompassed by the embodiments.
- fragment is intended a portion of the nucleic acid sequence encoding a PIP-1 polypeptide.
- a fragment of a nucleic acid sequence may encode a biologically active portion of a PIP-1 polypeptide or it may be a fragment that can be used as a hybridization probe or PCR primer using methods disclosed below.
- Nucleic acid molecules that are fragments of a nucleic acid sequence encoding a PIP-1 polypeptide comprise at least about 50, 100, 200, 300, 400, 500, 600 or 700, contiguous nucleotides or up to the number of nucleotides present in a full-length nucleic acid sequence encoding a PIP-1 polypeptide disclosed herein, depending upon the intended use.
- contiguous nucleotides is intended nucleotide residues that are immediately adjacent to one another. Fragments of the nucleic acid sequences of the embodiments will encode protein fragments that retain the biological activity of the PIP-1 polypeptide and, hence, retain insecticidal activity.
- the term “pesticidal activity” refers to activity of an organism or a substance (such as, for example, a protein) that can be measured by, but is not limited to, pest mortality, pest weight loss, pest repellency, and other behavioral and physical changes of a pest after feeding and exposure for an appropriate length of time.
- an organism or substance having pesticidal activity adversely impacts at least one measurable parameter of pest fitness.
- “pesticidal proteins” are proteins that display pesticidal activity by themselves or in combination with other proteins.
- insecticidal activity refers to activity of an organism or a substance (such as, for example, a protein) that can be measured by, but is not limited to, insect mortality, insect weight loss, insect repellency, and other behavioral and physical changes of an insect after feeding and exposure for an appropriate length of time.
- insect mortality e.g., insect mortality
- insect weight loss e.g., insect repellency
- insect repellency e.g., insect repellency
- other behavioral and physical changes of an insect after feeding and exposure for an appropriate length of time e.g., insect mortality, insect weight loss, insect repellency, and other behavioral and physical changes of an insect after feeding and exposure for an appropriate length of time.
- insecticidal proteins are proteins that display insecticidal activity by themselves or in combination with other proteins.
- the term “pesticidally effective amount” connotes a quantity of a substance or organism that has pesticidal activity when present in the environment of a pest. For each substance or organism, the pesticidally effective amount is determined empirically for each pest affected in a specific environment. Similarly, an “insecticidally effective amount” may be used to refer to a “pesticidally effective amount” when the pest is an insect pest.
- the PIP-1A polypeptide has at least about 10%, at least about 30%, at least about 50%, at least about 70%, 80%, 90%, 95% or higher of the insecticidal activity compared to the full-length PIP-1A polypeptide (SEQ ID NO:2).
- the insecticidal activity is against a Lepidoptera species. In another embodiment, the insecticidal activity is against a Hemiptera species.
- a fragment of a nucleic acid sequence encoding a PIP-1 polypeptide encoding a biologically active portion of a protein will encode at least about 15, 25, 30, 50, 75, 100, 125, 150, 175, 200 or 250, contiguous amino acids or up to the total number of amino acids present in a full-length PIP-1 polypeptide of the embodiments.
- the fragment is an N-terminal or a C-terminal truncation of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or more amino acids relative to SEQ ID NO: 2, 3 or 4 or variants thereof, e.g., by proteolysis, insertion of a start codon, deletion of the codons encoding the deleted amino acids with the concomitant insertion of a stop codon or by insertion of a stop codon in the coding sequence.
- the fragments encompassed herein result from the removal of the N-terminal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or more amino acids relative to SEQ ID NO: 2, 3 or 4 or variants thereof, e.g., by proteolysis or by insertion of a start codon in the coding sequence.
- the PIP-1 polypeptides are encoded by a nucleic acid sequence sufficiently identical to the nucleic acid sequence of SEQ ID NO: 1, 3 or 5.
- a nucleic acid sequence sufficiently identical is intended an amino acid or nucleic acid sequence that has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity compared to a reference sequence using one of the alignment programs described herein using standard parameters.
- sequence homology identity is against the full length sequence of the polynucleotide encoding a PIP-1 polypeptide or against the full length sequence of a PIP-1 polypeptide.
- the PIP-1 polypeptide has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity compared to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 332 or SEQ ID NO: 6.
- the sequences are aligned for optimal comparison purposes.
- the two sequences are the same length.
- the comparison is across the entirety of the reference sequence (e.g., across the entirety of SEQ ID NO: 1, 331 or 3 or across the entirety of one of SEQ ID NO: 2, 332 or 4).
- the percent identity between two sequences can be determined using techniques similar to those described below, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.
- the determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
- a non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, (1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin and Altschul, (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the BLASTN and BLASTX programs of Altschul, et al., (1990) J. Mol. Biol. 215:403.
- Gapped BLAST in BLAST 2.0
- PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules. See, Altschul, et al., (1997) supra.
- BLAST Altschul et al.
- Gapped BLAST e.g., BLASTX and BLASTN
- Alignment may also be performed manually by inspection.
- ClustalW compares sequences and aligns the entirety of the amino acid or DNA sequence and thus can provide data about the sequence conservation of the entire amino acid sequence.
- the ClustalW algorithm is used in several commercially available DNA/amino acid analysis software packages, such as the ALIGNX module of the Vector NTI Program Suite (Invitrogen Corporation, Carlsbad, Calif.). After alignment of amino acid sequences with ClustalW, the percent amino acid identity can be assessed.
- GENEDOCTM A non-limiting example of a software program useful for analysis of ClustalW alignments.
- GENEDOCTM (Karl Nicholas) allows assessment of amino acid (or DNA) similarity and identity between multiple proteins.
- Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, (1988) CABIOS 4:11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys, Inc., 9685 Scranton Rd., San Diego, Calif., USA).
- ALIGN program version 2.0
- a gap length penalty of 12 and a gap penalty of 4 can be used.
- Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48(3):443-453, used GAP Version 10 software to determine sequence identity or similarity using the following default parameters: % identity and % similarity for a nucleic acid sequence using GAP Weight of 50 and Length Weight of 3 and the nwsgapdna.cmpii scoring matrix; % identity or % similarity for an amino acid sequence using GAP weight of 8 and length weight of 2, and the BLOSUM62 scoring program. Equivalent programs may also be used.
- Equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
- the embodiments also encompass nucleic acid molecules encoding variants of PIP-1 polypeptide.
- “Variants” of the PIP-1 polypeptide encoding nucleic acid sequences include those sequences that encode the PIP-1 polypeptides disclosed herein but that differ conservatively because of the degeneracy of the genetic code as well as those that are sufficiently identical as discussed above.
- Naturally occurring allelic variants can be identified with the use of well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques as outlined below.
- Variant nucleic acid sequences also include synthetically derived nucleic acid sequences that have been generated, for example, by using site-directed mutagenesis but which still encode the PIP-1 polypeptides disclosed as discussed below.
- variant nucleic acid molecules can be created by introducing one or more nucleotide substitutions, additions or deletions into the corresponding nucleic acid sequence disclosed herein, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Such variant nucleic acid sequences are also encompassed by the present invention.
- variant nucleic acid sequences can be made by introducing mutations randomly along all or part of the coding sequence, such as by saturation mutagenesis and the resultant mutants can be screened for ability to confer pesticidal activity to identify mutants that retain activity.
- the encoded protein can be expressed recombinantly, and the activity of the protein can be determined using standard assay techniques.
- polynucleotides of the disclosure and fragments thereof are optionally used as substrates for a variety of recombination and recursive recombination reactions, in addition to standard cloning methods as set forth in, e.g., Ausubel, Berger and Sambrook, i.e., to produce additional pesticidal polypeptide homologues and fragments thereof with desired properties.
- standard cloning methods as set forth in, e.g., Ausubel, Berger and Sambrook, i.e., to produce additional pesticidal polypeptide homologues and fragments thereof with desired properties.
- a variety of such reactions are known, including those developed by the inventors and their co-workers.
- Methods for producing a variant of any nucleic acid listed herein comprising recursively recombining such polynucleotide with a second (or more) polynucleotide, thus forming a library of variant polynucleotides are also embodiments of the disclosure, as are the libraries produced, the cells comprising the libraries, and any recombinant polynucleotide produces by such methods. Additionally, such methods optionally comprise selecting a variant polynucleotide from such libraries based on pesticidal activity, as is wherein such recursive recombination is done in vitro or in vivo.
- a variety of diversity generating protocols including nucleic acid recursive recombination protocols are available and fully described in the art.
- the procedures can be used separately, and/or in combination to produce one or more variants of a nucleic acid or set of nucleic acids, as well as variants of encoded proteins. Individually and collectively, these procedures provide robust, widely applicable ways of generating diversified nucleic acids and sets of nucleic acids (including, e.g., nucleic acid libraries) useful, e.g., for the engineering or rapid evolution of nucleic acids, proteins, pathways, cells and/or organisms with new and/or improved characteristics.
- any of the diversity generating procedures described herein can be the generation of one or more nucleic acids, which can be selected or screened for nucleic acids with or which confer desirable properties or that encode proteins with or which confer desirable properties.
- any nucleic acids that are produced can be selected for a desired activity or property, e.g. pesticidal activity or, such activity at a desired pH, etc. This can include identifying any activity that can be detected, for example, in an automated or automatable format, by any of the assays in the art, see, e.g., discussion of screening of insecticidal activity, infra.
- a variety of related (or even unrelated) properties can be evaluated, in serial or in parallel, at the discretion of the practitioner.
- Mutational methods of generating diversity include, for example, site-directed mutagenesis (Ling, et al., (1997) Anal Biochem 254(2):157-178; Dale, et al., (1996) Methods Mol Biol 57:369-374; Smith, (1985) Ann Rev Genet 19:423-462; Botstein and Shortle, (1985) Science 229:1193-1201; Carter, (1986) Biochem J 237:1-7 and Kunkel, (1987) “The efficiency of oligonucleotide directed mutagenesis” in Nucleic Acids & Molecular Biology (Eckstein and Lilley, eds., Springer Verlag, Berlin)); mutagenesis using uracil containing templates (Kunkel, (1985) PNAS USA 82:488-492; Kunkel, et al., (1987) Methods Enzymol 154:367-382 and Bass, et al., (1988) Science 242:240-245); oligonucleo
- Additional suitable methods include point mismatch repair (Kramer, et al., (1984) Cell 38:879-887), mutagenesis using repair-deficient host strains (Carter, et al., (1985) Nucl Acids Res 13:4431-4443 and Carter, (1987) Methods in Enzymol 154:382-403), deletion mutagenesis (Eghtedarzadeh and Henikoff, (1986) Nucl Acids Res 14:5115), restriction-selection and restriction-purification (Wells, et al., (1986) Phil Trans R Soc Lond A 317:415-423), mutagenesis by total gene synthesis (Nambiar, et al., (1984) Science 223:1299-1301; Sakamar and Khorana, (1988) Nucl Acids Res 14:6361-6372; Wells, et al., (1985) Gene 34:315-323 and Grundstrom, et al., (1985) Nucl Acids
- the nucleotide sequences of the embodiments can also be used to isolate corresponding sequences from other organisms, particularly other bacteria, particularly a Pseudomonas species and more particularly a Pseudomonas chlororaphis strain. In this manner, methods such as PCR, hybridization and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences that are selected based on their sequence identity to the entire sequences set forth herein or to fragments thereof are encompassed by the embodiments. Such sequences include sequences that are orthologs of the disclosed sequences.
- the term “orthologs” refers to genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share substantial identity as defined elsewhere herein. Functions of orthologs are often highly conserved among species.
- oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest.
- Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.), hereinafter “Sambrook”. See also, Innis, et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds.
- PCR PCR Strategies
- nested primers single specific primers
- degenerate primers gene-specific primers
- vector-specific primers partially-mismatched primers
- the bacterial cell lysates can be screened with antibodies generated against PIP-1A (SEQ ID NO: 2), PSEEN3174 (SEQ ID NO: 6), PIP-1B (SEQ ID NO: 4) and PIP-1C (SEQ ID NO: 332) proteins using Western blotting and/or ELISA methods.
- This type of assays can be performed in a high throughput fashion. Positive samples can be further analyzed by various techniques such as antibody based protein purification and identification. Methods of generating antibodies are well known in the art as discussed infra.
- mass spectrometry based protein identification method can be used to identify homologs of PIP-1A (SEQ ID NO: 2) using protocols in the literatures (Patterson, (1998), 10(22):1-24, Current Protocol in Molecular Biology published by John Wiley & Son Inc).
- LC-MS/MS based protein identification method is used to associate the MS data of given cell lysate or desired molecular weight enriched samples (excised from SDS-PAGE gel of relevant molecular weight bands to PIP-1A protein) with sequence information of PIP-1A (SEQ ID NO: 2) and its homologs. Any match in peptide sequences indicates the potential of having the homologous proteins in the samples. Additional techniques (protein purification and molecular biology) can be used to isolate the protein and identify the sequences of the homologs.
- hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments or other oligonucleotides, and may be labeled with a detectable group such as 32P or any other detectable marker, such as other radioisotopes, a fluorescent compound, an enzyme or an enzyme co-factor.
- Probes for hybridization can be made by labeling synthetic oligonucleotides based on the known PIP-1 polypeptide-encoding nucleic acid sequence disclosed herein.
- the probe typically comprises a region of nucleic acid sequence that hybridizes under stringent conditions to at least about 12, at least about 25, at least about 50, 75, 100, 125, 150, 175 or 200 consecutive nucleotides of nucleic acid sequence encoding a PIP-1 polypeptide of the disclosure or a fragment or variant thereof.
- Methods for the preparation of probes for hybridization are generally known in the art and are disclosed in Sambrook and Russell, (2001), supra, herein incorporated by reference.
- an entire nucleic acid sequence, encoding a PIP-1 polypeptide, disclosed herein or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding nucleic acid sequences encoding PIP-1 polypeptide-like sequences and messenger RNAs.
- probes include sequences that are unique and are preferably at least about 10 nucleotides in length or at least about 20 nucleotides in length.
- probes may be used to amplify corresponding pesticidal sequences from a chosen organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism.
- Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
- Hybridization of such sequences may be carried out under stringent conditions.
- stringent conditions or “stringent hybridization conditions” is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background).
- Stringent conditions are sequence-dependent and will be different in different circumstances.
- target sequences that are 100% complementary to the probe can be identified (homologous probing).
- stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
- a probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length.
- stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37° C., and a wash in 0.5 ⁇ to 1 ⁇ SSC at 55 to 60° C.
- Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1 ⁇ SSC at 60 to 65° C.
- wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
- the Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ⁇ 90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3 or 4° C.
- Tm thermal melting point
- moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9 or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15 or 20° C. lower than the thermal melting point (Tm).
- Tm thermal melting point
- Pseudomonas Insecticidal Protein-1 polypeptides are also encompassed by the disclosure.
- Pseudomonas Insecticidal Protein-1 Pseudomonas Insecticidal Protein-1
- PIP-1 polypeptide Pseudomonas Insecticidal Protein-1
- PIP-1 protein Pseudomonas Insecticidal Protein-1
- Pseudomonas chlororaphis strain which comprises the polynucleotide of SEQ ID NO: 1 encoding the PIP-1 polypeptide of SEQ ID NO: 2.
- protein As used herein, the terms “protein,” “peptide molecule” or “polypeptide” includes any molecule that comprises five or more amino acids. It is well known in the art that protein, peptide or polypeptide molecules may undergo modification, including post-translational modifications, such as, but not limited to, disulfide bond formation, glycosylation, phosphorylation or oligomerization. Thus, as used herein, the terms “protein,” “peptide molecule” or “polypeptide” includes any protein that is modified by any biological or non-biological process.
- amino acid and “amino acids” refer to all naturally occurring L-amino acids.
- a “recombinant protein” is used to refer to a protein that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.
- a PIP-1 polypeptide that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10% or 5% or less (by dry weight) of non-pesticidal protein (also referred to herein as a “contaminating protein”).
- “Fragments” or “biologically active portions” include polypeptide fragments comprising amino acid sequences sufficiently identical to a PIP-1 polypeptide and that exhibit insecticidal activity. “Fragments” or “biologically active portions” include polypeptide fragments comprising amino acid sequences sufficiently identical to the amino acid sequence set forth in SEQ ID NO: 2, 4, 332 and 6 including but not limited to SEQ ID NO: 204, 206 and 208 and that exhibit insecticidal activity.
- a biologically active portion of a PIP-1 polypeptide can be a polypeptide that is, for example, 10, 25, 50, 100, 150, 200, 250 or more amino acids in length. Such biologically active portions can be prepared by recombinant techniques and evaluated for insecticidal activity.
- a fragment comprises at least 8 contiguous amino acids of a PIP-1 polypeptide. In some embodiments a fragment comprises at least 8 contiguous amino acids of SEQ ID NO: 2 or 4. In some embodiments a fragment comprises at least 8 contiguous amino acids of SEQ ID NO: 2. In some embodiments a fragment comprises at least 8 contiguous amino acids of SEQ ID NO: 4. The embodiments encompass other fragments, however, such as any fragment in the protein greater than about 10, 20, 30, 50, 100, 150, 200, 250 or more amino acids.
- the fragment is an N-terminal and/or a C-terminal truncation of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or more amino acids relative to SEQ ID NO: 2 or 4 or variants thereof e.g., by proteolysis, by insertion of a start codon, by deletion of the codons encoding the deleted amino acids and concomitant insertion of a start codon and/or insertion of a stop codon.
- the fragments encompassed herein result from the removal of the N-terminal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or more amino acids relative to SEQ ID NO: 2 or 4, and variants thereof (e.g., SEQ ID NO: 204, 206, 208 and 330), e.g., by proteolysis or by insertion of a start codon, by deletion of the codons encoding the deleted amino acids and concomitant insertion of a start codon.
- the proteolytic cleavage site is between Ser34 and Asn35 of SEQ ID NO: 2 or variants thereof.
- the truncation is of the first 34 amino acids of SEQ ID NO: 2 resulting in a PIP-1 polypeptide from amino acids 35-271 of SEQ ID NO: 2.
- polynucleotides encoding the truncated PIP-1 polypeptides can be engineered to add a start codon at the N-terminus such as ATG encoding methionine or methionine followed by an alanine. It is also well known in the art that depending on what host the PIP-1 polypeptide is expressed in the methionine may be partially of completed processed off.
- proteins or polypeptides having an amino acid sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the parental amino acid sequence.
- a PIP-1 polypeptide has at least about 60%, 65%, about 70%, 75%, at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity across the entire length of the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO: 4.
- a PIP-1 polypeptide has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity across the entire length of the amino acid sequence of SEQ ID NO: 2.
- a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO:4, wherein the polypeptide has insecticidal activity. In some embodiments a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO: 4, wherein the polypeptide has insecticidal activity. In some embodiments a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 2, wherein the polypeptide has insecticidal activity.
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 211, wherein Xaa at position 2 is Pro or Thr; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 46
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 211 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or 61 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 211 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 211 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 or 54 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 211 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 212, wherein Xaa at position 2 is Pro or Thr; Xaa at position 3 is lie or Thr; Xaa at position 6 is Glu or Gly; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln;
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 212 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 212 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 212 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 or 54 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 212 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 213 wherein Xaa at position 2 is Pro, Thr or Ser; Xaa at position 3 is lie, Thr, Leu, Val, Met or Ser; Xaa at position 6 is Glu, Gly, Asp or Ala; Xaa at position 8 is Ser, Gly, Asn, Thr or Gln; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu, Val, Ile or Met; Xaa at position 21 is Lys, Ser, Asn, Arg, Thr or Gln; Xaa at position 22 is Ser, Lys, Arg or Thr; Xaa at position 24 is Gln, Gly, Asn or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser, Asn, Thr or Gln; Xaa at position 27 is Leu, Thr
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 213 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 213 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 213 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 or 54 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 213 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- a PIP-1 polypeptide comprises one or more amino acid motifs selected from i) an amino acid motif represented by amino acids at positions 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) an amino acid motif represented by amino acids at positions 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) an amino acid motif represented by amino acids at positions 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) an amino acid motif represented by amino acids at positions 240-249 of SEQ ID NO: 2, amino acids 240
- the PIP-1 polypeptide comprises an amino acid as represented by positions 171-183 of SEQ ID NO: 213 wherein at least one amino acid at positions 171-183 of SEQ ID NO: 213 are not identical to amino acids at positions 171-183 of SEQ ID NO: 6.
- a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO: 4 and comprises one or more amino acid motifs selected from i) an amino acid motif represented by amino acids at positions 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) an amino acid motif represented by amino acids at positions 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) an amino acid motif represented by amino acids at positions 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171
- a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO: 4 and comprises one or more amino acid motifs selected from i) an amino acid motif represented by amino acids at positions 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) an amino acid motif represented by amino acids at positions 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) an amino acid motif represented by amino acids at positions 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171
- exemplary PIP-1 polypeptides are encoded by the polynucleotide sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 270, 271, 272, 273,
- exemplary nucleic acid molecules comprise a sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, and 244 as well as variants and fragments thereof encoding PIP-1 polypeptides
- a PIP-1 polypeptide includes variants where an amino acid that is part of a proteolytic cleavage site is changed to another amino acid to eliminate or alter the proteolytic cleavage at that site.
- the proteolytic cleavage is by a protease in the insect gut. In other embodiments the proteolytic cleavage is by a plant protease in the transgenic plant.
- exemplary PIP-1 polypeptides are the polypeptides shown in Table 4, Table 6, Table 9, Table 12, Table 13, Table 14 and/or Table 16 and combinations of the amino substitutions thereof as well as deletions, and or insertions and fragments thereof.
- a PIP-1 polypeptide does not have the amino acid sequence of SEQ ID NO: 4. In some embodiments a PIP-1 polypeptide does not have the amino acid sequence of SEQ ID NO: 6.
- a PIP-1 polypeptide has a calculated molecular weight of between about 15 kD and about 35 kD, between about 19 kD and about 35 kD, between about 21 kD and about 35 kD, between about 23 kD and about 35 kD, between about 25 kD and about 32 kD, between about 27 kD and about 32 kD, between about 28 kD and about 32 kD, between about 29 kD and about 32 kD, between about 30 kD and about 31 kD or about 30.5 kD.
- a PIP-1 polypeptide is encoded by a nucleic acid molecule that hybridizes under stringent conditions to the nucleic acid molecule of SEQ ID NO: 1 or 3.
- Variants include polypeptides that differ in amino acid sequence due to mutagenesis.
- Variant proteins encompassed by the disclosure are biologically active, that is they continue to possess the desired biological activity (i.e. pesticidal activity) of the native protein.
- By “retains activity” is intended that the variant will have at least about 30%, at least about 50%, at least about 70% or at least about 80% of the insecticidal activity of the native protein.
- the variants may have improved activity over the native protein.
- Bacterial genes quite often possess multiple methionine initiation codons in proximity to the start of the open reading frame. Often, translation initiation at one or more of these start codons will lead to generation of a functional protein. These start codons can include ATG codons.
- SEQ ID NO: 215 represent alternate start site protein encoded by SEQ ID NO: 1.
- bacteria such as Bacillus sp. also recognize the codon GTG as a start codon, and proteins that initiate translation at GTG codons contain a methionine at the first amino acid.
- translation in bacterial systems can initiate at a TTG codon, though in this event the TTG encodes a methionine.
- the PIP-1 polypeptide may be expressed as a precursor protein with an intervening sequence that catalyzes multi-step, post translational protein splicing.
- Protein splicing involves the excision of an intervening sequence from a polypeptide with the concomitant joining of the flanking sequences to yield a new polypeptide (Chong, et al., (1996) J. Biol. Chem. 271:22159-22168).
- inteins This intervening sequence or protein splicing element, referred to as inteins, which catalyze their own excision through three coordinated reactions at the N-terminal and C-terminal splice junctions: an acyl rearrangement of the N-terminal cysteine or Serine; a transesterfication reaction between the two termini to form a branched ester or thioester intermediate and peptide bond cleavage coupled to cyclization of the intein C-terminal asparagine to free the intein (Evans, et al., (2000) J. Biol. Chem. 275:9091-9094.
- the PIP-1 polypeptide may be encoded by two separate genes where the intein of the precursor protein comes from the two genes, referred to as a split-intein and the two portions of the precursor are joined by a peptide bond formation.
- This peptide bond formation is accomplished by intein-mediated trans-splicing.
- a first and a second expression cassette comprising the two separate genes further code for inteins capable of mediating protein trans-splicing.
- trans-splicing the proteins and polypeptides encoded by the first and second fragments may be linked by peptide bond formation.
- Trans-splicing inteins may be selected from the nucleolar and organellar genomes of different organisms including eukaryotes, archaebacteria and eubacteria. Inteins that may be used for are listed at neb.com/neb/inteins.html, which can be accessed on the world-wide web using the “www” prefix).
- the nucleotide sequence coding for an intein may be split into a 5′ and a 3′ part that code for the 5′ and the 3′ part of the intein, respectively. Sequence portions not necessary for intein splicing (e.g., homing endonuclease domain) may be deleted.
- the intein coding sequence is split such that the 5′ and the 3′ parts are capable of trans-splicing.
- a suitable splitting site of the intein coding sequence the considerations published by Southworth, et al., (1998) EMBO J. 17:918-926 may be followed.
- the 5′ intein coding sequence is linked to the 3′ end of the first fragment coding for the N-terminal part of the PIP-1 polypeptide and the 3′ intein coding sequence is linked to the 5′ end of the second fragment coding for the C-terminal part of the PIP-1 polypeptide.
- the trans-splicing partners can be designed using any split intein, including any naturally-occurring or artificially-split split intein.
- split inteins are known, for example: the split intein of the DnaE gene of Synechocystis sp. PCC6803 (see, Wu, et al., (1998) Proc Natl Acad Sci USA 95(16):9226-31 and Evans, et al., (2000) J Biol Chem 275(13):9091-4 and of the DnaE gene from Nostoc punctiforme (see, Iwai, et al., (2006) FEBS Lett 580(7):1853-8).
- Non-split inteins have been artificially split in the laboratory to create new split inteins, for example: the artificially split Ssp DnaB intein (see, Wu, et al., (1998) Biochim Biophys Acta 1387:422-32) and split Sce VMA intein (see, Brenzel, et al., (2006) Biochemistry 45(6):1571-8) and an artificially split fungal mini-intein (see, Elleuche, et al., (2007) Biochem Biophys Res Commun 355(3):830-4).
- Naturally-occurring non-split inteins may have endonuclease or other enzymatic activities that can typically be removed when designing an artificially-split split intein.
- Such mini-inteins or minimized split inteins are well known in the art and are typically less than 200 amino acid residues long (see, Wu, et al., (1998) Biochim Biophys Acta 1387:422-32).
- Suitable split inteins may have other purification enabling polypeptide elements added to their structure, provided that such elements do not inhibit the splicing of the split intein or are added in a manner that allows them to be removed prior to splicing.
- Protein splicing has been reported using proteins that comprise bacterial intein-like (BIL) domains (see, Amitai, et al., (2003) Mol Microbiol 47:61-73) and hedgehog (Hog) auto-processing domains (the latter is combined with inteins when referred to as the Hog/intein superfamily or HINT family (see, Dassa, et al., (2004) J Biol Chem. 279 32001-7) and domains such as these may also be used to prepare artificially-split inteins.
- non-splicing members of such families may be modified by molecular biology methodologies to introduce or restore splicing activity in such related species.
- the PIP-1 polypeptide is a circular permuted variant.
- the PIP-1 polypeptide is a circular permuted variant of the polypeptide of SEQ ID NO: 2, 4, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260
- the PIP-1 polypeptide is a circular permuted variant of the polypeptide of SEQ ID NO: 2, 4, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 2
- the new sequence is joined, either directly or through an additional portion of sequence (linker), to an amino acid that is at or near the original N-terminus and the new sequence continues with the same sequence as the original until it reaches a point that is at or near the amino acid that was N-terminal to the breakpoint site of the original sequence, this residue forming the new C-terminus of the chain.
- the length of the amino acid sequence of the linker can be selected empirically or with guidance from structural information or by using a combination of the two approaches.
- a small series of linkers can be prepared for testing using a design whose length is varied in order to span a range from 0 to 50 ⁇ and whose sequence is chosen in order to be consistent with surface exposure (hydrophilicity, Hopp and Woods, (1983) Mol. Immunol. 20:483-489; Kyte and Doolittle, (1982) J. Mol. Biol. 157:105-132; solvent exposed surface area, Lee and Richards, (1971) J. Mol. Biol. 55:379-400) and the ability to adopt the necessary conformation without deranging the configuration of the pesticidal polypeptide (conformationally flexible; Karplus and Schulz, (1985) Naturwissenschaften 72:212-213.
- linkers may be composed of the original sequence, shortened or lengthened as necessary, and when lengthened the additional residues may be chosen to be flexible and hydrophilic as described above; or optionally the original sequence may be substituted for using a series of linkers, one example being the Gly-Gly-Gly-Ser cassette approach mentioned above; or optionally a combination of the original sequence and new sequence having the appropriate total length may be used.
- Sequences of pesticidal polypeptides capable of folding to biologically active states can be prepared by appropriate selection of the beginning (amino terminus) and ending (carboxyl terminus) positions from within the original polypeptide chain while using the linker sequence as described above.
- Amino and carboxyl termini are selected from within a common stretch of sequence, referred to as a breakpoint region, using the guidelines described below.
- a novel amino acid sequence is thus generated by selecting amino and carboxyl termini from within the same breakpoint region.
- the selection of the new termini will be such that the original position of the carboxyl terminus immediately preceded that of the amino terminus.
- selections of termini anywhere within the region may function, and that these will effectively lead to either deletions or additions to the amino or carboxyl portions of the new sequence. It is a central tenet of molecular biology that the primary amino acid sequence of a protein dictates folding to the three-dimensional structure necessary for expression of its biological function.
- Biochemical methods are also sometimes applicable for empirically determining surface exposure when direct structural methods are not feasible; for example, using the identification of sites of chain scission following limited proteolysis in order to infer surface exposure (Gentile and Salvatore, (1993) Eur. J. Biochem. 218:603-621).
- the parental amino acid sequence is inspected to classify regions according to whether or not they are integral to the maintenance of secondary and tertiary structure.
- regions that are known to be involved in periodic secondary structure are regions that should be avoided.
- regions of amino acid sequence that are observed or predicted to have a low degree of solvent exposure are more likely to be part of the so-called hydrophobic core of the protein and should also be avoided for selection of amino and carboxyl termini.
- those regions that are known or predicted to be in surface turns or loops, and especially those regions that are known not to be required for biological activity are the preferred sites for location of the extremes of the polypeptide chain. Continuous stretches of amino acid sequence that are preferred based on the above criteria are referred to as a breakpoint region.
- Polynucleotides encoding circular permuted PIP-1 polypeptides with new N-terminus/C-terminus which contain a linker region separating the original C-terminus and N-terminus can be made essentially following the method described in Mullins, et al., (1994) J. Am. Chem. Soc. 116:5529-5533. Multiple steps of polymerase chain reaction (PCR) amplifications are used to rearrange the DNA sequence encoding the primary amino acid sequence of the protein.
- PCR polymerase chain reaction
- Polynucleotides encoding circular permuted PIP-1 polypeptides with new N-terminus/C-terminus which contain a linker region separating the original C-terminus and N-terminus can be made based on the tandem-duplication method described in Horlick, et al., (1992) Protein Eng. 5:427-431. Polymerase chain reaction (PCR) amplification of the new N-terminus/C-terminus genes is performed using a tandemly duplicated template DNA.
- PCR Polymerase chain reaction
- fusion proteins include within its amino acid sequence an amino acid sequence comprising a PIP-1 polypeptide including but not limited to the polypeptide of SEQ ID NO: 2, 4, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263,
- fusion proteins comprises a PIP-1 polypeptide of SEQ ID NO: 2, 4, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 332, and active fragments thereof
- fusion proteins comprising a PIP-1 polypeptide and a second pesticidal polypeptide such a Cry protein.
- Methods for design and construction of fusion proteins are known to those of skill in the art.
- Polynucleotides encoding a PIP-1 polypeptide may be fused to signal sequences which will direct the localization of the PIP-1 polypeptide to particular compartments of a prokaryotic or eukaryotic cell and/or direct the secretion of the PIP-1 polypeptide of the embodiments from a prokaryotic or eukaryotic cell.
- E. coli one may wish to direct the expression of the protein to the periplasmic space.
- Examples of signal sequences or proteins (or fragments thereof) to which the PIP-1 polypeptide may be fused in order to direct the expression of the polypeptide to the periplasmic space of bacteria include, but are not limited to, the pe/B signal sequence, the maltose binding protein (MBP) signal sequence, MBP, the ompA signal sequence, the signal sequence of the periplasmic E. coli heat-labile enterotoxin B-subunit, and the signal sequence of alkaline phosphatase.
- MBP maltose binding protein
- ompA signal sequence the signal sequence of the periplasmic E. coli heat-labile enterotoxin B-subunit
- alkaline phosphatase Several vectors are commercially available for the construction of fusion proteins which will direct the localization of a protein, such as the pMAL series of vectors (particularly the pMAL-p series) available from New England Biolabs.
- the PIP-1 polypeptide may be fused to the pe/B pectate lyase signal sequence to increase the efficiency of expression and purification of such polypeptides in Gram-negative bacteria (see, U.S. Pat. Nos. 5,576,195 and 5,846,818).
- Plant plastid transit peptide/polypeptide fusions are well known in the art (see, U.S. Pat. No. 7,193,133).
- Apoplast transit peptides such as rice or barley alpha-amylase secretion signal are also well known in the art.
- the plastid transit peptide is generally fused N-terminal to the polypeptide to be targeted (e.g., the fusion partner).
- the fusion protein consists essentially of the peptide transit plastid and the PIP-1 polypeptide to be targeted.
- the fusion protein comprises the peptide transit plastid and the polypeptide to be targeted.
- the plastid transit peptide is preferably at the N-terminus of the fusion protein.
- additional amino acid residues may be N-terminal to the plastid transit peptide providing that the fusion protein is at least partially targeted to a plastid.
- the plastid transit peptide is in the N-terminal half, N-terminal third or N-terminal quarter of the fusion protein.
- the plastid transit peptide is generally cleaved from the fusion protein upon insertion into the plastid.
- the position of cleavage may vary slightly between plant species, at different plant developmental stages, as a result of specific intercellular conditions or the particular combination of transit peptide/fusion partner used.
- the plastid transit peptide cleavage is homogenous such that the cleavage site is identical in a population of fusion proteins.
- the plastid transit peptide is not homogenous, such that the cleavage site varies by 1-10 amino acids in a population of fusion proteins.
- the plastid transit peptide can be recombinantly fused to a second protein in one of several ways.
- a restriction endonuclease recognition site can be introduced into the nucleotide sequence of the transit peptide at a position corresponding to its C-terminal end and the same or a compatible site can be engineered into the nucleotide sequence of the protein to be targeted at its N-terminal end. Care must be taken in designing these sites to ensure that the coding sequences of the transit peptide and the second protein are kept “in frame” to allow the synthesis of the desired fusion protein. In some cases, it may be preferable to remove the initiator methionine codon of the second protein when the new restriction site is introduced.
- restriction endonuclease recognition sites on both parent molecules and their subsequent joining through recombinant DNA techniques may result in the addition of one or more extra amino acids between the transit peptide and the second protein. This generally does not affect targeting activity as long as the transit peptide cleavage site remains accessible and the function of the second protein is not altered by the addition of these extra amino acids at its N-terminus.
- one skilled in the art can create a precise cleavage site between the transit peptide and the second protein (with or without its initiator methionine) using gene synthesis (Stemmer, et al., (1995) Gene 164:49-53) or similar methods.
- the transit peptide fusion can intentionally include amino acids downstream of the cleavage site.
- the amino acids at the N-terminus of the mature protein can affect the ability of the transit peptide to target proteins to plastids and/or the efficiency of cleavage following protein import. This may be dependent on the protein to be targeted. See, e.g., Comai, et al., (1988) J. Biol. Chem. 263(29):15104-9.
- fusion proteins comprising a PIP-1 polypeptide, a pesticidal protein such as a Cry protein, and an amino acid linker.
- R 1 is a PIP-1 polypeptide
- R 2 is a pesticidal protein with a different but complementary activity to the PIP-1 polypeptide, including but not limited to Cry proteins; a polypeptide that increases the solubility and/or stability of the PIP-1 polypeptide; or a transit peptide or leader sequence.
- the R 1 polypeptide is fused either directly or through a linker segment to the R 2 polypeptide.
- the term “directly” defines fusions in which the polypeptides are joined without a peptide linker.
- L represents a chemical bound or polypeptide segment to which both R 1 and R 2 are fused in frame
- L is a linear peptide to which R 1 and R 2 are bound by amide bonds linking the carboxy terminus of R 1 to the amino terminus of L and carboxy terminus of L to the amino terminus of R 2 .
- fused in frame is meant that there is no translation termination or disruption between the reading frames of R 1 and R 2 .
- the linking group (L) is generally a polypeptide of between 1 and 500 amino acids in length.
- the linkers joining the two molecules are preferably designed to (1) allow the two molecules to fold and act independently of each other, (2) not have a propensity for developing an ordered secondary structure which could interfere with the functional domains of the two proteins, (3) have minimal hydrophobic or charged characteristic which could interact with the functional protein domains and (4) provide steric separation of R 1 and R 2 such that R 1 and R 2 could interact simultaneously with their corresponding receptors on a single cell.
- surface amino acids in flexible protein regions include Gly, Asn and Ser. Virtually any permutation of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above criteria for a linker sequence.
- Other neutral amino acids, such as Thr and Ala may also be used in the linker sequence. Additional amino acids may also be included in the linkers due to the addition of unique restriction sites in the linker sequence to facilitate construction of the fusions.
- the linkers comprise sequences selected from the group of formulas: (Gly 3 Ser) n , (Gly 4 Ser) n , (Gly 5 Ser) n , (GlynSer) n or (AlaGlySer) n where n is an integer.
- a highly-flexible linker is the (GlySer)-rich spacer region present within the pIII protein of the filamentous bacteriophages, e.g., bacteriophages M13 or fd (Schaller, et al., 1975). This region provides a long, flexible spacer region between two domains of the pIII surface protein.
- linkers in which an endopeptidase recognition sequence is included.
- Such a cleavage site may be valuable to separate the individual components of the fusion to determine if they are properly folded and active in vitro.
- various endopeptidases include, but are not limited to, Plasmin, Enterokinase, Kallikerin, Urokinase, Tissue Plasminogen activator, clostripain, Chymosin, Collagenase, Russell's Viper Venom Protease, Postproline cleavage enzyme, V8 protease, Thrombin and factor Xa.
- the linker comprises the amino acids EEKKN from the multi-gene expression vehicle (MGEV), which is cleaved by vacuolar proteases as disclosed in US 2007/0277263.
- MGEV multi-gene expression vehicle
- peptide linker segments from the hinge region of heavy chain immunoglobulins IgG, IgA, IgM, IgD or IgE provide an angular relationship between the attached polypeptides.
- those hinge regions where the cysteines are replaced with serines are particularly useful.
- Preferred linkers of the present invention include sequences derived from murine IgG gamma 2b hinge region in which the cysteines have been changed to serines.
- the fusion proteins are not limited by the form, size or number of linker sequences employed and the only requirement of the linker is that functionally it does not interfere adversely with the folding and function of the individual molecules of the fusion.
- chimeric PIP-1 polypeptide are provided that are created through joining two or more portions of genes, which originally encoded separate insecticidal proteins from different species, to create a chimeric gene.
- the translation of the chimeric gene results in a single chimeric pesticidal polypeptide with regions, motifs or domains derived from each of the original polypeptides.
- the chimeric protein comprises portions, motifs or domains of PIP-1A (SEQ ID NO: 2) and orthologs PSEEN3174 (SEQ ID NO: 6), PIP-1C (SEQ ID NO: 332), and PIP-1B (SEQ ID NO: 4) in any combination.
- the chimeric insecticidal polypeptide includes but not limited to the polypeptides of SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269,
- DNA sequences may be altered by various methods, and that these alterations may result in DNA sequences encoding proteins with amino acid sequences different than that encoded by the wild-type (or native) pesticidal protein.
- proteins may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions of one or more amino acids, including up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40 45, 50, about 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155 or more amino acid substitutions, deletions and/or insertions or combinations thereof compared to SEQ ID NO: 2 or 4 including but not limited to SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121,
- a PIP-1 polypeptide comprises the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or more amino acids from the N-terminus of the PIP-1 polypeptide relative to the amino acid position of SEQ ID NO: 2.
- Methods for such manipulations are generally known in the art.
- amino acid sequence variants of a PIP-1 polypeptide can be prepared by mutations in the DNA. This may also be accomplished by one of several forms of mutagenesis and/or in directed evolution.
- the changes encoded in the amino acid sequence will not substantially affect the function of the protein.
- Such variants will possess the desired pesticidal activity.
- the ability of a PIP-1 polypeptide to confer pesticidal activity may be improved by the use of such techniques upon the compositions of this disclosure.
- conservative amino acid substitutions may be made at one or more, predicted, nonessential amino acid residues.
- a “nonessential” amino acid residue is a residue that can be altered from the wild-type sequence of a PIP-1 polypeptide without altering the biological activity.
- a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
- amino acids with basic side chains e.g., lysine, arginine, histidine
- acidic side chains e.g., aspartic acid, glutamic acid
- polar, negatively charged residues and their amides e.g., aspartic acid, asparagine, glutamic, acid, glutamine
- uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
- small aliphatic, nonpolar or slightly polar residues e.g., Alanine, serine, threonine, proline, glycine
- nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
- large aliphatic, nonpolar residues e.g., methionine, leucine, isoleucine, va
- amino acid substitutions may be made in nonconserved regions that retain function. In general, such substitutions would not be made for conserved amino acid residues or for amino acid residues residing within a conserved motif, where such residues are essential for protein activity. Examples of residues that are conserved and that may be essential for protein activity include, for example, residues that are identical between all proteins contained in an alignment of similar or related toxins to the sequences of the embodiments (e.g., residues that are identical in an alignment of homologous proteins).
- residues that are conserved but that may allow conservative amino acid substitutions and still retain activity include, for example, residues that have only conservative substitutions between all proteins contained in an alignment of similar or related toxins to the sequences of the embodiments (e.g., residues that have only conservative substitutions between all proteins contained in the alignment homologous proteins).
- residues that have only conservative substitutions between all proteins contained in an alignment of similar or related toxins to the sequences of the embodiments e.g., residues that have only conservative substitutions between all proteins contained in the alignment homologous proteins.
- residues that have only conservative substitutions between all proteins contained in the alignment homologous proteins e.g., residues that have only conservative substitutions between all proteins contained in the alignment homologous proteins.
- amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff, et al., (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference.
- the hydropathic index of amino acids may be considered.
- the importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, (1982) J Mol Biol. 157(1):105-32). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens and the like.
- amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, i.e., still obtain a biological functionally equivalent protein.
- Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte and Doolittle, ibid).
- the substitution of amino acids whose hydropathic indices are within +2 is preferred, those which are within +1 are particularly preferred and those within +0.5 are even more particularly preferred.
- hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0.+0.1); glutamate (+3.0.+0.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine ( ⁇ 0.4); proline ( ⁇ 0.5.+0.1); alanine ( ⁇ 0.5); histidine ( ⁇ 0.5); cysteine ( ⁇ 1.0); methionine ( ⁇ 1.3); valine ( ⁇ 1.5); leucine ( ⁇ 1.8); isoleucine ( ⁇ 1.8); tyrosine ( ⁇ 2.3); phenylalanine ( ⁇ 2.5); tryptophan ( ⁇ 3.4).
- alterations may be made to the protein sequence of many proteins at the amino or carboxy terminus without substantially affecting activity.
- This can include insertions, deletions or alterations introduced by modern molecular methods, such as PCR, including PCR amplifications that alter or extend the protein coding sequence by virtue of inclusion of amino acid encoding sequences in the oligonucleotides utilized in the PCR amplification.
- the protein sequences added can include entire protein-coding sequences, such as those used commonly in the art to generate protein fusions.
- Such fusion proteins are often used to (1) increase expression of a protein of interest (2) introduce a binding domain, enzymatic activity or epitope to facilitate either protein purification, protein detection or other experimental uses known in the art (3) target secretion or translation of a protein to a subcellular organelle, such as the periplasmic space of Gram-negative bacteria, mitochondria or chloroplasts of plants or the endoplasmic reticulum of eukaryotic cells, the latter of which often results in glycosylation of the protein.
- a subcellular organelle such as the periplasmic space of Gram-negative bacteria, mitochondria or chloroplasts of plants or the endoplasmic reticulum of eukaryotic cells, the latter of which often results in glycosylation of the protein.
- the PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 2 having an amino acid substitutions compared to the native amino acid of SEQ ID NO: 2 at one or more residues selected from positions 2, 3, 6, 8, 19, 20, 21, 22, 24, 25, 26, 27, 28, 30, 35, 36, 38, 42, 43, 46, 48, 49, 53, 60, 63, 66, 77, 89, 93, 97, 98, 105, 108, 110, 120, 121, 123, 125, 127, 134, 135, 137, 141, 142, 144, 147, 150, 151, 160, 162, 163, 164, 166, 167, 168, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 194, 195, 200, 203, 204, 209, 213, 220, 221, 222, 226, 228, 229, 231, 232, 240, 241, 242, 243, 24
- Variant nucleotide and amino acid sequences of the disclosure also encompass sequences derived from mutagenic and recombinogenic procedures such as DNA shuffling. With such a procedure, one or more different PIP-1 polypeptide coding regions can be used to create a new PIP-1 polypeptide possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo.
- sequence motifs encoding a domain of interest may be shuffled between a pesticidal gene and other known pesticidal genes to obtain a new gene coding for a protein with an improved property of interest, such as an increased insecticidal activity.
- Strategies for such DNA shuffling are known in the art. See, for example, Stemmer, (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer, (1994) Nature 370:389-391; Crameri, et al., (1997) Nature Biotech. 15:436-438; Moore, et al., (1997) J. Mol. Biol. 272:336-347; Zhang, et al., (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri, et al., (1998) Nature 391:288-291 and U.S. Pat. Nos. 5,605,793 and 5,837,458.
- Domain swapping or shuffling is another mechanism for generating altered PIP-1 polypeptides. Domains may be swapped between PIP-1 polypeptides, resulting in hybrid or chimeric toxins with improved pesticidal activity or target spectrum. Methods for generating recombinant proteins and testing them for pesticidal activity are well known in the art (see, for example, Naimov, et al., (2001) Appl. Environ. Microbiol. 67:5328-5330; de Maagd, et al., (1996) Appl. Environ. Microbiol. 62:1537-1543; Ge, et al., (1991) J. Biol. Chem.
- DNA shuffling was used to generate a library of active variants by recombination of the diversity present in PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6).
- PIP-1A SEQ ID NO: 2
- PSEEN3174 SEQ ID NO: 6
- the person skilled in the art will be able to use comparisons to other proteins or functional assays to further define motifs.
- High throughput screening can be used to test variations of those motifs to determine the role of specific residues. Given that knowledge for several motifs, one can then define the requirements for a functional protein. Knowledge of the motifs allows the skilled artisan to design sequence variations that would not impact function.
- Antibodies to a PIP-1 polypeptide of the embodiments or to variants or fragments thereof, are also encompassed. Methods for producing antibodies are well known in the art (see, for example, Harlow and Lane, (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; U.S. Pat. No. 4,196,265).
- kits for detecting the presence of a PIP-1 polypeptide, or detecting the presence of a nucleotide sequence encoding a PIP-1 polypeptide, in a sample are provided.
- the kit provides antibody-based reagents for detecting the presence of a PIP-1 polypeptide in a tissue sample.
- the kit provides labeled nucleic acid probes useful for detecting the presence of one or more polynucleotides encoding PIP-1 polypeptide(s).
- the kit is provided along with appropriate reagents and controls for carrying out a detection method, as well as instructions for use of the kit
- Receptors to the PIP-1 polypeptide of the embodiments or to variants or fragments thereof are also encompassed.
- Methods for identifying receptors are well known in the art (see, Hofmann, et. al., (1988) Eur. J. Biochem. 173:85-91; Gill, et al., (1995) J. Biol. Chem. 27277-27282) can be employed to identify and isolate the receptor that recognizes the PIP-1 polypeptides using the brush-border membrane vesicles from susceptible insects.
- PIP-1 polypeptide can be labeled with fluorescent dye and other common labels such as streptavidin.
- BBMV Brush-border membrane vesicles
- susceptible insects such as soybean looper and stink bugs
- BBMV Brush-border membrane vesicles
- Labeled PIP-1 polypeptides can be incubated with blotted membrane of BBMV and labeled the PIP-1 polypeptides can be identified with the labeled reporters.
- Identification of protein band(s) that interact with the PIP-1 polypeptides can be detected by N-terminal amino acid gas phase sequencing or mass spectrometry based protein identification method (Patterson, (1998) 10(22):1-24 , Current Protocol in Molecular Biology published by John Wiley & Son Inc).
- the corresponding gene can be cloned from genomic DNA or cDNA library of the susceptible insects and binding affinity can be measured directly with the PIP-1 polypeptides. Receptor function for insecticidal activity by the PIP-1 polypeptides can be verified by accomplished by RNAi type of gene knock out method (Rajagopal, et al., (2002) J. Biol. Chem. 277:46849-46851).
- nucleotide constructs are not intended to limit the embodiments to nucleotide constructs comprising DNA.
- nucleotide constructs particularly polynucleotides and oligonucleotides composed of ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides may also be employed in the methods disclosed herein.
- the nucleotide constructs, nucleic acids, and nucleotide sequences of the embodiments additionally encompass all complementary forms of such constructs, molecules and sequences.
- nucleotide constructs, nucleotide molecules and nucleotide sequences of the embodiments encompass all nucleotide constructs, molecules and sequences which can be employed in the methods of the embodiments for transforming plants including, but not limited to, those comprised of deoxyribonucleotides, ribonucleotides and combinations thereof.
- deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues.
- nucleotide constructs, nucleic acids, and nucleotide sequences of the embodiments also encompass all forms of nucleotide constructs including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures and the like.
- a further embodiment relates to a transformed organism such as an organism selected from plant and insect cells, bacteria, yeast, baculovirus, protozoa, nematodes and algae.
- the transformed organism comprises a DNA molecule of the embodiments, an expression cassette comprising the DNA molecule or a vector comprising the expression cassette, which may be stably incorporated into the genome of the transformed organism.
- the sequences of the embodiments are provided in DNA constructs for expression in the organism of interest.
- the construct will include 5′ and 3′ regulatory sequences operably linked to a sequence of the embodiments.
- operably linked refers to a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
- operably linked means that the nucleic acid sequences being linked are contiguous and where necessary to join two protein coding regions in the same reading frame.
- the construct may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple DNA constructs.
- Such a DNA construct is provided with a plurality of restriction sites for insertion of the PIP-1 polypeptide gene sequence to be under the transcriptional regulation of the regulatory regions.
- the DNA construct may additionally contain selectable marker genes.
- the DNA construct will generally include in the 5′ to 3′ direction of transcription: a transcriptional and translational initiation region (i.e., a promoter), a DNA sequence of the embodiments and a transcriptional and translational termination region (i.e., termination region) functional in the organism serving as a host.
- the transcriptional initiation region i.e., the promoter
- the transcriptional initiation region may be native, analogous, foreign or heterologous to the host organism and/or to the sequence of the embodiments.
- the promoter may be the natural sequence or alternatively a synthetic sequence.
- the term “foreign” as used herein indicates that the promoter is not found in the native organism into which the promoter is introduced.
- a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.
- the expression of the operably linked sequence is altered from the wild-type expression, which results in an alteration in phenotype.
- the DNA construct may also include a transcriptional enhancer sequence.
- an “enhancer” refers to a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter.
- Various enhancers are known in the art including for example, introns with gene expression enhancing properties in plants (US Patent Application Publication Number 2009/0144863, the ubiquitin intron (i.e., the maize ubiquitin intron 1 (see, for example, NCBI sequence S94464)), the omega enhancer or the omega prime enhancer (Gallie, et al., (1989) Molecular Biology of RNA ed.
- the termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, may be native with the plant host or may be derived from another source (i.e., foreign or heterologous to the promoter, the sequence of interest, the plant host or any combination thereof).
- Convenient termination regions are available from the Ti-plasmid of A. tumefaciens , such as the octopine synthase and nopaline synthase termination regions. See also, Guerineau, et al., (1991) Mol. Gen. Genet. 262:141-144; Proudfoot, (1991) Cell 64:671-674; Sanfacon, et al., (1991) Genes Dev. 5:141-149; Mogen, et al., (1990) Plant Cell 2:1261-1272; Munroe, et al., (1990) Gene 91:151-158; Ballas, et al., (1989) Nucleic Acids Res. 17:7891-7903 and Joshi, et al., (1987) Nucleic Acid Res. 15:9627-9639.
- a nucleic acid may be optimized for increased expression in the host organism.
- the synthetic nucleic acids can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri, (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage.
- nucleic acid sequences of the embodiments may be expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific codon preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et al. (1989) Nucleic Acids Res.
- the maize-preferred codon for a particular amino acid may be derived from known gene sequences from maize.
- Maize codon usage for 28 genes from maize plants is listed in Table 4 of Murray, et al., supra. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831, and 5,436,391 and Murray, et al., (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.
- host cell refers to a cell which contains a vector and supports the replication and/or expression of the expression vector is intended.
- Host cells may be prokaryotic cells such as E.
- coli or eukaryotic cells such as yeast, insect, amphibian or mammalian cells or monocotyledonous or dicotyledonous plant cells.
- An example of a monocotyledonous host cell is a maize host cell.
- the sequence is modified to avoid predicted hairpin secondary mRNA structures.
- the expression cassettes may additionally contain 5′ leader sequences.
- leader sequences can act to enhance translation.
- Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5′ noncoding region) (Elroy-Stein, et al., (1989) Proc. Natl. Acad. Sci.
- TEV leader tobacco Etch Virus
- MDMV leader Maize Dwarf Mosaic Virus
- human immunoglobulin heavy-chain binding protein BiP
- untranslated leader from the coat protein mRNA of alfalfa mosaic virus AMV RNA 4
- tobacco mosaic virus leader TMV (Gallie, et al., (1989) in Molecular Biology of RNA, ed.
- Such constructs may also contain a “signal sequence” or “leader sequence” to facilitate co-translational or post-translational transport of the peptide to certain intracellular structures such as the chloroplast (or other plastid), endoplasmic reticulum or Golgi apparatus.
- signal sequence is intended a sequence that is known or suspected to result in cotranslational or post-translational peptide transport across the cell membrane. In eukaryotes, this typically involves secretion into the Golgi apparatus, with some resulting glycosylation. Insecticidal toxins of bacteria are often synthesized as protoxins, which are protolytically activated in the gut of the target pest (Chang, (1987) Methods Enzymol. 153:507-516). In some embodiments, the signal sequence is located in the native sequence or may be derived from a sequence of the embodiments.
- leader sequence is intended any sequence that when translated, results in an amino acid sequence sufficient to trigger co-translational transport of the peptide chain to a subcellular organelle.
- this includes leader sequences targeting transport and/or glycosylation by passage into the endoplasmic reticulum, passage to vacuoles, plastids including chloroplasts, mitochondria and the like.
- Nuclear-encoded proteins targeted to the chloroplast thylakoid lumen compartment have a characteristic bipartite transit peptide, composed of a stromal targeting signal peptide and a lumen targeting signal peptide.
- the stromal targeting information is in the amino-proximal portion of the transit peptide.
- the lumen targeting signal peptide is in the carboxyl-proximal portion of the transit peptide, and contains all the information for targeting to the lumen.
- Recent research in proteomics of the higher plant chloroplast has achieved in the identification of numerous nuclear-encoded lumen proteins (Kieselbach et al. FEBS LETT 480:271-276, 2000; Peltier et al. Plant Cell 12:319-341, 2000; Bricker et al. Biochim. Biophys Acta 1503:350-356, 2001), the lumen targeting signal peptide of which can potentially be used in accordance with the present invention.
- CTP chloroplast transit peptides
- chimeric CTPs comprising but not limited to, an N-terminal domain, a central domain or a C-terminal domain from a CTP from Oryza sativa 1-deoxy-D xyulose-5-Phosphate Synthase Oryza sativa -Superoxide dismutase Oryza sativa -soluble starch synthase Oryza sativa -NADP-dependent Malic acid enzyme Oryza sativa -Phospho-2-dehydro-3-deoxyheptonate Aldolase 2 Oryza sativa -L-Ascorbate peroxidase 5 Oryza sativa -Phosphoglucan water dikinase, Zea mays sRUBISCO, Zea mays -beta-glucosidase, Zea mays -Malate dehydrogenas
- the PIP-1 polypeptide gene to be targeted to the chloroplast may be optimized for expression in the chloroplast to account for differences in codon usage between the plant nucleus and this organelle.
- the nucleic acids of interest may be synthesized using chloroplast-preferred codons. See, for example, U.S. Pat. No. 5,380,831, herein incorporated by reference.
- the various DNA fragments may be manipulated so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame.
- adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites or the like.
- in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions may be involved.
- a number of promoters can be used in the practice of the embodiments.
- the promoters can be selected based on the desired outcome.
- the nucleic acids can be combined with constitutive, tissue-preferred, inducible or other promoters for expression in the host organism.
- Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 1999/43838 and U.S. Pat. No.
- ALS promoter U.S. Pat. No. 5,659,026
- Other constitutive promoters include, for example, those discussed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611.
- wound-inducible promoters are wound-inducible promoters.
- Such wound-inducible promoters may respond to damage caused by insect feeding, and include potato proteinase inhibitor (pin II) gene (Ryan, (1990) Ann. Rev. Phytopath. 28:425-449; Duan, et al., (1996) Nature Biotechnology 14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1 and win2 (Stanford, et al., (1989) Mol. Gen. Genet.
- pin II potato proteinase inhibitor
- pathogen-inducible promoters may be employed in the methods and nucleotide constructs of the embodiments.
- pathogen-inducible promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi, et al., (1983) Neth. J. Plant Pathol. 89:245-254; Uknes, et al., (1992) Plant Cell 4:645-656 and Van Loon, (1985) Plant Mol. Virol. 4:111-116. See also, WO 1999/43819, herein incorporated by reference.
- PR proteins pathogenesis-related proteins
- promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau, et al., (1987) Plant Mol. Biol. 9:335-342; Matton, et al., (1989) Molecular Plant - Microbe Interactions 2:325-331; Somsisch, et al., (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch, et al., (1988) Mol. Gen. Genet. 2:93-98 and Yang, (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen, et al., (1996) Plant J.
- Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
- the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression or a chemical-repressible promoter, where application of the chemical represses gene expression.
- Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid.
- promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena, et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis, et al., (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz, et al., (1991) Mol. Gen. Genet. 227:229-237 and U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by reference.
- steroid-responsive promoters see, for example, the glucocorticoid-inducible promoter in Schena, et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis, et al
- Tissue-preferred promoters can be utilized to target enhanced PIP-1 polypeptide expression within a particular plant tissue.
- Tissue-preferred promoters include those discussed in Yamamoto, et al., (1997) Plant J. 12(2)255-265; Kawamata, et al., (1997) Plant Cell Physiol. 38(7):792-803; Hansen, et al., (1997) Mol. Gen Genet. 254(3):337-343; Russell, et al., (1997) Transgenic Res. 6(2):157-168; Rinehart, et al., (1996) Plant Physiol. 112(3):1331-1341; Van Camp, et al., (1996) Plant Physiol.
- Leaf-preferred promoters are known in the art. See, for example, Yamamoto, et al., (1997) Plant J. 12(2):255-265; Kwon, et al., (1994) Plant Physiol. 105:357-67; Yamamoto, et al., (1994) Plant Cell Physiol. 35(5):773-778; Gotor, et al., (1993) Plant J. 3:509-18; Orozco, et al., (1993) Plant Mol. Biol. 23(6):1129-1138 and Matsuoka, et al., (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.
- Root-preferred or root-specific promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire, et al., (1992) Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner, (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger, et al., (1990) Plant Mol. Biol.
- the promoters of these genes were linked to a ⁇ -glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tabacum and the legume Lotus corniculatus , and in both instances root-specific promoter activity was preserved.
- Leach and Aoyagi, (1991) describe their analysis of the promoters of the highly expressed rolC and rolD root-inducing genes of Agrobacterium rhizogenes (see, Plant Science (Limerick) 79(1):69-76). They concluded that enhancer and tissue-preferred DNA determinants are dissociated in those promoters.
- Teer, et al., (1989) used gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR2′ gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene (see, EMBO J. 8(2):343-350).
- the TR1 gene fused to nptII neomycin phosphotransferase II
- Additional root-preferred promoters include the VfENOD-GRP3 gene promoter (Kuster, et al., (1995) Plant Mol. Biol.
- seed-specific promoters include both “seed-specific” promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as “seed-germinating” promoters (those promoters active during seed germination). See, Thompson, et al., (1989) BioEssays 10:108, herein incorporated by reference.
- seed-preferred promoters include, but are not limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa zein); and milps (myo-inositol-1-phosphate synthase) (see, U.S. Pat. No. 6,225,529, herein incorporated by reference).
- seed-specific promoters include, but are not limited to, Kunitz trypsin inhibitor 3 (KTi3) (Jofuku, K. D. and Goldberg, R. B. Plant Cell 1:1079-1093, 1989), bean ⁇ -phaseolin, napin, ⁇ -conglycinin, glycinin 1, soybean lectin, cruciferin, and the like.
- seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2, globulin 1, etc.
- seed-preferred promoters from end1 and end2 genes are disclosed; herein incorporated by reference.
- seed specific promoters include but are not limited to seed coat promoter from Arabidopsis , pBAN; and the early seed promoters from Arabidopsis, p 26, p63, and p63tr (U.S. Pat. Nos. 7,294,760 and 7,847,153).
- a promoter that has “preferred” expression in a particular tissue is expressed in that tissue to a greater degree than in at least one other plant tissue. Some tissue-preferred promoters show expression almost exclusively in the particular tissue.
- weak promoters will be used.
- the term “weak promoter” as used herein refers to a promoter that drives expression of a coding sequence at a low level. By low level expression at levels of about 1/1000 transcripts to about 1/100,000 transcripts to about 1/500,000 transcripts is intended. Alternatively, it is recognized that the term “weak promoters” also encompasses promoters that drive expression in only a few cells and not in others to give a total low level of expression. Where a promoter drives expression at unacceptably high levels, portions of the promoter sequence can be deleted or modified to decrease expression levels.
- Such weak constitutive promoters include, for example the core promoter of the Rsyn7 promoter (WO 1999/43838 and U.S. Pat. No. 6,072,050), the core 35S CaMV promoter, and the like.
- Other constitutive promoters include, for example, those disclosed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611, herein incorporated by reference.
- the expression cassette will comprise a selectable marker gene for the selection of transformed cells.
- Selectable marker genes are utilized for the selection of transformed cells or tissues.
- Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones and 2,4-dichlorophenoxyacetate (2,4-D).
- selectable marker genes include, but are not limited to, genes encoding resistance to chloramphenicol (Herrera Estrella, et al., (1983) EMBO J. 2:987-992); methotrexate (Herrera Estrella, et al., (1983) Nature 303:209-213 and Meijer, et al., (1991) Plant Mol. Biol. 16:807-820); streptomycin (Jones, et al., (1987) Mol. Gen. Genet. 210:86-91); spectinomycin (Bretagne-Sagnard, et al., (1996) Transgenic Res.
- selectable marker genes are not meant to be limiting. Any selectable marker gene can be used in the embodiments.
- the methods of the embodiments involve introducing a polypeptide or polynucleotide into a plant.
- “Introducing” is intended to mean presenting to the plant the polynucleotide or polypeptide in such a manner that the sequence gains access to the interior of a cell of the plant.
- the methods of the embodiments do not depend on a particular method for introducing a polynucleotide or polypeptide into a plant, only that the polynucleotide or polypeptides gains access to the interior of at least one cell of the plant.
- Methods for introducing polynucleotide or polypeptides into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods and virus-mediated methods.
- “Stable transformation” is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. “Transient transformation” is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.
- plant is intended whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, propagules, embryos and progeny of the same. Plant cells can be differentiated or undifferentiated (e.g. callus, suspension culture cells, protoplasts, leaf cells, root cells, phloem cells, and pollen).
- Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway, et al., (1986) Biotechniques 4:320-334), electroporation (Riggs, et al., (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium -mediated transformation (U.S. Pat. Nos.
- the sequences of the embodiments can be provided to a plant using a variety of transient transformation methods.
- transient transformation methods include, but are not limited to, the introduction of the PIP-1 polypeptide or variants and fragments thereof directly into the plant or the introduction of the PIP-1 polypeptide transcript into the plant.
- Such methods include, for example, microinjection or particle bombardment. See, for example, Crossway, et al., (1986) Mol Gen. Genet. 202:179-185; Nomura, et al., (1986) Plant Sci. 44:53-58; Hepler, et al., (1994) Proc. Natl. Acad. Sci.
- the PIP-1 polypeptide polynucleotide can be transiently transformed into the plant using techniques known in the art. Such techniques include viral vector system and the precipitation of the polynucleotide in a manner that precludes subsequent release of the DNA. Thus, transcription from the particle-bound DNA can occur, but the frequency with which it is released to become integrated into the genome is greatly reduced. Such methods include the use of particles coated with polyethylimine (PEI; Sigma #P3143).
- the insertion of the polynucleotide at a desired genomic location is achieved using a site-specific recombination system.
- a site-specific recombination system See, for example, WO 1999/25821, WO 1999/25854, WO 1999/25840, WO 1999/25855 and WO 1999/25853, all of which are herein incorporated by reference.
- the polynucleotide of the embodiments can be contained in transfer cassette flanked by two non-identical recombination sites.
- the transfer cassette is introduced into a plant have stably incorporated into its genome a target site which is flanked by two non-identical recombination sites that correspond to the sites of the transfer cassette. An appropriate recombinase is provided and the transfer cassette is integrated at the target site. The polynucleotide of interest is thereby integrated at a specific chromosomal position in the plant genome.
- Plant transformation vectors may be comprised of one or more DNA vectors needed for achieving plant transformation.
- DNA vectors needed for achieving plant transformation.
- Binary vectors as well as vectors with helper plasmids are most often used for Agrobacterium -mediated transformation, where the size and complexity of DNA segments needed to achieve efficient transformation is quite large, and it is advantageous to separate functions onto separate DNA molecules.
- Binary vectors typically contain a plasmid vector that contains the cis-acting sequences required for T-DNA transfer (such as left border and right border), a selectable marker that is engineered to be capable of expression in a plant cell, and a “gene of interest” (a gene engineered to be capable of expression in a plant cell for which generation of transgenic plants is desired). Also present on this plasmid vector are sequences required for bacterial replication. The cis-acting sequences are arranged in a fashion to allow efficient transfer into plant cells and expression therein. For example, the selectable marker gene and the pesticidal gene are located between the left and right borders.
- a second plasmid vector contains the trans-acting factors that mediate T-DNA transfer from Agrobacterium to plant cells.
- This plasmid often contains the virulence functions (Vir genes) that allow infection of plant cells by Agrobacterium , and transfer of DNA by cleavage at border sequences and vir-mediated DNA transfer, as is understood in the art (Hellens and Mullineaux, (2000) Trends in Plant Science 5:446-451).
- Several types of Agrobacterium strains e.g. LBA4404, GV3101, EHA101, EHA105, etc.
- the second plasmid vector is not necessary for transforming the plants by other methods such as microprojection, microinjection, electroporation, polyethylene glycol, etc.
- plant transformation methods involve transferring heterologous DNA into target plant cells (e.g., immature or mature embryos, suspension cultures, undifferentiated callus, protoplasts, etc.), followed by applying a maximum threshold level of appropriate selection (depending on the selectable marker gene) to recover the transformed plant cells from a group of untransformed cell mass.
- target plant cells e.g., immature or mature embryos, suspension cultures, undifferentiated callus, protoplasts, etc.
- a maximum threshold level of appropriate selection depending on the selectable marker gene
- Explants are typically transferred to a fresh supply of the same medium and cultured routinely. Subsequently, the transformed cells are differentiated into shoots after placing on regeneration medium supplemented with a maximum threshold level of selecting agent. The shoots are then transferred to a selective rooting medium for recovering rooted shoot or plantlet. The transgenic plantlet then grows into a mature plant and produces fertile seeds (e.g., Hiei, et al., (1994) The Plant Journal 6:271-282; Ishida, et al., (1996) Nature Biotechnology 14:745-750). Explants are typically transferred to a fresh supply of the same medium and cultured routinely.
- fertile seeds e.g., Hiei, et al., (1994) The Plant Journal 6:271-282; Ishida, et al., (1996) Nature Biotechnology 14:745-750.
- the cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick, et al., (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains and the resulting hybrid having constitutive or inducible expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure that expression of the desired phenotypic characteristic has been achieved.
- the nucleotide sequences of the embodiments may be provided to the plant by contacting the plant with a virus or viral nucleic acids. Generally, such methods involve incorporating the nucleotide construct of interest within a viral DNA or RNA molecule. It is recognized that the recombinant proteins of the embodiments may be initially synthesized as part of a viral polyprotein, which later may be processed by proteolysis in vivo or in vitro to produce the desired PIP-1 polypeptide. It is also recognized that such a viral polyprotein, comprising at least a portion of the amino acid sequence of a PIP-1 polypeptide of the embodiments, may have the desired pesticidal activity.
- Such viral polyproteins and the nucleotide sequences that encode for them are encompassed by the embodiments.
- Methods for providing plants with nucleotide constructs and producing the encoded proteins in the plants, which involve viral DNA or RNA molecules are known in the art. See, for example, U.S. Pat. Nos. 5,889,191; 5,889,190; 5,866,785; 5,589,367 and 5,316,931, herein incorporated by reference.
- plastid transformation can be accomplished by transactivation of a silent plastid-borne transgene by tissue-preferred expression of a nuclear-encoded and plastid-directed RNA polymerase.
- tissue-preferred expression of a nuclear-encoded and plastid-directed RNA polymerase Such a system has been reported in McBride, et al., (1994) Proc. Natl. Acad. Sci. USA 91:7301-7305.
- the embodiments may be used for transformation of any plant species, including, but not limited to, monocots and dicots.
- plants of interest include, but are not limited to, corn ( Zea mays ), Brassica sp. (e.g., B. napus, B. rapa, B.
- juncea particularly those Brassica species useful as sources of seed oil, alfalfa ( Medicago sativa ), rice ( Oryza sativa ), rye ( Secale cereale ), sorghum ( Sorghum bicolor, Sorghum vulgare ), millet (e.g., pearl millet ( Pennisetum glaucum ), proso millet ( Panicum miliaceum ), foxtail millet ( Setaria italica ), finger millet ( Eleusine coracana )), sunflower ( Helianthus annuus ), safflower ( Carthamus tinctorius ), wheat ( Triticum aestivum ), soybean ( Glycine max ), tobacco ( Nicotiana tabacum ), potato ( Solanum tuberosum ), peanuts ( Arachis hypogaea ), cotton ( Gossypium barbadense, Gossypium hirsutum ), sweet potato ( Ipomoea batat
- Ornamentals include azalea ( Rhododendron spp.), hydrangea ( Macrophylla hydrangea ), hibiscus ( Hibiscus rosasanensis ), roses ( Rosa spp.), tulips ( Tulipa spp.), daffodils ( Narcissus spp.), petunias ( Petunia hybrida ), carnation ( Dianthus caryophyllus ), poinsettia ( Euphorbia pulcherrima ), and chrysanthemum .
- Conifers that may be employed in practicing the embodiments include, for example, pines such as loblolly pine ( Pinus taeda ), slash pine ( Pinus elliotii ), ponderosa pine ( Pinus ponderosa ), lodgepole pine ( Pinus contorta ) and Monterey pine ( Pinus radiata ); Douglas-fir ( Pseudotsuga menziesii ); Western hemlock ( Tsuga canadensis ); Sitka spruce ( Picea glauca ); redwood ( Sequoia sempervirens ); true firs such as silver fir ( Abies amabilis ) and balsam fir ( Abies balsamea ); and cedars such as Western red cedar ( Thuja plicata ) and Alaska yellow-cedar ( Chamaecyparis nootkatensis ). Plants of the embodiments include crop plants (for example, corn, alfalfa, sunflower
- Turf grasses include, but are not limited to: annual bluegrass ( Poa annua ); annual ryegrass ( Lolium multiflorum ); Canada bluegrass ( Poa compressa ); Chewing's fescue ( Festuca rubra ); colonial bentgrass ( Agrostis tenuis ); creeping bentgrass ( Agrostis palustris ); crested wheatgrass ( Agropyron desertorum ); fairway wheatgrass ( Agropyron cristatum ); hard fescue ( Festuca longifolia ); Kentucky bluegrass ( Poa pratensis ); orchardgrass ( Dactylis glomerata ); perennial ryegrass ( Lolium perenne ); red fescue ( Festuca rubra ); redtop ( Agrostis alba ); rough bluegrass ( Poa trivialis ); sheep fescue ( Festuca ovina ); smooth bromegrass ( Bromus inermis ); tall fescue ( Festuca arundinace
- Augustine grass Stenotaphrum secundatum ); zoysia grass ( Zoysia spp.); Bahia grass ( Paspalum notatum ); carpet grass ( Axonopus affinis ); centipede grass ( Eremochloa ophiuroides ); kikuyu grass ( Pennisetum clandesinum ); seashore paspalum ( Paspalum vaginatum ); blue gramma ( Bouteloua gracilis ); buffalo grass ( Buchloe dactyloids ); sideoats gramma ( Bouteloua curtipendula ).
- Plants of interest include grain plants that provide seeds of interest, oil-seed plants, and leguminous plants.
- Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, millet, etc.
- Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica , maize, alfalfa, palm, coconut, flax, castor, olive etc.
- Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
- heterologous foreign DNA Following introduction of heterologous foreign DNA into plant cells, the transformation or integration of heterologous gene in the plant genome is confirmed by various methods such as analysis of nucleic acids, proteins and metabolites associated with the integrated gene.
- PCR analysis is a rapid method to screen transformed cells, tissue or shoots for the presence of incorporated gene at the earlier stage before transplanting into the soil (Sambrook and Russell, (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). PCR is carried out using oligonucleotide primers specific to the gene of interest or Agrobacterium vector background, etc.
- Plant transformation may be confirmed by Southern blot analysis of genomic DNA (Sambrook and Russell, (2001) supra).
- total DNA is extracted from the transformant, digested with appropriate restriction enzymes, fractionated in an agarose gel and transferred to a nitrocellulose or nylon membrane.
- the membrane or “blot” is then probed with, for example, radiolabeled 32P target DNA fragment to confirm the integration of introduced gene into the plant genome according to standard techniques (Sambrook and Russell, (2001) supra).
- RNA is isolated from specific tissues of transformant, fractionated in a formaldehyde agarose gel, and blotted onto a nylon filter according to standard procedures that are routinely used in the art (Sambrook and Russell, (2001) supra). Expression of RNA encoded by the pesticidal gene is then tested by hybridizing the filter to a radioactive probe derived from a pesticidal gene, by methods known in the art (Sambrook and Russell, (2001) supra).
- Western blot, biochemical assays and the like may be carried out on the transgenic plants to confirm the presence of protein encoded by the pesticidal gene by standard procedures (Sambrook and Russell, 2001, supra) using antibodies that bind to one or more epitopes present on the PIP-1 polypeptide.
- Transgenic plants may comprise a stack of one or more insecticidal polynucleotides disclosed herein with one or more additional polynucleotides resulting in the production or suppression of multiple polypeptide sequences.
- Transgenic plants comprising stacks of polynucleotide sequences can be obtained by either or both of traditional breeding methods or through genetic engineering methods. These methods include, but are not limited to, breeding individual lines each comprising a polynucleotide of interest, transforming a transgenic plant comprising a gene disclosed herein with a subsequent gene, and co-transformation of genes into a single plant cell.
- stacked includes having two or more traits present in the same plant (e.g., both traits are incorporated into the nuclear genome, one trait is incorporated into the nuclear genome and one trait is incorporated into the genome of a plastid or both traits are incorporated into the genome of a plastid).
- stacked traits comprise a molecular stack where the sequences are physically adjacent to each other.
- a trait refers to the phenotype derived from a particular sequence or groups of sequences. Co-transformation of genes can be carried out using single transformation vectors comprising multiple genes or genes carried separately on multiple vectors.
- the polynucleotide sequences of interest can be combined at any time and in any order.
- the traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes.
- the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis).
- Expression of the sequences can be driven by the same promoter or by different promoters.
- polynucleotide sequences can be stacked at a desired genomic location using a site-specific recombination system. See, for example, WO 1999/25821, WO 1999/25854, WO 1999/25840, WO 1999/25855 and WO 1999/25853, all of which are herein incorporated by reference.
- the polynucleotides encoding the PIP-1 polypeptides disclosed herein, alone or stacked with one or more additional insect resistance traits can be stacked with one or more additional input traits (e.g., herbicide resistance, fungal resistance, virus resistance or stress tolerance, disease resistance, male sterility, stalk strength, and the like) or output traits (e.g., increased yield, modified starches, improved oil profile, balanced amino acids, high lysine or methionine, increased digestibility, improved fiber quality, drought resistance, and the like).
- additional input traits e.g., herbicide resistance, fungal resistance, virus resistance or stress tolerance, disease resistance, male sterility, stalk strength, and the like
- output traits e.g., increased yield, modified starches, improved oil profile, balanced amino acids, high lysine or methionine, increased digestibility, improved fiber quality, drought resistance, and the like.
- Transgenes useful for stacking include but are not limited to: 1. Transgenes that Confer Resistance to Insects or Disease and that Encode:
- a Plant disease resistance genes Plant defenses are often activated by specific interaction between the product of a disease resistance gene (R) in the plant and the product of a corresponding avirulence (Avr) gene in the pathogen.
- R disease resistance gene
- Avr avirulence
- a plant variety can be transformed with cloned resistance gene to engineer plants that are resistant to specific pathogen strains. See, for example, Jones, et al., (1994) Science 266:789 (cloning of the tomato Cf-9 gene for resistance to Cladosporium fulvum ); Martin, et al., (1993) Science 262:1432 ( tomato Pto gene for resistance to Pseudomonas syringae pv.
- a plant resistant to a disease is one that is more resistant to a pathogen as compared to the wild type plant.
- Genes encoding pesticidal proteins may also be stacked including but are not limited to: insecticidal proteins from Pseudomonas sp. such as PSEEN3174 (Monalysin, (2011) PLoS Pathogens, 7:1-13), from Pseudomonas protegens strain CHAO and Pf-5 (previously fluorescens ) (Pechy-Tarr, (2008) Environmental Microbiology 10:2368-2386: GenBank Accession No. EU400157); from Pseudomonas taiwanensis (Liu, et al., (2010) J. Agric. Food Chem.
- Pseudomonas sp. such as PSEEN3174 (Monalysin, (2011) PLoS Pathogens, 7:1-13), from Pseudomonas protegens strain CHAO and Pf-5 (previously fluorescens ) (Pechy-Tarr, (2008) Environmental Microbiology
- ⁇ -endotoxins including, but not limited to, the Cry1, Cry2, Cry3, Cry4, Cry5, Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12, Cry13, Cry14, Cry15, Cry16, Cry17, Cry18, Cry19, Cry20, Cry21, Cry22, Cry23, Cry24, Cry25, Cry26, Cry27, Cry 28, Cry 29, Cry 30, Cry31, Cry32, Cry33, Cry34, Cry35, Cry36, Cry37, Cry38, Cry39, Cry40, Cry41, Cry42, Cry43, Cry44, Cry45, Cry 46, Cry47, Cry49, Cry 51 and Cry55 classes of ⁇ -endotoxin genes and the B.
- B. thuringiensis insecticidal proteins include, but are not limited to Cry1Aa1 (Accession #Accession #M11250), Cry1Aa2 (Accession #M10917), Cry1Aa3 (Accession #D00348), Cry1Aa4 (Accession #X13535), Cry1Aa5 (Accession #D17518), Cry1Aa6 (Accession #U43605), Cry1Aa7 (Accession #AF081790), Cry1Aa8 (Accession #126149), Cry1Aa9 (Accession #AB026261), Cry1Aa10 (Accession #AF154676), Cry1Aa11 (Accession #Y09663), Cry1Aa12 (Accession #AF384211), Cry1Aa13 (Accession #AF510713), Cry1Aa14
- Examples of ⁇ -endotoxins also include but are not limited to Cry1A proteins of U.S. Pat. Nos. 5,880,275 and 7,858,849; a DIG-3 or DIG-11 toxin (N-terminal deletion of ⁇ -helix 1 and/or ⁇ -helix 2 variants of Cry proteins such as Cry1A) of U.S. Pat. Nos. 8,304,604 and 8,304,605, Cry1B of U.S. patent application Ser. No. 10/525,318; Cry1C of U.S. Pat. No. 6,033,874; Cry1F of U.S. Pat. Nos. 5,188,960, 6,218,188; Cry1A/F chimeras of U.S. Pat.
- a Cry2 protein such as Cry2Ab protein of U.S. Pat. No. 7,064,249
- a Cry3A protein including but not limited to an engineered hybrid insecticidal protein (eHIP) created by fusing unique combinations of variable regions and conserved blocks of at least two different Cry proteins (US Patent Application Publication Number 2010/0017914); a Cry4 protein; a Cry5 protein; a Cry6 protein; Cry8 proteins of U.S. Pat. Nos.
- eHIP engineered hybrid insecticidal protein
- a Cry9 protein such as such as members of the Cry9A, Cry9B, Cry9C, Cry9D, Cry9E, and Cry9F families; a Cry15 protein of Naimov, et al., (2008) Applied and Environmental Microbiology 74:7145-7151; a Cry22, a Cry34Ab1 protein of U.S. Pat. Nos. 6,127,180, 6,624,145 and 6,340,593; a CryET33 and CryET34 protein of U.S. Pat. Nos.
- Cry proteins are well known to one skilled in the art (for review, see, van Frannkenhuyzen, (2009) J. Invert. Path. 101:1-16).
- the use of Cry proteins as transgenic plant traits is well known to one skilled in the art and Cry-transgenic plants including but not limited to Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105, Cry1F, Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, mCry3A, Cry9c and CBI-Bt have received regulatory approval (see, Sanahuja, (2011) Plant Biotech Journal 9:283-300 and the CERA (2010) GM Crop Database Center for Environmental Risk Assessment (CERA), ILSI Research Foundation, Washington D.C.
- More than one pesticidal proteins well known to one skilled in the art can also be expressed in plants such as Vip3Ab & Cry1Fa (US2012/0317682), Cry1BE & Cry1F (US2012/0311746), Cry1CA & Cry1AB (US2012/0311745), Cry1F & CryCa (US2012/0317681), Cry1DA & Cry1BE (US2012/0331590), Cry1DA & Cry1Fa (US2012/0331589), Cry1AB & Cry1BE (US2012/0324606), and Cry1Fa & Cry2Aa, Cry1I or Cry1E (US2012/0324605).
- Vip3Ab & Cry1Fa US2012/0317682
- Cry1BE & Cry1F US2012/0311746
- Cry1CA & Cry1AB US2012/0311745
- Cry1F & CryCa
- Pesticidal proteins also include insecticidal lipases including lipid acyl hydrolases of U.S. Pat. No. 7,491,869, and cholesterol oxidases such as from Streptomyces (Purcell et al. (1993) Biochem Biophys Res Commun 15:1406-1413). Pesticidal proteins also include VIP (vegetative insecticidal proteins) toxins of U.S. Pat. Nos. 5,877,012, 6,107,279, 6,137,033, 7,244,820, 7,615,686, and 8,237,020, and the like.
- VIP vegetable insecticidal proteins
- Pesticidal proteins are well known to one skilled in the art (see, lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html which can be accessed on the world-wide web using the “www” prefix).
- Pesticidal proteins also include toxin complex (TC) proteins, obtainable from organisms such as Xenorhabdus, Photorhabdus and Paenibacillus (see, U.S. Pat. Nos. 7,491,698 and 8,084,418).
- Some TC proteins have “stand alone” insecticidal activity and other TC proteins enhance the activity of the stand-alone toxins produced by the same given organism.
- TC protein from Photorhabdus, Xenorhabdus or Paenibacillus , for example
- TC protein “potentiators” derived from a source organism of a different genus.
- TC protein “potentiators” derived from a source organism of a different genus.
- Class B proteins are TcaC, TcdB, XptB1Xb and XptC1Wi.
- Class C proteins are TccC, XptC1Xb and XptB1Wi.
- Pesticidal proteins also include spider, snake and scorpion venom proteins. Examples of spider venom peptides include but are not limited to lycotoxin-1 peptides and mutants thereof (U.S. Pat. No. 8,334,366).
- (C) A polynucleotide encoding an insect-specific hormone or pheromone such as an ecdysteroid and juvenile hormone, a variant thereof, a mimetic based thereon or an antagonist or agonist thereof. See, for example, the disclosure by Hammock, et al., (1990) Nature 344:458, of baculovirus expression of cloned juvenile hormone esterase, an inactivator of juvenile hormone.
- (E) A polynucleotide encoding an enzyme responsible for a hyperaccumulation of a monterpene, a sesquiterpene, a steroid, hydroxamic acid, a phenylpropanoid derivative or another non-protein molecule with insecticidal activity.
- a polynucleotide encoding an enzyme involved in the modification, including the post-translational modification, of a biologically active molecule for example, a glycolytic enzyme, a proteolytic enzyme, a lipolytic enzyme, a nuclease, a cyclase, a transaminase, an esterase, a hydrolase, a phosphatase, a kinase, a phosphorylase, a polymerase, an elastase, a chitinase and a glucanase, whether natural or synthetic.
- a glycolytic enzyme for example, a glycolytic enzyme, a proteolytic enzyme, a lipolytic enzyme, a nuclease, a cyclase, a transaminase, an esterase, a hydrolase, a phosphatase, a kinase, a phosphorylase, a polymerase, an elastase,
- G A polynucleotide encoding a molecule that stimulates signal transduction.
- Botella et al., (1994) Plant Molec. Biol. 24:757, of nucleotide sequences for mung bean calmodulin cDNA clones and Griess, et al., (1994) Plant Physiol. 104:1467, who provide the nucleotide sequence of a maize calmodulin cDNA clone.
- (J) A gene encoding a viral-invasive protein or a complex toxin derived therefrom.
- the accumulation of viral coat proteins in transformed plant cells imparts resistance to viral infection and/or disease development effected by the virus from which the coat protein gene is derived, as well as by related viruses. See, Beachy, et al., (1990) Ann. Rev. Phytopathol. 28:451.
- Coat protein-mediated resistance has been conferred upon transformed plants against alfalfa mosaic virus, cucumber mosaic virus, tobacco streak virus, potato virus X, potato virus Y, tobacco etch virus, tobacco rattle virus and tobacco mosaic virus. Id.
- (M) A polynucleotide encoding a developmental-arrestive protein produced in nature by a pathogen or a parasite.
- fungal endo alpha-1,4-D-polygalacturonases facilitate fungal colonization and plant nutrient release by solubilizing plant cell wall homo-alpha-1,4-D-galacturonase.
- the cloning and characterization of a gene which encodes a bean endopolygalacturonase-inhibiting protein is described by Toubart, et al., (1992) Plant J. 2:367.
- N A polynucleotide encoding a developmental-arrestive protein produced in nature by a plant. For example, Logemann, et al., (1992) Bio/Technology 10:305, have shown that transgenic plants expressing the barley ribosome-inactivating gene have an increased resistance to fungal disease.
- (Q) Detoxification genes such as for fumonisin, beauvericin, moniliformin and zearalenone and their structurally related derivatives. For example, see, U.S. Pat. Nos. 5,716,820; 5,792,931; 5,798,255; 5,846,812; 6,083,736; 6,538,177; 6,388,171 and 6,812,380.
- (U) Genes that confer resistance to Phytophthora Root Rot such as the Rps 1, Rps 1-a, Rps 1-b, Rps 1-c, Rps 1-d, Rps 1-e, Rps 1-k, Rps 2, Rps 3-a, Rps 3-b, Rps 3-c, Rps 4, Rps 5, Rps 6, Rps 7 and other Rps genes. See, for example, Shoemaker, et al., Phytophthora Root Rot Resistance Gene Mapping in Soybean, Plant Genome IV Conference, San Diego, Calif. (1995).
- a herbicide that inhibits the growing point or meristem
- Exemplary genes in this category code for mutant ALS and AHAS enzyme as described, for example, by Lee, et al., (1988) EMBO J. 7:1241 and Miki, et al., (1990) Theor. Appl. Genet. 80:449, respectively. See also, U.S. Pat. Nos.
- B A polynucleotide encoding a protein for resistance to Glyphosate (resistance imparted by mutant 5-enolpyruvl-3-phosphikimate synthase (EPSP) and aroA genes, respectively) and other phosphono compounds such as glufosinate (phosphinothricin acetyl transferase (PAT) and Streptomyces hygroscopicus phosphinothricin acetyl transferase (bar) genes) and pyridinoxy or phenoxy proprionic acids and cyclohexones (ACCase inhibitor-encoding genes). See, for example, U.S. Pat. No.
- Glyphosate resistance is also imparted to plants that express a gene encoding a glyphosate oxido-reductase enzyme as described more fully in U.S. Pat. Nos. 5,776,760 and 5,463,175, which are incorporated herein by reference for this purpose.
- glyphosate resistance can be imparted to plants by the over expression of genes encoding glyphosate N-acetyltransferase. See, for example, U.S. Pat. Nos. 7,462,481; 7,405,074 and US Patent Publication Number US 2008/0234130).
- a DNA molecule encoding a mutant aroA gene can be obtained under ATCC Accession Number 39256 and the nucleotide sequence of the mutant gene is disclosed in U.S. Pat. No. 4,769,061 to Comai.
- European Patent Application Number 0 333 033 to Kumada, et al., and U.S. Pat. No. 4,975,374 to Goodman, et al. disclose nucleotide sequences of glutamine synthetase genes which confer resistance to herbicides such as L-phosphinothricin.
- the nucleotide sequence of a phosphinothricin-acetyl-transferase gene is provided in European Patent No.
- genes conferring resistance to phenoxy proprionic acids and cyclohexones are the Acc1-S1, Acc1-S2 and Acc1-S3 genes described by Marshall, et al., (1992) Theor. Appl. Genet. 83:435.
- C A polynucleotide encoding a protein for resistance to herbicide that inhibits photosynthesis, such as a triazine (psbA and gs+genes) and a benzonitrile (nitrilase gene).
- psbA and gs+genes triazine
- nitrilase gene a benzonitrile
- Przibilla, et al., (1991) Plant Cell 3:169 describe the transformation of Chlamydomonas with plasmids encoding mutant psbA genes.
- Nucleotide sequences for nitrilase genes are disclosed in U.S. Pat. No. 4,810,648 to Stalker and DNA molecules containing these genes are available under ATCC Accession Numbers 53435, 67441 and 67442. Cloning and expression of DNA coding for a glutathione S-transferase is described by Hayes, et al., (1992) Biochem. J.
- genes that confer resistance to herbicides include: a gene encoding a chimeric protein of rat cytochrome P4507A1 and yeast NADPH-cytochrome P450 oxidoreductase (Shiota, et al., (1994) Plant Physiol 106:17), genes for glutathione reductase and superoxide dismutase (Aono, et al., (1995) Plant Cell Physiol 36:1687, and genes for various phosphotransferases (Datta, et al., (1992) Plant Mol Biol 20:619).
- the aad-1 gene (originally from Sphingobium herbicidovorans ) encodes the aryloxyalkanoate dioxygenase (AAD-1) protein.
- AAD-1 aryloxyalkanoate dioxygenase
- the trait confers tolerance to 2,4-dichlorophenoxyacetic acid and aryloxyphenoxypropionate (commonly referred to as “fop” herbicides such as quizalofop) herbicides.
- the aad-1 gene, itself, for herbicide tolerance in plants was first disclosed in WO 2005/107437 (see also, US 2009/0093366).
- the aad-12 gene derived from Delftia acidovorans , which encodes the aryloxyalkanoate dioxygenase (AAD-12) protein that confers tolerance to 2,4-dichlorophenoxyacetic acid and pyridyloxyacetate herbicides by deactivating several herbicides with an aryloxyalkanoate moiety, including phenoxy auxin (e.g., 2,4-D, MCPA), as well as pyridyloxy auxins (e.g., fluroxypyr, triclopyr).
- phenoxy auxin e.g., 2,4-D, MCPA
- pyridyloxy auxins e.g., fluroxypyr, triclopyr
- delta-8 desaturase for making long-chain polyunsaturated fatty acids (U.S. Pat. Nos. 8,058,571 and 8,338,152), delta-9 desaturase for lowering saturated fats (U.S. Pat. No. 8,063,269), Primula ⁇ 6-desaturase for improving omega-3 fatty acid profiles.
- LMP lipid metabolism protein
- HS12 Sugar-Inducible 2
- D Altered antioxidant content or composition, such as alteration of tocopherol or tocotrienols.
- tocopherol or tocotrienols For example, see, U.S. Pat. No. 6,787,683, US 2004/0034886 and WO 2000/68393 involving the manipulation of antioxidant levels and WO 2003/082899 through alteration of a homogentisate geranyl geranyl transferase (hggt).
- 5,432,068 describe a system of nuclear male sterility which includes: identifying a gene which is critical to male fertility; silencing this native gene which is critical to male fertility; removing the native promoter from the essential male fertility gene and replacing it with an inducible promoter; inserting this genetically engineered gene back into the plant; and thus creating a plant that is male sterile because the inducible promoter is not “on” resulting in the male fertility gene not being transcribed. Fertility is restored by inducing or turning “on”, the promoter, which in turn allows the gene that confers male fertility to be transcribed.
- FRT sites that may be used in the FLP/FRT system and/or Lox sites that may be used in the Cre/Loxp system.
- Lox sites that may be used in the Cre/Loxp system.
- Other systems that may be used include the Gin recombinase of phage Mu (Maeser, et al., (1991) Vicki Chandler, The Maize Handbook ch. 118 (Springer-Verlag 1994), the Pin recombinase of E. coli (Enomoto, et al., 1983) and the R/RS system of the pSRi plasmid (Araki, et al., 1992).
- G Genes that increase expression of vacuolar pyrophosphatase such as AVP1 (U.S. Pat. No. 8,058,515) for increased yield; nucleic acid encoding a HSFA4 or a HSFA5 (Heat Shock Factor of the class A4 or A5) polypeptides, an oligopeptide transporter protein (OPT4-like) polypeptide; a plastochron2-like (PLA2-like) polypeptide or a Wuschel related homeobox 1-like (WOX1-like) polypeptide (US Patent Application Publication Number US 2011/0283420);
- TPP Trehalose Phosphate Phosphatase
- genes and transcription factors that affect plant growth and agronomic traits such as yield, flowering, plant growth and/or plant structure, can be introduced or introgressed into plants, see e.g., WO 1997/49811 (LHY), WO 1998/56918 (ESD4), WO 1997/10339 and U.S. Pat. No. 6,573,430 (TFL), U.S. Pat. No. 6,713,663 (FT), WO 1996/14414 (CON), WO 1996/38560, WO 2001/21822 (VRN1), WO 2000/44918 (VRN2), WO 1999/49064 (GI), WO 2000/46358 (FR1), WO 1997/29123, U.S. Pat. Nos. 6,794,560, 6,307,126 (GAI), WO 1999/09174 (D8 and Rht), and WO 2004/076638 and WO 2004/031349 (transcription factors).
- LHY WO 1997/49811
- ESD4 WO 1998/56918
- ACCDP 1-AminoCyclopropane-1-Carboxylate Deaminase-like Polypeptide
- NDK nucleoside diphosphatase kinase
- the stacked trait may be a trait or event that has received regulatory approval including but not limited to the events in Table 1A-1F.
- AHAS acetohydroxyacid synthase
- ALS acetolactate synthase
- acetohydroxyacid synthase also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase.
- BW7 BASF Inc. Tolerance to imidazolinone herbicides induced by chemical mutagenesis of the acetohydroxyacid synthase (AHAS) gene using sodium azide.
- EPSPS modified 5-enolpyruvylshikimate-3- phosphate synthase
- AHAS acetohydroxyacid synthase
- ALS acetolactate synthase
- A5547-127 Bayer Glufosinate ammonium herbicide tolerant CropScience soybean produced by inserting a modified (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces viridochromogenes. BPS- BASF Inc.
- the introduced csr1-2 gene from Arabidopsis CV127-9 thaliana encodes an acetohydroxyacid synthase protein that confers tolerance to imidazolinone herbicides due to a point mutation that results in a single amino acid substitution in which the serine residue at position 653 is replaced by asparagine (S653N).
- DP-305423 Pioneer High oleic acid soybean produced Hi-Bred by inserting additional copies International of a portion of the omega-6 Inc. desaturase encoding gene, gm-fad2-1 resulting in silencing of the endogenous omega-6 desaturase gene (FAD2-1).
- ALS acetolactate synthase
- G94-1 DuPont High oleic acid soybean G94-19, Canada produced by inserting G168 Agricultural a second copy of the fatty acid desaturase Products (GmFad2-1) encoding gene from soybean, which resulted in “silencing” of the endogenous host gene.
- GTS 40-3-2 Monsanto Glyphosate tolerant soybean Company variety produced by inserting a modified 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) encoding gene from the soil bacterium Agrobacterium tumefaciens.
- EPSPS modified 5-enolpyruvylshikimate-3- phosphate synthase
- GU262 Bayer Glufosinate ammonium herbicide tolerant CropScience soybean produced by inserting a modified (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces viridochromogenes.
- PAT ventis phosphinothricin acetyltransferase
- tumefaciens strain CP4 and resistance to lepidopteran pests of soybean including velvetbean caterpillar ( Anticarsia gemmatalis ) and soybean looper ( Pseudoplusia includens ) via expression of the Cry1Ac encoding gene from B. thuringiensis.
- EPSPS modified 5-enolpyruvylshikimate-3- phosphate synthase
- OT96-15 Agriculture Low linolenic acid soybean produced through & Agri-Food traditional cross-breeding to incorporate the Canada novel trait from a naturally occurring fan1 gene mutant that was selected for low linolenic acid.
- W62, W98 Bayer Glufosinate ammonium herbicide tolerant CropScience soybean produced by inserting a modified (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces hygroscopicus .
- PAT Application phosphinothricin acetyltransferase
- LLRICE06 Aventis Glufosinate ammonium herbicide tolerant LLRICE62 CropScience rice produced by inserting a modified phosphinothricin acetyltransferase (PAT) encoding gene from the soil bacterium Streptomyces hygroscopicus ).
- LLRICE601 Bayer Glufosinate ammonium herbicide tolerant CropScience rice produced by inserting a modified (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces hygroscopicus ).
- ALS acetolactate synth
- ammonium herbicide tolerant maize produced by inserting genes encoding DNA adenine methylase and phosphinothricin acetyltransferase (PAT) from Escherichia coli and Streptomyces viridochromogenes , respectively.
- PAT DNA adenine methylase and phosphinothricin acetyltransferase
- B16 DLL25
- Dekalb Genetics Glufosinate ammonium Corporation herbicide tolerant maize produced by inserting the gene encoding phosphinothricin acetyltransferase (PAT) from Streptomyces hygroscopicus.
- BT11 Syngenta Insect-resistant and (X4334CBR, Seeds, Inc.
- herbicide tolerant maize X4734CBR produced by inserting the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki , and the phosphinothricin N-acetyltransferase (PAT) encoding gene from S. viridochromogenes.
- BT11 x GA21 Syngenta Seeds, Inc. Stacked insect resistant and herbicide tolerant maize produced by conventional cross breeding of parental lines BT11 (OECD unique identifier: SYN-BTO11-1) and GA21 (OECD unique identifier: MON-OOO21-9).
- Resistance to the European Corn Borer and tolerance to the herbicide glufosinate ammonium (Liberty) is derived from BT11, which contains the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki , and the phosphinothricin N-acetyltransferase (PAT) encoding gene from S. viridochromogenes .
- ipsilon , and S. albicosta is derived from MIR162, which contains the vip3Aa gene from Bacillus thuringiensis strain AB88. BT11 x MIR162 x Syngenta Seeds, Inc.
- BT11 x Syngenta Seeds Resistance to coleopteran pests, MIR162 x Inc. particularly corn rootworm pests MIR604 x ( Diabrotica spp.) and several GA21 lepidopteran pests of corn, including European corn borer (ECB, Ostrinia nubilalis ), corn earworm (CEW, Helicoverpa zea ), fall army worm (FAW, Spodoptera frugiperda ), and black cutworm (BCW, Agrotis ipsilon ); tolerance to glyphosate and glufosinate-ammonium containing herbicides.
- ECB European corn borer
- CEW Corn earworm
- FAW Fall army worm
- BCW Black cutworm
- BCW Agrotis ipsilon
- BT11 OECD unique identifier: SYN-BTO11-1
- MIR604 OECD unique identifier: SYN-IR6O5-5
- Resistance to the European Corn Borer and tolerance to the herbicide glufosinate ammonium (Liberty) is derived from BT11, which contains the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki , and the phosphinothricin N- acetyltransferase (PAT) encoding gene from S. viridochromogenes .
- PAT phosphinothricin N- acetyltransferase
- Corn rootworm- resistance is derived from MIR604 which contains the mCry3A gene from Bacillus thuringiensis.
- Resistance to the European Corn Borer and tolerance to the herbicide glufosinate ammonium (Liberty) is derived from BT11, which contains the Cry1Ab gene from Bacillus thuringiensis subsp.
- israeltaki and the phosphinothricin N- acetyltransferase (PAT) encoding gene from S. viridochromogenes.
- Corn rootworm- resistance is derived from MIR604 which contains the mCry3A gene from Bacillus thuringiensis .
- Tolerance to glyphosate herbicide is derived from GA21 which contains a modified EPSPS gene from maize.
- CBH-351 Aventis Insect-resistant and glufosinate CropScience ammonium herbicide tolerant maize developed by inserting genes encoding Cry9C protein from Bacillus thuringiensis subsp tolworthi and phosphinothricin acetyltransferase (PAT) from Streptomyces hygroscopicus.
- PAT phosphinothricin acetyltransferase
- DAS- DOW Lepidopteran insect resistant 06275-8 AgroSciences and glufosinate ammonium LLC herbicide-tolerant maize variety produced by inserting the Cry1F gene from Bacillus thuringiensis var aizawai and the phosphinothricin acetyltransferase (PAT) from Streptomyces hygroscopicus.
- the PAT encoding Inc. gene from Streptomyces viridochromogenes was introduced as a selectable marker.
- Corn rootworm-resistance is derived from DAS-59122-7 which contains the Cry34Ab1 and Cry35Ab1 genes from Bacillus thuringiensis strain PS149B1.
- Tolerance to glyphosate herbicide is derived from NK603.
- Corn rootworm-resistance is derived from DAS-59122-7 which contains the Cry34Ab1 and Cry35Ab1 genes from Bacillus thuringiensis strain PS149B1. Lepidopteran resistance and tolerance to glufosinate ammonium herbicide is derived from TC1507.
- Tolerance to glyphosate herbicide is derived from NK603.
- DBT418 Dekalb Genetics Corporation Insect-resistant and glufosinate ammonium herbicide tolerant maize developed by inserting genes encoding Cry1AC protein from Bacillus thuringiensis subsp kurstaki and phosphinothricin acetyltransferase (PAT) from Streptomyces hygroscopicus DK404SR BASF Inc. Somaclonal variants with a modified acetyl-CoA-carboxylase (ACCase) were selected by culture of embryos on sethoxydim enriched medium. Event 3272 Syngenta Seeds, Inc.
- the phosphomannose isomerase gene from E. coli was used as a selectable marker.
- Event 98140 Pioneer Hi-Bred International Inc. Maize event expressing tolerance to glyphosate herbicide, via expression of a modified bacterial glyphosate N- acetlytransferase, and ALS-inhibiting herbicides, vial expression of a modified form of the maize acetolactate synthase enzyme.
- EXP1910IT Syngenta Seeds, Tolerance to the imidazolinone Inc.
- EPSPS enolpyruvyl shikimate-3-phosphate synthase
- MIR604 x Syngenta Stacked insect resistant and herbicide GA21 Seeds, Inc. tolerant maize produced by conventional cross breeding of parental lines MIR604 (OECD unique identifier: SYN-IR6O5-5) and GA21 (OECD unique identifier: MON- OOO21-9).
- Corn rootworm-resistance is derived from MIR604 which contains the mCry3A gene from Bacillus thuringiensis .
- Tolerance to glyphosate herbicide is derived from GA21.
- MON80100 Monsanto Insect-resistant maize produced by Company inserting the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki .
- the genetic modification affords resistance to attack by the European corn borer (ECB).
- MON802 Monsanto Company Insect-resistant and glyphosate herbicide tolerant maize produced by inserting the genes encoding the Cry1Ab protein from Bacillus thuringiensis and the 5-enolpyruvylshikimate- 3-phosphate synthase (EPSPS) from A. tumefaciens strain CP4.
- EPSPS 5-enolpyruvylshikimate- 3-phosphate synthase
- MON809 Pioneer Hi- Resistance to European corn borer Bred ( Ostrinia nubilalis ) by introduction International Inc. of a synthetic Cry1Ab gene. Glyphosate resistance via introduction of the bacterial version of a plant enzyme, 5-enolpyruvyl shikimate-3- phosphate synthase (EPSPS).
- EPSPS 5-enolpyruvyl shikimate-3- phosphate synthase
- MON810 Monsanto Company Insect-resistant maize produced by inserting a truncated form of the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki HD-1. The genetic modification affords resistance to attack by the European corn borer (ECB).
- European corn borer (ECB) resistance is derived from a truncated form of the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki HD-1 present in MON810.
- Corn rootworm resistance is derived from the Cry3Bb1 gene from Bacillus thuringiensis subspecies kumamotoensis strain EG4691 present in MON88017.
- Glyphosate tolerance is derived from a 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) encoding gene from Agrobacterium tumefaciens strain CP4 present in MON88017.
- EPSPS 5-enolpyruvylshikimate-3- phosphate synthase
- MON832 Monsanto Company Introduction, by particle bombardment, of glyphosate oxidase (GOX) and a modified 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS), an enzyme involved in the shikimate biochemical pathway for the production of the aromatic amino acids.
- MON863 Monsanto Company Corn root worm resistant maize produced by inserting the Cry3Bb1 gene from Bacillus thuringiensis subsp.
- MON863 x Monsanto Stacked insect resistant corn hybrid MON810 Company derived from conventional cross- breeding of the parental lines MON863 (OECD identifier: MON- OO863-5) and MON810 (OECD identifier: MON-OO81O-6)
- MON87460 Monsanto Company MON 87460 was developed to provide reduced yield loss underwater- limited conditions compared to conventional maize. Efficacy in MON 87460 is derived by expression of the inserted Bacillus subtilis cold shock protein B (CspB).
- MON88017 Monsanto Company Corn rootworm-resistant maize produced by inserting the Cry3Bb1 gene from Bacillus thuringiensis subspecies kumamotoensis strain EG4691. Glyphosate tolerance derived by inserting a 5-enolpyruvylshikimate- 3-phosphate synthase (EPSPS) encoding gene from Agrobacterium tumefaciens strain CP4.
- EPSPS 5-enolpyruvylshikimate- 3-phosphate synthase
- MON89034 Monsanto Company Maize event expressing two different insecticidal proteins from Bacillus thuringiensis providing resistance to number of lepidopteran pests.
- MON89034 Monsanto Stacked insect resistant x Company and glyphosate tolerant MON88017 maize derived from conventional cross-breeding of the parental lines MON89034 (OECD identifier: MON-89O34-3) and MON88017 (OECD identifier: MON-88O17-3). Resistance to Lepidopteran insects is derived from two Cry genes present in MON89043. Corn rootworm resistance is derived from a single Cry genes and glyphosate tolerance is derived from the 5- enolpyruvylshikimate-3- phosphate synthase (EPSPS) encoding gene from Agrobacterium tumefaciens present in MON88017.
- EPSPS 5- enolpyruvylshikimate-3- phosphate synthase
- MON89034 Monsanto Stacked insect resistant x Company and herbicide tolerant NK603 maize produced by conventional cross breeding of parental lines MON89034 (OECD identifier: MON-89O34-3) with NK603 (OECD unique identifier: MON-OO6O3-6). Resistance to Lepidopteran insects is derived from two Cry genes present in MON89043. Tolerance to glyphosate herbicide is derived from NK603.
- MS3 Bayer Male sterility caused by CropScience expression of the barnase (Aventis ribonuclease gene CropScience from Bacillus (AgrEvo)) amyloliquefaciens ; PPT resistance was via PPT- acetyltransferase (PAT).
- MS6 Bayer Male sterility caused by CropScience expression of the barnase (Aventis ribonuclease gene from Bacillus CropScience amyloliquefaciens ; PPT (AgrEvo)) resistance was via PPT- acetyltransferase (PAT).
- NK603 Monsanto Introduction, by particle Company bombardment, of a modified 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS), an enzyme involved in the shikimate biochemical pathway for the production of the aromatic amino acids.
- EPSPS modified 5-enolpyruvyl shikimate-3-phosphate synthase
- T25 x Bayer Stacked insect resistant MON810 CropScience and herbicide tolerant (Aventis corn hybrid derived from CropScience conventional cross- (AgrEvo)) breeding of the parental lines T25 (OECD identifier: ACS-ZMOO3-2) and MON810 (OECD identifier:MON-OO81O-6).
- OECD identifier: ACS-ZMOO3-2 ACS-ZMOO3-2
- MON810 OECD identifier:MON-OO81O-6
- Corn rootworm- resistance is derived from DAS-59122-7 which contains the Cry34Ab1 and Cry35Ab1 genes from Bacillus thuringiensis strain PS149B1.
- Tolerance to glufosinate ammonium herbicide is derived from TC1507 from the phosphinothricin N- acetyltransferase encoding gene from Streptomyces viridochromogenes.
- the stacked trait may be in the form of silencing of one or more polynucleotides of interest resulting in suppression of one or more target pest polypeptides.
- the silencing is achieved through the use of a suppression DNA construct.
- one or more of the PIP-1, PIP-1A (SEQ ID NO: 2), PSEEN3174 (SEQ ID NO: 6), PIP-1C (SEQ ID NO: 332), and PIP-1B (SEQ ID NO: 4) polypeptides or fragments or variants thereof may be stacked with one or more polynucleotides encoding one or more polypeptides having insecticidal activity or agronomic traits as set forth supra and optionally may further include one or more polynucleotides providing for gene silencing of one or more target polynucleotides as discussed infra.
- “Suppression DNA construct” is a recombinant DNA construct which when transformed or stably integrated into the genome of the plant, results in “silencing” of a target gene in the plant.
- the target gene may be endogenous or transgenic to the plant.
- “Silencing,” as used herein with respect to the target gene refers generally to the suppression of levels of mRNA or protein/enzyme expressed by the target gene, and/or the level of the enzyme activity or protein functionality.
- the term “suppression” includes lower, reduce, decline, decrease, inhibit, eliminate and prevent.
- RNAi-based approaches RNAi-based approaches.
- a suppression DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or antisense strand) of the target gene of interest. Depending upon the approach to be utilized, the region may be 100% identical or less than 100% identical (e.g., at least 50% or any integer between 51% and 100% identical) to all or part of the sense strand (or antisense strand) of the gene of interest.
- Suppression DNA constructs are well-known in the art, are readily constructed once the target gene of interest is selected, and include, without limitation, cosuppression constructs, antisense constructs, viral-suppression constructs, hairpin suppression constructs, stem-loop suppression constructs, double-stranded RNA-producing constructs, and more generally, RNAi (RNA interference) constructs and small RNA constructs such as siRNA (short interfering RNA) constructs and miRNA (microRNA) constructs.
- cosuppression constructs include, without limitation, cosuppression constructs, antisense constructs, viral-suppression constructs, hairpin suppression constructs, stem-loop suppression constructs, double-stranded RNA-producing constructs, and more generally, RNAi (RNA interference) constructs and small RNA constructs such as siRNA (short interfering RNA) constructs and miRNA (microRNA) constructs.
- cosuppression constructs include, without limitation, cosuppression constructs, antisense constructs, viral
- Antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein.
- Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (U.S. Pat. No. 5,107,065).
- the complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5′ non-coding sequence, 3′ non-coding sequence, introns or the coding sequence.
- Codon refers to the production of sense RNA transcripts capable of suppressing the expression of the target protein.
- Sense RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Cosuppression constructs in plants have been previously designed by focusing on overexpression of a nucleic acid sequence having homology to a native mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (see, Vaucheret, et al. (1998) Plant J. 16:651-659 and Gura, (2000) Nature 404:804-808).
- a construct where the stem is formed by at least 30 nucleotides from a gene to be suppressed and the loop is formed by a random nucleotide sequence has also effectively been used for suppression (WO 1999/61632).
- Yet another variation includes using synthetic repeats to promote formation of a stem in the stem-loop structure.
- Transgenic organisms prepared with such recombinant DNA fragments have been shown to have reduced levels of the protein encoded by the nucleotide fragment forming the loop as described in PCT Publication Number WO 2002/00904.
- RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire, et al., (1998) Nature 391:806). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi.
- PTGS post-transcriptional gene silencing
- the process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire, et al., (1999) Trends Genet. 15:358).
- Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA of viral genomic RNA.
- dsRNAs double-stranded RNAs
- the presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized.
- dsRNAs ribonuclease Ill enzyme
- Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein, et al., (2001) Nature 409:363).
- Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir, et al., (2001) Genes Dev. 15:188).
- Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner, et al., (2001) Science 293:834).
- the RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementarity to the antisense strand of the siRNA duplex.
- RISC RNA-induced silencing complex
- RNA interference can also involve small RNA (e.g., miRNA) mediated gene silencing, presumably through cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see, e.g., Allshire, (2002) Science 297:1818-1819; Volpe, et al., (2002) Science 297:1833-1837; Jenuwein, (2002) Science 297:2215-2218; and Hall, et al., (2002) Science 297:2232-2237).
- miRNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional or post-transcriptional level.
- Methods and compositions are further provided which allow for an increase in RNAi produced from the silencing element.
- the methods and compositions employ a first polynucleotide comprising a silencing element for a target pest sequence operably linked to a promoter active in the plant cell; and, a second polynucleotide comprising a suppressor enhancer element comprising the target pest sequence or an active variant or fragment thereof operably linked to a promoter active in the plant cell.
- the combined expression of the silencing element with suppressor enhancer element leads to an increased amplification of the inhibitory RNA produced from the silencing element over that achievable with only the expression of the silencing element alone.
- the methods and compositions further allow for the production of a diverse population of RNAi species that can enhance the effectiveness of disrupting target gene expression.
- the methods and composition can allow for the systemic production of RNAi throughout the plant; the production of greater amounts of RNAi than would be observed with just the silencing element construct alone; and, the improved loading of RNAi into the phloem of the plant, thus providing better control of phloem feeding insects by an RNAi approach.
- the various methods and compositions provide improved methods for the delivery of inhibitory RNA to the target organism. See, for example, US 2009/0188008.
- a “suppressor enhancer element” comprises a polynucleotide comprising the target sequence to be suppressed or an active fragment or variant thereof. It is recognize that the suppressor enhancer element need not be identical to the target sequence, but rather, the suppressor enhancer element can comprise a variant of the target sequence, so long as the suppressor enhancer element has sufficient sequence identity to the target sequence to allow for an increased level of the RNAi produced by the silencing element over that achievable with only the expression of the silencing element. Similarly, the suppressor enhancer element can comprise a fragment of the target sequence, wherein the fragment is of sufficient length to allow for an increased level of the RNAi produced by the silencing element over that achievable with only the expression of the silencing element.
- the suppressor enhancer elements employed can comprise fragments of the target sequence derived from different region of the target sequence (i.e., from the 3′UTR, coding sequence, intron, and/or 5′UTR).
- the suppressor enhancer element can be contained in an expression cassette, as described elsewhere herein, and in specific embodiments, the suppressor enhancer element is on the same or on a different DNA vector or construct as the silencing element.
- the suppressor enhancer element can be operably linked to a promoter as disclosed herein. It is recognized that the suppressor enhancer element can be expressed constitutively or alternatively, it may be produced in a stage-specific manner employing the various inducible or tissue-preferred or developmentally regulated promoters that are discussed elsewhere herein.
- RNAi RNAi-derived RNAi
- the plant or plant parts of the invention have an improved loading of RNAi into the phloem of the plant than would be observed with the expression of the silencing element construct alone and, thus provide better control of phloem feeding insects by an RNAi approach.
- the plants, plant parts, and plant cells of the invention can further be characterized as allowing for the production of a diversity of RNAi species that can enhance the effectiveness of disrupting target gene expression.
- the combined expression of the silencing element and the suppressor enhancer element increases the concentration of the inhibitory RNA in the plant cell, plant, plant part, plant tissue or phloem over the level that is achieved when the silencing element is expressed alone.
- an “increased level of inhibitory RNA” comprises any statistically significant increase in the level of RNAi produced in a plant having the combined expression when compared to an appropriate control plant.
- an increase in the level of RNAi in the plant, plant part or the plant cell can comprise at least about a 1%, about a 1%-5%, about a 5%-10%, about a 10%-20%, about a 20%-30%, about a 30%-40%, about a 40%-50%, about a 50%-60%, about 60-70%, about 70%-80%, about a 80%-90%, about a 90%-100% or greater increase in the level of RNAi in the plant, plant part, plant cell or phloem when compared to an appropriate control.
- the increase in the level of RNAi in the plant, plant part, plant cell or phloem can comprise at least about a 1 fold, about a 1 fold-5 fold, about a 5 fold-10 fold, about a 10 fold-20 fold, about a 20 fold-30 fold, about a 30 fold-40 fold, about a 40 fold-50 fold, about a 50 fold-60 fold, about 60 fold-70 fold, about 70 fold-80 fold, about a 80 fold-90 fold, about a 90 fold-100 fold or greater increase in the level of RNAi in the plant, plant part, plant cell or phloem when compared to an appropriate control.
- RNA molecules interfering ribonucleic acid (RNA) molecules.
- WO 2007/074405 describes methods of inhibiting expression of target genes in invertebrate pests including Colorado potato beetle.
- WO 2005/110068 describes methods of inhibiting expression of target genes in invertebrate pests including in particular Western corn rootworm as a means to control insect infestation.
- WO 2009/091864 describes compositions and methods for the suppression of target genes from insect pest species including pests from the Lygus genus.
- RNAi for targeting the vacuolar ATPase H subunit, useful for controlling a coleopteran pest population and infestation as described in US Patent Application Publication 2012/0198586.
- WO 2012/055982 describes ribonucleic acid (RNA or double stranded RNA) that inhibits or down regulates the expression of a target gene that encodes: an insect ribosomal protein such as the ribosomal protein L19, the ribosomal protein L40 or the ribosomal protein S27A; an insect proteasome subunit such as the Rpn6 protein, the Pros 25, the Rpn2 protein, the proteasome beta 1 subunit protein or the Pros beta 2 protein; an insect ⁇ -coatomer of the COPI vesicle, the ⁇ -coatomer of the COPI vesicle, the ⁇ ′-coatomer protein or the ⁇ -coatomer of the COPI vesicle; an insect Tetraspanine 2 A protein which is
- RNA or double stranded RNA that functions upon uptake by an insect pest species to down-regulate expression of a target gene in said insect pest
- the RNA comprises at least one silencing element wherein the silencing element is a region of double-stranded RNA comprising annealed complementary strands, one strand of which comprises or consists of a sequence of nucleotides which is at least partially complementary to a target nucleotide sequence within the target gene.
- US Patent Application Publication 2012/0164205 describe potential targets for interfering double stranded ribonucleic acids for inhibiting invertebrate pests including: a Chd3 Homologous Sequence, a Beta-Tubulin Homologous Sequence, a 40 kDa V-ATPase Homologous Sequence, a EF1a Homologous Sequence, a 26S Proteosome Subunit p28 Homologous Sequence, a Juvenile Hormone Epoxide Hydrolase Homologous Sequence, a Swelling Dependent Chloride Channel Protein Homologous Sequence, a Glucose-6-Phosphate 1-Dehydrogenase Protein Homologous Sequence, an Act42A Protein Homologous Sequence, a ADP-Ribosylation Factor 1 Homologous Sequence, a Transcription Factor IIB Protein Homologous Sequence, a
- Microorganism hosts that are known to occupy the “phytosphere” (phylloplane, phyllosphere, rhizosphere, and/or rhizoplana) of one or more crops of interest may be selected. These microorganisms are selected so as to be capable of successfully competing in the particular environment with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing the PIP-1 polypeptide, and desirably, provide for improved protection of the pesticide from environmental degradation and inactivation.
- microorganisms include bacteria, algae, and fungi.
- microorganisms such as bacteria, e.g., Alcaligenes, Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc , and Alcaligenes , fungi, particularly yeast, e.g., Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotorula , and Aureobasidium .
- phytosphere bacterial species as Alcaligenes faecalis, Pseudomonas syringae, Pseudomonas fluorescens, Serratia marcescens, Acetobacter xylinum , Agrobacteria, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus, Clavibacter xyli and Azotobacter vinelandii and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, C.
- yeast such as Rhodotorula spp., Aureobasidium spp., Saccharomyces spp. (such as S. cerevisiae ), Sporobolomyces spp., phylloplane organisms such as Pseudomonas spp. (such as P.
- aeruginosa P. fluorescens, P. chlororaphis
- Erwinia spp. Erwinia spp.
- Flavobacterium spp. and other such organisms, including Agrobacterium tumefaciens, E. coli, Bacillus subtilis , and the like.
- Genes encoding the PIP-1 polypeptides of the embodiments can be introduced into microorganisms that multiply on plants (epiphytes) to deliver PIP-1 polypeptides to potential target pests.
- Epiphytes for example, can be gram-positive or gram-negative bacteria.
- Root-colonizing bacteria for example, can be isolated from the plant of interest by methods known in the art. Specifically, a Bacillus cereus strain that colonizes roots can be isolated from roots of a plant (see, for example, bottlesman, et al., (1991) Appl. Environ. Microbiol. 56:713-718). Genes encoding the PIP-1 polypeptides of the embodiments can be introduced into a root-colonizing Bacillus cereus by standard methods known in the art.
- Genes encoding PIP-1 polypeptides can be introduced, for example, into the root-colonizing Bacillus by means of electro transformation.
- genes encoding the PIP-1 polypeptides can be cloned into a shuttle vector, for example, pHT3101 (Lerecius, et al., (1989) FEMS Microbiol. Letts. 60:211-218.
- the shuttle vector pHT3101 containing the coding sequence for the particular PIP-1 polypeptide gene can, for example, be transformed into the root-colonizing Bacillus by means of electroporation (Lerecius, et al., (1989) FEMS Microbiol. Letts. 60:211-218).
- Expression systems can be designed so that PIP-1 polypeptides are secreted outside the cytoplasm of gram-negative bacteria, such as E. coli , for example.
- Advantages of having PIP-1 polypeptides secreted are: (1) avoidance of potential cytotoxic effects of the PIP-1 polypeptide expressed; and (2) improvement in the efficiency of purification of the PIP-1 polypeptide, including, but not limited to, increased efficiency in the recovery and purification of the protein per volume cell broth and decreased time and/or costs of recovery and purification per unit protein.
- PIP-1 polypeptides can be made to be secreted in E. coli , for example, by fusing an appropriate E. coli signal peptide to the amino-terminal end of the PIP-1 polypeptide.
- Signal peptides recognized by E. coli can be found in proteins already known to be secreted in E. coli , for example the OmpA protein (Ghrayeb, et al., (1984) EMBO J, 3:2437-2442).
- OmpA is a major protein of the E. coli outer membrane, and thus its signal peptide is thought to be efficient in the translocation process.
- OmpA signal peptide does not need to be modified before processing as may be the case for other signal peptides, for example lipoprotein signal peptide (Duffaud, et al., (1987) Meth. Enzymol. 153:492).
- PIP-1 polypeptides of the embodiments can be fermented in a bacterial host and the resulting bacteria processed and used as a microbial spray in the same manner that Bt strains have been used as insecticidal sprays.
- the secretion signal is removed or mutated using procedures known in the art. Such mutations and/or deletions prevent secretion of the PIP-1 polypeptide(s) into the growth medium during the fermentation process.
- the PIP-1 polypeptides are retained within the cell, and the cells are then processed to yield the encapsulated PIP-1 polypeptides. Any suitable microorganism can be used for this purpose.
- Pseudomonas has been used to express Bt toxins as encapsulated proteins and the resulting cells processed and sprayed as an insecticide (Gaertner, et al., (1993), in: Advanced Engineered Pesticides , ed. Kim).
- the PIP-1 polypeptides are produced by introducing a heterologous gene into a cellular host. Expression of the heterologous gene results, directly or indirectly, in the intracellular production and maintenance of the pesticide. These cells are then treated under conditions that prolong the activity of the toxin produced in the cell when the cell is applied to the environment of target pest(s). The resulting product retains the toxicity of the toxin.
- These naturally encapsulated PIP-1 polypeptides may then be formulated in accordance with conventional techniques for application to the environment hosting a target pest, e.g., soil, water, and foliage of plants. See, for example EPA 0192319, and the references cited therein.
- the active ingredients can be applied in the form of compositions and can be applied to the crop area or plant to be treated, simultaneously or in succession, with other compounds.
- These compounds can be fertilizers, weed killers, Cryoprotectants, surfactants, detergents, pesticidal soaps, dormant oils, polymers, and/or time-release or biodegradable carrier formulations that permit long-term dosing of a target area following a single application of the formulation.
- Suitable carriers and adjuvants can be solid or liquid and correspond to the substances ordinarily employed in formulation technology, e.g. natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackifiers, binders or fertilizers.
- the formulations may be prepared into edible “baits” or fashioned into pest “traps” to permit feeding or ingestion by a target pest of the pesticidal formulation.
- Methods of applying an active ingredient or an agrochemical composition that contains at least one of the PIP-1 polypeptides produced by the bacterial strains include leaf application, seed coating and soil application. The number of applications and the rate of application depend on the intensity of infestation by the corresponding pest.
- the composition may be formulated as a powder, dust, pellet, granule, spray, emulsion, colloid, solution or such like, and may be prepared by such conventional means as desiccation, lyophilization, homogenation, extraction, filtration, centrifugation, sedimentation or concentration of a culture of cells comprising the polypeptide.
- the polypeptide may be present in a concentration of from about 1% to about 99% by weight.
- Lepidopteran, dipteran, heteropteran, nematode, hemiptera or coleopteran pests may be killed or reduced in numbers in a given area by the methods of the disclosure or may be prophylactically applied to an environmental area to prevent infestation by a susceptible pest.
- the pest ingests or is contacted with, a pesticidally-effective amount of the polypeptide.
- pesticidally-effective amount is intended an amount of the pesticide that is able to bring about death to at least one pest or to noticeably reduce pest growth, feeding or normal physiological development.
- the formulations may also vary with respect to climatic conditions, environmental considerations, and/or frequency of application and/or severity of pest infestation.
- the pesticide compositions described may be made by formulating either the bacterial cell, Crystal and/or spore suspension or isolated protein component with the desired agriculturally-acceptable carrier.
- the compositions may be formulated prior to administration in an appropriate means such as lyophilized, freeze-dried, desiccated or in an aqueous carrier, medium or suitable diluent, such as saline or other buffer.
- the formulated compositions may be in the form of a dust or granular material or a suspension in oil (vegetable or mineral) or water or oil/water emulsions or as a wettable powder or in combination with any other carrier material suitable for agricultural application.
- Suitable agricultural carriers can be solid or liquid and are well known in the art.
- the term “agriculturally-acceptable carrier” covers all adjuvants, inert components, dispersants, surfactants, tackifiers, binders, etc. that are ordinarily used in pesticide formulation technology; these are well known to those skilled in pesticide formulation.
- the formulations may be mixed with one or more solid or liquid adjuvants and prepared by various means, e.g., by homogeneously mixing, blending and/or grinding the pesticidal composition with suitable adjuvants using conventional formulation techniques. Suitable formulations and application methods are described in U.S. Pat. No. 6,468,523, herein incorporated by reference.
- the plants can also be treated with one or more chemical compositions, including one or more herbicide, insecticides or fungicides.
- Exemplary chemical compositions include: Fruits/Vegetables Herbicides: Atrazine, Bromacil, Diuron, Glyphosate, Linuron, Metribuzin, Simazine, Trifluralin, Fluazifop, Glufosinate, Halo sulfuron Gowan, Paraquat, Propyzamide, Sethoxydim, Butafenacil, Halosulfuron, Indaziflam; Fruits/Vegetables Insecticides: Aldicarb, Bacillus thuriengiensis , Carbaryl, Carbofuran, Chlorpyrifos, Cypermethrin, Deltamethrin, Diazinon, Malathion, Abamectin, Cyfluthrin/beta-cyfluthrin, Esfenvalerate, Lambda-cyhalothrin, Acequinocyl, Bifenazate, Methoxyfenozide, Novaluron, Chromafeno
- the herbicide is Atrazine, Bromacil, Diuron, Chlorsulfuron, Metsulfuron, Thifensulfuron Methyl, Tribenuron, Acetochlor, Dicamba, Isoxaflutole, Nicosulfuron, Rimsulfuron, Pyrithiobac-sodium, Flumioxazin, Chlorimuron-Ethyl, Metribuzin, Quizalofop, S-metolachlor, Hexazinne or combinations thereof.
- insecticide is Esfenvalerate, Chlorantraniliprole, Methomyl, Indoxacarb, Oxamyl or combinations thereof.
- Pests includes but is not limited to, insects, fungi, bacteria, nematodes, mites, ticks, and the like.
- Insect pests include insects selected from the orders Coleoptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera, etc., particularly Lepidoptera, and Hemiptera.
- Larvae of the order Lepidoptera include, but are not limited to, armyworms, cutworms, loopers, and heliothines in the family Noctuidae Spodoptera frugiperda J E Smith (fall armyworm); S. exigua Hübner (beet armyworm); S. litura Fabricius (tobacco cutworm, cluster caterpillar); Mamestra configurata Walker (bertha armyworm); M. brassicae Linnaeus (cabbage moth); Agrotis ipsilon Hufnagel (black cutworm); A. orthogonia Morrison (western cutworm); A.
- subterranea Fabricius (granulate cutworm); Alabama argillacea Hübner (cotton leaf worm); Trichoplusia ni Hübner (cabbage looper); Pseudoplusia includens Walker (soybean looper); Anticarsia gemmatalis Hübner (velvetbean caterpillar); Hypena scabra Fabricius (green cloverworm); Heliothis virescens Fabricius (tobacco budworm); Pseudaletia unipuncta Haworth (armyworm); Athetis mindara Barnes and Mcdunnough (rough skinned cutworm); Euxoa messoria Harris (darksided cutworm); Earias insulana Boisduval (spiny bollworm); E.
- vittella Fabricius (spotted bollworm); Helicoverpa armigera Hübner (American bollworm); H. zea Boddie (corn earworm or cotton bollworm); Melanchra picta Harris (zebra caterpillar); Egira (Xylomyges) curialis Grote ( citrus cutworm); borers, casebearers, webworms, coneworms, and skeletonizers from the family Pyralidae Ostrinia nubilalis Hübner (European corn borer); Amyelois transitella Walker (naval orangeworm); Anagasta kuehniella Zeller (Mediterranean flour moth); Cadra cautella Walker (almond moth); Chilo suppressalis Walker (rice stem borer); C.
- saccharalis Fabricius saccharalis Fabricius (sugarcane borer); Eoreuma loftini Dyar (Mexican rice borer); Ephestia elutella Hübner (tobacco (cacao) moth); Galleria mellonella Linnaeus (greater wax moth); Herpetogramma licarsisalis Walker (sod webworm); Homoeosoma electellum Hulst (sunflower moth); Elasmopalpus lignosellus Zeller (lesser cornstalk borer); Achroia grisella Fabricius (lesser wax moth); Loxostege sticticalis Linnaeus (beet webworm); Orthaga thyrisalis Walker (tea tree web moth); Maruca testulalis Geyer (bean pod borer); Plodia interpunctella Hübner (Indian meal moth); Scirpophaga incertulas Walker (y
- stultana Walsingham omnivorous leafroller
- Lobesia botrana Denis & Schiffermüller European grape vine moth
- Spilonota ocellana Denis & Schiffermüller eyespotted bud moth
- Endopiza viteana Clemens grape berry moth
- Eupoecilia ambiguella Hübner vine moth
- Bonagota salubricola Meyrick Brainzilian apple leafroller
- Grapholita molesta Busck oriental fruit moth
- Suleima helianthana Riley unsunflower bud moth
- Argyrotaenia spp. Choristoneura spp.
- Selected other agronomic pests in the order Lepidoptera include, but are not limited to, Alsophila pometaria Harris (fall cankerworm); Anarsia lineatella Zeller (peach twig borer); Anisota senatoria J. E.
- fiscellaria lugubrosa Hulst (Western hemlock looper); Leucoma salicis Linnaeus (satin moth); Lymantria dispar Linnaeus (gypsy moth); Manduca quinquemaculata Haworth (five spotted hawk moth, tomato hornworm); M.
- larvae and adults of the order Coleoptera including weevils from the families Anthribidae, Bruchidae, and Curculionidae (including, but not limited to: Anthonomus grandis Boheman (boll weevil); Lissorhoptrus oryzophilus Kuschel (rice water weevil); Sitophilus granarius Linnaeus (granary weevil); S. oryzae Linnaeus (rice weevil); Hypera punctata Fabricius (clover leaf weevil); Cylindrocopturus adspersus LeConte (sunflower stem weevil); Smicronyx fulvus LeConte (red sunflower seed weevil); S.
- Anthonomus grandis Boheman boll weevil
- Lissorhoptrus oryzophilus Kuschel rice water weevil
- Sitophilus granarius Linnaeus granary weevil
- sordidus LeConte (gray sunflower seed weevil); Sphenophorus maidis Chittenden (maize billbug)); flea beetles, cucumber beetles, rootworms, leaf beetles, potato beetles, and leafminers in the family Chrysomelidae (including, but not limited to: Leptinotarsa decemlineata Say (Colorado potato beetle); Diabrotica virgifera virgifera LeConte (western corn rootworm); D. barberi Smith & Lawrence (northern corn rootworm); D.
- Leafminers Agromyza parvicornis Loew corn blotch leafminer
- midges including, but not limited to: Contarinia sorghicola Coquillett (sorghum midge); Mayetiola destructor Say (Hessian fly); Sitodiplosis mosellana Gehin (wheat midge); Neolasioptera murtfeldtiana Felt, (sunflower seed midge)); fruit flies (Tephritidae), Oscinella frit Linnaeus (fruit flies); maggots (including, but not limited to: Delia platura Meigen (seedcorn maggot); D.
- femoralis Stein (lesser house flies); Stomoxys calcitrans Linnaeus (stable flies)); face flies, horn flies, blow flies, Chrysomya spp.; Phormia spp.; and other muscoid fly pests, horse flies Tabanus spp.; bot flies Gastrophilus spp.; Oestrus spp.; cattle grubs Hypoderma spp.; deer flies Chrysops spp.; Melophagus ovinus Linnaeus (keds); and other Brachycera , mosquitoes Aedes spp.; Anopheles spp.; Culex spp.; black flies Prosimulium spp.; Simulium spp.; biting midges, sand flies, sciarids, and other Nematocera.
- insects of interest are adults and nymphs of the orders Hemiptera and Homoptera such as, but not limited to, adelgids from the family Adelgidae, plant bugs from the family Miridae, cicadas from the family Cicadidae, leafhoppers, Empoasca spp.; from the family Cicadellidae, planthoppers from the families Cixiidae, Flatidae, Fulgoroidea, Issidae and Delphacidae, treehoppers from the family Membracidae, psyllids from the family Psyllidae, whiteflies from the family Aleyrodidae, aphids from the family Aphididae, phylloxera from the family Phylloxeridae, mealybugs from the family Pseudococcidae, scales from the families Asterolecanidae, Coccidae, Dactylopii
- Agronomically important members from the order Homoptera further include, but are not limited to: Acyrthisiphon pisum Harris (pea aphid); Aphis craccivora Koch (cowpea aphid); A. fabae Scopoli (black bean aphid); A. gossypii Glover (cotton aphid, melon aphid); A. maidiradicis Forbes (corn root aphid); A. pomi De Geer (apple aphid); A.
- vaporariorum Westwood greenhouse whitefly
- Empoasca fabae Harris potato leafhopper
- Laodelphax striatellus Fallen small brown planthopper
- Macrolestes quadrilineatus Forbes aster leafhopper
- Nephotettix cinticeps Uhler green leafhopper
- nigropictus Stal (rice leafhopper); Nilaparvata lugens Stal (brown planthopper); Peregrinus maidis Ashmead (corn planthopper); Sogatella furcifera Horvath (white-backed planthopper); Sogatodes orizicola Muir (rice delphacid); Typhlocyba pomaria McAtee (white apple leafhopper); Erythroneoura spp.
- Agronomically important species of interest from the order Hemiptera include, but are not limited to: Acrosternum hilare Say (green stink bug); Anasa tristis De Geer (squash bug); Blissus leucopterus leucopterus Say (chinch bug); Corythuca gossypii Fabricius (cotton lace bug); Cyrtopeltis modesta Distant ( tomato bug); Dysdercus suturellus Herrich-Schäffer (cotton stainer); Euschistus servus Say (brown stink bug); E. variolarius Palisot de Beauvois (one-spotted stink bug); Graptostethus spp.
- rugulipennis Poppius European tarnished plant bug
- Lygocoris pabulinus Linnaeus common green capsid
- Nezara viridula Linnaeus (southern green stink bug); Oebalus pugnax Fabricius (rice stink bug); Oncopeltus fasciatus Dallas (large milkweed bug); Pseudatomoscelis seriatus Reuter (cotton fleahopper).
- embodiments may be effective against Hemiptera such, Calocoris norvegicus Gmelin (strawberry bug); Orthops campestris Linnaeus; Plesiocoris rugicollis Fallen (apple capsid); Cyrtopeltis modestus Distant ( tomato bug); Cyrtopeltis notatus Distant (suckfly); Spanagonicus albofasciatus Reuter (whitemarked fleahopper); Diaphnocoris chlorionis Say (honeylocust plant bug); Labopidicola allii Knight (onion plant bug); Pseudatomoscelis seriatus Reuter (cotton fleahopper); Adelphocoris rapidus Say (rapid plant bug); Poecilocapsus lineatus Fabricius (four-lined plant bug); Nysius ericae Schilling (false chinch bug); Nysius raphanus Howard (false chinch bug); Nezara vi
- Insect pests of the order Thysanura are of interest, such as Lepisma saccharina Linnaeus (silverfish); Thermobia domestica Packard (firebrat).
- Additional arthropod pests covered include: spiders in the order Araneae such as Loxosceles reclusa Gertsch & Mulaik (brown recluse spider); and the Latrodectus mactans Fabricius (black widow spider); and centipedes in the order Scutigeromorpha such as Scutigera coleoptrata Linnaeus (house centipede).
- Insect pest of interest include the superfamily of stink bugs and other related insects including but not limited to species belonging to the family Pentatomidae ( Nezara viridula, Halyomorpha halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare, Euschistus heros, Euschistus tristigmus, Acrosternum hilare, Dichelops furcatus, Dichelops melacanthus , and Bagrada hilaris ( Bagrada Bug)), the family Plataspidae ( Megacopta cribraria —Bean plataspid), and the family Cydnidae ( Scaptocoris castanea —Root stink bug); and Lepidoptera species including but not limited to: diamond-back moth, e.g., Helicoverpa zea Boddie; soybean looper, e.g., Pseudoplusia includens Walker; and velvet bean caterpillar e.
- Nematodes include parasitic nematodes such as root-knot, cyst, and lesion nematodes, including Heterodera spp., Meloidogyne spp., and Globodera spp.; particularly members of the cyst nematodes, including, but not limited to, Heterodera glycines (soybean cyst nematode); Heterodera schachtii (beet cyst nematode); Heterodera avenae (cereal cyst nematode); and Globodera rostochiensis and Globodera pailida (potato cyst nematodes).
- Lesion nematodes include Pratylenchus spp.
- seed treatment options can provide additional crop plan flexibility and cost effective control against insects, weeds and diseases.
- Seed material can be treated, typically surface treated, with a composition comprising combinations of chemical or biological herbicides, herbicide safeners, insecticides, fungicides, germination inhibitors and enhancers, nutrients, plant growth regulators and activators, bactericides, nematocides, avicides and/or molluscicides. These compounds are typically formulated together with further carriers, surfactants or application-promoting adjuvants customarily employed in the art of formulation.
- the coatings may be applied by impregnating propagation material with a liquid formulation or by coating with a combined wet or dry formulation. Examples of the various types of compounds that may be used as seed treatments are provided in The Pesticide Manual: A World Compendium, C. D. S. Tomlin Ed., Published by the British Crop Production Council, which is hereby incorporated by reference.
- Some seed treatments that may be used on crop seed include, but are not limited to, one or more of abscisic acid, acibenzolar-S-methyl, avermectin, amitrol, azaconazole, azospirillum, azadirachtin, azoxystrobin, bacillus spp. (including one or more of cereus, firmus, megaterium, pumilis, sphaericus, subtilis and/or thuringiensis ), bradyrhizobium spp.
- captan including one or more of betae, canariense, elkanii, iriomotense, japonicum, liaonigense, pachyrhizi and/or yuanmingense
- captan including one or more of betae, canariense, elkanii, iriomotense, japonicum, liaonigense, pachyrhizi and/or yuanmingense
- captan including one or more of betae, canariense, elkanii, iriomotense, japonicum, liaonigense, pachyrhizi and/or yuanmingense
- captan including one or more of betae, canariense, elkanii, iriomotense, japonicum, liaonigense, pachyrhizi and/or yuanmingense
- captan including one or more of betae, canariense
- Seed varieties and seeds with specific transgenic traits may be tested to determine which seed treatment options and application rates may complement such varieties and transgenic traits in order to enhance yield.
- a variety with good yield potential but head smut susceptibility may benefit from the use of a seed treatment that provides protection against head smut
- a variety with good yield potential but cyst nematode susceptibility may benefit from the use of a seed treatment that provides protection against cyst nematode, and so on.
- a variety encompassing a transgenic trait conferring insect resistance may benefit from the second mode of action conferred by the seed treatment
- a variety encompassing a transgenic trait conferring herbicide resistance may benefit from a seed treatment with a safener that enhances the plants resistance to that herbicide, etc.
- methods are provided for inhibiting growth or killing an insect pest, comprising contacting the insect pest with an insecticidally-effective amount of a recombinant PIP-1 polypeptide. In some embodiments methods are provided for inhibiting growth or killing an insect pest, comprising contacting the insect pest with an insecticidally-effective amount of a recombinant pesticidal protein of SEQ ID NO: 6 or a variant thereof.
- methods are provided for controlling an insect pest population, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant PIP-1 polypeptide. In some embodiments methods are provided for controlling an insect pest population, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant pesticidal protein of SEQ ID NO: 6 or a variant thereof.
- controlling a pest population or “controls a pest” is intended any effect on a pest that results in limiting the damage that the pest causes.
- Controlling a pest includes, but is not limited to, killing the pest, inhibiting development of the pest, altering fertility or growth of the pest in such a manner that the pest provides less damage to the plant, decreasing the number of offspring produced, producing less fit pests, producing pests more susceptible to predator attack or deterring the pests from eating the plant.
- methods are provided for controlling an insect pest population resistant to a pesticidal protein, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant PIP-1 polypeptide. In some embodiments methods are provided for controlling an insect pest population resistant to a pesticidal protein, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant pesticidal protein of SEQ ID NO: 6 or a variant thereof.
- methods are provided for protecting a plant from an insect pest, comprising expressing in the plant or cell thereof a recombinant PIP-1 polypeptide. In some embodiments methods are provided for protecting a plant from an insect pest, comprising expressing in the plant or cell thereof a recombinant pesticidal protein of SEQ ID NO: 6 or variants thereof.
- B. thuringiensis ⁇ -endotoxins in transgenic corn plants has proven to be an effective means of controlling agriculturally important insect pests (Perlak, et al., 1990; 1993). However, insects have evolved that are resistant to B. thuringiensis ⁇ -endotoxins expressed in transgenic plants. Such resistance, should it become widespread, would clearly limit the commercial value of germplasm containing genes encoding such B. thuringiensis ⁇ -endotoxins.
- Non-transgenic i.e., non-insecticidal protein
- refuges a section of non-insecticidal crops/corn
- the United States Environmental Protection Agency epa.gov/oppbppdl/biopesticides/pips/bt_corn_refuge_2006.htm, which can be accessed using the www prefix
- Another way of increasing the effectiveness of the transgenic insecticides against target pests and contemporaneously reducing the development of insecticide-resistant pests would be to have a repository of insecticidal genes that are effective against groups of insect pests and which manifest their effects through different modes of action.
- the PIP-1 polypeptides of the disclosure are useful as an insect resistance management strategy in combination (i.e., pyramided) with other pesticidal proteins include but are not limited to Bt toxins, Xenorhabdus sp. or Photorhabdus sp. insecticidal proteins, and the like.
- the methods of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and promoting insect resistance management comprise a PIP-1 polypeptide insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- the methods of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and promoting insect resistance management comprises a protein of SEQ ID NO: 6 or variants thereof, insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- the methods of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and promoting insect resistance management comprise expressing in the transgenic plant a PIP-1 polypeptide and a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera having different modes of action.
- the methods of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and promoting insect resistance management comprise in the transgenic plant a protein of SEQ ID NO: 6 or variants thereof and a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera having different modes of action.
- methods are provided for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera, comprising the step of referring to, submitting or relying on insect assay binding data showing that the PIP-1 polypeptide does not compete with binding sites for Cry proteins in such insects.
- methods are provided for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera, comprising the step of referring to, submitting or relying on insect assay binding data showing that the protein of SEQ ID NO: 6 or variant thereof does not compete with binding sites for Cry proteins in such insects.
- the methods comprise providing a plant or plant cell expressing a polynucleotide encoding the pesticidal polypeptide sequence disclosed herein and growing the plant or a seed thereof in a field infested with a pest against which the polypeptide has pesticidal activity.
- the polypeptide has pesticidal activity against a lepidopteran, coleopteran, dipteran, hemipteran or nematode pest
- the field is infested with a lepidopteran, hemipteran, coleopteran, dipteran or nematode pest.
- the “yield” of the plant refers to the quality and/or quantity of biomass produced by the plant.
- biomass is intended any measured plant product.
- An increase in biomass production is any improvement in the yield of the measured plant product.
- Increasing plant yield has several commercial applications. For example, increasing plant leaf biomass may increase the yield of leafy vegetables for human or animal consumption. Additionally, increasing leaf biomass can be used to increase production of plant-derived pharmaceutical or industrial products.
- An increase in yield can comprise any statistically significant increase including, but not limited to, at least a 1% increase, at least a 3% increase, at least a 5% increase, at least a 10% increase, at least a 20% increase, at least a 30%, at least a 50%, at least a 70%, at least a 100% or a greater increase in yield compared to a plant not expressing the pesticidal sequence.
- plant yield is increased as a result of improved pest resistance of a plant expressing a PIP-1 polypeptide disclosed herein.
- Expression of the PIP-1 polypeptide results in a reduced ability of a pest to infest or feed on the plant, thus improving plant yield.
- Lygus active protein PIP-1A was identified by protein purification, N-terminal amino acid sequencing, PCR cloning from Pseudomonas chlororaphis strain SS44C4 as follows:
- Insecticidal activity against Lygus was observed from a cell lysate of SS44C4 grown in Trypticase soy medium (Tryptone 17 g/ L , enzymatic digest of soy meal 3 g/ L , Dextrose 2.5 g/ L , Sodium Chloride 5 g/ L , K2HPO4 2.5 g/ L ) and cultured overnight at 30° C.
- Trypticase soy medium Trypticase soy medium
- This insecticidal activity exhibited heat and proteinase sensitivity indicating proteinaceous nature.
- Lygus ( Lygus hesperus ) bioassays were conducted using the cell lysate samples mixed with insect diet (Bio-Serv F9644B) in each well of a 96 well bioassay plate (BD FalconTM 353910). A variable number of Lygus hesperus second instar nymphs (2 to 7) were placed into each well of a 96 well plate. The assay was run four days at 25° C. and then was scored for insect mortality and stunting of insect growth. A series of concentrations of the purified protein sample was assayed against those insects and concentrations for 50% mortality (LC50) or inhibition of 50% of the individuals (IC50) were calculated. The Lygus bioassay results for PIP-1A is shown in Table 2.
- Genomic DNA was extracted with a Sigma Bacterial Genomic DNA Extraction Kit (Cat #NA2110-KT, Sigma-Aldrich, PO Box 14508, St. Louis, Mo. 63178) according to the manufactures' instructions.
- the DNA concentration was determined using a NanoDrop Spectrophotometer (Thermo Scientific, 3411 Silverside Road, Bancroft Building, Suite 100, Wilmington, Del. 19810) and the genomic DNA was diluted to 40 ng/ul with sterile water.
- a 25 ul PCR reaction was set up by combining 80 ng genomic DNA, 2 ul (5 uM) 16S ribosomal DNA primers TACCTTGTTACGACTT (SEQ ID NO: 209) and AGAGTTTGATCMTGGCTCAG (SEQ ID NO: 210), 1 ul 10 cmM dNTP, 1 ⁇ PhusionTM HF buffer, and 1 unit of PhusionTM High-Fidelity DNA Polymerase (New England Biolabs, Cat #M0530L, 240 County Road, Ipswich, Mass. 01938-2723).
- the PCR reaction was run in MJ Research PTC-200 Thermo Cycler (Bio-Rad Laboratories, Inc., 1000 Alfred Nobel Drive, Hercules, Calif., 94547, USA) with the following program: 96° C. 1 min; 30 cycles of 96° C. 15 seconds, 52° C. 2 minutes and 72° C. 2 minutes; 72° C. 10 minutes; and hold on 4° C.
- the PCR products were purified with QiaQuick® DNA purification Kit (Cat #28104, QIAGEN® Inc., 27220 Turnberry Lane, Valencia, Calif. 91355).
- the purified PCR sample was DNA sequenced and the resulting 16S ribosomal DNA sequence was BLAST searched against the NCBI database which indicated that SS44C4 is a Pseudomonas chlororaphis strain.
- the Pseudomonas chlororaphis strain SS44C4 was deposited on Dec. 1, 2011 under accession #NRRLB-50613 with the Agricultural Research Service Culture Collection (NRRL), 1815 North University Street, Peoria, Ill. 61604, (nrrl.ncaur.usda.gov, which can be accessed on the world-wide web using the “www” prefix).
- the cell pellet of an overnight culture from a single colony of SS44C4 grown in LB Broth at 30° C. was lyzed in a French Press at ⁇ 20,000 psi in a single pass after resuspension with PBS buffer.
- the lysis product was centrifuged and the soluble fraction retained and stored at 4° C. overnight to allow insoluble chlororaphin products to precipitate.
- the remaining supernatant was filtered sequentially through 25 um, 8 um, 5 um, 1.2 um and 0.45 um filters to remove the majority of the Crystalline material.
- the soluble cell lysate was adjusted to 1.2 M ammonium sulfate and loaded onto an Ether column (ToyopearlTM Ether-650S, Tosoh Bioscience LLC, 3604 Horizon Drive, Suite 100, King of Prussia, Pa. 19406) of appropriate size.
- Ether column ToyopearlTM Ether-650S, Tosoh Bioscience LLC, 3604 Horizon Drive, Suite 100, King of Prussia, Pa. 19406
- a linear gradient was run from 1.2 M ammonium sulfate to 0.6 M ammonium sulfate over 15 column volumes.
- the elution peak fractions containing protein of interest were then concentrated via a spin concentrator.
- the concentrate was then buffer exchanged into 25 mM Tris pH 8 to remove ammonium sulfate using a 7000 MWCO ZebaTM desalting column (Thermo Fisher Scientific Inc., 747 Meridian Rd, Rockford, Ill. 61101).
- the concentrated and desalted protein was then loaded onto a MonoQTM column (cat #17-5166-01, GE Healthcare). Optimum elution and purity was achieved by application of a linear gradient from 0 to 400 mM NaCl.
- the active fraction pool from the MonoQTM purification was subjected to N-terminal sequencing.
- the protein pool was run on SDS-PAGE, transferred to a PVDF membrane, and stained with CoomassieTM Blue dye. Four bands were present on the membrane. All were successfully identified by N-terminal sequencing with a single sequence per band.
- the N-terminal amino acid sequence of two protein bands were BLAST searched against the NCBI database and a hypothetical protein (PSEEN3174) from a genome sequence of Pseudomonas entomophila (Vodovar, N et al. (2006) Nat. Biotechnol. 24 (6), 673-679) was identified as a homology match ( FIG. 1 ).
- the PSEEN3174 gene was cloned by PCR using primers ATACATATGACGATCAAGGAAGAGCTG (SEQ ID NO: 13) and TTGGATCCTCAATAACGGCGATGAGGATCGTTGTAG (SEQ ID NO: 14). PCR with the cloning primers (SEQ ID NO: 13 and 14) was performed against the SS44C4 genomic DNA preparation, and a band of the expected molecular weight was isolated.
- the resulting PCR product was DNA sequenced and coupled with MS/MS spectra from in-gel digests showed this gene product having the DNA sequence of SEQ ID NO: 1 encoding a protein designated herein as “PIP-1A”, having the amino acid sequence of SEQ ID NO: 2.
- the PSEEN3174 gene has the DNA sequence set forth in SEQ ID NO: 5 and encodes an amino acid sequence having the amino acid sequence set forth in SEQ ID NO: 6.
- SPBB_340380 annotated as a hypothetical protein from Dendroctonus frontalis Bacterial community
- PSEEN3174 SEQ ID NO: 6
- the SPBB_340380 coding sequence was generated by back translation of protein sequence using PSEEN3174 (SEQ ID NO: 5) codon usage and the gene was synthesized.
- the SPBB_340380 coding sequence has the DNA sequence set forth in SEQ ID NO: 3 and encodes an amino acid sequence, designated herein as “PIP-1B”, having the amino acid sequence set forth in SEQ ID NO: 4.
- Example 2 E. coli Expression of PIP-1A, PSEEN3174 and PIP-1B
- PIP-1A SEQ ID NO: 1
- PSEEN3174 SEQ ID NO: 5
- PIP-1B SEQ ID NO: 3
- E. coli expression vector pMALTM New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723
- 6 ⁇ His tag added to the Maltose Binding Protein
- E. coli cells transformed with the expression constructs were grown overnight at 37° C. with carbenicillin selection and then inoculated to a fresh 2XYT medium (1:250) and further grown to OD 600 ⁇ 0.8.
- IPTG was then added and the cells were grown further at 37° C. for another 6 hours or transferred to 16° C. for overnight growth to induce protein expression.
- the E. coli expressed proteins were purified either by Amylose resin (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723) or Ni-NTA agarose (Cat. No. K950-01, Invitrogen, 3175 Staley Road, Grand Island, N.Y. 14072), according to the manufacturer's protocols.
- Insecticidal activity bioassay screens were conducted on the cell lysate to evaluate the effects of the insecticidal proteins on a variety of Lepidoptera species (European corn borer ( Ostrinia nubilalis ), corn earworm ( Helicoverpa zea ), black cutworm ( Agrotis ipsilon ), fall armyworm ( Spodoptera frugiperda ), Soybean looper ( Pseudoplusia includens ) and Velvet bean caterpillar ( Anticarsia gemmatalis )), a Coleoptera specie (Western corn rootworm ( Diabrotica virgifera )
- Lepidoptera species European corn borer ( Ostrinia nubilalis ), corn earworm ( Helicoverpa zea ), black cutworm ( Agrotis ipsilon ), fall armyworm ( Spodoptera frugiperda ), Soybean looper ( Pseudoplusia includens ) and
- Lepidoptera feeding assays were conducted on an artificial diet containing the cell lysates of bacterial strains in a 96 well plate set up. The cell lysate was incorporated with the Lepidopteran-specific artificial diet in a ratio of 1:2 cell lysate to diet mixture. Neonate larvae were placed in each well to feed ad libitum for 5 days. Results were expressed as positive for larvae reactions such as stunting and or mortality. Results were expressed as negative if the larvae were similar to the negative control that is feeding diet to which the above buffer only has been applied.
- Coleoptera feeding assays were conducted on an artificial diet containing the cell lysates of bacterial strains. The cell lysate was incorporated with the coleopteran-specific artificial diet in a ratio of 1:5 cell lysate to diet mixture.
- Western corn rootworm Diabrotica virgifera
- Results were placed in each well to feed ad libitum for 5 days. Results were expressed as positive for larvae reactions such as stunting and or mortality. Results were expressed as negative if the larvae were similar to the negative control that is feeding diet to which the above buffer only has been applied. A series of concentrations of the purified protein sample was assayed against those insects and concentrations for 50% mortality (LC50) or inhibition of 50% of the individuals (IC50) were calculated.
- the results for PIP-1A and PSEEN3174 are shown in Table 2.
- Membrane feeding assays as described (Li, et al., (2011) Journal of Invertebrate Pathology 107:69-78) were used to assess the toxicity of PIP-1A and PSEEN3174, formulated in PBS pH 7.4. Briefly, the individual proteins were mixed with filter-sterilized complete artificial diet as described in Febvay, et al., ((1988), Can. J. Zool. 66:2449-2453) to a final concentration of up to 1250 micrograms/ml. This diet (100 ul) was placed on stretched parafilm pulled tightly across a 3 cm cell culture plate with a 1 cm hole on one side of the plate.
- a second layer of stretched parafilm was applied to form a thin film of diet exposed to aphids through the 1 cm hole.
- Around 30 second instar pea or green peach aphids were transferred to each plate, with three replicates for each toxin. The same number of aphids were fed on diet only, as a control treatment. All plates were incubated at 24° C. with an 18:6 light:dark photoperiod. Mortality was scored every 24 hours and dead aphids were removed. The artificial diet was replaced every 3 days. Data were analyzed by one-way ANOVA. The results for PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) are shown in Table 2.
- Example 6 Colorado Potato Beetle ( Leptinotarsa decemlineata ) Bioassay with Purified Proteins
- DBM susceptible and Cry1A-resistant diamondback moth
- PIP-1A SEQ ID NO: 2
- 5 ml artificial diet Southland Products Inc.
- Each bioassay included seven 2 ⁇ consecutive dilutions from 500 ng/cm 2 of the PIP-1A (SEQ ID NO: 2) sample and the negative control, with three replications for each concentration.
- the PIP-1A (SEQ ID NO: 2) protein dilutions were prepared by mixing PIP-1A protein (SEQ ID NO: 2) with appropriate amount of PBS buffer solution (Fisher Scientific Inc). Neonate larvae ( ⁇ 24 h after hatch) were placed in each assaying cup. Mortality and larval growth inhibition (defined as inhibition if larvae did not enter second instar within 4 days) by each sample were scored after 4 days of feeding on the treated diet at 27° C.
- the modified PIP-1A coding sequence was named as PIP-1A Synth (SEQ ID NO: 15) and was synthesized. The DNA sequence identity between those two genes was increased from 78% to 87% after the modification.
- PIP-1A Synth SEQ ID NO: 15
- PSEEN3174 SEQ ID NO: 5
- DNA fragments with molecular weights of 50 to 200 base pairs of both genes were recovered from agarose gel. The isolated DNA fragments were assembled on a thermo cycler with polymerase and rescued by cloning primers franking both termini.
- the libraries were cloned as Maltose-Binding-Protein fusions into pMAL®-c2x (NEB) and transformed into E. coli cells. Approximately 5000 clones from the shuffled libraries were screened in the Lygus assay and approximately 1000 clones expressed a polypeptide at significant levels and were active as clear cell lysates in the Lygus bioassay. Lygus bioassays were conducted using the cell lysates at 100 ppm concentration of the PIP-1 polypeptide.
- the concentrations of PIP-1 polypeptides were estimated using densitometry method of SDS-PAGE with BSA as standard using program Phoretix ID (TotalLab Ltd Keel House, Garth Heads, Newcastle upon Tyne NE1 2JE).
- 50 were DNA sequenced (SEQ ID NOS: 152-202) and the amino acid sequence (SEQ ID NOS: 101-151) of the encoded PIP-1 polypeptide was determined.
- Table 4 shows the percent homology of the PIP-1 polypeptides (SEQ ID NOs: 101-151) to PIP-1A (SEQ ID NO: 2).
- the AECFG_592740 coding sequence has the DNA sequence set forth in SEQ ID NO: 11 and encodes a polypeptide, having the amino acid sequence set forth in SEQ ID NO: 12.
- the Pput_1063 coding sequence has the DNA sequence set forth in SEQ ID NO: 7 and encodes the polypeptide set forth in SEQ ID NO: 8.
- the Pput_1064 coding sequence has the DNA sequence set forth in SEQ ID NO: 9 and encodes the polypeptide set forth in SEQ ID NO: 10.
- the AECFG_592740 (SEQ ID NO: 11), Pput_1063 (SEQ ID NO: 7), and Pput_1064 (SEQ ID NO: 9) genes were synthesized, the respective proteins were expressed as Maltose binding protein fusions in E.
- PIP-1A SEQ ID NO: 2
- PSEEN3174 SEQ ID NO: 6
- PIP-1B SEQ ID NO: 4
- AECFG_592740 SEQ ID NO: 12
- Pput_1063 SEQ ID NO: 8
- Pput_1064 SEQ ID NO: 10
- Secondary structure features of PIP-1A SEQ ID NO: 2 were obtained using program Garnier (EMBOSS Explorer) (Garnier, et al., (1978) J. Mol. Biol. 120:97-120) and selected structure features shown above the alignment of FIG. 1 .
- amino acids 64-79 of SEQ ID NO: 2 amino acids 64-79 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 2, and amino acids 240-249 of SEQ ID NO: 2
- the sequence was replaced with corresponding sequences from three distantly related but functionally inactive proteins AECFG_592740 (SEQ ID NO: 12), Pput_1063 (SEQ ID NO: 8), and Pput_1064 (SEQ ID NO: 10) respectively (Table 7 shows the % identity).
- the chimeras were generated using a sewing PCR strategy with fragments of N-terminus and C-terminus of the wild type PIP-1A with overlapping oligonucleotides (Table 8) coding for the replaced sequence of inactive proteins.
- Table 9 shows the amino acid sequence for each of the four motifs (underlined in FIG. 1 ) from PIP-1A and the corresponding amino acid sequence based on the alignment ( FIG. 1 ) with AECFG_592740 (SEQ ID NO:12), Pput_1063 (SEQ ID NO: 8), and Pput_1064 (SEQ ID NO: 10) that were substituted.
- FIG. 1 shows the differences between the respective sequences in indicated in “bold” and “underlining”.
- Table 9 also indicates if the resulting proteins were soluble when expressed as a MAL fusion in E. coli . and were active in the Lygus assay.
- Example 11 Saturated Mutagenesis of Motifs to Define Sequence Variations that Retain Insecticidal Activity
- Tables 12 and 13 show for each mutated position the amino acid substitutions identified, those substitutions that expressed soluble protein, and those substitutions that were active in the Lygus assay and/or the Soy bean looper assay with a minimal score of 4 or greater out of total maximal score of 8. This data demonstrate that the amino substitutions indicated in Tables 12 and 13 as “Active mutants” can be made while retaining activity.
- a series of truncated variants of PIP-1A (SEQ ID NO: 2) are generated in 5 amino acid increments from both ends by PCR cloning for the first and/or last 30 amino acids.
- the truncated genes are cloned to the same expression system as listed above. Recombinant proteins of those truncated versions of PIP-1A are assayed with insects and minimal length of the protein is defined with the variant still retains detectible insecticidal activity.
- PIP-1A SEQ ID NO: 2
- PSEEN3174 SEQ ID NO: 6
- PIP-1B SEQ ID NO: 4
- the resulting N-terminal trypsin truncated variants, PIP-1AT1 (SEQ ID NO: 204), PSEEN3174T1 (SEQ ID NO: 206), PIP-1BT1 SEQ ID NO: 208
- PIP-1AT1 SEQ ID NO: 204
- PSEEN3174T1 SEQ ID NO: 206
- PIP-1BT1 SEQ ID NO: 208
- the arginine (R) at position 28 of PIP-1A was mutated to alter the trypsin cleavage site.
- the variants were generated using a similar strategy as described in Example 9 using the saturation mutagenesis primers R28R (SEQ ID NO: 218), and R28F (SEQ ID NO: 219).
- Table 14 shows the amino acid substitutions identified, those substitutions that expressed soluble protein, and those substitutions that were active in the Lygus assay with a minimal score of 4 or greater out of total maximal score of 8. This data demonstrate that the amino substitutions indicated in Table 14 as “Active mutants” can be made to eliminate a proteolytic cleavage site while retaining activity.
- motif 4 amino acids 240 to 249 of PIP-1A (SEQ ID NO: 2)
- a series of variants were generated with multiple amino acid substitutions in motif 4.
- the variants were generated using a similar mutagenesis strategy as described in Example 9 using the mutagenesis primer Motif 4-Comb-F CCGCTGGATTGGGATACTGTTVWWNGCHAYDTTWTKDTKGRKNAYTWTNAYCCAGGCAGC AATAGTGGGCACTTC (SEQ ID NO: 326) paired with primer 3188R GGATGTGCTGCAAGGCGATTAAG (SEQ ID NO: 327) and Comb-R AACAGTATCCCAATCCAGCGG (SEQ ID NO: 328) paired with 3188F CAGACTGTCGATGAAGCCCTGAAAG (SEQ ID NO: 329).
- the mutagenesis primer Motif 4-Comb-F was designed to be partially degenerate at residues 240-249 of PIP-1A (SEQ ID NO: 2) resulting in selected amino acid substitutions at each residues.
- Table 15 shows the degenerate codon encoding each of residues 240-249 and the possible resulting amino acids. In Table 15 the native amino acid is indicated in bold and underlining.
- the resulting polynucleotides encoding the PIP-1A variant polypeptides were expressed as MBP fusions in E. coli and screened as cleared lysates in a 96 well format (3 plates) for Lygus insecticidal activity as described in Example 1 and scored for activity on a scale of 0 to 8 (see FIG. 4 ).
- the clones encoding the variant PIP-polypeptides having Lygus insecticidal activity ranging from 4 to 8 were DNA sequenced (SEQ ID NO: 220, SEQ ID NO: 221, SEQ ID NO: 222, SEQ ID NO: 223, SEQ ID NO: 224, SEQ ID NO: 225, SEQ ID NO: 226, SEQ ID NO: 227, SEQ ID NO: 228, SEQ ID NO: 229, SEQ ID NO: 230, SEQ ID NO: 231, SEQ ID NO: 232, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO: 243, and SEQ ID NO: 244) to determine the identity of the amino acid substitutions at residues 240-249 of the PIP1A polypeptides
- the clones encoding the variant PIP-1A polypeptides having Lygus insecticidal activity ranging from 0 to 4 were DNA sequenced (SEQ ID NO: 270, SEQ ID NO: 271, SEQ ID NO: 272, SEQ ID NO: 273, SEQ ID NO: 274, SEQ ID NO: 275, SEQ ID NO: 276, SEQ ID NO: 277, SEQ ID NO: 278, SEQ ID NO: 279, SEQ ID NO: 280, SEQ ID NO: 281, SEQ ID NO: 282, SEQ ID NO: 283, SEQ ID NO: 284, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO: 287, SEQ ID NO: 288, SEQ ID NO: 289, SEQ ID NO: 290, SEQ ID NO: 291, SEQ ID NO: 292, SEQ ID NO: 293, SEQ ID NO: 294, SEQ ID NO: 295, SEQ ID NO: 296, and SEQ ID NO: 297), to determine the identity of the amino acid substitution
- Protein expression analysis by SDS-PAGE revealed that the variant proteins with Lygus insecticidal activity from 0 to 4 affect soluble expression (protein folding and solubility) in E. coli with the proteins accumulating as insoluble fraction of the cleared lysate.
- the loss of activity from the multiple substitutions in motif 4 appears to be from the lack of soluble expressed proteins in the E coli expression system.
- Motif 4 appears to be tolerant to multiple amino acid substitution while remaining active.
- a Blast search of a proprietary genomic contig library of a Pseudomonas protegens strain JH19887-2 against the PIP-1 polynucleotide sequence of SEQ ID NO: 1 identified a polynucleotide of SEQ ID NO: 331, encoding a polypeptide of SEQ ID NO: 332 (herein referred to as PIP-1C) having 82% sequence identity to PIP-1A (SEQ ID NO: 2).
- Table 18 shows the % sequence identity between PIP-1C (SEQ ID NO: 332) and PIP-1A (SEQ ID NO: 2), PIP-1B (SEQ ID NO: 4), and PSEEN3174 (SEQ ID NO: 6).
- PIP-1A SEQ ID NO: 2
- PIP-1B SEQ ID NO: 4
- PIP-1C SEQ ID NO: 332
- PSEEN3174 SEQ ID NO: 6
- PIP-1C was expressed in E. coli in the same way as PIP-1A.
- the purified PIP-1C was assayed against Soybean looper (SBL) and lygus in diet based assays.
- PIP-1C (SEQ ID NO: 332) demonstrated killing activity against both SBL and lygus demonstrating insecticidal spectrum similar to PIP-1A (SEQ ID NO: 2).
- Immature maize embryos from greenhouse donor plants are bombarded with a DNA molecule containing the toxin nucleotide sequence (e.g., SEQ ID NO: 1) operably linked to an ubiquitin promoter and the selectable marker gene PAT (Wohlleben, et al., (1988) Gene 70: 25-37), which confers resistance to the herbicide Bialaphos.
- the selectable marker gene is provided on a separate DNA molecule. Transformation is performed as follows. Media recipes follow below.
- the ears are husked and surface sterilized in 30% CLOROXTM bleach plus 0.5% Micro detergent for 20 minutes, and rinsed two times with sterile water.
- the immature embryos are excised and placed embryo axis side down (scutellum side up), 25 embryos per plate, on 560Y medium for 4 hours and then aligned within the 2.5 cm target zone in preparation for bombardment.
- Each reagent is added sequentially to a tungsten particle suspension, while maintained on the multitube vortexer.
- the final mixture is sonicated briefly and allowed to incubate under constant vortexing for 10 minutes.
- the tubes are centrifuged briefly, liquid removed, washed with 500 mL 100% ethanol, and centrifuged for 30 seconds. Again the liquid is removed, and 105 ⁇ L 100% ethanol is added to the final tungsten particle pellet.
- the tungsten/DNA particles are briefly sonicated and 10 ⁇ L spotted onto the center of each macrocarrier and allowed to dry about 2 minutes before bombardment.
- sample plates are bombarded at level #4 in particle gun #HE34-1 or #HE34-2. All samples receive a single shot at 650 PSI, with a total of ten aliquots taken from each tube of prepared particles/DNA.
- the embryos are kept on 560Y medium for 2 days, then transferred to 560R selection medium containing 3 mg/liter Bialaphos, and subcultured every 2 weeks. After approximately 10 weeks of selection, selection-resistant callus clones are transferred to 288J medium to initiate plant regeneration. Following somatic embryo maturation (2-4 weeks), well-developed somatic embryos are transferred to medium for germination and transferred to the lighted culture room. Approximately 7-10 days later, developing plantlets are transferred to 272V hormone-free medium in tubes for 7-10 days until plantlets are well established.
- Plants are then transferred to inserts in flats (equivalent to 2.5′′ pot) containing potting soil and grown for 1 week in a growth chamber, subsequently grown an additional 1-2 weeks in the greenhouse, then transferred to classic 600 pots (1.6 gallon) and grown to maturity. Plants are monitored and scored for expression of the toxin by assays known in the art or as described above.
- Bombardment medium comprises 4.0 g/L N6 basal salts (SIGMA C-1416), 1.0 mL/L Eriksson's Vitamin Mix (1000 ⁇ SIGMA-1511), 0.5 mg/L thiamine HCl, 120.0 g/L sucrose, 1.0 mg/L 2,4-D and 2.88 g/L L-proline (brought to volume with deionized H 2 O following adjustment to pH 5.8 with KOH); 2.0 g/L GelriteTM (added after bringing to volume with dI H 2 O); and 8.5 mg/L silver nitrate (added after sterilizing the medium and cooling to room temperature).
- Selection medium comprises 4.0 g/L N6 basal salts (SIGMA C-1416), 1.0 mL/L Eriksson's Vitamin Mix (1000 ⁇ SIGMA-1511), 0.5 mg/L thiamine HCl, 30.0 g/L sucrose, and 2.0 mg/L 2,4-D (brought to volume with dI H 2 O following adjustment to pH 5.8 with KOH); 3.0 g/L GelriteTM (added after bringing to volume with dI H 2 O); and 0.85 mg/L silver nitrate and 3.0 mg/L Bialaphos (both added after sterilizing the medium and cooling to room temperature).
- Plant regeneration medium (288J) comprises 4.3 g/L MS salts (GIBCO 11117-074), 5.0 mL/L MS vitamins stock solution (0.100 g nicotinic acid, 0.02 g/L thiamine HCl, 0.10 g/L pyridoxine HCl, and 0.40 g/L Glycine brought to volume with polished D-I H 2 0) (Murashige and Skoog, (1962) Physiol. Plant.
- Hormone-free medium comprises 4.3 g/L MS salts (GIBCO 11117-074), 5.0 mL/L MS vitamins stock solution (0.100 g/L nicotinic acid, 0.02 g/L thiamine HCl, 0.10 g/L pyridoxine HCl, and 0.40 g/L Glycine brought to volume with polished dI H 2 0), 0.1 g/L myo-inositol, and 40.0 g/L sucrose (brought to volume with polished dI H 2 0 after adjusting pH to 5.6); and 6 g/L Bacto-agar (added after bringing to volume with polished dI H 2 0), sterilized and cooled to 60° C.
- the method of Zhao can be used (U.S. Pat. No. 5,981,840 and PCT Patent Publication Number WO 1998/32326; the contents of which are hereby incorporated by reference). Briefly, immature embryos are isolated from maize and the embryos contacted with a suspension of Agrobacterium under conditions whereby the bacteria are capable of transferring the nucleotide sequence (e.g. SEQ ID NO: 1) to at least one cell of at least one of the immature embryos (step 1: the infection step).
- the nucleotide sequence e.g. SEQ ID NO: 1
- the immature embryos can be immersed in an Agrobacterium suspension for the initiation of inoculation.
- the embryos are co-cultured for a time with the Agrobacterium (step 2: the co-cultivation step).
- the immature embryos can be cultured on solid medium following the infection step.
- an optional “resting” step is contemplated.
- the embryos are incubated in the presence of at least one antibiotic known to inhibit the growth of Agrobacterium without the addition of a selective agent for plant transformants (step 3: resting step).
- the immature embryos can be cultured on solid medium with antibiotic, but without a selecting agent, for elimination of Agrobacterium and for a resting phase for the infected cells.
- inoculated embryos are cultured on medium containing a selective agent and growing transformed callus is recovered (step 4: the selection step).
- the immature embryos are cultured on solid medium with a selective agent resulting in the selective growth of transformed cells.
- the callus is then regenerated into plants (step 5: the regeneration step), and calli grown on selective medium can be cultured on solid medium to regenerate the plants.
- Soybean embryos are bombarded with a plasmid containing a nucleotide sequence (e.g., SEQ ID NO: 1) operably linked to a pinII promoter as follows.
- a nucleotide sequence e.g., SEQ ID NO: 1
- Somatic embryos producing secondary embryos are then excised and placed into a suitable liquid medium. After repeated selection for clusters of somatic embryos that multiplied as early, globular-staged embryos, the suspensions are maintained as described below.
- Soybean embryogenic suspension cultures can be maintained in 35 mL liquid media on a rotary shaker, 150 rpm, at 26° C. with florescent lights on a 16:8 hour day/night schedule. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 mL of liquid medium.
- Soybean embryogenic suspension cultures may then be transformed by the method of particle gun bombardment (Klein, et al., (1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050).
- a Du Pont Biolistic PDS1000/HE instrument helium retrofit
- a selectable marker gene that can be used to facilitate soybean transformation is a transgene composed of the 35S promoter from Cauliflower Mosaic Virus (Odell, et al., (1985) Nature 313:810-812), the hygromycin phosphotransferase gene from plasmid pJR225 (from E. coli ; Gritz, et al., (1983) Gene 25:179-188), and the 3′ region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens .
- the expression cassette comprising a toxin nucleotide sequence (e.g., SEQ ID NO: 1) operably linked to the pinII promoter can be isolated as a restriction fragment. This fragment can then be inserted into a unique restriction site of the vector carrying the marker gene.
- a toxin nucleotide sequence e.g., SEQ ID NO: 1
- Approximately 300-400 mg of a two-week-old suspension culture is placed in an empty 60 ⁇ 15 mm petri dish and the residual liquid removed from the tissue with a pipette.
- approximately 5-10 plates of tissue are normally bombarded.
- Membrane rupture pressure is set at 1100 psi, and the chamber is evacuated to a vacuum of 28 inches mercury.
- the tissue is placed approximately 3.5 inches away from the retaining screen and bombarded three times. Following bombardment, the tissue can be divided in half and placed back into liquid and cultured as described above.
- the liquid media may be exchanged with fresh media, and eleven to twelve days post-bombardment with fresh media containing 50 mg/mL hygromycin. This selective media can be refreshed weekly.
- Green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated green tissue is removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryogenic suspension cultures. Each new line may be treated as an independent transformation event. These suspensions can then be subcultured and maintained as clusters of immature embryos or regenerated into whole plants by maturation and germination of individual somatic embryos.
Abstract
Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other homologous (or partially homologous) genes. The insecticidal proteins find use in controlling, inhibiting growth or killing lepidopteran, coleopteran, dipteran, fungal, hemipteran, and nematode pest populations and for producing compositions with insecticidal activity.
Description
- This utility application is a continuation of U.S. Non Provisional application Ser. No. 16/813,357 filed Mar. 9, 2020, which is a continuation of U.S. Non Provisional application Ser. No. 15/602,900 filed May 23, 2017, which is a divisional of U.S. Non Provisional application Ser. No. 13/792,861 filed Mar. 11, 2013, which claims the benefit U.S. Provisional Application No. 61/667,039, filed Jul. 2, 2012, the disclosures of each of which are incorporated herein by reference in their entireties.
- The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named “4208-US-DIV2_SequenceListing_Revised” created on May 19, 2020, and having a size of 471 kilobytes and is filed concurrently with the specification. The sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.
- This disclosure relates to the field of molecular biology. Provided are novel genes that encode pesticidal proteins. These pesticidal proteins and the nucleic acid sequences that encode them are useful in preparing pesticidal formulations and in the production of transgenic pest-resistant plants.
- Biological control of insect pests of agricultural significance using a microbial agent, such as fungi, bacteria or another species of insect affords an environmentally friendly and commercially attractive alternative to synthetic chemical pesticides. Generally speaking, the use of biopesticides presents a lower risk of pollution and environmental hazards, and biopesticides provide greater target specificity than is characteristic of traditional broad-spectrum chemical insecticides. In addition, biopesticides often cost less to produce and thus improve economic yield for a wide variety of crops.
- Certain species of microorganisms of the genus Bacillus are known to possess pesticidal activity against a range of insect pests including Lepidoptera, Diptera, Coleoptera, Hemiptera and others. Bacillus thuringiensis (Bt) and Bacillus popilliae are among the most successful biocontrol agents discovered to date. Insect pathogenicity has also been attributed to strains of B. larvae, B. lentimorbus, B. sphaericus and B. cereus. Microbial insecticides, particularly those obtained from Bacillus strains, have played an important role in agriculture as alternatives to chemical pest control.
- Crop plants have been developed with enhanced insect resistance by genetically engineering crop plants to produce pesticidal proteins from Bacillus. For example, corn and cotton plants have been genetically engineered to produce pesticidal proteins isolated from strains of Bt. These genetically engineered crops are now widely used in agriculture and have provided the farmer with an environmentally friendly alternative to traditional insect-control methods. While they have proven to be very successful commercially, these genetically engineered, insect-resistant crop plants provide resistance to only a narrow range of the economically important insect pests. In some cases, insects can develop resistance to different insecticidal compounds, which raises the need to identify alternative biological control agents for pest control.
- Accordingly, there remains a need for new pesticidal proteins with different ranges of insecticidal activity against insect pests, e.g., insecticidal proteins which are active against a variety of insects in the order Lepidoptera and the order Hemiptera including but not limited to species belonging to the family Pentatomidae, the family Plataspidae and the family Cydnidae. In addition, there remains a need for biopesticides having activity against a variety of insect pests that have developed resistance to existing pesticides.
- Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions include nucleic acid molecules encoding sequences for pesticidal and insecticidal polypeptides, vectors comprising those nucleic acid molecules, and host cells comprising the vectors. Compositions also include the pesticidal polypeptide sequences and antibodies to those polypeptides. The nucleic acid sequences can be used in DNA constructs or expression cassettes for transformation and expression in organisms, including microorganisms and plants. The nucleotide or amino acid sequences may be synthetic sequences that have been designed for expression in an organism including, but not limited to, a microorganism or a plant. Compositions also comprise transformed bacteria, plants, plant cells, tissues and seeds.
- In particular, isolated or recombinant nucleic acid molecules are provided encoding Pseudomonas Insecticidal Protein-1 (PIP-1) polypeptides including amino acid substitutions, amino acid deletions, amino acid insertions, and fragments thereof, and combinations thereof. Additionally, amino acid sequences corresponding to the PIP-1 polypeptides are encompassed. Provided are an isolated or recombinant nucleic acid molecule capable of encoding a PIP-1 polypeptide of SEQ ID NO: 2, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, and 325 as well as amino acid substitutions, amino acid deletions, amino acid insertions, and fragments thereof, and combinations thereof. In some embodiments exemplary PIP-1 polypeptides comprise a sequence set forth in of SEQ ID NO: 2, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, and 269 as well as amino acid substitutions, amino acid deletions, amino acid insertions, and fragments thereof, and combinations thereof.
- Also provided are nucleic acid sequences set forth in SEQ ID NO: 1, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, and 297 as well as variants and fragments thereof encoding PIP-1 polypeptides.
- In some embodiments exemplary nucleic acid molecules comprise a sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, and 244 as well as variants and fragments thereof encoding PIP-1 polypeptides, as well as variants and fragments thereof that encode PIP-1 polypeptides. Nucleic acid sequences that are complementary to a nucleic acid sequence of the embodiments or that hybridize to a sequence of the embodiments are also encompassed.
- Methods are provided for producing the polypeptides and for using those polypeptides for controlling, inhibiting growth or killing a Lepidopteran, Coleopteran, nematode, fungi, Hemipteran and/or Dipteran pests. The transgenic plants of the embodiments express one or more of the pesticidal sequences disclosed herein. In various embodiments, the transgenic plant further comprises one or more additional genes for insect resistance, for example, one or more additional genes for controlling coleopteran, lepidopteran, hemipteran or nematode pests. It will be understood by one of skill in the art that the transgenic plant may comprise any gene imparting an agronomic trait of interest.
- Methods for detecting the nucleic acids and polypeptides of the embodiments in a sample are also included. A kit for detecting the presence of a PIP-1 polypeptide or detecting the presence of a nucleotide sequence encoding a PIP-1 polypeptide in a sample is provided. A kit for detecting the presence of nucleotide sequence encoding a PIP-1 polypeptide may comprise a nucleic acid probe that comprises at least 20 contiguous nucleotides of the nucleotide sequence encoding the PIP-1 polypeptide or a complement thereof. A kit for detecting the presence of a PIP-1 polypeptide may comprise an antibody that specifically binds to the PIP-1 polypeptide. The kit is provided along with all reagents and control samples necessary for carrying out a method for detecting the intended agent, as well as instructions for use.
- The compositions and methods of the embodiments are useful for the production of organisms with enhanced pest resistance or tolerance. These organisms and compositions comprising the organisms are desirable for agricultural purposes. The compositions of the embodiments are also useful for generating altered or improved proteins that have pesticidal activity or for detecting the presence of PIP-1 polypeptides or nucleic acids in products or organisms.
- The following embodiments are encompassed by the present disclosure.
- 1. A recombinant nucleic acid molecule encoding a PIP-1 polypeptide.
- 2. The recombinant nucleic acid molecule of
embodiment 1, wherein the PIP-1 polypeptide is orally active. - 3. The recombinant nucleic acid molecule of
embodiment - 4. The recombinant nucleic acid molecule of
embodiment - 5. The recombinant nucleic acid molecule of
embodiment - 6. The recombinant nucleic acid molecule of
embodiment - 7. The recombinant nucleic acid molecule of
embodiment - 8. The recombinant nucleic acid molecule of
embodiment - 9. The recombinant nucleic acid molecule of
embodiment - 10. The recombinant nucleic acid molecule of
embodiment - 11. The recombinant nucleic acid molecule of
embodiment - 12. The recombinant nucleic acid molecule of
embodiment - 13. The recombinant nucleic acid molecule of
embodiment - Xaa at position 2 is Pro or Thr; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly or Asp; Xaa at position 49 is Phe or Tyr; Xaa at position 53 is Ser or Gly; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala or Ser; Xaa at position 63 is Gln or Lys; Xaa at position 77 is Phe or Tyr; Xaa at position 97 is Met or Val; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr or lie; Xaa at position 108 is Gln or Thr; Xaa at position 110 is Arg or Leu; Xaa at position 120 is Lys, Arg or Gln; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr or Glu; Xaa at position 125 is Asn or Ser; Xaa at position 127 is Ser, Asn, Thr or Lys; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn or Lys; Xaa at position 137 is Asp or Gly; Xaa at position 141 is Val or lie; Xaa at position 142 is Gly or Asp; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr or Val; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg or Ser; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp or Glu; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln or Glu; Xaa at position 167 is Leu or Met; Xaa at position 168 is Thr, Lys or Ala; Xaa at position 174 is lie, Val or Met; Xaa at position 175 is Val or lie; Xaa at position 180 is Met or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 200 is Asn or Ser; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr or Ala; Xaa at position 206 is Gly or Asp; Xaa at position 209 is Leu or Val; Xaa at position 220 is Asn or Arg; Xaa at position 221 is Ser or Lys; Xaa at position 222 is Thr or Arg; Xaa at position 226 is Asp, Pro or Glu; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys or Asn; Xaa at position 231 is lie or Val; Xaa at position 232 is Ala, Thr or Glu; and Xaa at position 251 is Gly, Ser or Glu; Xaa at position 254 is Ser or Asn; Xaa at position 258 is Ser or Arg; Xaa at position 265 is Asn or Asp; and Xaa at position 266 is Asp or Asn; and wherein, 1 to 28 amino acids are optionally deleted from the N-terminus of the polypeptide.
- 14. The recombinant nucleic acid molecule of
embodiment - Xaa at position 2 is Pro or Thr; Xaa at position 3 is lie or Thr; Xaa at position 6 is Glu or Gly; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 43 is Pro, Met, Gly, Gln, Ser, Thr, Arg, Val, Leu, Lys, Asp, Ala, Asn, Phe, Trp, Glu or Cys; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly or Asp; Xaa at position 49 is Phe, Tyr or Leu; Xaa at position 53 is Ser or Gly; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala or Ser; Xaa at position 63 is Gln or Lys; Xaa at position 66 is Trp, Tyr, Phe, Arg, Lys, His, Ile, Val or Ser; Xaa at position 77 is Phe or Tyr; Xaa at position 89 is Pro, Leu, Gly, Arg, Thr, Ser, Met, Ala, Ile, Asn, Val, Cys or Lys; Xaa at position 93 is Tyr, Cys, Trp, Val, Asp, Asn, Ile, Leu, Met, Phe, Ala or Thr; Xaa at position 97 is Met or Val; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr or lie; Xaa at position 108 is Gln or Thr; Xaa at position 110 is Arg or Leu; Xaa at position 120 is Lys, Arg or Gln; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr or Glu; Xaa at position 125 is Asn or Ser; Xaa at position 127 is Ser, Asn, Thr or Lys; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn or Lys; Xaa at position 137 is Asp or Gly; Xaa at position 141 is Val or lie; Xaa at position 142 is Gly or Asp; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr or Val; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg or Ser; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp or Glu; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln or Glu; Xaa at position 167 is Leu or Met; Xaa at position 168 is Thr, Lys or Ala; Xaa at position 171 is Gly, Leu, Gln, Met, Cys, Asn, Asp, Ser or Ala; Xaa at position 172 is Thr, Gly, His, Phe, Glu, Arg, Ser, Asn, Ile, Trp, Lys, Gln, Cys, Val, Ala or Met; Xaa at position 173 is Phe, Gly, His, Leu, Ala, Arg, Asn, Cys, Lys, Trp, Thr, Ser, Tyr or Met; Xaa at position 174 is lie, Val, Gly, Arg, Asn, Ala, Gln, Met, Cys, Leu, Phe, Tyr, Lys, Glu, Ser, His or Thr; Xaa at position 175 is Val, Ile, Ala, Cys, Glu, Lys, Leu or Met; Xaa at position 176 is Tyr, Met, Phe, Leu or Cys; Xaa at position 177 is Gln, lie, Met or Pro; Xaa at position 178 is Val, Cys, Thr, Pro, Ala, Met, Gln, Phe, Ile, Ser or Lys; Xaa at position 179 is Val, Phe, Thr, Ile, Cys, Leu, Met, Ser, Ala or Gln; Xaa at position 180 is Met, Leu, Pro, Trp, Asn, Tyr, Gly, Gln, Ala, Val, Phe, Ile, Cys or Ser; Xaa at position 181 is Val, Ala, Leu, Trp, Cys, Thr, Ile or Lys; Xaa at position 182 is Tyr, Phe, Met or His; Xaa at position 183 is Ala, Met, Val, Thr, Asp, Gly, Cys, Ile, Phe, Ser, Gln or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 195 is Asn or Tyr; Xaa at position 200 is Asn or Ser; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr or Ala; Xaa at position 206 is Gly or Asp; Xaa at position 209 is Leu or Val; Xaa at position 213 is Tyr or Phe; Xaa at position 220 is Asn or Arg; Xaa at position 221 is Ser or Lys; Xaa at position 222 is Thr or Arg; Xaa at position 226 is Asp, Pro or Glu; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys or Asn; Xaa at position 231 is lie or Val; Xaa at position 232 is Ala, Thr or Glu; Xaa at position 240 is Gln, Arg, Ala, Val, Glu, Met, Gly, Asp, Trp, Asn, Thr, Ile, Ser, Phe, His, Cys or Leu; Xaa at position 241 is Arg, Lys, Glu, Gln, Ser, Ile, Val, Asp, Tyr, Met, Asn, His, Pro, Gly, Leu, Phe, Thr, Ala or Cys; Xaa at position 242 is Asn, Ala, Arg, Lys, His, Ser, Cys, Glu, Pro, Trp, Gln, Thr, Phe, Tyr, Met, Asp, Gly, Leu or Val; Xaa at position 243 is Val, Leu, Ala, Thr, Gly, Cys, Ile, Ser or Met; Xaa at position 244 is Leu, Val, Phe, Ile, Met, Gln, Cys, Trp or Ala; Xaa at position 245 is Met, Ala, Arg, Asp, Glu, Leu, Pro, Ser, Trp, Gly, Val, Lys, Phe, Cys, Thr, His, Ile, Gln, Tyr or Asn; Xaa at position 246 is Glu, Asp, Tyr, Gly, Arg, Val, Ala, Trp, Gln, Ser, Asn, Ile Leu, Met, Cys, Pro, His, Phe, Thr or Lys; Xaa at position 247 is Asn, Leu, Asp, Tyr, Ala, Phe, His, Arg, Lys, Gln, Gly, Val, Ile, Ser, Glu, Pro, Met, Trp, Thr or Cys; Xaa at position 248 is Tyr, Val, Thr, Glu, Phe, Ser, His, Cys, Leu, Trp, Ile, Asp, Gly or Ala; Xaa at position 249 is Asn, Lys, Val, Gly, Met, Asp, Cys, Phe, Arg, Glu, Trp, Tyr, Ser, lie, Thr, Pro, Leu, Ala, His or Gln; Xaa at position 251 is Gly, Ser or Glu; Xaa at position 254 is Ser or Asn; Xaa at position 258 is Ser or Arg; Xaa at position 259 is Phe, Trp, Tyr, Cys, Met, Leu, Val, Ile or His; Xaa at position 265 is Asn or Asp; and Xaa at position 266 is Asp or Asn; and wherein, 1 to 28 amino acids are optionally deleted from the N-terminus of the polypeptide.
- 15. The recombinant nucleic acid molecule of
embodiment - Xaa at position 2 is Pro, Thr or Ser; Xaa at position 3 is lie, Thr, Leu, Val, Met or Ser; Xaa at position 6 is Glu, Gly, Asp or Ala; Xaa at position 8 is Ser, Gly, Asn, Thr or Gln; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu, Val, Ile or Met; Xaa at position 21 is Lys, Ser, Asn, Arg, Thr or Gln; Xaa at position 22 is Ser, Lys, Arg or Thr; Xaa at position 24 is Gln, Gly, Asn or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser, Asn, Thr or Gln; Xaa at position 27 is Leu, Thr, Ala, Ser, Ile, Val or Met; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln; Xaa at position 30 is Ala, Ile, Leu, Val or Met; Xaa at position 35 is Phe, Leu, Ile, Val or Met; Xaa at position 36 is Ala, Ser, Thr, Val, Ile or Leu; Xaa at position 38 is Asn, Arg, Ser, Gln, Lys or Thr; Xaa at position 42 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 43 is Pro, Met, Gly, Gln, Ser, Thr, Arg, Val, Leu, Lys, Asp, Ala, Asn, Phe, Trp, Glu or Cys; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly, Asp, Ala or Glu; Xaa at position 49 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 53 is Ser, Gly, Ala or Thr; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala, Ser, Gly or Thr; Xaa at position 63 is Gln, Lys, Asn or Arg; Xaa at position 66 is Trp, Tyr, Phe, Arg, Lys, His, Ile, Val or Ser; Xaa at position 77 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 89 is Pro, Leu, Gly, Arg, Thr, Ser, Met, Ala, Ile, Asn, Val, Cys or Lys; Xaa at position 93 is Tyr, Cys, Trp, Val, Asp, Asn, Ile, Leu, Met, Phe, Ala or Thr; Xaa at position 97 is Met, Val, Leu or lie; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr, Ile, Ser, Leu or Val; Xaa at position 108 is Gln, Thr, Ser or Asn; Xaa at position 110 is Arg, Leu, Lys, Ile, Val or Met; Xaa at position 120 is Lys, Arg, Gln or Asn; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr, Glu, Ser or Asp; Xaa at position 125 is Asn, Ser, Gln or Thr; Xaa at position 127 is Ser, Asn, Thr, Gln, Lys, Ser or Arg; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn, Thr, Gln, Arg or Lys; Xaa at position 137 is Asp, Gly, Glu or Ala; Xaa at position 141 is Val, Ile or Leu; Xaa at position 142 is Gly, Asp, Ala or Glu; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr, Val, Leu, Met or Ser; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg, Ser, Gln, Lys or Thr; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp, Glu or Gln; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln, Glu, Asp or Asn; Xaa at position 167 is Leu, Met, Ile, Val; Xaa at position 168 is Thr, Lys, Ala, Ser, Arg or Gly; Xaa at position 171 is Gly, Leu, Gln, Met, Cys, Asn, Asp, Ser or Ala; Xaa at position 172 is Thr, Gly, His, Phe, Glu, Arg, Ser, Asn, lie, Trp, Lys, Gln, Cys, Val, Ala or Met; Xaa at position 173 is Phe, Gly, His, Leu, Ala, Arg, Asn, Cys, Lys, Trp, Thr, Ser, Tyr or Met; Xaa at position 174 is lie, Val, Gly, Arg, Asn, Ala, Gln, Met, Cys, Leu, Phe, Tyr, Lys, Glu, Ser, His or Thr; Xaa at position 175 is Val, Ile, Ala, Cys, Glu, Lys, Leu or Met; Xaa at position 176 is Tyr, Met, Phe, Leu or Cys; Xaa at position 177 is Gln, Ile, Met or Pro; Xaa at position 178 is Val, Cys, Thr, Pro, Ala, Met, Gln, Phe, Ile, Ser or Lys; Xaa at position 179 is Val, Phe, Thr, Ile, Cys, Leu, Met, Ser, Ala or Gln; Xaa at position 180 is Met, Leu; Pro, Trp, Asn, Tyr, Gly, Gln, Ala, Val, Phe, Ile, Cys or Ser; Xaa at position 181 is Val, Ala, Leu, Trp, Cys, Thr, Ile or Lys; Xaa at position 182 is Tyr, Phe, Met or His; Xaa at position 183 is Ala, Met, Val, Thr, Asp, Gly, Cys, Ile, Phe, Ser, Gln or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 195 is Asn, Tyr, Gln or Trp; Xaa at position 200 is Asn, Ser, Thr or Gln; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr, Ala, Ser or Gly; Xaa at position 206 is Gly, Asp, Ala or Glu; Xaa at position 209 is Leu, Val, Ile or Met; Xaa at position 213 is Tyr or Phe; Xaa at position 220 is Asn, Arg, Gln or Lys; Xaa at position 221 is Ser, Lys, Thr or Arg; Xaa at position 222 is Thr, Arg, Ser or Lys; Xaa at position 226 is Asp, Pro, Glu or Gln; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys, Asn, Arg or Gln; Xaa at position 231 is lie, Val, Leu or Met; Xaa at position 232 is Ala, Thr, Ser, Gly, Asp or Glu; Xaa at position 240 is Gln, Arg, Ala, Val, Glu, Met, Gly, Asp, Trp, Asn, Thr, Ile, Ser, Phe, His, Cys or Leu; Xaa at position 241 is Arg, Lys, Glu, Gln, Ser, Ile, Val, Asp, Tyr, Met, Asn, His, Pro, Gly, Leu, Phe, Thr, Ala or Cys; Xaa at position 242 is Asn, Ala, Arg, Lys, His, Ser, Cys, Glu, Pro, Trp, Gln, Thr, Phe, Tyr, Met, Asp, Gly, Leu or Val; Xaa at position 243 is Val, Leu, Ala, Thr, Gly, Cys, Ile, Ser or Met; Xaa at position 244 is Leu, Val, Phe, Ile, Met, Gln, Cys, Trp or Ala; Xaa at position 245 is Met, Ala, Arg, Asp, Glu, Leu, Pro, Ser, Trp, Gly, Val, Lys, Phe, Cys, Thr, His, Ile, Gln, Tyr or Asn; Xaa at position 246 is Glu, Asp, Tyr, Gly, Arg, Val, Ala, Trp, Gln, Ser, Asn, Ile Leu, Met, Cys, Pro, His, Phe, Thr or Lys; Xaa at position 247 is Asn, Leu, Asp, Tyr, Ala, Phe, His, Arg, Lys, Gln, Gly, Val, Ile, Ser, Glu, Pro, Met, Trp, Thr or Cys; Xaa at position 248 is Tyr, Val, Thr, Glu, Phe, Ser, His, Cys, Leu, Trp, Ile, Asp, Gly or Ala; Xaa at position 249 is Asn, Lys, Val, Gly, Met, Asp, Cys, Phe, Arg, Glu, Trp, Tyr, Ser, Ile, Thr, Pro, Leu, Ala, His or Gln; Xaa at position 251 is Gly, Ser, Thr, Ala, Asp or Glu; Xaa at position 254 is Ser, Asn, Thr or Gln; Xaa at position 258 is Ser, Arg, Thr or Lys; Xaa at position 259 is Phe, Trp, Tyr, Cys, Met, Leu, Val, Ile or His; Xaa at position 265 is Asn, Asp, Gln or Glu; and Xaa at position 266 is Asp, Asn, Gln or Glu; and wherein, 1 to 28 amino acids are optionally deleted from the N-terminus of the polypeptide.
- 16. The recombinant nucleic acid molecule of
embodiment - 17. The recombinant nucleic acid molecule of
embodiment - 18. The recombinant nucleic acid molecule of
embodiment - 19. The recombinant nucleic acid molecule of
embodiment - 20. A plant or progeny thereof, comprising the recombinant nucleic acid molecule of
embodiment - 21. A plant or progeny thereof stably transformed with the recombinant nucleic acid molecule of
embodiment - 22. The plant of
embodiment 20 or 21, wherein the plant is a monocotyledon. - 23. The plant of
embodiment 20 or 21, wherein the plant is a dicotyledon. - 24. The plant of
embodiment 20 or 21, wherein the plant is selected from barley, corn, oat, rice, rye, sorghum, turf grass, sugarcane, wheat, alfalfa, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, a cucurbit, eucalyptus, flax, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, tomato ornamental, shrub, nut, chickpea, pigeon pea, millets, hops, and pasture grass plant cells. - 25. The plant of
embodiment 20, 21, 22, 23 or 24, further comprising one or more additional transgenic traits. - 26. The plant of
embodiment 25, wherein the one or more additional transgenic trait is selected from insect resistance, herbicide resistance, fungal resistance, virus resistance or stress tolerance, disease resistance, male sterility, stalk strength, increased yield, modified starches, improved oil profile, balanced amino acids, high lysine or methionine, increased digestibility, improved fiber quality, and drought tolerance. - 27. An expression cassette, comprising the recombinant nucleic acid molecule of
embodiment - 28. A plant, comprising the expression cassette of embodiment 27.
- 29. A plant cell, comprising the expression cassette of embodiment 27.
- 30. A recombinant microbial cell, comprising the expression cassette of embodiment 27.
- 31. Seed or grain of the plant of
embodiment - 32. The seed of embodiment 31, wherein one or more seed treatment has been applied to the seed.
- 33. The seed of embodiment 32, wherein the one or more seed treatment is selected from a herbicide, an insecticide, a fungicide, a germination inhibitor, a germination enhancer, a plant growth regulator, a bactericide, and a nematocide.
- 34. A biological sample derived from a tissue or seed of the plant of
embodiment - 35. A recombinant microorganism, comprising a recombinant nucleic acid molecule of
embodiment - 36. The microorganism of embodiment 35, wherein the microorganism is selected from a bacteria, baculovirus, algae, and fungi.
- 37. The microorganism of embodiment 36, wherein the bacteria is selected from a Bacillus, a Pseudomonas, a Clavibacter, a Rhizobium and E. coli.
- 38. A method for producing a polypeptide with insecticidal activity, comprising culturing the microorganism of embodiment 35, 36 or 37 under conditions in which the nucleic acid molecule encoding the polypeptide is expressed.
- 39. A method for expressing in a plant a PIP-1 polypeptide, comprising the steps of:
-
- (a) inserting into the plant cell a nucleic acid sequence comprising in the 5′ to 3′ direction an operably linked recombinant, double-stranded DNA molecule, wherein the recombinant double-stranded DNA molecule comprises
- (i) a promoter that functions in the plant cell;
- (ii) a nucleic acid molecule encoding a PIP-1 polypeptide as set forth in
embodiment - (iii) a 3′ non-translated polynucleotide that functions in the cells of the plant to cause termination of transcription;
- (b) obtaining a transformed plant cell comprising the nucleic acid sequence of step (a); and
- (c) generating from the transformed plant cell a plant capable of expressing the PIP-1 polypeptide.
- (a) inserting into the plant cell a nucleic acid sequence comprising in the 5′ to 3′ direction an operably linked recombinant, double-stranded DNA molecule, wherein the recombinant double-stranded DNA molecule comprises
- 40. A plant produced by the method of embodiment 39.
- 41. Seed or grain produced by the plant of embodiment 40.
- 42. The plant of embodiment 40, further comprising one or more additional transgenic traits.
- 43. The plant of embodiment 42, wherein the one or more additional transgenic trait is selected from insect resistance, herbicide resistance, fungal resistance, viral resistance, stress tolerance, disease resistance, male sterility, stalk strength, increased yield, modified starches, improved oil profile, balanced amino acids, high lysine or methionine, increased digestibility, improved fiber quality, flowering, ear and seed development, enhancement of nitrogen utilization efficiency, altered nitrogen responsiveness, drought resistance or tolerance, cold resistance or tolerance, salt resistance or tolerance, and increased yield under stress.
- 44. The plant of embodiment 40, 42 or 43, wherein the plant is a monocotyledon.
- 45. The plant of embodiment 40, 42 or 43, wherein the plant is a dicotyledon.
- 46. A recombinant PIP-1 polypeptide.
- 47. The recombinant PIP-1 polypeptide of embodiment 46, wherein the PIP-1 polypeptide is orally active.
- 48. The recombinant PIP-1 polypeptide of embodiment 46 or 47, wherein the PIP-1 polypeptide has insecticidal activity against an insect pest of the order Hemiptera.
- 49. The recombinant PIP-1 polypeptide of embodiment 46, 47 or 48, wherein the PIP-1 polypeptide has insecticidal activity against an insect pest of the Pentatomidae family.
- 50. The recombinant PIP-1 polypeptide of embodiment 49, wherein the PIP-1 polypeptide has insecticidal activity against an insect selected from Nezara viridula, Halyomorpha halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare, Euschistus heros, Euschistus tristigmus, Acrosternum hilare, Dichelops furcatus, Dichelops melacanthus, Bagrada hilaris, Megacopta cribraria, Scaptocoris castanea, Helicoverpa zea Boddie, Pseudoplusia includens Walker, and Anticarsia gemmatalis.
- 51. The recombinant PIP-1 polypeptide of
embodiment 46, 47, 48, 49 or 50, wherein the PIP-1 polypeptide has insecticidal activity against an insect pest of the order Lepidoptera. - 52. The recombinant PIP-1 polypeptide of
embodiment - 53. The recombinant PIP-1 polypeptide of embodiment 52, wherein the PIP-1 polypeptide is produced by a Pseudomonas chlororaphis strain having a 16S ribosomal DNA having at least about 96.9% identity to SEQ ID NO: 216.
- 54. The recombinant PIP-1 polypeptide of embodiment 52, wherein the Pseudomonas chlororaphis strain is SS44C4 deposited under accession #NRRLB-50613.
- 55. The recombinant PIP-1 polypeptide of
embodiment - 56. The recombinant PIP-1 polypeptide of embodiment 55, further comprising any one or more amino acid motifs as represented by positions 149-159 of SEQ ID NO: 213, and positions 64-79 of SEQ ID NO: 213.
- 57. The recombinant PIP-1 polypeptide of
embodiment - 58. The recombinant PIP-1 polypeptide of
embodiment - 59. The recombinant PIP-1 polypeptide of
embodiment - Xaa at position 2 is Pro or Thr; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly or Asp; Xaa at position 49 is Phe or Tyr; Xaa at position 53 is Ser or Gly; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala or Ser; Xaa at position 63 is Gln or Lys; Xaa at position 77 is Phe or Tyr; Xaa at position 97 is Met or Val; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr or lie; Xaa at position 108 is Gln or Thr; Xaa at position 110 is Arg or Leu; Xaa at position 120 is Lys, Arg or Gln; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr or Glu; Xaa at position 125 is Asn or Ser; Xaa at position 127 is Ser, Asn, Thr or Lys; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn or Lys; Xaa at position 137 is Asp or Gly; Xaa at position 141 is Val or lie; Xaa at position 142 is Gly or Asp; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr or Val; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg or Ser; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp or Glu; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln or Glu; Xaa at position 167 is Leu or Met; Xaa at position 168 is Thr, Lys or Ala; Xaa at position 174 is lie, Val or Met; Xaa at position 175 is Val or lie; Xaa at position 180 is Met or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 200 is Asn or Ser; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr or Ala; Xaa at position 206 is Gly or Asp; Xaa at position 209 is Leu or Val; Xaa at position 220 is Asn or Arg; Xaa at position 221 is Ser or Lys; Xaa at position 222 is Thr or Arg; Xaa at position 226 is Asp, Pro or Glu; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys or Asn; Xaa at position 231 is lie or Val; Xaa at position 232 is Ala, Thr or Glu; and Xaa at position 251 is Gly, Ser or Glu; Xaa at position 254 is Ser or Asn; Xaa at position 258 is Ser or Arg; Xaa at position 265 is Asn or Asp; and Xaa at position 266 is Asp or Asn; and wherein, 1 to 28 amino acids are optionally deleted from the N-terminus of the polypeptide.
- 60. The recombinant PIP-1 polypeptide of
embodiment - Xaa at position 2 is Pro or Thr; Xaa at position 3 is lie or Thr; Xaa at position 6 is Glu or Gly; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 43 is Pro, Met, Gly, Gln, Ser, Thr, Arg, Val, Leu, Lys, Asp, Ala, Asn, Phe, Trp, Glu or Cys; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly or Asp; Xaa at position 49 is Phe, Tyr or Leu; Xaa at position 53 is Ser or Gly; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala or Ser; Xaa at position 63 is Gln or Lys; Xaa at position 66 is Trp, Tyr, Phe, Arg, Lys, His, Ile, Val or Ser; Xaa at position 77 is Phe or Tyr; Xaa at position 89 is Pro, Leu, Gly, Arg, Thr, Ser, Met, Ala, Ile, Asn, Val, Cys or Lys; Xaa at position 93 is Tyr, Cys, Trp, Val, Asp, Asn, Ile, Leu, Met, Phe, Ala or Thr; Xaa at position 97 is Met or Val; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr or lie; Xaa at position 108 is Gln or Thr; Xaa at position 110 is Arg or Leu; Xaa at position 120 is Lys, Arg or Gln; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr or Glu; Xaa at position 125 is Asn or Ser; Xaa at position 127 is Ser, Asn, Thr or Lys; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn or Lys; Xaa at position 137 is Asp or Gly; Xaa at position 141 is Val or lie; Xaa at position 142 is Gly or Asp; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr or Val; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg or Ser; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp or Glu; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln or Glu; Xaa at position 167 is Leu or Met; Xaa at position 168 is Thr, Lys or Ala; Xaa at position 171 is Gly, Leu, Gln, Met, Cys, Asn, Asp, Ser or Ala; Xaa at position 172 is Thr, Gly, His, Phe, Glu, Arg, Ser, Asn, Ile, Trp, Lys, Gln, Cys, Val, Ala or Met; Xaa at position 173 is Phe, Gly, His, Leu, Ala, Arg, Asn, Cys, Lys, Trp, Thr, Ser, Tyr or Met; Xaa at position 174 is lie, Val, Gly, Arg, Asn, Ala, Gln, Met, Cys, Leu, Phe, Tyr, Lys, Glu, Ser, His or Thr; Xaa at position 175 is Val, Ile, Ala, Cys, Glu, Lys, Leu or Met; Xaa at position 176 is Tyr, Met, Phe, Leu or Cys; Xaa at position 177 is Gln, lie, Met or Pro; Xaa at position 178 is Val, Cys, Thr, Pro, Ala, Met, Gln, Phe, Ile, Ser or Lys; Xaa at position 179 is Val, Phe, Thr, Ile, Cys, Leu, Met, Ser, Ala or Gln; Xaa at position 180 is Met, Leu, Pro, Trp, Asn, Tyr, Gly, Gln, Ala, Val, Phe, Ile, Cys or Ser; Xaa at position 181 is Val, Ala, Leu, Trp, Cys, Thr, Ile or Lys; Xaa at position 182 is Tyr, Phe, Met or His; Xaa at position 183 is Ala, Met, Val, Thr, Asp, Gly, Cys, Ile, Phe, Ser, Gln or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 195 is Asn or Tyr; Xaa at position 200 is Asn or Ser; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr or Ala; Xaa at position 206 is Gly or Asp; Xaa at position 209 is Leu or Val; Xaa at position 213 is Tyr or Phe; Xaa at position 220 is Asn or Arg; Xaa at position 221 is Ser or Lys; Xaa at position 222 is Thr or Arg; Xaa at position 226 is Asp, Pro or Glu; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys or Asn; Xaa at position 231 is lie or Val; Xaa at position 232 is Ala, Thr or Glu; Xaa at position 240 is Gln, Arg, Ala, Val, Glu, Met, Gly, Asp, Trp, Asn, Thr, Ile, Ser, Phe, His, Cys or Leu; Xaa at position 241 is Arg, Lys, Glu, Gln, Ser, Ile, Val, Asp, Tyr, Met, Asn, His, Pro, Gly, Leu, Phe, Thr, Ala or Cys; Xaa at position 242 is Asn, Ala, Arg, Lys, His, Ser, Cys, Glu, Pro, Trp, Gln, Thr, Phe, Tyr, Met, Asp, Gly, Leu or Val; Xaa at position 243 is Val, Leu, Ala, Thr, Gly, Cys, Ile, Ser or Met; Xaa at position 244 is Leu, Val, Phe, Ile, Met, Gln, Cys, Trp or Ala; Xaa at position 245 is Met, Ala, Arg, Asp, Glu, Leu, Pro, Ser, Trp, Gly, Val, Lys, Phe, Cys, Thr, His, Ile, Gln, Tyr or Asn; Xaa at position 246 is Glu, Asp, Tyr, Gly, Arg, Val, Ala, Trp, Gln, Ser, Asn, Ile Leu, Met, Cys, Pro, His, Phe, Thr or Lys; Xaa at position 247 is Asn, Leu, Asp, Tyr, Ala, Phe, His, Arg, Lys, Gln, Gly, Val, Ile, Ser, Glu, Pro, Met, Trp, Thr or Cys; Xaa at position 248 is Tyr, Val, Thr, Glu, Phe, Ser, His, Cys, Leu, Trp, Ile, Asp, Gly or Ala; Xaa at position 249 is Asn, Lys, Val, Gly, Met, Asp, Cys, Phe, Arg, Glu, Trp, Tyr, Ser, lie, Thr, Pro, Leu, Ala, His or Gln; Xaa at position 251 is Gly, Ser or Glu; Xaa at position 254 is Ser or Asn; Xaa at position 258 is Ser or Arg; Xaa at position 259 is Phe, Trp, Tyr, Cys, Met, Leu, Val, Ile or His; Xaa at position 265 is Asn or Asp; and Xaa at position 266 is Asp or Asn; and wherein, 1 to 28 amino acids are optionally deleted from the N-terminus of the polypeptide.
- 61. The recombinant PIP-1 polypeptide of embodiment 58, wherein the PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 213, wherein Xaa at position 2 is Pro, Thr or Ser; Xaa at position 3 is lie, Thr, Leu, Val, Met or Ser; Xaa at position 6 is Glu, Gly, Asp or Ala; Xaa at position 8 is Ser, Gly, Asn, Thr or Gln; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu, Val, Ile or Met; Xaa at position 21 is Lys, Ser, Asn, Arg, Thr or Gln; Xaa at position 22 is Ser, Lys, Arg or Thr; Xaa at position 24 is Gln, Gly, Asn or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser, Asn, Thr or Gln; Xaa at position 27 is Leu, Thr, Ala, Ser, Ile, Val or Met; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln; Xaa at position 30 is Ala, Ile, Leu, Val or Met; Xaa at position 35 is Phe, Leu, Ile, Val or Met; Xaa at position 36 is Ala, Ser, Thr, Val, Ile or Leu; Xaa at position 38 is Asn, Arg, Ser, Gln, Lys or Thr; Xaa at position 42 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 43 is Pro, Met, Gly, Gln, Ser, Thr, Arg, Val, Leu, Lys, Asp, Ala, Asn, Phe, Trp, Glu or Cys; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly, Asp, Ala or Glu; Xaa at position 49 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 53 is Ser, Gly, Ala or Thr; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala, Ser, Gly or Thr; Xaa at position 63 is Gln, Lys, Asn or Arg; Xaa at position 66 is Trp, Tyr, Phe, Arg, Lys, His, Ile, Val or Ser; Xaa at position 77 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 89 is Pro, Leu, Gly, Arg, Thr, Ser, Met, Ala, Ile, Asn, Val, Cys or Lys; Xaa at position 93 is Tyr, Cys, Trp, Val, Asp, Asn, Ile, Leu, Met, Phe, Ala or Thr; Xaa at position 97 is Met, Val, Leu or lie; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr, Ile, Ser, Leu or Val; Xaa at position 108 is Gln, Thr, Ser or Asn; Xaa at position 110 is Arg, Leu, Lys, Ile, Val or Met; Xaa at position 120 is Lys, Arg, Gln or Asn; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr, Glu, Ser or Asp; Xaa at position 125 is Asn, Ser, Gln or Thr; Xaa at position 127 is Ser, Asn, Thr, Gln, Lys, Ser or Arg; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn, Thr, Gln, Arg or Lys; Xaa at position 137 is Asp, Gly, Glu or Ala; Xaa at position 141 is Val, Ile or Leu; Xaa at position 142 is Gly, Asp, Ala or Glu; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr, Val, Leu, Met or Ser; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg, Ser, Gln, Lys or Thr; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp, Glu or Gln; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln, Glu, Asp or Asn; Xaa at position 167 is Leu, Met, Ile, Val; Xaa at position 168 is Thr, Lys, Ala, Ser, Arg or Gly; Xaa at position 171 is Gly, Leu, Gln, Met, Cys, Asn, Asp, Ser or Ala; Xaa at position 172 is Thr, Gly, His, Phe, Glu, Arg, Ser, Asn, lie, Trp, Lys, Gln, Cys, Val, Ala or Met; Xaa at position 173 is Phe, Gly, His, Leu, Ala, Arg, Asn, Cys, Lys, Trp, Thr, Ser, Tyr or Met; Xaa at position 174 is lie, Val, Gly, Arg, Asn, Ala, Gln, Met, Cys, Leu, Phe, Tyr, Lys, Glu, Ser, His or Thr; Xaa at position 175 is Val, Ile, Ala, Cys, Glu, Lys, Leu or Met; Xaa at position 176 is Tyr, Met, Phe, Leu or Cys; Xaa at position 177 is Gln, Ile, Met or Pro; Xaa at position 178 is Val, Cys, Thr, Pro, Ala, Met, Gln, Phe, Ile, Ser or Lys; Xaa at position 179 is Val, Phe, Thr, Ile, Cys, Leu, Met, Ser, Ala or Gln; Xaa at position 180 is Met, Leu; Pro, Trp, Asn, Tyr, Gly, Gln, Ala, Val, Phe, Ile, Cys or Ser; Xaa at position 181 is Val, Ala, Leu, Trp, Cys, Thr, Ile or Lys; Xaa at position 182 is Tyr, Phe, Met or His; Xaa at position 183 is Ala, Met, Val, Thr, Asp, Gly, Cys, Ile, Phe, Ser, Gln or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 195 is Asn, Tyr, Gln or Trp; Xaa at position 200 is Asn, Ser, Thr or Gln; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr, Ala, Ser or Gly; Xaa at position 206 is Gly, Asp, Ala or Glu; Xaa at position 209 is Leu, Val, Ile or Met; Xaa at position 213 is Tyr or Phe; Xaa at position 220 is Asn, Arg, Gln or Lys; Xaa at position 221 is Ser, Lys, Thr or Arg; Xaa at position 222 is Thr, Arg, Ser or Lys; Xaa at position 226 is Asp, Pro, Glu or Gln; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys, Asn, Arg or Gln; Xaa at position 231 is lie, Val, Leu or Met; Xaa at position 232 is Ala, Thr, Ser, Gly, Asp or Glu; Xaa at position 240 is Gln, Arg, Ala, Val, Glu, Met, Gly, Asp, Trp, Asn, Thr, Ile, Ser, Phe, His, Cys or Leu; Xaa at position 241 is Arg, Lys, Glu, Gln, Ser, Ile, Val, Asp, Tyr, Met, Asn, His, Pro, Gly, Leu, Phe, Thr, Ala or Cys; Xaa at position 242 is Asn, Ala, Arg, Lys, His, Ser, Cys, Glu, Pro, Trp, Gln, Thr, Phe, Tyr, Met, Asp, Gly, Leu or Val; Xaa at position 243 is Val, Leu, Ala, Thr, Gly, Cys, Ile, Ser or Met; Xaa at position 244 is Leu, Val, Phe, Ile, Met, Gln, Cys, Trp or Ala; Xaa at position 245 is Met, Ala, Arg, Asp, Glu, Leu, Pro, Ser, Trp, Gly, Val, Lys, Phe, Cys, Thr, His, Ile, Gln, Tyr or Asn; Xaa at position 246 is Glu, Asp, Tyr, Gly, Arg, Val, Ala, Trp, Gln, Ser, Asn, Ile Leu, Met, Cys, Pro, His, Phe, Thr or Lys; Xaa at position 247 is Asn, Leu, Asp, Tyr, Ala, Phe, His, Arg, Lys, Gln, Gly, Val, Ile, Ser, Glu, Pro, Met, Trp, Thr or Cys; Xaa at position 248 is Tyr, Val, Thr, Glu, Phe, Ser, His, Cys, Leu, Trp, Ile, Asp, Gly or Ala; Xaa at position 249 is Asn, Lys, Val, Gly, Met, Asp, Cys, Phe, Arg, Glu, Trp, Tyr, Ser, Ile, Thr, Pro, Leu, Ala, His or Gln; Xaa at position 251 is Gly, Ser, Thr, Ala, Asp or Glu; Xaa at position 254 is Ser, Asn, Thr or Gln; Xaa at position 258 is Ser, Arg, Thr or Lys; Xaa at position 259 is Phe, Trp, Tyr, Cys, Met, Leu, Val, Ile or His; Xaa at position 265 is Asn, Asp, Gln or Glu; and Xaa at position 266 is Asp, Asn, Gln or Glu; and wherein, 1 to 28 amino acids are optionally deleted from the N-terminus of the polypeptide.
- 62. The recombinant PIP-1 polypeptide of embodiment 55, comprising an amino acid sequence of SEQ ID NO: 2 or a fragment thereof.
- 63. The recombinant PIP-1 polypeptide of embodiment 55, consisting essentially of an amino acid sequence of SEQ ID NO: 2.
- 64. The recombinant PIP-1 polypeptide of embodiment 55, wherein the PIP-1 polypeptide is encoded by the polynucleotide of SEQ ID NO: 1.
- 65. The recombinant PIP-1 polypeptide of embodiment 46, comprising one or more properties selected from:
-
- a) an amino acid motif as represented by positions 64-79 of SEQ ID NO: 213;
- b) an amino acid motif as represented by positions 149-159 of SEQ ID NO: 213;
- c) an amino acid motif as represented by positions 171-183 of SEQ ID NO: 213;
- e) insecticidal activity against an insect pest of the order Hemiptera;
- f) insecticidal activity against an insect pest of the order Lepidoptera;
- g) orally active; and
- h) a calculated molecular weight of between about 15 kD to about 35 kD.
- 66. A plant capable of expressing the recombinant PIP-1 polypeptide of
embodiment - 67. The plant of embodiment 66, wherein the plant is a monocotyledon.
- 68. The plant of embodiment 66, wherein the plant is a dicotyledon.
- 69. The plant of embodiment 66, wherein the plant is selected from barley, corn, oat, rice, rye, sorghum, turf grass, sugarcane, wheat, alfalfa, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, a cucurbit, eucalyptus, flax, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, tomato ornamental, shrub, nut, chickpea, pigeon pea, millets, hops, and pasture grasses.
- 70. The plant of
embodiment 66, 67, 68, 69 or 70 wherein the plant expresses one or more additional transgenic traits. - 71. The plant of embodiment 70, wherein the one or more additional transgenic trait is selected insect resistance, herbicide resistance, fungal resistance, viral resistance, stress tolerance, disease resistance, male sterility, stalk strength, increased yield, modified starches, improved oil profile, balanced amino acids, high lysine or methionine, increased digestibility, improved fiber quality, flowering, ear and seed development, enhancement of nitrogen utilization efficiency, altered nitrogen responsiveness, drought resistance or tolerance, cold resistance or tolerance, and salt resistance or tolerance, and increased yield under stress.
- 72. A composition, comprising an insecticidally-effective amount of the recombinant PIP-1 polypeptide of
embodiment - 73. The composition of
embodiment 72, further comprising an agriculturally suitable carrier. - 74. The composition of embodiment 73, wherein the carrier is selected from a powder, a dust, pellets, granules, spray, emulsion, colloid, and solution.
- 75. The composition of
embodiment 72, 73 or 74, further comprising one or more herbicides, insecticides or fungicides. - 76. The composition of embodiment 75, wherein the one or more insecticides are pesticidal proteins.
- 77. The composition of embodiment 76, wherein the one or more pesticidal proteins are selected from a Cry1 protein, a Cry2 protein, a Cry3 protein, a Cry4 protein, a Cry5 protein, a Cry6 protein, a Cry7 protein, a Cry8 protein, a Cry9 protein, a Cry15 protein, Cry22 protein, a Cry23 protein, a Cry32 protein, a Cry34 protein, a Cry35 protein, a Cry36 protein, a Cry37 protein, a Cry43 protein, a Cry46 protein, a Cry51 protein, a Cry55 protein, a Cry binary toxin, a Cyt protein, a VIP toxin, a SIP protein, an insecticidal lipase, an insecticidal chitinase, and a snake venom protein.
- 78. A method for controlling an insect pest population, comprising contacting the insect pest population with an insecticidally-effective amount of the recombinant PIP-1 polypeptide of
embodiment - 79. A method of inhibiting growth or killing an insect pest, comprising contacting the insect pest with a insecticidally-effective amount of recombinant PIP-1 polypeptide of
embodiment - 80. A method for controlling an insect pest population resistant to a pesticidal protein, comprising contacting the resistant insect pest population with a insecticidally-effective amount of the recombinant PIP-1 polypeptide of
embodiment - 81. The method of controlling an insect pest population resistant to an pesticidal protein, comprising contacting the population with a insecticidally-effective amount of the recombinant PIP-1 polypeptide of
embodiment - 82. A method for protecting a plant from an insect pest, comprising expressing in the plant or cell thereof a recombinant PIP-1 polypeptide of
embodiment - 83. A biologically pure culture of a Pseudomonas chlororaphis strain SS44C4 deposited under accession #NRRLB-50613.
- 84. A method of isolating a polypeptide having insecticidal activity from a Pseudomonas chlororaphis strain, comprising
-
- a) obtaining a protein cell lysate from a bacterial isolate;
- b) screening the protein cell lysate for insecticidal activity; and
- c) isolating an insecticidal protein from the protein cell lysate.
- 85. A recombinant receptor to the polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 332 or SEQ ID NO: 6.
- 86. The recombinant receptor of embodiment 85, wherein the receptor is isolated from a Hemiptera.
- 87. A method of identifying a PIP-1 polypeptide in a biological sample, comprising contacting the biological sample with the receptor of embodiment 85 or 86.
- 88. An isolated antibody or antigen-binding portion thereof, wherein the antibody binds specifically to the PIP-1 polypeptide of
embodiment - 89. A method of detecting a PIP-1 polypeptide in a biological sample comprising, contacting the protein with the antibody of embodiment 88.
- 90. A method of isolating a PIP-1 polypeptide in a biological sample comprising, contacting the protein with the antibody of embodiment 88.
- 91. A method of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and providing insect resistance management, comprising expressing in the plant at least two different insecticidal proteins having different modes of action.
- 92. The method of embodiment 91, wherein one of the at least two insecticidal proteins comprises a PIP-1 polypeptide of
embodiment - 93. The method of embodiment 92, wherein one of the at least two insecticidal proteins comprises a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- 94. A method of reducing likelihood of emergence of Lepidoptera and/or Hemiptera insect resistance to transgenic plants expressing in the plants insecticidal proteins to control the insect species, comprising expressing a PIP-1A polypeptide of
embodiment - 95. A means for effective Lepidoptera and/or Hemiptera insect resistance management, comprising co-expressing at high levels in transgenic plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or killing activity, wherein the two or more insecticidal proteins comprise a PIP-1 polypeptide of
embodiment - 96. A method for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera, comprising the step of referring to, submitting or relying on insect assay binding data showing that the PIP-1 polypeptide of
embodiment - 97. A plant or progeny thereof, comprising the recombinant nucleic acid molecule of SEQ ID NO: 3.
- 98. A plant or progeny thereof stably transformed with the recombinant nucleic acid molecule of SEQ ID NO: 3.
- 99. The plant or progeny thereof of embodiment 97 or 98, wherein the plant is a monocotyledon.
- 100. The plant or progeny thereof of embodiment 97 or 98, wherein the plant is a dicotyledon.
- 101. The plant or progeny thereof of embodiment 97 or 98, wherein the plant is selected from barley, corn, oat, rice, rye, sorghum, turf grass, sugarcane, wheat, alfalfa, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, a cucurbit, eucalyptus, flax, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, tomato ornamental, shrub, nut, chickpea, pigeon pea, millets, hops, and pasture grasses.
- 102. The plant or progeny thereof of
embodiment - 103. An expression cassette, comprising the recombinant nucleic acid molecule of SEQ ID NO: 3 or SEQ ID NO: 331, wherein the nucleic acid is operably linked to one or more regulatory sequences directing expression of the polypeptide of SEQ ID NO: 4 or SEQ ID NO: 332.
- 104. A plant, comprising the expression cassette of embodiment 103.
- 105. A plant cell, comprising the expression cassette of embodiment 103.
- 106. A seed or grain of the plant of
embodiment - 107. The seed of embodiment 106, wherein one or more seed treatment has been applied to the seed.
- 108. A method for expressing in a plant a insecticidal protein, comprising
-
- (a) inserting into the plant cell a nucleic acid sequence comprising in the 5′ to 3′ direction an operably linked recombinant, double-stranded DNA molecule, wherein the recombinant, double-stranded DNA molecule comprises
- (i) a promoter that functions in the plant cell;
- (ii) a nucleic acid molecule encoding the protein of SEQ ID NO: 4; and
- (iii) a 3′ non-translated polynucleotide that functions in the cells of the plant to cause termination of transcription;
- (b) obtaining a transformed plant cell comprising the nucleic acid sequence of step (a); and
- (c) generating from the transformed plant cell a plant capable of expressing the protein of SEQ ID NO: 4.
- (a) inserting into the plant cell a nucleic acid sequence comprising in the 5′ to 3′ direction an operably linked recombinant, double-stranded DNA molecule, wherein the recombinant, double-stranded DNA molecule comprises
- 109. A plant produced by the method of embodiment 108.
- 110. Seed or grain of the plant of embodiment 109.
- 111. The method of embodiment 108, wherein the plant further comprises one or more additional transgenic traits.
- 112. A plant capable of expressing a recombinant protein of SEQ ID NO: 4.
- 113. A method for controlling an insect pest population, comprising contacting the insect pest population with a insecticidally-effective amount of a recombinant protein of SEQ ID NO: 4.
- 114. A method of inhibiting growth or killing an insect pest, comprising contacting the insect pest with a insecticidally-effective amount of a recombinant protein of SEQ ID NO: 4.
- 115. A method for controlling an insect pest population resistant to a pesticidal protein, comprising contacting the insect pest population with a insecticidally-effective amount of a recombinant protein of SEQ ID NO: 4.
- 116. A method for protecting a plant from an insect pest, comprising expressing in the plant or cell thereof a recombinant insecticidal protein of SEQ ID NO: 4.
- 117. A recombinant nucleic acid molecule encoding a insecticidal protein comprising a polypeptide having at least 80% identity to the amino acid sequence of SEQ ID NO: 6.
- 118. The recombinant nucleic acid molecule of embodiment 117, wherein the insecticidal protein is orally active.
- 119. The recombinant nucleic acid molecule of
embodiment 117 or 118, wherein the insecticidal protein has insecticidal activity against an insect pest in the order Hemiptera. - 120. The recombinant nucleic acid molecule of embodiment 119, wherein the insecticidal protein has insecticidal activity against an insect pest in the family Pentatomidae.
- 121. The recombinant nucleic acid molecule of
embodiment - 122. The recombinant nucleic acid molecule of
embodiment - 123. The recombinant nucleic acid molecule of embodiment 117, wherein the insecticidal protein comprises an amino acid motif as represented by positions 171-183 of SEQ ID NO: 6 or positions 171-183 of SEQ ID NO: 213.
- 124. The recombinant nucleic acid molecule of embodiment 123, wherein the insecticidal protein further comprises any one or more amino acid motifs as represented by positions 149-159 of SEQ ID NO: 213 and positions 69-79 of SEQ ID NO: 213.
- 125. A recombinant insecticidal protein, comprising a polypeptide having at least 80% identity to the amino acid sequence of SEQ ID NO: 6.
- 126. The recombinant insecticidal protein of embodiment 125, wherein the insecticidal protein is orally active.
- 127. The recombinant insecticidal protein of embodiment 125 or 126, wherein the insecticidal protein has insecticidal activity against an insect pest in the order Hemiptera.
- 128. The recombinant insecticidal protein of embodiment 127, wherein the insecticidal protein has insecticidal activity against an insect pest in the family Pentatomidae.
- 129. The recombinant insecticidal protein of embodiment 125, 126, 127 or 128, wherein the insecticidal protein has insecticidal activity against an insect pest in the order Lepidoptera.
- 130. The recombinant insecticidal protein of embodiment 125, 126, 127, 128 or 129, wherein the nucleic acid molecule is produced by a Pseudomonas entomophila strain.
- 131. The recombinant insecticidal protein of embodiment 125, wherein the insecticidal protein comprises an amino acid motif as represented by positions 171-183 of SEQ ID NO: 213.
- 132. The recombinant insecticidal protein of embodiment 131, wherein the insecticidal protein further comprises any one or more amino acid motifs as represented by positions 149-159 of SEQ ID NO: 213, and positions 69-79 of SEQ ID NO: 213.
- 133. A plant or progeny thereof, comprising the recombinant nucleic acid molecule of
embodiment - 134. A plant or progeny thereof stably transformed with the recombinant nucleic acid molecule of
embodiment - 135. The plant or progeny thereof of
embodiment 133 or 134, wherein the plant is a monocotyledon. - 136. The plant or progeny thereof of
embodiment 133 or 134, wherein the plant is a dicotyledon. - 137. The plant or progeny thereof of
embodiment 133 or 134, wherein the plant is selected from barley, corn, oat, rice, rye, sorghum, turf grass, sugarcane, wheat, alfalfa, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, a cucurbit, eucalyptus, flax, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, tomato ornamental, shrub, nut, chickpea, pigeon pea, millets, hops, and pasture grass plant cells. - 138. The plant or progeny thereof of
embodiment 133, 134,135, 136 or 137, further comprising one or more additional transgenic traits. - 139. An expression cassette, comprising the recombinant nucleic acid molecule encoding the insecticidal protein of
embodiment - 140. A plant, comprising the expression cassette of embodiment 139.
- 141. A plant cell, comprising the expression cassette of embodiment 139.
- 142. Seed or grain of the plant of
embodiment 133, 134, 135, 136, 137 or 138, wherein the seed or grain comprises the recombinant nucleic acid molecule. - 143. The seed of embodiment 142, wherein one or more seed treatment has been applied to the seed.
- 144. A method for expressing in a plant a insecticidal protein, comprising
-
- (a) inserting into the plant cell a nucleic acid sequence comprising in the 5′ to 3′ direction an operably linked recombinant, double-stranded DNA molecule, wherein the recombinant, double-stranded DNA molecule comprises
- (i) a promoter that functions in the plant cell;
- (ii) a nucleic acid molecule encoding the insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132; and
- (iii) a 3′ non-translated polynucleotide that functions in the cells of the plant to cause termination of transcription;
- (b) obtaining a transformed plant cell comprising the nucleic acid sequence of step (a); and
- (c) generating from the transformed plant cell a plant capable of expressing the insecticidal protein.
- (a) inserting into the plant cell a nucleic acid sequence comprising in the 5′ to 3′ direction an operably linked recombinant, double-stranded DNA molecule, wherein the recombinant, double-stranded DNA molecule comprises
- 145. A plant produced by the method of embodiment 144.
- 146. Seed or grain of the plant of embodiment 145.
- 147. The method of embodiment 144, wherein the plant further comprises one or more additional transgenic traits.
- 148. A plant capable of expressing a recombinant insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- 149. A method for controlling an insect pest population, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- 150. A method of inhibiting growth or killing an insect pest, comprising contacting the insect pest with a insecticidally-effective amount of a recombinant insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- 151. A method for controlling an insect pest population resistant to a pesticidal protein, comprising contacting the insect pest population with a pesticidally-effective amount of a recombinant protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- 152. A method for protecting a plant from an insect pest, comprising expressing in the plant or cell thereof a recombinant pesticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132.
- 153. A method of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and providing insect resistance management, comprising expressing in the plant at least two different insecticidal proteins having different modes of action, wherein one of the at least two insecticidal proteins comprises a insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132, insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- 154. The method of embodiment 153, wherein one of the at least two insecticidal proteins comprises a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- 155. A method of reducing likelihood of emergence of Lepidoptera and/or Hemiptera insect species resistance to transgenic plants expressing in the plants insecticidal proteins to control the insect species, comprising expressing a first insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132, insecticidal to the insect species in combination with a second insecticidal protein insecticidal to the insect species having a different mode of action compared to the first insecticidal protein.
- 156. A means for effective Lepidoptera and/or Hemiptera insect resistance management, comprising co-expressing at high levels in transgenic plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or killing activity, wherein one of the two or more insecticidal proteins comprise a insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132 and one of the two or more insecticidal proteins comprise a Cry protein.
- 157. A method for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera, comprising the step of referring to, submitting or relying on insect assay binding data showing that the insecticidal protein of embodiment 125, 126, 127, 128, 129, 130, 131 or 132 does not compete with binding sites for a Cry protein in the insects.
- 158. A method of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and providing insect resistance management, comprising expressing in the plant at least two different insecticidal proteins having different modes of action, wherein one of the at least two insecticidal proteins comprises the amino acid sequence of SEQ ID NO: 4, insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- 159. The method of embodiment 158, wherein one of the at least two insecticidal proteins comprises a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- 160. A method of reducing likelihood of emergence of Lepidoptera and/or Hemiptera insect species resistance to transgenic plants expressing in the plants insecticidal proteins to control the insect species, comprising expressing the insecticidal protein of SEQ ID NO: 4 insecticidal to the insect species in combination with an insecticidal protein insecticidal to the insect species having a different modes of action compared to the protein of SEQ ID NO: 4.
- 161. A means for effective Lepidoptera and/or Hemiptera insect resistance management, comprising co-expressing at high levels in transgenic plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or killing activity, wherein one of the two or more insecticidal proteins comprise the insecticidal protein of SEQ ID NO: 4 and one of the two or more insecticidal proteins comprise a Cry protein.
- 162. A method for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera, comprising the step of referring to, submitting or relying on insect assay binding data showing that the insecticidal protein of SEQ ID NO: 4 does not compete with binding sites for a Cry protein in the insects.
-
FIG. 1 shows the alignment of PIP-1A (SEQ ID NO: 2); the active insecticidal protein orthologs PSEEN3174 (SEQ ID NO: 6) and PIP-1B (SEQ ID NO: 4); and the inactive homologs AECFG_592740 (SEQ ID NO: 12); Pput_1063 (SEQ ID NO: 8); and Pput_1064 (SEQ ID NO: 10). The motifs [amino acids 64-79 of SEQ ID NO: 2 (motif 1), amino acids 149-159 of SEQ ID NO: 2 (motif 2), amino acids 171-183 of SEQ ID NO: 2 (motif 3), and amino acids 240-249 of SEQ ID NO: 2 (motif 4)] are indicated in bold and underline in the PIP-1A sequence. The predicted secondary structures of selected beta-sheets are indicated with “B” above the sequence. -
FIG. 2 illustrates a generalized sewing and rescuing PCR mutagenesis strategy using degenerate oligonucleotides to generate partially or fully saturated amino acid substitutions at positions in the PIP-1A protein. -
FIG. 3A-3C shows the alignment of Pseudomonaschlororaphis strain SS44C4 16S ribosomal DNA (SEQ ID NO: 216) andPseudomonas entomophila L48 16S ribosomal DNA (SEQ ID NO: 217) having 96.8% identity. Differences between the sequences are indicated in Bold and Underlined. -
FIG. 4 shows the results of the Lygus insecticidal activity screening of PIP-1A polypeptide variants having multiple amino acid substitutions at residues 240-249 of SEQ ID NO: 2 (motif 4). The insecticidal activity was scored from 0 to 8 with 8 being the most active. -
FIG. 5 shows the sequence alignment of PIP-1A (SEQ ID NO: 2), PIP-1B (SEQ ID NO: 4), PIP-1C (SEQ ID NO: 332) and PSEEN3174 (SEQ ID NO: 6). - It is to be understood that this invention is not limited to the particular methodology, protocols, cell lines, genera, and reagents described, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention.
- As used herein the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a plurality of such cells and reference to “the protein” includes reference to one or more proteins and equivalents thereof known to those skilled in the art, and so forth. All technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs unless clearly indicated otherwise.
- The present disclosure is drawn to compositions and methods for controlling pests. The methods involve transforming organisms with a nucleic acid sequence encoding a PIP-1 polypeptide. In particular, the nucleic acid sequences of the embodiments are useful for preparing plants and microorganisms that possess pesticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are pesticidal nucleic acids and proteins of bacterial species.
- The nucleic acid sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other homologous (or partially homologous) genes, and for the generation of altered PIP-1 polypeptides by methods known in the art, such as site directed mutagenesis, domain swapping or DNA shuffling. The PIP-1 polypeptides find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran, and nematode pest populations and for producing compositions with pesticidal activity. Insect pests of interest include, but are not limited to, the superfamily of stink bugs and other related insects including, but not limited to, species belonging to the family Pentatomidae (Nezara viridula, Halyomorpha halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare, Euschistus heros, Euschistus tristigmus, Acrosternum hilare, Dichelops furcatus, Dichelops melacanthus, and Bagrada hilaris (Bagrada Bug)), the family Plataspidae (Megacopta cribraria—Bean plataspid), and the family Cydnidae (Scaptocoris castanea—Root stink bug) and Lepidoptera species including but not limited to: diamond-back moth, e.g., Helicoverpa zea Boddie; soybean looper, e.g., Pseudoplusia includens Walker and velvet bean caterpillar e.g., Anticarsia gemmatalis Hübner.
- By “pesticidal toxin” or “pesticidal protein” is intended a toxin that has toxic activity against one or more pests, including, but not limited to, members of the Lepidoptera, Diptera, Hemiptera and Coleoptera orders or the Nematoda phylum or a protein that has homology to such a protein. Pesticidal proteins have been isolated from organisms including, for example, Bacillus sp., Pseudomonas sp., Photorhabdus sp., Xenorhabdus sp., Clostridium bifermentans and Paenibacillus popilliae. Pesticidal proteins include but are not limited to: insecticidal proteins from Pseudomonas sp. such as PSEEN3174 (Monalysin, (2011) PLoS Pathogens, 7:1-13), from Pseudomonas protegens strain CHAO and Pf-5 (previously fluorescens) (Pechy-Tarr, (2008) Environmental Microbiology 10:2368-2386: GenBank Accession No. EU400157); from Pseudomonas taiwanensis (Liu, et al., (2010) J. Agric. Food Chem. 58:12343-12349) and from Pseudomonas pseudoalcligenes (Zhang, et al., (2009) Annals of Microbiology 59:45-50 and Li, et al., (2007) Plant Cell Tiss. Organ Cult. 89:159-168); insecticidal proteins from Photorhabdus sp. and Xenorhabdus sp. (Hinchliffe, et al., (2010) The Open Toxinology Journal 3:101-118 and Morgan, et al., (2001) Applied and Envir. Micro. 67:2062-2069), U.S. Pat. Nos. 6,048,838, and 6,379,946; and 5-endotoxins including, but not limited to, the Cry1, Cry2, Cry3, Cry4, Cry5, Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12, Cry13, Cry14, Cry15, Cry16, Cry17, Cry18, Cry19, Cry20, Cry21, Cry22, Cry23, Cry24, Cry25, Cry26, Cry27, Cry 28, Cry 29, Cry 30, Cry31, Cry32, Cry33, Cry34, Cry35, Cry36, Cry37, Cry38, Cry39, Cry40, Cry41, Cry42, Cry43, Cry44, Cry45, Cry 46, Cry47, Cry49,
Cry 51 and Cry55 classes of 5-endotoxin genes and the B. thuringiensis cytolytic Cyt1 and Cyt2 genes. Members of these classes of B. thuringiensis insecticidal proteins include, but are not limited to Cry1Aa1 (Accession #Accession #M11250), Cry1Aa2 (Accession #M10917), Cry1Aa3 (Accession #D00348), Cry1Aa4 (Accession #X13535), Cry1Aa5 (Accession #D17518), Cry1Aa6 (Accession #U43605), Cry1Aa7 (Accession #AF081790), Cry1Aa8 (Accession #126149), Cry1Aa9 (Accession #AB026261), Cry1Aa10 (Accession #AF154676), Cry1Aa11 (Accession #Y09663), Cry1Aa12 (Accession #AF384211), Cry1Aa13 (Accession #AF510713), Cry1Aa14 (Accession #AY197341), Cry1Aa15 (Accession #DQ062690), Cry1Ab1 (Accession #M13898), Cry1Ab2 (Accession #M12661), Cry1Ab3 (Accession #M15271), Cry1Ab4 (Accession #D00117), Cry1Ab5 (Accession #X04698), Cry1Ab6 (Accession #M37263), Cry1Ab7 (Accession #X13233), Cry1Ab8 (Accession #M16463), Cry1Ab9 (Accession #X54939), Cry1Ab10 (Accession #A29125), Cry1Ab11 (Accession #112419), Cry1Ab12 (Accession #AF059670), Cry1Ab13 (Accession #AF254640), Cry1Ab14 (Accession #U94191), Cry1Ab15 (Accession #AF358861), Cry1Ab16 (Accession #AF375608), Cry1Ab17 (Accession #AAT46415), Cry1Ab18 (Accession #AAQ88259), Cry1Ab19 (Accession #AY847289), Cry1Ab20 (Accession #DQ241675), Cry1Ab21 (Accession #EF683163), Cry1Ab22 (Accession #ABW87320), Cry1Ab-like (Accession #AF327924), Cry1Ab-like (Accession #AF327925), Cry1Ab-like (Accession #AF327926), Cry1Ab-like (Accession #DQ781309), Cry1Ac1 (Accession #M11068), Cry1Ac2 (Accession #M35524), Cry1Ac3 (Accession #X54159), Cry1Ac4 (Accession #M73249), Cry1Ac5 (Accession #M73248), Cry1Ac6 (Accession #U43606), Cry1Ac7 (Accession #U87793), Cry1Ac8 (Accession #U87397), Cry1Ac9 (Accession #U89872), Cry1Ac10 (Accession #AJ002514), Cry1Ac11 (Accession #AJ130970), Cry1Ac12 (Accession #112418), Cry1Ac13 (Accession #AF148644), Cry1Ac14 (Accession #AF492767), Cry1Ac15 (Accession #AY122057), Cry1Ac16 (Accession #AY730621), Cry1Ac17 (Accession #AY925090), Cry1Ac18 (Accession #DQ023296), Cry1Ac19 (Accession #DQ195217), Cry1Ac20 (Accession #DQ285666), Cry1Ac21 (Accession #DQ062689), Cry1Ac22 (Accession #EU282379), Cry1Ac23 (Accession #AM949588), Cry1Ac24 (Accession #ABL01535), Cry1Ad1 (Accession #M73250), Cry1Ad2 (Accession #A27531), Cry1Ae1 (Accession #M65252), Cry1Af1 (Accession #U82003), Cry1Ag1 (Accession #AF081248), Cry1Ah1 (Accession #AF281866), Cry1Ah2 (Accession #DQ269474), Cry1Ai1 (Accession #AY174873), Cry1A-like (Accession #AF327927), Cry1Ba1 (Accession #X06711), Cry1Ba2 (Accession #X95704), Cry1Ba3 (Accession #AF368257), Cry1Ba4 (Accession #AF363025), Cry1 Ba5 (Accession #AB020894), Cry1Ba6 (Accession #ABL60921), Cry1Bb1 (Accession #L32020), Cry1Bc1 (Accession #Z46442), Cry1Bd1 (Accession #U70726), Cry1Bd2 (Accession #AY138457), Cry1Be1 (Accession #AF077326), Cry1 Be2 (Accession #AAQ52387), Cry1 Bf1 (Accession #AX189649), Cry1Bf2 (Accession #AAQ52380), Cry1Bg1 (Accession #AY176063), Cry1Ca1 (Accession #X07518), Cry1Ca2 (Accession #X13620), Cry1Ca3 (Accession #M73251), Cry1Ca4 (Accession #A27642), Cry1Ca5 (Accession #X96682), Cry1Ca6 [1](Accession #AF215647), Cry1Ca7 (Accession #AY015492), Cry1Ca8 (Accession #AF362020), Cry1Ca9 (Accession #AY078160), Cry1Ca10 (Accession #AF540014), Cry1Ca11 (Accession #AY955268), Cry1Cb1 (Accession #M97880), Cry1Cb2 (Accession #AY007686), Cry1Cb3 (Accession #EU679502), Cry1Cb-like (Accession #AAX63901), Cry1Da1 (Accession #X54160), Cry1Da2 (Accession #176415), Cry1db1 (Accession #Z22511), Cry1db2 (Accession #AF358862), Cry1Dc1 (Accession #EF059913), Cry1Ea1 (Accession #X53985), Cry1Ea2 (Accession #X56144), Cry1Ea3 (Accession #M73252), Cry1Ea4 (Accession #U94323), Cry1Ea5 (Accession #A15535), Cry1Ea6 (Accession #AF202531), Cry1Ea7 (Accession #AAW72936), Cry1Ea8 (Accession #ABX11258), Cry1Eb1 (Accession #M73253), Cry1Fa1 (Accession #M63897), Cry1Fa2 (Accession #M73254), Cry1Fb1 (Accession #Z22512), Cry1Fb2 (Accession #AB012288), Cry1Fb3 (Accession #AF062350), Cry1Fb4 (Accession #173895), Cry1Fb5 (Accession #AF336114), Cry1Fb6 (Accession #EU679500), Cry1Fb7 (Accession #EU679501), Cry1Ga1 (Accession #Z22510), Cry1Ga2 (Accession #Y09326), Cry1Gb1 (Accession #U70725), Cry1Gb2 (Accession #AF288683), Cry1Gc (Accession #AAQ52381), Cry1Ha1 (Accession #Z22513), Cry1Hb1 (Accession #U35780), Cry1H-like (Accession #AF182196), Cry11a1 (Accession #X62821), Cry11a2 (Accession #M98544), Cry11a3 (Accession #L36338), Cry11a4 (Accession #L49391), Cry11a5 (Accession #Y08920), Cry11a6 (Accession #AF076953), Cry11a7 (Accession #AF278797), Cry11a8 (Accession #AF373207), Cry11a9 (Accession #AF521013), Cry11a10 (Accession #AY262167), Cry11a11 (Accession #AJ315121), Cry11a12 (Accession #AAV53390), Cry11a13 (Accession #ABF83202), Cry11a14 (Accession #EU887515), Cry11b1 (Accession #U07642), Cry11b2 (Accession #ABW88019), Cry11b3 (Accession #EU677422), Cry11c1 (Accession #AF056933), Cry11c2 (Accession #AAE71691), Cry11d1 (Accession #AF047579), CryIle1 (Accession #AF211190), Cry11f1 (Accession #AAQ52382), Cry11-like (Accession #190732), Cry11-like (Accession #DQ781310), Cry1Ja1 (Accession #L32019), Cry1Jb1 (Accession #U31527), Cry1Jc1 (Accession #190730), Cry1Jc2 (Accession #AAQ52372), Cry1Jd1 (Accession #AX189651), Cry1Ka1 (Accession #U28801), Cry1La1 (Accession #AAS60191), Cry1-like (Accession #190729), Cry2Aa1 (Accession #M31738), Cry2Aa2 (Accession #M23723), Cry2Aa3 (Accession #D86064), Cry2Aa4 (Accession #AF047038), Cry2Aa5 (Accession #AJ132464), Cry2Aa6 (Accession #AJ132465), Cry2Aa7 (Accession #AJ132463), Cry2Aa8 (Accession #AF252262), Cry2Aa9 (Accession #AF273218), Cry2Aa10 (Accession #AF433645), Cry2Aa11 (Accession #AAQ52384), Cry2Aa12 (Accession #DQ977646), Cry2Aa13 (Accession #ABL01536), Cry2Aa14 (Accession #ACF04939), Cry2Ab1 (Accession #M23724), Cry2Ab2 (Accession #X55416), Cry2Ab3 (Accession #AF164666), Cry2Ab4 (Accession #AF336115), Cry2Ab5 (Accession #AF441855), Cry2Ab6 (Accession #AY297091), Cry2Ab7 (Accession #DQ119823), Cry2Ab8 (Accession #DQ361266), Cry2Ab9 (Accession #DQ341378), Cry2Ab10 (Accession #EF157306), Cry2Ab11 (Accession #AM691748), Cry2Ab12 (Accession #ABM21764), Cry2Ab13 (Accession #EU909454), Cry2Ab14 (Accession #EU909455), Cry2Ac1 (Accession #X57252), Cry2Ac2 (Accession #AY007687), Cry2Ac3 (Accession #AAQ52385), Cry2Ac4 (Accession #DQ361267), Cry2Ac5 (Accession #DQ341379), Cry2Ac6 (Accession #DQ359137), Cry2Ac7 (Accession #AM292031), Cry2Ac8 (Accession #AM421903), Cry2Ac9 (Accession #AM421904), Cry2Ac10 (Accession #BI 877475), Cry2Ac11 (Accession #AM689531), Cry2Ac12 (Accession #AM689532), Cry2Ad1 (Accession #AF200816), Cry2Ad2 (Accession #DQ358053), Cry2Ad3 (Accession #AM268418), Cry2Ad4 (Accession #AM490199), Cry2Ad5 (Accession #AM765844), Cry2Ae1 (Accession #AAQ52362), Cry2Af1 (Accession #EF439818), Cry2Ag (Accession #ACH91610), Cry2Ah (Accession #EU939453), Cry3Aa1 (Accession #M22472), Cry3Aa2 (Accession #J02978), Cry3Aa3 (Accession #Y00420), Cry3Aa4 (Accession #M30503), Cry3Aa5 (Accession #M37207), Cry3Aa6 (Accession #U10985), Cry3Aa7 (Accession #AJ237900), Cry3Aa8 (Accession #AAS79487), Cry3Aa9 (Accession #AAW05659), Cry3Aa10 (Accession #AAU29411), Cry3Aa11 (Accession #AY882576), Cry3Aa12 (Accession #ABY49136), Cry3Ba1 (Accession #X17123), Cry3Ba2 (Accession #A07234), Cry3Bb1 (Accession #M89794), Cry3Bb2 (Accession #U31633), Cry3Bb3 (Accession #115475), Cry3Ca1 (Accession #X59797), Cry4Aa1 (Accession #Y00423), Cry4Aa2 (Accession #D00248), Cry4Aa3 (Accession #AL731825), Cry4A-like (Accession #DQ078744), Cry4Ba1 (Accession #X07423), Cry4Ba2 (Accession #X07082), Cry4Ba3 (Accession #M20242), Cry4Ba4 (Accession #D00247), Cry4Ba5 (Accession #AL731825), Cry4Ba-like (Accession #ABC47686), Cry4Ca1 (Accession #EU646202), Cry5Aa1 (Accession #L07025), Cry5Ab1 (Accession #L07026), Cry5Ac1 (Accession #134543), Cry5Ad1 (Accession #EF219060), Cry5Ba1 (Accession #U19725), Cry5Ba2 (Accession #EU121522), Cry6Aa1 (Accession #L07022), Cry6Aa2 (Accession #AF499736), Cry6Aa3 (Accession #DQ835612), Cry6Ba1 (Accession #L07024), Cry7Aa1 (Accession #M64478), Cry7Ab1 (Accession #U04367), Cry7Ab2 (Accession #U04368), Cry7Ab3 (Accession #BI 1015188), Cry7Ab4 (Accession #EU380678), Cry7Ab5 (Accession #ABX79555), Cry7Ab6 (Accession #FJ194973), Cry7Ba1 (Accession #ABB70817), Cry7Ca1 (Accession #EF486523), Cry8Aa1 (Accession #U04364), Cry8Ab1 (Accession #EU044830), Cry8Ba1 (Accession #U04365), Cry8Bb1 (Accession #AX543924), Cry8Bc1 (Accession #AX543926), Cry8Ca1 (Accession #U04366), Cry8Ca2 (Accession #AAR98783), Cry8Ca3 (Accession #EU625349), Cry8Da1 (Accession #AB089299), Cry8Da2 (Accession #BD133574), Cry8Da3 (Accession #BD133575), Cry8db1 (Accession #AB303980), Cry8Ea1 (Accession #AY329081), Cry8Ea2 (Accession #EU047597), Cry8Fa1 (Accession #AY551093), Cry8Ga1 (Accession #AY590188), Cry8Ga2 (Accession #DQ318860), Cry8Ga3 (Accession #FJ198072), Cry8Ha1 (Accession #EF465532), Cry8Ia1 (Accession #EU381044), Cry8Ja1 (Accession #EU625348), Cry8 like (Accession #ABS53003), Cry9Aa1 (Accession #X58120), Cry9Aa2 (Accession #X58534), Cry9Aa like (Accession #AAQ52376), Cry9Ba1 (Accession #X75019), Cry9Bb1 (Accession #AY758316), Cry9Ca1 (Accession #Z37527), Cry9Ca2 (Accession #AAQ52375), Cry9Da1 (Accession #D85560), Cry9Da2 (Accession #AF042733), Cry9db1 (Accession #AY971349), Cry9Ea1 (Accession #AB011496), Cry9Ea2 (Accession #AF358863), Cry9Ea3 (Accession #EF157307), Cry9Ea4 (Accession #EU760456), Cry9Ea5 (Accession #EU789519), Cry9Ea6 (Accession #EU887516), Cry9Eb1 (Accession #AX189653), Cry9Ec1 (Accession #AF093107), Cry9Ed1 (Accession #AY973867), Cry9 like (Accession #AF093107), Cry10Aa1 (Accession #M12662), Cry10Aa2 (Accession #E00614), Cry10Aa3 (Accession #AL731825), Cry10A like (Accession #DQ167578), Cry11Aa1 (Accession #M31737), Cry11Aa2 (Accession #M22860), Cry11Aa3 (Accession #AL731825), Cry11Aa-like (Accession #DQ166531), Cry11Ba1 (Accession #X86902), Cry11Bb1 (Accession #AF017416), Cry12Aa1 (Accession #L07027), Cry13Aa1 (Accession #L07023), Cry14Aa1 (Accession #U13955), Cry15Aa1 (Accession #M76442), Cry16Aa1 (Accession #X94146), Cry17Aa1 (Accession #X99478), Cry18Aa1 (Accession #X99049), Cry18Ba1 (Accession #AF169250), Cry18Ca1 (Accession #AF169251), Cry19Aa1 (Accession #Y07603), Cry19Ba1 (Accession #D88381), Cry20Aa1 (Accession #U82518), Cry21Aa1 (Accession #132932), Cry21Aa2 (Accession #166477), Cry21 Ba1 (Accession #AB088406), Cry22Aa1 (Accession #134547), Cry22Aa2 (Accession #AX472772), Cry22Aa3 (Accession #EU715020), Cry22Ab1 (Accession #AAK50456), Cry22Ab2 (Accession #AX472764), Cry22Ba1 (Accession #AX472770), Cry23Aa1 (Accession #AAF76375), Cry24Aa1 (Accession #U88188), Cry24Ba1 (Accession #BAD32657), Cry24Ca1 (Accession #AM158318), Cry25Aa1 (Accession #U88189), Cry26Aa1 (Accession #AF122897), Cry27Aa1 (Accession #AB023293), Cry28Aa1 (Accession #AF132928), Cry28Aa2 (Accession #AF285775), Cry29Aa1 (Accession #AJ251977), Cry30Aa1 (Accession #AJ251978), Cry30Ba1 (Accession #BAD00052), Cry30Ca1 (Accession #BAD67157), Cry30Da1 (Accession #EF095955), Cry30db1 (Accession #BAE80088), Cry30Ea1 (Accession #EU503140), Cry30Fa1 (Accession #EU751609), Cry30Ga1 (Accession #EU882064), Cry31Aa1 (Accession #AB031065), Cry31Aa2 (Accession #AY081052), Cry31Aa3 (Accession #AB250922), Cry31Aa4 (Accession #AB274826), Cry31Aa5 (Accession #AB274827), Cry31Ab1 (Accession #AB250923), Cry31Ab2 (Accession #AB274825), Cry31Ac1 (Accession #AB276125), Cry32Aa1 (Accession #AY008143), Cry32Ba1 (Accession #BAB78601), Cry32Ca1 (Accession #BAB78602), Cry32Da1 (Accession #BAB78603), Cry33Aa1 (Accession #AAL26871), Cry34Aa1 (Accession #AAG50341), Cry34Aa2 (Accession #AAK64560), Cry34Aa3 (Accession #AY536899), Cry34Aa4 (Accession #AY536897), Cry34Ab1 (Accession #AAG41671), Cry34Ac1 (Accession #AAG50118), Cry34Ac2 (Accession #AAK64562), Cry34Ac3 (Accession #AY536896), Cry34Ba1 (Accession #AAK64565), Cry34Ba2 (Accession #AY536900), Cry34Ba3 (Accession #AY536898), Cry35Aa1 (Accession #AAG50342), Cry35Aa2 (Accession #AAK64561), Cry35Aa3 (Accession #AY536895), Cry35Aa4 (Accession #AY536892), Cry35Ab1 (Accession #AAG41672), Cry35Ab2 (Accession #AAK64563), Cry35Ab3 (Accession #AY536891), Cry35Ac1 (Accession #AAG50117), Cry35Ba1 (Accession #AAK64566), Cry35Ba2 (Accession #AY536894), Cry35Ba3 (Accession #AY536893), Cry36Aa1 (Accession #AAK64558), Cry37Aa1 (Accession #AAF76376), Cry38Aa1 (Accession #AAK64559), Cry39Aa1 (Accession #BAB72016), Cry40Aa1 (Accession #BAB72018), Cry40Ba1 (Accession #BAC77648), Cry40Ca1 (Accession #EU381045), Cry40Da1 (Accession #EU596478), Cry41Aa1 (Accession #AB116649), Cry41Ab1 (Accession #AB116651), Cry42Aa1 (Accession #AB116652), Cry43Aa1 (Accession #AB115422), Cry43Aa2 (Accession #AB176668), Cry43Ba1 (Accession #AB115422), Cry43-like (Accession #AB1115422), Cry44Aa (Accession #BAD08532), Cry45Aa (Accession #BAD22577), Cry46Aa (Accession #BAC79010), Cry46Aa2 (Accession #BAG68906), Cry46Ab (Accession #BAD35170), Cry47Aa (Accession #AY950229), Cry48Aa (Accession #AJ841948), Cry48Aa2 (Accession #AM237205), Cry48Aa3 (Accession #AM237206), Cry48Ab (Accession #AM237207), Cry48Ab2 (Accession #AM237208), Cry49Aa (Accession #AJ841948), Cry49Aa2 (Accession #AM237201), Cry49Aa3 (Accession #AM237203), Cry49Aa4 (Accession #AM237204), Cry49Ab1 (Accession #AM237202), Cry50Aa1 (Accession #AB253419), Cry51Aa1 (Accession #DQ836184), Cry52Aa1 (Accession #EF613489), Cry53Aa1 (Accession #EF633476), Cry54Aa1 (Accession #EU339367), Cry55Aa1 (Accession #EU121521), Cry55Aa2 (Accession #AAE33526). - Examples of δ-endotoxins also include but are not limited to Cry1A proteins of U.S. Pat. Nos. 5,880,275 and 7,858,849; a DIG-3 or DIG-11 toxin (N-terminal deletion of α-
helix 1 and/or α-helix 2 variants of Cry proteins such as Cry1A) of U.S. Pat. Nos. 8,304,604 and 8,304,605, Cry1B of U.S. patent application Ser. No. 10/525,318; Cry1C of U.S. Pat. No. 6,033,874; Cry1F of U.S. Pat. Nos. 5,188,960, 6,218,188; Cry1A/F chimeras of U.S. Pat. Nos. 7,070,982; 6,962,705 and 6,713,063); a Cry2 protein such as Cry2Ab protein of U.S. Pat. No. 7,064,249); a Cry3A protein including but not limited to an engineered hybrid insecticidal protein (eHIP) created by fusing unique combinations of variable regions and conserved blocks of at least two different Cry proteins (US Patent Application Publication Number 2010/0017914); a Cry4 protein; a Cry5 protein; a Cry6 protein; Cry8 proteins of U.S. Pat. Nos. 7,329,736, 7,449,552, 7,803,943, 7,476,781, 7,105,332, 7,378,499 and 7,462,760; a Cry9 protein such as such as members of the Cry9A, Cry9B, Cry9C, Cry9D, Cry9E, and Cry9F families; a Cry15 protein of Naimov, et al., (2008) Applied and Environmental Microbiology 74:7145-7151; a Cry22, a Cry34Ab1 protein of U.S. Pat. Nos. 6,127,180, 6,624,145 and 6,340,593; a CryET33 and CryET34 protein of U.S. Pat. Nos. 6,248,535, 6,326,351, 6,399,330, 6,949,626, 7,385,107 and 7,504,229; a CryET33 and CryET34 homologs of US Patent Publication Number 2006/0191034, 2012/0278954, and PCT Publication Number WO 2012/139004; a Cry35Ab1 protein of U.S. Pat. Nos. 6,083,499, 6,548,291 and 6,340,593; a Cry46 protein, aCry 51 protein, a Cry binary toxin; a TIC901 or related toxin; TIC807 of US 2008/0295207; ET29, ET37, TIC809, TIC810, TIC812, TIC127, TIC128 of PCT US 2006/033867; AXMI-027, AXMI-036, and AXMI-038 of U.S. Pat. No. 8,236,757; AXMI-031, AXMI-039, AXMI-040, AXMI-049 of U.S. Pat. No. 7,923,602; AXMI-018, AXMI-020, and AXMI-021 of WO 2006/083891; AXMI-010 of WO 2005/038032; AXMI-003 of WO 2005/021585; AXMI-008 of US 2004/0250311; AXMI-006 of US 2004/0216186; AXMI-007 of US 2004/0210965; AXMI-009 of US 2004/0210964; AXMI-014 of US 2004/0197917; AXMI-004 of US 2004/0197916; AXMI-028 and AXMI-029 of WO 2006/119457; AXMI-007, AXMI-008, AXMI-0080rf2, AXMI-009, AXMI-014 and AXMI-004 of WO 2004/074462; AXMI-150 of U.S. Pat. No. 8,084,416; AXMI-205 of US20110023184; AXMI-011, AXMI-012, AXMI-013, AXMI-015, AXMI-019, AXMI-044, AXMI-037, AXMI-043, AXMI-033, AXMI-034, AXMI-022, AXMI-023, AXMI-041, AXMI-063, and AXMI-064 of US 2011/0263488; AXMI-R1 and related proteins of US 2010/0197592; AXM1221Z, AXM1222z, AXM1223z, AXM1224z and AXM1225z of WO 2011/103248; AXM1218, AXM1219, AXM1220, AXM1226, AXM1227, AXM1228, AXM1229, AXM1230, and AXM1231 of WO11/103247; AXMI-115, AXMI-113, AXMI-005, AXMI-163 and AXMI-184 of U.S. Pat. No. 8,334,431; AXMI-001, AXMI-002, AXMI-030, AXMI-035, and AXMI-045 of US 2010/0298211; AXMI-066 and AXMI-076 of US20090144852; AXM1128, AXM1130, AXM1131, AXM1133, AXM1140, AXM1141, AXM1142, AXM1143, AXM1144, AXM1146, AXM1148, AXM1149, AXM1152, AXM1153, AXM1154, AXM1155, AXM1156, AXM1157, AXM1158, AXM1162, AXM1165, AXM1166, AXM1167, AXM1168, AXM1169, AXM1170, AXM1171, AXM1172, AXM1173, AXM1174, AXM1175, AXM1176, AXM1177, AXM1178, AXM1179, AXM1180, AXM1181, AXM1182, AXM1185, AXM1186, AXM1187, AXM1188, AXM1189 of U.S. Pat. No. 8,318,900; AXM1079, AXM1080, AXM1081, AXM1082, AXM1091, AXM1092, AXM1096, AXM1097, AXM1098, AXM1099, AXM1100, AXM1101, AXM1102, AXM1103, AXM1104, AXM1107, AXM1108, AXM1109, AXM1110, AXM1111, AXM1112, AXM1114, AXM1116, AXM1117, AXM1118, AXM1119, AXM1120, AXM1121, AXM1122, AXM1123, AXM1124, AXM11257, AXM11268, AXM1127, AXM1129, AXM1164, AXM1151, AXM1161, AXM1183, AXM1132, AXM1138, AXM1137 of US 2010/0005543; Cry proteins such as Cry1A and Cry3A having modified proteolytic sites of U.S. Pat. No. 8,319,019; and a Cry1Ac, Cry2Aa and Cry1Ca toxin protein from Bacillus thuringiensis strain VBTS 2528 of US Patent Application Publication Number 2011/0064710. Other Cry proteins are well known to one skilled in the art (see, Crickmore, et al., “Bacillus thuringiensis toxin nomenclature” (2011), at lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/ which can be accessed on the world-wide web using the “www” prefix). The insecticidal activity of Cry proteins is well known to one skilled in the art (for review, see, van Frannkenhuyzen, (2009) J. Invert. Path. 101:1-16). The use of Cry proteins as transgenic plant traits is well known to one skilled in the art and Cry-transgenic plants including but not limited to Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105, Cry1F, Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, mCry3A, Cry9c and CBI-Bt have received regulatory approval (see, Sanahuja, (2011) Plant Biotech Journal 9:283-300 and the CERA (2010) GM Crop Database Center for Environmental Risk Assessment (CERA), ILSI Research Foundation, Washington D.C. at cera-gmc.org/index.php?action=gm_crop_database which can be accessed on the world-wide web using the “www” prefix). More than one pesticidal proteins well known to one skilled in the art can also be expressed in plants such as Vip3Ab & Cry1Fa (US2012/0317682), Cry1BE & Cry1F (US2012/0311746), Cry1CA & Cry1AB (US2012/0311745), Cry1F & CryCa (US2012/0317681), Cry1DA & Cry1BE (US2012/0331590), Cry1DA & Cry1Fa (US2012/0331589), Cry1AB & Cry1BE (US2012/0324606), and Cry1Fa & Cry2Aa, Cry1I or Cry1E (US2012/0324605). Pesticidal proteins also include insecticidal lipases including lipid acyl hydrolases of U.S. Pat. No. 7,491,869, and cholesterol oxidases such as from Streptomyces (Purcell et al. (1993) Biochem Biophys Res Commun 15:1406-1413). Pesticidal proteins also include VIP (vegetative insecticidal proteins) toxins of U.S. Pat. Nos. 5,877,012, 6,107,279, 6,137,033, 7,244,820, 7,615,686, and 8,237,020, and the like. Other VIP proteins are well known to one skilled in the art (see, lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html which can be accessed on the world-wide web using the “www” prefix). Pesticidal proteins also include toxin complex (TC) proteins, obtainable from organisms such as Xenorhabdus, Photorhabdus and Paenibacillus (see, U.S. Pat. Nos. 7,491,698 and 8,084,418). Some TC proteins have “stand alone” insecticidal activity and other TC proteins enhance the activity of the stand-alone toxins produced by the same given organism. The toxicity of a “stand-alone” TC protein (from Photorhabdus, Xenorhabdus or Paenibacillus, for example) can be enhanced by one or more TC protein “potentiators” derived from a source organism of a different genus. There are three main types of TC proteins. As referred to herein, Class A proteins (“Protein A”) are stand-alone toxins. Class B proteins (“Protein B”) and Class C proteins (“Protein C”) enhance the toxicity of Class A proteins. Examples of Class A proteins are TcbA, TcdA, XptA1 and XptA2. Examples of Class B proteins are TcaC, TcdB, XptB1Xb and XptC1Wi. Examples of Class C proteins are TccC, XptC1Xb and XptB1Wi. Pesticidal proteins also include spider, snake and scorpion venom proteins. Examples of spider venom peptides include but are not limited to lycotoxin-1 peptides and mutants thereof (U.S. Pat. No. 8,334,366). - In some embodiments the PIP-1 polypeptides include amino acid sequences deduced from the full-length nucleic acid sequences disclosed herein, and amino acid sequences that are shorter than the full-length sequences, either due to the use of an alternate downstream start site or due to processing that produces a shorter protein having pesticidal activity. Processing may occur in the organism after the protein is expressed in or in the pest after ingestion of the protein.
- Thus, provided herein are novel isolated or recombinant nucleic acid sequences encoding polypeptides that confer pesticidal activity. Also provided are the amino acid sequences of PIP-1 polypeptides. The protein resulting from translation of these PIP-1 polypeptide genes allows cells to control or kill pests that ingest it.
- One aspect of the invention pertains to bacterial strains that are capable of expressing a PIP-1 polypeptide. In some embodiments the bacterial strain is a Pseudomonas chlororaphis strain. In some embodiments the bacterial strain is a biologically pure culture of a Pseudomonas chlororaphis strain SS44C4, deposited on Dec. 1, 2011 under Accession Number NRRLB-50613 with the Agricultural Research Service Culture Collection (NRRL). In some embodiments the bacterial strain is a biologically pure culture of a Pseudomonas chlororaphis strain having a 16S ribosomal DNA having at least about 96.9%, 97%, 97.1%, 97.2%, 97.3%. 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity compared to SEQ ID NO: 216.
- Another aspect of the invention pertains to isolated or recombinant nucleic acid molecules comprising nucleic acid sequences encoding PIP-1 polypeptides and polypeptides or biologically active portions thereof, as well as nucleic acid molecules sufficient for use as hybridization probes to identify nucleic acid molecules encoding proteins with regions of sequence homology. As used herein, the term “nucleic acid molecule” is intended to include DNA molecules (e.g., recombinant DNA, cDNA, genomic DNA, plastid DNA, mitochondrial DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA.
- An “isolated” or “recombinant” nucleic acid molecule (or DNA) is used herein to refer to a nucleic acid sequence (or DNA) that is no longer in its natural environment, for example in an in vitro or in a recombinant bacterial or plant host cell. In some embodiments, an “isolated” or “recombinant” nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5′ and 3′ ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For purposes of the disclosure, “isolated” or “recombinant” when used to refer to nucleic acid molecules excludes isolated chromosomes. For example, in various embodiments, the recombinant nucleic acid molecule encoding a PIP-1 polypeptide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleic acid sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
- A variety of polynucleotides that encode PIP-1 polypeptides or related proteins are contemplated. Such polynucleotides are useful for production of PIP-1 polypeptides in host cells when operably linked to suitable promoter, transcription termination and/or polyadenylation sequences. Such polynucleotides are also useful as probes for isolating homologous or substantially homologous polynucleotides that encode PIP-1 polypeptides or related proteins.
- One source of polynucleotides that encode PIP-1 polypeptides or related proteins is a Pseudomonas chlororaphis strain which contains the PIP-1A polynucleotide of SEQ ID NO: 1 encoding the PIP-1A polypeptide of SEQ ID NO: 2. This polynucleotide sequence was isolated from a Pseudomonas chlororaphis host and is thus suitable for expression of the encoded PIP-1A polypeptide in other bacterial hosts. For example, SEQ ID NO: 1 can be used to express the PIP-1A protein in bacterial hosts that include but are not limited to an Agrobacterium, an Alcaligenes, a Bacillus, an Escherichia, a Salmonella, a Pseudomonas and a Rhizobium bacterial host cells. The polynucleotides are also useful as probes for isolating homologous or substantially homologous polynucleotides that encode PIP-1 polypeptides or related proteins. Such probes can be used to identify homologous or substantially homologous polynucleotides derived from Pseudomonas or other bacterial strains.
- Polynucleotides that encode a PIP-1 polypeptide can also be synthesized de novo from a PIP-1 polypeptide sequence. The sequence of the polynucleotide gene can be deduced from a PIP-1A polypeptide sequence through use of the genetic code. Computer programs such as “BackTranslate” (GCG™ Package, Acclerys, Inc. San Diego, Calif.) can be used to convert a peptide sequence to the corresponding nucleotide sequence encoding the peptide. Examples of PIP-1 polypeptide sequences that can be used to obtain corresponding nucleotide encoding sequences include, but are not limited to, the PIP-1 polypeptide sequence of SEQ ID NO: 2. Furthermore, synthetic PIP-1A polynucleotide sequences of the invention can be designed so that they will be expressed in plants. U.S. Pat. No. 5,500,365 describes a method for synthesizing plant genes to improve the expression level of the protein encoded by the synthesized gene. This method relates to the modification of the structural gene sequences of the exogenous transgene, to cause them to be more efficiently transcribed, processed, translated and expressed by the plant. Features of genes that are expressed well in plants include elimination of sequences that can cause undesired intron splicing or polyadenylation in the coding region of a gene transcript while retaining substantially the amino acid sequence of the toxic portion of the insecticidal protein. A similar method for obtaining enhanced expression of transgenes in monocotyledonous plants is disclosed in U.S. Pat. No. 5,689,052.
- In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having the sequence set forth in SEQ ID NO: 1, 3 or 331 and variants, fragments and complements thereof. By “complement” is intended a nucleic acid sequence that is sufficiently complementary to a given nucleic acid sequence such that it can hybridize to the given nucleic acid sequence to thereby form a stable duplex. In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a nucleic acid molecule having the sequence set forth in SEQ ID NO: 1, 3 or 331. The corresponding amino acid sequences for the insecticidal protein encoded by these nucleic acid sequences are set forth in SEQ ID NO: 2, 4 and 332.
- In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO:4 or SEQ ID NO: 332, wherein the polypeptide has pesticidal activity.
- In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 2, wherein the polypeptide has pesticidal activity. In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 4, wherein the polypeptide has pesticidal activity. In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 332, wherein the polypeptide has pesticidal activity.
- In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence of (SEQ ID NO: 211), wherein Xaa at position 2 is Pro or Thr; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly or Asp; Xaa at position 49 is Phe or Tyr; Xaa at position 53 is Ser or Gly; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala or Ser; Xaa at position 63 is Gln or Lys; Xaa at position 77 is Phe or Tyr; Xaa at position 97 is Met or Val; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr or lie; Xaa at position 108 is Gln or Thr; Xaa at position 110 is Arg or Leu; Xaa at position 120 is Lys, Arg or Gln; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr or Glu; Xaa at position 125 is Asn or Ser; Xaa at position 127 is Ser, Asn, Thr or Lys; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn or Lys; Xaa at position 137 is Asp or Gly; Xaa at position 141 is Val or lie; Xaa at position 142 is Gly or Asp; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr or Val; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg or Ser; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp or Glu; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln or Glu; Xaa at position 167 is Leu or Met; Xaa at position 168 is Thr, Lys or Ala; Xaa at position 174 is lie, Val or Met; Xaa at position 175 is Val or lie; Xaa at position 180 is Met or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 200 is Asn or Ser; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr or Ala; Xaa at position 206 is Gly or Asp; Xaa at position 209 is Leu or Val; Xaa at position 220 is Asn or Arg; Xaa at position 221 is Ser or Lys; Xaa at position 222 is Thr or Arg; Xaa at position 226 is Asp, Pro or Glu; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys or Asn; Xaa at position 231 is lie or Val; Xaa at position 232 is Ala, Thr or Glu; and Xaa at position 251 is Gly, Ser or Glu; Xaa at position 254 is Ser or Asn; Xaa at position 258 is Ser or Arg; Xaa at position 265 is Asn or Asp; and Xaa at position 266 is Asp or Asn; and wherein, 1 to 28 amino acids are optionally deleted from the N-terminus of the polypeptide.
- In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence of a sequence of SEQ ID NO: 212, wherein Xaa at position 2 is Pro or Thr; Xaa at position 3 is lie or Thr; Xaa at position 6 is Glu or Gly; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 43 is Pro, Met, Gly, Gln, Ser, Thr, Arg, Val, Leu, Lys, Asp, Ala, Asn, Phe, Trp, Glu or Cys; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly or Asp; Xaa at position 49 is Phe, Tyr or Leu; Xaa at position 53 is Ser or Gly; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala or Ser; Xaa at position 63 is Gln or Lys; Xaa at position 66 is Trp, Tyr, Phe, Arg, Lys, His, Ile, Val or Ser; Xaa at position 77 is Phe or Tyr; Xaa at position 89 is Pro, Leu, Gly, Arg, Thr, Ser, Met, Ala, Ile, Asn, Val, Cys or Lys; Xaa at position 93 is Tyr, Cys, Trp, Val, Asp, Asn, Ile, Leu, Met, Phe, Ala or Thr; Xaa at position 97 is Met or Val; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr or lie; Xaa at position 108 is Gln or Thr; Xaa at position 110 is Arg or Leu; Xaa at position 120 is Lys, Arg or Gln; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr or Glu; Xaa at position 125 is Asn or Ser; Xaa at position 127 is Ser, Asn, Thr or Lys; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn or Lys; Xaa at position 137 is Asp or Gly; Xaa at position 141 is Val or lie; Xaa at position 142 is Gly or Asp; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr or Val; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg or Ser; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp or Glu; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln or Glu; Xaa at position 167 is Leu or Met; Xaa at position 168 is Thr, Lys or Ala; Xaa at position 171 is Gly, Leu, Gln, Met, Cys, Asn, Asp, Ser or Ala; Xaa at position 172 is Thr, Gly, His, Phe, Glu, Arg, Ser, Asn, Ile, Trp, Lys, Gln, Cys, Val, Ala or Met; Xaa at position 173 is Phe, Gly, His, Leu, Ala, Arg, Asn, Cys, Lys, Trp, Thr, Ser, Tyr or Met; Xaa at position 174 is lie, Val, Gly, Arg, Asn, Ala, Gln, Met, Cys, Leu, Phe, Tyr, Lys, Glu, Ser, His or Thr; Xaa at position 175 is Val, Ile, Ala, Cys, Glu, Lys, Leu or Met; Xaa at position 176 is Tyr, Met, Phe, Leu or Cys; Xaa at position 177 is Gln, Ile, Met or Pro; Xaa at position 178 is Val, Cys, Thr, Pro, Ala, Met, Gln, Phe, Ile, Ser or Lys; Xaa at position 179 is Val, Phe, Thr, Ile, Cys, Leu, Met, Ser, Ala or Gln; Xaa at position 180 is Met, Leu, Pro, Trp, Asn, Tyr, Gly, Gln, Ala, Val, Phe, Ile, Cys or Ser; Xaa at position 181 is Val, Ala, Leu, Trp, Cys, Thr, Ile or Lys; Xaa at position 182 is Tyr, Phe, Met or His; Xaa at position 183 is Ala, Met, Val, Thr, Asp, Gly, Cys, Ile, Phe, Ser, Gln or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 195 is Asn or Tyr; Xaa at position 200 is Asn or Ser; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr or Ala; Xaa at position 206 is Gly or Asp; Xaa at position 209 is Leu or Val; Xaa at position 213 is Tyr or Phe; Xaa at position 220 is Asn or Arg; Xaa at position 221 is Ser or Lys; Xaa at position 222 is Thr or Arg; Xaa at position 226 is Asp, Pro or Glu; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys or Asn; Xaa at position 231 is lie or Val; Xaa at position 232 is Ala, Thr or Glu; Xaa at position 240 is Gln, Arg, Ala, Val, Glu, Met, Gly, Asp, Trp, Asn, Thr, Ile, Ser, Phe, His, Cys or Leu; Xaa at position 241 is Arg, Lys, Glu, Gln, Ser, Ile, Val, Asp, Tyr, Met, Asn, His, Pro, Gly, Leu, Phe, Thr, Ala or Cys; Xaa at position 242 is Asn, Ala, Arg, Lys, His, Ser, Cys, Glu, Pro, Trp, Gln, Thr, Phe, Tyr, Met, Asp, Gly, Leu or Val; Xaa at position 243 is Val, Leu, Ala, Thr, Gly, Cys, Ile, Ser or Met; Xaa at position 244 is Leu, Val, Phe, Ile, Met, Gln, Cys, Trp or Ala; Xaa at position 245 is Met, Ala, Arg, Asp, Glu, Leu, Pro, Ser, Trp, Gly, Val, Lys, Phe, Cys, Thr, His, Ile, Gln, Tyr or Asn; Xaa at position 246 is Glu, Asp, Tyr, Gly, Arg, Val, Ala, Trp, Gln, Ser, Asn, Ile Leu, Met, Cys, Pro, His, Phe, Thr or Lys; Xaa at position 247 is Asn, Leu, Asp, Tyr, Ala, Phe, His, Arg, Lys, Gln, Gly, Val, Ile, Ser, Glu, Pro, Met, Trp, Thr or Cys; Xaa at position 248 is Tyr, Val, Thr, Glu, Phe, Ser, His, Cys, Leu, Trp, Ile, Asp, Gly or Ala; Xaa at position 249 is Asn, Lys, Val, Gly, Met, Asp, Cys, Phe, Arg, Glu, Trp, Tyr, Ser, Ile, Thr, Pro, Leu, Ala, His or Gln; Xaa at position 251 is Gly, Ser or Glu; Xaa at position 254 is Ser or Asn; Xaa at position 258 is Ser or Arg; Xaa at position 259 is Phe, Trp, Tyr, Cys, Met, Leu, Val, Ile or His; Xaa at position 265 is Asn or Asp; and Xaa at position 266 is Asp or Asn.
- In some embodiments the nucleic acid molecule encoding a PIP-1 polypeptide is a polynucleotide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence of a sequence of SEQ ID NO: 213 wherein Xaa at position 2 is Pro, Thr or Ser; Xaa at position 3 is lie, Thr, Leu, Val, Met or Ser; Xaa at position 6 is Glu, Gly, Asp or Ala; Xaa at position 8 is Ser, Gly, Asn, Thr or Gln; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu, Val, Ile or Met; Xaa at position 21 is Lys, Ser, Asn, Arg, Thr or Gln; Xaa at position 22 is Ser, Lys, Arg or Thr; Xaa at position 24 is Gln, Gly, Asn or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser, Asn, Thr or Gln; Xaa at position 27 is Leu, Thr, Ala, Ser, Ile, Val or Met; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln; Xaa at position 30 is Ala, Ile, Leu, Val or Met; Xaa at position 35 is Phe, Leu, Ile, Val or Met; Xaa at position 36 is Ala, Ser, Thr, Val, Ile or Leu; Xaa at position 38 is Asn, Arg, Ser, Gln, Lys or Thr; Xaa at position 42 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 43 is Pro, Met, Gly, Gln, Ser, Thr, Arg, Val, Leu, Lys, Asp, Ala, Asn, Phe, Trp, Glu or Cys; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly, Asp, Ala or Glu; Xaa at position 49 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 53 is Ser, Gly, Ala or Thr; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala, Ser, Gly or Thr; Xaa at position 63 is Gln, Lys, Asn or Arg; Xaa at position 66 is Trp, Tyr, Phe, Arg, Lys, His, Ile, Val or Ser; Xaa at position 77 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 89 is Pro, Leu, Gly, Arg, Thr, Ser, Met, Ala, Ile, Asn, Val, Cys or Lys; Xaa at position 93 is Tyr, Cys, Trp, Val, Asp, Asn, Ile, Leu, Met, Phe, Ala or Thr; Xaa at position 97 is Met, Val, Leu or lie; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr, Ile, Ser, Leu or Val; Xaa at position 108 is Gln, Thr, Ser or Asn; Xaa at position 110 is Arg, Leu, Lys, Ile, Val or Met; Xaa at position 120 is Lys, Arg, Gln or Asn; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr, Glu, Ser or Asp; Xaa at position 125 is Asn, Ser, Gln or Thr; Xaa at position 127 is Ser, Asn, Thr, Gln, Lys, Ser or Arg; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn, Thr, Gln, Arg or Lys; Xaa at position 137 is Asp, Gly, Glu or Ala; Xaa at position 141 is Val, Ile or Leu; Xaa at position 142 is Gly, Asp, Ala or Glu; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr, Val, Leu, Met or Ser; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg, Ser, Gln, Lys or Thr; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp, Glu or Gln; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln, Glu, Asp or Asn; Xaa at position 167 is Leu, Met, Ile, Val; Xaa at position 168 is Thr, Lys, Ala, Ser, Arg or Gly; Xaa at position 171 is Gly, Leu, Gln, Met, Cys, Asn, Asp, Ser or Ala; Xaa at position 172 is Thr, Gly, His, Phe, Glu, Arg, Ser, Asn, Ile, Trp, Lys, Gln, Cys, Val, Ala or Met; Xaa at position 173 is Phe, Gly, His, Leu, Ala, Arg, Asn, Cys, Lys, Trp, Thr, Ser, Tyr or Met; Xaa at position 174 is lie, Val, Gly, Arg, Asn, Ala, Gln, Met, Cys, Leu, Phe, Tyr, Lys, Glu, Ser, His or Thr; Xaa at position 175 is Val, Ile, Ala, Cys, Glu, Lys, Leu or Met; Xaa at position 176 is Tyr, Met, Phe, Leu or Cys; Xaa at position 177 is Gln, Ile, Met or Pro; Xaa at position 178 is Val, Cys, Thr, Pro, Ala, Met, Gln, Phe, Ile, Ser or Lys; Xaa at position 179 is Val, Phe, Thr, Ile, Cys, Leu, Met, Ser, Ala or Gln; Xaa at position 180 is Met, Leu; Pro, Trp, Asn, Tyr, Gly, Gln, Ala, Val, Phe, Ile, Cys or Ser; Xaa at position 181 is Val, Ala, Leu, Trp, Cys, Thr, Ile or Lys; Xaa at position 182 is Tyr, Phe, Met or His; Xaa at position 183 is Ala, Met, Val, Thr, Asp, Gly, Cys, Ile, Phe, Ser, Gln or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 195 is Asn, Tyr, Gln or Trp; Xaa at position 200 is Asn, Ser, Thr or Gln; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr, Ala, Ser or Gly; Xaa at position 206 is Gly, Asp, Ala or Glu; Xaa at position 209 is Leu, Val, Ile or Met; Xaa at position 213 is Tyr or Phe; Xaa at position 220 is Asn, Arg, Gln or Lys; Xaa at position 221 is Ser, Lys, Thr or Arg; Xaa at position 222 is Thr, Arg, Ser or Lys; Xaa at position 226 is Asp, Pro, Glu or Gln; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys, Asn, Arg or Gln; Xaa at position 231 is lie, Val, Leu or Met; Xaa at position 232 is Ala, Thr, Ser, Gly, Asp or Glu; Xaa at position 240 is Gln, Arg, Ala, Val, Glu, Met, Gly, Asp, Trp, Asn, Thr, Ile, Ser, Phe, His, Cys or Leu; Xaa at position 241 is Arg, Lys, Glu, Gln, Ser, Ile, Val, Asp, Tyr, Met, Asn, His, Pro, Gly, Leu, Phe, Thr, Ala or Cys; Xaa at position 242 is Asn, Ala, Arg, Lys, His, Ser, Cys, Glu, Pro, Trp, Gln, Thr, Phe, Tyr, Met, Asp, Gly, Leu or Val; Xaa at position 243 is Val, Leu, Ala, Thr, Gly, Cys, Ile, Ser or Met; Xaa at position 244 is Leu, Val, Phe, Ile, Met, Gln, Cys, Trp or Ala; Xaa at position 245 is Met, Ala, Arg, Asp, Glu, Leu, Pro, Ser, Trp, Gly, Val, Lys, Phe, Cys, Thr, His, Ile, Gln, Tyr or Asn; Xaa at position 246 is Glu, Asp, Tyr, Gly, Arg, Val, Ala, Trp, Gln, Ser, Asn, Ile Leu, Met, Cys, Pro, His, Phe, Thr or Lys; Xaa at position 247 is Asn, Leu, Asp, Tyr, Ala, Phe, His, Arg, Lys, Gln, Gly, Val, Ile, Ser, Glu, Pro, Met, Trp, Thr or Cys; Xaa at position 248 is Tyr, Val, Thr, Glu, Phe, Ser, His, Cys, Leu, Trp, Ile, Asp, Gly or Ala; Xaa at position 249 is Asn, Lys, Val, Gly, Met, Asp, Cys, Phe, Arg, Glu, Trp, Tyr, Ser, Ile, Thr, Pro, Leu, Ala, His or Gln; Xaa at position 251 is Gly, Ser, Thr, Ala, Asp or Glu; Xaa at position 254 is Ser, Asn, Thr or Gln; Xaa at position 258 is Ser, Arg, Thr or Lys; Xaa at position 259 is Phe, Trp, Tyr, Cys, Met, Leu, Val, Ile or His; Xaa at position 265 is Asn, Asp, Gln or Glu; and Xaa at position 266 is Asp, Asn, Gln or Glu.
- In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) amino acids 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213. In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid as represented by positions 171-183 of SEQ ID NO: 213 wherein at least one amino acid at positions 171-183 of SEQ ID NO: 213 are not identical to amino acids at positions 171-183 of SEQ ID NO: 6.
- In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO:4 and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) amino acids 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213.
- In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO:4 and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) amino acids 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213.
- In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity to the amino acid sequence set forth in SEQ ID NO: 2 and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) amino acids 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213.
- In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2 and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) amino acids 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213.
- In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity to the amino acid sequence set forth in SEQ ID NO: 2, and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2 or amino acids 171-183 of SEQ ID NO: 213 and iv) amino acids 240-249 of SEQ ID NO: 2 or amino acids 240-249 of SEQ ID NO: 213.
- In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide having a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2, and wherein the polypeptide comprises one or more amino acid motifs selected from i) amino acids 64-79 of SEQ ID NO: 2 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2 or amino acids 171-183 of SEQ ID NO: 213 and iv) amino acids 240-249 of SEQ ID NO: 2 or amino acids 240-249 of SEQ ID NO: 213.
- In some embodiments exemplary nucleic acid molecules encode a PIP-1 polypeptide of SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, and 325 as well as amino acid substitutions, amino acid deletions, amino acid insertions and fragments thereof and combinations thereof.
- In some embodiments exemplary nucleic acid molecules encode a PIP-1 polypeptide of SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, and 269 as well as amino acid substitutions, deletions, insertions and fragments thereof and combinations thereof.
- In some embodiments exemplary nucleic acid molecules comprise a sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, and 297 as well as variants and fragments thereof encoding PIP-1 polypeptides.
- In some embodiments exemplary nucleic acid molecules comprise a sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, and 244 as well as variants and fragments thereof encoding PIP-1 polypeptides.
- In some embodiments the nucleic acid molecules encode a PIP-1 polypeptide of Table 4, Table 6, Table 9, Table 12, Table 13, Table 14 and/or Table 16, combinations of the amino acid substitutions thereof and deletions and/or insertions thereof.
- Also provided are nucleic acid molecules that encode transcription and/or translation products that are subsequently spliced to ultimately produce functional PIP-1 polypeptide. Splicing can be accomplished in vitro or in vivo, and can involve cis- or trans-splicing. The substrate for splicing can be polynucleotides (e.g., RNA transcripts) or polypeptides. An example of cis-splicing of a polynucleotide is where an intron inserted into a coding sequence is removed and the two flanking exon regions are spliced to generate a PIP-1 polypeptide encoding sequence. An example of trans splicing would be where a polynucleotide is encrypted by separating the coding sequence into two or more fragments that can be separately transcribed and then spliced to form the full-length pesticidal encoding sequence. The use of a splicing enhancer sequence, which can be introduced into a construct, can facilitate splicing either in cis or trans-splicing of polypeptides (U.S. Pat. Nos. 6,365,377 and 6,531,316). Thus, in some embodiments the polynucleotides do not directly encode a full-length PIP-1 polypeptide, but rather encode a fragment or fragments of a PIP-1 polypeptide. These polynucleotides can be used to express a functional PIP-1 polypeptide through a mechanism involving splicing, where splicing can occur at the level of polynucleotide (e.g., intron/exon) and/or polypeptide (e.g., intein/extein). This can be useful, for example, in controlling expression of pesticidal activity, since functional pesticidal polypeptide will only be expressed if all required fragments are expressed in an environment that permits splicing processes to generate functional product. In another example, introduction of one or more insertion sequences into a polynucleotide can facilitate recombination with a low homology polynucleotide; use of an intron or intein for the insertion sequence facilitates the removal of the intervening sequence, thereby restoring function of the encoded variant.
- Nucleic acid molecules that are fragments of these nucleic acid sequences encoding PIP-1 polypeptides are also encompassed by the embodiments. By “fragment” is intended a portion of the nucleic acid sequence encoding a PIP-1 polypeptide. A fragment of a nucleic acid sequence may encode a biologically active portion of a PIP-1 polypeptide or it may be a fragment that can be used as a hybridization probe or PCR primer using methods disclosed below. Nucleic acid molecules that are fragments of a nucleic acid sequence encoding a PIP-1 polypeptide comprise at least about 50, 100, 200, 300, 400, 500, 600 or 700, contiguous nucleotides or up to the number of nucleotides present in a full-length nucleic acid sequence encoding a PIP-1 polypeptide disclosed herein, depending upon the intended use. By “contiguous” nucleotides is intended nucleotide residues that are immediately adjacent to one another. Fragments of the nucleic acid sequences of the embodiments will encode protein fragments that retain the biological activity of the PIP-1 polypeptide and, hence, retain insecticidal activity. As used herein, the term “pesticidal activity” refers to activity of an organism or a substance (such as, for example, a protein) that can be measured by, but is not limited to, pest mortality, pest weight loss, pest repellency, and other behavioral and physical changes of a pest after feeding and exposure for an appropriate length of time. Thus, an organism or substance having pesticidal activity adversely impacts at least one measurable parameter of pest fitness. For example, “pesticidal proteins” are proteins that display pesticidal activity by themselves or in combination with other proteins. As used herein, the term “insecticidal activity” refers to activity of an organism or a substance (such as, for example, a protein) that can be measured by, but is not limited to, insect mortality, insect weight loss, insect repellency, and other behavioral and physical changes of an insect after feeding and exposure for an appropriate length of time. Thus, an organism or substance having insecticidal activity adversely impacts at least one measurable parameter of insect fitness. For example, “insecticidal proteins” are proteins that display insecticidal activity by themselves or in combination with other proteins.
- As used herein, the term “pesticidally effective amount” connotes a quantity of a substance or organism that has pesticidal activity when present in the environment of a pest. For each substance or organism, the pesticidally effective amount is determined empirically for each pest affected in a specific environment. Similarly, an “insecticidally effective amount” may be used to refer to a “pesticidally effective amount” when the pest is an insect pest.
- By “retains activity” is intended that the PIP-1A polypeptide has at least about 10%, at least about 30%, at least about 50%, at least about 70%, 80%, 90%, 95% or higher of the insecticidal activity compared to the full-length PIP-1A polypeptide (SEQ ID NO:2). In one embodiment, the insecticidal activity is against a Lepidoptera species. In another embodiment, the insecticidal activity is against a Hemiptera species.
- In some embodiments a fragment of a nucleic acid sequence encoding a PIP-1 polypeptide encoding a biologically active portion of a protein will encode at least about 15, 25, 30, 50, 75, 100, 125, 150, 175, 200 or 250, contiguous amino acids or up to the total number of amino acids present in a full-length PIP-1 polypeptide of the embodiments. In some embodiments, the fragment is an N-terminal or a C-terminal truncation of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or more amino acids relative to SEQ ID NO: 2, 3 or 4 or variants thereof, e.g., by proteolysis, insertion of a start codon, deletion of the codons encoding the deleted amino acids with the concomitant insertion of a stop codon or by insertion of a stop codon in the coding sequence. In some embodiments, the fragments encompassed herein result from the removal of the N-
terminal - In some embodiments the PIP-1 polypeptides are encoded by a nucleic acid sequence sufficiently identical to the nucleic acid sequence of SEQ ID NO: 1, 3 or 5. By “sufficiently identical” is intended an amino acid or nucleic acid sequence that has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity compared to a reference sequence using one of the alignment programs described herein using standard parameters. In some embodiments the sequence homology identity is against the full length sequence of the polynucleotide encoding a PIP-1 polypeptide or against the full length sequence of a PIP-1 polypeptide. In some embodiments the PIP-1 polypeptide has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity compared to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 332 or SEQ ID NO: 6. One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleic acid sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like.
- To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity=number of identical positions/total number of positions (e.g., overlapping positions)×100). In one embodiment, the two sequences are the same length. In another embodiment, the comparison is across the entirety of the reference sequence (e.g., across the entirety of SEQ ID NO: 1, 331 or 3 or across the entirety of one of SEQ ID NO: 2, 332 or 4). The percent identity between two sequences can be determined using techniques similar to those described below, with or without allowing gaps. In calculating percent identity, typically exact matches are counted.
- The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, (1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin and Altschul, (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the BLASTN and BLASTX programs of Altschul, et al., (1990) J. Mol. Biol. 215:403. BLAST nucleotide searches can be performed with the BLASTN program, score=100, wordlength=12, to obtain nucleic acid sequences homologous to pesticidal-like nucleic acid molecules. BLAST protein searches can be performed with the BLASTX program, score=50, wordlength=3, to obtain amino acid sequences homologous to pesticidal protein molecules. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul, et al., (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules. See, Altschul, et al., (1997) supra.
- When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., BLASTX and BLASTN) can be used. Alignment may also be performed manually by inspection.
- Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the ClustalW algorithm (Higgins, et al., (1994) Nucleic Acids Res. 22:4673-4680). ClustalW compares sequences and aligns the entirety of the amino acid or DNA sequence and thus can provide data about the sequence conservation of the entire amino acid sequence. The ClustalW algorithm is used in several commercially available DNA/amino acid analysis software packages, such as the ALIGNX module of the Vector NTI Program Suite (Invitrogen Corporation, Carlsbad, Calif.). After alignment of amino acid sequences with ClustalW, the percent amino acid identity can be assessed. A non-limiting example of a software program useful for analysis of ClustalW alignments is GENEDOC™. GENEDOC™ (Karl Nicholas) allows assessment of amino acid (or DNA) similarity and identity between multiple proteins. Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, (1988) CABIOS 4:11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys, Inc., 9685 Scranton Rd., San Diego, Calif., USA). When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4 can be used.
- Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48(3):443-453, used
GAP Version 10 software to determine sequence identity or similarity using the following default parameters: % identity and % similarity for a nucleic acid sequence using GAP Weight of 50 and Length Weight of 3 and the nwsgapdna.cmpii scoring matrix; % identity or % similarity for an amino acid sequence using GAP weight of 8 and length weight of 2, and the BLOSUM62 scoring program. Equivalent programs may also be used. By “equivalent program” is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated byGAP Version 10. - The embodiments also encompass nucleic acid molecules encoding variants of PIP-1 polypeptide. “Variants” of the PIP-1 polypeptide encoding nucleic acid sequences include those sequences that encode the PIP-1 polypeptides disclosed herein but that differ conservatively because of the degeneracy of the genetic code as well as those that are sufficiently identical as discussed above. Naturally occurring allelic variants can be identified with the use of well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant nucleic acid sequences also include synthetically derived nucleic acid sequences that have been generated, for example, by using site-directed mutagenesis but which still encode the PIP-1 polypeptides disclosed as discussed below.
- The skilled artisan will further appreciate that changes can be introduced by mutation of the nucleic acid sequences thereby leading to changes in the amino acid sequence of the encoded PIP-1 polypeptides, without altering the biological activity of the proteins. Thus, variant nucleic acid molecules can be created by introducing one or more nucleotide substitutions, additions or deletions into the corresponding nucleic acid sequence disclosed herein, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Such variant nucleic acid sequences are also encompassed by the present invention.
- Alternatively, variant nucleic acid sequences can be made by introducing mutations randomly along all or part of the coding sequence, such as by saturation mutagenesis and the resultant mutants can be screened for ability to confer pesticidal activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly, and the activity of the protein can be determined using standard assay techniques.
- The polynucleotides of the disclosure and fragments thereof are optionally used as substrates for a variety of recombination and recursive recombination reactions, in addition to standard cloning methods as set forth in, e.g., Ausubel, Berger and Sambrook, i.e., to produce additional pesticidal polypeptide homologues and fragments thereof with desired properties. A variety of such reactions are known, including those developed by the inventors and their co-workers. Methods for producing a variant of any nucleic acid listed herein comprising recursively recombining such polynucleotide with a second (or more) polynucleotide, thus forming a library of variant polynucleotides are also embodiments of the disclosure, as are the libraries produced, the cells comprising the libraries, and any recombinant polynucleotide produces by such methods. Additionally, such methods optionally comprise selecting a variant polynucleotide from such libraries based on pesticidal activity, as is wherein such recursive recombination is done in vitro or in vivo.
- A variety of diversity generating protocols, including nucleic acid recursive recombination protocols are available and fully described in the art. The procedures can be used separately, and/or in combination to produce one or more variants of a nucleic acid or set of nucleic acids, as well as variants of encoded proteins. Individually and collectively, these procedures provide robust, widely applicable ways of generating diversified nucleic acids and sets of nucleic acids (including, e.g., nucleic acid libraries) useful, e.g., for the engineering or rapid evolution of nucleic acids, proteins, pathways, cells and/or organisms with new and/or improved characteristics.
- While distinctions and classifications are made in the course of the ensuing discussion for clarity, it will be appreciated that the techniques are often not mutually exclusive. Indeed, the various methods can be used singly or in combination, in parallel or in series, to access diverse sequence variants.
- The result of any of the diversity generating procedures described herein can be the generation of one or more nucleic acids, which can be selected or screened for nucleic acids with or which confer desirable properties or that encode proteins with or which confer desirable properties. Following diversification by one or more of the methods herein or otherwise available to one of skill, any nucleic acids that are produced can be selected for a desired activity or property, e.g. pesticidal activity or, such activity at a desired pH, etc. This can include identifying any activity that can be detected, for example, in an automated or automatable format, by any of the assays in the art, see, e.g., discussion of screening of insecticidal activity, infra. A variety of related (or even unrelated) properties can be evaluated, in serial or in parallel, at the discretion of the practitioner.
- Descriptions of a variety of diversity generating procedures for generating modified nucleic acid sequences, e.g., those coding for polypeptides having pesticidal activity or fragments thereof, are found in the following publications and the references cited therein: Soong, et al., (2000) Nat Genet 25(4):436-439; Stemmer, et al., (1999) Tumor Targeting 4:1-4; Ness et al. (1999) Nat Biotechnol 17:893-896; Chang et al. (1999) Nat Biotechnol 17:793-797; Minshull and Stemmer, (1999) Curr Opin Chem Biol 3:284-290; Christians, et al., (1999) Nat Biotechnol 17:259-264; Crameri, et al., (1998) Nature 391:288-291; Crameri, et al., (1997) Nat Biotechnol 15:436-438; Zhang, et al., (1997) PNAS USA 94:4504-4509; Patten, et al., (1997) Curr Opin Biotechnol 8:724-733; Crameri, et al., (1996) Nat Med 2:100-103; Crameri, et al., (1996) Nat Biotechnol 14:315-319; Gates, et al., (1996) J Mol Biol 255:373-386; Stemmer, (1996) “Sexual PCR and Assembly PCR” In: The Encyclopedia of Molecular Biology. VCH Publishers, New York. pp. 447-457; Crameri and Stemmer, (1995) BioTechniques 18:194-195; Stemmer, et al., (1995) Gene, 164:49-53; Stemmer, (1995) Science 270:1510; Stemmer, (1995) Bio/Technology 13:549-553; Stemmer, (1994) Nature 370:389-391 and Stemmer, (1994) PNAS USA 91:10747-10751.
- Mutational methods of generating diversity include, for example, site-directed mutagenesis (Ling, et al., (1997) Anal Biochem 254(2):157-178; Dale, et al., (1996) Methods Mol Biol 57:369-374; Smith, (1985) Ann Rev Genet 19:423-462; Botstein and Shortle, (1985) Science 229:1193-1201; Carter, (1986) Biochem J 237:1-7 and Kunkel, (1987) “The efficiency of oligonucleotide directed mutagenesis” in Nucleic Acids & Molecular Biology (Eckstein and Lilley, eds., Springer Verlag, Berlin)); mutagenesis using uracil containing templates (Kunkel, (1985) PNAS USA 82:488-492; Kunkel, et al., (1987) Methods Enzymol 154:367-382 and Bass, et al., (1988) Science 242:240-245); oligonucleotide-directed mutagenesis (Zoller and Smith, (1983) Methods Enzymol 100:468-500; Zoller and Smith, (1987) Methods Enzymol 154:329-350; Zoller and Smith, (1982) Nucleic Acids Res 10:6487-6500), phosphorothioate-modified DNA mutagenesis (Taylor, et al., (1985) Nucl Acids Res 13:8749-8764; Taylor, et al., (1985) Nucl Acids Res 13:8765-8787 (1985); Nakamaye and Eckstein (1986) Nucl Acids Res 14:9679-9698; Sayers, et al., (1988) Nucl Acids Res 16:791-802 and Sayers, et al., (1988) Nucl Acids Res 16: 803-814); mutagenesis using gapped duplex DNA (Kramer, et al., (1984) Nucl Acids Res 12:9441-9456; Kramer and Fritz, (1987) Methods Enzymol 154:350-367; Kramer, et al., (1988) Nucl Acids Res 16:7207 and Fritz, et al., (1988) Nucl Acids Res 16:6987-6999).
- Additional suitable methods include point mismatch repair (Kramer, et al., (1984) Cell 38:879-887), mutagenesis using repair-deficient host strains (Carter, et al., (1985) Nucl Acids Res 13:4431-4443 and Carter, (1987) Methods in Enzymol 154:382-403), deletion mutagenesis (Eghtedarzadeh and Henikoff, (1986) Nucl Acids Res 14:5115), restriction-selection and restriction-purification (Wells, et al., (1986) Phil Trans R Soc Lond A 317:415-423), mutagenesis by total gene synthesis (Nambiar, et al., (1984) Science 223:1299-1301; Sakamar and Khorana, (1988) Nucl Acids Res 14:6361-6372; Wells, et al., (1985) Gene 34:315-323 and Grundstrom, et al., (1985) Nucl Acids Res 13:3305-3316), double-strand break repair (Mandecki, (1986) PNAS USA, 83:7177-7181 and Arnold, (1993) Curr Opin Biotech 4:450-455). Additional details on many of the above methods can be found in Methods Enzymol Volume 154, which also describes useful controls for trouble-shooting problems with various mutagenesis methods.
- Additional details regarding various diversity generating methods can be found in the following US patents, PCT Publications and applications and EPO Publications: U.S. Pat. Nos. 5,723,323, 5,763,192, 5,814,476, 5,817,483, 5,824,514, 5,976,862, 5,605,793, 5,811,238, 5,830,721, 5,834,252, 5,837,458, WO 1995/22625, WO 1996/33207, WO 1997/20078, WO 1997/35966, WO 1999/41402, WO 1999/41383, WO 1999/41369, WO 1999/41368, EP 752008, EP 0932670, WO 1999/23107, WO 1999/21979, WO 1998/31837, WO 1998/27230, WO 1998/27230, WO 2000/00632, WO 2000/09679, WO 1998/42832, WO 1999/29902, WO 1998/41653, WO 1998/41622, WO 1998/42727, WO 2000/18906, WO 2000/04190, WO 2000/42561, WO 2000/42559, WO 2000/42560, WO 2001/23401, and PCT/US01/06775.
- The nucleotide sequences of the embodiments can also be used to isolate corresponding sequences from other organisms, particularly other bacteria, particularly a Pseudomonas species and more particularly a Pseudomonas chlororaphis strain. In this manner, methods such as PCR, hybridization and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences that are selected based on their sequence identity to the entire sequences set forth herein or to fragments thereof are encompassed by the embodiments. Such sequences include sequences that are orthologs of the disclosed sequences. The term “orthologs” refers to genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share substantial identity as defined elsewhere herein. Functions of orthologs are often highly conserved among species.
- In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.), hereinafter “Sambrook”. See also, Innis, et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.
- To identify potential PIP-1 polypeptides from bacterial collections, the bacterial cell lysates can be screened with antibodies generated against PIP-1A (SEQ ID NO: 2), PSEEN3174 (SEQ ID NO: 6), PIP-1B (SEQ ID NO: 4) and PIP-1C (SEQ ID NO: 332) proteins using Western blotting and/or ELISA methods. This type of assays can be performed in a high throughput fashion. Positive samples can be further analyzed by various techniques such as antibody based protein purification and identification. Methods of generating antibodies are well known in the art as discussed infra.
- Alternatively, mass spectrometry based protein identification method can be used to identify homologs of PIP-1A (SEQ ID NO: 2) using protocols in the literatures (Patterson, (1998), 10(22):1-24, Current Protocol in Molecular Biology published by John Wiley & Son Inc). Specifically, LC-MS/MS based protein identification method is used to associate the MS data of given cell lysate or desired molecular weight enriched samples (excised from SDS-PAGE gel of relevant molecular weight bands to PIP-1A protein) with sequence information of PIP-1A (SEQ ID NO: 2) and its homologs. Any match in peptide sequences indicates the potential of having the homologous proteins in the samples. Additional techniques (protein purification and molecular biology) can be used to isolate the protein and identify the sequences of the homologs.
- In hybridization methods, all or part of the pesticidal nucleic acid sequence can be used to screen cDNA or genomic libraries. Methods for construction of such cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook and Russell, (2001), supra. The so-called hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments or other oligonucleotides, and may be labeled with a detectable group such as 32P or any other detectable marker, such as other radioisotopes, a fluorescent compound, an enzyme or an enzyme co-factor. Probes for hybridization can be made by labeling synthetic oligonucleotides based on the known PIP-1 polypeptide-encoding nucleic acid sequence disclosed herein. Degenerate primers designed on the basis of conserved nucleotides or amino acid residues in the nucleic acid sequence or encoded amino acid sequence can additionally be used. The probe typically comprises a region of nucleic acid sequence that hybridizes under stringent conditions to at least about 12, at least about 25, at least about 50, 75, 100, 125, 150, 175 or 200 consecutive nucleotides of nucleic acid sequence encoding a PIP-1 polypeptide of the disclosure or a fragment or variant thereof. Methods for the preparation of probes for hybridization are generally known in the art and are disclosed in Sambrook and Russell, (2001), supra, herein incorporated by reference.
- For example, an entire nucleic acid sequence, encoding a PIP-1 polypeptide, disclosed herein or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding nucleic acid sequences encoding PIP-1 polypeptide-like sequences and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique and are preferably at least about 10 nucleotides in length or at least about 20 nucleotides in length. Such probes may be used to amplify corresponding pesticidal sequences from a chosen organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
- Hybridization of such sequences may be carried out under stringent conditions. By “stringent conditions” or “stringent hybridization conditions” is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, preferably less than 500 nucleotides in length.
- Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37° C., and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
- Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, (1984) Anal. Biochem. 138:267-284: Tm=81.5° C.+16.6 (log M)+0.41 (% GC)−0.61 (% form)−500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≥90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3 or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9 or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15 or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen, (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, N.Y.); and Ausubel, et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See, Sambrook, et al., (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
- Pseudomonas Insecticidal Protein-1 (PIP-1) polypeptides are also encompassed by the disclosure. By “Pseudomonas Insecticidal Protein-1”, “PIP-1 polypeptide” or “PIP-1 protein” is intended a polypeptide that retains insecticidal activity against one or more insect pests of the Lepidoptera and/or Hemiptera orders compared to, and including, the protein of SEQ ID NO: 2, and is sufficiently homologous to, and includes, the protein of SEQ ID NO: 2. A variety of PIP-1 polypeptides are contemplated. One source of polypeptides that encode a PIP-1 polypeptide or related proteins is a Pseudomonas chlororaphis strain which comprises the polynucleotide of SEQ ID NO: 1 encoding the PIP-1 polypeptide of SEQ ID NO: 2.
- As used herein, the terms “protein,” “peptide molecule” or “polypeptide” includes any molecule that comprises five or more amino acids. It is well known in the art that protein, peptide or polypeptide molecules may undergo modification, including post-translational modifications, such as, but not limited to, disulfide bond formation, glycosylation, phosphorylation or oligomerization. Thus, as used herein, the terms “protein,” “peptide molecule” or “polypeptide” includes any protein that is modified by any biological or non-biological process. The terms “amino acid” and “amino acids” refer to all naturally occurring L-amino acids.
- A “recombinant protein” is used to refer to a protein that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell. A PIP-1 polypeptide that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10% or 5% or less (by dry weight) of non-pesticidal protein (also referred to herein as a “contaminating protein”).
- “Fragments” or “biologically active portions” include polypeptide fragments comprising amino acid sequences sufficiently identical to a PIP-1 polypeptide and that exhibit insecticidal activity. “Fragments” or “biologically active portions” include polypeptide fragments comprising amino acid sequences sufficiently identical to the amino acid sequence set forth in SEQ ID NO: 2, 4, 332 and 6 including but not limited to SEQ ID NO: 204, 206 and 208 and that exhibit insecticidal activity. A biologically active portion of a PIP-1 polypeptide can be a polypeptide that is, for example, 10, 25, 50, 100, 150, 200, 250 or more amino acids in length. Such biologically active portions can be prepared by recombinant techniques and evaluated for insecticidal activity. As used here, a fragment comprises at least 8 contiguous amino acids of a PIP-1 polypeptide. In some embodiments a fragment comprises at least 8 contiguous amino acids of SEQ ID NO: 2 or 4. In some embodiments a fragment comprises at least 8 contiguous amino acids of SEQ ID NO: 2. In some embodiments a fragment comprises at least 8 contiguous amino acids of SEQ ID NO: 4. The embodiments encompass other fragments, however, such as any fragment in the protein greater than about 10, 20, 30, 50, 100, 150, 200, 250 or more amino acids.
- In some embodiments, the fragment is an N-terminal and/or a C-terminal truncation of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or more amino acids relative to SEQ ID NO: 2 or 4 or variants thereof e.g., by proteolysis, by insertion of a start codon, by deletion of the codons encoding the deleted amino acids and concomitant insertion of a start codon and/or insertion of a stop codon. In some embodiments, the fragments encompassed herein result from the removal of the N-
terminal - In some embodiments fragments, biologically active portions of SEQ ID NO: 2 or 4, including but not limited to SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, and 269, as well as amino acid substitutions, deletions and/or insertions thereof are also provided, and may be used to practice the methods of the disclosure.
- By variants is intended proteins or polypeptides having an amino acid sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the parental amino acid sequence. In some embodiments a PIP-1 polypeptide has at least about 60%, 65%, about 70%, 75%, at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity across the entire length of the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO: 4. In some embodiments a PIP-1 polypeptide has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity across the entire length of the amino acid sequence of SEQ ID NO: 2.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity, to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO:4, wherein the polypeptide has insecticidal activity. In some embodiments a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO: 4, wherein the polypeptide has insecticidal activity. In some embodiments a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence of SEQ ID NO: 2, wherein the polypeptide has insecticidal activity.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 211, wherein Xaa at position 2 is Pro or Thr; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly or Asp; Xaa at position 49 is Phe or Tyr; Xaa at position 53 is Ser or Gly; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala or Ser; Xaa at position 63 is Gln or Lys; Xaa at position 77 is Phe or Tyr; Xaa at position 97 is Met or Val; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr or lie; Xaa at position 108 is Gln or Thr; Xaa at position 110 is Arg or Leu; Xaa at position 120 is Lys, Arg or Gln; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr or Glu; Xaa at position 125 is Asn or Ser; Xaa at position 127 is Ser, Asn, Thr or Lys; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn or Lys; Xaa at position 137 is Asp or Gly; Xaa at position 141 is Val or lie; Xaa at position 142 is Gly or Asp; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr or Val; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg or Ser; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp or Glu; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln or Glu; Xaa at position 167 is Leu or Met; Xaa at position 168 is Thr, Lys or Ala; Xaa at position 174 is lie, Val or Met; Xaa at position 175 is Val or lie; Xaa at position 180 is Met or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 200 is Asn or Ser; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr or Ala; Xaa at position 206 is Gly or Asp; Xaa at position 209 is Leu or Val; Xaa at position 220 is Asn or Arg; Xaa at position 221 is Ser or Lys; Xaa at position 222 is Thr or Arg; Xaa at position 226 is Asp, Pro or Glu; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys or Asn; Xaa at position 231 is lie or Val; Xaa at position 232 is Ala, Thr or Glu; and Xaa at position 251 is Gly, Ser or Glu; Xaa at position 254 is Ser or Asn; Xaa at position 258 is Ser or Arg; Xaa at position 265 is Asn or Asp; and Xaa at position 266 is Asp or Asn; and amino acid deletions, amino acid insertions, and fragments thereof, and combinations thereof.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 211 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or 61 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 211 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 211 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 or 54 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 211 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 212, wherein Xaa at position 2 is Pro or Thr; Xaa at position 3 is lie or Thr; Xaa at position 6 is Glu or Gly; Xaa at position 8 is Ser, Gly or Asn; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu or Val; Xaa at position 21 is Lys, Ser or Asn; Xaa at position 22 is Ser, Lys or Arg; Xaa at position 24 is Gln or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser or Asn; Xaa at position 27 is Leu, Thr or Ala; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln; Xaa at position 30 is Ala or lie; Xaa at position 35 is Phe or Leu; Xaa at position 36 is Ala, Ser or Val; Xaa at position 38 is Asn, Arg or Ser; Xaa at position 42 is Phe or Tyr; Xaa at position 43 is Pro, Met, Gly, Gln, Ser, Thr, Arg, Val, Leu, Lys, Asp, Ala, Asn, Phe, Trp, Glu or Cys; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly or Asp; Xaa at position 49 is Phe, Tyr or Leu; Xaa at position 53 is Ser or Gly; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala or Ser; Xaa at position 63 is Gln or Lys; Xaa at position 66 is Trp, Tyr, Phe, Arg, Lys, His, Ile, Val or Ser; Xaa at position 77 is Phe or Tyr; Xaa at position 89 is Pro, Leu, Gly, Arg, Thr, Ser, Met, Ala, Ile, Asn, Val, Cys or Lys; Xaa at position 93 is Tyr, Cys, Trp, Val, Asp, Asn, Ile, Leu, Met, Phe, Ala or Thr; Xaa at position 97 is Met or Val; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr or lie; Xaa at position 108 is Gln or Thr; Xaa at position 110 is Arg or Leu; Xaa at position 120 is Lys, Arg or Gln; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr or Glu; Xaa at position 125 is Asn or Ser; Xaa at position 127 is Ser, Asn, Thr or Lys; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn or Lys; Xaa at position 137 is Asp or Gly; Xaa at position 141 is Val or lie; Xaa at position 142 is Gly or Asp; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr or Val; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg or Ser; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp or Glu; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln or Glu; Xaa at position 167 is Leu or Met; Xaa at position 168 is Thr, Lys or Ala; Xaa at position 171 is Gly, Leu, Gln, Met, Cys, Asn, Asp, Ser or Ala; Xaa at position 172 is Thr, Gly, His, Phe, Glu, Arg, Ser, Asn, lie, Trp, Lys, Gln, Cys, Val, Ala or Met; Xaa at position 173 is Phe, Gly, His, Leu, Ala, Arg, Asn, Cys, Lys, Trp, Thr, Ser, Tyr or Met; Xaa at position 174 is lie, Val, Gly, Arg, Asn, Ala, Gln, Met, Cys, Leu, Phe, Tyr, Lys, Glu, Ser, His or Thr; Xaa at position 175 is Val, Ile, Ala, Cys, Glu, Lys, Leu or Met; Xaa at position 176 is Tyr, Met, Phe, Leu or Cys; Xaa at position 177 is Gln, Ile, Met or Pro; Xaa at position 178 is Val, Cys, Thr, Pro, Ala, Met, Gln, Phe, Ile, Ser or Lys; Xaa at position 179 is Val, Phe, Thr, Ile, Cys, Leu, Met, Ser, Ala or Gln; Xaa at position 180 is Met, Leu, Pro, Trp, Asn, Tyr, Gly, Gln, Ala, Val, Phe, Ile, Cys or Ser; Xaa at position 181 is Val, Ala, Leu, Trp, Cys, Thr, Ile or Lys; Xaa at position 182 is Tyr, Phe, Met or His; Xaa at position 183 is Ala, Met, Val, Thr, Asp, Gly, Cys, Ile, Phe, Ser, Gln or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 195 is Asn or Tyr; Xaa at position 200 is Asn or Ser; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr or Ala; Xaa at position 206 is Gly or Asp; Xaa at position 209 is Leu or Val; Xaa at position 213 is Tyr or Phe; Xaa at position 220 is Asn or Arg; Xaa at position 221 is Ser or Lys; Xaa at position 222 is Thr or Arg; Xaa at position 226 is Asp, Pro or Glu; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys or Asn; Xaa at position 231 is lie or Val; Xaa at position 232 is Ala, Thr or Glu; Xaa at position 240 is Gln, Arg, Ala, Val, Glu, Met, Gly, Asp, Trp, Asn, Thr, Ile, Ser, Phe, His, Cys or Leu; Xaa at position 241 is Arg, Lys, Glu, Gln, Ser, Ile, Val, Asp, Tyr, Met, Asn, His, Pro, Gly, Leu, Phe, Thr, Ala or Cys; Xaa at position 242 is Asn, Ala, Arg, Lys, His, Ser, Cys, Glu, Pro, Trp, Gln, Thr, Phe, Tyr, Met, Asp, Gly, Leu or Val; Xaa at position 243 is Val, Leu, Ala, Thr, Gly, Cys, Ile, Ser or Met; Xaa at position 244 is Leu, Val, Phe, Ile, Met, Gln, Cys, Trp or Ala; Xaa at position 245 is Met, Ala, Arg, Asp, Glu, Leu, Pro, Ser, Trp, Gly, Val, Lys, Phe, Cys, Thr, His, Ile, Gln, Tyr or Asn; Xaa at position 246 is Glu, Asp, Tyr, Gly, Arg, Val, Ala, Trp, Gln, Ser, Asn, Ile Leu, Met, Cys, Pro, His, Phe, Thr or Lys; Xaa at position 247 is Asn, Leu, Asp, Tyr, Ala, Phe, His, Arg, Lys, Gln, Gly, Val, Ile, Ser, Glu, Pro, Met, Trp, Thr or Cys; Xaa at position 248 is Tyr, Val, Thr, Glu, Phe, Ser, His, Cys, Leu, Trp, Ile, Asp, Gly or Ala; Xaa at position 249 is Asn, Lys, Val, Gly, Met, Asp, Cys, Phe, Arg, Glu, Trp, Tyr, Ser, Ile, Thr, Pro, Leu, Ala, His or Gln; Xaa at position 251 is Gly, Ser or Glu; Xaa at position 254 is Ser or Asn; Xaa at position 258 is Ser or Arg; Xaa at position 259 is Phe, Trp, Tyr, Cys, Met, Leu, Val, Ile or His; Xaa at position 265 is Asn or Asp; and Xaa at position 266 is Asp or Asn; and amino acid deletions, amino acid insertions, and fragments thereof, and combinations thereof.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 212 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 212 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 212 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 or 54 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 212 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 213 wherein Xaa at position 2 is Pro, Thr or Ser; Xaa at position 3 is lie, Thr, Leu, Val, Met or Ser; Xaa at position 6 is Glu, Gly, Asp or Ala; Xaa at position 8 is Ser, Gly, Asn, Thr or Gln; Xaa at position 19 is Asp, Glu or Cys; Xaa at position 20 is Leu, Val, Ile or Met; Xaa at position 21 is Lys, Ser, Asn, Arg, Thr or Gln; Xaa at position 22 is Ser, Lys, Arg or Thr; Xaa at position 24 is Gln, Gly, Asn or Ala; Xaa at position 25 is Gly or Ala; Xaa at position 26 is Ser, Asn, Thr or Gln; Xaa at position 27 is Leu, Thr, Ala, Ser, Ile, Val or Met; Xaa at position 28 is Arg, Ser, Lys, Thr, Val, Gly, Ala, Met, Asp, Trp, Pro, Leu, His, Cys or Gln; Xaa at position 30 is Ala, Ile, Leu, Val or Met; Xaa at position 35 is Phe, Leu, lie, Val or Met; Xaa at position 36 is Ala, Ser, Thr, Val, Ile or Leu; Xaa at position 38 is Asn, Arg, Ser, Gln, Lys or Thr; Xaa at position 42 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 43 is Pro, Met, Gly, Gln, Ser, Thr, Arg, Val, Leu, Lys, Asp, Ala, Asn, Phe, Trp, Glu or Cys; Xaa at position 46 is Arg, Lys or His; Xaa at position 48 is Gly, Asp, Ala or Glu; Xaa at position 49 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 53 is Ser, Gly, Ala or Thr; Xaa at position 58 is Tyr or Phe; Xaa at position 60 is Ala, Ser, Gly or Thr; Xaa at position 63 is Gln, Lys, Asn or Arg; Xaa at position 66 is Trp, Tyr, Phe, Arg, Lys, His, Ile, Val or Ser; Xaa at position 77 is Phe, Tyr, Trp, Leu, Ile, Val or Met; Xaa at position 89 is Pro, Leu, Gly, Arg, Thr, Ser, Met, Ala, Ile, Asn, Val, Cys or Lys; Xaa at position 93 is Tyr, Cys, Trp, Val, Asp, Asn, Ile, Leu, Met, Phe, Ala or Thr; Xaa at position 97 is Met, Val, Leu or lie; Xaa at position 98 is Asp or Glu; Xaa at position 105 is Gln or Asn; Xaa at position 107 is Thr, Ile, Ser, Leu or Val; Xaa at position 108 is Gln, Thr, Ser or Asn; Xaa at position 110 is Arg, Leu, Lys, Ile, Val or Met; Xaa at position 120 is Lys, Arg, Gln or Asn; Xaa at position 121 is Thr or Ser; Xaa at position 123 is Thr, Glu, Ser or Asp; Xaa at position 125 is Asn, Ser, Gln or Thr; Xaa at position 127 is Ser, Asn, Thr, Gln, Lys, Ser or Arg; Xaa at position 134 is Gly or Ala; Xaa at position 135 is Ser, Asn, Thr, Gln, Arg or Lys; Xaa at position 137 is Asp, Gly, Glu or Ala; Xaa at position 141 is Val, Ile or Leu; Xaa at position 142 is Gly, Asp, Ala or Glu; Xaa at position 144 is Asp or Glu; Xaa at position 147 is lie, Thr, Val, Leu, Met or Ser; Xaa at position 150 is Ser or Thr; Xaa at position 151 is Asn, Arg, Ser, Gln, Lys or Thr; Xaa at position 160 is Thr or Ser; Xaa at position 162 is Ser or Thr; Xaa at position 163 is Asn, Asp, Glu or Gln; Xaa at position 164 is Ser or Thr; Xaa at position 166 is Gln, Glu, Asp or Asn; Xaa at position 167 is Leu, Met, Ile, Val; Xaa at position 168 is Thr, Lys, Ala, Ser, Arg or Gly; Xaa at position 171 is Gly, Leu, Gln, Met, Cys, Asn, Asp, Ser or Ala; Xaa at position 172 is Thr, Gly, His, Phe, Glu, Arg, Ser, Asn, lie, Trp, Lys, Gln, Cys, Val, Ala or Met; Xaa at position 173 is Phe, Gly, His, Leu, Ala, Arg, Asn, Cys, Lys, Trp, Thr, Ser, Tyr or Met; Xaa at position 174 is lie, Val, Gly, Arg, Asn, Ala, Gln, Met, Cys, Leu, Phe, Tyr, Lys, Glu, Ser, His or Thr; Xaa at position 175 is Val, Ile, Ala, Cys, Glu, Lys, Leu or Met; Xaa at position 176 is Tyr, Met, Phe, Leu or Cys; Xaa at position 177 is Gln, Ile, Met or Pro; Xaa at position 178 is Val, Cys, Thr, Pro, Ala, Met, Gln, Phe, Ile, Ser or Lys; Xaa at position 179 is Val, Phe, Thr, Ile, Cys, Leu, Met, Ser, Ala or Gln; Xaa at position 180 is Met, Leu; Pro, Trp, Asn, Tyr, Gly, Gln, Ala, Val, Phe, Ile, Cys or Ser; Xaa at position 181 is Val, Ala, Leu, Trp, Cys, Thr, Ile or Lys; Xaa at position 182 is Tyr, Phe, Met or His; Xaa at position 183 is Ala, Met, Val, Thr, Asp, Gly, Cys, Ile, Phe, Ser, Gln or Leu; Xaa at position 191 is Arg or Lys; Xaa at position 194 is Gly or Ala; Xaa at position 195 is Asn, Tyr, Gln or Trp; Xaa at position 200 is Asn, Ser, Thr or Gln; Xaa at position 203 is Asn or Gln; Xaa at position 204 is Thr, Ala, Ser or Gly; Xaa at position 206 is Gly, Asp, Ala or Glu; Xaa at position 209 is Leu, Val, Ile or Met; Xaa at position 213 is Tyr or Phe; Xaa at position 220 is Asn, Arg, Gln or Lys; Xaa at position 221 is Ser, Lys, Thr or Arg; Xaa at position 222 is Thr, Arg, Ser or Lys; Xaa at position 226 is Asp, Pro, Glu or Gln; Xaa at position 228 is Ser or Gly; Xaa at position 229 is Lys, Asn, Arg or Gln; Xaa at position 231 is lie, Val, Leu or Met; Xaa at position 232 is Ala, Thr, Ser, Gly, Asp or Glu; Xaa at position 240 is Gln, Arg, Ala, Val, Glu, Met, Gly, Asp, Trp, Asn, Thr, Ile, Ser, Phe, His, Cys or Leu; Xaa at position 241 is Arg, Lys, Glu, Gln, Ser, Ile, Val, Asp, Tyr, Met, Asn, His, Pro, Gly, Leu, Phe, Thr, Ala or Cys; Xaa at position 242 is Asn, Ala, Arg, Lys, His, Ser, Cys, Glu, Pro, Trp, Gln, Thr, Phe, Tyr, Met, Asp, Gly, Leu or Val; Xaa at position 243 is Val, Leu, Ala, Thr, Gly, Cys, Ile, Ser or Met; Xaa at position 244 is Leu, Val, Phe, Ile, Met, Gln, Cys, Trp or Ala; Xaa at position 245 is Met, Ala, Arg, Asp, Glu, Leu, Pro, Ser, Trp, Gly, Val, Lys, Phe, Cys, Thr, His, Ile, Gln, Tyr or Asn; Xaa at position 246 is Glu, Asp, Tyr, Gly, Arg, Val, Ala, Trp, Gln, Ser, Asn, Ile Leu, Met, Cys, Pro, His, Phe, Thr or Lys; Xaa at position 247 is Asn, Leu, Asp, Tyr, Ala, Phe, His, Arg, Lys, Gln, Gly, Val, Ile, Ser, Glu, Pro, Met, Trp, Thr or Cys; Xaa at position 248 is Tyr, Val, Thr, Glu, Phe, Ser, His, Cys, Leu, Trp, Ile, Asp, Gly or Ala; Xaa at position 249 is Asn, Lys, Val, Gly, Met, Asp, Cys, Phe, Arg, Glu, Trp, Tyr, Ser, Ile, Thr, Pro, Leu, Ala, His or Gln; Xaa at position 251 is Gly, Ser, Thr, Ala, Asp or Glu; Xaa at position 254 is Ser, Asn, Thr or Gln; Xaa at position 258 is Ser, Arg, Thr or Lys; Xaa at position 259 is Phe, Trp, Tyr, Cys, Met, Leu, Val, Ile or His; Xaa at position 265 is Asn, Asp, Gln or Glu; and Xaa at position 266 is Asp, Asn, Gln or Glu; and amino acid deletions, amino acid insertions and fragments thereof, and combinations thereof.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 213 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 213 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 213 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 or 54 amino acid substitutions, in any combination, at residues designated by Xaa in SEQ ID NO: 213 compared to the native amino acid at the corresponding position of SEQ ID NO: 2.
- In some embodiments a PIP-1 polypeptide comprises one or more amino acid motifs selected from i) an amino acid motif represented by amino acids at positions 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) an amino acid motif represented by amino acids at positions 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) an amino acid motif represented by amino acids at positions 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) an amino acid motif represented by amino acids at positions 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213. In some embodiments the PIP-1 polypeptide comprises an amino acid as represented by positions 171-183 of SEQ ID NO: 213 wherein at least one amino acid at positions 171-183 of SEQ ID NO: 213 are not identical to amino acids at positions 171-183 of SEQ ID NO: 6.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO: 4 and comprises one or more amino acid motifs selected from i) an amino acid motif represented by amino acids at positions 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) an amino acid motif represented by amino acids at positions 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) an amino acid motif represented by amino acids at positions 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) an amino acid motif represented by amino acids at positions 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213.
- In some embodiments a PIP-1 polypeptide comprises an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 332 or SEQ ID NO: 4 and comprises one or more amino acid motifs selected from i) an amino acid motif represented by amino acids at positions 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) an amino acid motif represented by amino acids at positions 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) an amino acid motif represented by amino acids at positions 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) amino acids 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213.
- In some embodiments the amino acid motifs represented by i) amino acids 64-79 of SEQ ID NO: 2, amino acids 64-79 of SEQ ID NO: 211, amino acids 64-79 of SEQ ID NO: 212 or amino acids 64-79 of SEQ ID NO: 213, ii) amino acids 149-159 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 211, amino acids 149-159 of SEQ ID NO: 212 or amino acids 149-159 of SEQ ID NO: 213, iii) amino acids 171-183 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 211, amino acids 171-183 of SEQ ID NO: 212 or amino acids 171-183 of SEQ ID NO: 213, and iv) amino acids 240-249 of SEQ ID NO: 2, amino acids 240-249 of SEQ ID NO: 211, amino acids 240-249 of SEQ ID NO: 212 or amino acids 240-249 of SEQ ID NO: 213, the amino acid motif may optional have a deletion of one or more amino acids within the motif, a insertion of one or more amino acids within the motif or combinations thereof.
- In some embodiments exemplary PIP-1 polypeptides are encoded by the polynucleotide sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, and 297 as well as variants and fragments thereof encoding PIP-1 polypeptides.
- In some embodiments exemplary nucleic acid molecules comprise a sequence set forth in SEQ ID NO: 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 197, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 205, 207, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, and 244 as well as variants and fragments thereof encoding PIP-1 polypeptides.
- In some embodiments a PIP-1 polypeptide includes variants where an amino acid that is part of a proteolytic cleavage site is changed to another amino acid to eliminate or alter the proteolytic cleavage at that site. In some embodiments the proteolytic cleavage is by a protease in the insect gut. In other embodiments the proteolytic cleavage is by a plant protease in the transgenic plant.
- In some embodiments exemplary PIP-1 polypeptides are the polypeptides shown in Table 4, Table 6, Table 9, Table 12, Table 13, Table 14 and/or Table 16 and combinations of the amino substitutions thereof as well as deletions, and or insertions and fragments thereof.
- In some embodiments a PIP-1 polypeptide does not have the amino acid sequence of SEQ ID NO: 4. In some embodiments a PIP-1 polypeptide does not have the amino acid sequence of SEQ ID NO: 6.
- In some embodiments a PIP-1 polypeptide has a calculated molecular weight of between about 15 kD and about 35 kD, between about 19 kD and about 35 kD, between about 21 kD and about 35 kD, between about 23 kD and about 35 kD, between about 25 kD and about 32 kD, between about 27 kD and about 32 kD, between about 28 kD and about 32 kD, between about 29 kD and about 32 kD, between about 30 kD and about 31 kD or about 30.5 kD.
- In some embodiments a PIP-1 polypeptide is encoded by a nucleic acid molecule that hybridizes under stringent conditions to the nucleic acid molecule of SEQ ID NO: 1 or 3. Variants include polypeptides that differ in amino acid sequence due to mutagenesis. Variant proteins encompassed by the disclosure are biologically active, that is they continue to possess the desired biological activity (i.e. pesticidal activity) of the native protein. By “retains activity” is intended that the variant will have at least about 30%, at least about 50%, at least about 70% or at least about 80% of the insecticidal activity of the native protein. In some embodiments, the variants may have improved activity over the native protein.
- Bacterial genes quite often possess multiple methionine initiation codons in proximity to the start of the open reading frame. Often, translation initiation at one or more of these start codons will lead to generation of a functional protein. These start codons can include ATG codons. For example, SEQ ID NO: 215 represent alternate start site protein encoded by SEQ ID NO: 1. However, bacteria such as Bacillus sp. also recognize the codon GTG as a start codon, and proteins that initiate translation at GTG codons contain a methionine at the first amino acid. On rare occasions, translation in bacterial systems can initiate at a TTG codon, though in this event the TTG encodes a methionine. Furthermore, it is not often determined a priori which of these codons are used naturally in the bacterium. Thus, it is understood that use of one of the alternate methionine codons may also lead to generation of pesticidal proteins. These pesticidal proteins are encompassed in the present disclosure and may be used in the methods of the present disclosure. It will be understood that, when expressed in plants, it will be necessary to alter the alternate start codon to ATG for proper translation.
- In another aspect the PIP-1 polypeptide may be expressed as a precursor protein with an intervening sequence that catalyzes multi-step, post translational protein splicing. Protein splicing involves the excision of an intervening sequence from a polypeptide with the concomitant joining of the flanking sequences to yield a new polypeptide (Chong, et al., (1996) J. Biol. Chem. 271:22159-22168). This intervening sequence or protein splicing element, referred to as inteins, which catalyze their own excision through three coordinated reactions at the N-terminal and C-terminal splice junctions: an acyl rearrangement of the N-terminal cysteine or Serine; a transesterfication reaction between the two termini to form a branched ester or thioester intermediate and peptide bond cleavage coupled to cyclization of the intein C-terminal asparagine to free the intein (Evans, et al., (2000) J. Biol. Chem. 275:9091-9094. The elucidation of the mechanism of protein splicing has led to a number of intein-based applications (Comb, et al., U.S. Pat. No. 5,496,714; Comb, et al., U.S. Pat. No. 5,834,247; Camarero and Muir, (1999) J. Amer. Chem. Soc. 121:5597-5598; Chong, et al., (1997) Gene 192:271-281, Chong, et al., (1998) Nucleic Acids Res. 26:5109-5115; Chong, et al., (1998) J. Biol. Chem. 273:10567-10577; Cotton, et al., (1999) J. Am. Chem. Soc. 121:1100-1101; Evans, et al., (1999) J. Biol. Chem. 274:18359-18363; Evans, et al., (1999) J. Biol. Chem. 274:3923-3926; Evans, et al., (1998) Protein Sci. 7:2256-2264; Evans, et al., (2000) J. Biol. Chem. 275:9091-9094; Iwai and Pluckthun, (1999) FEBS Lett. 459:166-172; Mathys, et al., (1999) Gene 231:1-13; Mills, et al., (1998) Proc. Natl. Acad. Sci. USA 95:3543-3548; Muir, et al., (1998) Proc. Natl. Acad. Sci. USA 95:6705-6710; Otomo, et al., (1999) Biochemistry 38:16040-16044; Otomo, et al., (1999) J. Biolmol. NMR 14:105-114; Scott, et al., (1999) Proc. Natl. Acad. Sci. USA 96:13638-13643; Severinov and Muir, (1998) J. Biol. Chem. 273:16205-16209; Shingledecker, et al., (1998) Gene 207:187-195; Southworth, et al., (1998) EMBO J. 17:918-926; Southworth, et al., (1999) Biotechniques 27:110-120; Wood, et al., (1999) Nat. Biotechnol. 17:889-892; Wu, et al., (1998a) Proc. Natl. Acad. Sci. USA 95:9226-9231; Wu, et al., (1998b) Biochim Biophys Acta 1387:422-432; Xu, et al., (1999) Proc. Natl. Acad. Sci. USA 96:388-393; Yamazaki, et al., (1998) J. Am. Chem. Soc. 120:5591-5592). For the application of inteins in plant transgenes see Yang, J, et al., (Transgene Res 15:583-593 (2006)) and Evans, et al., (Annu. Rev. Plant Biol. 56:375-392, (2005)).
- In another aspect the PIP-1 polypeptide may be encoded by two separate genes where the intein of the precursor protein comes from the two genes, referred to as a split-intein and the two portions of the precursor are joined by a peptide bond formation. This peptide bond formation is accomplished by intein-mediated trans-splicing. For this purpose, a first and a second expression cassette comprising the two separate genes further code for inteins capable of mediating protein trans-splicing. By trans-splicing, the proteins and polypeptides encoded by the first and second fragments may be linked by peptide bond formation. Trans-splicing inteins may be selected from the nucleolar and organellar genomes of different organisms including eukaryotes, archaebacteria and eubacteria. Inteins that may be used for are listed at neb.com/neb/inteins.html, which can be accessed on the world-wide web using the “www” prefix). The nucleotide sequence coding for an intein may be split into a 5′ and a 3′ part that code for the 5′ and the 3′ part of the intein, respectively. Sequence portions not necessary for intein splicing (e.g., homing endonuclease domain) may be deleted. The intein coding sequence is split such that the 5′ and the 3′ parts are capable of trans-splicing. For selecting a suitable splitting site of the intein coding sequence, the considerations published by Southworth, et al., (1998) EMBO J. 17:918-926 may be followed. In constructing the first and the second expression cassette, the 5′ intein coding sequence is linked to the 3′ end of the first fragment coding for the N-terminal part of the PIP-1 polypeptide and the 3′ intein coding sequence is linked to the 5′ end of the second fragment coding for the C-terminal part of the PIP-1 polypeptide.
- In general, the trans-splicing partners can be designed using any split intein, including any naturally-occurring or artificially-split split intein. Several naturally-occurring split inteins are known, for example: the split intein of the DnaE gene of Synechocystis sp. PCC6803 (see, Wu, et al., (1998) Proc Natl Acad Sci USA 95(16):9226-31 and Evans, et al., (2000) J Biol Chem 275(13):9091-4 and of the DnaE gene from Nostoc punctiforme (see, Iwai, et al., (2006) FEBS Lett 580(7):1853-8). Non-split inteins have been artificially split in the laboratory to create new split inteins, for example: the artificially split Ssp DnaB intein (see, Wu, et al., (1998) Biochim Biophys Acta 1387:422-32) and split Sce VMA intein (see, Brenzel, et al., (2006) Biochemistry 45(6):1571-8) and an artificially split fungal mini-intein (see, Elleuche, et al., (2007) Biochem Biophys Res Commun 355(3):830-4). There are also intein databases available that catalogue known inteins (see, for example the online-database available at: bioinformatics.weizmann.ac.il/˜pietro/inteins/Inteinstable.html, which can be accessed on the world-wide web using the “www” prefix).
- Naturally-occurring non-split inteins may have endonuclease or other enzymatic activities that can typically be removed when designing an artificially-split split intein. Such mini-inteins or minimized split inteins are well known in the art and are typically less than 200 amino acid residues long (see, Wu, et al., (1998) Biochim Biophys Acta 1387:422-32). Suitable split inteins may have other purification enabling polypeptide elements added to their structure, provided that such elements do not inhibit the splicing of the split intein or are added in a manner that allows them to be removed prior to splicing. Protein splicing has been reported using proteins that comprise bacterial intein-like (BIL) domains (see, Amitai, et al., (2003) Mol Microbiol 47:61-73) and hedgehog (Hog) auto-processing domains (the latter is combined with inteins when referred to as the Hog/intein superfamily or HINT family (see, Dassa, et al., (2004) J Biol Chem. 279 32001-7) and domains such as these may also be used to prepare artificially-split inteins. In particular, non-splicing members of such families may be modified by molecular biology methodologies to introduce or restore splicing activity in such related species. Recent studies demonstrate that splicing can be observed when a N-terminal split intein component is allowed to react with a C-terminal split intein component not found in nature to be its “partner”; for example, splicing has been observed utilizing partners that have as little as 30 to 50% homology with the “natural” splicing partner (see, Dassa, et al., (2007) Biochemistry 46(1):322-30). Other such mixtures of disparate split intein partners have been shown to be unreactive one with another (see, Brenzel, et al., 2006 Biochemistry 45(6):1571-8). However, it is within the ability of a person skilled in the relevant art to determine whether a particular pair of polypeptides is able to associate with each other to provide a functional intein, using routine methods and without the exercise of inventive skill.
- In another aspect the PIP-1 polypeptide is a circular permuted variant. In certain embodiments the PIP-1 polypeptide is a circular permuted variant of the polypeptide of SEQ ID NO: 2, 4, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, and 332. In certain embodiments the PIP-1 polypeptide is a circular permuted variant of the polypeptide of SEQ ID NO: 2, 4, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, and 332.
- The development of recombinant DNA methods has made it possible to study the effects of sequence transposition on protein folding, structure and function. The approach used in creating new sequences resembles that of naturally occurring pairs of proteins that are related by linear reorganization of their amino acid sequences (Cunningham, et al., (1979) Proc. Natl. Acad. Sci. U.S.A. 76:3218-3222; Teather and Erfle, (1990) J. Bacteriol. 172:3837-3841; Schimming, et al., (1992) Eur. J. Biochem. 204:13-19; Yamiuchi and Minamikawa, (1991) FEBS Lett. 260:127-130; MacGregor, et al., (1996) FEBS Lett. 378:263-266). The first in vitro application of this type of rearrangement to proteins was described by Goldenberg and Creighton (J. Mol. Biol. 165:407-413, 1983). In creating a circular permuted variant a new N-terminus is selected at an internal site (breakpoint) of the original sequence, the new sequence having the same order of amino acids as the original from the breakpoint until it reaches an amino acid that is at or near the original C-terminus. At this point the new sequence is joined, either directly or through an additional portion of sequence (linker), to an amino acid that is at or near the original N-terminus and the new sequence continues with the same sequence as the original until it reaches a point that is at or near the amino acid that was N-terminal to the breakpoint site of the original sequence, this residue forming the new C-terminus of the chain. The length of the amino acid sequence of the linker can be selected empirically or with guidance from structural information or by using a combination of the two approaches. When no structural information is available, a small series of linkers can be prepared for testing using a design whose length is varied in order to span a range from 0 to 50 Å and whose sequence is chosen in order to be consistent with surface exposure (hydrophilicity, Hopp and Woods, (1983) Mol. Immunol. 20:483-489; Kyte and Doolittle, (1982) J. Mol. Biol. 157:105-132; solvent exposed surface area, Lee and Richards, (1971) J. Mol. Biol. 55:379-400) and the ability to adopt the necessary conformation without deranging the configuration of the pesticidal polypeptide (conformationally flexible; Karplus and Schulz, (1985) Naturwissenschaften 72:212-213. Assuming an average of translation of 2.0 to 3.8 Å per residue, this would mean the length to test would be between 0 to 30 residues, with 0 to 15 residues being the preferred range. Exemplary of such an empirical series would be to construct linkers using a cassette sequence such as Gly-Gly-Gly-Ser repeated n times, where n is 1, 2, 3 or 4. Those skilled in the art will recognize that there are many such sequences that vary in length or composition that can serve as linkers with the primary consideration being that they be neither excessively long nor short (cf., Sandhu, (1992) Critical Rev. Biotech. 12:437-462); if they are too long, entropy effects will likely destabilize the three-dimensional fold, and may also make folding kinetically impractical, and if they are too short, they will likely destabilize the molecule because of torsional or steric strain. Those skilled in the analysis of protein structural information will recognize that using the distance between the chain ends, defined as the distance between the c-alpha carbons, can be used to define the length of the sequence to be used or at least to limit the number of possibilities that must be tested in an empirical selection of linkers. They will also recognize that it is sometimes the case that the positions of the ends of the polypeptide chain are ill-defined in structural models derived from x-ray diffraction or nuclear magnetic resonance spectroscopy data, and that when true, this situation will therefore need to be taken into account in order to properly estimate the length of the linker required. From those residues whose positions are well defined are selected two residues that are close in sequence to the chain ends, and the distance between their c-alpha carbons is used to calculate an approximate length for a linker between them. Using the calculated length as a guide, linkers with a range of number of residues (calculated using 2 to 3.8 Å per residue) are then selected. These linkers may be composed of the original sequence, shortened or lengthened as necessary, and when lengthened the additional residues may be chosen to be flexible and hydrophilic as described above; or optionally the original sequence may be substituted for using a series of linkers, one example being the Gly-Gly-Gly-Ser cassette approach mentioned above; or optionally a combination of the original sequence and new sequence having the appropriate total length may be used. Sequences of pesticidal polypeptides capable of folding to biologically active states can be prepared by appropriate selection of the beginning (amino terminus) and ending (carboxyl terminus) positions from within the original polypeptide chain while using the linker sequence as described above. Amino and carboxyl termini are selected from within a common stretch of sequence, referred to as a breakpoint region, using the guidelines described below. A novel amino acid sequence is thus generated by selecting amino and carboxyl termini from within the same breakpoint region. In many cases the selection of the new termini will be such that the original position of the carboxyl terminus immediately preceded that of the amino terminus. However, those skilled in the art will recognize that selections of termini anywhere within the region may function, and that these will effectively lead to either deletions or additions to the amino or carboxyl portions of the new sequence. It is a central tenet of molecular biology that the primary amino acid sequence of a protein dictates folding to the three-dimensional structure necessary for expression of its biological function. Methods are known to those skilled in the art to obtain and interpret three-dimensional structural information using x-ray diffraction of single protein Crystals or nuclear magnetic resonance spectroscopy of protein solutions. Examples of structural information that are relevant to the identification of breakpoint regions include the location and type of protein secondary structure (alpha and 3-10 helices, parallel and anti-parallel beta sheets, chain reversals and turns, and loops; Kabsch and Sander, (1983) Biopolymers 22:2577-2637; the degree of solvent exposure of amino acid residues, the extent and type of interactions of residues with one another (Chothia, (1984) Ann. Rev. Biochem. 53:537-572) and the static and dynamic distribution of conformations along the polypeptide chain (Alber and Mathews, (1987) Methods Enzymol. 154:511-533). In some cases additional information is known about solvent exposure of residues; one example is a site of post-translational attachment of carbohydrate which is necessarily on the surface of the protein. When experimental structural information is not available or is not feasible to obtain, methods are also available to analyze the primary amino acid sequence in order to make predictions of protein tertiary and secondary structure, solvent accessibility and the occurrence of turns and loops. Biochemical methods are also sometimes applicable for empirically determining surface exposure when direct structural methods are not feasible; for example, using the identification of sites of chain scission following limited proteolysis in order to infer surface exposure (Gentile and Salvatore, (1993) Eur. J. Biochem. 218:603-621). Thus using either the experimentally derived structural information or predictive methods (e.g., Srinivisan and Rose, (1995) Proteins: Struct., Funct. & Genetics 22:81-99) the parental amino acid sequence is inspected to classify regions according to whether or not they are integral to the maintenance of secondary and tertiary structure. The occurrence of sequences within regions that are known to be involved in periodic secondary structure (alpha and 3-10 helices, parallel and anti-parallel beta sheets) are regions that should be avoided. Similarly, regions of amino acid sequence that are observed or predicted to have a low degree of solvent exposure are more likely to be part of the so-called hydrophobic core of the protein and should also be avoided for selection of amino and carboxyl termini. In contrast, those regions that are known or predicted to be in surface turns or loops, and especially those regions that are known not to be required for biological activity, are the preferred sites for location of the extremes of the polypeptide chain. Continuous stretches of amino acid sequence that are preferred based on the above criteria are referred to as a breakpoint region. Polynucleotides encoding circular permuted PIP-1 polypeptides with new N-terminus/C-terminus which contain a linker region separating the original C-terminus and N-terminus can be made essentially following the method described in Mullins, et al., (1994) J. Am. Chem. Soc. 116:5529-5533. Multiple steps of polymerase chain reaction (PCR) amplifications are used to rearrange the DNA sequence encoding the primary amino acid sequence of the protein. Polynucleotides encoding circular permuted PIP-1 polypeptides with new N-terminus/C-terminus which contain a linker region separating the original C-terminus and N-terminus can be made based on the tandem-duplication method described in Horlick, et al., (1992) Protein Eng. 5:427-431. Polymerase chain reaction (PCR) amplification of the new N-terminus/C-terminus genes is performed using a tandemly duplicated template DNA.
- In another aspect fusion proteins are provided that include within its amino acid sequence an amino acid sequence comprising a PIP-1 polypeptide including but not limited to the polypeptide of SEQ ID NO: 2, 4, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, and 332.
- In some embodiments fusion proteins comprises a PIP-1 polypeptide of SEQ ID NO: 2, 4, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 332, and active fragments thereof.
- In another aspect fusion proteins are provided comprising a PIP-1 polypeptide and a second pesticidal polypeptide such a Cry protein. Methods for design and construction of fusion proteins (and polynucleotides encoding same) are known to those of skill in the art. Polynucleotides encoding a PIP-1 polypeptide may be fused to signal sequences which will direct the localization of the PIP-1 polypeptide to particular compartments of a prokaryotic or eukaryotic cell and/or direct the secretion of the PIP-1 polypeptide of the embodiments from a prokaryotic or eukaryotic cell. For example, in E. coli, one may wish to direct the expression of the protein to the periplasmic space. Examples of signal sequences or proteins (or fragments thereof) to which the PIP-1 polypeptide may be fused in order to direct the expression of the polypeptide to the periplasmic space of bacteria include, but are not limited to, the pe/B signal sequence, the maltose binding protein (MBP) signal sequence, MBP, the ompA signal sequence, the signal sequence of the periplasmic E. coli heat-labile enterotoxin B-subunit, and the signal sequence of alkaline phosphatase. Several vectors are commercially available for the construction of fusion proteins which will direct the localization of a protein, such as the pMAL series of vectors (particularly the pMAL-p series) available from New England Biolabs. In a specific embodiment, the PIP-1 polypeptide may be fused to the pe/B pectate lyase signal sequence to increase the efficiency of expression and purification of such polypeptides in Gram-negative bacteria (see, U.S. Pat. Nos. 5,576,195 and 5,846,818). Plant plastid transit peptide/polypeptide fusions are well known in the art (see, U.S. Pat. No. 7,193,133). Apoplast transit peptides such as rice or barley alpha-amylase secretion signal are also well known in the art. The plastid transit peptide is generally fused N-terminal to the polypeptide to be targeted (e.g., the fusion partner). In one embodiment, the fusion protein consists essentially of the peptide transit plastid and the PIP-1 polypeptide to be targeted. In another embodiment, the fusion protein comprises the peptide transit plastid and the polypeptide to be targeted. In such embodiments, the plastid transit peptide is preferably at the N-terminus of the fusion protein. However, additional amino acid residues may be N-terminal to the plastid transit peptide providing that the fusion protein is at least partially targeted to a plastid. In a specific embodiment, the plastid transit peptide is in the N-terminal half, N-terminal third or N-terminal quarter of the fusion protein. Most or all of the plastid transit peptide is generally cleaved from the fusion protein upon insertion into the plastid. The position of cleavage may vary slightly between plant species, at different plant developmental stages, as a result of specific intercellular conditions or the particular combination of transit peptide/fusion partner used. In one embodiment, the plastid transit peptide cleavage is homogenous such that the cleavage site is identical in a population of fusion proteins. In another embodiment, the plastid transit peptide is not homogenous, such that the cleavage site varies by 1-10 amino acids in a population of fusion proteins. The plastid transit peptide can be recombinantly fused to a second protein in one of several ways. For example, a restriction endonuclease recognition site can be introduced into the nucleotide sequence of the transit peptide at a position corresponding to its C-terminal end and the same or a compatible site can be engineered into the nucleotide sequence of the protein to be targeted at its N-terminal end. Care must be taken in designing these sites to ensure that the coding sequences of the transit peptide and the second protein are kept “in frame” to allow the synthesis of the desired fusion protein. In some cases, it may be preferable to remove the initiator methionine codon of the second protein when the new restriction site is introduced. The introduction of restriction endonuclease recognition sites on both parent molecules and their subsequent joining through recombinant DNA techniques may result in the addition of one or more extra amino acids between the transit peptide and the second protein. This generally does not affect targeting activity as long as the transit peptide cleavage site remains accessible and the function of the second protein is not altered by the addition of these extra amino acids at its N-terminus. Alternatively, one skilled in the art can create a precise cleavage site between the transit peptide and the second protein (with or without its initiator methionine) using gene synthesis (Stemmer, et al., (1995) Gene 164:49-53) or similar methods. In addition, the transit peptide fusion can intentionally include amino acids downstream of the cleavage site. The amino acids at the N-terminus of the mature protein can affect the ability of the transit peptide to target proteins to plastids and/or the efficiency of cleavage following protein import. This may be dependent on the protein to be targeted. See, e.g., Comai, et al., (1988) J. Biol. Chem. 263(29):15104-9.
- In some embodiments fusion proteins are provide comprising a PIP-1 polypeptide, a pesticidal protein such as a Cry protein, and an amino acid linker.
- In some embodiments fusion proteins are provided represented by a formula selected from the group consisting of
-
R1-L-R2, R2-L-R1, R1-R2 or R2-R1 - where R1 is a PIP-1 polypeptide, R2 is a pesticidal protein with a different but complementary activity to the PIP-1 polypeptide, including but not limited to Cry proteins; a polypeptide that increases the solubility and/or stability of the PIP-1 polypeptide; or a transit peptide or leader sequence. The R1 polypeptide is fused either directly or through a linker segment to the R2 polypeptide. The term “directly” defines fusions in which the polypeptides are joined without a peptide linker. Thus L represents a chemical bound or polypeptide segment to which both R1 and R2 are fused in frame, most commonly L is a linear peptide to which R1 and R2 are bound by amide bonds linking the carboxy terminus of R1 to the amino terminus of L and carboxy terminus of L to the amino terminus of R2. By “fused in frame” is meant that there is no translation termination or disruption between the reading frames of R1 and R2. The linking group (L) is generally a polypeptide of between 1 and 500 amino acids in length. The linkers joining the two molecules are preferably designed to (1) allow the two molecules to fold and act independently of each other, (2) not have a propensity for developing an ordered secondary structure which could interfere with the functional domains of the two proteins, (3) have minimal hydrophobic or charged characteristic which could interact with the functional protein domains and (4) provide steric separation of R1 and R2 such that R1 and R2 could interact simultaneously with their corresponding receptors on a single cell. Typically surface amino acids in flexible protein regions include Gly, Asn and Ser. Virtually any permutation of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above criteria for a linker sequence. Other neutral amino acids, such as Thr and Ala, may also be used in the linker sequence. Additional amino acids may also be included in the linkers due to the addition of unique restriction sites in the linker sequence to facilitate construction of the fusions.
- In some embodiments the linkers comprise sequences selected from the group of formulas: (Gly3Ser)n, (Gly4Ser)n, (Gly5Ser)n, (GlynSer)n or (AlaGlySer)n where n is an integer. One example of a highly-flexible linker is the (GlySer)-rich spacer region present within the pIII protein of the filamentous bacteriophages, e.g., bacteriophages M13 or fd (Schaller, et al., 1975). This region provides a long, flexible spacer region between two domains of the pIII surface protein. Also included are linkers in which an endopeptidase recognition sequence is included. Such a cleavage site may be valuable to separate the individual components of the fusion to determine if they are properly folded and active in vitro. Examples of various endopeptidases include, but are not limited to, Plasmin, Enterokinase, Kallikerin, Urokinase, Tissue Plasminogen activator, clostripain, Chymosin, Collagenase, Russell's Viper Venom Protease, Postproline cleavage enzyme, V8 protease, Thrombin and factor Xa. In some embodiments the linker comprises the amino acids EEKKN from the multi-gene expression vehicle (MGEV), which is cleaved by vacuolar proteases as disclosed in US 2007/0277263. In other embodiments, peptide linker segments from the hinge region of heavy chain immunoglobulins IgG, IgA, IgM, IgD or IgE provide an angular relationship between the attached polypeptides. Especially useful are those hinge regions where the cysteines are replaced with serines. Preferred linkers of the present invention include sequences derived from murine IgG gamma 2b hinge region in which the cysteines have been changed to serines. The fusion proteins are not limited by the form, size or number of linker sequences employed and the only requirement of the linker is that functionally it does not interfere adversely with the folding and function of the individual molecules of the fusion.
- In another aspect chimeric PIP-1 polypeptide are provided that are created through joining two or more portions of genes, which originally encoded separate insecticidal proteins from different species, to create a chimeric gene. The translation of the chimeric gene results in a single chimeric pesticidal polypeptide with regions, motifs or domains derived from each of the original polypeptides. In certain embodiments the chimeric protein comprises portions, motifs or domains of PIP-1A (SEQ ID NO: 2) and orthologs PSEEN3174 (SEQ ID NO: 6), PIP-1C (SEQ ID NO: 332), and PIP-1B (SEQ ID NO: 4) in any combination. In certain embodiments the chimeric insecticidal polypeptide includes but not limited to the polypeptides of SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, and 332.
- It is recognized that DNA sequences may be altered by various methods, and that these alterations may result in DNA sequences encoding proteins with amino acid sequences different than that encoded by the wild-type (or native) pesticidal protein. These proteins may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions of one or more amino acids, including up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40 45, 50, about 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155 or more amino acid substitutions, deletions and/or insertions or combinations thereof compared to SEQ ID NO: 2 or 4 including but not limited to SEQ ID NO: 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 204, 206, 208, 211, 212, 213, 214, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, and 332. In some embodiments a PIP-1 polypeptide comprises the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or more amino acids from the N-terminus of the PIP-1 polypeptide relative to the amino acid position of SEQ ID NO: 2. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of a PIP-1 polypeptide can be prepared by mutations in the DNA. This may also be accomplished by one of several forms of mutagenesis and/or in directed evolution. In some aspects, the changes encoded in the amino acid sequence will not substantially affect the function of the protein. Such variants will possess the desired pesticidal activity. However, it is understood that the ability of a PIP-1 polypeptide to confer pesticidal activity may be improved by the use of such techniques upon the compositions of this disclosure.
- For example, conservative amino acid substitutions may be made at one or more, predicted, nonessential amino acid residues. A “nonessential” amino acid residue is a residue that can be altered from the wild-type sequence of a PIP-1 polypeptide without altering the biological activity. A “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include: amino acids with basic side chains (e.g., lysine, arginine, histidine); acidic side chains (e.g., aspartic acid, glutamic acid); polar, negatively charged residues and their amides (e.g., aspartic acid, asparagine, glutamic, acid, glutamine; uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine); small aliphatic, nonpolar or slightly polar residues (e.g., Alanine, serine, threonine, proline, glycine); nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); large aliphatic, nonpolar residues (e.g., methionine, leucine, isoleucine, valine, cystine); beta-branched side chains (e.g., threonine, valine, isoleucine); aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine); large aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan).
- Amino acid substitutions may be made in nonconserved regions that retain function. In general, such substitutions would not be made for conserved amino acid residues or for amino acid residues residing within a conserved motif, where such residues are essential for protein activity. Examples of residues that are conserved and that may be essential for protein activity include, for example, residues that are identical between all proteins contained in an alignment of similar or related toxins to the sequences of the embodiments (e.g., residues that are identical in an alignment of homologous proteins). Examples of residues that are conserved but that may allow conservative amino acid substitutions and still retain activity include, for example, residues that have only conservative substitutions between all proteins contained in an alignment of similar or related toxins to the sequences of the embodiments (e.g., residues that have only conservative substitutions between all proteins contained in the alignment homologous proteins). However, one of skill in the art would understand that functional variants may have minor conserved or nonconserved alterations in the conserved residues. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff, et al., (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference.
- In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, (1982) J Mol Biol. 157(1):105-32). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens and the like.
- It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, i.e., still obtain a biological functionally equivalent protein. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte and Doolittle, ibid). These are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (−0.4); threonine (−0.7); serine (−0.8); tryptophan (−0.9); tyrosine (−1.3); proline (−1.6); histidine (−3.2); glutamate (−3.5); glutamine (−3.5); aspartate (−3.5); asparagine (−3.5); lysine (−3.9) and arginine (−4.5). In making such changes, the substitution of amino acids whose hydropathic indices are within +2 is preferred, those which are within +1 are particularly preferred and those within +0.5 are even more particularly preferred.
- It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Pat. No. 4,554,101, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein.
- As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0.+0.1); glutamate (+3.0.+0.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (−0.4); proline (−0.5.+0.1); alanine (−0.5); histidine (−0.5); cysteine (−1.0); methionine (−1.3); valine (−1.5); leucine (−1.8); isoleucine (−1.8); tyrosine (−2.3); phenylalanine (−2.5); tryptophan (−3.4).
- Alternatively, alterations may be made to the protein sequence of many proteins at the amino or carboxy terminus without substantially affecting activity. This can include insertions, deletions or alterations introduced by modern molecular methods, such as PCR, including PCR amplifications that alter or extend the protein coding sequence by virtue of inclusion of amino acid encoding sequences in the oligonucleotides utilized in the PCR amplification. Alternatively, the protein sequences added can include entire protein-coding sequences, such as those used commonly in the art to generate protein fusions.
- Such fusion proteins are often used to (1) increase expression of a protein of interest (2) introduce a binding domain, enzymatic activity or epitope to facilitate either protein purification, protein detection or other experimental uses known in the art (3) target secretion or translation of a protein to a subcellular organelle, such as the periplasmic space of Gram-negative bacteria, mitochondria or chloroplasts of plants or the endoplasmic reticulum of eukaryotic cells, the latter of which often results in glycosylation of the protein.
- In some embodiments, the PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 2 having an amino acid substitutions compared to the native amino acid of SEQ ID NO: 2 at one or more residues selected from
positions - Variant nucleotide and amino acid sequences of the disclosure also encompass sequences derived from mutagenic and recombinogenic procedures such as DNA shuffling. With such a procedure, one or more different PIP-1 polypeptide coding regions can be used to create a new PIP-1 polypeptide possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest may be shuffled between a pesticidal gene and other known pesticidal genes to obtain a new gene coding for a protein with an improved property of interest, such as an increased insecticidal activity. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer, (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer, (1994) Nature 370:389-391; Crameri, et al., (1997) Nature Biotech. 15:436-438; Moore, et al., (1997) J. Mol. Biol. 272:336-347; Zhang, et al., (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri, et al., (1998) Nature 391:288-291 and U.S. Pat. Nos. 5,605,793 and 5,837,458.
- Domain swapping or shuffling is another mechanism for generating altered PIP-1 polypeptides. Domains may be swapped between PIP-1 polypeptides, resulting in hybrid or chimeric toxins with improved pesticidal activity or target spectrum. Methods for generating recombinant proteins and testing them for pesticidal activity are well known in the art (see, for example, Naimov, et al., (2001) Appl. Environ. Microbiol. 67:5328-5330; de Maagd, et al., (1996) Appl. Environ. Microbiol. 62:1537-1543; Ge, et al., (1991) J. Biol. Chem. 266:17954-17958; Schnepf, et al., (1990) J. Biol. Chem. 265:20923-20930; Rang, et al., 91999) Appl. Environ. Microbiol. 65:2918-2925).
- Both DNA shuffling and site directed mutagenesis were used to define polypeptide sequences that possess pesticidal activity. In Example 8 DNA shuffling was used to generate a library of active variants by recombination of the diversity present in PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6). The person skilled in the art will be able to use comparisons to other proteins or functional assays to further define motifs. High throughput screening can be used to test variations of those motifs to determine the role of specific residues. Given that knowledge for several motifs, one can then define the requirements for a functional protein. Knowledge of the motifs allows the skilled artisan to design sequence variations that would not impact function.
- This line of investigation was pursued in Examples 9-11. Alignment of homologues of SEQ ID NO: 2, 4 and 6 allowed identification of residues that are highly conserved among natural homologues in this family (
FIG. 1 ). In example 9 saturation mutagenesis was used to make and test most or all possible substitutions at each of 6 conserved residues. These mutants were tested for activity and a number of active substitutions not present among the homologues were identified providing an understanding of the functional constraints at these residues. In Example 10 four motifs were identified among the most conserved regions in the alignment of SEQ ID NO: 2, 4 and 6. To further characterize the functional constraints on these sequence motifs, they were compared to a set of three distant homologues (AECFG_592740 (SEQ ID NO: 12), Pput_1063 (SEQ ID NO: 8), and Pput_1064 (SEQ ID NO: 10) that have no detectable insecticidal activity (FIG. 1 ). These homologues are deemed to fall within the same PFAM as SEQ ID NO: 2, 4 and 6 and thus are likely to share the same overall fold. The sequences corresponding to these four motifs from these distant homologues were swapped into the PIP-1A backbone. The data presented in Example 10 demonstrates that these motifs are under relatively stringent functional constraints, as most of the motif swaps from the distant homologues resulted in loss of function. In Example 11 the functional constraints on two of these motifs were further examined by performing saturation mutagenesis on all residues inmotifs - Antibodies to a PIP-1 polypeptide of the embodiments or to variants or fragments thereof, are also encompassed. Methods for producing antibodies are well known in the art (see, for example, Harlow and Lane, (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; U.S. Pat. No. 4,196,265).
- A kit for detecting the presence of a PIP-1 polypeptide, or detecting the presence of a nucleotide sequence encoding a PIP-1 polypeptide, in a sample is provided. In one embodiment, the kit provides antibody-based reagents for detecting the presence of a PIP-1 polypeptide in a tissue sample. In another embodiment, the kit provides labeled nucleic acid probes useful for detecting the presence of one or more polynucleotides encoding PIP-1 polypeptide(s). The kit is provided along with appropriate reagents and controls for carrying out a detection method, as well as instructions for use of the kit
- Receptors to the PIP-1 polypeptide of the embodiments or to variants or fragments thereof, are also encompassed. Methods for identifying receptors are well known in the art (see, Hofmann, et. al., (1988) Eur. J. Biochem. 173:85-91; Gill, et al., (1995) J. Biol. Chem. 27277-27282) can be employed to identify and isolate the receptor that recognizes the PIP-1 polypeptides using the brush-border membrane vesicles from susceptible insects. In addition to the radioactive labeling method listed in the cited literatures, PIP-1 polypeptide can be labeled with fluorescent dye and other common labels such as streptavidin. Brush-border membrane vesicles (BBMV) of susceptible insects such as soybean looper and stink bugs can be prepared according to the protocols listed in the references and separated on SDS-PAGE gel and blotted on suitable membrane. Labeled PIP-1 polypeptides can be incubated with blotted membrane of BBMV and labeled the PIP-1 polypeptides can be identified with the labeled reporters. Identification of protein band(s) that interact with the PIP-1 polypeptides can be detected by N-terminal amino acid gas phase sequencing or mass spectrometry based protein identification method (Patterson, (1998) 10(22):1-24, Current Protocol in Molecular Biology published by John Wiley & Son Inc). Once the protein is identified, the corresponding gene can be cloned from genomic DNA or cDNA library of the susceptible insects and binding affinity can be measured directly with the PIP-1 polypeptides. Receptor function for insecticidal activity by the PIP-1 polypeptides can be verified by accomplished by RNAi type of gene knock out method (Rajagopal, et al., (2002) J. Biol. Chem. 277:46849-46851).
- The use of the term “nucleotide constructs” herein is not intended to limit the embodiments to nucleotide constructs comprising DNA. Those of ordinary skill in the art will recognize that nucleotide constructs particularly polynucleotides and oligonucleotides composed of ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides may also be employed in the methods disclosed herein. The nucleotide constructs, nucleic acids, and nucleotide sequences of the embodiments additionally encompass all complementary forms of such constructs, molecules and sequences. Further, the nucleotide constructs, nucleotide molecules and nucleotide sequences of the embodiments encompass all nucleotide constructs, molecules and sequences which can be employed in the methods of the embodiments for transforming plants including, but not limited to, those comprised of deoxyribonucleotides, ribonucleotides and combinations thereof. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The nucleotide constructs, nucleic acids, and nucleotide sequences of the embodiments also encompass all forms of nucleotide constructs including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures and the like.
- A further embodiment relates to a transformed organism such as an organism selected from plant and insect cells, bacteria, yeast, baculovirus, protozoa, nematodes and algae. The transformed organism comprises a DNA molecule of the embodiments, an expression cassette comprising the DNA molecule or a vector comprising the expression cassette, which may be stably incorporated into the genome of the transformed organism.
- The sequences of the embodiments are provided in DNA constructs for expression in the organism of interest. The construct will include 5′ and 3′ regulatory sequences operably linked to a sequence of the embodiments. The term “operably linked” as used herein refers to a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and where necessary to join two protein coding regions in the same reading frame. The construct may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple DNA constructs.
- Such a DNA construct is provided with a plurality of restriction sites for insertion of the PIP-1 polypeptide gene sequence to be under the transcriptional regulation of the regulatory regions. The DNA construct may additionally contain selectable marker genes.
- The DNA construct will generally include in the 5′ to 3′ direction of transcription: a transcriptional and translational initiation region (i.e., a promoter), a DNA sequence of the embodiments and a transcriptional and translational termination region (i.e., termination region) functional in the organism serving as a host. The transcriptional initiation region (i.e., the promoter) may be native, analogous, foreign or heterologous to the host organism and/or to the sequence of the embodiments. Additionally, the promoter may be the natural sequence or alternatively a synthetic sequence. The term “foreign” as used herein indicates that the promoter is not found in the native organism into which the promoter is introduced. Where the promoter is “foreign” or “heterologous” to the sequence of the embodiments, it is intended that the promoter is not the native or naturally occurring promoter for the operably linked sequence of the embodiments. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence. Where the promoter is a native or natural sequence, the expression of the operably linked sequence is altered from the wild-type expression, which results in an alteration in phenotype.
- In some embodiments the DNA construct may also include a transcriptional enhancer sequence. As used herein, the term an “enhancer” refers to a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Various enhancers are known in the art including for example, introns with gene expression enhancing properties in plants (US Patent Application Publication Number 2009/0144863, the ubiquitin intron (i.e., the maize ubiquitin intron 1 (see, for example, NCBI sequence S94464)), the omega enhancer or the omega prime enhancer (Gallie, et al., (1989) Molecular Biology of RNA ed. Cech (Liss, New York) 237-256 and Gallie, et al., (1987) Gene 60:217-25), the CaMV 35S enhancer (see, e.g., Benfey, et al., (1990) EMBO J. 9:1685-96) and the enhancers of U.S. Pat. No. 7,803,992 may also be used, each of which is incorporated by reference. The above list of transcriptional enhancers is not meant to be limiting. Any appropriate transcriptional enhancer can be used in the embodiments.
- The termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, may be native with the plant host or may be derived from another source (i.e., foreign or heterologous to the promoter, the sequence of interest, the plant host or any combination thereof).
- Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also, Guerineau, et al., (1991) Mol. Gen. Genet. 262:141-144; Proudfoot, (1991) Cell 64:671-674; Sanfacon, et al., (1991) Genes Dev. 5:141-149; Mogen, et al., (1990) Plant Cell 2:1261-1272; Munroe, et al., (1990) Gene 91:151-158; Ballas, et al., (1989) Nucleic Acids Res. 17:7891-7903 and Joshi, et al., (1987) Nucleic Acid Res. 15:9627-9639.
- Where appropriate, a nucleic acid may be optimized for increased expression in the host organism. Thus, where the host organism is a plant, the synthetic nucleic acids can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri, (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage. For example, although nucleic acid sequences of the embodiments may be expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific codon preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et al. (1989) Nucleic Acids Res. 17:477-498). Thus, the maize-preferred codon for a particular amino acid may be derived from known gene sequences from maize. Maize codon usage for 28 genes from maize plants is listed in Table 4 of Murray, et al., supra. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831, and 5,436,391 and Murray, et al., (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.
- Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other well-characterized sequences that may be deleterious to gene expression. The GC content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. The term “host cell” as used herein refers to a cell which contains a vector and supports the replication and/or expression of the expression vector is intended. Host cells may be prokaryotic cells such as E. coli or eukaryotic cells such as yeast, insect, amphibian or mammalian cells or monocotyledonous or dicotyledonous plant cells. An example of a monocotyledonous host cell is a maize host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
- The expression cassettes may additionally contain 5′ leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (
Encephalomyocarditis 5′ noncoding region) (Elroy-Stein, et al., (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie, et al., (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic Virus), human immunoglobulin heavy-chain binding protein (BiP) (Macejak, et al., (1991) Nature 353:90-94); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling, et al., (1987) Nature 325:622-625); tobacco mosaic virus leader (TMV) (Gallie, et al., (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256) and maize chlorotic mottle virus leader (MCMV) (Lommel, et al., (1991) Virology 81:382-385). See also, Della-Cioppa, et al., (1987) Plant Physiol. 84:965-968. Such constructs may also contain a “signal sequence” or “leader sequence” to facilitate co-translational or post-translational transport of the peptide to certain intracellular structures such as the chloroplast (or other plastid), endoplasmic reticulum or Golgi apparatus. - By “signal sequence” is intended a sequence that is known or suspected to result in cotranslational or post-translational peptide transport across the cell membrane. In eukaryotes, this typically involves secretion into the Golgi apparatus, with some resulting glycosylation. Insecticidal toxins of bacteria are often synthesized as protoxins, which are protolytically activated in the gut of the target pest (Chang, (1987) Methods Enzymol. 153:507-516). In some embodiments, the signal sequence is located in the native sequence or may be derived from a sequence of the embodiments. By “leader sequence” is intended any sequence that when translated, results in an amino acid sequence sufficient to trigger co-translational transport of the peptide chain to a subcellular organelle. Thus, this includes leader sequences targeting transport and/or glycosylation by passage into the endoplasmic reticulum, passage to vacuoles, plastids including chloroplasts, mitochondria and the like. Nuclear-encoded proteins targeted to the chloroplast thylakoid lumen compartment have a characteristic bipartite transit peptide, composed of a stromal targeting signal peptide and a lumen targeting signal peptide. The stromal targeting information is in the amino-proximal portion of the transit peptide. The lumen targeting signal peptide is in the carboxyl-proximal portion of the transit peptide, and contains all the information for targeting to the lumen. Recent research in proteomics of the higher plant chloroplast has achieved in the identification of numerous nuclear-encoded lumen proteins (Kieselbach et al. FEBS LETT 480:271-276, 2000; Peltier et al. Plant Cell 12:319-341, 2000; Bricker et al. Biochim. Biophys Acta 1503:350-356, 2001), the lumen targeting signal peptide of which can potentially be used in accordance with the present invention. About 80 proteins from Arabidopsis, as well as homologous proteins from spinach and garden pea, are reported by Kieselbach et al., Photosynthesis Research, 78:249-264, 2003. In particular, table 2 of this publication, which is incorporated into the description herewith by reference, discloses 85 proteins from the chloroplast lumen, identified by their accession number (see also US Patent Application Publication 2009/09044298). In addition, the recently published draft version of the rice genome (Goff et al, Science 296:92-100, 2002) is a suitable source for lumen targeting signal peptide which may be used in accordance with the present invention.
- Suitable chloroplast transit peptides (CTP) are well known to one skilled in the art including chimeric CTPs comprising but not limited to, an N-terminal domain, a central domain or a C-terminal domain from a CTP from Oryza sativa 1-deoxy-D xyulose-5-Phosphate Synthase Oryza sativa-Superoxide dismutase Oryza sativa-soluble starch synthase Oryza sativa-NADP-dependent Malic acid enzyme Oryza sativa-Phospho-2-dehydro-3-
deoxyheptonate Aldolase 2 Oryza sativa-L-Ascorbate peroxidase 5 Oryza sativa-Phosphoglucan water dikinase, Zea mays ssRUBISCO, Zea mays-beta-glucosidase, Zea mays-Malate dehydrogenase, Zea mays Thioredoxin M-type US Patent Application Publication 2012/0304336). - The PIP-1 polypeptide gene to be targeted to the chloroplast may be optimized for expression in the chloroplast to account for differences in codon usage between the plant nucleus and this organelle. In this manner, the nucleic acids of interest may be synthesized using chloroplast-preferred codons. See, for example, U.S. Pat. No. 5,380,831, herein incorporated by reference.
- In preparing the expression cassette, the various DNA fragments may be manipulated so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.
- A number of promoters can be used in the practice of the embodiments. The promoters can be selected based on the desired outcome. The nucleic acids can be combined with constitutive, tissue-preferred, inducible or other promoters for expression in the host organism. Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 1999/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell, et al., (1985) Nature 313:810-812); rice actin (McElroy, et al., (1990) Plant Cell 2:163-171); ubiquitin (Christensen, et al., (1989) Plant Mol. Biol. 12:619-632 and Christensen, et al., (1992) Plant Mol. Biol. 18:675-689); pEMU (Last, et al., (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten, et al., (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Pat. No. 5,659,026) and the like. Other constitutive promoters include, for example, those discussed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611.
- Depending on the desired outcome, it may be beneficial to express the gene from an inducible promoter. Of particular interest for regulating the expression of the nucleotide sequences of the embodiments in plants are wound-inducible promoters. Such wound-inducible promoters, may respond to damage caused by insect feeding, and include potato proteinase inhibitor (pin II) gene (Ryan, (1990) Ann. Rev. Phytopath. 28:425-449; Duan, et al., (1996) Nature Biotechnology 14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1 and win2 (Stanford, et al., (1989) Mol. Gen. Genet. 215:200-208); systemin (McGurl, et al., (1992) Science 225:1570-1573); WIP1 (Rohmeier, et al., (1993) Plant Mol. Biol. 22:783-792; Eckelkamp, et al., (1993) FEBS Letters 323:73-76); MPI gene (Corderok, et al., (1994) Plant J. 6(2):141-150) and the like, herein incorporated by reference.
- Additionally, pathogen-inducible promoters may be employed in the methods and nucleotide constructs of the embodiments. Such pathogen-inducible promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi, et al., (1983) Neth. J. Plant Pathol. 89:245-254; Uknes, et al., (1992) Plant Cell 4:645-656 and Van Loon, (1985) Plant Mol. Virol. 4:111-116. See also, WO 1999/43819, herein incorporated by reference.
- Of interest are promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau, et al., (1987) Plant Mol. Biol. 9:335-342; Matton, et al., (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch, et al., (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch, et al., (1988) Mol. Gen. Genet. 2:93-98 and Yang, (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen, et al., (1996) Plant J. 10:955-966; Zhang, et al., (1994) Proc. Natl. Acad. Sci. USA 91:2507-2511; Warner, et al., (1993) Plant J. 3:191-201; Siebertz, et al., (1989) Plant Cell 1:961-968; U.S. Pat. No. 5,750,386 (nematode-inducible) and the references cited therein. Of particular interest is the inducible promoter for the maize PRms gene, whose expression is induced by the pathogen Fusarium moniliforme (see, for example, Cordero, et al., (1992) Physiol. Mol. Plant Path. 41:189-200).
- Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena, et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis, et al., (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz, et al., (1991) Mol. Gen. Genet. 227:229-237 and U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by reference.
- Tissue-preferred promoters can be utilized to target enhanced PIP-1 polypeptide expression within a particular plant tissue. Tissue-preferred promoters include those discussed in Yamamoto, et al., (1997) Plant J. 12(2)255-265; Kawamata, et al., (1997) Plant Cell Physiol. 38(7):792-803; Hansen, et al., (1997) Mol. Gen Genet. 254(3):337-343; Russell, et al., (1997) Transgenic Res. 6(2):157-168; Rinehart, et al., (1996) Plant Physiol. 112(3):1331-1341; Van Camp, et al., (1996) Plant Physiol. 112(2):525-535; Canevascini, et al., (1996) Plant Physiol. 112(2):513-524; Yamamoto, et al., (1994) Plant Cell Physiol. 35(5):773-778; Lam, (1994) Results Probl. Cell Differ. 20:181-196; Orozco, et al., (1993) Plant Mol Biol. 23(6):1129-1138; Matsuoka, et al., (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590 and Guevara-Garcia, et al., (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression.
- Leaf-preferred promoters are known in the art. See, for example, Yamamoto, et al., (1997) Plant J. 12(2):255-265; Kwon, et al., (1994) Plant Physiol. 105:357-67; Yamamoto, et al., (1994) Plant Cell Physiol. 35(5):773-778; Gotor, et al., (1993) Plant J. 3:509-18; Orozco, et al., (1993) Plant Mol. Biol. 23(6):1129-1138 and Matsuoka, et al., (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.
- Root-preferred or root-specific promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire, et al., (1992) Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner, (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger, et al., (1990) Plant Mol. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens) and Miao, et al., (1991) Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic glutamine synthetase (GS), which is expressed in roots and root nodules of soybean). See also, Bogusz, et al., (1990) Plant Cell 2(7):633-641, where two root-specific promoters isolated from hemoglobin genes from the nitrogen-fixing nonlegume Parasponia andersonii and the related non-nitrogen-fixing nonlegume Trema tomentosa are described. The promoters of these genes were linked to a β-glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tabacum and the legume Lotus corniculatus, and in both instances root-specific promoter activity was preserved. Leach and Aoyagi, (1991) describe their analysis of the promoters of the highly expressed rolC and rolD root-inducing genes of Agrobacterium rhizogenes (see, Plant Science (Limerick) 79(1):69-76). They concluded that enhancer and tissue-preferred DNA determinants are dissociated in those promoters. Teer, et al., (1989) used gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR2′ gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene (see, EMBO J. 8(2):343-350). The TR1 gene fused to nptII (neomycin phosphotransferase II) showed similar characteristics. Additional root-preferred promoters include the VfENOD-GRP3 gene promoter (Kuster, et al., (1995) Plant Mol. Biol. 29(4):759-772) and rolB promoter (Capana, et al., (1994) Plant Mol. Biol. 25(4):681-691. See also, U.S. Pat. Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732 and 5,023,179.
- “Seed-preferred” promoters include both “seed-specific” promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as “seed-germinating” promoters (those promoters active during seed germination). See, Thompson, et al., (1989) BioEssays 10:108, herein incorporated by reference. Such seed-preferred promoters include, but are not limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa zein); and milps (myo-inositol-1-phosphate synthase) (see, U.S. Pat. No. 6,225,529, herein incorporated by reference). Gamma-zein and Glb-1 are endosperm-specific promoters. For dicots, seed-specific promoters include, but are not limited to, Kunitz trypsin inhibitor 3 (KTi3) (Jofuku, K. D. and Goldberg, R. B. Plant Cell 1:1079-1093, 1989), bean β-phaseolin, napin, β-conglycinin,
glycinin 1, soybean lectin, cruciferin, and the like. For monocots, seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2,globulin 1, etc. See also, WO 2000/12733, where seed-preferred promoters from end1 and end2 genes are disclosed; herein incorporated by reference. In dicots, seed specific promoters include but are not limited to seed coat promoter from Arabidopsis, pBAN; and the early seed promoters from Arabidopsis, p26, p63, and p63tr (U.S. Pat. Nos. 7,294,760 and 7,847,153). A promoter that has “preferred” expression in a particular tissue is expressed in that tissue to a greater degree than in at least one other plant tissue. Some tissue-preferred promoters show expression almost exclusively in the particular tissue. - Where low level expression is desired, weak promoters will be used. Generally, the term “weak promoter” as used herein refers to a promoter that drives expression of a coding sequence at a low level. By low level expression at levels of about 1/1000 transcripts to about 1/100,000 transcripts to about 1/500,000 transcripts is intended. Alternatively, it is recognized that the term “weak promoters” also encompasses promoters that drive expression in only a few cells and not in others to give a total low level of expression. Where a promoter drives expression at unacceptably high levels, portions of the promoter sequence can be deleted or modified to decrease expression levels.
- Such weak constitutive promoters include, for example the core promoter of the Rsyn7 promoter (WO 1999/43838 and U.S. Pat. No. 6,072,050), the core 35S CaMV promoter, and the like. Other constitutive promoters include, for example, those disclosed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611, herein incorporated by reference.
- The above list of promoters is not meant to be limiting. Any appropriate promoter can be used in the embodiments.
- Generally, the expression cassette will comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones and 2,4-dichlorophenoxyacetate (2,4-D). Additional examples of suitable selectable marker genes include, but are not limited to, genes encoding resistance to chloramphenicol (Herrera Estrella, et al., (1983) EMBO J. 2:987-992); methotrexate (Herrera Estrella, et al., (1983) Nature 303:209-213 and Meijer, et al., (1991) Plant Mol. Biol. 16:807-820); streptomycin (Jones, et al., (1987) Mol. Gen. Genet. 210:86-91); spectinomycin (Bretagne-Sagnard, et al., (1996) Transgenic Res. 5:131-137); bleomycin (Hille, et al., (1990) Plant Mol. Biol. 7:171-176); sulfonamide (Guerineau, et al., (1990) Plant Mol. Biol. 15:127-136); bromoxynil (Stalker, et al., (1988) Science 242:419-423); glyphosate (Shaw, et al., (1986) Science 233:478-481 and U.S. patent application Ser. Nos. 10/004,357 and 10/427,692); phosphinothricin (DeBlock, et al., (1987) EMBO J. 6:2513-2518). See generally, Yarranton, (1992) Curr. Opin. Biotech. 3:506-511; Christopherson, et al., (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao, et al., (1992) Cell 71:63-72; Reznikoff, (1992) Mol. Microbiol. 6:2419-2422; Barkley, et al., (1980) in The Operon, pp. 177-220; Hu, et al., (1987) Cell 48:555-566; Brown, et al., (1987) Cell 49:603-612; Figge, et al., (1988) Cell 52:713-722; Deuschle, et al., (1989) Proc. Natl. Acad. Sci. USA 86:5400-5404; Fuerst, et al., (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle, et al., (1990) Science 248:480-483; Gossen, (1993) Ph.D. Thesis, University of Heidelberg; Reines, et al., (1993) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow, et al., (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti, et al., (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Baim, et al., (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski, et al., (1991) Nucleic Acids Res. 19:4647-4653; Hillenand-Wissman, (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb, et al., (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt, et al., (1988) Biochemistry 27:1094-1104; Bonin, (1993) Ph.D. Thesis, University of Heidelberg; Gossen, et al., (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva, et al., (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka, et al., (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin) and Gill, et al., (1988) Nature 334:721-724. Such disclosures are herein incorporated by reference.
- The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the embodiments.
- The methods of the embodiments involve introducing a polypeptide or polynucleotide into a plant. “Introducing” is intended to mean presenting to the plant the polynucleotide or polypeptide in such a manner that the sequence gains access to the interior of a cell of the plant. The methods of the embodiments do not depend on a particular method for introducing a polynucleotide or polypeptide into a plant, only that the polynucleotide or polypeptides gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotide or polypeptides into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods and virus-mediated methods.
- “Stable transformation” is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. “Transient transformation” is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant. By “plant” is intended whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, plant cells, propagules, embryos and progeny of the same. Plant cells can be differentiated or undifferentiated (e.g. callus, suspension culture cells, protoplasts, leaf cells, root cells, phloem cells, and pollen).
- Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway, et al., (1986) Biotechniques 4:320-334), electroporation (Riggs, et al., (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,563,055 and 5,981,840), direct gene transfer (Paszkowski, et al., (1984) EMBO J. 3:2717-2722) and ballistic particle acceleration (see, for example, U.S. Pat. Nos. 4,945,050; 5,879,918; 5,886,244 and 5,932,782; Tomes, et al., (1995) in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips, (Springer-Verlag, Berlin) and McCabe, et al., (1988) Biotechnology 6:923-926) and Led transformation (WO 2000/28058). For potato transformation see, Tu, et al., (1998) Plant Molecular Biology 37:829-838 and Chong, et al., (2000) Transgenic Research 9:71-78. Additional transformation procedures can be found in Weissinger, et al., (1988) Ann. Rev. Genet. 22:421-477; Sanford, et al., (1987) Particulate Science and Technology 5:27-37 (onion); Christou, et al., (1988) Plant Physiol. 87:671-674 (soybean); McCabe, et al., (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen, (1991) In Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh, et al., (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta, et al., (1990) Biotechnology 8:736-740 (rice); Klein, et al., (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein, et al., (1988) Biotechnology 6:559-563 (maize); U.S. Pat. Nos. 5,240,855; 5,322,783 and 5,324,646; Klein, et al., (1988) Plant Physiol. 91:440-444 (maize); Fromm, et al., (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren, et al., (1984) Nature (London) 311:763-764; U.S. Pat. No. 5,736,369 (cereals); Bytebier, et al., (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet, et al., (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman, et al., (Longman, New York), pp. 197-209 (pollen); Kaeppler, et al., (1990) Plant Cell Reports 9:415-418 and Kaeppler, et al., (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin, et al., (1992) Plant Cell 4:1495-1505 (electroporation); Li, et al., (1993) Plant Cell Reports 12:250-255 and Christou and Ford, (1995) Annals of Botany 75:407-413 (rice); Osjoda, et al., (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all of which are herein incorporated by reference.
- In specific embodiments, the sequences of the embodiments can be provided to a plant using a variety of transient transformation methods. Such transient transformation methods include, but are not limited to, the introduction of the PIP-1 polypeptide or variants and fragments thereof directly into the plant or the introduction of the PIP-1 polypeptide transcript into the plant. Such methods include, for example, microinjection or particle bombardment. See, for example, Crossway, et al., (1986) Mol Gen. Genet. 202:179-185; Nomura, et al., (1986) Plant Sci. 44:53-58; Hepler, et al., (1994) Proc. Natl. Acad. Sci. 91:2176-2180 and Hush, et al., (1994) The Journal of Cell Science 107:775-784, all of which are herein incorporated by reference. Alternatively, the PIP-1 polypeptide polynucleotide can be transiently transformed into the plant using techniques known in the art. Such techniques include viral vector system and the precipitation of the polynucleotide in a manner that precludes subsequent release of the DNA. Thus, transcription from the particle-bound DNA can occur, but the frequency with which it is released to become integrated into the genome is greatly reduced. Such methods include the use of particles coated with polyethylimine (PEI; Sigma #P3143).
- Methods are known in the art for the targeted insertion of a polynucleotide at a specific location in the plant genome. In one embodiment, the insertion of the polynucleotide at a desired genomic location is achieved using a site-specific recombination system. See, for example, WO 1999/25821, WO 1999/25854, WO 1999/25840, WO 1999/25855 and WO 1999/25853, all of which are herein incorporated by reference. Briefly, the polynucleotide of the embodiments can be contained in transfer cassette flanked by two non-identical recombination sites. The transfer cassette is introduced into a plant have stably incorporated into its genome a target site which is flanked by two non-identical recombination sites that correspond to the sites of the transfer cassette. An appropriate recombinase is provided and the transfer cassette is integrated at the target site. The polynucleotide of interest is thereby integrated at a specific chromosomal position in the plant genome.
- Plant transformation vectors may be comprised of one or more DNA vectors needed for achieving plant transformation. For example, it is a common practice in the art to utilize plant transformation vectors that are comprised of more than one contiguous DNA segment. These vectors are often referred to in the art as “binary vectors”. Binary vectors as well as vectors with helper plasmids are most often used for Agrobacterium-mediated transformation, where the size and complexity of DNA segments needed to achieve efficient transformation is quite large, and it is advantageous to separate functions onto separate DNA molecules. Binary vectors typically contain a plasmid vector that contains the cis-acting sequences required for T-DNA transfer (such as left border and right border), a selectable marker that is engineered to be capable of expression in a plant cell, and a “gene of interest” (a gene engineered to be capable of expression in a plant cell for which generation of transgenic plants is desired). Also present on this plasmid vector are sequences required for bacterial replication. The cis-acting sequences are arranged in a fashion to allow efficient transfer into plant cells and expression therein. For example, the selectable marker gene and the pesticidal gene are located between the left and right borders. Often a second plasmid vector contains the trans-acting factors that mediate T-DNA transfer from Agrobacterium to plant cells. This plasmid often contains the virulence functions (Vir genes) that allow infection of plant cells by Agrobacterium, and transfer of DNA by cleavage at border sequences and vir-mediated DNA transfer, as is understood in the art (Hellens and Mullineaux, (2000) Trends in Plant Science 5:446-451). Several types of Agrobacterium strains (e.g. LBA4404, GV3101, EHA101, EHA105, etc.) can be used for plant transformation. The second plasmid vector is not necessary for transforming the plants by other methods such as microprojection, microinjection, electroporation, polyethylene glycol, etc.
- In general, plant transformation methods involve transferring heterologous DNA into target plant cells (e.g., immature or mature embryos, suspension cultures, undifferentiated callus, protoplasts, etc.), followed by applying a maximum threshold level of appropriate selection (depending on the selectable marker gene) to recover the transformed plant cells from a group of untransformed cell mass. Following integration of heterologous foreign DNA into plant cells, one then applies a maximum threshold level of appropriate selection in the medium to kill the untransformed cells and separate and proliferate the putatively transformed cells that survive from this selection treatment by transferring regularly to a fresh medium. By continuous passage and challenge with appropriate selection, one identifies and proliferates the cells that are transformed with the plasmid vector. Molecular and biochemical methods can then be used to confirm the presence of the integrated heterologous gene of interest into the genome of the transgenic plant.
- Explants are typically transferred to a fresh supply of the same medium and cultured routinely. Subsequently, the transformed cells are differentiated into shoots after placing on regeneration medium supplemented with a maximum threshold level of selecting agent. The shoots are then transferred to a selective rooting medium for recovering rooted shoot or plantlet. The transgenic plantlet then grows into a mature plant and produces fertile seeds (e.g., Hiei, et al., (1994) The Plant Journal 6:271-282; Ishida, et al., (1996) Nature Biotechnology 14:745-750). Explants are typically transferred to a fresh supply of the same medium and cultured routinely. A general description of the techniques and methods for generating transgenic plants are found in Ayres and Park, (1994) Critical Reviews in Plant Science 13:219-239 and Bommineni and Jauhar, (1997) Maydica 42:107-120. Since the transformed material contains many cells; both transformed and non-transformed cells are present in any piece of subjected target callus or tissue or group of cells. The ability to kill non-transformed cells and allow transformed cells to proliferate results in transformed plant cultures. Often, the ability to remove non-transformed cells is a limitation to rapid recovery of transformed plant cells and successful generation of transgenic plants.
- The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick, et al., (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains and the resulting hybrid having constitutive or inducible expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure that expression of the desired phenotypic characteristic has been achieved.
- The nucleotide sequences of the embodiments may be provided to the plant by contacting the plant with a virus or viral nucleic acids. Generally, such methods involve incorporating the nucleotide construct of interest within a viral DNA or RNA molecule. It is recognized that the recombinant proteins of the embodiments may be initially synthesized as part of a viral polyprotein, which later may be processed by proteolysis in vivo or in vitro to produce the desired PIP-1 polypeptide. It is also recognized that such a viral polyprotein, comprising at least a portion of the amino acid sequence of a PIP-1 polypeptide of the embodiments, may have the desired pesticidal activity. Such viral polyproteins and the nucleotide sequences that encode for them are encompassed by the embodiments. Methods for providing plants with nucleotide constructs and producing the encoded proteins in the plants, which involve viral DNA or RNA molecules are known in the art. See, for example, U.S. Pat. Nos. 5,889,191; 5,889,190; 5,866,785; 5,589,367 and 5,316,931, herein incorporated by reference.
- Methods for transformation of chloroplasts are known in the art. See, for example, Svab, et al., (1990) Proc. Natl. Acad. Sci. USA 87:8526-8530; Svab and Maliga, (1993) Proc. Natl. Acad. Sci. USA 90:913-917; Svab and Maliga, (1993) EMBO J. 12:601-606. The method relies on particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination. Additionally, plastid transformation can be accomplished by transactivation of a silent plastid-borne transgene by tissue-preferred expression of a nuclear-encoded and plastid-directed RNA polymerase. Such a system has been reported in McBride, et al., (1994) Proc. Natl. Acad. Sci. USA 91:7301-7305.
- The embodiments further relate to plant-propagating material of a transformed plant of the embodiments including, but not limited to, seeds, tubers, corms, bulbs, leaves, and cuttings of roots and shoots.
- The embodiments may be used for transformation of any plant species, including, but not limited to, monocots and dicots. Examples of plants of interest include, but are not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables ornamentals and conifers.
- Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum. Conifers that may be employed in practicing the embodiments include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta) and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis). Plants of the embodiments include crop plants (for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.), such as corn and soybean plants.
- Turf grasses include, but are not limited to: annual bluegrass (Poa annua); annual ryegrass (Lolium multiflorum); Canada bluegrass (Poa compressa); Chewing's fescue (Festuca rubra); colonial bentgrass (Agrostis tenuis); creeping bentgrass (Agrostis palustris); crested wheatgrass (Agropyron desertorum); fairway wheatgrass (Agropyron cristatum); hard fescue (Festuca longifolia); Kentucky bluegrass (Poa pratensis); orchardgrass (Dactylis glomerata); perennial ryegrass (Lolium perenne); red fescue (Festuca rubra); redtop (Agrostis alba); rough bluegrass (Poa trivialis); sheep fescue (Festuca ovina); smooth bromegrass (Bromus inermis); tall fescue (Festuca arundinacea); timothy (Phleum pratense); velvet bentgrass (Agrostis canina); weeping alkaligrass (Puccinellia distans); western wheatgrass (Agropyron smithii); Bermuda grass (Cynodon spp.); St. Augustine grass (Stenotaphrum secundatum); zoysia grass (Zoysia spp.); Bahia grass (Paspalum notatum); carpet grass (Axonopus affinis); centipede grass (Eremochloa ophiuroides); kikuyu grass (Pennisetum clandesinum); seashore paspalum (Paspalum vaginatum); blue gramma (Bouteloua gracilis); buffalo grass (Buchloe dactyloids); sideoats gramma (Bouteloua curtipendula).
- Plants of interest include grain plants that provide seeds of interest, oil-seed plants, and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, millet, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, flax, castor, olive etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
- Following introduction of heterologous foreign DNA into plant cells, the transformation or integration of heterologous gene in the plant genome is confirmed by various methods such as analysis of nucleic acids, proteins and metabolites associated with the integrated gene.
- PCR analysis is a rapid method to screen transformed cells, tissue or shoots for the presence of incorporated gene at the earlier stage before transplanting into the soil (Sambrook and Russell, (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). PCR is carried out using oligonucleotide primers specific to the gene of interest or Agrobacterium vector background, etc.
- Plant transformation may be confirmed by Southern blot analysis of genomic DNA (Sambrook and Russell, (2001) supra). In general, total DNA is extracted from the transformant, digested with appropriate restriction enzymes, fractionated in an agarose gel and transferred to a nitrocellulose or nylon membrane. The membrane or “blot” is then probed with, for example, radiolabeled 32P target DNA fragment to confirm the integration of introduced gene into the plant genome according to standard techniques (Sambrook and Russell, (2001) supra).
- In Northern blot analysis, RNA is isolated from specific tissues of transformant, fractionated in a formaldehyde agarose gel, and blotted onto a nylon filter according to standard procedures that are routinely used in the art (Sambrook and Russell, (2001) supra). Expression of RNA encoded by the pesticidal gene is then tested by hybridizing the filter to a radioactive probe derived from a pesticidal gene, by methods known in the art (Sambrook and Russell, (2001) supra).
- Western blot, biochemical assays and the like may be carried out on the transgenic plants to confirm the presence of protein encoded by the pesticidal gene by standard procedures (Sambrook and Russell, 2001, supra) using antibodies that bind to one or more epitopes present on the PIP-1 polypeptide.
- Transgenic plants may comprise a stack of one or more insecticidal polynucleotides disclosed herein with one or more additional polynucleotides resulting in the production or suppression of multiple polypeptide sequences. Transgenic plants comprising stacks of polynucleotide sequences can be obtained by either or both of traditional breeding methods or through genetic engineering methods. These methods include, but are not limited to, breeding individual lines each comprising a polynucleotide of interest, transforming a transgenic plant comprising a gene disclosed herein with a subsequent gene, and co-transformation of genes into a single plant cell. As used herein, the term “stacked” includes having two or more traits present in the same plant (e.g., both traits are incorporated into the nuclear genome, one trait is incorporated into the nuclear genome and one trait is incorporated into the genome of a plastid or both traits are incorporated into the genome of a plastid). In one non-limiting example, “stacked traits” comprise a molecular stack where the sequences are physically adjacent to each other. A trait, as used herein, refers to the phenotype derived from a particular sequence or groups of sequences. Co-transformation of genes can be carried out using single transformation vectors comprising multiple genes or genes carried separately on multiple vectors. If the sequences are stacked by genetically transforming the plants, the polynucleotide sequences of interest can be combined at any time and in any order. The traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes. For example, if two sequences will be introduced, the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis). Expression of the sequences can be driven by the same promoter or by different promoters. In certain cases, it may be desirable to introduce a transformation cassette that will suppress the expression of the polynucleotide of interest. This may be combined with any combination of other suppression cassettes or overexpression cassettes to generate the desired combination of traits in the plant. It is further recognized that polynucleotide sequences can be stacked at a desired genomic location using a site-specific recombination system. See, for example, WO 1999/25821, WO 1999/25854, WO 1999/25840, WO 1999/25855 and WO 1999/25853, all of which are herein incorporated by reference.
- In some embodiments the polynucleotides encoding the PIP-1 polypeptides disclosed herein, alone or stacked with one or more additional insect resistance traits can be stacked with one or more additional input traits (e.g., herbicide resistance, fungal resistance, virus resistance or stress tolerance, disease resistance, male sterility, stalk strength, and the like) or output traits (e.g., increased yield, modified starches, improved oil profile, balanced amino acids, high lysine or methionine, increased digestibility, improved fiber quality, drought resistance, and the like). Thus, the polynucleotide embodiments can be used to provide a complete agronomic package of improved crop quality with the ability to flexibly and cost effectively control any number of agronomic pests.
- Transgenes useful for stacking include but are not limited to:
1. Transgenes that Confer Resistance to Insects or Disease and that Encode: - (A) Plant disease resistance genes. Plant defenses are often activated by specific interaction between the product of a disease resistance gene (R) in the plant and the product of a corresponding avirulence (Avr) gene in the pathogen. A plant variety can be transformed with cloned resistance gene to engineer plants that are resistant to specific pathogen strains. See, for example, Jones, et al., (1994) Science 266:789 (cloning of the tomato Cf-9 gene for resistance to Cladosporium fulvum); Martin, et al., (1993) Science 262:1432 (tomato Pto gene for resistance to Pseudomonas syringae pv. tomato encodes a protein kinase); Mindrinos, et al., (1994) Cell 78:1089 (Arabidopsis RSP2 gene for resistance to Pseudomonas syringae), McDowell and Woffenden, (2003) Trends Biotechnol. 21(4):178-83 and Toyoda, et al., (2002) Transgenic Res. 11(6):567-82. A plant resistant to a disease is one that is more resistant to a pathogen as compared to the wild type plant.
- (B) Genes encoding a Bacillus thuringiensis protein, a derivative thereof or a synthetic polypeptide modeled thereon. See, for example, Geiser, et al., (1986) Gene 48:109, who disclose the cloning and nucleotide sequence of a Bt delta-endotoxin gene. Moreover, DNA molecules encoding delta-endotoxin genes can be purchased from American Type Culture Collection (Rockville, Md.), for example, under ATCC™ Accession Numbers 40098, 67136, 31995 and 31998. Other non-limiting examples of Bacillus thuringiensis transgenes being genetically engineered are given in the following patents and patent applications and hereby are incorporated by reference for this purpose: U.S. Pat. Nos. 5,188,960; 5,689,052; 5,880,275; 5,986,177; 6,023,013, 6,060,594, 6,063,597, 6,077,824, 6,620,988, 6,642,030, 6,713,259, 6,893,826, 7,105,332; 7,179,965, 7,208,474; 7,227,056, 7,288,643, 7,323,556, 7,329,736, 7,449,552, 7,468,278, 7,510,878, 7,521,235, 7,544,862, 7,605,304, 7,696,412, 7,629,504, 7,705,216, 7,772,465, 7,790,846, 7,858,849, and WO 1991/14778; WO 1999/31248; WO 2001/12731; WO 1999/24581 and WO 1997/40162.
- Genes encoding pesticidal proteins may also be stacked including but are not limited to: insecticidal proteins from Pseudomonas sp. such as PSEEN3174 (Monalysin, (2011) PLoS Pathogens, 7:1-13), from Pseudomonas protegens strain CHAO and Pf-5 (previously fluorescens) (Pechy-Tarr, (2008) Environmental Microbiology 10:2368-2386: GenBank Accession No. EU400157); from Pseudomonas taiwanensis (Liu, et al., (2010) J. Agric. Food Chem. 58:12343-12349) and from Pseudomonas pseudoalcligenes (Zhang, et al., (2009) Annals of Microbiology 59:45-50 and Li, et al., (2007) Plant Cell Tiss. Organ Cult. 89:159-168); insecticidal proteins from Photorhabdus sp. and Xenorhabdus sp. (Hinchliffe, et al., (2010) The Open Toxinology Journal 3:101-118 and Morgan, et al., (2001) Applied and Envir. Micro. 67:2062-2069), U.S. Pat. Nos. 6,048,838, and 6,379,946; and δ-endotoxins including, but not limited to, the Cry1, Cry2, Cry3, Cry4, Cry5, Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12, Cry13, Cry14, Cry15, Cry16, Cry17, Cry18, Cry19, Cry20, Cry21, Cry22, Cry23, Cry24, Cry25, Cry26, Cry27, Cry 28, Cry 29, Cry 30, Cry31, Cry32, Cry33, Cry34, Cry35, Cry36, Cry37, Cry38, Cry39, Cry40, Cry41, Cry42, Cry43, Cry44, Cry45, Cry 46, Cry47, Cry49,
Cry 51 and Cry55 classes of δ-endotoxin genes and the B. thuringiensis cytolytic Cyt1 and Cyt2 genes. Members of these classes of B. thuringiensis insecticidal proteins include, but are not limited to Cry1Aa1 (Accession #Accession #M11250), Cry1Aa2 (Accession #M10917), Cry1Aa3 (Accession #D00348), Cry1Aa4 (Accession #X13535), Cry1Aa5 (Accession #D17518), Cry1Aa6 (Accession #U43605), Cry1Aa7 (Accession #AF081790), Cry1Aa8 (Accession #126149), Cry1Aa9 (Accession #AB026261), Cry1Aa10 (Accession #AF154676), Cry1Aa11 (Accession #Y09663), Cry1Aa12 (Accession #AF384211), Cry1Aa13 (Accession #AF510713), Cry1Aa14 (Accession #AY197341), Cry1Aa15 (Accession #DQ062690), Cry1Ab1 (Accession #M13898), Cry1Ab2 (Accession #M12661), Cry1Ab3 (Accession #M15271), Cry1Ab4 (Accession #D00117), Cry1Ab5 (Accession #X04698), Cry1Ab6 (Accession #M37263), Cry1Ab7 (Accession #X13233), Cry1Ab8 (Accession #M16463), Cry1Ab9 (Accession #X54939), Cry1Ab10 (Accession #A29125), Cry1Ab11 (Accession #112419), Cry1Ab12 (Accession #AF059670), Cry1Ab13 (Accession #AF254640), Cry1Ab14 (Accession #U94191), Cry1Ab15 (Accession #AF358861), Cry1Ab16 (Accession #AF375608), Cry1Ab17 (Accession #AAT46415), Cry1Ab18 (Accession #AAQ88259), Cry1Ab19 (Accession #AY847289), Cry1Ab20 (Accession #DQ241675), Cry1Ab21 (Accession #EF683163), Cry1Ab22 (Accession #ABW87320), Cry1Ab-like (Accession #AF327924), Cry1Ab-like (Accession #AF327925), Cry1Ab-like (Accession #AF327926), Cry1Ab-like (Accession #DQ781309), Cry1Ac1 (Accession #M11068), Cry1Ac2 (Accession #M35524), Cry1Ac3 (Accession #X54159), Cry1Ac4 (Accession #M73249), Cry1Ac5 (Accession #M73248), Cry1Ac6 (Accession #U43606), Cry1Ac7 (Accession #U87793), Cry1Ac8 (Accession #U87397), Cry1Ac9 (Accession #U89872), Cry1Ac10 (Accession #AJ002514), Cry1Ac11 (Accession #AJ130970), Cry1Ac12 (Accession #112418), Cry1Ac13 (Accession #AF148644), Cry1Ac14 (Accession #AF492767), Cry1Ac15 (Accession #AY122057), Cry1Ac16 (Accession #AY730621), Cry1Ac17 (Accession #AY925090), Cry1Ac18 (Accession #DQ023296), Cry1Ac19 (Accession #DQ195217), Cry1Ac20 (Accession #DQ285666), Cry1Ac21 (Accession #DQ062689), Cry1Ac22 (Accession #EU282379), Cry1Ac23 (Accession #AM949588), Cry1Ac24 (Accession #ABL01535), Cry1Ad1 (Accession #M73250), Cry1Ad2 (Accession #A27531), Cry1Ae1 (Accession #M65252), Cry1Af1 (Accession #U82003), Cry1Ag1 (Accession #AF081248), Cry1Ah1 (Accession #AF281866), Cry1Ah2 (Accession #DQ269474), Cry1Ai1 (Accession #AY174873), Cry1A-like (Accession #AF327927), Cry1Ba1 (Accession #X06711), Cry1Ba2 (Accession #X95704), Cry1Ba3 (Accession #AF368257), Cry1Ba4 (Accession #AF363025), Cry1Ba5 (Accession #AB020894), Cry1Ba6 (Accession #ABL60921), Cry1Bb1 (Accession #L32020), Cry1Bc1 (Accession #Z46442), Cry1Bd1 (Accession #U70726), Cry1Bd2 (Accession #AY138457), Cry1 Be1 (Accession #AF077326), Cry1Be2 (Accession #AAQ52387), Cry1Bf1 (Accession #AX189649), Cry1Bf2 (Accession #AAQ52380), Cry1Bg1 (Accession #AY176063), Cry1Ca1 (Accession #X07518), Cry1Ca2 (Accession #X13620), Cry1Ca3 (Accession #M73251), Cry1Ca4 (Accession #A27642), Cry1Ca5 (Accession #X96682), Cry1Ca6 [1] (Accession #AF215647), Cry1Ca7 (Accession #AY015492), Cry1Ca8 (Accession #AF362020), Cry1Ca9 (Accession #AY078160), Cry1Ca10 (Accession #AF540014), Cry1Ca11 (Accession #AY955268), Cry1Cb1 (Accession #M97880), Cry1Cb2 (Accession #AY007686), Cry1Cb3 (Accession #EU679502), Cry1Cb-like (Accession #AAX63901), Cry1Da1 (Accession #X54160), Cry1Da2 (Accession #176415), Cry1db1 (Accession #Z22511), Cry1db2 (Accession #AF358862), Cry1Dc1 (Accession #EF059913), Cry1Ea1 (Accession #X53985), Cry1Ea2 (Accession #X56144), Cry1Ea3 (Accession #M73252), Cry1Ea4 (Accession #U94323), Cry1Ea5 (Accession #A15535), Cry1Ea6 (Accession #AF202531), Cry1Ea7 (Accession #AAW72936), Cry1Ea8 (Accession #ABX11258), Cry1Eb1 (Accession #M73253), Cry1Fa1 (Accession #M63897), Cry1Fa2 (Accession #M73254), Cry1Fb1 (Accession #Z22512), Cry1Fb2 (Accession #AB012288), Cry1Fb3 (Accession #AF062350), Cry1Fb4 (Accession #173895), Cry1Fb5 (Accession #AF336114), Cry1Fb6 (Accession #EU679500), Cry1Fb7 (Accession #EU679501), Cry1Ga1 (Accession #Z22510), Cry1Ga2 (Accession #Y09326), Cry1Gb1 (Accession #U70725), Cry1Gb2 (Accession #AF288683), Cry1Gc (Accession #AAQ52381), Cry1Ha1 (Accession #Z22513), Cry1Hb1 (Accession #U35780), Cry1H-like (Accession #AF182196), Cry11a1 (Accession #X62821), Cry11a2 (Accession #M98544), Cry11a3 (Accession #L36338), Cry11a4 (Accession #L49391), Cry11a5 (Accession #Y08920), Cry11a6 (Accession #AF076953), Cry11a7 (Accession #AF278797), Cry11a8 (Accession #AF373207), Cry11a9 (Accession #AF521013), Cry11a10 (Accession #AY262167), Cry11a11 (Accession #AJ315121), Cry11a12 (Accession #AAV53390), Cry11a13 (Accession #ABF83202), Cry11a14 (Accession #EU887515), Cry11b1 (Accession #U07642), Cry11b2 (Accession #ABW88019), Cry11b3 (Accession #EU677422), Cry11c1 (Accession #AF056933), Cry11c2 (Accession #AAE71691), Cry11d1 (Accession #AF047579), CryIle1 (Accession #AF211190), Cry11f1 (Accession #AAQ52382), Cry11-like (Accession #190732), Cry11-like (Accession #DQ781310), Cry1Ja1 (Accession #L32019), Cry1Jb1 (Accession #U31527), Cry1Jc1 (Accession #190730), Cry1Jc2 (Accession #AAQ52372), Cry1Jd1 (Accession #AX189651), Cry1Ka1 (Accession #U28801), Cry1La1 (Accession #AAS60191), Cry1-like (Accession #190729), Cry2Aa1 (Accession #M31738), Cry2Aa2 (Accession #M23723), Cry2Aa3 (Accession #D86064), Cry2Aa4 (Accession #AF047038), Cry2Aa5 (Accession #AJ132464), Cry2Aa6 (Accession #AJ132465), Cry2Aa7 (Accession #AJ132463), Cry2Aa8 (Accession #AF252262), Cry2Aa9 (Accession #AF273218), Cry2Aa10 (Accession #AF433645), Cry2Aa11 (Accession #AAQ52384), Cry2Aa12 (Accession #DQ977646), Cry2Aa13 (Accession #ABL01536), Cry2Aa14 (Accession #ACF04939), Cry2Ab1 (Accession #M23724), Cry2Ab2 (Accession #X55416), Cry2Ab3 (Accession #AF164666), Cry2Ab4 (Accession #AF336115), Cry2Ab5 (Accession #AF441855), Cry2Ab6 (Accession #AY297091), Cry2Ab7 (Accession #DQ119823), Cry2Ab8 (Accession #DQ361266), Cry2Ab9 (Accession #DQ341378), Cry2Ab10 (Accession #EF157306), Cry2Ab11 (Accession #AM691748), Cry2Ab12 (Accession #ABM21764), Cry2Ab13 (Accession #EU909454), Cry2Ab14 (Accession #EU909455), Cry2Ac1 (Accession #X57252), Cry2Ac2 (Accession #AY007687), Cry2Ac3 (Accession #AAQ52385), Cry2Ac4 (Accession #DQ361267), Cry2Ac5 (Accession #DQ341379), Cry2Ac6 (Accession #DQ359137), Cry2Ac7 (Accession #AM292031), Cry2Ac8 (Accession #AM421903), Cry2Ac9 (Accession #AM421904), Cry2Ac10 (Accession #BI 877475), Cry2Ac11 (Accession #AM689531), Cry2Ac12 (Accession #AM689532), Cry2Ad1 (Accession #AF200816), Cry2Ad2 (Accession #DQ358053), Cry2Ad3 (Accession #AM268418), Cry2Ad4 (Accession #AM490199), Cry2Ad5 (Accession #AM765844), Cry2Ae1 (Accession #AAQ52362), Cry2Af1 (Accession #EF439818), Cry2Ag (Accession #ACH91610), Cry2Ah (Accession #EU939453), Cry3Aa1 (Accession #M22472), Cry3Aa2 (Accession #J02978), Cry3Aa3 (Accession #Y00420), Cry3Aa4 (Accession #M30503), Cry3Aa5 (Accession #M37207), Cry3Aa6 (Accession #U10985), Cry3Aa7 (Accession #AJ237900), Cry3Aa8 (Accession #AAS79487), Cry3Aa9 (Accession #AAW05659), Cry3Aa10 (Accession #AAU29411), Cry3Aa11 (Accession #AY882576), Cry3Aa12 (Accession #ABY49136), Cry3Ba1 (Accession #X17123), Cry3Ba2 (Accession #A07234), Cry3Bb1 (Accession #M89794), Cry3Bb2 (Accession #U31633), Cry3Bb3 (Accession #115475), Cry3Ca1 (Accession #X59797), Cry4Aa1 (Accession #Y00423), Cry4Aa2 (Accession #D00248), Cry4Aa3 (Accession #AL731825), Cry4A-like (Accession #DQ078744), Cry4Ba1 (Accession #X07423), Cry4Ba2 (Accession #X07082), Cry4Ba3 (Accession #M20242), Cry4Ba4 (Accession #D00247), Cry4Ba5 (Accession #AL731825), Cry4Ba-like (Accession #ABC47686), Cry4Ca1 (Accession #EU646202), Cry5Aa1 (Accession #L07025), Cry5Ab1 (Accession #L07026), Cry5Ac1 (Accession #134543), Cry5Ad1 (Accession #EF219060), Cry5Ba1 (Accession #U19725), Cry5Ba2 (Accession #EU121522), Cry6Aa1 (Accession #L07022), Cry6Aa2 (Accession #AF499736), Cry6Aa3 (Accession #DQ835612), Cry6Ba1 (Accession #L07024), Cry7Aa1 (Accession #M64478), Cry7Ab1 (Accession #U04367), Cry7Ab2 (Accession #U04368), Cry7Ab3 (Accession #BI 1015188), Cry7Ab4 (Accession #EU380678), Cry7Ab5 (Accession #ABX79555), Cry7Ab6 (Accession #FJ194973), Cry7Ba1 (Accession #ABB70817), Cry7Ca1 (Accession #EF486523), Cry8Aa1 (Accession #U04364), Cry8Ab1 (Accession #EU044830), Cry8Ba1 (Accession #U04365), Cry8Bb1 (Accession #AX543924), Cry8Bc1 (Accession #AX543926), Cry8Ca1 (Accession #U04366), Cry8Ca2 (Accession #AAR98783), Cry8Ca3 (Accession #EU625349), Cry8Da1 (Accession #AB089299), Cry8Da2 (Accession #BD133574), Cry8Da3 (Accession #BD133575), Cry8db1 (Accession #AB303980), Cry8Ea1 (Accession #AY329081), Cry8Ea2 (Accession #EU047597), Cry8Fa1 (Accession #AY551093), Cry8Ga1 (Accession #AY590188), Cry8Ga2 (Accession #DQ318860), Cry8Ga3 (Accession #FJ198072), Cry8Ha1 (Accession #EF465532), Cry8Ia1 (Accession #EU381044), Cry8Ja1 (Accession #EU625348), Cry8 like (Accession #ABS53003), Cry9Aa1 (Accession #X58120), Cry9Aa2 (Accession #X58534), Cry9Aa like (Accession #AAQ52376), Cry9Ba1 (Accession #X75019), Cry9Bb1 (Accession #AY758316), Cry9Ca1 (Accession #Z37527), Cry9Ca2 (Accession #AAQ52375), Cry9Da1 (Accession #D85560), Cry9Da2 (Accession #AF042733), Cry9db1 (Accession #AY971349), Cry9Ea1 (Accession #AB011496), Cry9Ea2 (Accession #AF358863), Cry9Ea3 (Accession #EF157307), Cry9Ea4 (Accession #EU760456), Cry9Ea5 (Accession #EU789519), Cry9Ea6 (Accession #EU887516), Cry9Eb1 (Accession #AX189653), Cry9Ec1 (Accession #AF093107), Cry9Ed1 (Accession #AY973867), Cry9 like (Accession #AF093107), Cry10Aa1 (Accession #M12662), Cry10Aa2 (Accession #E00614), Cry10Aa3 (Accession #AL731825), Cry10A like (Accession #DQ167578), Cry11Aa1 (Accession #M31737), Cry11Aa2 (Accession #M22860), Cry11Aa3 (Accession #AL731825), Cry11Aa-like (Accession #DQ166531), Cry11Ba1 (Accession #X86902), Cry11Bb1 (Accession #AF017416), Cry12Aa1 (Accession #L07027), Cry13Aa1 (Accession #L07023), Cry14Aa1 (Accession #U13955), Cry15Aa1 (Accession #M76442), Cry16Aa1 (Accession #X94146), Cry17Aa1 (Accession #X99478), Cry18Aa1 (Accession #X99049), Cry18Ba1 (Accession #AF169250), Cry18Ca1 (Accession #AF169251), Cry19Aa1 (Accession #Y07603), Cry19Ba1 (Accession #D88381), Cry20Aa1 (Accession #U82518), Cry21Aa1 (Accession #132932), Cry21Aa2 (Accession #166477), Cry21 Ba1 (Accession #AB088406), Cry22Aa1 (Accession #134547), Cry22Aa2 (Accession #AX472772), Cry22Aa3 (Accession #EU715020), Cry22Ab1 (Accession #AAK50456), Cry22Ab2 (Accession #AX472764), Cry22Ba1 (Accession #AX472770), Cry23Aa1 (Accession #AAF76375), Cry24Aa1 (Accession #U88188), Cry24Ba1 (Accession #BAD32657), Cry24Ca1 (Accession #AM158318), Cry25Aa1 (Accession #U88189), Cry26Aa1 (Accession #AF122897), Cry27Aa1 (Accession #AB023293), Cry28Aa1 (Accession #AF132928), Cry28Aa2 (Accession #AF285775), Cry29Aa1 (Accession #AJ251977), Cry30Aa1 (Accession #AJ251978), Cry30Ba1 (Accession #BAD00052), Cry30Ca1 (Accession #BAD67157), Cry30Da1 (Accession #EF095955), Cry30db1 (Accession #BAE80088), Cry30Ea1 (Accession #EU503140), Cry30Fa1 (Accession #EU751609), Cry30Ga1 (Accession #EU882064), Cry31Aa1 (Accession #AB031065), Cry31Aa2 (Accession #AY081052), Cry31Aa3 (Accession #AB250922), Cry31Aa4 (Accession #AB274826), Cry31Aa5 (Accession #AB274827), Cry31Ab1 (Accession #AB250923), Cry31Ab2 (Accession #AB274825), Cry31Ac1 (Accession #AB276125), Cry32Aa1 (Accession #AY008143), Cry32Ba1 (Accession #BAB78601), Cry32Ca1 (Accession #BAB78602), Cry32Da1 (Accession #BAB78603), Cry33Aa1 (Accession #AAL26871), Cry34Aa1 (Accession #AAG50341), Cry34Aa2 (Accession #AAK64560), Cry34Aa3 (Accession #AY536899), Cry34Aa4 (Accession #AY536897), Cry34Ab1 (Accession #AAG41671), Cry34Ac1 (Accession #AAG50118), Cry34Ac2 (Accession #AAK64562), Cry34Ac3 (Accession #AY536896), Cry34Ba1 (Accession #AAK64565), Cry34Ba2 (Accession #AY536900), Cry34Ba3 (Accession #AY536898), Cry35Aa1 (Accession #AAG50342), Cry35Aa2 (Accession #AAK64561), Cry35Aa3 (Accession #AY536895), Cry35Aa4 (Accession #AY536892), Cry35Ab1 (Accession #AAG41672), Cry35Ab2 (Accession #AAK64563), Cry35Ab3 (Accession #AY536891), Cry35Ac1 (Accession #AAG50117), Cry35Ba1 (Accession #AAK64566), Cry35Ba2 (Accession #AY536894), Cry35Ba3 (Accession #AY536893), Cry36Aa1 (Accession #AAK64558), Cry37Aa1 (Accession #AAF76376), Cry38Aa1 (Accession #AAK64559), Cry39Aa1 (Accession #BAB72016), Cry40Aa1 (Accession #BAB72018), Cry40Ba1 (Accession #BAC77648), Cry40Ca1 (Accession #EU381045), Cry40Da1 (Accession #EU596478), Cry41Aa1 (Accession #AB116649), Cry41Ab1 (Accession #AB116651), Cry42Aa1 (Accession #AB116652), Cry43Aa1 (Accession #AB115422), Cry43Aa2 (Accession #AB176668), Cry43Ba1 (Accession #AB115422), Cry43-like (Accession #AB1115422), Cry44Aa (Accession #BAD08532), Cry45Aa (Accession #BAD22577), Cry46Aa (Accession #BAC79010), Cry46Aa2 (Accession #BAG68906), Cry46Ab (Accession #BAD35170), Cry47Aa (Accession #AY950229), Cry48Aa (Accession #AJ841948), Cry48Aa2 (Accession #AM237205), Cry48Aa3 (Accession #AM237206), Cry48Ab (Accession #AM237207), Cry48Ab2 (Accession #AM237208), Cry49Aa (Accession #AJ841948), Cry49Aa2 (Accession #AM237201), Cry49Aa3 (Accession #AM237203), Cry49Aa4 (Accession #AM237204), Cry49Ab1 (Accession #AM237202), Cry50Aa1 (Accession #AB253419), Cry51Aa1 (Accession #DQ836184), Cry52Aa1 (Accession #EF613489), Cry53Aa1 (Accession #EF633476), Cry54Aa1 (Accession #EU339367), Cry55Aa1 (Accession #EU121521), Cry55Aa2 (Accession #AAE33526). - Examples of δ-endotoxins also include but are not limited to Cry1A proteins of U.S. Pat. Nos. 5,880,275 and 7,858,849; a DIG-3 or DIG-11 toxin (N-terminal deletion of α-
helix 1 and/or α-helix 2 variants of Cry proteins such as Cry1A) of U.S. Pat. Nos. 8,304,604 and 8,304,605, Cry1B of U.S. patent application Ser. No. 10/525,318; Cry1C of U.S. Pat. No. 6,033,874; Cry1F of U.S. Pat. Nos. 5,188,960, 6,218,188; Cry1A/F chimeras of U.S. Pat. Nos. 7,070,982; 6,962,705 and 6,713,063); a Cry2 protein such as Cry2Ab protein of U.S. Pat. No. 7,064,249); a Cry3A protein including but not limited to an engineered hybrid insecticidal protein (eHIP) created by fusing unique combinations of variable regions and conserved blocks of at least two different Cry proteins (US Patent Application Publication Number 2010/0017914); a Cry4 protein; a Cry5 protein; a Cry6 protein; Cry8 proteins of U.S. Pat. Nos. 7,329,736, 7,449,552, 7,803,943, 7,476,781, 7,105,332, 7,378,499 and 7,462,760; a Cry9 protein such as such as members of the Cry9A, Cry9B, Cry9C, Cry9D, Cry9E, and Cry9F families; a Cry15 protein of Naimov, et al., (2008) Applied and Environmental Microbiology 74:7145-7151; a Cry22, a Cry34Ab1 protein of U.S. Pat. Nos. 6,127,180, 6,624,145 and 6,340,593; a CryET33 and CryET34 protein of U.S. Pat. Nos. 6,248,535, 6,326,351, 6,399,330, 6,949,626, 7,385,107 and 7,504,229; a CryET33 and CryET34 homologs of US Patent Publication Number 2006/0191034, 2012/0278954, and PCT Publication Number WO 2012/139004; a Cry35Ab1 protein of U.S. Pat. Nos. 6,083,499, 6,548,291 and 6,340,593; a Cry46 protein, aCry 51 protein, a Cry binary toxin; a TIC901 or related toxin; TIC807 of US 2008/0295207; ET29, ET37, TIC809, TIC810, TIC812, TIC127, TIC128 of PCT US 2006/033867; AXMI-027, AXMI-036, and AXMI-038 of U.S. Pat. No. 8,236,757; AXMI-031, AXMI-039, AXMI-040, AXMI-049 of U.S. Pat. No. 7,923,602; AXMI-018, AXMI-020, and AXMI-021 of WO 2006/083891; AXMI-010 of WO 2005/038032; AXMI-003 of WO 2005/021585; AXMI-008 of US 2004/0250311; AXMI-006 of US 2004/0216186; AXMI-007 of US 2004/0210965; AXMI-009 of US 2004/0210964; AXMI-014 of US 2004/0197917; AXMI-004 of US 2004/0197916; AXMI-028 and AXMI-029 of WO 2006/119457; AXMI-007, AXMI-008, AXMI-0080rf2, AXMI-009, AXMI-014 and AXMI-004 of WO 2004/074462; AXMI-150 of U.S. Pat. No. 8,084,416; AXMI-205 of US20110023184; AXMI-011, AXMI-012, AXMI-013, AXMI-015, AXMI-019, AXMI-044, AXMI-037, AXMI-043, AXMI-033, AXMI-034, AXMI-022, AXMI-023, AXMI-041, AXMI-063, and AXMI-064 of US 2011/0263488; AXMI-R1 and related proteins of US 2010/0197592; AXM1221Z, AXM1222z, AXM1223z, AXM1224z and AXM1225z of WO 2011/103248; AXM1218, AXM1219, AXM1220, AXM1226, AXM1227, AXM1228, AXM1229, AXM1230, and AXM1231 of WO11/103247; AXMI-115, AXMI-113, AXMI-005, AXMI-163 and AXMI-184 of U.S. Pat. No. 8,334,431; AXMI-001, AXMI-002, AXMI-030, AXMI-035, and AXMI-045 of US 2010/0298211; AXMI-066 and AXMI-076 of US20090144852; AXM1128, AXM1130, AXM1131, AXM1133, AXM1140, AXM1141, AXM1142, AXM1143, AXM1144, AXM1146, AXM1148, AXM1149, AXM1152, AXM1153, AXM1154, AXM1155, AXM1156, AXM1157, AXM1158, AXM1162, AXM1165, AXM1166, AXM1167, AXM1168, AXM1169, AXM1170, AXM1171, AXM1172, AXM1173, AXM1174, AXM1175, AXM1176, AXM1177, AXM1178, AXM1179, AXM1180, AXM1181, AXM1182, AXM1185, AXM1186, AXM1187, AXM1188, AXM1189 of U.S. Pat. No. 8,318,900; AXM1079, AXM1080, AXM1081, AXM1082, AXM1091, AXM1092, AXM1096, AXM1097, AXM1098, AXM1099, AXM1100, AXM1101, AXM1102, AXM1103, AXM1104, AXM1107, AXM1108, AXM1109, AXM1110, AXM1111, AXM1112, AXM1114, AXM1116, AXM1117, AXM1118, AXM1119, AXM1120, AXM1121, AXM1122, AXM1123, AXM1124, AXM11257, AXM11268, AXM1127, AXM1129, AXM1164, AXM1151, AXM1161, AXM1183, AXM1132, AXM1138, AXM1137 of US 2010/0005543; Cry proteins such as Cry1A and Cry3A having modified proteolytic sites of U.S. Pat. No. 8,319,019; and a Cry1Ac, Cry2Aa and Cry1Ca toxin protein from Bacillus thuringiensis strain VBTS 2528 of US Patent Application Publication Number 2011/0064710. Other Cry proteins are well known to one skilled in the art (see, Crickmore, et al., “Bacillus thuringiensis toxin nomenclature” (2011), at lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/ which can be accessed on the world-wide web using the “www” prefix). The insecticidal activity of Cry proteins is well known to one skilled in the art (for review, see, van Frannkenhuyzen, (2009) J. Invert. Path. 101:1-16). The use of Cry proteins as transgenic plant traits is well known to one skilled in the art and Cry-transgenic plants including but not limited to Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105, Cry1F, Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, mCry3A, Cry9c and CBI-Bt have received regulatory approval (see, Sanahuja, (2011) Plant Biotech Journal 9:283-300 and the CERA (2010) GM Crop Database Center for Environmental Risk Assessment (CERA), ILSI Research Foundation, Washington D.C. at cera-gmc.org/index.php?action=gm_crop_database which can be accessed on the world-wide web using the “www” prefix). More than one pesticidal proteins well known to one skilled in the art can also be expressed in plants such as Vip3Ab & Cry1Fa (US2012/0317682), Cry1BE & Cry1F (US2012/0311746), Cry1CA & Cry1AB (US2012/0311745), Cry1F & CryCa (US2012/0317681), Cry1DA & Cry1BE (US2012/0331590), Cry1DA & Cry1Fa (US2012/0331589), Cry1AB & Cry1BE (US2012/0324606), and Cry1Fa & Cry2Aa, Cry1I or Cry1E (US2012/0324605). Pesticidal proteins also include insecticidal lipases including lipid acyl hydrolases of U.S. Pat. No. 7,491,869, and cholesterol oxidases such as from Streptomyces (Purcell et al. (1993) Biochem Biophys Res Commun 15:1406-1413). Pesticidal proteins also include VIP (vegetative insecticidal proteins) toxins of U.S. Pat. Nos. 5,877,012, 6,107,279, 6,137,033, 7,244,820, 7,615,686, and 8,237,020, and the like. Other VIP proteins are well known to one skilled in the art (see, lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html which can be accessed on the world-wide web using the “www” prefix). Pesticidal proteins also include toxin complex (TC) proteins, obtainable from organisms such as Xenorhabdus, Photorhabdus and Paenibacillus (see, U.S. Pat. Nos. 7,491,698 and 8,084,418). Some TC proteins have “stand alone” insecticidal activity and other TC proteins enhance the activity of the stand-alone toxins produced by the same given organism. The toxicity of a “stand-alone” TC protein (from Photorhabdus, Xenorhabdus or Paenibacillus, for example) can be enhanced by one or more TC protein “potentiators” derived from a source organism of a different genus. There are three main types of TC proteins. As referred to herein, Class A proteins (“Protein A”) are stand-alone toxins. Class B proteins (“Protein B”) and Class C proteins (“Protein C”) enhance the toxicity of Class A proteins. Examples of Class A proteins are TcbA, TcdA, XptA1 and XptA2. Examples of Class B proteins are TcaC, TcdB, XptB1Xb and XptC1Wi. Examples of Class C proteins are TccC, XptC1Xb and XptB1Wi. Pesticidal proteins also include spider, snake and scorpion venom proteins. Examples of spider venom peptides include but are not limited to lycotoxin-1 peptides and mutants thereof (U.S. Pat. No. 8,334,366). - (C) A polynucleotide encoding an insect-specific hormone or pheromone such as an ecdysteroid and juvenile hormone, a variant thereof, a mimetic based thereon or an antagonist or agonist thereof. See, for example, the disclosure by Hammock, et al., (1990) Nature 344:458, of baculovirus expression of cloned juvenile hormone esterase, an inactivator of juvenile hormone.
- (D) A polynucleotide encoding an insect-specific peptide which, upon expression, disrupts the physiology of the affected pest. For example, see the disclosures of Regan, (1994) J. Biol. Chem. 269:9 (expression cloning yields DNA coding for insect diuretic hormone receptor); Pratt, et al., (1989) Biochem. Biophys. Res. Comm. 163:1243 (an allostatin is identified in Diploptera puntata); Chattopadhyay, et al., (2004) Critical Reviews in Microbiology 30(1):33-54; Zjawiony, (2004) J Nat Prod 67(2):300-310; Carlini and Grossi-de-Sa (2002) Toxicon 40(11):1515-1539; Ussuf, et al., (2001) Curr Sci. 80(7):847-853 and Vasconcelos and Oliveira (2004) Toxicon 44(4):385-403. See also, U.S. Pat. No. 5,266,317 to Tomalski, et al., who disclose genes encoding insect-specific toxins.
- (E) A polynucleotide encoding an enzyme responsible for a hyperaccumulation of a monterpene, a sesquiterpene, a steroid, hydroxamic acid, a phenylpropanoid derivative or another non-protein molecule with insecticidal activity.
- (F) A polynucleotide encoding an enzyme involved in the modification, including the post-translational modification, of a biologically active molecule; for example, a glycolytic enzyme, a proteolytic enzyme, a lipolytic enzyme, a nuclease, a cyclase, a transaminase, an esterase, a hydrolase, a phosphatase, a kinase, a phosphorylase, a polymerase, an elastase, a chitinase and a glucanase, whether natural or synthetic. See, PCT Application WO 1993/02197 in the name of Scott, et al., which discloses the nucleotide sequence of a callase gene. DNA molecules which contain chitinase-encoding sequences can be obtained, for example, from the ATCC under Accession Numbers 39637 and 67152. See also, Kramer, et al., (1993) Insect Biochem. Molec. Biol. 23:691, who teach the nucleotide sequence of a cDNA encoding tobacco hookworm chitinase and Kawalleck, et al., (1993) Plant Molec. Biol. 21:673, who provide the nucleotide sequence of the parsley ubi4-2 polyubiquitin gene and U.S. Pat. Nos. 6,563,020; 7,145,060 and 7,087,810.
- (G) A polynucleotide encoding a molecule that stimulates signal transduction. For example, see the disclosure by Botella, et al., (1994) Plant Molec. Biol. 24:757, of nucleotide sequences for mung bean calmodulin cDNA clones and Griess, et al., (1994) Plant Physiol. 104:1467, who provide the nucleotide sequence of a maize calmodulin cDNA clone.
- (H) A polynucleotide encoding a hydrophobic moment peptide. See, PCT Application WO 1995/16776 and U.S. Pat. No. 5,580,852 disclosure of peptide derivatives of Tachyplesin which inhibit fungal plant pathogens) and PCT Application WO 1995/18855 and U.S. Pat. No. 5,607,914 (teaches synthetic antimicrobial peptides that confer disease resistance).
- (I) A polynucleotide encoding a membrane permease, a channel former or a channel blocker. For example, see the disclosure by Jaynes, et al., (1993) Plant Sci. 89:43, of heterologous expression of a cecropin-beta lytic peptide analog to render transgenic tobacco plants resistant to Pseudomonas solanacearum.
- (J) A gene encoding a viral-invasive protein or a complex toxin derived therefrom. For example, the accumulation of viral coat proteins in transformed plant cells imparts resistance to viral infection and/or disease development effected by the virus from which the coat protein gene is derived, as well as by related viruses. See, Beachy, et al., (1990) Ann. Rev. Phytopathol. 28:451. Coat protein-mediated resistance has been conferred upon transformed plants against alfalfa mosaic virus, cucumber mosaic virus, tobacco streak virus, potato virus X, potato virus Y, tobacco etch virus, tobacco rattle virus and tobacco mosaic virus. Id.
- (K) A gene encoding an insect-specific antibody or an immunotoxin derived therefrom. Thus, an antibody targeted to a critical metabolic function in the insect gut would inactivate an affected enzyme, killing the insect. Cf. Taylor, et al., Abstract #497, SEVENTH INT'L SYMPOSIUM ON MOLECULAR PLANT-MICROBE INTERACTIONS (Edinburgh, Scotland, 1994) (enzymatic inactivation in transgenic tobacco via production of single-chain antibody fragments).
- (L) A gene encoding a virus-specific antibody. See, for example, Tavladoraki, et al., (1993) Nature 366:469, who show that transgenic plants expressing recombinant antibody genes are protected from virus attack.
- (M) A polynucleotide encoding a developmental-arrestive protein produced in nature by a pathogen or a parasite. Thus, fungal endo alpha-1,4-D-polygalacturonases facilitate fungal colonization and plant nutrient release by solubilizing plant cell wall homo-alpha-1,4-D-galacturonase. See, Lamb, et al., (1992) Bio/Technology 10:1436. The cloning and characterization of a gene which encodes a bean endopolygalacturonase-inhibiting protein is described by Toubart, et al., (1992) Plant J. 2:367.
- (N) A polynucleotide encoding a developmental-arrestive protein produced in nature by a plant. For example, Logemann, et al., (1992) Bio/Technology 10:305, have shown that transgenic plants expressing the barley ribosome-inactivating gene have an increased resistance to fungal disease.
- (O) Genes involved in the Systemic Acquired Resistance (SAR) Response and/or the pathogenesis related genes. Briggs, (1995) Current Biology 5(2), Pieterse and Van Loon, (2004) Curr. Opin. Plant Bio. 7(4):456-64 and Somssich, (2003) Cell 113(7):815-6.
- (P) Antifungal genes (Cornelissen and Melchers, (1993) Pl. Physiol. 101:709-712 and Parijs, et al., (1991) Planta 183:258-264 and Bushnell, et al., (1998) Can. J. of Plant Path. 20(2):137-149. Also see, U.S. application Ser. Nos. 09/950,933; 11/619,645; 11/657,710; 11/748,994; 11/774,121 and U.S. Pat. Nos. 6,891,085 and 7,306,946. LysM Receptor-like kinases for the perception of chitin fragments as a first step in plant defense response against fungal pathogens (US 2012/0110696).
- (Q) Detoxification genes, such as for fumonisin, beauvericin, moniliformin and zearalenone and their structurally related derivatives. For example, see, U.S. Pat. Nos. 5,716,820; 5,792,931; 5,798,255; 5,846,812; 6,083,736; 6,538,177; 6,388,171 and 6,812,380.
- (R) A polynucleotide encoding a Cystatin and cysteine proteinase inhibitors. See, U.S. Pat. No. 7,205,453.
- (S) Defensin genes. See, WO 2003/000863 and U.S. Pat. Nos. 6,911,577; 6,855,865; 6,777,592 and 7,238,781.
- (T) Genes conferring resistance to nematodes. See, e.g., PCT Application Number WO 1996/30517; PCT Application Number WO 1993/19181, WO 2003/033651 and Urwin, et al., (1998) Planta 204:472-479, Williamson, (1999) Curr Opin Plant Bio. 2(4):327-31; U.S. Pat. Nos. 6,284,948 and 7,301,069 and miR164 genes (WO 2012/058266).
- (U) Genes that confer resistance to Phytophthora Root Rot, such as the
Rps 1, Rps 1-a, Rps 1-b, Rps 1-c, Rps 1-d, Rps 1-e, Rps 1-k,Rps 2, Rps 3-a, Rps 3-b, Rps 3-c,Rps 4,Rps 5,Rps 6,Rps 7 and other Rps genes. See, for example, Shoemaker, et al., Phytophthora Root Rot Resistance Gene Mapping in Soybean, Plant Genome IV Conference, San Diego, Calif. (1995). - (V) Genes that confer resistance to Brown Stem Rot, such as described in U.S. Pat. No. 5,689,035 and incorporated by reference for this purpose.
- (W) Genes that confer resistance to Colletotrichum, such as described in US Patent Application Publication US 2009/0035765 and incorporated by reference for this purpose. This includes the Rcg locus that may be utilized as a single locus conversion.
- 2. Transgenes that Confer Resistance to a Herbicide, for Example:
- (A) A polynucleotide encoding resistance to a herbicide that inhibits the growing point or meristem, such as an imidazolinone or a sulfonylurea. Exemplary genes in this category code for mutant ALS and AHAS enzyme as described, for example, by Lee, et al., (1988) EMBO J. 7:1241 and Miki, et al., (1990) Theor. Appl. Genet. 80:449, respectively. See also, U.S. Pat. Nos. 5,605,011; 5,013,659; 5,141,870; 5,767,361; 5,731,180; 5,304,732; 4,761,373; 5,331,107; 5,928,937 and 5,378,824; U.S. patent application Ser. No. 11/683,737 and International Publication WO 1996/33270.
- (B) A polynucleotide encoding a protein for resistance to Glyphosate (resistance imparted by mutant 5-enolpyruvl-3-phosphikimate synthase (EPSP) and aroA genes, respectively) and other phosphono compounds such as glufosinate (phosphinothricin acetyl transferase (PAT) and Streptomyces hygroscopicus phosphinothricin acetyl transferase (bar) genes) and pyridinoxy or phenoxy proprionic acids and cyclohexones (ACCase inhibitor-encoding genes). See, for example, U.S. Pat. No. 4,940,835 to Shah, et al., which discloses the nucleotide sequence of a form of EPSPS which can confer glyphosate resistance. U.S. Pat. No. 5,627,061 to Barry, et al., also describes genes encoding EPSPS enzymes. See also, U.S. Pat. Nos. 6,566,587; 6,338,961; 6,248,876 B1; 6,040,497; 5,804,425; 5,633,435; 5,145,783; 4,971,908; 5,312,910; 5,188,642; 5,094,945, 4,940,835; 5,866,775; 6,225,114 B1; 6,130,366; 5,310,667; 4,535,060; 4,769,061; 5,633,448; 5,510,471; Re. 36,449; RE 37,287 E and 5,491,288 and International Publications EP 1173580; WO 2001/66704; EP 1173581 and EP 1173582, which are incorporated herein by reference for this purpose. Glyphosate resistance is also imparted to plants that express a gene encoding a glyphosate oxido-reductase enzyme as described more fully in U.S. Pat. Nos. 5,776,760 and 5,463,175, which are incorporated herein by reference for this purpose. In addition glyphosate resistance can be imparted to plants by the over expression of genes encoding glyphosate N-acetyltransferase. See, for example, U.S. Pat. Nos. 7,462,481; 7,405,074 and US Patent Publication Number US 2008/0234130). A DNA molecule encoding a mutant aroA gene can be obtained under ATCC Accession Number 39256 and the nucleotide sequence of the mutant gene is disclosed in U.S. Pat. No. 4,769,061 to Comai. European
Patent Application Number 0 333 033 to Kumada, et al., and U.S. Pat. No. 4,975,374 to Goodman, et al. disclose nucleotide sequences of glutamine synthetase genes which confer resistance to herbicides such as L-phosphinothricin. The nucleotide sequence of a phosphinothricin-acetyl-transferase gene is provided in European Patent No. 0 242 246 and 0 242 236 to Leemans, et al. De Greef, et al., (1989) Bio/Technology 7:61, describe the production of transgenic plants that express chimeric bar genes coding for phosphinothricin acetyl transferase activity. See also, U.S. Pat. Nos. 5,969,213; 5,489,520; 5,550,318; 5,874,265; 5,919,675; 5,561,236; 5,648,477; 5,646,024; 6,177,616 B1 and 5,879,903, which are incorporated herein by reference for this purpose. Exemplary genes conferring resistance to phenoxy proprionic acids and cyclohexones, such as sethoxydim and haloxyfop, are the Acc1-S1, Acc1-S2 and Acc1-S3 genes described by Marshall, et al., (1992) Theor. Appl. Genet. 83:435. - (C) A polynucleotide encoding a protein for resistance to herbicide that inhibits photosynthesis, such as a triazine (psbA and gs+genes) and a benzonitrile (nitrilase gene). Przibilla, et al., (1991) Plant Cell 3:169 describe the transformation of Chlamydomonas with plasmids encoding mutant psbA genes. Nucleotide sequences for nitrilase genes are disclosed in U.S. Pat. No. 4,810,648 to Stalker and DNA molecules containing these genes are available under ATCC Accession Numbers 53435, 67441 and 67442. Cloning and expression of DNA coding for a glutathione S-transferase is described by Hayes, et al., (1992) Biochem. J. 285: 173.
- (D) A polynucleotide encoding a protein for resistance to Acetohydroxy acid synthase, which has been found to make plants that express this enzyme resistant to multiple types of herbicides, has been introduced into a variety of plants (see, e.g., Hattori, et al., (1995) Mol Gen Genet. 246:419). Other genes that confer resistance to herbicides include: a gene encoding a chimeric protein of rat cytochrome P4507A1 and yeast NADPH-cytochrome P450 oxidoreductase (Shiota, et al., (1994) Plant Physiol 106:17), genes for glutathione reductase and superoxide dismutase (Aono, et al., (1995) Plant Cell Physiol 36:1687, and genes for various phosphotransferases (Datta, et al., (1992) Plant Mol Biol 20:619).
- (E) A polynucleotide encoding resistance to a herbicide targeting Protoporphyrinogen oxidase (protox) which is necessary for the production of chlorophyll. The protox enzyme serves as the target for a variety of herbicidal compounds. These herbicides also inhibit growth of all the different species of plants present, causing their total destruction. The development of plants containing altered protox activity which are resistant to these herbicides are described in U.S. Pat. Nos. 6,288,306 E1; 6,282,837 B1; and 5,767,373 and International Publication WO 2001/12825.
- (F) The aad-1 gene (originally from Sphingobium herbicidovorans) encodes the aryloxyalkanoate dioxygenase (AAD-1) protein. The trait confers tolerance to 2,4-dichlorophenoxyacetic acid and aryloxyphenoxypropionate (commonly referred to as “fop” herbicides such as quizalofop) herbicides. The aad-1 gene, itself, for herbicide tolerance in plants was first disclosed in WO 2005/107437 (see also, US 2009/0093366). The aad-12 gene, derived from Delftia acidovorans, which encodes the aryloxyalkanoate dioxygenase (AAD-12) protein that confers tolerance to 2,4-dichlorophenoxyacetic acid and pyridyloxyacetate herbicides by deactivating several herbicides with an aryloxyalkanoate moiety, including phenoxy auxin (e.g., 2,4-D, MCPA), as well as pyridyloxy auxins (e.g., fluroxypyr, triclopyr).
- (G) A polynucleotide encoding a herbicide resistant dicamba monooxygenase disclosed in US Patent Application Publication 2003/0135879 for imparting dicamba tolerance;
- (H) A polynucleotide molecule encoding bromoxynil nitrilase (Bxn) disclosed in U.S. Pat. No. 4,810,648 for imparting bromoxynil tolerance;
- (I) A polynucleotide molecule encoding phytoene (crtl) described in Misawa, et al., (1993) Plant J. 4:833-840 and in Misawa, et al., (1994) Plant J. 6:481-489 for norflurazon tolerance.
- 3. Transgenes that Confer or Contribute to an Altered Grain Characteristic, Such as:
- (A) Altered fatty acids, for example, by
- (1) Down-regulation of stearoyl-ACP to increase stearic acid content of the plant. See, Knultzon, et al., (1992) Proc. Natl. Acad. Sci. USA 89:2624 and WO 1999/64579 (Genes to Alter Lipid Profiles in Corn),
- (2) Elevating oleic acid via FAD-2 gene modification and/or decreasing linolenic acid via FAD-3 gene modification (see, U.S. Pat. Nos. 6,063,947; 6,323,392; 6,372,965 and WO 1993/11245),
- (3) Altering conjugated linolenic or linoleic acid content, such as in WO 2001/12800,
- (4) Altering LEC1, AGP, Dek1, Superal1, mi1 ps, and various Ipa genes such as Ipa1, Ipa3, hpt or hggt. For example, see, WO 2002/42424, WO 1998/22604, WO 2003/011015, WO 2002/057439, WO 2003/011015, U.S. Pat. Nos. 6,423,886, 6,197,561, 6,825,397 and US Patent Application Publication Numbers US 2003/0079247, US 2003/0204870 and Rivera-Madrid, et al., (1995) Proc. Natl. Acad. Sci. 92:5620-5624.
- (5) Genes encoding delta-8 desaturase for making long-chain polyunsaturated fatty acids (U.S. Pat. Nos. 8,058,571 and 8,338,152), delta-9 desaturase for lowering saturated fats (U.S. Pat. No. 8,063,269), Primula Δ6-desaturase for improving omega-3 fatty acid profiles.
- (6) Isolated nucleic acids and proteins associated with lipid and sugar metabolism regulation, in particular, lipid metabolism protein (LMP) used in methods of producing transgenic plants and modulating levels of seed storage compounds including lipids, fatty acids, starches or seed storage proteins and use in methods of modulating the seed size, seed number, seed weights, root length and leaf size of plants (EP 2404499).
- (7) Altering expression of a High-Level Expression of Sugar-Inducible 2 (HS12) protein in the plant to increase or decrease expression of HS12 in the plant. Increasing expression of HS12 increases oil content while decreasing expression of HS12 decreases abscisic acid sensitivity and/or increases drought resistance (US 2012/0066794).
- (8) Expression of cytochrome b5 (Cb5) alone or with FAD2 to modulate oil content in plant seed, particularly to increase the levels of omega-3 fatty acids and improve the ratio of omega-6 to omega-3 fatty acids (US Patent Application Publication Number 2011/0191904).
- (9) Nucleic acid molecules encoding wrinkled1-like polypeptides for modulating sugar metabolism (U.S. Pat. No. 8,217,223).
- B) Altered phosphorus content, for example, by the
- (1) Introduction of a phytase-encoding gene would enhance breakdown of phytate, adding more free phosphate to the transformed plant. For example, see Van Hartingsveldt, et al., (1993) Gene 127:87, for a disclosure of the nucleotide sequence of an Aspergillus niger phytase gene.
- (2) Modulating a gene that reduces phytate content. In maize, this, for example, could be accomplished, by cloning and then re-introducing DNA associated with one or more of the alleles, such as the LPA alleles, identified in maize mutants characterized by low levels of phytic acid, such as in WO 2005/113778 and/or by altering inositol kinase activity as in WO 2002/059324, US 2003/0009011, WO 2003/027243, US 2003/0079247, WO 1999/05298, U.S. Pat. Nos. 6,197,561, 6,291,224, 6,391,348, WO 2002/059324, US 2003/0079247, WO 1998/45448, WO 1999/55882, WO 2001/04147.
- (C) Altered carbohydrates effected, for example, by altering a gene for an enzyme that affects the branching pattern of starch or, a gene altering thioredoxin such as NTR and/or TRX (see, (see, U.S. Pat. No. 6,531,648 which is incorporated by reference for this purpose) and/or a gamma zein knock out or mutant such as cs27 or TUSC27 or en27 (see, U.S. Pat. No. 6,858,778 and US 2005/0160488, US 2005/0204418; which are incorporated by reference for this purpose). See, Shiroza, et al., (1988) J. Bacteriol. 170:810 (nucleotide sequence of Streptococcus mutant fructosyltransferase gene), Steinmetz, et al., (1985) Mol. Gen. Genet. 200:220 (nucleotide sequence of Bacillus subtilis levansucrase gene), Pen, et al., (1992) Bio/Technology 10:292 (production of transgenic plants that express Bacillus licheniformis alpha-amylase), Elliot, et al., (1993) Plant Molec. Biol. 21:515 (nucleotide sequences of tomato invertase genes), Søgaard, et al., (1993) J. Biol. Chem. 268:22480 (site-directed mutagenesis of barley alpha-amylase gene) and Fisher, et al., (1993) Plant Physiol. 102:1045 (maize endosperm starch branching enzyme II), WO 1999/10498 (improved digestibility and/or starch extraction through modification of UDP-D-xylose 4-epimerase, Fragile 1 and 2, Ref1, HCHL, C4H), U.S. Pat. No. 6,232,529 (method of producing high oil seed by modification of starch levels (AGP)). The fatty acid modification genes mentioned herein may also be used to affect starch content and/or composition through the interrelationship of the starch and oil pathways.
- (D) Altered antioxidant content or composition, such as alteration of tocopherol or tocotrienols. For example, see, U.S. Pat. No. 6,787,683, US 2004/0034886 and WO 2000/68393 involving the manipulation of antioxidant levels and WO 2003/082899 through alteration of a homogentisate geranyl geranyl transferase (hggt).
- (E) Altered essential seed amino acids. For example, see, U.S. Pat. No. 6,127,600 (method of increasing accumulation of essential amino acids in seeds), U.S. Pat. No. 6,080,913 (binary methods of increasing accumulation of essential amino acids in seeds), U.S. Pat. No. 5,990,389 (high lysine), WO 1999/40209 (alteration of amino acid compositions in seeds), WO 1999/29882 (methods for altering amino acid content of proteins), U.S. Pat. No. 5,850,016 (alteration of amino acid compositions in seeds), WO 1998/20133 (proteins with enhanced levels of essential amino acids), U.S. Pat. No. 5,885,802 (high methionine), U.S. Pat. No. 5,885,801 (high threonine), U.S. Pat. No. 6,664,445 (plant amino acid biosynthetic enzymes), U.S. Pat. No. 6,459,019 (increased lysine and threonine), U.S. Pat. No. 6,441,274 (plant tryptophan synthase beta subunit), U.S. Pat. No. 6,346,403 (methionine metabolic enzymes), U.S. Pat. No. 5,939,599 (high sulfur), U.S. Pat. No. 5,912,414 (increased methionine), WO 1998/56935 (plant amino acid biosynthetic enzymes), WO 1998/45458 (engineered seed protein having higher percentage of essential amino acids), WO 1998/42831 (increased lysine), U.S. Pat. No. 5,633,436 (increasing sulfur amino acid content), U.S. Pat. No. 5,559,223 (synthetic storage proteins with defined structure containing programmable levels of essential amino acids for improvement of the nutritional value of plants), WO 1996/01905 (increased threonine), WO 1995/15392 (increased lysine), US 2003/0163838, US 2003/0150014, US 2004/0068767, U.S. Pat. No. 6,803,498, WO 2001/79516.
- 4. Genes that Control Male-Sterility:
- There are several methods of conferring genetic male sterility available, such as multiple mutant genes at separate locations within the genome that confer male sterility, as disclosed in U.S. Pat. Nos. 4,654,465 and 4,727,219 to Brar, et al., and chromosomal translocations as described by Patterson in U.S. Pat. Nos. 3,861,709 and 3,710,511. In addition to these methods, Albertsen, et al., U.S. Pat. No. 5,432,068, describe a system of nuclear male sterility which includes: identifying a gene which is critical to male fertility; silencing this native gene which is critical to male fertility; removing the native promoter from the essential male fertility gene and replacing it with an inducible promoter; inserting this genetically engineered gene back into the plant; and thus creating a plant that is male sterile because the inducible promoter is not “on” resulting in the male fertility gene not being transcribed. Fertility is restored by inducing or turning “on”, the promoter, which in turn allows the gene that confers male fertility to be transcribed.
- (A) Introduction of a deacetylase gene under the control of a tapetum-specific promoter and with the application of the chemical N—Ac-PPT (WO 01/29237).
- (B) Introduction of various stamen-specific promoters (WO 1992/13956, WO 1992/13957).
- (C) Introduction of the barnase and the barstar gene (Paul, et al., (1992) Plant Mol. Biol. 19:611-622).
- For additional examples of nuclear male and female sterility systems and genes, see also, U.S. Pat. Nos. 5,859,341; 6,297,426; 5,478,369; 5,824,524; 5,850,014; and 6,265,640; all of which are hereby incorporated by reference.
- 5. Genes that Create a Site for Site Specific DNA Integration.
- This includes the introduction of FRT sites that may be used in the FLP/FRT system and/or Lox sites that may be used in the Cre/Loxp system. For example, see Lyznik, et al., (2003) Plant Cell Rep 21:925-932 and WO 1999/25821, which are hereby incorporated by reference. Other systems that may be used include the Gin recombinase of phage Mu (Maeser, et al., (1991) Vicki Chandler, The Maize Handbook ch. 118 (Springer-Verlag 1994), the Pin recombinase of E. coli (Enomoto, et al., 1983) and the R/RS system of the pSRi plasmid (Araki, et al., 1992).
- 6. Genes that Affect Abiotic Stress Resistance
- Including but not limited to flowering, ear and seed development, enhancement of nitrogen utilization efficiency, altered nitrogen responsiveness, drought resistance or tolerance, cold resistance or tolerance, and salt resistance or tolerance, and increased yield under stress.
- (A) For example, see, WO 2000/73475 where water use efficiency is altered through alteration of malate; U.S. Pat. Nos. 5,892,009, 5,965,705, 5,929,305, 5,891,859, 6,417,428, 6,664,446, 6,706,866, 6,717,034, 6,801,104, WO 2000/060089, WO 2001/026459, WO 2001/035725, WO 2001/034726, WO 2001/035727, WO 2001/036444, WO 2001/036597, WO 2001/036598, WO 2002/015675, WO 2002/017430, WO 2002/077185, WO 2002/079403, WO 2003/013227, WO 2003/013228, WO 2003/014327, WO 2004/031349, WO 2004/076638, WO 199809521;
- (B) WO 199938977 describing genes, including CBF genes and transcription factors effective in mitigating the negative effects of freezing, high salinity and drought on plants, as well as conferring other positive effects on plant phenotype;
- (C) US 2004/0148654 and WO 2001/36596 where abscisic acid is altered in plants resulting in improved plant phenotype such as increased yield and/or increased tolerance to abiotic stress;
- (D) WO 2000/006341, WO 2004/090143, U.S. Pat. Nos. 7,531,723 and 6,992,237 where cytokinin expression is modified resulting in plants with increased stress tolerance, such as drought tolerance, and/or increased yield. Also see, WO 2002/02776, WO 2003/052063, JP 2002/281975, U.S. Pat. No. 6,084,153, WO 200164898, U.S. Pat. Nos. 6,177,275 and 6,107,547 (enhancement of nitrogen utilization and altered nitrogen responsiveness);
- (E) For ethylene alteration, see, US 2004/0128719, US 2003/0166197 and WO 2000/32761;
- (F) For plant transcription factors or transcriptional regulators of abiotic stress, see e.g., US 2004/0098764 or US 2004/0078852;
- (G) Genes that increase expression of vacuolar pyrophosphatase such as AVP1 (U.S. Pat. No. 8,058,515) for increased yield; nucleic acid encoding a HSFA4 or a HSFA5 (Heat Shock Factor of the class A4 or A5) polypeptides, an oligopeptide transporter protein (OPT4-like) polypeptide; a plastochron2-like (PLA2-like) polypeptide or a Wuschel related homeobox 1-like (WOX1-like) polypeptide (US Patent Application Publication Number US 2011/0283420);
- (H) Down regulation of polynucleotides encoding poly (ADP-ribose) polymerase (PARP) proteins to modulate programmed cell death (U.S. Pat. No. 8,058,510) for increased vigor;
- (I) Polynucleotide encoding DTP21 polypeptides for conferring drought resistance (US Patent Publication Number US 2011/0277181);
- (J) Nucleotide sequences encoding ACC Synthase 3 (ACS3) proteins for modulating development, modulating response to stress and modulating stress tolerance (US Patent Pub. No. US20100287669).
- (K) Polynucleotides that encode proteins that confer a drought tolerance phenotype (DTP) for conferring drought resistance (WO 2012/058528).
- (L) Tocopherol cyclase (TC) genes for conferring drought and salt tolerance (US Patent Application Publication Number 2012/0272352).
- (M) CAAX amino terminal family proteins for stress tolerance (U.S. Pat. No. 8,338,661).
- (N) Mutations in the SAL1 encoding gene have increased stress tolerance, including increased drought resistant (US Patent Application Publication Number 2010/0257633).
- (O) Expression of a nucleic acid sequence encoding a polypeptide selected from the group consisting of: GRF polypeptide, RAA1-like polypeptide, SYR polypeptide, ARKL polypeptide, and YTP polypeptide increasing yield-related traits (US Patent Application Publication Number 2011/0061133).
- (P) Modulating expression in a plant of a nucleic acid encoding a Class III Trehalose Phosphate Phosphatase (TPP) polypeptide for enhancing yield-related traits in plants, particularly increasing seed yield (US Patent Application Publication Number 2010/0024067).
- Other genes and transcription factors that affect plant growth and agronomic traits such as yield, flowering, plant growth and/or plant structure, can be introduced or introgressed into plants, see e.g., WO 1997/49811 (LHY), WO 1998/56918 (ESD4), WO 1997/10339 and U.S. Pat. No. 6,573,430 (TFL), U.S. Pat. No. 6,713,663 (FT), WO 1996/14414 (CON), WO 1996/38560, WO 2001/21822 (VRN1), WO 2000/44918 (VRN2), WO 1999/49064 (GI), WO 2000/46358 (FR1), WO 1997/29123, U.S. Pat. Nos. 6,794,560, 6,307,126 (GAI), WO 1999/09174 (D8 and Rht), and WO 2004/076638 and WO 2004/031349 (transcription factors).
- 7. Genes that Confer Increased Yield
- (A) A transgenic crop plant transformed by a 1-AminoCyclopropane-1-Carboxylate Deaminase-like Polypeptide (ACCDP) coding nucleic acid, wherein expression of the nucleic acid sequence in the crop plant results in the plant's increased root growth, and/or increased yield, and/or increased tolerance to environmental stress as compared to a wild type variety of the plant (U.S. Pat. No. 8,097,769).
- (B) Over-expression of maize zinc finger protein gene (Zm-ZFP1) using a seed preferred promoter has been shown to enhance plant growth, increase kernel number and total kernel weight per plant (US 2012/0079623).
- (C) Constitutive over-expression of maize lateral organ boundaries (LOB) domain protein (Zm-LOBDP1) has been shown to increase kernel number and total kernel weight per plant (2012/0079622).
- (D) Enhancing yield-related traits in plants by modulating expression in a plant of a nucleic acid encoding a VIM1 (Variant in Methylation 1)-like polypeptide or a VTC2-like (GDP-L-galactose phosphorylase) polypeptide or a DUF1685 polypeptide or an ARF6-like (Auxin Responsive Factor) polypeptide (WO 2012/038893).
- (E) Modulating expression in a plant of a nucleic acid encoding a Ste20-like polypeptide or a homologue thereof gives plants having increased yield relative to control plants (EP 2431472).
- (F) Genes encoding nucleoside diphosphatase kinase (NDK) polypeptides and homologs thereof for modifying the plant's root architecture (US Patent Application Publication Number 2009/0064373).
- 8. Genes that Confer Plant Digestibility.
- (A) Altering the level of xylan present in the cell wall of a plant by modulating expression of xylan synthase (U.S. Pat. No. 8,173,866).
- In some embodiment the stacked trait may be a trait or event that has received regulatory approval including but not limited to the events in Table 1A-1F.
-
TABLE 1A Triticum aestivum Wheat Event Company Description AP205CL BASF Inc. Selection for a mutagenized version of the enzyme acetohydroxyacid synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. AP602CL BASF Inc. Selection for a mutagenized version of the enzyme acetohydroxyacid synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. BW255-2, BASF Inc. Selection for a mutagenized version of the BW238-3 enzyme acetohydroxyacid synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. BW7 BASF Inc. Tolerance to imidazolinone herbicides induced by chemical mutagenesis of the acetohydroxyacid synthase (AHAS) gene using sodium azide. MON71800 Monsanto Glyphosate tolerant wheat variety produced by Company inserting a modified 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) encoding gene from the soil bacterium Agrobacterium tumefaciens, strain CP4. SWP965001 Cyanamid Selection for a mutagenized version of the Crop enzyme acetohydroxyacid synthase (AHAS), Protection also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. Teal 11A BASF Inc. Selection for a mutagenized version of the enzyme acetohydroxyacid synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. -
TABLE 1B Glycine max L. Soybean Event Company Description A2704-12, Bayer Glufosinate ammonium herbicide tolerant A2704-21, CropScience soybean produced by inserting a modified A5547-35 (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces viridochromogenes. A5547-127 Bayer Glufosinate ammonium herbicide tolerant CropScience soybean produced by inserting a modified (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces viridochromogenes. BPS- BASF Inc. The introduced csr1-2 gene from Arabidopsis CV127-9 thaliana encodes an acetohydroxyacid synthase protein that confers tolerance to imidazolinone herbicides due to a point mutation that results in a single amino acid substitution in which the serine residue at position 653 is replaced by asparagine (S653N). DP-305423 Pioneer High oleic acid soybean produced Hi-Bred by inserting additional copies International of a portion of the omega-6 Inc. desaturase encoding gene, gm-fad2-1 resulting in silencing of the endogenous omega-6 desaturase gene (FAD2-1). DP356043 Pioneer Soybean event with two herbicide tolerance Hi-Bred genes: glyphosate N-acetlytransferase, which International detoxifies glyphosate, and a modified Inc. acetolactate synthase (ALS) gene which is tolerant to ALS-inhibiting herbicides. G94-1, DuPont High oleic acid soybean G94-19, Canada produced by inserting G168 Agricultural a second copy of the fatty acid desaturase Products (GmFad2-1) encoding gene from soybean, which resulted in “silencing” of the endogenous host gene. GTS 40-3-2 Monsanto Glyphosate tolerant soybean Company variety produced by inserting a modified 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) encoding gene from the soil bacterium Agrobacterium tumefaciens. GU262 Bayer Glufosinate ammonium herbicide tolerant CropScience soybean produced by inserting a modified (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces viridochromogenes. MON87701 Monsanto Resistance to lepidopteran pests of soybean Company including velvetbean caterpillar (Anticarsia gemmatalis) and soybean looper (Pseudoplusia includens). MON87701 Monsanto Glyphosate herbicide tolerance through x Company expression of the EPSPS encoding gene from MON89788 A. tumefaciens strain CP4, and resistance to lepidopteran pests of soybean including velvetbean caterpillar (Anticarsia gemmatalis) and soybean looper (Pseudoplusia includens) via expression of the Cry1Ac encoding gene from B. thuringiensis. MON89788 Monsanto Glyphosate-tolerant soybean produced by Company inserting a modified 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) encoding aroA (epsps) gene from Agrobacterium tumefaciens CP4. OT96-15 Agriculture Low linolenic acid soybean produced through & Agri-Food traditional cross-breeding to incorporate the Canada novel trait from a naturally occurring fan1 gene mutant that was selected for low linolenic acid. W62, W98 Bayer Glufosinate ammonium herbicide tolerant CropScience soybean produced by inserting a modified (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces hygroscopicus. -
TABLE 1C Helianthus annuus Sunflower Event Company Description X81359 BASF Inc. Tolerance to imidazolinone herbicides by selection of a naturally occurring mutant. -
TABLE 1D Medicago sativa Alfalfa Event Company Description J101, Monsanto Glyphosate herbicide tolerant alfalfa (lucerne) J163 Company produced by inserting a gene encoding the and Forage enzyme 5-enolypyruvylshikimate-3-phosphate Genetics synthase (EPSPS) from the CP4 strain of International Agrobacterium tumefaciens. -
TABLE 1E Oryza sativa Rice Event Company Description CL121, BASF Inc. Tolerance to the imidazolinone herbicide, CL141, imazethapyr, induced by CFX51 chemical mutagenesis of the acetolactate synthase (ALS) enzyme using ethyl methanesulfonate (EMS). IMINTA-1, BASF Inc. Tolerance to imidazolinone IMINTA-4 herbicides induced by chemical mutagenesis of the acetolactate synthase (ALS) enzyme using sodium azide. LLRICE06, Aventis Glufosinate ammonium herbicide tolerant LLRICE62 CropScience rice produced by inserting a modified phosphinothricin acetyltransferase (PAT) encoding gene from the soil bacterium Streptomyces hygroscopicus). LLRICE601 Bayer Glufosinate ammonium herbicide tolerant CropScience rice produced by inserting a modified (Aventis phosphinothricin acetyltransferase (PAT) CropScience encoding gene from the soil bacterium (AgrEvo)) Streptomyces hygroscopicus). PWC16 BASF Inc. Tolerance to the imidazolinone herbicide, imazethapyr, induced by chemical mutagenesis of the acetolactate synthase (ALS) enzyme using ethyl methanesulfonate (EMS). -
TABLE 1F Zea mays L. Maize Event Company Description 176 Syngenta Seeds, Inc. Insect-resistant maize produced by inserting the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki. The genetic modification affords resistance to attack by the European corn borer (ECB). 3751IR Pioneer Hi-Bred Selection of somaclonal International Inc. variants by culture of embryos on imidazolinone containing media. 676, 678, 680 Pioneer Hi-Bred Male-sterile and glufosinate International Inc. ammonium herbicide tolerant maize produced by inserting genes encoding DNA adenine methylase and phosphinothricin acetyltransferase (PAT) from Escherichia coli and Streptomyces viridochromogenes, respectively. B16 (DLL25) Dekalb Genetics Glufosinate ammonium Corporation herbicide tolerant maize produced by inserting the gene encoding phosphinothricin acetyltransferase (PAT) from Streptomyces hygroscopicus. BT11 Syngenta Insect-resistant and (X4334CBR, Seeds, Inc. herbicide tolerant maize X4734CBR) produced by inserting the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki, and the phosphinothricin N-acetyltransferase (PAT) encoding gene from S. viridochromogenes. BT11 x GA21 Syngenta Seeds, Inc. Stacked insect resistant and herbicide tolerant maize produced by conventional cross breeding of parental lines BT11 (OECD unique identifier: SYN-BTO11-1) and GA21 (OECD unique identifier: MON-OOO21-9). BT11 x MIR162 Syngenta Seeds, Inc. Stacked insect resistant and herbicide tolerant maize produced by conventional cross breeding of parental lines BT11 (OECD unique identifier: SYN-BTO11-1) and MIR162 (OECD unique identifier: SYN-IR162-4). Resistance to the European Corn Borer and tolerance to the herbicide glufosinate ammonium (Liberty) is derived from BT11, which contains the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki, and the phosphinothricin N-acetyltransferase (PAT) encoding gene from S. viridochromogenes. Resistance to other lepidopteran pests, including H. zea, S. frugiperda, A. ipsilon, and S. albicosta, is derived from MIR162, which contains the vip3Aa gene from Bacillus thuringiensis strain AB88. BT11 x MIR162 x Syngenta Seeds, Inc. Bacillus thuringiensis Cry1Ab delta-endotoxin MIR604 protein and the genetic material necessary for its production (via elements of vector pZO1502) in Event Bt11 corn (OECD Unique Identifier: SYN- BTO11-1) x Bacillus thuringiensis Vip3Aa20 insecticidal protein and the genetic material necessary for its production (via elements of vector pNOV1300) in Event MIR162 maize (OECD Unique Identifier: SYN-IR162-4) x modified Cry3A protein and the genetic material necessary for its production (via elements of vector pZM26) in Event MIR604 corn (OECD Unique Identifier: SYN-IR6O4-5). BT11 x Syngenta Seeds, Resistance to coleopteran pests, MIR162 x Inc. particularly corn rootworm pests MIR604 x (Diabrotica spp.) and several GA21 lepidopteran pests of corn, including European corn borer (ECB, Ostrinia nubilalis), corn earworm (CEW, Helicoverpa zea), fall army worm (FAW, Spodoptera frugiperda), and black cutworm (BCW, Agrotis ipsilon); tolerance to glyphosate and glufosinate-ammonium containing herbicides. BT11 x Syngenta Seeds, Stacked insect resistant and MIR604 Inc. herbicide tolerant maize produced by conventional cross breeding of parental lines BT11 (OECD unique identifier: SYN-BTO11-1) and MIR604 (OECD unique identifier: SYN-IR6O5-5). Resistance to the European Corn Borer and tolerance to the herbicide glufosinate ammonium (Liberty) is derived from BT11, which contains the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki, and the phosphinothricin N- acetyltransferase (PAT) encoding gene from S. viridochromogenes. Corn rootworm- resistance is derived from MIR604 which contains the mCry3A gene from Bacillus thuringiensis. BT11 x Syngenta Seeds, Stacked insect resistant and herbicide MIR604 x Inc. tolerant maize produced GA21 by conventional cross breeding of parental lines BT11 (OECD unique identifier: SYN-BTO11-1), MIR604 (OECD unique identifier: SYN-IR6O5-5) and GA21 (OECD unique identifier: MON-OOO21-9). Resistance to the European Corn Borer and tolerance to the herbicide glufosinate ammonium (Liberty) is derived from BT11, which contains the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki, and the phosphinothricin N- acetyltransferase (PAT) encoding gene from S. viridochromogenes. Corn rootworm- resistance is derived from MIR604 which contains the mCry3A gene from Bacillus thuringiensis. Tolerance to glyphosate herbicide is derived from GA21 which contains a modified EPSPS gene from maize. CBH-351 Aventis Insect-resistant and glufosinate CropScience ammonium herbicide tolerant maize developed by inserting genes encoding Cry9C protein from Bacillus thuringiensis subsp tolworthi and phosphinothricin acetyltransferase (PAT) from Streptomyces hygroscopicus. DAS- DOW Lepidopteran insect resistant 06275-8 AgroSciences and glufosinate ammonium LLC herbicide-tolerant maize variety produced by inserting the Cry1F gene from Bacillus thuringiensis var aizawai and the phosphinothricin acetyltransferase (PAT) from Streptomyces hygroscopicus. DAS- DOW Corn rootworm-resistant maize 59122-7 AgroSciences produced by inserting the LLC and Cry34Ab1 and Cry35Ab1 genes Pioneer Hi- from Bacillus thuringiensis strain Bred International PS149B1. The PAT encoding Inc. gene from Streptomyces viridochromogenes was introduced as a selectable marker. DAS- DOW Stacked insect resistant and 59122-7 x AgroSciences herbicide tolerant maize produced NK603 LLC and by conventional cross breeding Pioneer Hi- of parental lines DAS-59122-7 Bred International (OECD unique identifier: Inc. DAS-59122-7) with NK603 (OECD unique identifier: MON-OO6O3-6). Corn rootworm-resistance is derived from DAS-59122-7 which contains the Cry34Ab1 and Cry35Ab1 genes from Bacillus thuringiensis strain PS149B1. Tolerance to glyphosate herbicide is derived from NK603. DAS- DOW Stacked insect resistant and 59122-7 x AgroSciences herbicide tolerant maize produced TC1507 LLC and by conventional cross breeding x Pioneer of parental lines DAS-59122-7 NK603 Hi-Bred (OECD unique identifier: International Inc. DAS-59122-7) and TC1507 (OECD unique identifier: DAS-O15O7-1) with NK603 (OECD unique identifier: MON-OO6O3-6). Corn rootworm-resistance is derived from DAS-59122-7 which contains the Cry34Ab1 and Cry35Ab1 genes from Bacillus thuringiensis strain PS149B1. Lepidopteran resistance and tolerance to glufosinate ammonium herbicide is derived from TC1507. Tolerance to glyphosate herbicide is derived from NK603. DBT418 Dekalb Genetics Corporation Insect-resistant and glufosinate ammonium herbicide tolerant maize developed by inserting genes encoding Cry1AC protein from Bacillus thuringiensis subsp kurstaki and phosphinothricin acetyltransferase (PAT) from Streptomyces hygroscopicus DK404SR BASF Inc. Somaclonal variants with a modified acetyl-CoA-carboxylase (ACCase) were selected by culture of embryos on sethoxydim enriched medium. Event 3272 Syngenta Seeds, Inc. Maize line expressing a heat stable alpha-amylase gene amy797E for use in the dry-grind ethanol process. The phosphomannose isomerase gene from E. coli was used as a selectable marker. Event 98140 Pioneer Hi-Bred International Inc. Maize event expressing tolerance to glyphosate herbicide, via expression of a modified bacterial glyphosate N- acetlytransferase, and ALS-inhibiting herbicides, vial expression of a modified form of the maize acetolactate synthase enzyme. EXP1910IT Syngenta Seeds, Tolerance to the imidazolinone Inc. (formerly herbicide, imazethapyr, Zeneca Seeds) induced by chemical mutagenesis of the acetolactate synthase (ALS) enzyme using ethyl methanesulfonate (EMS). GA21 Syngenta Seeds, Introduction, by particle Inc. (formerly bombardment, of a modified 5- Zeneca Seeds) enolpyruvyl shikimate-3-phosphate synthase (EPSPS), an enzyme involved in the shikimate biochemical pathway for the production of the aromatic amino acids. GA21 x MON810 Monsanto Company Stacked insect resistant and herbicide tolerant corn hybrid derived from conventional cross-breeding of the parental lines GA21 (OECD identifier: MON-OOO21-9) and MON810 (OECD identifier: MON-OO81O-6). IT Pioneer Hi-Bred Tolerance to the imidazolinone herbicide, imazethapyr, was International Inc. obtained by in vitro selection of somaclonal variants. LY038 Monsanto Company Altered amino acid composition, specifically elevated levels of lysine, through the introduction of the cordapA gene, derived from Corynebacterium glutamicum, encoding the enzyme dihydrodipicolinate synthase (cDHDPS). MIR162 Syngenta Seeds, Inc. Insect-resistant maize event expressing a Vip3A protein from Bacillus thuringiensis and the Escherichia coli PMI selectable marker MIR604 Syngenta Seeds, Inc. Corn rootworm resistant maize produced by transformation with a modified Cry3A gene. The phosphomannose isomerase gene from E. coli was used as a selectable marker. MIR604 x Syngenta Stacked insect resistant and herbicide GA21 Seeds, Inc. tolerant maize produced by conventional cross breeding of parental lines MIR604 (OECD unique identifier: SYN-IR6O5-5) and GA21 (OECD unique identifier: MON- OOO21-9). Corn rootworm-resistance is derived from MIR604 which contains the mCry3A gene from Bacillus thuringiensis. Tolerance to glyphosate herbicide is derived from GA21. MON80100 Monsanto Insect-resistant maize produced by Company inserting the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki. The genetic modification affords resistance to attack by the European corn borer (ECB). MON802 Monsanto Company Insect-resistant and glyphosate herbicide tolerant maize produced by inserting the genes encoding the Cry1Ab protein from Bacillus thuringiensis and the 5-enolpyruvylshikimate- 3-phosphate synthase (EPSPS) from A. tumefaciens strain CP4. MON809 Pioneer Hi- Resistance to European corn borer Bred (Ostrinia nubilalis) by introduction International Inc. of a synthetic Cry1Ab gene. Glyphosate resistance via introduction of the bacterial version of a plant enzyme, 5-enolpyruvyl shikimate-3- phosphate synthase (EPSPS). MON810 Monsanto Company Insect-resistant maize produced by inserting a truncated form of the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki HD-1. The genetic modification affords resistance to attack by the European corn borer (ECB). MON810 x Monsanto Stacked insect resistant and enhanced LY038 Company lysine content maize derived from conventional cross-breeding of the parental lines MON810 (OECD identifier: MON-OO81O-6) and LY038 (OECD identifier: REN-OOO38-3). MON810 x Monsanto Stacked insect resistant and MON88017 Company glyphosate tolerant maize derived from conventional cross-breeding of the parental lines MON810 (OECD identifier: MON-OO81O-6) and MON88017 (OECD identifier: MON- 88O17-3). European corn borer (ECB) resistance is derived from a truncated form of the Cry1Ab gene from Bacillus thuringiensis subsp. kurstaki HD-1 present in MON810. Corn rootworm resistance is derived from the Cry3Bb1 gene from Bacillus thuringiensis subspecies kumamotoensis strain EG4691 present in MON88017. Glyphosate tolerance is derived from a 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) encoding gene from Agrobacterium tumefaciens strain CP4 present in MON88017. MON832 Monsanto Company Introduction, by particle bombardment, of glyphosate oxidase (GOX) and a modified 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS), an enzyme involved in the shikimate biochemical pathway for the production of the aromatic amino acids. MON863 Monsanto Company Corn root worm resistant maize produced by inserting the Cry3Bb1 gene from Bacillus thuringiensis subsp. kumamotoensis. MON863 x Monsanto Stacked insect resistant corn hybrid MON810 Company derived from conventional cross- breeding of the parental lines MON863 (OECD identifier: MON- OO863-5) and MON810 (OECD identifier: MON-OO81O-6) MON863 x Monsanto Stacked insect resistant MON810 x Company and herbicide tolerant NK603 corn hybrid derived from conventional cross- breeding of the stacked hybrid MON-OO863-5 x MON-OO81O-6 and NK603 (OECD identifier:MON-OO6O3-6). MON863 x Monsanto Stacked insect resistant NK603 Company and herbicide tolerant corn hybrid derived from conventional cross- breeding of the parental lines MON863 (OECD identifier: MON-OO863-5) and NK603 (OECD identifier: MON-OO6O3-6). MON87460 Monsanto Company MON 87460 was developed to provide reduced yield loss underwater- limited conditions compared to conventional maize. Efficacy in MON 87460 is derived by expression of the inserted Bacillus subtilis cold shock protein B (CspB). MON88017 Monsanto Company Corn rootworm-resistant maize produced by inserting the Cry3Bb1 gene from Bacillus thuringiensis subspecies kumamotoensis strain EG4691. Glyphosate tolerance derived by inserting a 5-enolpyruvylshikimate- 3-phosphate synthase (EPSPS) encoding gene from Agrobacterium tumefaciens strain CP4. MON89034 Monsanto Company Maize event expressing two different insecticidal proteins from Bacillus thuringiensis providing resistance to number of lepidopteran pests. MON89034 Monsanto Stacked insect resistant x Company and glyphosate tolerant MON88017 maize derived from conventional cross-breeding of the parental lines MON89034 (OECD identifier: MON-89O34-3) and MON88017 (OECD identifier: MON-88O17-3). Resistance to Lepidopteran insects is derived from two Cry genes present in MON89043. Corn rootworm resistance is derived from a single Cry genes and glyphosate tolerance is derived from the 5- enolpyruvylshikimate-3- phosphate synthase (EPSPS) encoding gene from Agrobacterium tumefaciens present in MON88017. MON89034 Monsanto Stacked insect resistant x Company and herbicide tolerant NK603 maize produced by conventional cross breeding of parental lines MON89034 (OECD identifier: MON-89O34-3) with NK603 (OECD unique identifier: MON-OO6O3-6). Resistance to Lepidopteran insects is derived from two Cry genes present in MON89043. Tolerance to glyphosate herbicide is derived from NK603. MON89034 x Monsanto Stacked insect resistant TC1507 x Company and herbicide tolerant MON88017 x and Mycogen maize produced by DAS- Seeds c/o Dow conventional cross breeding 59122-7 AgroSciences of parental lines: LLC MON89034, TC1507, MON88017, and DAS-59122. Resistance to the above-ground and below- ground insect pests and tolerance to glyphosate and glufosinate- ammonium containing herbicides. MS3 Bayer Male sterility caused by CropScience expression of the barnase (Aventis ribonuclease gene CropScience from Bacillus (AgrEvo)) amyloliquefaciens; PPT resistance was via PPT- acetyltransferase (PAT). MS6 Bayer Male sterility caused by CropScience expression of the barnase (Aventis ribonuclease gene from Bacillus CropScience amyloliquefaciens; PPT (AgrEvo)) resistance was via PPT- acetyltransferase (PAT). NK603 Monsanto Introduction, by particle Company bombardment, of a modified 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS), an enzyme involved in the shikimate biochemical pathway for the production of the aromatic amino acids. NK603 x Monsanto Stacked insect resistant MON810 Company and herbicide tolerant corn hybrid derived from conventional cross- breeding of the parental lines NK603 (OECD identifier: MON-OO6O3-6) and MON810 (OECD identifier: MON-OO81O-6). NK603 x Monsanto Stacked glufosinate T25 Company ammonium and glyphosate herbicide tolerant maize hybrid derived from conventional cross-breeding of the parental lines NK603 (OECD identifier: MON-OO6O3-6) and T25 (OECD identifier: ACS-ZM003-2). T14, T25 Bayer CropScience Glufosinate herbicide tolerant maize produced by (Aventis inserting the phosphinothricin CropScience N-acetyltransferase (AgrEvo)) (PAT) encoding gene from the aerobic actinomycete Streptomyces viridochromogenes. T25 x Bayer Stacked insect resistant MON810 CropScience and herbicide tolerant (Aventis corn hybrid derived from CropScience conventional cross- (AgrEvo)) breeding of the parental lines T25 (OECD identifier: ACS-ZMOO3-2) and MON810 (OECD identifier:MON-OO81O-6). TC1507 Mycogen Insect-resistant and (c/o Dow glufosinate ammonium AgroSciences); herbicide tolerant maize Pioneer produced by inserting the (c/o DuPont) Cry1F gene from Bacillus thuringiensis var. aizawai and the phosphinothricin N- acetyltransferase encoding gene from Streptomyces viridochromogenes. TC1507 x DOW Stacked insect resistant DAS- AgroSciences and herbicide tolerant 59122-7 LLC and maize produced by Pioneer Hi-Bred conventional cross breeding of International Inc. parental lines TC1507 (OECD unique identifier: DAS-O15O7-1) with DAS- 59122-7 (OECD unique identifier: DAS-59122-7). Resistance to lepidopteran insects is derived from TC1507 due the presence of the Cry1F gene from Bacillus thuringiensis var. aizawai. Corn rootworm- resistance is derived from DAS-59122-7 which contains the Cry34Ab1 and Cry35Ab1 genes from Bacillus thuringiensis strain PS149B1. Tolerance to glufosinate ammonium herbicide is derived from TC1507 from the phosphinothricin N- acetyltransferase encoding gene from Streptomyces viridochromogenes. TC1507 x DOW Stacked insect resistant NK603 AgroSciences and herbicide tolerant LLC corn hybrid derived from conventional cross- breeding of the parental lines 1507 (OECD identifier: DAS-O15O7-1) and NK603 (OECD identifier: MON-OO6O3-6). - Other events with regulatory approval are well known to one skilled in the art and can be found at the Center for Environmental Risk Assessment (cera-gmc.org/?action=gm_crop_database, which can be accessed using the www prefix).
- In some embodiments the stacked trait may be in the form of silencing of one or more polynucleotides of interest resulting in suppression of one or more target pest polypeptides. In some embodiments the silencing is achieved through the use of a suppression DNA construct.
- In some embodiments one or more of the PIP-1, PIP-1A (SEQ ID NO: 2), PSEEN3174 (SEQ ID NO: 6), PIP-1C (SEQ ID NO: 332), and PIP-1B (SEQ ID NO: 4) polypeptides or fragments or variants thereof may be stacked with one or more polynucleotides encoding one or more polypeptides having insecticidal activity or agronomic traits as set forth supra and optionally may further include one or more polynucleotides providing for gene silencing of one or more target polynucleotides as discussed infra.
- “Suppression DNA construct” is a recombinant DNA construct which when transformed or stably integrated into the genome of the plant, results in “silencing” of a target gene in the plant. The target gene may be endogenous or transgenic to the plant. “Silencing,” as used herein with respect to the target gene, refers generally to the suppression of levels of mRNA or protein/enzyme expressed by the target gene, and/or the level of the enzyme activity or protein functionality. The term “suppression” includes lower, reduce, decline, decrease, inhibit, eliminate and prevent. “Silencing” or “gene silencing” does not specify mechanism and is inclusive, and not limited to, anti-sense, cosuppression, viral-suppression, hairpin suppression, stem-loop suppression, RNAi-based approaches and small RNA-based approaches.
- A suppression DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or antisense strand) of the target gene of interest. Depending upon the approach to be utilized, the region may be 100% identical or less than 100% identical (e.g., at least 50% or any integer between 51% and 100% identical) to all or part of the sense strand (or antisense strand) of the gene of interest.
- Suppression DNA constructs are well-known in the art, are readily constructed once the target gene of interest is selected, and include, without limitation, cosuppression constructs, antisense constructs, viral-suppression constructs, hairpin suppression constructs, stem-loop suppression constructs, double-stranded RNA-producing constructs, and more generally, RNAi (RNA interference) constructs and small RNA constructs such as siRNA (short interfering RNA) constructs and miRNA (microRNA) constructs.
- “Antisense inhibition” refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein.
- “Antisense RNA” refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5′ non-coding sequence, 3′ non-coding sequence, introns or the coding sequence.
- “Cosuppression” refers to the production of sense RNA transcripts capable of suppressing the expression of the target protein. “Sense” RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Cosuppression constructs in plants have been previously designed by focusing on overexpression of a nucleic acid sequence having homology to a native mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (see, Vaucheret, et al. (1998) Plant J. 16:651-659 and Gura, (2000) Nature 404:804-808).
- Another variation describes the use of plant viral sequences to direct the suppression of proximal mRNA encoding sequences (PCT Publication WO 1998/36083).
- Recent work has described the use of “hairpin” structures that incorporate all or part, of an mRNA encoding sequence in a complementary orientation that results in a potential “stem-loop” structure for the expressed RNA (PCT Publication Number WO 1999/53050). In this case the stem is formed by polynucleotides corresponding to the gene of interest inserted in either sense or anti-sense orientation with respect to the promoter and the loop is formed by some polynucleotides of the gene of interest, which do not have a complement in the construct. This increases the frequency of cosuppression or silencing in the recovered transgenic plants. For review of hairpin suppression see, Wesley, et al., (2003) Methods in Molecular Biology, Plant Functional Genomics: Methods and Protocols 236:273-286.
- A construct where the stem is formed by at least 30 nucleotides from a gene to be suppressed and the loop is formed by a random nucleotide sequence has also effectively been used for suppression (WO 1999/61632).
- The use of poly-T and poly-A sequences to generate the stem in the stem-loop structure has also been described (WO 2002/00894).
- Yet another variation includes using synthetic repeats to promote formation of a stem in the stem-loop structure. Transgenic organisms prepared with such recombinant DNA fragments have been shown to have reduced levels of the protein encoded by the nucleotide fragment forming the loop as described in PCT Publication Number WO 2002/00904.
- RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire, et al., (1998) Nature 391:806). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire, et al., (1999) Trends Genet. 15:358). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA of viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized.
- The presence of long dsRNAs in cells stimulates the activity of a ribonuclease Ill enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein, et al., (2001) Nature 409:363). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir, et al., (2001) Genes Dev. 15:188). Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner, et al., (2001) Science 293:834). The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementarity to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir, et al., (2001) Genes Dev. 15:188). In addition, RNA interference can also involve small RNA (e.g., miRNA) mediated gene silencing, presumably through cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see, e.g., Allshire, (2002) Science 297:1818-1819; Volpe, et al., (2002) Science 297:1833-1837; Jenuwein, (2002) Science 297:2215-2218; and Hall, et al., (2002) Science 297:2232-2237). As such, miRNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional or post-transcriptional level.
- Methods and compositions are further provided which allow for an increase in RNAi produced from the silencing element. In such embodiments, the methods and compositions employ a first polynucleotide comprising a silencing element for a target pest sequence operably linked to a promoter active in the plant cell; and, a second polynucleotide comprising a suppressor enhancer element comprising the target pest sequence or an active variant or fragment thereof operably linked to a promoter active in the plant cell. The combined expression of the silencing element with suppressor enhancer element leads to an increased amplification of the inhibitory RNA produced from the silencing element over that achievable with only the expression of the silencing element alone. In addition to the increased amplification of the specific RNAi species itself, the methods and compositions further allow for the production of a diverse population of RNAi species that can enhance the effectiveness of disrupting target gene expression. As such, when the suppressor enhancer element is expressed in a plant cell in combination with the silencing element, the methods and composition can allow for the systemic production of RNAi throughout the plant; the production of greater amounts of RNAi than would be observed with just the silencing element construct alone; and, the improved loading of RNAi into the phloem of the plant, thus providing better control of phloem feeding insects by an RNAi approach. Thus, the various methods and compositions provide improved methods for the delivery of inhibitory RNA to the target organism. See, for example, US 2009/0188008.
- As used herein, a “suppressor enhancer element” comprises a polynucleotide comprising the target sequence to be suppressed or an active fragment or variant thereof. It is recognize that the suppressor enhancer element need not be identical to the target sequence, but rather, the suppressor enhancer element can comprise a variant of the target sequence, so long as the suppressor enhancer element has sufficient sequence identity to the target sequence to allow for an increased level of the RNAi produced by the silencing element over that achievable with only the expression of the silencing element. Similarly, the suppressor enhancer element can comprise a fragment of the target sequence, wherein the fragment is of sufficient length to allow for an increased level of the RNAi produced by the silencing element over that achievable with only the expression of the silencing element.
- It is recognized that multiple suppressor enhancer elements from the same target sequence or from different target sequences or from different regions of the same target sequence can be employed. For example, the suppressor enhancer elements employed can comprise fragments of the target sequence derived from different region of the target sequence (i.e., from the 3′UTR, coding sequence, intron, and/or 5′UTR). Further, the suppressor enhancer element can be contained in an expression cassette, as described elsewhere herein, and in specific embodiments, the suppressor enhancer element is on the same or on a different DNA vector or construct as the silencing element. The suppressor enhancer element can be operably linked to a promoter as disclosed herein. It is recognized that the suppressor enhancer element can be expressed constitutively or alternatively, it may be produced in a stage-specific manner employing the various inducible or tissue-preferred or developmentally regulated promoters that are discussed elsewhere herein.
- In specific embodiments, employing both a silencing element and the suppressor enhancer element the systemic production of RNAi occurs throughout the entire plant. In further embodiments, the plant or plant parts of the invention have an improved loading of RNAi into the phloem of the plant than would be observed with the expression of the silencing element construct alone and, thus provide better control of phloem feeding insects by an RNAi approach. In specific embodiments, the plants, plant parts, and plant cells of the invention can further be characterized as allowing for the production of a diversity of RNAi species that can enhance the effectiveness of disrupting target gene expression.
- In specific embodiments, the combined expression of the silencing element and the suppressor enhancer element increases the concentration of the inhibitory RNA in the plant cell, plant, plant part, plant tissue or phloem over the level that is achieved when the silencing element is expressed alone.
- As used herein, an “increased level of inhibitory RNA” comprises any statistically significant increase in the level of RNAi produced in a plant having the combined expression when compared to an appropriate control plant. For example, an increase in the level of RNAi in the plant, plant part or the plant cell can comprise at least about a 1%, about a 1%-5%, about a 5%-10%, about a 10%-20%, about a 20%-30%, about a 30%-40%, about a 40%-50%, about a 50%-60%, about 60-70%, about 70%-80%, about a 80%-90%, about a 90%-100% or greater increase in the level of RNAi in the plant, plant part, plant cell or phloem when compared to an appropriate control. In other embodiments, the increase in the level of RNAi in the plant, plant part, plant cell or phloem can comprise at least about a 1 fold, about a 1 fold-5 fold, about a 5 fold-10 fold, about a 10 fold-20 fold, about a 20 fold-30 fold, about a 30 fold-40 fold, about a 40 fold-50 fold, about a 50 fold-60 fold, about 60 fold-70 fold, about 70 fold-80 fold, about a 80 fold-90 fold, about a 90 fold-100 fold or greater increase in the level of RNAi in the plant, plant part, plant cell or phloem when compared to an appropriate control. Examples of combined expression of the silencing element with suppressor enhancer element for the control of Stinkbugs and Lygus can be found in US 2011/0301223 and US 2009/0192117. Some embodiments relate to down-regulation of expression of target genes in insect pest species by interfering ribonucleic acid (RNA) molecules. WO 2007/074405 describes methods of inhibiting expression of target genes in invertebrate pests including Colorado potato beetle. WO 2005/110068 describes methods of inhibiting expression of target genes in invertebrate pests including in particular Western corn rootworm as a means to control insect infestation. Furthermore, WO 2009/091864 describes compositions and methods for the suppression of target genes from insect pest species including pests from the Lygus genus. Nucleic acid molecules including RNAi for targeting the vacuolar ATPase H subunit, useful for controlling a coleopteran pest population and infestation as described in US Patent Application Publication 2012/0198586. WO 2012/055982 describes ribonucleic acid (RNA or double stranded RNA) that inhibits or down regulates the expression of a target gene that encodes: an insect ribosomal protein such as the ribosomal protein L19, the ribosomal protein L40 or the ribosomal protein S27A; an insect proteasome subunit such as the Rpn6 protein, the
Pros 25, the Rpn2 protein, theproteasome beta 1 subunit protein or thePros beta 2 protein; an insect β-coatomer of the COPI vesicle, the γ-coatomer of the COPI vesicle, the β′-coatomer protein or the ζ-coatomer of the COPI vesicle; an insect Tetraspanine 2 A protein which is a putative transmembrane domain protein; an insect protein belonging to the actin family such as Actin 5C; an insect ubiquitin-5E protein; an insect Sec23 protein which is a GTPase activator involved in intracellular protein transport; an insect crinkled protein which is an unconventional myosin which is involved in motor activity; an insect crooked neck protein which is involved in the regulation of nuclear alternative mRNA splicing; an insect vacuolar H+-ATPase G-subunit protein; and an insect Tbp-1 such as Tat-binding protein. US Patent Application Publications 2012/029750 and 2012/0322660 describe an interfering ribonucleic acid (RNA or double stranded RNA) that functions upon uptake by an insect pest species to down-regulate expression of a target gene in said insect pest, wherein the RNA comprises at least one silencing element wherein the silencing element is a region of double-stranded RNA comprising annealed complementary strands, one strand of which comprises or consists of a sequence of nucleotides which is at least partially complementary to a target nucleotide sequence within the target gene. US Patent Application Publication 2012/0164205 describe potential targets for interfering double stranded ribonucleic acids for inhibiting invertebrate pests including: a Chd3 Homologous Sequence, a Beta-Tubulin Homologous Sequence, a 40 kDa V-ATPase Homologous Sequence, a EF1a Homologous Sequence, a 26S Proteosome Subunit p28 Homologous Sequence, a Juvenile Hormone Epoxide Hydrolase Homologous Sequence, a Swelling Dependent Chloride Channel Protein Homologous Sequence, a Glucose-6-Phosphate 1-Dehydrogenase Protein Homologous Sequence, an Act42A Protein Homologous Sequence, a ADP-Ribosylation Factor 1 Homologous Sequence, a Transcription Factor IIB Protein Homologous Sequence, a Chitinase Homologous Sequences, a Ubiquitin Conjugating Enzyme Homologous Sequence, a Glyceraldehyde-3-Phosphate Dehydrogenase Homologous Sequence, an Ubiquitin B Homologous Sequence, a Juvenile Hormone Esterase Homolog, and an Alpha Tubuliln Homologous Sequence. - General methods for employing strains comprising a nucleic acid sequence of the embodiments or a variant thereof, in pesticide control or in engineering other organisms as pesticidal agents are known in the art. See, for example U.S. Pat. No. 5,039,523 and EP 0480762A2.
- Microorganism hosts that are known to occupy the “phytosphere” (phylloplane, phyllosphere, rhizosphere, and/or rhizoplana) of one or more crops of interest may be selected. These microorganisms are selected so as to be capable of successfully competing in the particular environment with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing the PIP-1 polypeptide, and desirably, provide for improved protection of the pesticide from environmental degradation and inactivation.
- Such microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms such as bacteria, e.g., Alcaligenes, Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes, fungi, particularly yeast, e.g., Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodotorula, and Aureobasidium. Of particular interest are such phytosphere bacterial species as Alcaligenes faecalis, Pseudomonas syringae, Pseudomonas fluorescens, Serratia marcescens, Acetobacter xylinum, Agrobacteria, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus, Clavibacter xyli and Azotobacter vinelandii and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. marina, R. aurantiaca, Cryptococcus albidus, C. diffluens, C. laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, Sporobolomyces roseus, S. odorus, Kluyveromyces veronae, and Aureobasidium pollulans. Of particular interest are the pigmented microorganisms. Host organisms of particular interest include yeast, such as Rhodotorula spp., Aureobasidium spp., Saccharomyces spp. (such as S. cerevisiae), Sporobolomyces spp., phylloplane organisms such as Pseudomonas spp. (such as P. aeruginosa, P. fluorescens, P. chlororaphis), Erwinia spp., and Flavobacterium spp., and other such organisms, including Agrobacterium tumefaciens, E. coli, Bacillus subtilis, and the like.
- Genes encoding the PIP-1 polypeptides of the embodiments can be introduced into microorganisms that multiply on plants (epiphytes) to deliver PIP-1 polypeptides to potential target pests. Epiphytes, for example, can be gram-positive or gram-negative bacteria.
- Root-colonizing bacteria, for example, can be isolated from the plant of interest by methods known in the art. Specifically, a Bacillus cereus strain that colonizes roots can be isolated from roots of a plant (see, for example, Handelsman, et al., (1991) Appl. Environ. Microbiol. 56:713-718). Genes encoding the PIP-1 polypeptides of the embodiments can be introduced into a root-colonizing Bacillus cereus by standard methods known in the art.
- Genes encoding PIP-1 polypeptides can be introduced, for example, into the root-colonizing Bacillus by means of electro transformation. Specifically, genes encoding the PIP-1 polypeptides can be cloned into a shuttle vector, for example, pHT3101 (Lerecius, et al., (1989) FEMS Microbiol. Letts. 60:211-218. The shuttle vector pHT3101 containing the coding sequence for the particular PIP-1 polypeptide gene can, for example, be transformed into the root-colonizing Bacillus by means of electroporation (Lerecius, et al., (1989) FEMS Microbiol. Letts. 60:211-218).
- Expression systems can be designed so that PIP-1 polypeptides are secreted outside the cytoplasm of gram-negative bacteria, such as E. coli, for example. Advantages of having PIP-1 polypeptides secreted are: (1) avoidance of potential cytotoxic effects of the PIP-1 polypeptide expressed; and (2) improvement in the efficiency of purification of the PIP-1 polypeptide, including, but not limited to, increased efficiency in the recovery and purification of the protein per volume cell broth and decreased time and/or costs of recovery and purification per unit protein.
- PIP-1 polypeptides can be made to be secreted in E. coli, for example, by fusing an appropriate E. coli signal peptide to the amino-terminal end of the PIP-1 polypeptide. Signal peptides recognized by E. coli can be found in proteins already known to be secreted in E. coli, for example the OmpA protein (Ghrayeb, et al., (1984) EMBO J, 3:2437-2442). OmpA is a major protein of the E. coli outer membrane, and thus its signal peptide is thought to be efficient in the translocation process. Also, the OmpA signal peptide does not need to be modified before processing as may be the case for other signal peptides, for example lipoprotein signal peptide (Duffaud, et al., (1987) Meth. Enzymol. 153:492).
- PIP-1 polypeptides of the embodiments can be fermented in a bacterial host and the resulting bacteria processed and used as a microbial spray in the same manner that Bt strains have been used as insecticidal sprays. In the case of a PIP-1 polypeptide(s) that is secreted from Bacillus, the secretion signal is removed or mutated using procedures known in the art. Such mutations and/or deletions prevent secretion of the PIP-1 polypeptide(s) into the growth medium during the fermentation process. The PIP-1 polypeptides are retained within the cell, and the cells are then processed to yield the encapsulated PIP-1 polypeptides. Any suitable microorganism can be used for this purpose. Pseudomonas has been used to express Bt toxins as encapsulated proteins and the resulting cells processed and sprayed as an insecticide (Gaertner, et al., (1993), in: Advanced Engineered Pesticides, ed. Kim).
- Alternatively, the PIP-1 polypeptides are produced by introducing a heterologous gene into a cellular host. Expression of the heterologous gene results, directly or indirectly, in the intracellular production and maintenance of the pesticide. These cells are then treated under conditions that prolong the activity of the toxin produced in the cell when the cell is applied to the environment of target pest(s). The resulting product retains the toxicity of the toxin. These naturally encapsulated PIP-1 polypeptides may then be formulated in accordance with conventional techniques for application to the environment hosting a target pest, e.g., soil, water, and foliage of plants. See, for example EPA 0192319, and the references cited therein.
- In some embodiments the active ingredients can be applied in the form of compositions and can be applied to the crop area or plant to be treated, simultaneously or in succession, with other compounds. These compounds can be fertilizers, weed killers, Cryoprotectants, surfactants, detergents, pesticidal soaps, dormant oils, polymers, and/or time-release or biodegradable carrier formulations that permit long-term dosing of a target area following a single application of the formulation. They can also be selective herbicides, chemical insecticides, virucides, microbicides, amoebicides, pesticides, fungicides, bacteriocides, nematocides, molluscicides or mixtures of several of these preparations, if desired, together with further agriculturally acceptable carriers, surfactants or application-promoting adjuvants customarily employed in the art of formulation. Suitable carriers and adjuvants can be solid or liquid and correspond to the substances ordinarily employed in formulation technology, e.g. natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackifiers, binders or fertilizers. Likewise the formulations may be prepared into edible “baits” or fashioned into pest “traps” to permit feeding or ingestion by a target pest of the pesticidal formulation.
- Methods of applying an active ingredient or an agrochemical composition that contains at least one of the PIP-1 polypeptides produced by the bacterial strains include leaf application, seed coating and soil application. The number of applications and the rate of application depend on the intensity of infestation by the corresponding pest.
- The composition may be formulated as a powder, dust, pellet, granule, spray, emulsion, colloid, solution or such like, and may be prepared by such conventional means as desiccation, lyophilization, homogenation, extraction, filtration, centrifugation, sedimentation or concentration of a culture of cells comprising the polypeptide. In all such compositions that contain at least one such pesticidal polypeptide, the polypeptide may be present in a concentration of from about 1% to about 99% by weight.
- Lepidopteran, dipteran, heteropteran, nematode, hemiptera or coleopteran pests may be killed or reduced in numbers in a given area by the methods of the disclosure or may be prophylactically applied to an environmental area to prevent infestation by a susceptible pest. Preferably the pest ingests or is contacted with, a pesticidally-effective amount of the polypeptide. By “pesticidally-effective amount” is intended an amount of the pesticide that is able to bring about death to at least one pest or to noticeably reduce pest growth, feeding or normal physiological development. This amount will vary depending on such factors as, for example, the specific target pests to be controlled, the specific environment, location, plant, crop or agricultural site to be treated, the environmental conditions, and the method, rate, concentration, stability, and quantity of application of the pesticidally-effective polypeptide composition. The formulations may also vary with respect to climatic conditions, environmental considerations, and/or frequency of application and/or severity of pest infestation.
- The pesticide compositions described may be made by formulating either the bacterial cell, Crystal and/or spore suspension or isolated protein component with the desired agriculturally-acceptable carrier. The compositions may be formulated prior to administration in an appropriate means such as lyophilized, freeze-dried, desiccated or in an aqueous carrier, medium or suitable diluent, such as saline or other buffer. The formulated compositions may be in the form of a dust or granular material or a suspension in oil (vegetable or mineral) or water or oil/water emulsions or as a wettable powder or in combination with any other carrier material suitable for agricultural application. Suitable agricultural carriers can be solid or liquid and are well known in the art. The term “agriculturally-acceptable carrier” covers all adjuvants, inert components, dispersants, surfactants, tackifiers, binders, etc. that are ordinarily used in pesticide formulation technology; these are well known to those skilled in pesticide formulation. The formulations may be mixed with one or more solid or liquid adjuvants and prepared by various means, e.g., by homogeneously mixing, blending and/or grinding the pesticidal composition with suitable adjuvants using conventional formulation techniques. Suitable formulations and application methods are described in U.S. Pat. No. 6,468,523, herein incorporated by reference. The plants can also be treated with one or more chemical compositions, including one or more herbicide, insecticides or fungicides.
- Exemplary chemical compositions include: Fruits/Vegetables Herbicides: Atrazine, Bromacil, Diuron, Glyphosate, Linuron, Metribuzin, Simazine, Trifluralin, Fluazifop, Glufosinate, Halo sulfuron Gowan, Paraquat, Propyzamide, Sethoxydim, Butafenacil, Halosulfuron, Indaziflam; Fruits/Vegetables Insecticides: Aldicarb, Bacillus thuriengiensis, Carbaryl, Carbofuran, Chlorpyrifos, Cypermethrin, Deltamethrin, Diazinon, Malathion, Abamectin, Cyfluthrin/beta-cyfluthrin, Esfenvalerate, Lambda-cyhalothrin, Acequinocyl, Bifenazate, Methoxyfenozide, Novaluron, Chromafenozide, Thiacloprid, Dinotefuran, FluaCrypyrim, Tolfenpyrad, Clothianidin, Spirodiclofen, Gamma-cyhalothrin, Spiromesifen, Spinosad, Rynaxypyr, Cyazypyr, Spinoteram, Triflumuron, Spirotetramat, Imidacloprid, Flubendiamide, Thiodicarb, Metaflumizone, Sulfoxaflor, Cyflumetofen, Cyanopyrafen, Imidacloprid, Clothianidin, Thiamethoxam, Spinotoram, Thiodicarb, Flonicamid, Methiocarb, Emamectin-benzoate, Indoxacarb, Forthiazate, Fenamiphos, Cadusaphos, Pyriproxifen, Fenbutatin-oxid, Hexthiazox, Methomyl, 4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on; Fruits/Vegetables Fungicides: Carbendazim, Chlorothalonil, EBDCs, Sulphur, Thiophanate-methyl, Azoxystrobin, Cymoxanil, Fluazinam, Fosetyl, Iprodione, Kresoxim-methyl, Metalaxyl/mefenoxam, Trifloxystrobin, Ethaboxam, Iprovalicarb, Trifloxystrobin, Fenhexamid, Oxpoconazole fumarate, Cyazofamid, Fenamidone, Zoxamide, Picoxystrobin, Pyraclostrobin, Cyflufenamid, Boscalid; Cereals Herbicides: Isoproturon, Bromoxynil, Ioxynil, Phenoxies, Chlorsulfuron, Clodinafop, Diclofop, Diflufenican, Fenoxaprop, Florasulam, Fluoroxypyr, Metsulfuron, Triasulfuron, Flucarbazone, Iodosulfuron, Propoxycarbazone, Picolinafen, Mesosulfuron, Beflubutamid, Pinoxaden, Amidosulfuron, Thifensulfuron Methyl, Tribenuron, Flupyrsulfuron, Sulfosulfuron, Pyrasulfotole, Pyroxsulam, Flufenacet, Tralkoxydim, Pyroxasulfon; Cereals Fungicides: Carbendazim, Chlorothalonil, Azoxystrobin, Cyproconazole, Cyprodinil, Fenpropimorph, Epoxiconazole, Kresoxim-methyl, Quinoxyfen, Tebuconazole, Trifloxystrobin, Simeconazole, Picoxystrobin, Pyraclostrobin, Dimoxystrobin, Prothioconazole, Fluoxastrobin; Cereals Insecticides: Dimethoate, Lambda-cyhalthrin, Deltamethrin, alpha-Cypermethrin, β-cyfluthrin, Bifenthrin, Imidacloprid, Clothianidin, Thiamethoxam, Thiacloprid, Acetamiprid, Dinetofuran, Clorphyriphos, Metamidophos, Oxidemethon-methyl, Pirimicarb, Methiocarb; Maize Herbicides: Atrazine, Alachlor, Bromoxynil, Acetochlor, Dicamba, Clopyralid, (S-) Dimethenamid, Glufosinate, Glyphosate, Isoxaflutole, (S-)Metolachlor, Mesotrione, Nicosulfuron, Primisulfuron, Rimsulfuron, Sulcotrione, Foramsulfuron, Topramezone, Tembotrione, Saflufenacil, Thiencarbazone, Flufenacet, Pyroxasulfon; Maize Insecticides: Carbofuran, Chlorpyrifos, Bifenthrin, Fipronil, Imidacloprid, Lambda-Cyhalothrin, Tefluthrin, Terbufos, Thiamethoxam, Clothianidin, Spiromesifen, Flubendiamide, Triflumuron, Rynaxypyr, Deltamethrin, Thiodicarb, β-Cyfluthrin, Cypermethrin, Bifenthrin, Lufenuron, Triflumoron, Tefluthrin, Tebupirimphos, Ethiprole, Cyazypyr, Thiacloprid, Acetamiprid, Dinetofuran, Avermectin, Methiocarb, Spirodiclofen, Spirotetramat; Maize Fungicides: Fenitropan, Thiram, Prothioconazole, Tebuconazole, Trifloxystrobin; Rice Herbicides: Butachlor, Propanil, Azimsulfuron, Bensulfuron, Cyhalofop, Daimuron, Fentrazamide, Imazosulfuron, Mefenacet, Oxaziclomefone, Pyrazosulfuron, Pyributicarb, Quinclorac, Thiobencarb, Indanofan, Flufenacet, Fentrazamide, Halosulfuron, Oxaziclomefone, Benzobicyclon, Pyriftalid, Penoxsulam, Bispyribac, Oxadiargyl, Ethoxysulfuron, Pretilachlor, Mesotrione, Tefuryltrione, Oxadiazone, Fenoxaprop, Pyrimisulfan; Rice Insecticides: Diazinon, Fenitrothion, Fenobucarb, Monocrotophos, Benfuracarb, Buprofezin, Dinotefuran, Fipronil, Imidacloprid, Isoprocarb, Thiacloprid, Chromafenozide, Thiacloprid, Dinotefuran, Clothianidin, Ethiprole, Flubendiamide, Rynaxypyr, Deltamethrin, Acetamiprid, Thiamethoxam, Cyazypyr, Spinosad, Spinotoram, Emamectin-Benzoate, Cypermethrin, Chlorpyriphos, Cartap, Methamidophos, Etofenprox, Triazophos, 4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on, Carbofuran, Benfuracarb; Rice Fungicides: Thiophanate-methyl, Azoxystrobin, Carpropamid, Edifenphos, Ferimzone, Iprobenfos, Isoprothiolane, Pencycuron, Probenazole, Pyroquilon, Tricyclazole, Trifloxystrobin, Diclocymet, Fenoxanil, Simeconazole, Tiadinil; Cotton Herbicides: Diuron, Fluometuron, MSMA, Oxyfluorfen, Prometryn, Trifluralin, Carfentrazone, Clethodim, Fluazifop-butyl, Glyphosate, Norflurazon, Pendimethalin, Pyrithiobac-sodium, Trifloxysulfuron, Tepraloxydim, Glufosinate, Flumioxazin, Thidiazuron; Cotton Insecticides: Acephate, Aldicarb, Chlorpyrifos, Cypermethrin, Deltamethrin, Malathion, Monocrotophos, Abamectin, Acetamiprid, Emamectin Benzoate, Imidacloprid, Indoxacarb, Lambda-Cyhalothrin, Spinosad, Thiodicarb, Gamma-Cyhalothrin, Spiromesifen, Pyridalyl, Flonicamid, Flubendiamide, Triflumuron, Rynaxypyr, Beta-Cyfluthrin, Spirotetramat, Clothianidin, Thiamethoxam, Thiacloprid, Dinetofuran, Flubendiamide, Cyazypyr, Spinosad, Spinotoram, gamma Cyhalothrin, 4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on, Thiodicarb, Avermectin, Flonicamid, Pyridalyl, Spiromesifen, Sulfoxaflor, Profenophos, Thriazophos, Endosulfan; Cotton Fungicides: Etridiazole, Metalaxyl, Quintozene; Soybean Herbicides: Alachlor, Bentazone, Trifluralin, Chlorimuron-Ethyl, Cloransulam-Methyl, Fenoxaprop, Fomesafen, Fluazifop, Glyphosate, Imazamox, Imazaquin, Imazethapyr, (S-)Metolachlor, Metribuzin, Pendimethalin, Tepraloxydim, Glufosinate; Soybean Insecticides: Lambda-cyhalothrin, Methomyl, Parathion, Thiocarb, Imidacloprid, Clothianidin, Thiamethoxam, Thiacloprid, Acetamiprid, Dinetofuran, Flubendiamide, Rynaxypyr, Cyazypyr, Spinosad, Spinotoram, Emamectin-Benzoate, Fipronil, Ethiprole, Deltamethrin, β-Cyfluthrin, gamma and lambda Cyhalothrin, 4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on, Spirotetramat, Spinodiclofen, Triflumuron, Flonicamid, Thiodicarb, beta-Cyfluthrin; Soybean Fungicides: Azoxystrobin, Cyproconazole, Epoxiconazole, Flutriafol, Pyraclostrobin, Tebuconazole, Trifloxystrobin, Prothioconazole, Tetraconazole; Sugarbeet Herbicides: Chloridazon, Desmedipham, Ethofumesate, Phenmedipham, Triallate, Clopyralid, Fluazifop, Lenacil, Metamitron, Quinmerac, Cycloxydim, Triflusulfuron, Tepraloxydim, Quizalofop; Sugarbeet Insecticides: Imidacloprid, Clothianidin, Thiamethoxam, Thiacloprid, Acetamiprid, Dinetofuran, Deltamethrin, β-Cyfluthrin, gamma/lambda Cyhalothrin, 4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on, Tefluthrin, Rynaxypyr, Cyaxypyr, Fipronil, Carbofuran; Canola Herbicides: Clopyralid, Diclofop, Fluazifop, Glufosinate, Glyphosate, Metazachlor, Trifluralin Ethametsulfuron, Quinmerac, Quizalofop, Clethodim, Tepraloxydim; Canola Fungicides: Azoxystrobin, Carbendazim, Fludioxonil, Iprodione, Prochloraz, Vinclozolin; Canola Insecticides: Carbofuran organophosphates, Pyrethroids, Thiacloprid, Deltamethrin, Imidacloprid, Clothianidin, Thiamethoxam, Acetamiprid, Dinetofuran, β-Cyfluthrin, gamma and lambda Cyhalothrin, tau-Fluvaleriate, Ethiprole, Spinosad, Spinotoram, Flubendiamide, Rynaxypyr, Cyazypyr, 4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on.
- In some embodiments the herbicide is Atrazine, Bromacil, Diuron, Chlorsulfuron, Metsulfuron, Thifensulfuron Methyl, Tribenuron, Acetochlor, Dicamba, Isoxaflutole, Nicosulfuron, Rimsulfuron, Pyrithiobac-sodium, Flumioxazin, Chlorimuron-Ethyl, Metribuzin, Quizalofop, S-metolachlor, Hexazinne or combinations thereof.
- In some embodiments the insecticide is Esfenvalerate, Chlorantraniliprole, Methomyl, Indoxacarb, Oxamyl or combinations thereof.
- “Pest” includes but is not limited to, insects, fungi, bacteria, nematodes, mites, ticks, and the like. Insect pests include insects selected from the orders Coleoptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera, etc., particularly Lepidoptera, and Hemiptera.
- Those skilled in the art will recognize that not all compounds are equally effective against all pests. Compounds of the embodiments display activity against insect pests, which may include economically important agronomic, forest, greenhouse, nursery ornamentals, food and fiber, public and animal health, domestic and commercial structure, household and stored product pests.
- Larvae of the order Lepidoptera include, but are not limited to, armyworms, cutworms, loopers, and heliothines in the family Noctuidae Spodoptera frugiperda J E Smith (fall armyworm); S. exigua Hübner (beet armyworm); S. litura Fabricius (tobacco cutworm, cluster caterpillar); Mamestra configurata Walker (bertha armyworm); M. brassicae Linnaeus (cabbage moth); Agrotis ipsilon Hufnagel (black cutworm); A. orthogonia Morrison (western cutworm); A. subterranea Fabricius (granulate cutworm); Alabama argillacea Hübner (cotton leaf worm); Trichoplusia ni Hübner (cabbage looper); Pseudoplusia includens Walker (soybean looper); Anticarsia gemmatalis Hübner (velvetbean caterpillar); Hypena scabra Fabricius (green cloverworm); Heliothis virescens Fabricius (tobacco budworm); Pseudaletia unipuncta Haworth (armyworm); Athetis mindara Barnes and Mcdunnough (rough skinned cutworm); Euxoa messoria Harris (darksided cutworm); Earias insulana Boisduval (spiny bollworm); E. vittella Fabricius (spotted bollworm); Helicoverpa armigera Hübner (American bollworm); H. zea Boddie (corn earworm or cotton bollworm); Melanchra picta Harris (zebra caterpillar); Egira (Xylomyges) curialis Grote (citrus cutworm); borers, casebearers, webworms, coneworms, and skeletonizers from the family Pyralidae Ostrinia nubilalis Hübner (European corn borer); Amyelois transitella Walker (naval orangeworm); Anagasta kuehniella Zeller (Mediterranean flour moth); Cadra cautella Walker (almond moth); Chilo suppressalis Walker (rice stem borer); C. partellus, (sorghum borer); Corcyra cephalonica Stainton (rice moth); Crambus caliginosellus Clemens (corn root webworm); C. teterrellus Zincken (bluegrass webworm); Cnaphalocrocis medinalis Guenee (rice leaf roller); Desmia funeralis Hübner (grape leaffolder); Diaphania hyalinata Linnaeus (melon worm); D. nitidalis Stoll (pickleworm); Diatraea grandiosella Dyar (southwestern corn borer), D. saccharalis Fabricius (sugarcane borer); Eoreuma loftini Dyar (Mexican rice borer); Ephestia elutella Hübner (tobacco (cacao) moth); Galleria mellonella Linnaeus (greater wax moth); Herpetogramma licarsisalis Walker (sod webworm); Homoeosoma electellum Hulst (sunflower moth); Elasmopalpus lignosellus Zeller (lesser cornstalk borer); Achroia grisella Fabricius (lesser wax moth); Loxostege sticticalis Linnaeus (beet webworm); Orthaga thyrisalis Walker (tea tree web moth); Maruca testulalis Geyer (bean pod borer); Plodia interpunctella Hübner (Indian meal moth); Scirpophaga incertulas Walker (yellow stem borer); Udea rubigalis Guenee (celery leaftier); and leafrollers, budworms, seed worms, and fruit worms in the family Tortricidae Acleris gloverana Walsingham (Western blackheaded budworm); A. variana Fernald (Eastern blackheaded budworm); Archips argyrospila Walker (fruit tree leaf roller); A. rosana Linnaeus (European leaf roller); and other Archips species, Adoxophyes orana Fischer von Rösslerstamm (summer fruit tortrix moth); Cochylis hospes Walsingham (banded sunflower moth); Cydia latiferreana Walsingham (filbertworm); C. pomonella Linnaeus (coding moth); Platynota flavedana Clemens (variegated leafroller); P. stultana Walsingham (omnivorous leafroller); Lobesia botrana Denis & Schiffermüller (European grape vine moth); Spilonota ocellana Denis & Schiffermüller (eyespotted bud moth); Endopiza viteana Clemens (grape berry moth); Eupoecilia ambiguella Hübner (vine moth); Bonagota salubricola Meyrick (Brazilian apple leafroller); Grapholita molesta Busck (oriental fruit moth); Suleima helianthana Riley (sunflower bud moth); Argyrotaenia spp.; Choristoneura spp.
- Selected other agronomic pests in the order Lepidoptera include, but are not limited to, Alsophila pometaria Harris (fall cankerworm); Anarsia lineatella Zeller (peach twig borer); Anisota senatoria J. E. Smith (orange striped oakworm); Antheraea pernyi Guerin-Meneville (Chinese Oak Tussah Moth); Bombyx mori Linnaeus (Silkworm); Bucculatrix thurberiella Busck (cotton leaf perforator); Colias eurytheme Boisduval (alfalfa caterpillar); Datana integerrima Grote & Robinson (walnut caterpillar); Dendrolimus sibiricus Tschetwerikov (Siberian silk moth), Ennomos subsignaria Hübner (elm spanworm); Erannis tiliaria Harris (linden looper); Euproctis chrysorrhoea Linnaeus (browntail moth); Harrisina americana Guerin-Meneville (grapeleaf skeletonizer); Hemileuca oliviae Cockrell (range caterpillar); Hyphantria cunea Drury (fall webworm); Keiferia lycopersicella Walsingham (tomato pinworm); Lambdina fiscellaria fiscellaria Hulst (Eastern hemlock looper); L. fiscellaria lugubrosa Hulst (Western hemlock looper); Leucoma salicis Linnaeus (satin moth); Lymantria dispar Linnaeus (gypsy moth); Manduca quinquemaculata Haworth (five spotted hawk moth, tomato hornworm); M. sexta Haworth (tomato hornworm, tobacco hornworm); Operophtera brumata Linnaeus (winter moth); Paleacrita vernata Peck (spring cankerworm); Papilio cresphontes Cramer (giant swallowtail orange dog); Phryganidia californica Packard (California oakworm); Phyllocnistis citrella Stainton (citrus leafminer); Phyllonorycter blancardella Fabricius (spotted tentiform leafminer); Pieris brassicae Linnaeus (large white butterfly); P. rapae Linnaeus (small white butterfly); P. napi Linnaeus (green veined white butterfly); Platyptilia carduidactyla Riley (artichoke plume moth); Plutella xylostella Linnaeus (diamondback moth); Pectinophora gossypiella Saunders (pink bollworm); Pontia protodice Boisduval & Leconte (Southern cabbageworm); Sabulodes aegrotata Guenee (omnivorous looper); Schizura concinna J. E. Smith (red humped caterpillar); Sitotroga cerealella Olivier (Angoumois grain moth); Thaumetopoea pityocampa Schiffermuller (pine processionary caterpillar); Tineola bisselliella Hummel (webbing clothesmoth); Tuta absoluta Meyrick (tomato leafminer); Yponomeuta padella Linnaeus (ermine moth); Heliothis subflexa Guenee; Malacosoma spp. and Orgyia spp.
- Of interest are larvae and adults of the order Coleoptera including weevils from the families Anthribidae, Bruchidae, and Curculionidae (including, but not limited to: Anthonomus grandis Boheman (boll weevil); Lissorhoptrus oryzophilus Kuschel (rice water weevil); Sitophilus granarius Linnaeus (granary weevil); S. oryzae Linnaeus (rice weevil); Hypera punctata Fabricius (clover leaf weevil); Cylindrocopturus adspersus LeConte (sunflower stem weevil); Smicronyx fulvus LeConte (red sunflower seed weevil); S. sordidus LeConte (gray sunflower seed weevil); Sphenophorus maidis Chittenden (maize billbug)); flea beetles, cucumber beetles, rootworms, leaf beetles, potato beetles, and leafminers in the family Chrysomelidae (including, but not limited to: Leptinotarsa decemlineata Say (Colorado potato beetle); Diabrotica virgifera virgifera LeConte (western corn rootworm); D. barberi Smith & Lawrence (northern corn rootworm); D. undecimpunctata howardi Barber (southern corn rootworm); Chaetocnema pulicaria Melsheimer (corn flea beetle); Phyllotreta cruciferae Goeze (corn flea beetle); Colaspis brunnea Fabricius (grape colaspis); Oulema melanopus Linnaeus (cereal leaf beetle); Zygogramma exclamationis Fabricius (sunflower beetle)); beetles from the family Coccinellidae (including, but not limited to: Epilachna varivestis Mulsant (Mexican bean beetle)); chafers and other beetles from the family Scarabaeidae (including, but not limited to: Popillia japonica Newman (Japanese beetle); Cyclocephala borealis Arrow (northern masked chafer, white grub); C. immaculata Olivier (southern masked chafer, white grub); Rhizotrogus majalis Razoumowsky (European chafer); Phyllophaga crinita Burmeister (white grub); Ligyrus gibbosus De Geer (carrot beetle)); carpet beetles from the family Dermestidae; wireworms from the family Elateridae, Eleodes spp., Melanotus spp.; Conoderus spp.; Limonius spp.; Agriotes spp.; Ctenicera spp.; Aeolus spp.; bark beetles from the family Scolytidae and beetles from the family Tenebrionidae.
- Adults and immatures of the order Diptera are of interest, including leafminers Agromyza parvicornis Loew (corn blotch leafminer); midges (including, but not limited to: Contarinia sorghicola Coquillett (sorghum midge); Mayetiola destructor Say (Hessian fly); Sitodiplosis mosellana Gehin (wheat midge); Neolasioptera murtfeldtiana Felt, (sunflower seed midge)); fruit flies (Tephritidae), Oscinella frit Linnaeus (fruit flies); maggots (including, but not limited to: Delia platura Meigen (seedcorn maggot); D. coarctata Fallen (wheat bulb fly); and other Delia spp., Meromyza americana Fitch (wheat stem maggot); Musca domestica Linnaeus (house flies); Fannia canicularis Linnaeus, F. femoralis Stein (lesser house flies); Stomoxys calcitrans Linnaeus (stable flies)); face flies, horn flies, blow flies, Chrysomya spp.; Phormia spp.; and other muscoid fly pests, horse flies Tabanus spp.; bot flies Gastrophilus spp.; Oestrus spp.; cattle grubs Hypoderma spp.; deer flies Chrysops spp.; Melophagus ovinus Linnaeus (keds); and other Brachycera, mosquitoes Aedes spp.; Anopheles spp.; Culex spp.; black flies Prosimulium spp.; Simulium spp.; biting midges, sand flies, sciarids, and other Nematocera.
- Included as insects of interest are adults and nymphs of the orders Hemiptera and Homoptera such as, but not limited to, adelgids from the family Adelgidae, plant bugs from the family Miridae, cicadas from the family Cicadidae, leafhoppers, Empoasca spp.; from the family Cicadellidae, planthoppers from the families Cixiidae, Flatidae, Fulgoroidea, Issidae and Delphacidae, treehoppers from the family Membracidae, psyllids from the family Psyllidae, whiteflies from the family Aleyrodidae, aphids from the family Aphididae, phylloxera from the family Phylloxeridae, mealybugs from the family Pseudococcidae, scales from the families Asterolecanidae, Coccidae, Dactylopiidae, Diaspididae, Eriococcidae ortheziidae, Phoenicococcidae and Margarodidae, lace bugs from the family Tingidae, stink bugs from the family Pentatomidae, cinch bugs, Blissus spp.; and other seed bugs from the family Lygaeidae, spittlebugs from the family Cercopidae squash bugs from the family Coreidae, and red bugs and cotton stainers from the family Pyrrhocoridae.
- Agronomically important members from the order Homoptera further include, but are not limited to: Acyrthisiphon pisum Harris (pea aphid); Aphis craccivora Koch (cowpea aphid); A. fabae Scopoli (black bean aphid); A. gossypii Glover (cotton aphid, melon aphid); A. maidiradicis Forbes (corn root aphid); A. pomi De Geer (apple aphid); A. spiraecola Patch (spirea aphid); Aulacorthum solani Kaltenbach (foxglove aphid); Chaetosiphon fragaefolii Cockerell (strawberry aphid); Diuraphis noxia Kurdjumov/Mordvilko (Russian wheat aphid); Dysaphis plantaginea Paaserini (rosy apple aphid); Eriosoma lanigerum Hausmann (woolly apple aphid); Brevicoryne brassicae Linnaeus (cabbage aphid); Hyalopterus pruni Geoffroy (mealy plum aphid); Lipaphis erysimi Kaltenbach (turnip aphid); Metopolophium dirrhodum Walker (cereal aphid); Macrosiphum euphorbiae Thomas (potato aphid); Myzus persicae Sulzer (peach-potato aphid, green peach aphid); Nasonovia ribisnigri Mosley (lettuce aphid); Pemphigus spp. (root aphids and gall aphids); Rhopalosiphum maidis Fitch (corn leaf aphid); R. padi Linnaeus (bird cherry-oat aphid); Schizaphis graminum Rondani (greenbug); Sipha flava Forbes (yellow sugarcane aphid); Sitobion avenae Fabricius (English grain aphid); Therioaphis maculata Buckton (spotted alfalfa aphid); Toxoptera aurantii Boyer de Fonscolombe (black citrus aphid); and T. citricida Kirkaldy (brown citrus aphid); Adelges spp. (adelgids); Phylloxera devastatrix Pergande (pecan phylloxera); Bemisia tabaci Gennadius (tobacco whitefly, sweetpotato whitefly); B. argentifolii Bellows & Perring (silverleaf whitefly); Dialeurodes citri Ashmead (citrus whitefly); Trialeurodes abutiloneus (bandedwinged whitefly) and T. vaporariorum Westwood (greenhouse whitefly); Empoasca fabae Harris (potato leafhopper); Laodelphax striatellus Fallen (smaller brown planthopper); Macrolestes quadrilineatus Forbes (aster leafhopper); Nephotettix cinticeps Uhler (green leafhopper); N. nigropictus Stal (rice leafhopper); Nilaparvata lugens Stal (brown planthopper); Peregrinus maidis Ashmead (corn planthopper); Sogatella furcifera Horvath (white-backed planthopper); Sogatodes orizicola Muir (rice delphacid); Typhlocyba pomaria McAtee (white apple leafhopper); Erythroneoura spp. (grape leafhoppers); Magicicada septendecim Linnaeus (periodical cicada); Icerya purchasi Maskell (cottony cushion scale); Quadraspidiotus perniciosus Comstock (San Jose scale); Planococcus citri Risso (citrus mealybug); Pseudococcus spp. (other mealybug complex); Cacopsylla pyricola Foerster (pear psylla); Trioza diospyri Ashmead (persimmon psylla).
- Agronomically important species of interest from the order Hemiptera include, but are not limited to: Acrosternum hilare Say (green stink bug); Anasa tristis De Geer (squash bug); Blissus leucopterus leucopterus Say (chinch bug); Corythuca gossypii Fabricius (cotton lace bug); Cyrtopeltis modesta Distant (tomato bug); Dysdercus suturellus Herrich-Schäffer (cotton stainer); Euschistus servus Say (brown stink bug); E. variolarius Palisot de Beauvois (one-spotted stink bug); Graptostethus spp. (complex of seed bugs); Leptoglossus corculus Say (leaf-footed pine seed bug); Lygus lineolaris Palisot de Beauvois (tarnished plant bug); L. Hesperus Knight (Western tarnished plant bug); L. pratensis Linnaeus (common meadow bug); L. rugulipennis Poppius (European tarnished plant bug); Lygocoris pabulinus Linnaeus (common green capsid); Nezara viridula Linnaeus (southern green stink bug); Oebalus pugnax Fabricius (rice stink bug); Oncopeltus fasciatus Dallas (large milkweed bug); Pseudatomoscelis seriatus Reuter (cotton fleahopper).
- Furthermore, embodiments may be effective against Hemiptera such, Calocoris norvegicus Gmelin (strawberry bug); Orthops campestris Linnaeus; Plesiocoris rugicollis Fallen (apple capsid); Cyrtopeltis modestus Distant (tomato bug); Cyrtopeltis notatus Distant (suckfly); Spanagonicus albofasciatus Reuter (whitemarked fleahopper); Diaphnocoris chlorionis Say (honeylocust plant bug); Labopidicola allii Knight (onion plant bug); Pseudatomoscelis seriatus Reuter (cotton fleahopper); Adelphocoris rapidus Say (rapid plant bug); Poecilocapsus lineatus Fabricius (four-lined plant bug); Nysius ericae Schilling (false chinch bug); Nysius raphanus Howard (false chinch bug); Nezara viridula Linnaeus (Southern green stink bug); Eurygaster spp.; Coreidae spp.; Pyrrhocoridae spp.; Tinidae spp.; Blostomatidae spp.; Reduviidae spp.; and Cimicidae spp.
- Also included are adults and larvae of the order Acari (mites) such as Aceria tosichella Keifer (wheat curl mite); Petrobia latens Müller (brown wheat mite); spider mites and red mites in the family Tetranychidae, Panonychus ulmi Koch (European red mite); Tetranychus urticae Koch (two spotted spider mite); (T. mcdanieli McGregor (McDaniel mite); T. cinnabarinus Boisduval (carmine spider mite); T. turkestani Ugarov & Nikolski (strawberry spider mite); flat mites in the family Tenuipalpidae, Brevipalpus lewisi McGregor (citrus flat mite); rust and bud mites in the family Eriophyidae and other foliar feeding mites and mites important in human and animal health, i.e. dust mites in the family Epidermoptidae, follicle mites in the family Demodicidae, grain mites in the family Glycyphagidae, ticks in the order Ixodidae. Ixodes scapularis Say (deer tick); I. holocyclus Neumann (Australian paralysis tick); Dermacentor variabilis Say (American dog tick); Amblyomma americanum Linnaeus (lone star tick); and scab and itch mites in the families Psoroptidae, Pyemotidae, and Sarcoptidae.
- Insect pests of the order Thysanura are of interest, such as Lepisma saccharina Linnaeus (silverfish); Thermobia domestica Packard (firebrat).
- Additional arthropod pests covered include: spiders in the order Araneae such as Loxosceles reclusa Gertsch & Mulaik (brown recluse spider); and the Latrodectus mactans Fabricius (black widow spider); and centipedes in the order Scutigeromorpha such as Scutigera coleoptrata Linnaeus (house centipede).
- Insect pest of interest include the superfamily of stink bugs and other related insects including but not limited to species belonging to the family Pentatomidae (Nezara viridula, Halyomorpha halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare, Euschistus heros, Euschistus tristigmus, Acrosternum hilare, Dichelops furcatus, Dichelops melacanthus, and Bagrada hilaris (Bagrada Bug)), the family Plataspidae (Megacopta cribraria—Bean plataspid), and the family Cydnidae (Scaptocoris castanea—Root stink bug); and Lepidoptera species including but not limited to: diamond-back moth, e.g., Helicoverpa zea Boddie; soybean looper, e.g., Pseudoplusia includens Walker; and velvet bean caterpillar e.g., Anticarsia gemmatalis Hübner.
- Methods for measuring pesticidal activity are well known in the art. See, for example, Czapla and Lang, (1990) J. Econ. Entomol. 83:2480-2485; Andrews, et al., (1988) Biochem. J. 252:199-206; Marrone, et al., (1985) J. of Economic Entomology 78:290-293 and U.S. Pat. No. 5,743,477, all of which are herein incorporated by reference in their entirety. Generally, the protein is mixed and used in feeding assays. See, for example Marrone, et al., (1985) J. of Economic Entomology 78:290-293. Such assays can include contacting plants with one or more pests and determining the plant's ability to survive and/or cause the death of the pests.
- Nematodes include parasitic nematodes such as root-knot, cyst, and lesion nematodes, including Heterodera spp., Meloidogyne spp., and Globodera spp.; particularly members of the cyst nematodes, including, but not limited to, Heterodera glycines (soybean cyst nematode); Heterodera schachtii (beet cyst nematode); Heterodera avenae (cereal cyst nematode); and Globodera rostochiensis and Globodera pailida (potato cyst nematodes). Lesion nematodes include Pratylenchus spp.
- To protect and to enhance yield production and trait technologies, seed treatment options can provide additional crop plan flexibility and cost effective control against insects, weeds and diseases. Seed material can be treated, typically surface treated, with a composition comprising combinations of chemical or biological herbicides, herbicide safeners, insecticides, fungicides, germination inhibitors and enhancers, nutrients, plant growth regulators and activators, bactericides, nematocides, avicides and/or molluscicides. These compounds are typically formulated together with further carriers, surfactants or application-promoting adjuvants customarily employed in the art of formulation. The coatings may be applied by impregnating propagation material with a liquid formulation or by coating with a combined wet or dry formulation. Examples of the various types of compounds that may be used as seed treatments are provided in The Pesticide Manual: A World Compendium, C. D. S. Tomlin Ed., Published by the British Crop Production Council, which is hereby incorporated by reference.
- Some seed treatments that may be used on crop seed include, but are not limited to, one or more of abscisic acid, acibenzolar-S-methyl, avermectin, amitrol, azaconazole, azospirillum, azadirachtin, azoxystrobin, bacillus spp. (including one or more of cereus, firmus, megaterium, pumilis, sphaericus, subtilis and/or thuringiensis), bradyrhizobium spp. (including one or more of betae, canariense, elkanii, iriomotense, japonicum, liaonigense, pachyrhizi and/or yuanmingense), captan, carboxin, chitosan, clothianidin, copper, cyazypyr, difenoconazole, etidiazole, fipronil, fludioxonil, fluoxastrobin, fluquinconazole, flurazole, fluxofenim, harpin protein, imazalil, imidacloprid, ipconazole, isoflavenoids, lipo-chitooligosaccharide, mancozeb, manganese, maneb, mefenoxam, metalaxyl, metconazole, myclobutanil, PCNB, penflufen, penicillium, penthiopyrad, permethrine, picoxystrobin, prothioconazole, pyraclostrobin, rynaxypyr, S-metolachlor, saponin, sedaxane, TCMTB, tebuconazole, thiabendazole, thiamethoxam, thiocarb, thiram, tolclofos-methyl, triadimenol, trichoderma, trifloxystrobin, triticonazole and/or zinc. PCNB seed coat refers to EPA registration number 00293500419, containing quintozen and terrazole. TCMTB refers to 2-(thiocyanomethylthio) benzothiazole.
- Seed varieties and seeds with specific transgenic traits may be tested to determine which seed treatment options and application rates may complement such varieties and transgenic traits in order to enhance yield. For example, a variety with good yield potential but head smut susceptibility may benefit from the use of a seed treatment that provides protection against head smut, a variety with good yield potential but cyst nematode susceptibility may benefit from the use of a seed treatment that provides protection against cyst nematode, and so on. Likewise, a variety encompassing a transgenic trait conferring insect resistance may benefit from the second mode of action conferred by the seed treatment, a variety encompassing a transgenic trait conferring herbicide resistance may benefit from a seed treatment with a safener that enhances the plants resistance to that herbicide, etc. Further, the good root establishment and early emergence that results from the proper use of a seed treatment may result in more efficient nitrogen use, a better ability to withstand drought and an overall increase in yield potential of a variety or varieties containing a certain trait when combined with a seed treatment.
- In some embodiments methods are provided for inhibiting growth or killing an insect pest, comprising contacting the insect pest with an insecticidally-effective amount of a recombinant PIP-1 polypeptide. In some embodiments methods are provided for inhibiting growth or killing an insect pest, comprising contacting the insect pest with an insecticidally-effective amount of a recombinant pesticidal protein of SEQ ID NO: 6 or a variant thereof.
- In some embodiments methods are provided for controlling an insect pest population, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant PIP-1 polypeptide. In some embodiments methods are provided for controlling an insect pest population, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant pesticidal protein of SEQ ID NO: 6 or a variant thereof. As used herein, by “controlling a pest population” or “controls a pest” is intended any effect on a pest that results in limiting the damage that the pest causes. Controlling a pest includes, but is not limited to, killing the pest, inhibiting development of the pest, altering fertility or growth of the pest in such a manner that the pest provides less damage to the plant, decreasing the number of offspring produced, producing less fit pests, producing pests more susceptible to predator attack or deterring the pests from eating the plant.
- In some embodiments methods are provided for controlling an insect pest population resistant to a pesticidal protein, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant PIP-1 polypeptide. In some embodiments methods are provided for controlling an insect pest population resistant to a pesticidal protein, comprising contacting the insect pest population with an insecticidally-effective amount of a recombinant pesticidal protein of SEQ ID NO: 6 or a variant thereof.
- In some embodiments methods are provided for protecting a plant from an insect pest, comprising expressing in the plant or cell thereof a recombinant PIP-1 polypeptide. In some embodiments methods are provided for protecting a plant from an insect pest, comprising expressing in the plant or cell thereof a recombinant pesticidal protein of SEQ ID NO: 6 or variants thereof.
- Expression of B. thuringiensis δ-endotoxins in transgenic corn plants has proven to be an effective means of controlling agriculturally important insect pests (Perlak, et al., 1990; 1993). However, insects have evolved that are resistant to B. thuringiensis δ-endotoxins expressed in transgenic plants. Such resistance, should it become widespread, would clearly limit the commercial value of germplasm containing genes encoding such B. thuringiensis δ-endotoxins.
- One way to increasing the effectiveness of the transgenic insecticides against target pests and contemporaneously reducing the development of insecticide-resistant pests is to use provide non-transgenic (i.e., non-insecticidal protein) refuges (a section of non-insecticidal crops/corn) for use with transgenic crops producing a single insecticidal protein active against target pests. The United States Environmental Protection Agency (epa.gov/oppbppdl/biopesticides/pips/bt_corn_refuge_2006.htm, which can be accessed using the www prefix) publishes the requirements for use with transgenic crops producing a single Bt protein active against target pests. In addition, the National Corn Growers Association, on their website: (ncga.com/insect-resistance-management-fact-sheet-bt-corn, which can be accessed using the www prefix) also provides similar guidance regarding refuge requirements. Due to losses to insects within the refuge area, larger refuges may reduce overall yield.
- Another way of increasing the effectiveness of the transgenic insecticides against target pests and contemporaneously reducing the development of insecticide-resistant pests would be to have a repository of insecticidal genes that are effective against groups of insect pests and which manifest their effects through different modes of action.
- Expression in a plant of two or more insecticidal compositions toxic to the same insect species, each insecticide being expressed at efficacious levels would be another way to achieve control of the development of resistance. This is based on the principle that evolution of resistance against two separate modes of action is far more unlikely than only one. Roush for example, outlines two-toxin strategies, also called “pyramiding” or “stacking,” for management of insecticidal transgenic crops. (The Royal Society. Phil. Trans. R. Soc. Lond. B. (1998) 353:777-1786). Stacking or pyramiding of two different proteins each effective against the target pests and with little or no cross-resistance can allow for use of a smaller refuge. The U.S. Environmental Protection Agency requires significantly less (generally 5%) structured refuge of non-Bt corn be planted than for single trait products (generally 20%). There are various ways of providing the IRM effects of a refuge, including various geometric planting patterns in the fields and in-bag seed mixtures, as discussed further by Roush.
- In some embodiments the PIP-1 polypeptides of the disclosure are useful as an insect resistance management strategy in combination (i.e., pyramided) with other pesticidal proteins include but are not limited to Bt toxins, Xenorhabdus sp. or Photorhabdus sp. insecticidal proteins, and the like.
- Provided are methods of controlling Lepidoptera and/or Hemiptera insect infestation(s) in a transgenic plant that promote insect resistance management, comprising expressing in the plant at least two different insecticidal proteins having different modes of action.
- In some embodiments the methods of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and promoting insect resistance management the at least one of the insecticidal proteins comprise a PIP-1 polypeptide insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- In some embodiments the methods of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and promoting insect resistance management the at least one of the insecticidal proteins comprises a protein of SEQ ID NO: 6 or variants thereof, insecticidal to insects in the order Lepidoptera and/or Hemiptera.
- In some embodiments the methods of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and promoting insect resistance management comprise expressing in the transgenic plant a PIP-1 polypeptide and a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera having different modes of action.
- In some embodiments the methods of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and promoting insect resistance management comprise in the transgenic plant a protein of SEQ ID NO: 6 or variants thereof and a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera having different modes of action.
- Also provided are methods of reducing likelihood of emergence of Lepidoptera and/or Hemiptera insect resistance to transgenic plants expressing in the plants insecticidal proteins to control the insect species, comprising expression of a PIP-1 polypeptide insecticidal to the insect species in combination with a second insecticidal protein to the insect species having different modes of action.
- Also provided are methods of reducing likelihood of emergence of Lepidoptera and/or Hemiptera insect resistance to transgenic plants expressing in the plants insecticidal proteins to control the insect species, comprising expression of a protein of SEQ ID NO: 6 or variants thereof, insecticidal to the insect species in combination with a second insecticidal protein to the insect species having different modes of action.
- Also provided are means for effective Lepidoptera and/or Hemiptera insect resistance management of transgenic plants, comprising co-expressing at high levels in the plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or killing activity, wherein the two or more insecticidal proteins comprise a PIP-1 polypeptide and a Cry protein. Also provided are means for effective Lepidoptera and/or Hemiptera insect resistance management of transgenic plants, comprising co-expressing at high levels in the plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or activity, wherein the two or more insecticidal proteins comprise a protein of SEQ ID NO: 6 or variants thereof and a Cry protein.
- In addition, methods are provided for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera, comprising the step of referring to, submitting or relying on insect assay binding data showing that the PIP-1 polypeptide does not compete with binding sites for Cry proteins in such insects. In addition, methods are provided for obtaining regulatory approval for planting or commercialization of plants expressing proteins insecticidal to insects in the order Lepidoptera and/or Hemiptera, comprising the step of referring to, submitting or relying on insect assay binding data showing that the protein of SEQ ID NO: 6 or variant thereof does not compete with binding sites for Cry proteins in such insects.
- Methods for increasing plant yield are provided. The methods comprise providing a plant or plant cell expressing a polynucleotide encoding the pesticidal polypeptide sequence disclosed herein and growing the plant or a seed thereof in a field infested with a pest against which the polypeptide has pesticidal activity. In some embodiments, the polypeptide has pesticidal activity against a lepidopteran, coleopteran, dipteran, hemipteran or nematode pest, and the field is infested with a lepidopteran, hemipteran, coleopteran, dipteran or nematode pest.
- As defined herein, the “yield” of the plant refers to the quality and/or quantity of biomass produced by the plant. By “biomass” is intended any measured plant product. An increase in biomass production is any improvement in the yield of the measured plant product. Increasing plant yield has several commercial applications. For example, increasing plant leaf biomass may increase the yield of leafy vegetables for human or animal consumption. Additionally, increasing leaf biomass can be used to increase production of plant-derived pharmaceutical or industrial products. An increase in yield can comprise any statistically significant increase including, but not limited to, at least a 1% increase, at least a 3% increase, at least a 5% increase, at least a 10% increase, at least a 20% increase, at least a 30%, at least a 50%, at least a 70%, at least a 100% or a greater increase in yield compared to a plant not expressing the pesticidal sequence.
- In specific methods, plant yield is increased as a result of improved pest resistance of a plant expressing a PIP-1 polypeptide disclosed herein. Expression of the PIP-1 polypeptide results in a reduced ability of a pest to infest or feed on the plant, thus improving plant yield.
- The following examples are offered by way of illustration and not by way of limitation.
- The Lygus active protein PIP-1A was identified by protein purification, N-terminal amino acid sequencing, PCR cloning from Pseudomonas chlororaphis strain SS44C4 as follows:
- Insecticidal activity against Lygus (Lygus hesperus) was observed from a cell lysate of SS44C4 grown in Trypticase soy medium (Tryptone 17 g/L, enzymatic digest of soy meal 3 g/L, Dextrose 2.5 g/L, Sodium Chloride 5 g/L, K2HPO4 2.5 g/L) and cultured overnight at 30° C. This insecticidal activity exhibited heat and proteinase sensitivity indicating proteinaceous nature.
- Lygus (Lygus hesperus) bioassays were conducted using the cell lysate samples mixed with insect diet (Bio-Serv F9644B) in each well of a 96 well bioassay plate (BD Falcon™ 353910). A variable number of Lygus hesperus second instar nymphs (2 to 7) were placed into each well of a 96 well plate. The assay was run four days at 25° C. and then was scored for insect mortality and stunting of insect growth. A series of concentrations of the purified protein sample was assayed against those insects and concentrations for 50% mortality (LC50) or inhibition of 50% of the individuals (IC50) were calculated. The Lygus bioassay results for PIP-1A is shown in Table 2.
- Genomic DNA was extracted with a Sigma Bacterial Genomic DNA Extraction Kit (Cat #NA2110-KT, Sigma-Aldrich, PO Box 14508, St. Louis, Mo. 63178) according to the manufactures' instructions. The DNA concentration was determined using a NanoDrop Spectrophotometer (Thermo Scientific, 3411 Silverside Road, Bancroft Building,
Suite 100, Wilmington, Del. 19810) and the genomic DNA was diluted to 40 ng/ul with sterile water. A 25 ul PCR reaction was set up by combining 80 ng genomic DNA, 2 ul (5 uM) 16S ribosomal DNA primers TACCTTGTTACGACTT (SEQ ID NO: 209) and AGAGTTTGATCMTGGCTCAG (SEQ ID NO: 210), 1ul 10 cmM dNTP, 1× Phusion™ HF buffer, and 1 unit of Phusion™ High-Fidelity DNA Polymerase (New England Biolabs, Cat #M0530L, 240 County Road, Ipswich, Mass. 01938-2723). The PCR reaction was run in MJ Research PTC-200 Thermo Cycler (Bio-Rad Laboratories, Inc., 1000 Alfred Nobel Drive, Hercules, Calif., 94547, USA) with the following program: 96° C. 1 min; 30 cycles of 96° C. 15 seconds, 52° C. 2 minutes and 72° C. 2 minutes; 72° C. 10 minutes; and hold on 4° C. The PCR products were purified with QiaQuick® DNA purification Kit (Cat #28104, QIAGEN® Inc., 27220 Turnberry Lane, Valencia, Calif. 91355). The purified PCR sample was DNA sequenced and the resulting 16S ribosomal DNA sequence was BLAST searched against the NCBI database which indicated that SS44C4 is a Pseudomonas chlororaphis strain. The Pseudomonas chlororaphis strain SS44C4 was deposited on Dec. 1, 2011 under accession #NRRLB-50613 with the Agricultural Research Service Culture Collection (NRRL), 1815 North University Street, Peoria, Ill. 61604, (nrrl.ncaur.usda.gov, which can be accessed on the world-wide web using the “www” prefix). - The cell pellet of an overnight culture from a single colony of SS44C4 grown in LB Broth at 30° C. was lyzed in a French Press at ˜20,000 psi in a single pass after resuspension with PBS buffer. The lysis product was centrifuged and the soluble fraction retained and stored at 4° C. overnight to allow insoluble chlororaphin products to precipitate. The remaining supernatant was filtered sequentially through 25 um, 8 um, 5 um, 1.2 um and 0.45 um filters to remove the majority of the Crystalline material. The soluble cell lysate was adjusted to 1.2 M ammonium sulfate and loaded onto an Ether column (Toyopearl™ Ether-650S, Tosoh Bioscience LLC, 3604 Horizon Drive,
Suite 100, King of Prussia, Pa. 19406) of appropriate size. A linear gradient was run from 1.2 M ammonium sulfate to 0.6 M ammonium sulfate over 15 column volumes. The elution peak fractions containing protein of interest were then concentrated via a spin concentrator. The concentrate was then buffer exchanged into 25 mM Tris pH 8 to remove ammonium sulfate using a 7000 MWCO Zeba™ desalting column (Thermo Fisher Scientific Inc., 747 Meridian Rd, Rockford, Ill. 61101). The concentrated and desalted protein was then loaded onto a MonoQ™ column (cat #17-5166-01, GE Healthcare). Optimum elution and purity was achieved by application of a linear gradient from 0 to 400 mM NaCl. - The active fraction pool from the MonoQ™ purification was subjected to N-terminal sequencing. The protein pool was run on SDS-PAGE, transferred to a PVDF membrane, and stained with Coomassie™ Blue dye. Four bands were present on the membrane. All were successfully identified by N-terminal sequencing with a single sequence per band. The N-terminal amino acid sequence of two protein bands were BLAST searched against the NCBI database and a hypothetical protein (PSEEN3174) from a genome sequence of Pseudomonas entomophila (Vodovar, N et al. (2006) Nat. Biotechnol. 24 (6), 673-679) was identified as a homology match (
FIG. 1 ). The PSEEN3174 gene, was cloned by PCR using primers ATACATATGACGATCAAGGAAGAGCTG (SEQ ID NO: 13) and TTGGATCCTCAATAACGGCGATGAGGATCGTTGTAG (SEQ ID NO: 14). PCR with the cloning primers (SEQ ID NO: 13 and 14) was performed against the SS44C4 genomic DNA preparation, and a band of the expected molecular weight was isolated. - The resulting PCR product was DNA sequenced and coupled with MS/MS spectra from in-gel digests showed this gene product having the DNA sequence of SEQ ID NO: 1 encoding a protein designated herein as “PIP-1A”, having the amino acid sequence of SEQ ID NO: 2. The PSEEN3174 gene has the DNA sequence set forth in SEQ ID NO: 5 and encodes an amino acid sequence having the amino acid sequence set forth in SEQ ID NO: 6. Using the PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) sequence information another homologous gene, SPBB_340380 (annotated as a hypothetical protein from Dendroctonus frontalis Bacterial community), was identified by BLAST search from the Department of Energy Joint Genomic Institute website (jgi.doe.gov/, which can be accessed on the world wide web using the “www” prefix). The SPBB_340380 coding sequence was generated by back translation of protein sequence using PSEEN3174 (SEQ ID NO: 5) codon usage and the gene was synthesized. The SPBB_340380 coding sequence has the DNA sequence set forth in SEQ ID NO: 3 and encodes an amino acid sequence, designated herein as “PIP-1B”, having the amino acid sequence set forth in SEQ ID NO: 4.
- The three coding sequences, PIP-1A (SEQ ID NO: 1); PSEEN3174 (SEQ ID NO: 5); & PIP-1B (SEQ ID NO: 3), were subcloned into an E. coli expression vector pMAL™ (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723) having a 6×His tag added to the Maltose Binding Protein and transformed into E. coli for recombinant protein expression. E. coli cells transformed with the expression constructs were grown overnight at 37° C. with carbenicillin selection and then inoculated to a fresh 2XYT medium (1:250) and further grown to OD600 ˜0.8. IPTG was then added and the cells were grown further at 37° C. for another 6 hours or transferred to 16° C. for overnight growth to induce protein expression. The E. coli expressed proteins were purified either by Amylose resin (New England Biolabs, 240 County Road, Ipswich, Mass. 01938-2723) or Ni-NTA agarose (Cat. No. K950-01, Invitrogen, 3175 Staley Road, Grand Island, N.Y. 14072), according to the manufacturer's protocols.
- Insecticidal activity bioassay screens were conducted on the cell lysate to evaluate the effects of the insecticidal proteins on a variety of Lepidoptera species (European corn borer (Ostrinia nubilalis), corn earworm (Helicoverpa zea), black cutworm (Agrotis ipsilon), fall armyworm (Spodoptera frugiperda), Soybean looper (Pseudoplusia includens) and Velvet bean caterpillar (Anticarsia gemmatalis)), a Coleoptera specie (Western corn rootworm (Diabrotica virgifera)
- Lepidoptera feeding assays were conducted on an artificial diet containing the cell lysates of bacterial strains in a 96 well plate set up. The cell lysate was incorporated with the Lepidopteran-specific artificial diet in a ratio of 1:2 cell lysate to diet mixture. Neonate larvae were placed in each well to feed ad libitum for 5 days. Results were expressed as positive for larvae reactions such as stunting and or mortality. Results were expressed as negative if the larvae were similar to the negative control that is feeding diet to which the above buffer only has been applied. Cell lysates was assayed on European corn borer (Ostrinia nubilalis), corn earworm (Helicoverpa zea), black cutworm (Agrotis ipsilon), fall armyworm (Spodoptera frugiperda), Soybean looper (Pseudoplusia includens) and Velvet bean caterpillar (Anticarsia gemmatalis). A series of concentrations of the purified protein sample was assayed against those insects and concentrations for 50% mortality (LC50) or inhibition of 50% of the individuals (IC50) were calculated. The insecticidal activity for PIP-1A and PSEEN3174 are shown in Table 2.
-
TABLE 2 PIP-1A (SEQ ID NO: 2) PSEEN3174 (SEQ ID NO: 6) Insect dose effect dose effect Lygus 40 ppm LC-50 40 ppm LC-50 Brown marmorated stink bug 150 ppm LC50 100 ppm LC50 Southern green stink bug, 700 ppm single dose, 85% 620 ppm single dose, 75% adult mortality at 6 days mortality at 6 days Southern green stink bug, 250 ppm single dose, 99% not tested nymphs mortality at 4 days Southern green stink bug, 100 ppm LC50 100 ppm LC50 nymphs Colorado potato beetle 875 ppm inactive 875 ppm inactive Diamond back moth 122 ng/cm2 LC-50 20.5 ng/cm2 LC-50 Diamond back moth 66.7 ng/cm2 IC-50 12.8 ng/cm2 IC50 Diamond back moth -Cry1A 205 ng/cm2 LC-50 15.9 ng/cm2 LC-50 resistant Diamond back moth -Cry1A 59.9 ng/cm2 IC-50 8.7 ng/cm2 IC50 resistant Western Corn Root Worm 200 ug/cm2 mild stunting 90 ug/cm2 mild stunting Soy bean looper 21.3 ppm LC-50 44.8 ppm LC-50 Soy bean looper 10.0 ppm IC-50 18.8 ppm IC-50 Velvet bean caterpillar 14.0 ppm LC-50 45.8 ppm LC-50 Velvet bean caterpillar 3.9 ppm IC-50 11.8 ppm IC-50 Corn ear worm ~200 ppm IC-50 ~200 ppm IC-50 Fall army worm ~200 ppm IC-50 ~200 ppm IC-50 European corn borer 700 ppm inactive >400 ppm IC-50 Black cut worm ~300 ppm IC-50 ~200 ppm IC-50 Black bean aphid inactive highest dose 200 inactive highest dose 200 ppm ppm Pea aphid (oral dose) 260 ug/ml LC-50 Day1, 90% 161 ug/ml LC-50 Day 2, 90% mortality on day 2 mortality on day 3 - Coleoptera feeding assays were conducted on an artificial diet containing the cell lysates of bacterial strains. The cell lysate was incorporated with the coleopteran-specific artificial diet in a ratio of 1:5 cell lysate to diet mixture. Western corn rootworm (Diabrotica virgifera) neonate larvae were placed in each well to feed ad libitum for 5 days. Results were expressed as positive for larvae reactions such as stunting and or mortality. Results were expressed as negative if the larvae were similar to the negative control that is feeding diet to which the above buffer only has been applied. A series of concentrations of the purified protein sample was assayed against those insects and concentrations for 50% mortality (LC50) or inhibition of 50% of the individuals (IC50) were calculated. The results for PIP-1A and PSEEN3174 are shown in Table 2.
- Membrane feeding assays as described (Li, et al., (2011) Journal of Invertebrate Pathology 107:69-78) were used to assess the toxicity of PIP-1A and PSEEN3174, formulated in PBS pH 7.4. Briefly, the individual proteins were mixed with filter-sterilized complete artificial diet as described in Febvay, et al., ((1988), Can. J. Zool. 66:2449-2453) to a final concentration of up to 1250 micrograms/ml. This diet (100 ul) was placed on stretched parafilm pulled tightly across a 3 cm cell culture plate with a 1 cm hole on one side of the plate. A second layer of stretched parafilm was applied to form a thin film of diet exposed to aphids through the 1 cm hole. Around 30 second instar pea or green peach aphids were transferred to each plate, with three replicates for each toxin. The same number of aphids were fed on diet only, as a control treatment. All plates were incubated at 24° C. with an 18:6 light:dark photoperiod. Mortality was scored every 24 hours and dead aphids were removed. The artificial diet was replaced every 3 days. Data were analyzed by one-way ANOVA. The results for PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) are shown in Table 2.
- 40 ul of the cell lysate samples were mixed with 360 ul of the diet (Bio-Serv F9644B). 10 to 15 newly molted instar nymphs were placed in polystyrene Petri dishes (100 mm×20 mm) lined with moist Whatman® filter paper (100 mm diameter). The bioassay was incubated at 25° C. for four days. The bioassay was scored for insect mortality and stunting of growth. To generate IC50 or LC50 data, a series of concentrations of purified proteins were assayed against insects and the concentration at which 50% of insects experienced severe damage was the IC50 and the concentration at which 50% of insects were dead was the LC50. The results for PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) are shown in Table 2.
- 20 ul of cell lysate samples were mixed with 75 ul of modified Coleopteran diet (Bio-Serv F9800E) in each well of a 96 well bioassay plate (BD Falcon™ 353910) and allowed to solidify. A single neonate larva was placed in each well and the plate sealed with a Mylar covering. Holes were punched in the Mylar sheet and the plate incubated at 25° C. for four days. The bioassay was scored for insect mortality and stunting of growth. The results for PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) are shown in Table 2.
- A diet overlay assay similar to Wang, et al., ((2007) Appl. Environ. Microbiol. 73:1199-1207) was used for testing the LC50 and IC50 of the sample on susceptible and Cry1A-resistant diamondback moth (DBM, Plutella xylostella). For neonate bioassays, an aliquot of PIP-1A (SEQ ID NO: 2) sample solution was applied to the surface (˜7 cm2) of 5 ml artificial diet (Southland Products Inc.) in a 30-ml insect-rearing cup. Each bioassay included seven 2× consecutive dilutions from 500 ng/cm2 of the PIP-1A (SEQ ID NO: 2) sample and the negative control, with three replications for each concentration. The PIP-1A (SEQ ID NO: 2) protein dilutions were prepared by mixing PIP-1A protein (SEQ ID NO: 2) with appropriate amount of PBS buffer solution (Fisher Scientific Inc). Neonate larvae (<24 h after hatch) were placed in each assaying cup. Mortality and larval growth inhibition (defined as inhibition if larvae did not enter second instar within 4 days) by each sample were scored after 4 days of feeding on the treated diet at 27° C. Concentrations for 50% mortality (LC50) or inhibition of 50% of the individuals (IC50) were calculated based on probit analysis. The results (Table 3) showed no cross-resistance (resistance ratio <2) for PIP-1A (SEQ ID NO: 2) to Cry1A in diamondback moth.
-
TABLE 3 DBM strain LC/IC ng/cm2 95% FL Resistance Ratio Susceptible LC 122.5 80.8-172.3 1.0 IC 66.71 42.20-98.21 1.0 Cry1A-Res LC 205.3 145.7-285.1 1.7 IC 59.94 36.90-88.64 0.90 - Libraries of modified PIP-1A polynucleotides were generated using recursive sequence recombination methods (Crameri, et al., (1998) Nature. 391:288-291; Stemmer, (1994) Proc. Natl. Acad. Sci USA 91:10747-10751; Ness, et. al., (2002) Nature Biotechnology 20:1251-1255), also known as gene shuffling methods. To increase the crossover points between the two genes, codons of PIP-1A (SEQ ID NO: 1) were modified using the codon usage of PSEEN3174 (SEQ ID NO: 5) as the template while the protein sequences are not changed. The modified PIP-1A coding sequence was named as PIP-1A Synth (SEQ ID NO: 15) and was synthesized. The DNA sequence identity between those two genes was increased from 78% to 87% after the modification. To perform the classic gene family shuffling, random DNA fragments of both PIP-1A Synth (SEQ ID NO: 15) and PSEEN3174 (SEQ ID NO: 5) were generated by limited nuclease digestion. DNA fragments with molecular weights of 50 to 200 base pairs of both genes were recovered from agarose gel. The isolated DNA fragments were assembled on a thermo cycler with polymerase and rescued by cloning primers franking both termini. The libraries were cloned as Maltose-Binding-Protein fusions into pMAL®-c2x (NEB) and transformed into E. coli cells. Approximately 5000 clones from the shuffled libraries were screened in the Lygus assay and approximately 1000 clones expressed a polypeptide at significant levels and were active as clear cell lysates in the Lygus bioassay. Lygus bioassays were conducted using the cell lysates at 100 ppm concentration of the PIP-1 polypeptide. The concentrations of PIP-1 polypeptides were estimated using densitometry method of SDS-PAGE with BSA as standard using program Phoretix ID (TotalLab Ltd Keel House, Garth Heads, Newcastle upon Tyne NE1 2JE). Of the active clones, 50 were DNA sequenced (SEQ ID NOS: 152-202) and the amino acid sequence (SEQ ID NOS: 101-151) of the encoded PIP-1 polypeptide was determined. Table 4 shows the percent homology of the PIP-1 polypeptides (SEQ ID NOs: 101-151) to PIP-1A (SEQ ID NO: 2). For each of the sequences in Table 4 only those positions and the corresponding amino acids where PIP-1A (SEQ ID NO: 2), PSEEN3174 (SEQ ID NO: 6) and the PIP-1 polypeptide differ are shown. Amino acid substitutions were also identified at
positions -
TABLE 4 % Identity to PIP- Sequence Name 1A 2 3 6 8 19 20 21 22 24 25 27 35 36 38 42 46 48 49 53 60 PIP-1A (SEQ ID NO: 2) 100 P I E S D L K S Q G L F A N F R G F S A D_D0274242 SEQ ID NO: 109 97 S D_D0274246 SEQ ID NO: 112 97 D_D0274267 SEQ ID NO: 125 97 Y K D D_D0274273 SEQ ID NO: 127 97 D_D0274276 SEQ ID NO: 128 97 E V S K A A T D_D0274308 SEQ ID NO: 143 96 D_D0274234 SEQ ID NO: 102 95 S D_D0274322 SEQ ID NO: 148 95 L P R Y K D D_D0274327 SEQ ID NO: 151 95 L D_D0274236 SEQ ID NO: 104 94 G S D_D0274291 SEQ ID NO: 135 94 E V S K A A T D_D0274238 SEQ ID NO: 105 93 L S R Y K D G D_D0274270 SEQ ID NO: 126 92 E V S K A A T L S R Y K D G S D_D0274311 SEQ ID NO: 144 92 Y K D G D_D0274247 SEQ ID NO: 113 91 E V S K A A T L S R Y K D G D_D0274258 SEQ ID NO: 119 91 D_D0274264 SEQ ID NO: 123 91 E V S K A A T L S R Y K D G D_D0274303 SEQ ID NO: 140 91 G D_D0274235 SEQ ID NO: 103 90 L S R D_D0274294 SEQ ID NO: 136 90 E V S K A A T L S R Y D_D0274300 SEQ ID NO: 138 90 T D_D0274324 SEQ ID NO: 150 90 D_D0274241 SEQ ID NO: 108 89 E V S K A A T L S R S E D_D0274244 SEQ ID NO: 111 89 L S R Y K D D_D0274248 SEQ ID NO: 114 89 G S D_D0274251 SEQ ID NO: 116 89 K D S D_D0274262 SEQ ID NO: 122 89 E V S K A A T PSEEN3174 (SEQ ID NO: 6) 79 T I E G E V S K A A T L S R Y K D F G S % Identity to PIP- Sequence Name 1A 77 97 98 105 108 110 120 121 123 125 127 134 135 144 147 150 151 160 162 163 164 PIP-1A 100 F M D Q Q R K T T N S G S D I S N T S N S D_D0274242 97 S T D T D_D0274246 97 Y T T R D_D0274267 97 D_D0274273 97 S T D T D_D0274276 97 D_D0274308 96 A N E T T R D_D0274234 95 E T T R S T D T D_D0274322 95 E A N R D_D0274327 95 E T T R S T D T D_D0274236 94 Y N T R D_D0274291 94 S T D T D_D0274238 93 Y A N R D_D0274270 92 Y A N E T T R D_D0274311 92 Y A N S T D T D_D0274247 91 T T R D_D0274258 91 V E N T L S T D T D_D0274264 91 E T T R D_D0274303 91 Y V S T D T D_D0274235 90 Y V S T D T D_D0274294 90 S T D T D_D0274300 90 Y V E R S E S N A N S T D T D_D0274324 90 R S E S N A N E T T R S T D T D_D0274241 89 E T T R S T D T D_D0274244 89 Y E T T R S T D T D_D0274248 89 Y R S E S N A N E T T R S T D T D_D0274251 89 Y T L R S E S N A N E T T R D_D0274262 89 E T T R S T D T PSEEN3174 79 Y V E N T L R S E S N A N E T T R S T D T % Identity to PIP- Sequence Name 1A 166 167 168 174 175 180 194 195 200 203 204 209 213 220 221 222 226 229 231 232 249 PIP-1A 100 Q L T I V M G N N N T L Y N S T D K I A N D_D0274242 97 E M K A D_D0274246 97 S Q A D_D0274267 97 L N V T D_D0274273 97 E M K A S D_D0274276 97 D_D0274308 96 S Q A N V T D_D0274234 95 E M K V D_D0274322 95 A S Q A D_D0274327 95 E M K V D_D0274236 94 V I L R K R P N V T D_D0274291 94 E M K N V T D_D0274238 93 L A S Q A V R K R D_D0274270 92 A D_D0274311 92 E M K A S Q A V R K R P D_D0274247 91 R K R P N V T D_D0274258 91 E M K V I L Q A V R K R P N V T D_D0274264 91 V I L A S V D_D0274303 91 E M K V I L S Q A V R K R P N V T D_D0274235 90 E M K V I L A S Q A R K R P N V T D_D0274294 90 E M K A S Q A V R K R P D_D0274300 90 E M K V I L R K R P N V T D_D0274324 90 E M K L R K R P N V T D_D0274241 89 E M K A S R K R P D_D0274244 89 E M K V I L A S Q A V P N V T D_D0274248 89 E M K V I R K R P N V T D_D0274251 89 A S Q A V R K R P N V T D_D0274262 89 E M K V I L A R K R P N V T PSEEN3174 79 E M K V I L A N S Q A V Y R K R P N V T N % Identity to PIP- Sequence Name 1A 2 3 6 8 19 20 21 22 24 25 27 35 36 38 42 46 48 49 53 60 PIP-1A (SEQ ID NO: 2) 100 P I E S D L K S Q G L F A N F R D_D0274266 SEQ ID NO: 124 89 E V S K A A T L S R Y K D_D0274283 SEQ ID NO: 133 89 D_D0274290 SEQ ID NO: 134 89 E V S K A A T L S R Y K D G D_D0274233 SEQ ID NO: 101 88 D_D0274259 SEQ ID NO: 120 88 D_D0274278 SEQ ID NO: 129 88 L S R Y K D D_D0274280 SEQ ID NO: 130 88 D_D0274306 SEQ ID NO: 142 88 D_D0274316 SEQ ID NO: 146 88 E V S K A A T L S R Y G S D_D0274323 SEQ ID NO: 149 88 L S R Y K D G D_D0274239 SEQ ID NO: 106 87 E V S K A A T L S R Y K D D_D0274260 SEQ ID NO: 121 87 D_D0274298 SEQ ID NO: 137 87 E V S K A A T L S R G D_D0274304 SEQ ID NO: 141 87 D_D0274282 SEQ ID NO: 132 86 E V S K A A T L S R Y K D D_D0274320 SEQ ID NO: 147 86 D_D0274302 SEQ ID NO: 139 85 E A S K A A T L S R Y K D G D_D0274240 SEQ ID NO: 107 84 E V S K A A T L S R Y K D S D_D0274252 SEQ ID NO: 117 84 E V S K A A T L S R Y K D G S D_D0274249 SEQ ID NO: 115 83 E V S K A A T D_D0274255 SEQ ID NO: 118 83 E V S K A A T L S D_D0274243 SEQ ID NO: 110 82 E V S K A A T L S R Y D_D0274281 SEQ ID NO: 131 82 E V S K A A T L S R Y K D D_D0274313 SEQ ID NO: 145 82 E V S K A A T L S R Y K D PSEEN3174 (SEQ ID NO: 6) 79 T I E G E V S K A A T L S R Y K D F G S % Identity to PIP- Sequence Name 1A 77 97 98 105 108 110 120 121 123 125 127 134 135 144 147 150 151 160 162 163 164 PIP-1A 100 F M D Q Q R K T T N S G S D I S N T S N S D_D0274266 89 E T T R D_D0274283 89 V E N T L R S E S N R S T D T D_D0274290 89 V E T T R D_D0274233 88 Y R S E S N A N E T T R S T D T D_D0274259 88 V E N T L R S E S N S T D T D_D0274278 88 Y V E N T L R S E S N S T D T D_D0274280 88 Y V E R S E S N A N E T T R S T D T D_D0274306 88 Y R S E S N A N E T T R S T D T D_D0274316 88 Y V E R S E S N A N S T D_D0274323 88 R S E S N A N S T D T D_D0274239 87 V E E T T R S T D T D_D0274260 87 V E N T L R S E S N A N E T T R S T D T D_D0274298 87 Y A N E T T R S T D T D_D0274304 87 V E N T L R S E S N A N T T R S T D T D_D0274282 86 N T L R S E S N A N E T T R S T D T D_D0274320 86 V E N T L R S E S N A N E T T R S T D T D_D0274302 85 V E T T R S T D T D_D0274240 84 R S E S N A N S T D T D_D0274252 84 Y A N E T T R S T D T D_D0274249 83 V E N T L R S E S N A N E T T R S T D T D_D0274255 83 V E N T L R S E S N A N E T T R S T D T D_D0274243 82 Y V E N T L R S E S N A N E T T R S T D T D_D0274281 82 Y V E N T L R S E S N A N T R S T D T D_D0274313 82 E N T L R S E S N A N T T R S T D T PSEEN3174 79 Y V E N T L R S E S N A N E T T R S T D T % Identity to PIP- Sequence Name 1A 166 167 168 174 175 180 194 195 200 203 204 209 213 220 221 222 226 229 231 232 249 PIP-1A 100 Q L T I V M G N N N T L Y N S T D K V T N D_D0274266 89 S Q A V R K R P N V T D_D0274283 89 E M K A S Q A V R K R P N V T D_D0274290 89 S Q A V R K R P N V T D_D0274233 88 E M K V I L A V R K R P N V T D_D0274259 88 E M K V I L S Q A V R K R P N V T D_D0274278 88 E M K R K R P N V T D_D0274280 88 E M K V I L R K R P N V T D_D0274306 88 E M K A Y Q A V F R K R P N V T D_D0274316 88 V R K R P N V T D_D0274323 88 E M K A S Q A R K R P N V T D_D0274239 87 E M K L R K R P N V T D_D0274260 87 E M K L A S Q A V R K R P N V T D_D0274298 87 E M K L S Q A V R K R P D_D0274304 87 E M K V I A S Q A V R K R P N V T D_D0274282 86 E M K A S Q A V D_D0274320 86 E M K V I L A S Q A V R K R P N V T D_D0274302 85 E M K V I L S Q A V R K R P N V T D_D0274240 84 E M K L A S Q A V R K R P N V T S D_D0274252 84 E M K V I L S Q A V R K R P N V T D_D0274249 83 E M K V I L A S Q A V R K R P N V T D_D0274255 83 E M K V I A S Q A R K R P N V T D_D0274243 82 E M K V I L A S Q A R K R P N V T D_D0274281 82 E M K V I L A S Q A V R K R P N V T D_D0274313 82 E M K V I L A S Q A V R K R P N V T PSEEN3174 79 E M K V I L A N S Q A V Y R K R P N V T N - BLAST searching the Department of Energy Joint Genomic Institute website (www.jgi.doe.gov/) and NCBI database using the PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) sequence revealed information regarding three additional genes having lower homology: AECFG_592740 (2035954615—annotated as a hypothetical protein [Acromyrmex echinatior fungus garden]), Pput_1063 (Accession #ABQ77224; Gene ID:5191350—annotated as a hypothetical protein [Pseudomonas putida F1]) and Pput_1064 (Accession #ABQ77225; Gene ID:5191351—annotated as a hypothetical protein [Pseudomonas putida F1]). The AECFG_592740 coding sequence has the DNA sequence set forth in SEQ ID NO: 11 and encodes a polypeptide, having the amino acid sequence set forth in SEQ ID NO: 12. The Pput_1063 coding sequence has the DNA sequence set forth in SEQ ID NO: 7 and encodes the polypeptide set forth in SEQ ID NO: 8. The Pput_1064 coding sequence has the DNA sequence set forth in SEQ ID NO: 9 and encodes the polypeptide set forth in SEQ ID NO: 10. The AECFG_592740 (SEQ ID NO: 11), Pput_1063 (SEQ ID NO: 7), and Pput_1064 (SEQ ID NO: 9) genes were synthesized, the respective proteins were expressed as Maltose binding protein fusions in E. coli, and cell lysates were tested in the Lygus assay as described previously for PIP-1A (SEQ ID NO: 2). The AECFG_592740 (SEQ ID NO: 12), Pput_1063 (SEQ ID NO: 8), and Pput_1064 (SEQ ID NO: 8) proteins were inactive in the Lygus assay.
- The protein sequence alignment of three active homologs, PIP-1A (SEQ ID NO: 2), PSEEN3174 (SEQ ID NO: 6) and PIP-1B (SEQ ID NO: 4), and three inactive orthologs, AECFG_592740 (SEQ ID NO: 12), Pput_1063 (SEQ ID NO: 8) and Pput_1064 (SEQ ID NO: 10) is shown in
FIG. 1 . Secondary structure features of PIP-1A (SEQ ID NO: 2) were obtained using program Garnier (EMBOSS Explorer) (Garnier, et al., (1978) J. Mol. Biol. 120:97-120) and selected structure features shown above the alignment ofFIG. 1 . Six positions (P43, W66, P89, Y93, Y176, F259 of SEQ ID NO: 2) were selected for saturated mutagenesis analysis. Mutants were generated using degenerate oligos (Table 5) for each site using sewing and rescuing PCR strategy of two overlapping fragments of N-terminus (no mutation) and C-terminus (with mutations) gene) for each site using sewing and rescuing PCR strategy of two overlapping fragments of N-terminus (no mutation) and C-terminus (with mutations) gene) as illustrated inFIG. 2 . The rescued mutant libraries were cloned into the Maltose-Binding-Protein fusions of pMAL®-c2x (NEB). Individual mutations were identified by sequencing 96 clones of each library. The respective variant proteins were expressed in E. coli, and cell lysates tested in the Lygus assay as described previously for PIP-1A (SEQ ID NO: 2). Table 6 shows for each mutated position the amino acid substitutions identified those substitutions that expressed soluble protein, and those substitutions that were active in the Lygus assay and/or the Soy bean looper assay with a minimal score of 4 or greater out of total maximal score of 8. The expression and activity of the substitutions in parenthesis were not determined. Substitutions indicated with an “*” had significantly reduced soluble expression. This data demonstrate that the amino substitutions indicated in Table 6 as “Active mutants” can be made while retaining activity. -
TABLE 5 Resi- Oligo due name Sequence P43 P43r GAACTGATCGAAGTTGCCAGC SEQ ID NO: 16 P43f1 GCTGGCAACTTCGATCAGTTCCDNACTAAGCGTGGT GGCTTTGC SEQ ID NO: 17 P43f2 GCTGGCAACTTCGATCAGTTCDNNACTAAGCGTGGT GGCTTTGC SEQ ID NO: 18 W66 W68r GCAGCCTTGCTTGGGCGCGCTG SEQ ID NO: 19 W68f1 CAGCGCGCCCAAGCAAGGCTGCTNYGTAGATGGCAT TACCGTCTACG SEQ ID NO: 20 W68f2 CAGCGCGCCCAAGCAAGGCTGCVNNGTAGATGGCAT TACCGTCTACG SEQ ID NO: 21 P89 P91r GCGAGTGTAGGTGCCCCAATT SEQ ID NO: 22 P91f AATTGGGGCACCTACACTCGCNNKGTCTTTGCCTAC CTGCAGTACATG SEQ ID NO: 23 Y93 Y95r GGCAAAGACCGGGCGAGTGTAGG SEQ ID NO: 24 Y95f1 CCTACACTCGCCCGGTCTTTGCCTBBCTGCAGTACA TGGACACCATT SEQ ID NO: 25 Y95f2 CCTACACTCGCCCGGTCTTTGCCVNNCTGCAGTACA TGGACACCATT SEQ ID NO: 26 Y176 Y178r CACGATGAAGGTGCCAGGACC SEQ ID NO: 27 Y178f1 GGTCCTGGCACCTTCATCGTGTBBCAGGTTGTTATG GTTTATGC SEQ ID NO: 28 Y178f2 GGTCCTGGCACCTTCATCGTGVNNCAGGTTGTTATG GTTTATGC SEQ ID NO: 29 F259 F267r ACTGAAGTGCCCACTATTGCTG SEQ ID NO: 30 F267f1 CAGCAATAGTGGGCACTTCAGTTVNGACTGGAGCGC CTACAACGATC SEQ ID NO: 31 F267f2 CAGCAATAGTGGGCACTTCAGTVNNGACTGGAGCGC CTACAACGATC SEQ ID NO: 32 -
TABLE 6 Soluble Lygus SBL Identified expressed Active Active Residue mutations Mutants mutants mutants P43 M, G, Q, S, M, G, Q, S, M, G, Q, S, M, G, Q, S, T, T, R, V, L, T, R*, V, T, R, V, L, V, L, K, D, A, K, D, A, N, L, K, D, A, K, D, A, N, N, F, W, E, C, F, W, E, C, N, F, W, E, F, W, E, C, Y (I), (Y), C (H) W66 S, F, Y, P, Y, F, H, Y, F, K, R, V, S V, K, T, Q, K*, R*, M*, H, I C, M, N, R, L*, A*, I*, L, A, G, E, C* , V, S D, H, I P89 L, G, R, Y, K, A, C, L, L, G, R, T, V, C, T, S, E, Q, G*, V*, I*, S, M, A, I, M, K, A, W, I*, S* , Q* , N, V, C, K D, I, N, V, M*, N* C, (H), (F) Y93 Q, R, M, D, W, M, F, C, W, V, M, W, V, D, N, L, T, V, H, L, C*, V*, T*, L, I, F, A, I, F, K N, C, A, L*, I*, A*, T W, E, I, G, S, P, F Y176 S, W, V, T, M, F, L*, M, F, L M, L, C M, R, Q, L, C*, A*, W* N, D, C, A, E, G, F, I, P, (H), (K) F259 W, C, A, D, W, Y, F, M, W, Y, C, M, W, M, L, V, I, R, K, M, E, L, V, I, L, V, I, H Y, L, P, V, H, H*, C*, N, T, I, G, S, Q, Y - Four conserved motifs, amino acids 64-79 of SEQ ID NO: 2 (motif 1), amino acids 149-159 of SEQ ID NO: 2 (motif 2), amino acids 171-183 of SEQ ID NO: 2 (motif 3), and amino acids 240-249 of SEQ ID NO: 2 (motif 4) (motifs underlined in
FIG. 1 ) of active proteins (PIP-1A (SEQ ID NO: 2), PSEEN3174 (SEQ ID NO: 6) and PIP-1B (SEQ ID NO: 4) were selected to determine their roles for insecticidal functions. For each selected motif, amino acids 64-79 of SEQ ID NO: 2, amino acids 149-159 of SEQ ID NO: 2, amino acids 171-183 of SEQ ID NO: 2, and amino acids 240-249 of SEQ ID NO: 2, the sequence was replaced with corresponding sequences from three distantly related but functionally inactive proteins AECFG_592740 (SEQ ID NO: 12), Pput_1063 (SEQ ID NO: 8), and Pput_1064 (SEQ ID NO: 10) respectively (Table 7 shows the % identity). -
TABLE 7 PIP-1A PIP-1 B PSEEN3174 Pput_1063 AECFG_592740 Pput_1064 PIP-1A 93 79 23 37 36 PIP-1 B 79 26 38 35 PSEEN3174 24 36 34 Pput_1063 22 23 AECFG_592740 36 Pput_1064 - The chimeras were generated using a sewing PCR strategy with fragments of N-terminus and C-terminus of the wild type PIP-1A with overlapping oligonucleotides (Table 8) coding for the replaced sequence of inactive proteins.
- The rescued PCR products containing the replacements were cloned into the pMAL expression vector as described above for PIP-1A. The resulting chimeras were expressed and functionally tested in Lygus insect bioassays. Table 9 shows the amino acid sequence for each of the four motifs (underlined in
FIG. 1 ) from PIP-1A and the corresponding amino acid sequence based on the alignment (FIG. 1 ) with AECFG_592740 (SEQ ID NO:12), Pput_1063 (SEQ ID NO: 8), and Pput_1064 (SEQ ID NO: 10) that were substituted. In Table 9 the differences between the respective sequences are in indicated in “bold” and “underlining”. -
TABLE 8 Replaced Oligo Motif from name Sequence 1 AECFG_59 55Mot1R CATGTCACCGTAGATGGTACCGCCACGTACCCAGCAGCCTTGCTTGGG SEQ ID NO: 33 2740 55Mot1F GGTACCATCTACGGTGACATGTGGATCTGGAAGCAGAATTGGGGCACCTAC AC SEQ ID NO: 34 Pput 1063Mot1R GAAGCCACCGTAGACGGTTTCGCCTTCTATCCAGCAGCCTTGCTTGGGC SEQ ID NO: 35 1063 1063Mot1F GAAACCGTCTACGGTGGCTTCGGTTTCCCCAAGCAGAATTGGGGCACCTAC SEQ ID NO: 36 Pput 1064Mot1R ACGGACGTCACCGTAGGTGGTATCGGCATCTACCCAGCAGCCTTGCTTGG SEQ ID NO: 37 1064 1064Mot1F ACCACCTACGGTGACGTCCGTTGCGGCAAGCAGAATTGGGGCACCTAC SEQ ID NO: 38 2 AECFG_59 55Mot2R ACCATGCACGCCTTCAGTGTAACTGGATCCAATTGAGATATCCGAACC SEQ ID NO: 39 2740 55Mot2F TACACTGAAGGCGTGCATGGTTCGAACACGTTCAGCAATAGCACTCAATTG SEQ ID NO: 40 Pput 1063Mot2R CAGAGGACGCCATTCTTCAGCACTGCATCCAATTGAGATATCCGAACC SEQ ID NO: 41 1063 1063Mot2F GCTGAAGAATGGCGTCCTCTGTCGACGTTCAGCAATAGCACTCAATTG SEQ ID NO: 42 Pput 1064Mot2R CGAACCAGACACGGTTTCACTGACACTGAATCCAATTGAGATATCCG SEQ ID NO: 43 1064 1064Mot2F AGTGAAACCGTGTCTGGTTCGGAGACGTTCAGCAATAGCACTCAATTG SEQ ID NO: 44 3 AECFG_59 55Mot3R ATGCATCTGATAGAAGTTGTAGATGCCAGGACCAGTCAATTGAGTG SEQ ID NO: 45 2740 55Mot3F TACAACTTCTATCAGATGCATATGGTTTTTGCGCACAACGCCACTTCTG SEQ ID NO: 46 Pput 1063Mot3R CTGATACGCGACGTAGCATTCAGGACCAGTCAATTGAGTGCTATT SEQ ID NO: 47 1063 1063Mot3F GAATGCTACGTCGCGTATCAGCTTAAACTGGTTTATGCGCACAACGCCACT TC SEQ ID NO: 48 Pput 1064Mot3R ATGAACCTGATACACCATGATGGTGCCAGGACCAGTCAATTGAG SEQ ID NO: 49 1064 1064Mot3F ATCATGGTGTATCAGGTTCATATGGTTTATGCGCACAACGCCAC SEQ ID NO: 50 4 AECFG_59 55Mot4R GTTGTCCATCAACACAGCGCGCTGAACAGTATCCCAATCCAG SEQ ID NO: 51 2740 55Mot4F CGCGCTGTGTTGATGGACAACTACAAGCCAGGCAGCAATAGTGGGCAC SEQ ID NO: 52 Pput 1063Mot4R GGCCAGGTTGAAGATAAGGTGGTAAACAGTATCCCAATCCAGCGGC SEQ ID NO: 53 1063 1063Mot4F CACCTTATCTTCAACCTGGCCTACGGCCCAGGCAGCAATAGTGGGCACTTC SEQ ID NO: 54 Pput 1064Mot4R CTGGTTGAACAACACAGCCTGGTTAACAGTATCCCAATCCAGCGGC SEQ ID NO: 55 1064 1064Mot4F CAGGCTGTGTTGTTCAACCAGGAGGAGCCAGGCAGCAATAGTGGGCACTTC SEQ ID NO: 56 -
TABLE 9 Soluble Replaced PIP-1A WT amino Amino acids protein Motif from Oligos acid sequence replaced expressed Activity 1 AECFG_592740 55Mot1R GCWVDGITVYGDIFI GCWV R G G T I YGD MW I W No No 55Mot1F G a.a. 64-79 of a.a. 49-64 of SEQ ID NO: 2 SEQ ID NO: 12 Pput1063 1063Mot1R GCW IE G E TVYG GFGF P No No 1063Mot1F a.a. 34-49 of SEQ ID NO: 8 Pput1064 1064Mot1R GCWVD AD T T YGD VRC G No No 1064Mot1F a.a. 37-52 of SEQ ID NO: 10 2 AECFG_592740 55Mot2R FSNSESWSTTQ S S YT E GVHGSN No No 55Mot2F a.a. 149-159 of a.a. 133-143 of SEQ ID NO: 2 SEQ ID NO: 12 Pput1063 1063Mot2R C S -A E EWRPLS No No 1063Mot2F a.a. 118-127 of SEQ ID NO: 8 Pput1064 1064Mot2R FS V SE TV S GSE No No 1064Mot2F a.a. 122-132 of SEQ ID NO: 10 3 AECFG_592740 55Mot3R GTFIVYQVVMVYA G IYNF YQ MH MV F A No No 55Mot3F a.a. 171-183 of a.a. 155-167 of SEQ ID NO: 2 SEQ ID NO: 12 Pput1063 1063Mot3R ECY V A YQ LKL VYA No No 1063Mot3F a.a. 139-151 of SEQ ID NO: 8 Pput1064 1064Mot3R GT IM VYQV H MVYA No No 1064Mot3F a.a. 144-156 of SEQ ID NO: 10 4 AECFG_592740 55Mot4R QRNVLMENYN QR A VLM D NY K Yes Yes 55Mot4F a.a. 240-249 of a.a. 224-233 of SEQ ID NO: 2 SEQ ID NO: 12 Pput1063 1063Mot4R LYHLIFNLAY No No 1063Mot4F a.a. 208-217 of SEQ ID NO: 8 Pput1064 1064Mot4R NQA VL FNQFE No No 1064Mot4F a.a. 217-227 of SEQ ID NO: 10 - Table 9 also indicates if the resulting proteins were soluble when expressed as a MAL fusion in E. coli. and were active in the Lygus assay.
- As indicated in Table 9, all but one of these chimeras had reduced expression of soluble protein and was inactive in the bioassay indicating that these four motifs have functional constraints.
- Two motifs,
amino acids 171 to 183 (motif 3) andamino acids 240 to 249 (motif 4) of PIP-1A (SEQ ID NO: 2) were selected to further define the roles of the regions in insecticidal functions. To further define the permitted sequence variation within those two selected motifs, saturated mutagenesis was designed for each position of the motifs using the mutagenesis oligonucleotides as shown in Tables 10 and 11 formotifs -
TABLE 10 Amino acid Position of PIP-1A Motif (SEQ ID Oligo # NO: 2) name Sequence 3 G171 G173R AGGACCAGTCAATTGAGTGCT SEQ ID NO: 57 G173F AGCACTCAATTGACTGGTCCTNNKACCTTCATCGTGTATCAGGT SEQ ID NO: 58 T172 T174R GCCAGGACCAGTCAATTGAGT SEQ ID NO: 59 T174F ACTCAATTGACTGGTCCTGGCNNKTTCATCGTGTATCAGGTTG SEQ ID NO: 60 F173 F175R GGTGCCAGGACCAGTCAATTG SEQ ID NO: 61 F175F CAATTGACTGGTCCTGGCACCNNKATCGTGTATCAGGTTGTTATG SEQ ID NO: 62 I174 I176R GAAGGTGCCAGGACCAGTCAA SEQ ID NO: 63 I176F TTGACTGGTCCTGGCACCTTCNNKGTGTATCAGGTTGTTATG SEQ ID NO: 64 V175 V177R GATGAAGGTGCCAGGACCAGT SEQ ID NO: 65 V177F ACTGGTCCTGGCACCTTCATCNNKTATCAGGTTGTTATGGTTTAT SEQ ID NO: 66 Q177 Q179R ATACAOGATGAAGGTGCCAGG SEQ ID NO: 67 Q179F CCTGGCACCTTCATCGTGTATNNKGTTGTTATGGTTTATGCGCAC SEQ ID NO: 68 V178 V180R CTGATACACGATGAAGGTGCC SEQ ID NO: 69 V180F GGCACCTTCATCGTGTATCAGNNKGTTATGGTTTATGCGCACAAC SEQ ID NO: 70 V179 V181R AACCTGATACACGATGAAGGT SEQ ID NO: 71 V181F ACCTTCATCGTGTATCAGGTTNNKATGGTTTATGCGCACAACGCC SEQ ID NO: 72 M180 M182R AACAACCTGATACACGATGAA SEQ ID NO: 73 M182F TTCATCGTGTATCAGGTTGTTNNKGTTTATGCGCACAACGCCACT SEQ ID NO: 74 V181 V183R CATAACAACOTGATACACGAT SEQ ID NO: 75 V183F ATCGTGTATCAGGTTGTTATGNNKTATGCGCACAACGCCACTTCT SEQ ID NO: 76 Y182 Y184R AACCATAACAACCTGATACAC SEQ ID NO: 77 Y184F GTGTATCAGGTTGTTATGGTTNNKGCGCACAACGCCACTTCTGCG SEQ ID NO: 78 A183 A185R ATAAACCATAACAACCTGATA SEQ ID NO: 79 A185F TATCAGGTTGTTATGGTTTATNNKCACAACGCCACTTCTGCGGGC SEQ ID NO: 80 -
TABLE 11 Amino Motif acid Oligo # Position name Sequence 4 Q240 Q247R AACAGTATCCCAATCCAGCGG SEQ ID NO: 81 Q247F CCGCTGGATTGGGATACTGTTNNKCGCAATGTGTTGATGGAGAAC SEQ ID NO: 82 R241 R248R CTGAACAGTATCCCAATCCAG SEQ ID NO: 83 R248F CTGGATTGGGATACTGTTCAGNNKAATGTGTTGATGGAGAACTAC SEQ ID NO: 84 N242 N249R GCGCTGAACAGTATCCCAATC SEQ ID NO: 85 N249F GATTGGGATACTGTTCAGCGCNNKGTGTTGATGGAGAACTACAAC SEQ ID NO: 86 V243 V250R ATTGCGCTGAACAGTATCCCA SEQ ID NO: 87 V250F TGGGATACTGTTCAGCGCAATNNKTTGATGGAGAACTACAACCCA SEQ ID NO: 88 L244 L251R CACATTGCGCTGAACAGTATC SEQ ID NO: 89 L251F GATACTGTTCAGCGCAATGTGNNKATGGAGAACTACAACCCAGG SEQ ID NO: 90 M245 M252R CAACACATTGCGCTGAACAGT SEQ ID NO: 91 M252F ACTGTTCAGCGCAATGTGTTGNNKGAGAACTACAACCCAGGCAGC SEQ ID NO: 92 E246 E253R CATCAACACATTGCGCTGAAC SEQ ID NO: 93 E253F GTTCAGCGCAATGTGTTGATGNNKAACTACAACCCAGGCAGC SEQ ID NO: 94 N247 N254R CTCCATCAACACATTGCGCTG SEQ ID NO: 95 N254F CAGCGCAATGTGTTGATGGAGNNKTACAACCCAGGCAGCAATAG SEQ ID NO: 96 Y248 Y255R GTTCTCCATCAACACATTGCG SEQ ID NO: 97 Y255F CGCAATGTGTTGATGGAGAACNNKAACCCAGGCAGCAATAGTGG SEQ ID NO: 98 N249 N256R GTAGTTCTCCATCAACACATT SEQ ID NO: 99 N256F AATGTGTTGATGGAGAACTACNNKCCAGGCAGCAATAGTGGGCA SEQ ID NO: 100 -
TABLE 12 Soluble Lygus SBL Identified expressed Active Active Position mutations Mutants mutants mutants G171 P, W, R, Q, S, L, Q, M, Y, L, Q, M, C, S, L, M, L, M, A, S, W, C, H, T, I, N, D C, A, N V, Y, C, K, A, K, R, V, D, I, T, H, F, F, E, N N, D, E T172 G, A, L, H, G, A, L, H, V, G, H, F, E, G, H, F, V, F, S, M, F, S, M, R, E, R, S, N, I, R, S, N, R, E, I, N, I, N, W, Q, K, W, K, Q, C, V I, W, K, W, Q, K, P, P, D, C, Y Q, C, V, D, C, Y A, M F173 G, R, P, C, G, H, Q, L, A, G, H, L, A, H, L, A, D, A, E, I, R, I, N, C, K, R, N, C, K, N, C, K, L, V, S, K, W, T, S, Y, M W, T, S, Y, M W, T, S, Q, T, H, W, Y, M N, M, Y I174 A, K, G, P, A, K, G, W, L, G, R, N, A, G, R, N, W, L, R, C, R, C, H, Q, S, Q, M, I, C, A, Q, M, H, Q, S, V, V, E, I, Y, M, L, F, V, Y, I, C, L, E, I, Y, M, F, N, T K, E, S, H, T F, V, Y, F, N, T K, E, S, H, T V175 L, Q, R, G, A, I, C, E, K, L A, I, C, E, A, I, C, C, E, W, A, K, L E, L D, F, K, T, P, N, M, I, S, Y, H Y176 S, W, V, T, M, F, L, C, A, W M, F, L M, L, C M, R, Q, L, N, D, C, A, E, G, F, I, P, H, K Q177 W, R, L, K, I, M, P, I, M, P M, P G, S, A, D, P, E, C, M, V, I, H, T, F, Y, N V178 C, T, R, S, C, T, R, S, Y, C, T, P, A, C, T, S, Y, D, G, L, D, L, P, A, M, M, Q, F, I P, A, M, P, A, M, Q, Q, W, E, F, I, Q, I, K W, E, F, H, H, N, K, I V179 F, Y, T, P, D, F, Y, T, I, C, F, T, I, C, T, I, C, K, I, G, C, R, L, M, S, H, Q, A L, M, S, A, Q S, A L, M, S, H, W, Q, E, N, A, M180 K, D, R, P, E, K, P, W, N, Y, P, W, N, Y, P, W, N, W, N, Y, G, Q, G, Q, L, A, V, G, Q, L, A, Y, Q, L, S, L, A, V, F, F, I, C V, F, I, C, S A, V, F, I, H, T, C I, C, S V181 G, R, A, P, D, A, L, W, C, T, I A, L, W, C, A, L, C, L, E, W, C, S, T, I T, I, K Q, T, I, N, F, Y, H, K, M Y182 V, E, P, K, A, F, M, H F, M, H F, M W, R, T, L, F, Q, C, D, N, M, G, H, S, I A183 W, M, P, V, T, M, V, T, D, G, M, V, T, D, M, V, T, D, G, C, I, Y, C, I, F, S, Q, L G, C, I, F, D, G, C, N, F, E, S, Q, S, L I, F, S, L L, H, R, K -
TABLE 13 Posi- Identified Soluble expressed tion mutations mutants Active mutants Q240 R, A, V, E, M, G, R, A, V, E, M, G, R, A, V, E, M, G, D, W, N, T, I, S, D*, W, N, T, I, S, F, D, W, N, T, I, S, F, F, H, C, L, Y, P, K H, C, L, Y, K H, C, L, Y, K R241 K, E, Q, S, I, V, K, E, Q, S, I, V, D, K, E, Q, S, I, V, D, D, Y, M, N, H, P, Y, M, N, H, P, G, L, Y, M, N, H, P, G, G, L, F, T, A, C, W F, T, A, C, W L, F, T, A, C, W N242 R, K, H, S, C, A, R, K, H, S, C, A, E, R, K, H, S, C, A, E, E, P, W, Q, T, F, P*, W, Q, T, F, Y, P, W, Q, T, F, Y, Y, M, D, V, G, L, I M, D, V, G, L, I M, D, G, L, I V243 P, L, Q, E, A, F, L, A, T, G, C, I, S, L, A, T, G, C, I, S, N, Y, T, W, G, C, M, M, I, R, S, H, K, M, D L244 V, F, I, S, M, Y, V, F, I, M, W, Q, A, V, F, I, M, Q, C, W W, P, Q, H, T, K, C, E, A, N, C, R, G, D M245 A, R, D, E, L, P, A, R, D, E, L, P, S, A, R, D, E, L, P, S, S, W, G, V, K, F, W, G, V, K, F, C, T, W, G, V, K, F, C, C, T, H, I, Q, Y, N H, I, Q, Y, N T, H, I, Q, Y, N E246 G, S, I, A, L, V, Y, D, G, R, V, A, Y, D, G, R, H, W, R, Y, C, D, W, Q, S, N, I, L, M, V, A, W, N, Q, P, M, F, C, P, H, F, T, K Q, S, N, I, L, M. C, T, K P, H, F, T, K N247 L, D, Y, A, F, H, L, D, Y, A, F, H, R, L, D, Y, A, F, H, R, R, K, Q, G, V, I, K, Q, G, V, I, S, E, K, Q, G, V, I, S, E, S, E, P, M, W, T, C P, M, W, T, C P, M, W, T, C Y248 V, T, E, F, S, H, V, T, E, F, S, H, C, V, T, E, F, S, H, C, C, N, L, G, K, A, N, L, G, A, W, I, D, L, W, I, D, G, A W, R, I, D, P, Q, P (M) N249 V, G, M, D, K, C, V, G, M, D, K, C, F, V, G, M, D, K, C, F, R, E, W, Y, S, R, E, W, Y, S, I, T, F, R, E, W, Y, I, T, P, L, A, H, Q P, L, A, H, Q S, I, T, P, L, A, - Both PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) as MBP fusions and alone were cloned into a transient expression vector under control of a viral promoter pDMMV (Dav, et. al., (1999) Plant Mol. Biol. 40:771-782). The agro-infiltration method of introducing an Agrobacterium cell suspension to plant cells of intact tissues so that reproducible infection and subsequent plant derived transgene expression may be measured or studied is well known in the art (Kapila, et. al., (1997) Plant Science 122:101-108). Briefly, young plantlets of Phaseolus vulgaris or Glycine max, were agro-infiltrated with normalized bacterial cell cultures of test and control strains. Leaf discs were generated and infested with 3 neonates of both Soy Bean Looper (SBL) (Pseudoplusia includes) or Velvet bean caterpillar (VBC) (Velvet Anticarsia gemmatalis) with two control leaf discs generated with Agrobacterium only. The consumption of green leaf tissues was scored after two day's infestation. The transiently expressed PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) protected leaf discs from consumption by the infested SBL and VBC insects while the total green tissue consumption was observed for the two negative controls. Transient protein expressions of both PIP-1A (SEQ ID NO: 2) and PSEEN3174 (SEQ ID NO: 6) were confirmed by Mass spectrometry based protein identification method using extracted protein lysates from infiltrate leaf tissues (Patterson, (1998) 10(22):1-24, Current Protocol in Molecular Biology published by John Wiley & Son Inc).
- A series of truncated variants of PIP-1A (SEQ ID NO: 2) are generated in 5 amino acid increments from both ends by PCR cloning for the first and/or last 30 amino acids. The truncated genes are cloned to the same expression system as listed above. Recombinant proteins of those truncated versions of PIP-1A are assayed with insects and minimal length of the protein is defined with the variant still retains detectible insecticidal activity.
- The PIP-1A (SEQ ID NO: 2), PSEEN3174 (SEQ ID NO: 6) and PIP-1B (SEQ ID NO: 4) proteins were digested with a limited Trypsin digestion (1 part of Trypsin vs. 100 parts of purified protein). The resulting N-terminal trypsin truncated variants, PIP-1AT1 (SEQ ID NO: 204), PSEEN3174T1 (SEQ ID NO: 206), PIP-1BT1 (SEQ ID NO: 208), have amino acids 1-28 deleted compared to the respective full length proteins by N-terminal Amino Acid sequencing. The PIP-1AT1 (SEQ ID NO: 204), PSEEN3174T1 (SEQ ID NO: 206), PIP-1BT1 (SEQ ID NO: 208) were assayed in the Lygus assay and found to have substantially the same activity as the respective full length proteins.
- The arginine (R) at position 28 of PIP-1A was mutated to alter the trypsin cleavage site. The variants were generated using a similar strategy as described in Example 9 using the saturation mutagenesis primers R28R (SEQ ID NO: 218), and R28F (SEQ ID NO: 219). Table 14 shows the amino acid substitutions identified, those substitutions that expressed soluble protein, and those substitutions that were active in the Lygus assay with a minimal score of 4 or greater out of total maximal score of 8. This data demonstrate that the amino substitutions indicated in Table 14 as “Active mutants” can be made to eliminate a proteolytic cleavage site while retaining activity.
-
TABLE 14 Identified Soluble expressed Lygus Active Position mutations Mutants mutants R28 S, K, T, V, G, A, S, K, T, V, G, A, S, K, T, V, G, M, D, W, P, L, H, M, D, W, P, L, H, A, M, D, W, P, C, Q, C, Q, L, H, C, Q, - To further explore the role of motif 4 (
amino acids 240 to 249 of PIP-1A (SEQ ID NO: 2), a series of variants were generated with multiple amino acid substitutions inmotif 4. The variants were generated using a similar mutagenesis strategy as described in Example 9 using the mutagenesis primer Motif 4-Comb-F CCGCTGGATTGGGATACTGTTVWWNGCHAYDTTWTKDTKGRKNAYTWTNAYCCAGGCAGC AATAGTGGGCACTTC (SEQ ID NO: 326) paired withprimer 3188R GGATGTGCTGCAAGGCGATTAAG (SEQ ID NO: 327) and Comb-R AACAGTATCCCAATCCAGCGG (SEQ ID NO: 328) paired with 3188F CAGACTGTCGATGAAGCCCTGAAAG (SEQ ID NO: 329). The mutagenesis primer Motif 4-Comb-F was designed to be partially degenerate at residues 240-249 of PIP-1A (SEQ ID NO: 2) resulting in selected amino acid substitutions at each residues. Table 15 shows the degenerate codon encoding each of residues 240-249 and the possible resulting amino acids. In Table 15 the native amino acid is indicated in bold and underlining. -
TABLE 15 Degenerate Residue codon Degeneracy Resulting amino acids* 240 VWW V = A, G OR C Gln , Lys, Glu, Asp, Ile, W = A OR T Val, Asn, His and Leu 241 NGC N = G, A, T OR C Arg , Ser, Gly, and Gys 242 HAY H = A, C OR T Asn , His, and Tyr Y = C OR T 243 DTT D = A, G OR T Val , Ile and Phe 244 WTK W = A OR T Leu , Met, Ile and Phe K = G OR T 245 DTK D = A, G OR T Met , He, Val, Leu and K = G OR T Phe 246 GRK R = A OR G Glu , Gly and Asp K = G OR T 247 NAY N = G, A, T OR C Asn , Asp, Tyr and His Y = C OR T 248 TWT W = A OR T Tyr and Phe 249 NAY N = G, A, T OR C Asn , Asp, Tyr and His Y = C OR T - The resulting polynucleotides encoding the PIP-1A variant polypeptides were expressed as MBP fusions in E. coli and screened as cleared lysates in a 96 well format (3 plates) for Lygus insecticidal activity as described in Example 1 and scored for activity on a scale of 0 to 8 (see
FIG. 4 ). The clones encoding the variant PIP-polypeptides having Lygus insecticidal activity ranging from 4 to 8 were DNA sequenced (SEQ ID NO: 220, SEQ ID NO: 221, SEQ ID NO: 222, SEQ ID NO: 223, SEQ ID NO: 224, SEQ ID NO: 225, SEQ ID NO: 226, SEQ ID NO: 227, SEQ ID NO: 228, SEQ ID NO: 229, SEQ ID NO: 230, SEQ ID NO: 231, SEQ ID NO: 232, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO: 243, and SEQ ID NO: 244) to determine the identity of the amino acid substitutions at residues 240-249 of the PIP1A polypeptides of SEQ ID NO: 245, SEQ ID NO: 246, SEQ ID NO: 247, SEQ ID NO: 248, SEQ ID NO: 249, SEQ ID NO: 250, SEQ ID NO: 251, SEQ ID NO: 252, SEQ ID NO: 253, SEQ ID NO: 254, SEQ ID NO: 255, SEQ ID NO: 256, SEQ ID NO: 257, SEQ ID NO: 258, SEQ ID NO: 259, SEQ ID NO: 260, SEQ ID NO: 261, SEQ ID NO: 262, SEQ ID NO: 263, SEQ ID NO: 264, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO: 267, SEQ ID NO: 268, and SEQ ID NO: 269, which are shown in Table 16. Themotif 4 amino acid substitutions compared to PIP-1A (SEQ ID NO: 2) are indicated in bold and underlining. -
TABLE 16 # of Soluble muta- ex- Variant Amino acids seq tions pression PIP-1A QRNVLMENYN (a.a. 240-249 0 Yes of SEQ ID NO: 2) 1A3 NSY VL LDY Y Y (a.a. 240-249 7 Yes SEQ ID of SEQ ID NO: 245) NO: 245 1E3 NCYIF ME Y Y D (a.a. 240-249 7 Yes SEQ ID of SEQ ID NO: 246) NO: 246 1F5 NCYIM MEN FD (a.a. 240-249 7 Yes SEQ ID of SEQ ID NO: 247) NO: 247 1B9 Q C NVL FD N FH (a.a. 240-249 5 Yes SEQ ID of SEQ ID NO: 248) NO: 248 1C10 Q GY VL V DN F N (a.a. 240-249 5 Yes SEQ ID of SEQ ID NO: 249) NO: 249 1A11 N R Y V FFG NY D (a.a. 240-249 6 Yes SEQ ID of SEQ ID NO: 250) NO: 250 2A2 Q C N IMIGYFD (a.a. 240-249 8 Yes SEQ ID of SEQ ID NO: 251) NO: 251 2G1 Q G NVLMENYN (a.a. 240-249 1 Yes SEQ ID of SEQ ID NO: 252) NO: 252 2C7 VS N I L VG N F N (a.a. 240-249 6 Yes SEQ ID of SEQ ID NO: 253) NO: 253 2E1 N R H VL VD N F Y (a.a. 240-249 5 Yes SEQ ID of SEQ ID NO: 254) NO: 254 2E12 VS NVL IDDFD (a.a. 240-249 7 Yes SEQ ID of SEQ ID NO: 255) NO: 255 2F4 VSH VM M E D Y D (a.a. 240-249 6 Yes SEQ ID of SEQ ID NO: 256) NO: 256 2F8 NSHI L VG NY D (a.a. 240-249 7 Yes SEQ ID of SEQ ID NO: 257) NO: 257 2G5 NSY V MI EN FY (a.a. 240-249 7 Yes SEQ ID of SEQ ID NO: 258) NO: 258 2G6 NC N II MENY D (a.a. 240-249 5 Yes SEQ ID of SEQ ID NO: 259) NO: 259 3A2 I R YIFID N FD (a.a. 240-249 8 Yes SEQ ID of SEQ ID NO: 260) NO: 260 3A10 V RNVL V ENY H (a.a. 240-249 3 Yes SEQ ID of SEQ ID NO: 261) NO: 261 3C7 QR Y VL ID N FY (a.a. 240-249 5 Yes SEQ ID of SEQ ID NO: 262) NO: 262 3E3 LSHFMLG N F N (a.a. 240-249 8 Yes SEQ ID of SEQ ID NO: 263) NO: 263 3F1 RC NVLM GDFD (a.a. 240-249 6 Yes SEQ ID of SEQ ID NO: 264) NO: 264 3F2 IG NV MVGDFD (a.a. 240-249 8 Yes SEQ ID of SEQ ID NO: 265) NO: 265 3F6 Q CY VL I EN FH (a.a. 240-249 5 Yes SEQ ID of SEQ ID NO: 266) NO: 266 3F12 VC NVLME HFY (a.a. 240-249 5 Yes SEQ ID of SEQ ID NO: 267) NO: 267 3G7 V RNV FFDYFD (a.a. 240-249 7 Yes SEQ ID8 of SEQ ID NO: 268) NO: 26 3F4 VSYI L FD N FH (a.a. 240-249 8 Yes SEQ ID of SEQ ID NO: 269) NO: 269 - The clones encoding the variant PIP-1A polypeptides having Lygus insecticidal activity ranging from 0 to 4 were DNA sequenced (SEQ ID NO: 270, SEQ ID NO: 271, SEQ ID NO: 272, SEQ ID NO: 273, SEQ ID NO: 274, SEQ ID NO: 275, SEQ ID NO: 276, SEQ ID NO: 277, SEQ ID NO: 278, SEQ ID NO: 279, SEQ ID NO: 280, SEQ ID NO: 281, SEQ ID NO: 282, SEQ ID NO: 283, SEQ ID NO: 284, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO: 287, SEQ ID NO: 288, SEQ ID NO: 289, SEQ ID NO: 290, SEQ ID NO: 291, SEQ ID NO: 292, SEQ ID NO: 293, SEQ ID NO: 294, SEQ ID NO: 295, SEQ ID NO: 296, and SEQ ID NO: 297), to determine the identity of the amino acid substitutions at residues 240-249 of the PIP-1A polypeptides SEQ ID NO: 298, SEQ ID NO: 299, SEQ ID NO: 300, SEQ ID NO: 301, SEQ ID NO: 302, SEQ ID NO: 303, SEQ ID NO: 304, SEQ ID NO: 305, SEQ ID NO: 306, SEQ ID NO: 307, SEQ ID NO: 308, SEQ ID NO: 309, SEQ ID NO: 310, SEQ ID NO: 311, SEQ ID NO: 312, SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO: 315, SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO: 318, SEQ ID NO: 319, SEQ ID NO: 320, SEQ ID NO: 321, SEQ ID NO: 322, SEQ ID NO: 323, SEQ ID NO: 324, and SEQ ID NO: 325, which are shown in Table 17. Protein expression analysis by SDS-PAGE (data not shown) revealed that the variant proteins with Lygus insecticidal activity from 0 to 4 affect soluble expression (protein folding and solubility) in E. coli with the proteins accumulating as insoluble fraction of the cleared lysate. The loss of activity from the multiple substitutions in
motif 4 appears to be from the lack of soluble expressed proteins in the E coli expression system.Motif 4 appears to be tolerant to multiple amino acid substitution while remaining active. -
TABLE 17 # of Soluble muta- ex- Variants Amino acids seq tions pression PIP-1A QRNVLMENYN (a.a. 240-249 0 yes of SEQ ID NO: 2) 1B7 HSY V FID NYN (a.a. 240-249 6 No SEQ ID of SEQ ID NO: 298) NO: 298 1C7 VC N FFFGDFD (a.a. 240-249 9 No SEQ ID of SEQ ID NO: 299) NO: 299 1D7 K R YFM M GYFH (a.a. 240-249 8 No SEQ ID of SEQ ID NO: 300) NO: 300 1E7 LCH V FIGYFY (a.a. 240-249 9 No SEQ ID of SEQ ID NO: 301) NO: 301 1F7 EG N FFVG N FD (a.a. 240-249 8 No SEQ ID of SEQ ID NO: 302) NO: 302 1A8 I R YFIL E D YN (a.a. 240-249 6 No SEQ ID of SEQ ID NO: 303) NO: 303 1B8 LGYFMV E DFD (a.a. 240-249 9 No SEQ ID of SEQ ID NO: 304) NO: 304 1C8 KG NVL V E Y YN (a.a. 240-249 4 No SEQ ID of SEQ ID NO: 305) NO: 305 1D8 LS NV I M GHFY (a.a. 240-249 7 No SEQ ID of SEQ ID NO: 306) NO: 306 1E8 VSY V FFGHFD (a.a. 240-249 9 No SEQ ID of SEQ ID NO: 307) NO: 307 1G8 DGYI L VG N FD (a.a. 240-249 8 No SEQ ID of SEQ ID NO: 308) NO: 308 1A9 NG N IFLDHFD (a.a. 240-249 9 No SEQ ID of SEQ ID NO: 309) NO: 309 1D9 ICYIIFDD Y H (a.a. 240-249 9 No SEQ ID of SEQ ID NO: 310) NO: 310 1F9 NS N F L F EN FH (a.a. 240-249 6 No SEQ ID of SEQ ID NO: 311) NO: 311 1D10 LCHI L IGD YN (a.a. 240-249 7 No SEQ ID of SEQ ID NO: 312) NO: 312 1E10 HC NV IVDY YN (a.a. 240-249 6 No SEQ ID of SEQ ID NO: 313) NO: 313 1F10 EGY V MFGYF N (a.a. 240-249 8 No SEQ ID of SEQ ID NO: 314) NO: 314 IBU VCYI L V E Y Y H (a.a. 240-249 7 No SEQ ID of SEQ ID NO: 315) NO: 315 1011 L R H V MFG NY Y (a.a. 240-249 6 No SEQ ID of SEQ ID NO: 316) NO: 316 1D11 N RN IFFDD Y Y (a.a. 240-249 7 No SEQ ID of SEQ ID NO: 317) NO: 317 1E11 KGY V MVGDF N (a.a. 240-249 8 No SEQ ID of SEQ ID NO: 318) NO: 318 1F11 LG N FFLGY YN (a.a. 240-249 7 No SEQ ID of SEQ ID NO: 319) NO: 319 1H11 LS NVL ID N FY (a.a. 240-249 6 No SEQ ID of SEQ ID NO: 320) NO: 320 1A12 NCYFIVDD YN (a.a. 240-249 8 No SEQ ID of SEQ ID NO: 321) NO: 321 1B12 ISY V FV E DFH (a.a. 240-249 8 No SEQ ID of SEQ ID NO: 322) NO: 322 1D12 NIHIMI E Y Y H (a.a. 240-249 8 No SEQ ID of SEQ ID NO: 323) NO: 323 1E12 IGHFMLDY Y H (a.a. 240-249 9 No SEQ ID of SEQ ID NO: 324) NO: 324 1G12 ICY V MVG NY H (a.a. 240-249 7 No SEQ ID of SEQ ID NO: 325) NO: 325 - A Blast search of a proprietary genomic contig library of a Pseudomonas protegens strain JH19887-2 against the PIP-1 polynucleotide sequence of SEQ ID NO: 1 identified a polynucleotide of SEQ ID NO: 331, encoding a polypeptide of SEQ ID NO: 332 (herein referred to as PIP-1C) having 82% sequence identity to PIP-1A (SEQ ID NO: 2). Table 18 shows the % sequence identity between PIP-1C (SEQ ID NO: 332) and PIP-1A (SEQ ID NO: 2), PIP-1B (SEQ ID NO: 4), and PSEEN3174 (SEQ ID NO: 6).
FIG. 5 shows the sequence alignment of PIP-1A (SEQ ID NO: 2), PIP-1B (SEQ ID NO: 4), PIP-1C (SEQ ID NO: 332) and PSEEN3174 (SEQ ID NO: 6). PIP-1C was expressed in E. coli in the same way as PIP-1A. The purified PIP-1C was assayed against Soybean looper (SBL) and lygus in diet based assays. PIP-1C (SEQ ID NO: 332) demonstrated killing activity against both SBL and lygus demonstrating insecticidal spectrum similar to PIP-1A (SEQ ID NO: 2). -
TABLE 18 PIP-1A PIP-1B PSEEN3174 PIP-1C SEQ ID NO: 2 SEQ ID NO: 4 SEQ ID NO: 6 SEQ ID NO: 332 PIP-1A 93% 79% 82% PIP-1B 79% 84% PSEEN3174 80% PIP-1C - Immature maize embryos from greenhouse donor plants are bombarded with a DNA molecule containing the toxin nucleotide sequence (e.g., SEQ ID NO: 1) operably linked to an ubiquitin promoter and the selectable marker gene PAT (Wohlleben, et al., (1988) Gene 70: 25-37), which confers resistance to the herbicide Bialaphos. Alternatively, the selectable marker gene is provided on a separate DNA molecule. Transformation is performed as follows. Media recipes follow below.
- The ears are husked and surface sterilized in 30% CLOROX™ bleach plus 0.5% Micro detergent for 20 minutes, and rinsed two times with sterile water. The immature embryos are excised and placed embryo axis side down (scutellum side up), 25 embryos per plate, on 560Y medium for 4 hours and then aligned within the 2.5 cm target zone in preparation for bombardment.
- A plasmid vector comprising a nucleotide sequence (e.g., SEQ ID NO: 1) operably linked to an ubiquitin promoter is made. For example, a suitable transformation vector comprises a UBI1 promoter from Zea mays, a 5′ UTR from UBI1 and a UBI1 intron, in combination with a PinII terminator. The vector additionally contains a PAT selectable marker gene driven by a CAMV35S promoter and includes a CAMV35S terminator. Optionally, the selectable marker can reside on a separate plasmid. A DNA molecule comprising a toxin nucleotide sequence as well as a PAT selectable marker is precipitated onto 1.1 μm (average diameter) tungsten pellets using a CaCl2 precipitation procedure as follows:
-
- 100 μL prepared tungsten particles in water
- L (1 μg) DNA in Tris EDTA buffer (1 μg total DNA)
- 100 μL 2.5 M CaCl2
- 10 μL 0.1 M spermidine
- Each reagent is added sequentially to a tungsten particle suspension, while maintained on the multitube vortexer. The final mixture is sonicated briefly and allowed to incubate under constant vortexing for 10 minutes. After the precipitation period, the tubes are centrifuged briefly, liquid removed, washed with 500
mL 100% ethanol, and centrifuged for 30 seconds. Again the liquid is removed, and 105μL 100% ethanol is added to the final tungsten particle pellet. For particle gun bombardment, the tungsten/DNA particles are briefly sonicated and 10 μL spotted onto the center of each macrocarrier and allowed to dry about 2 minutes before bombardment. - The sample plates are bombarded at
level # 4 in particle gun #HE34-1 or #HE34-2. All samples receive a single shot at 650 PSI, with a total of ten aliquots taken from each tube of prepared particles/DNA. - Following bombardment, the embryos are kept on 560Y medium for 2 days, then transferred to 560R selection medium containing 3 mg/liter Bialaphos, and subcultured every 2 weeks. After approximately 10 weeks of selection, selection-resistant callus clones are transferred to 288J medium to initiate plant regeneration. Following somatic embryo maturation (2-4 weeks), well-developed somatic embryos are transferred to medium for germination and transferred to the lighted culture room. Approximately 7-10 days later, developing plantlets are transferred to 272V hormone-free medium in tubes for 7-10 days until plantlets are well established. Plants are then transferred to inserts in flats (equivalent to 2.5″ pot) containing potting soil and grown for 1 week in a growth chamber, subsequently grown an additional 1-2 weeks in the greenhouse, then transferred to classic 600 pots (1.6 gallon) and grown to maturity. Plants are monitored and scored for expression of the toxin by assays known in the art or as described above.
- Bombardment medium (560Y) comprises 4.0 g/L N6 basal salts (SIGMA C-1416), 1.0 mL/L Eriksson's Vitamin Mix (1000× SIGMA-1511), 0.5 mg/L thiamine HCl, 120.0 g/L sucrose, 1.0 mg/
L 2,4-D and 2.88 g/L L-proline (brought to volume with deionized H2O following adjustment to pH 5.8 with KOH); 2.0 g/L Gelrite™ (added after bringing to volume with dI H2O); and 8.5 mg/L silver nitrate (added after sterilizing the medium and cooling to room temperature). Selection medium (560R) comprises 4.0 g/L N6 basal salts (SIGMA C-1416), 1.0 mL/L Eriksson's Vitamin Mix (1000× SIGMA-1511), 0.5 mg/L thiamine HCl, 30.0 g/L sucrose, and 2.0 mg/L 2,4-D (brought to volume with dI H2O following adjustment to pH 5.8 with KOH); 3.0 g/L Gelrite™ (added after bringing to volume with dI H2O); and 0.85 mg/L silver nitrate and 3.0 mg/L Bialaphos (both added after sterilizing the medium and cooling to room temperature). - Plant regeneration medium (288J) comprises 4.3 g/L MS salts (GIBCO 11117-074), 5.0 mL/L MS vitamins stock solution (0.100 g nicotinic acid, 0.02 g/L thiamine HCl, 0.10 g/L pyridoxine HCl, and 0.40 g/L Glycine brought to volume with polished D-I H20) (Murashige and Skoog, (1962) Physiol. Plant. 15:473), 100 mg/L myo-inositol, 0.5 mg/L zeatin, 60 g/L sucrose, and 1.0 mL/L of 0.1 mM abscisic acid (brought to volume with
polished dI H 20 after adjusting to pH 5.6); 3.0 g/L Gelrite™ (added after bringing to volume with dI H20); and 1.0 mg/L indoleacetic acid and 3.0 mg/L Bialaphos (added after sterilizing the medium and cooling to 60 C). - Hormone-free medium (272V) comprises 4.3 g/L MS salts (GIBCO 11117-074), 5.0 mL/L MS vitamins stock solution (0.100 g/L nicotinic acid, 0.02 g/L thiamine HCl, 0.10 g/L pyridoxine HCl, and 0.40 g/L Glycine brought to volume with polished dI H20), 0.1 g/L myo-inositol, and 40.0 g/L sucrose (brought to volume with
polished dI H 20 after adjusting pH to 5.6); and 6 g/L Bacto-agar (added after bringing to volume with polished dI H20), sterilized and cooled to 60° C. - For Agrobacterium-mediated transformation of maize with a toxin nucleotide sequence (e.g., SEQ ID NO: 1), the method of Zhao can be used (U.S. Pat. No. 5,981,840 and PCT Patent Publication Number WO 1998/32326; the contents of which are hereby incorporated by reference). Briefly, immature embryos are isolated from maize and the embryos contacted with a suspension of Agrobacterium under conditions whereby the bacteria are capable of transferring the nucleotide sequence (e.g. SEQ ID NO: 1) to at least one cell of at least one of the immature embryos (step 1: the infection step). In this step the immature embryos can be immersed in an Agrobacterium suspension for the initiation of inoculation. The embryos are co-cultured for a time with the Agrobacterium (step 2: the co-cultivation step). The immature embryos can be cultured on solid medium following the infection step. Following this co-cultivation period an optional “resting” step is contemplated. In this resting step, the embryos are incubated in the presence of at least one antibiotic known to inhibit the growth of Agrobacterium without the addition of a selective agent for plant transformants (step 3: resting step). The immature embryos can be cultured on solid medium with antibiotic, but without a selecting agent, for elimination of Agrobacterium and for a resting phase for the infected cells. Next, inoculated embryos are cultured on medium containing a selective agent and growing transformed callus is recovered (step 4: the selection step). The immature embryos are cultured on solid medium with a selective agent resulting in the selective growth of transformed cells. The callus is then regenerated into plants (step 5: the regeneration step), and calli grown on selective medium can be cultured on solid medium to regenerate the plants.
- Soybean embryos are bombarded with a plasmid containing a nucleotide sequence (e.g., SEQ ID NO: 1) operably linked to a pinII promoter as follows. To induce somatic embryos, cotyledons, 3-5 mm in length dissected from surface-sterilized, immature seeds of an appropriate soybean cultivar are cultured in the light or dark at 26° C. on an appropriate agar medium for six to ten weeks. Somatic embryos producing secondary embryos are then excised and placed into a suitable liquid medium. After repeated selection for clusters of somatic embryos that multiplied as early, globular-staged embryos, the suspensions are maintained as described below.
- Soybean embryogenic suspension cultures can be maintained in 35 mL liquid media on a rotary shaker, 150 rpm, at 26° C. with florescent lights on a 16:8 hour day/night schedule. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 mL of liquid medium.
- Soybean embryogenic suspension cultures may then be transformed by the method of particle gun bombardment (Klein, et al., (1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050). A Du Pont Biolistic PDS1000/HE instrument (helium retrofit) can be used for these transformations.
- A selectable marker gene that can be used to facilitate soybean transformation is a transgene composed of the 35S promoter from Cauliflower Mosaic Virus (Odell, et al., (1985) Nature 313:810-812), the hygromycin phosphotransferase gene from plasmid pJR225 (from E. coli; Gritz, et al., (1983) Gene 25:179-188), and the 3′ region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens. The expression cassette comprising a toxin nucleotide sequence (e.g., SEQ ID NO: 1) operably linked to the pinII promoter can be isolated as a restriction fragment. This fragment can then be inserted into a unique restriction site of the vector carrying the marker gene.
- To 50 μL of a 60 mg/
mL 1 μm gold particle suspension is added (in order): 5 μL DNA (1 μg/μL), 20 μL spermidine (0.1M), and 50 μL CaCl2 (2.5M). The particle preparation is then agitated for three minutes, spun in a microfuge for 10 seconds and the supernatant removed. The DNA-coated particles are then washed once in 400 μL 70% ethanol and resuspended in 40 μL of anhydrous ethanol. The DNA/particle suspension can be sonicated three times for one second each. Five microliters of the DNA-coated gold particles are then loaded on each macro carrier disk. - Approximately 300-400 mg of a two-week-old suspension culture is placed in an empty 60×15 mm petri dish and the residual liquid removed from the tissue with a pipette. For each transformation experiment, approximately 5-10 plates of tissue are normally bombarded. Membrane rupture pressure is set at 1100 psi, and the chamber is evacuated to a vacuum of 28 inches mercury. The tissue is placed approximately 3.5 inches away from the retaining screen and bombarded three times. Following bombardment, the tissue can be divided in half and placed back into liquid and cultured as described above.
- Five to seven days post bombardment the liquid media may be exchanged with fresh media, and eleven to twelve days post-bombardment with fresh media containing 50 mg/mL hygromycin. This selective media can be refreshed weekly. Seven to eight weeks post-bombardment, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated green tissue is removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryogenic suspension cultures. Each new line may be treated as an independent transformation event. These suspensions can then be subcultured and maintained as clusters of immature embryos or regenerated into whole plants by maturation and germination of individual somatic embryos.
- All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this disclosure pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
- Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.
- The above description of various illustrated embodiments of the invention is not intended to be exhaustive or to limit the invention to the precise form disclosed. While specific embodiments of, and examples for, the invention are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the invention, as those skilled in the relevant art will recognize. The teachings provided herein of the invention can be applied to other purposes, other than the examples described above. The invention may be practiced in ways other than those particularly described in the foregoing description and examples. Numerous modifications and variations of the invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.
- These and other changes may be made to the invention in light of the above detailed description. In general, in the following claims, the terms used should not be construed to limit the invention to the specific embodiments disclosed in the specification and the claims.
- Certain teachings related to PIP polynucleotides and polypeptides were disclosed in U.S. Provisional patent application No. 61/667,039, filed Jul. 2, 2012, the disclosure of which is herein incorporated by reference in its entirety.
- The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, manuals, books, or other disclosures) in the Background of the Invention, Detailed Description, and Examples is herein incorporated by reference in their entireties.
- The above examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the subject invention, and are not intended to limit the scope of what is regarded as the invention. Efforts have been made to ensure accuracy with respect to the numbers used (e.g. amounts, temperature, concentrations, etc.) but some experimental errors and deviations should be allowed for. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight; temperature is in degrees centigrade; and pressure is at or near atmospheric.
Claims (15)
1-30. (canceled)
31. A nucleic acid molecule comprising a heterologous regulatory element and a polynucleotide encoding an insecticidal polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 6 or a fragment thereof and having insecticidal activity.
32. A DNA construct comprising the nucleic acid molecule of claim 31 , wherein the polynucleotide has codons optimized for expression in an agriculturally important crop.
33. A transgenic plant comprising the nucleic acid molecule of claim 31 .
34. A method of inhibiting growth of or killing an insect pest or pest population, comprising contacting the insect pest or pest population with an insecticidal polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 6 or a fragment thereof having insecticidal activity.
35. A method of inhibiting growth of or killing an insect pest or pest population in a plant comprising expressing in a plant the nucleic acid molecule of claim 31 .
36. A method of controlling insect pest damage to plants comprising providing the insecticidal polypeptide of claim 31 to an insect pest or pest population for ingestion, wherein said insecticidal polypeptide is produced by a transgenic plant and is present in at least one of said plants.
37. A method for controlling insect pest infestation comprising providing in the diet of the pest the transgenic plant of claim 33 , or a part thereof.
38. A method for improving the yield of a crop comprising growing the transgenic plant of claim 33 , wherein the yield of the crop is increased in the presence of the insect pest relative to the crop not comprising said transgenic plant.
39. The method of claim 34 , wherein the insect pest or pest population is resistant to at least one Cry insecticidal protein.
40. The method of claim 36 , wherein the transgenic plant is selected from barley, corn, oat, rice, rye, sorghum, turf grass, sugarcane, wheat, alfalfa, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, a cucurbit, eucalyptus, flax, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, tomato ornamental, shrub, nut, chickpea, pigeon pea, millets, hops, and pasture grass plant cells.
41. The method of claim 34 , wherein the insect pest or insect pest population is an agriculturally important species in the Order Lepidoptera or Order Hemiptera.
42. The method of claim 41 , wherein the insect pest or insect pest population is selected from corn earworm, European corn borer, black cutworm, fall armyworm, soybean looper, velvet bean caterpillar, and diamondback moth.
43. A method of controlling Lepidoptera and/or Hemiptera insect infestation in a transgenic plant and providing insect resistance management, comprising expressing in the plant at least two different insecticidal proteins having different modes of action, wherein one of the at least two insecticidal proteins comprises the insecticidal polypeptide of claim 31 and one of the at least two insecticidal proteins comprises a Cry protein insecticidal to insects in the order Lepidoptera and/or Hemiptera.
44. A means for effective Lepidoptera and/or Hemiptera insect resistance management, comprising co-expressing at high levels in transgenic plants two or more insecticidal proteins toxic to Lepidoptera and/or Hemiptera insects but each exhibiting a different mode of effectuating its inhibiting growth or killing activity, wherein the two or more insecticidal proteins are selected from the insecticidal polypeptide of claim 31 and a Cry protein.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US17/805,704 US20220389445A1 (en) | 2012-07-02 | 2022-06-07 | Novel insecticidal proteins and methods for their use |
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201261667039P | 2012-07-02 | 2012-07-02 | |
US13/792,861 US9688730B2 (en) | 2012-07-02 | 2013-03-11 | Insecticidal proteins and methods for their use |
US15/602,900 US10655143B2 (en) | 2012-07-02 | 2017-05-23 | Insecticidal proteins and methods for their use |
US16/813,357 US20200270630A1 (en) | 2012-07-02 | 2020-03-09 | Novel insecticidal proteins and methods for their use |
US17/805,704 US20220389445A1 (en) | 2012-07-02 | 2022-06-07 | Novel insecticidal proteins and methods for their use |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US16/813,357 Continuation US20200270630A1 (en) | 2012-07-02 | 2020-03-09 | Novel insecticidal proteins and methods for their use |
Publications (1)
Publication Number | Publication Date |
---|---|
US20220389445A1 true US20220389445A1 (en) | 2022-12-08 |
Family
ID=49779797
Family Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/792,861 Active 2035-06-29 US9688730B2 (en) | 2012-07-02 | 2013-03-11 | Insecticidal proteins and methods for their use |
US15/602,900 Active 2034-01-12 US10655143B2 (en) | 2012-07-02 | 2017-05-23 | Insecticidal proteins and methods for their use |
US16/813,357 Abandoned US20200270630A1 (en) | 2012-07-02 | 2020-03-09 | Novel insecticidal proteins and methods for their use |
US17/805,704 Pending US20220389445A1 (en) | 2012-07-02 | 2022-06-07 | Novel insecticidal proteins and methods for their use |
Family Applications Before (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/792,861 Active 2035-06-29 US9688730B2 (en) | 2012-07-02 | 2013-03-11 | Insecticidal proteins and methods for their use |
US15/602,900 Active 2034-01-12 US10655143B2 (en) | 2012-07-02 | 2017-05-23 | Insecticidal proteins and methods for their use |
US16/813,357 Abandoned US20200270630A1 (en) | 2012-07-02 | 2020-03-09 | Novel insecticidal proteins and methods for their use |
Country Status (7)
Country | Link |
---|---|
US (4) | US9688730B2 (en) |
CN (1) | CN104968672A (en) |
AR (2) | AR092343A1 (en) |
BR (2) | BR112015000023B1 (en) |
CA (1) | CA2878263A1 (en) |
MX (1) | MX2015000231A (en) |
WO (1) | WO2014008054A2 (en) |
Families Citing this family (83)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
ES2776730T3 (en) | 2013-09-13 | 2020-07-31 | Pioneer Hi Bred Int | Insecticidal proteins and methods for their use |
RU2021113662A (en) | 2014-02-07 | 2021-05-31 | Пайонир Хай-Бред Интернэшнл, Инк. | INSECTICIDE PROTEINS AND METHODS OF THEIR APPLICATION |
WO2015130890A1 (en) | 2014-02-28 | 2015-09-03 | E. I. Du Pont De Nemours And Company | Synthetic salt complexes for improvement of plant growth and yield |
WO2015130893A1 (en) | 2014-02-28 | 2015-09-03 | E. I. Du Pont De Nemours And Company | Synthetic oligoglucosamines for improvement of plant growth and yield |
WO2015134256A1 (en) | 2014-02-28 | 2015-09-11 | E. I. Du Pont De Nemours And Company | Combinatorial libraries |
CN106133142B (en) | 2014-03-28 | 2020-10-30 | 孟山都技术公司 | Insecticidal toxin proteins having activity against coleopteran insects |
CR20210268A (en) | 2014-10-16 | 2021-07-14 | Monsanto Technology Llc | Novel chimeric insecticidal proteins toxic or inhibitory to lepidopteran pests |
WO2016061392A1 (en) | 2014-10-16 | 2016-04-21 | Monsanto Technology Llc | Proteins toxic or inhibitory to lepidopteran insects |
WO2016061377A2 (en) | 2014-10-16 | 2016-04-21 | Monsanto Technology Llc | Lepidopteran-active cry1da1 amino acid sequence variant proteins |
US10487123B2 (en) | 2014-10-16 | 2019-11-26 | Monsanto Technology Llc | Chimeric insecticidal proteins toxic or inhibitory to lepidopteran pests |
EP3207143B1 (en) | 2014-10-16 | 2023-11-22 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
US11130964B2 (en) | 2014-11-20 | 2021-09-28 | Monsanto Technology Llc | Insect inhibitory proteins |
BR122020006739B1 (en) | 2014-11-20 | 2024-01-23 | Monsanto Technology Llc | EXPRESSION CASSETTE, BACTERIAL HOST CELL, INSECT INHIBITORY COMPOSITION, METHOD FOR CONTROLING A PEST OF COLEOPTERA SPECIES, AND RECOMBINANT VECTOR |
CN114075267A (en) * | 2015-01-15 | 2022-02-22 | 先锋国际良种公司 | Insecticidal proteins and methods of use thereof |
EP3244739A4 (en) * | 2015-01-16 | 2018-07-11 | Valent Biosciences Llc | Synergistic bacillus thuringiensis subsp. aizawai, bacillus thuringiensis subsp. kurstaki and chlorantraniliprole mixtures |
GB201501941D0 (en) | 2015-02-05 | 2015-03-25 | British American Tobacco Co | Method |
CN108064303A (en) * | 2015-03-11 | 2018-05-22 | 先锋国际良种公司 | It is structure-based to be used to modify PIP-72 polypeptides and the method by its derivative PIP-72 polypeptide |
MX2017011525A (en) * | 2015-03-11 | 2018-01-30 | Pioneer Hi Bred Int | Insecticidal combinations of pip-72 and methods of use. |
BR112017024948A2 (en) | 2015-05-19 | 2018-07-31 | Pioneer Hi Bred Int | insecticide proteins and methods for their use |
BR102016012010A2 (en) | 2015-05-29 | 2020-03-24 | Dow Agrosciences Llc | NUCLEIC ACID, RIBONUCLEIC ACID (RNA) AND DOUBLE-FILAMENT RIBONUCLEIC ACID (DSRNA) MOLECULE, CELL, PLANT AND SEED USES, PRIMARY PRODUCT, AS WELL AS METHODS TO CONTROL A POPULATION OF HOLIDAYS, OR HOSPITALS, OR HOSPITALS, OR HOSPITALS, OR HOSPITALS THE INCOME OF A CULTURE, AND TO PRODUCE A TRANSGENIC VEGETABLE CELL AND A TRANSGENIC PLANT |
WO2016205445A1 (en) | 2015-06-16 | 2016-12-22 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
US11198709B2 (en) | 2015-08-06 | 2021-12-14 | E. I. Du Pont De Nemours And Company | Plant derived insecticidal proteins and methods for their use |
ES2892627T3 (en) | 2015-08-27 | 2022-02-04 | Monsanto Technology Llc | Novel insect inhibitory proteins |
EP3353308A4 (en) * | 2015-09-25 | 2019-06-12 | Dow AgroSciences LLC | Shibire/dynamin nucleic acid molecules to control coleopteran and hemipteran pests |
AR106309A1 (en) | 2015-10-12 | 2018-01-03 | Pioneer Hi Bred Int | COMPOSITION THAT INCLUDES AN ENTOMOPATHOGENIC Fungal strain for PEST CONTROL IN PLANTS |
JP6737885B2 (en) | 2015-11-18 | 2020-08-12 | プロヴィヴィ インコーポレイテッド | Microorganisms and related compounds for the production of insect pheromones |
CN108575091A (en) * | 2015-12-18 | 2018-09-25 | 先锋国际良种公司 | Insecticidal protein and its application method |
EP3394269A2 (en) * | 2015-12-22 | 2018-10-31 | AgBiome, Inc. | Pesticidal genes and methods of use |
MX2018012025A (en) * | 2016-04-14 | 2019-02-07 | Pioneer Hi Bred Int | Insecticidal polypeptides having improved activity spectrum and uses thereof. |
CA3018384A1 (en) | 2016-05-04 | 2017-11-09 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
CA3023483C (en) | 2016-05-16 | 2024-01-16 | Danisco Us Inc. | Entomopathogenic products, metarhizium anisopliae or metarhizium robertsii |
JP2019517797A (en) | 2016-06-06 | 2019-06-27 | プロヴィヴィ インコーポレイテッド | Semibiosynthetic production of fatty alcohols and fatty aldehydes |
CN109312359A (en) | 2016-06-16 | 2019-02-05 | 先锋国际良种公司 | To prevent and treat the composition and method of insect pest |
WO2018005411A1 (en) | 2016-07-01 | 2018-01-04 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins from plants and methods for their use |
WO2018013333A1 (en) | 2016-07-12 | 2018-01-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
CN109788736B (en) * | 2016-08-09 | 2022-05-27 | 先正达参股股份有限公司 | Insecticidal proteins |
CN110088123B (en) * | 2016-12-14 | 2023-10-20 | 先锋国际良种公司 | Insecticidal proteins and methods of use thereof |
WO2018118811A1 (en) | 2016-12-22 | 2018-06-28 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
EP3342780A1 (en) | 2016-12-30 | 2018-07-04 | Dow AgroSciences LLC | Pre-mrna processing factor 8 (prp8) nucleic acid molecules to control insect pests |
WO2018128986A1 (en) * | 2017-01-03 | 2018-07-12 | Monsanto Technology Llc | Microbial compositions and methods |
US20190320661A1 (en) * | 2017-01-03 | 2019-10-24 | Monsanto Technology, Llc | Microbial compositions and methods |
US10465205B2 (en) * | 2017-04-03 | 2019-11-05 | Monsanto Technology Llc | Insect inhibitory proteins |
CN106905421B (en) * | 2017-04-06 | 2020-10-09 | 中国农业科学院植物保护研究所 | Novel insecticidal protein and nucleotide sequence thereof |
BR112019023628A2 (en) | 2017-05-11 | 2020-06-02 | Pioneer Hi-Bred International, Inc. | RECOMBINANT INSECTICIDE POLYPEPIDE, CHEMICAL INSECTICIDE PROTEIN, FUSION PROTEIN, AGRICULTURAL COMPOSITION, RECOMBINANT POLYNUCLEOTIDE, DNA BUILDING, TRANSGENIC PLANT, METHOD OF INHIBITING THE AGGREGATION OR EXERCISING AGAINST EXERCISE OR EXERCISE , METHOD TO CONTROL PEST INFESTATION AND METHOD TO IMPROVE THE PERFORMANCE OF A CULTURE |
CN110914442A (en) | 2017-05-17 | 2020-03-24 | 普罗维维股份有限公司 | Microorganisms for the production of insect pheromones and related compounds |
WO2018217333A1 (en) | 2017-05-26 | 2018-11-29 | Pioneer Hi-Bred International, Inc. | Insecticidal polypeptides having improved activity spectrum and uses thereof |
CN107602678B (en) * | 2017-09-21 | 2021-03-05 | 福建省农业科学院农业生物资源研究所 | Acetamiprid-coupled Bt insecticidal toxin and preparation method and application thereof |
WO2019074598A1 (en) | 2017-10-13 | 2019-04-18 | Pioneer Hi-Bred International, Inc. | Virus-induced gene silencing technology for insect control in maize |
CA3082256A1 (en) * | 2017-11-09 | 2019-05-16 | Dow Agrosciences Llc | Hemipteran active insecticidal protein |
CN109813667A (en) * | 2017-11-18 | 2019-05-28 | 镇江亿特生物科技发展有限公司 | Ethiprole content uv-spectrophotometric detection method |
US20200359619A1 (en) | 2018-01-18 | 2020-11-19 | Pioneer Hi-Bred International, Inc. | Alginate encapsulation of fungal microsclerotia |
AR115359A1 (en) * | 2018-01-29 | 2021-01-13 | Lavie Bio Ltd | MICROBIAL PREPARATIONS FOR PLANTS, COMPOSITIONS AND FORMULATIONS THAT INCLUDE THEM AND THEIR USES |
CN110144301B (en) * | 2018-02-10 | 2022-04-01 | 河南农业大学 | Pseudomonas chlororaphis and culture method and application thereof |
CN110144361A (en) * | 2018-02-11 | 2019-08-20 | 中国种子集团有限公司 | The anti-stick worm new application of Cry1Ab/Cry1AcZM gene |
EP3755797A1 (en) | 2018-02-22 | 2020-12-30 | Zymergen, Inc. | Method for creating a genomic library enriched for bacillus and identification of novel cry toxins |
US20210002657A1 (en) | 2018-03-02 | 2021-01-07 | Pioneer Hi-Bred International, Inc. | Plant health assay |
KR20200127180A (en) * | 2018-03-02 | 2020-11-10 | 지머젠 인코포레이티드 | Pesticide protein discovery platform and insecticidal proteins found therefrom |
CN110540995B (en) * | 2018-05-28 | 2023-01-10 | 南京农业大学 | Myosin-5 protein reduction and application thereof in cyanoacrylate drug resistance treatment |
EP3844283A1 (en) | 2018-08-29 | 2021-07-07 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
US20220056469A1 (en) * | 2018-09-11 | 2022-02-24 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
US20230183734A1 (en) * | 2018-10-10 | 2023-06-15 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
CN109258695A (en) * | 2018-10-18 | 2019-01-25 | 江苏师范大学 | Application of the Pseudomonas chlororaphis in prevention and treatment nematode |
CN109355275B (en) * | 2018-11-21 | 2021-08-20 | 中山大学 | Beta-glucosidase mutant with high thermal stability and application thereof |
CN109456954B (en) * | 2018-11-21 | 2021-08-20 | 中山大学 | Beta-glucosidase mutant with improved thermal stability and application thereof |
WO2020123242A1 (en) | 2018-12-14 | 2020-06-18 | Pioneer Hi-Bred International, Inc. | Biologicals and their use in plants |
CN111714519B (en) * | 2019-03-22 | 2023-11-24 | 中国科学院海洋研究所 | Application and composition of organic solvent extract of sea cockroach |
WO2021076346A1 (en) | 2019-10-18 | 2021-04-22 | Pioneer Hi-Bred International, Inc. | Maize event dp-202216-6 and dp-023211-2 stack |
CN111171118B (en) * | 2019-12-23 | 2021-08-06 | 隆平生物技术(海南)有限公司 | Plant insect-resistant gene mCry2Ab, and vector and application thereof |
CN110903361B (en) * | 2019-12-24 | 2021-08-06 | 隆平生物技术(海南)有限公司 | Plant insect-resistant gene mVip3Aa, and vector and application thereof |
TW202142114A (en) | 2020-02-04 | 2021-11-16 | 美商陶氏農業科學公司 | Compositions having pesticidal utility and processes related thereto |
US20230235352A1 (en) * | 2020-07-14 | 2023-07-27 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
CN116096903A (en) | 2020-08-10 | 2023-05-09 | 先锋国际良种公司 | Plant regulating element and method of use thereof |
CN111965353B (en) * | 2020-08-18 | 2022-08-19 | 四川农业大学 | Application of psoroptes ovis cysteine protease inhibitor and ELISA kit |
WO2022125639A1 (en) | 2020-12-08 | 2022-06-16 | Monsanto Technology Llc | Modified plant-associated bacteria and methods of their use |
AR124445A1 (en) | 2020-12-21 | 2023-03-29 | Monsanto Technology Llc | NOVEL INSECT INHIBITOR PROTEINS |
UY39585A (en) | 2020-12-23 | 2022-07-29 | Monsanto Technology Llc | PROTEINS THAT EXHIBIT INSECT INHIBITOR ACTIVITY AGAINST PESTS OF AGRICULTURAL IMPORTANCE OF CROP PLANTS AND SEEDS |
CA3206691A1 (en) | 2020-12-31 | 2022-07-07 | Monsanto Technology Llc | Novel insect inhibitory proteins |
CN116829163A (en) * | 2021-01-22 | 2023-09-29 | 先正达生物科技(中国)有限公司 | Control of nocturnal moth, meadow moth and borer moth pests |
CN113005131B (en) * | 2021-04-21 | 2023-03-10 | 山西大学 | SOD gene only containing Cu, encoded protein and application thereof |
CN113943720A (en) * | 2021-11-03 | 2022-01-18 | 江苏省农业科学院 | Apolygus lucorum GRK gene, dsRNA thereof, synthetic method and application thereof |
CN114908060B (en) * | 2022-05-12 | 2023-04-14 | 江南大学 | Hybridoma cell strain capable of secreting zoxamide monoclonal antibody and application of hybridoma cell strain |
TW202345696A (en) | 2022-05-18 | 2023-12-01 | 美商科迪華農業科技有限責任公司 | Compositions having pesticidal utility and processes related thereto |
WO2024044596A1 (en) * | 2022-08-23 | 2024-02-29 | AgBiome, Inc. | Pesticidal genes and methods of use |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5965428A (en) * | 1996-10-08 | 1999-10-12 | Ecogen, Inc. | Chimeric lepidopteran-toxic crystal proteins |
US6172184B1 (en) * | 1997-08-06 | 2001-01-09 | Cornell Research Foundation, Inc. | Hypersensitive response elicitor from Pseudomonas syringae and its use |
EP1756148A4 (en) | 2004-03-02 | 2007-09-26 | Dow Agrosciences Llc | Insecticidal toxin complex fusion proteins |
WO2006063075A2 (en) * | 2004-12-06 | 2006-06-15 | Fmc Corporation | Hemipteran octopamine receptor |
EP1920060B1 (en) * | 2005-08-31 | 2011-04-13 | Monsanto Technology LLC | Insecticidal compositions and methods for making insect-resistant transgenic plants |
UA112287C2 (en) * | 2009-12-16 | 2016-08-25 | ДАУ АГРОСАЙЄНСІЗ ЕлЕлСі | A TRANSGENIC PLANT CONTAINING DNA INVESTING THE CRY1C AND CRY1AB Insecticidal Protein for the Control of Common Wing Pests |
-
2013
- 2013-03-11 US US13/792,861 patent/US9688730B2/en active Active
- 2013-06-26 BR BR112015000023-1A patent/BR112015000023B1/en active IP Right Grant
- 2013-06-26 MX MX2015000231A patent/MX2015000231A/en unknown
- 2013-06-26 CA CA2878263A patent/CA2878263A1/en not_active Abandoned
- 2013-06-26 WO PCT/US2013/047760 patent/WO2014008054A2/en active Application Filing
- 2013-06-26 BR BR122022004006-3A patent/BR122022004006B1/en active IP Right Grant
- 2013-06-26 CN CN201380045688.9A patent/CN104968672A/en active Pending
- 2013-07-02 AR ARP130102361A patent/AR092343A1/en not_active Application Discontinuation
-
2017
- 2017-05-23 US US15/602,900 patent/US10655143B2/en active Active
-
2020
- 2020-03-09 US US16/813,357 patent/US20200270630A1/en not_active Abandoned
-
2022
- 2022-02-18 AR ARP220100349A patent/AR124918A2/en unknown
- 2022-06-07 US US17/805,704 patent/US20220389445A1/en active Pending
Also Published As
Publication number | Publication date |
---|---|
AR092343A1 (en) | 2015-04-15 |
US10655143B2 (en) | 2020-05-19 |
US20140007292A1 (en) | 2014-01-02 |
BR112015000023B1 (en) | 2023-02-28 |
AR124918A2 (en) | 2023-05-17 |
BR112015000023A2 (en) | 2017-08-01 |
WO2014008054A2 (en) | 2014-01-09 |
CA2878263A1 (en) | 2014-01-09 |
BR122022004006B1 (en) | 2022-10-04 |
US20200270630A1 (en) | 2020-08-27 |
WO2014008054A3 (en) | 2015-08-20 |
MX2015000231A (en) | 2015-11-16 |
US20170327546A1 (en) | 2017-11-16 |
US9688730B2 (en) | 2017-06-27 |
CN104968672A (en) | 2015-10-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20220389445A1 (en) | Novel insecticidal proteins and methods for their use | |
US11091771B2 (en) | PHI-4 polypeptides and methods for their use | |
US11697821B2 (en) | PHI-4 polypeptides and methods for their use | |
US11325949B2 (en) | Insecticidal proteins and methods for their use | |
US11780891B2 (en) | Insecticidal proteins and methods for their use | |
US10563221B2 (en) | Insecticidal proteins and methods for their use | |
US10294490B2 (en) | Insecticidal proteins and methods for their use |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: PIONEER HI-BRED INTERNATIONAL, INC., IOWA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CERF, DAVID C;ENGLISH, JAMES J;HENDRICK, CAROL A;AND OTHERS;SIGNING DATES FROM 20130403 TO 20130410;REEL/FRAME:060118/0304 |
|
STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |