CN113005131B

CN113005131B - SOD gene only containing Cu, encoded protein and application thereof

Info

Publication number: CN113005131B
Application number: CN202110427907.6A
Authority: CN
Inventors: 吴海花; 刘静; 张学尧; 张建珍; 马恩波
Original assignee: Shanxi University
Current assignee: Shanxi University
Priority date: 2021-04-21
Filing date: 2021-04-21
Publication date: 2023-03-10
Anticipated expiration: 2041-04-21
Also published as: CN113005131A

Abstract

The invention belongs to the field of genetic engineering, and particularly relates to an SOD gene only containing Cu, a coded protein and application thereof. The gene is derived from a Chinese rice locust and is named as a Cu-only SOD gene, the nucleotide sequence of the gene is a sequence shown by SEQ ID NO. 1, the amino acid sequence of the coded protein is a sequence shown by SEQ ID NO. 2, and the protein is superoxide dismutase. The gene sequence is cloned by a gene cloning technology, and the spatial structure of the protein is simulated based on the amino acid sequence, so that the protein is found to lack a Zn atom and only contain one Cu atom, which is the Cu-only SOD existing in cells for the first time. A prokaryotic expression vector is constructed by utilizing a genetic engineering technology, separation and purification of protein are carried out, and the function of the protein is researched in vitro, so that the protein has an antioxidant function.

Description

SOD gene only containing Cu, encoded protein and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to an SOD gene only containing Cu, a coded protein and application thereof.

Background

Superoxide dismutase (SOD) is a metalloproteinase widely existing in living body, and can scavenge Superoxide anion free radical (. O.) generated in biological oxidation process ^2- ) It is one of the important antioxidant enzymes for the organism to effectively eliminate active oxygen, and is called the first line of defense of the organism antioxidant system. Researches find that SOD plays an important role in aging and death of human bodies, the occurrence and development of a plurality of diseases are closely related to SOD, and the purposes of preventing and treating various diseases and delaying aging can be achieved by supplementing SOD. SOD plays an important biological role in various environmental stresses, such as resistance to oxidative stress caused by heavy metals, chemical pollutants, temperature, moisture, salt, radiation, etc. SOD is widely used in food, cosmetics, daily necessities, disease treatment, etc., and therefore, the role of SOD in biological oxidation resistance is more and more important.

SOD can be classified into CuZnSOD, mnSOD, feSOD and NiSOD according to the kind of metal ion combined with SOD. CuZnSOD consists of two identical subunits which are associated with each other through non-covalent hydrophobic interaction, and intramolecular disulfide bonds formed inside peptide chains play an important role in subunit association. Each subunit active center comprises a Cu atom and a Zn atom, wherein the Cu is involved in electron transfer and is necessary for CuZnSOD activity, and the Zn is related to the maintenance of the active center conformation, is not directly acted with superoxide anion free radicals and plays a role in stabilizing the environment around the active center.

In recent years, more and more CuZnSOD genes and proteins encoded by them have been discovered, but SOD genes containing only Cu are few. The invention discloses SOD gene only containing Cu and protein thereof in Chinese rice locust. Whether the protein still has the function of removing free radicals or not is found by using the gene engineering technology to express, separate and purify the protein in vitro, researching the function of the protein and finding that the protein has the antioxidant function.

Disclosure of Invention

The invention provides an SOD gene only containing Cu, a coded protein and application thereof aiming at the problems.

In order to achieve the purpose, the invention adopts the following technical scheme:

the SOD gene only containing Cu provided by the invention is derived from Chinese rice locust and is named as Cu-only SOD, and the gene sequence of the Cu-only SOD is shown as SEQ ID NO. 1. The gene sequence takes the cDNA of the Chinese rice locust as a template, partial fragments are obtained through degenerate primers, then the full length is obtained through an RACE-PCR method, and finally, the specific primers are utilized to carry out PCR amplification and clone sequencing to verify the full length sequence.

The protein coded by the Cu-only SOD gene has an amino acid sequence shown in SEQ ID NO:2, the protein is superoxide dismutase and has an antioxidant function.

A carrier containing the Cu-only SOD gene is a prokaryotic cell expression carrier.

Further, the prokaryotic cell expression vector is a pCold I expression vector.

A gene engineering cell containing the Cu-only SOD gene is an Escherichia coli cell.

The application of the protein coded by the Cu-only SOD gene is applied to preparing products for scavenging free radicals.

Compared with the prior art, the invention has the following advantages:

CuZnSOD consists of two identical subunits, each subunit active center comprising one Cu atom and one Zn atom. The invention discovers an SOD gene only containing Cu and a protein thereof in a Chinese rice locust body, wherein the protein lacks a Zn atom and only contains a Cu atom. The protein is found to have antioxidant activity by functional research. The protein is intracellular Cu-only SOD, and intracellular SOD only containing Cu is not reported in any species.

The SOD containing only Cu has the oxidation resistance and SOD characteristic, can be applied to the industries of medicine, food, cosmetics, health care products and the like, and has wide market application prospect.

Drawings

FIG. 1 shows the primer design of Cu-only SOD gene in example 1;

FIG. 2 is a gel electrophoresis diagram of PCR products for full-length verification of Cu-only SOD gene in example 1;

FIG. 3 is a schematic diagram showing the primary structure of the translated amino acid sequence of the Cu-only SOD gene in example 1;

FIG. 4 is a schematic diagram showing the spatial structure of Cu-only SOD protein in example 2;

FIG. 5 is a diagram showing the functional verification of the Cu-only SOD protein in example 5.

Detailed Description

Example 1: obtaining of Chinese rice locust Cu-only SOD gene sequence

1. Obtaining the sequence of conserved region of Cu-only SOD gene of Chinese rice locust

Degenerate primers were designed based on published CuZnSOD gene sequences of other insect species, the positions and lengths of which are shown in FIG. 1, and the primers were synthesized by Biotechnology engineering (Shanghai) GmbH, and the sequences of which are shown below:

the sequence of the upstream primer is shown as SEQ ID NO:3, showing:

TTYCAYGTNCAYGARTTYGG；

the sequence of the downstream primer is shown as SEQ ID NO:4, showing:

CKNGCNCCNGCRTTNCC；

selecting 5 nymphs of 5-instar nymphs of Chinese rice locusts with good activity and uniform size (the nymphs are raised in a field collection 4-instar nymph laboratory to 5-instar nymphs), quickly freezing in liquid nitrogen, and storing at low temperature of-80 ℃. Total RNA of the whole locust of Oryza sativa was extracted according to the method described in the instructions of Trizol kit (TaKaRa Co.). The total RNA was reverse-transcribed into cDNA using M-MLV reverse transcriptase (TaKaRa Co.). Using this as a template, a degenerate primer (FIG. 1) synthesized was used to perform PCR amplification by a PCR amplification apparatus, and a sequence fragment of the conserved region of the Cu-only SOD gene was obtained by ligation, transformation and sequencing.

2. The 5 'and 3' sequences of the Chinese rice locust Cu-only SOD gene

3 'and 5' RACE specific primers (FIG. 1) synthesized by Biotechnology engineering (Shanghai) Co., ltd were designed from the obtained conserved region fragments, and the primer sequences thereof are shown below:

the sequence of the upstream primer is shown as SEQ ID NO: and 5, as follows:

AGACCACAACGTCATTGGCCGCAC；

the sequence of the downstream primer is shown as SEQ ID NO:6, showing:

TTCCCAGGTCGTCAGGGTCA；

according to

mRNA Isolation Systems kit (Promega corporation) instructions for mRNA Isolation. 5 'and 3' -RACE-Ready cDNAs were synthesized according to the SMARTTM RACE cDNA Amplification kit (Promega Co.) instructions. According to the following

Amplification reaction system and reaction conditions according to 2 Polymerase (Promega corporation) instructions for amplification of cDNA sequences at 5 'and 3' ends of Cu-only SOD gene, ligation, transformation, and sequencing were performed to obtain 5 'and 3' end sequences of Cu-only SOD gene.

3. Verification of full-length sequence of Chinese rice locust Cu-only SOD gene

Splicing the sequences of the conserved region, 5 'end and 3' end of the obtained Cu-only SOD gene, and designing a specific primer for verifying the full-length sequence, wherein the sequence is shown as follows:

the sequence of the upstream primer is shown as SEQ ID NO:7, and (c):

TTATATTTCAGACATGACTATYAAAGCAG；

the sequence of the downstream primer is shown as SEQ ID NO:8, showing:

CGCCTTCATGCCTTGGCAATGCCGATCA；

PCR amplification is carried out by a PCR amplification instrument, gel electrophoresis detection is carried out (figure 2), and then connection, transformation and sequencing are carried out to verify the full-length sequence of the Cu-only SOD gene, wherein the sequence is SEQ ID NO:1. The Cu-only SOD gene sequence of the locust of the Oryza sativa was translated into an amino acid sequence, SEQ ID NO:2, using ExPASY-Translate tool (https:// www.expass.org/Translate), which encodes 131 amino acids. The signature sequence and N-glycosylation site of Cu-only SOD protein were predicted by PROSITE database (http:// position. Expasy. Org/scan position /) and NetNGlyc 1.0 Server (http:// www. Cbs. Dtu. Dk/services/NetNGlyc /), respectively, and the protein contained 2 signature sequences, 4 Cu binding sites, 2 Zn binding sites, and no glycosylation site (FIG. 3).

Example 2: spatial structure simulation of Chinese rice locust Cu-only SOD protein

The spatial structure of Cu-only SOD protein of rice planthopper was simulated by using SWISS-MODEL software (http:// www.swissnodel. Expasy.org /) and silkworm CuZnSOD protein (PDB IDs:319y.1. A) as templates. The spatial structure shows that the protein does not include Zn atom, only includes one Cu atom, and includes 6 antiparallel beta-folds and 2 alpha helices (fig. 4).

Experimental example 3: construction of Cu-only SOD protein recombinant expression vector of Chinese rice locust

Designing protein expression primers with upstream BamH I and downstream Hind III enzyme cutting sites according to the verified full-length sequence, and extracting plasmids from bacterial liquid with sequenced confirmed full-length sequence. Carrying out PCR amplification by using a plasmid as a template and a protein expression primer with a restriction enzyme cutting site, carrying out gel recovery by cutting gel after electrophoresis detection on an amplification product, connecting the recovered product to a pEASY-T3 vector (whole-system gold company), transforming the vector into an escherichia coli competent cell Trans-T1 (whole-system gold company), coating the escherichia coli competent cell Trans-T1 vector on an LB solid medium plate containing 100mM IPTG, 20ng/mL X-gal and 100 mu g/mL ampicillin, carrying out overnight culture at 37 ℃, and carrying out blue white spot screening. The white spots were picked up and inoculated into LB liquid medium containing 100. Mu.g/mL ampicillin, cultured overnight at 37 ℃ and sequenced by Biotechnology engineering (Shanghai) Ltd to confirm the correctness of the sequence.

Extracting plasmid from bacterial liquid of sequencing confirmed sequence, cutting plasmid with target gene and pCold I protein expression vector with BamH I and Hind III endonuclease (NEB company), detecting cut product by electrophoresis, cutting gel and recovering gel. The digested target gene was ligated with a protein expression vector using T4 ligase (whole-plant gold) to construct a recombinant plasmid, which was then transformed into E.coli competent cells Trans-T1 (whole-plant gold) and plated on LB solid medium plate containing 100. Mu.g/mL ampicillin, and cultured overnight at 37 ℃. Positive clones were picked and inoculated into LB liquid medium containing 100. Mu.g/mL ampicillin, cultured overnight at 37 ℃ and sequenced by Biotechnology engineering (Shanghai) Ltd to confirm the correctness of the sequence.

Recombinant plasmids were extracted from the sequencing-confirmed sequence-containing bacterial suspension, transformed into competent cells BL21 (DE 3) (King Korea), plated on LB solid medium plates containing 100. Mu.g/mL ampicillin, and cultured overnight at 37 ℃, and positive clones were selected and inoculated into LB liquid medium containing 100. Mu.g/mL ampicillin and cultured overnight at 37 ℃.

Example 4: prokaryotic expression and purification of Chinese rice locust Cu-only SOD protein

1. Prokaryotic expression and identification of Chinese rice locust Cu-only SOD protein

50 μ L of a bacterial solution obtained by transferring the recombinant plasmid of the target gene into BL21 (DE 3) competent cells was cultured in 5mL of a fresh LB liquid medium containing 100 μ g/mL ampicillin at 37 ℃ until the bacterial solution OD was reached ₆₀₀ When the concentration is 0.6, IPTG is added to the mixture to a final concentration of 0.4mM, and the mixture is subjected to low-temperature induction at a temperature of 16 ℃ and a speed of 200rpm, and the expression of the target protein is induced for 14 hours.

The induced cells were collected by centrifugation in a cryo-centrifuge, and the cells were disrupted with 20mM Tris-HCl (pH 8.0) lysate containing 0.1M NaCl and 5% glycerol, sonicated on ice, centrifuged at 12000g for 10min at 4 ℃ to collect the supernatant. Preparing polyacrylamide gel of 5% concentrated gel and 12% separating gel, denaturing the collected supernatant at 95 ℃, loading, electrophoresing, photographing, and identifying an electrophoresis strip on the gel to obtain the Cu-only SOD protein.

2. Separation and purification of Cu-only SOD protein from Chinese rice locust

500mL of the cell suspension was induced according to the method in step 1 of example 4, and the cells were collected by centrifugation, disrupted by ultrasonication on ice, and centrifuged at low temperature to collect the supernatant. The supernatant was washed with 20ml of NaCl ²⁺ Column purification, 100mM imidazole washRemoving and collecting the eluent. Dialyzing the eluate with 2mM Tris-HCl (pH 8.0) buffer solution at 4 deg.C overnight, and concentrating at low temperature with ultrafiltration centrifugal tube to obtain purified protein. The protein content is 2.0mg/mL, and the activity is 25.2U/mg protein.

Example 5: functional verification of Chinese rice locust Cu-only SOD protein

LB solid medium plates without antibiotics were prepared. The plate was preheated at 37 ℃ for 30min, 150. Mu.L of the protein purified in step 2 of example 4 was dropped on the plate, an equal volume of 2mM Tris-HCl (pH 8.0) buffer was dropped on the control plate, and the plate was spread uniformly and placed in a 37 ℃ incubator for 30min to allow the liquid to be absorbed sufficiently. Set up 3 biological replicates. Then 100. Mu.L of Escherichia coli was dropped on the plate, spread uniformly, and cultured in an incubator at 37 ℃ for 1 hour. Finally, two pieces of sterilized filter paper with the diameter of 6mm are placed in the flat plate, 8 mu L of 5% and 15% hydrogen peroxide solutions are respectively dripped on the filter paper, the flat plate is firstly placed in an incubator at 37 ℃ upright for 1 hour, and then the flat plate is placed upside down for overnight culture. The plate was scanned with a scanner and the diameter of the zone was measured with a ruler for statistical analysis (fig. 5). The result shows that the diameter of the inhibition zone of the added purified Cu-only SOD protein is obviously smaller than that of a control group under the stress of 15% hydrogen peroxide, and the Cu-only SOD protein has an antioxidant function.

。

Sequence listing

<110> university of Shanxi

<120> SOD gene containing only Cu, encoded protein and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 396

<212> DNA

<213> locust of China rice (Oxya chinensis)

<400> 1

atgactatta aagcagtttg cgtgctgaac ggtgaacagg tgaaaggaac agttcacttt 60

gagcaagagg gtgcgaattc tcctgttaaa gtaactggag aaataactgg cttgacaaag 120

ggtctgcatg gtttccatgt acatgaattt ggtgataaca caaacggctg catgagtgcg 180

ggtgcacatt tcaacccaca cagcaaggac cacgcaggcc ccgaggattc ggacaagatt 240

atctctctca ccggagacca caacgtcatt ggccgcactc ttgtggtgca cgctgaccct 300

gacgacctgg gacgtggtgg acacgagctg agcaagacga ctggcaatgc cggggcgcgc 360

gtcgcctgtg gggtgatcgg cattgccaag gcatga 396

<210> 3

<211> 131

<212> PRT

<213> locust of China rice (Oxya chinensis)

<400> 3

Met Thr Ile Lys Ala Val Cys Val Leu Asn Gly Glu Gln Val Lys Gly

1 5 10 15

Thr Val His Phe Glu Gln Glu Gly Ala Asn Ser Pro Val Lys Val Thr

20 25 30

Gly Glu Ile Thr Gly Leu Thr Lys Gly Leu His Gly Phe His Val His

35 40 45

Glu Phe Gly Asp Asn Thr Asn Gly Cys Met Ser Ala Gly Ala His Phe

50 55 60

Asn Pro His Ser Lys Asp His Ala Gly Pro Glu Asp Ser Asp Lys Ile

65 70 75 80

Ile Ser Leu Thr Gly Asp His Asn Val Ile Gly Arg Thr Leu Val Val

85 90 95

His Ala Asp Pro Asp Asp Leu Gly Arg Gly Gly His Glu Leu Ser Lys

100 105 110

Thr Thr Gly Asn Ala Gly Ala Arg Val Ala Cys Gly Val Ile Gly Ile

115 120 125

Ala Lys Ala

130

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttycaygtnc aygarttygg 20

<210> 4

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ckngcnccng crttncc 17

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agaccacaac gtcattggcc gcac 24

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttcccaggtc gtcagggtca 20

<210> 7

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ttatatttca gacatgacta tyaaagcag 29

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgccttcatg ccttggcaat gccgatca 28

Claims

1. An SOD gene only containing Cu, which is characterized in that the gene is derived from a Chinese rice locust and has a sequence shown as SEQ ID NO:1 is shown.

2. A protein encoded by the gene of claim 1, wherein the protein has an amino acid sequence as set forth in SEQ ID NO:2, the protein is superoxide dismutase.

3. A vector containing the gene of claim 1, wherein the vector is a prokaryotic expression vector.

4. The vector of claim 3, wherein the prokaryotic expression vector is a pCold I expression vector.

5. A genetically engineered cell comprising the gene of claim 1, wherein the genetically engineered cell is Escherichia coli (E. Coli: (E. Coli) (E. Coli))Escherichia coli ) A cell.

6. Use of a protein according to claim 2 for the preparation of a free radical scavenging product.