US20210205428A1 - Tumor cell vaccines - Google Patents

Tumor cell vaccines Download PDF

Info

Publication number
US20210205428A1
US20210205428A1 US17/109,757 US202017109757A US2021205428A1 US 20210205428 A1 US20210205428 A1 US 20210205428A1 US 202017109757 A US202017109757 A US 202017109757A US 2021205428 A1 US2021205428 A1 US 2021205428A1
Authority
US
United States
Prior art keywords
cell lines
modified
expression
cancer
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US17/109,757
Other languages
English (en)
Inventor
Bernadette Ferraro
Justin James Arndt
Todd Merrill Binder
Aleksandr Dolgoter
Matthias Hundt
Amritha Balakrishnan Lewis
Kendall M. Mohler
Daniel Lee Shawler
Jian Yan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Neuvogen Inc
Original Assignee
Neuvogen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Neuvogen Inc filed Critical Neuvogen Inc
Priority to US17/109,757 priority Critical patent/US20210205428A1/en
Priority to US17/212,372 priority patent/US20210252122A1/en
Publication of US20210205428A1 publication Critical patent/US20210205428A1/en
Assigned to NEUVOGEN, INC. reassignment NEUVOGEN, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: Hundt, Matthias, Binder, Todd Merrill, DOLGOTER, Aleksandr, Shawler, Daniel Lee, Arndt, Justin James, Lewis, Amritha Balakrishnan, YAN, JIAN, FERRARO, BERNADETTE, MOHLER, KENDALL M.
Priority to US17/396,033 priority patent/US11369668B1/en
Priority to US17/726,295 priority patent/US11684659B2/en
Priority to US18/318,033 priority patent/US20230414733A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001154—Enzymes
    • A61K39/001157—Telomerase or TERT [telomerase reverse transcriptase]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001166—Adhesion molecules, e.g. NRCAM, EpCAM or cadherins
    • A61K39/001168—Mesothelin [MSLN]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001184—Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5152—Tumor cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5156—Animal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/80—Vaccine for a specifically defined cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/13—Tumour cells, irrespective of tissue of origin

Definitions

  • Cancer is a leading cause of death.
  • Therapeutic cancer vaccines have the potential to generate anti-tumor immune responses capable of eliciting clinical responses in cancer patients, but many of these therapies have a single target or are otherwise limited in scope of immunomodulatory targets and/or breadth of antigen specificity.
  • the development of a therapeutic vaccine customized for an indication that targets the heterogeneity of the cells within an individual tumor remains a challenge.
  • a vast majority of therapeutic cancer vaccine platforms are inherently limited in the number of antigens that can be targeted in a single formulation.
  • the lack of breadth in these vaccines adversely impacts efficacy and can lead to clinical relapse through a phenomenon called antigen escape, with the appearance of antigen-negative tumor cells. While these approaches may somewhat reduce tumor burden, they do not eliminate antigen-negative tumor cells or cancer stem cells. Harnessing a patient's own immune system to target a wide breadth of antigens could reduce tumor burden as well as prevent recurrence through the antigenic heterogeneity of the immune response. Thus, a need exists for improved whole cell cancer vaccines. Provided herein are methods and compositions that address this need.
  • the present disclosure provides an allogeneic whole cell cancer vaccine platform that includes compositions and methods for treating and preventing cancer.
  • the present disclosure provides compositions and methods that are customizable for the treatment of various solid tumor indications and target the heterogeneity of the cells within an individual tumor.
  • the compositions and methods of embodiments of the present disclosure are broadly applicable across solid tumor indications and to patients afflicted with such indications.
  • the present disclosure provides compositions of cancer cell lines that (i) are modified as described herein and (ii) express a sufficient number and amount of tumor associated antigens (TAAs) such that, when administered to a subject afflicted with a cancer, cancers, or cancerous tumor(s), a TAA-specific immune response is generated.
  • TAAs tumor associated antigens
  • a composition comprising a therapeutically effective amount of at least 1 cancer cell line, wherein the cell line or a combination of the cell lines comprises cells that express at least 5 tumor associated antigens (TAAs) associated with a cancer of a subject intended to receive said composition, and wherein said composition is capable of eliciting an immune response specific to the at least 5 TAAs.
  • TAAs tumor associated antigens
  • compositions comprising a therapeutically effective amount of at least 1 cancer cell line, wherein the cell line or a combination of the cell lines comprises cells that express at least 10 tumor associated antigens (TAAs) associated with a cancer of a subject intended to receive said composition, and wherein said composition is capable of eliciting an immune response specific to the at least 10 TAAs.
  • TAAs tumor associated antigens
  • compositions comprising a therapeutically effective amount of at least 1 cancer cell line, wherein the cell line or a combination of the cell lines comprises cells that express at least 15 tumor associated antigens (TAAs) associated with a cancer of a subject intended to receive said composition, and wherein said composition is capable of eliciting an immune response specific to the at least 15 TAAs.
  • TAAs tumor associated antigens
  • composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that express at least 5 tumor associated antigens (TAAs) associated with a cancer of a subject intended to receive said composition, and wherein each cell line or the combination of the cell lines are modified to express or increase expression of at least 1 immunostimulatory factor.
  • TAAs tumor associated antigens
  • composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that express at least 15 tumor associated antigens (TAAs) associated with a cancer of a subject intended to receive said composition, and wherein each cell line or the combination of the cell lines are modified to express or increase expression of at least 2 immunostimulatory factor.
  • TAAs tumor associated antigens
  • composition wherein said composition is capable of stimulating a 1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-fold or higher increase in IFN ⁇ production compared to a composition comprising unmodified cancer cell lines.
  • composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that express at least 5 tumor associated antigens (TAAs) associated with a cancer of a subject intended to receive said composition, and wherein each cell line or the combination of the cell lines are modified to inhibit or decrease expression of at least 1 immunosuppressive factor.
  • TAAs tumor associated antigens
  • composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that express at least 5 tumor associated antigens (TAAs) associated with a cancer of a subject intended to receive said composition, and wherein each cell line or the combination of the cell lines are modified to (i) express or increase expression of at least 1 immunostimulatory factor, and (ii) inhibit or decrease expression of at least 1 immunosuppressive factor.
  • TAAs tumor associated antigens
  • each cell line or the combination of the cell lines comprises cells that express 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 TAAs associated with the cancer of the subject intended to receive said composition.
  • the composition comprises 2, 3, 4, 5, or 6 cancer cell lines.
  • each cell line or a combination of the cell lines are modified to express or increase expression of 1, 2, 3, 4, 5, 6, 7, or 8 immunostimulatory factors.
  • each cell line or a combination of the cell lines are modified to inhibit or decrease expression of 1, 2, 3, 4, 5, 6, 7, or 8 immunosuppressive factors.
  • compositions comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to express or increase expression of at least 2 immunostimulatory factors.
  • a composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to express or increase expression of at least 1 immunostimulatory factor, and wherein at least 1 of the cell lines is modified to knockdown or knockout one or more of CD276, TGF ⁇ 1, and TGF ⁇ 2.
  • composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to express or increase expression of at least 1 immunostimulatory factor, and wherein said at least 1 immunostimulatory factor increases dendritic cell maturation.
  • compositions comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to express or increase expression of at least 1 immunostimulatory factor, and wherein said composition is capable of stimulating a 1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-fold or higher increase in IFN ⁇ production compared to a composition comprising unmodified cancer cell lines.
  • compositions comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 1 immunostimulatory factor, and (ii) inhibit or decrease expression of at least 1 immunosuppressive factor, and wherein said composition is capable of stimulating at least a 1.5-fold increase in IFN ⁇ production compared to a composition comprising unmodified cancer cell lines.
  • compositions comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, and (ii) inhibit or decrease expression of at least 1 immunosuppressive factor, and wherein said composition is capable of stimulating at least a 1.5-fold increase in IFN ⁇ production compared to a composition comprising unmodified cancer cell lines.
  • compositions comprising a therapeutically effective amount of at least 3 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, and (ii) inhibit or decrease expression of at least 1 immunosuppressive factor, and wherein said composition is capable of stimulating at least a 1.7-fold increase in IFN ⁇ production compared to a composition comprising unmodified cancer cell lines.
  • compositions comprising a therapeutically effective amount of at least 3 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, and (ii) inhibit or decrease expression of at least 2 immunosuppressive factors, and wherein said composition is capable of stimulating at least a 2.0-fold increase in IFN ⁇ production compared to a composition comprising unmodified cancer cell lines.
  • an immunogenic composition comprising a therapeutically effective amount of at least 1 cancer cell line, wherein the cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 1 immunostimulatory factor, and (ii) increase expression of at least 1 tumor associated antigen (TAA) that is either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • TAA tumor associated antigen
  • an immunogenic composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein the cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, and (ii) increase expression of at least 2 tumor associated antigens (TAAs) that are either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • TAAs tumor associated antigens
  • an immunogenic composition comprising a therapeutically effective amount of at least 3 cancer cell lines, wherein the cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, and (ii) increase expression of at least 2 tumor associated antigens (TAAs) that are either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • TAAs tumor associated antigens
  • an aforemention immunogenic composition wherein each cell line or a combination of the cell lines are modified to (i) express or increase expression of 3, 4, 5, 6, 7, 8, 9 or 10 immunostimulatory factors, and/or (iii) increase expression of 3, 4, 5, 6, 7, 8, 9 or 10 TAAs that are either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • an aforementioned immunogenic composition capable of stimulating at least a 1, 1.3, 1.4, 1.5, 1.6, 1.7, or 2-fold increase in IFN ⁇ production compared to a composition comprising unmodified cancer cell lines.
  • an immunogenic composition comprising a therapeutically effective amount of at least 1 cancer cell line, wherein the cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 1 immunostimulatory factor, (ii) inhibit or decrease expression of at least 1 immunosuppressive factor, and (iii) increase expression of at least 1 tumor associated antigen (TAA) that is either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • TAA tumor associated antigen
  • an immunogenic composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, (ii) inhibit or decrease expression of at least 2 immunosuppressive factors, and (iii) increase expression of at least 2 tumor associated antigens (TAAs) that are either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • TAAs tumor associated antigens
  • an immunogenic composition comprising a therapeutically effective amount of at least 3 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, (ii) inhibit or decrease expression of at least 2 immunosuppressive factors, and (iii) increase expression of at least 1 tumor associated antigen (TAA) that is either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • TAA tumor associated antigen
  • an immunogenic composition comprising a therapeutically effective amount of at least 3 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, (ii) inhibit or decrease expression of at least 2 immunosuppressive factors, and (iii) increase expression of at least 2 tumor associated antigens (TAAs) that are either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • TAAs tumor associated antigens
  • an aforementioned immunogenic composition wherein the composition comprises 4, 5, or 6 cancer cell lines.
  • each cell line or a combination of the cell lines comprises cells that are modified to increase expression of at least 3, 4, 5, 6, 7, 8, 9, or 10 or more TAAs that are either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • each cell line or a combination of the cell lines are modified to (i) express or increase expression of 3, 4, 5, 6, 7, 8, 9 or 10 immunostimulatory factors, (ii) inhibit or decrease expression of 3, 4, 5, 6, 7, 8, 9 or 10 immunosuppressive factors, and/or (iii) increase expression of 3, 4, 5, 6, 7, 8, 9 or 10 TAAs that are either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • animmunogenic composition comprising a therapeutically effective amount of at least 3 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, (ii) inhibit or decrease expression of at least 2 immunosuppressive factors, and/or (iii) express or increase expression of one or more of CT83, MSLN, TERT, PSMA, MAGEA1, EGFRvIII, hCMV pp65, TBXT, BORIS, FSHR, MAGEA10, MAGEC2, WT1, FBP, TDGF1, Claudin 18, LYK6K, FAP, PRAME, HPV16/18 E6/E7, or mutated versions thereof.
  • the mutated versions comprise: (i) a modified version selected from the group consisting of modTERT, modPSMA, modMAGEA1, modTBXT, modBORIS, modFSHR, modMAGEA10, modMAGEC2, modWT1, modKRAS, modFBP, modTDGF1, modClaudin 18, modLY6K, modFAP, and modPRAME; or (ii) a fusion protein selected from the group consisting of modCT83-MSLN, modMAGEA1-EGFRvIII-pp65, modTBXT-modBORIS, modFSHR-modMAGEA10, modTBXT-modMAGEC2, modTBXT-modWT1, modTBXT-modWT1-KRAS, modWT1-modFBP, modPSMA-modTDGF1, modWT1-modClaudin 18, modPSMA-modLY6K, modFAP-modClaudin 18, and modPRAME-modTBXT.
  • the mutated versions comprise: (i) a modified version selected from the group consisting of modMesothelin (SEQ ID NO: 62), modTERT (SEQ ID NO: 36), modPSMA (SEQ ID NO: 38), modMAGEA1 (SEQ ID NO: 73), modTBXT (SEQ ID NO: 79), modBORIS(SEQ ID NO: 60), modFSHR (SEQ ID NO: 95), modMAGEA10 (SEQ ID NO: 97), modMAGEC2 (SEQ ID NO: 87), modWT1 (SEQ ID NO: 81), KRAS G12D (SEQ ID NO: 83) or KRAS G12V (SEQ ID NO:85), modFBP (SEQ ID NO: 93), modTDGF1 (SEQ ID NO: 89), modClaudin 18 (SEQ ID NO: 110), modLYK6K (SEQ ID NO: 112), modFAP (SEQ ID NO: 115), and modPRAME (SEQ ID NO:
  • compositions comprising a therapeutically effective amount of a cancer stem cell line, wherein said cancer stem cell line is modified to express or increase expression of at least 1 immunostimulatory factor.
  • a composition comprising a therapeutically effective amount of a cancer stem cell line, wherein said cancer stem cell line is modified to (i) express or increase expression of at least 1 immunostimulatory factor, and (ii) inhibit or decrease expression of at least 1 immunosuppressive factor.
  • composition comprising a therapeutically effective amount of a cancer stem cell line, wherein said cell line is modified to (i) express or increase expression of at least 1 immunostimulatory factor, and (ii) increase expression of at least 1 TAA that is either not expressed or minimally expressed by the cancer stem cell line.
  • the at least 1 TAA is selected from the group consisting of TERT, PSMA, MAGEA1, EGFRvIII, hCMV pp65, TBXT, BORIS, FSHR, MAGEA10, MAGEC2, WT1, KRAS, FBP, TDGF1, Claudin 18, LY6K, FAP, PRAME, HPV16/18 E6/E7, and FAP, or mutated versions thereof.
  • composition comprising a therapeutically effective amount of a cancer stem cell line, wherein said cancer stem cell line is modified to (i) express or increase expression of at least 1 immunostimulatory factor, (ii) inhibit or decrease expression of at least 1 immunosuppressive factor, and (iii) increase expression of at least 1 tumor associated antigen (TAA) that is either not expressed or minimally expressed by the cancer stem cell line.
  • TAA tumor associated antigen
  • composition comprising a therapeutically effective amount of a cancer stem cell line, wherein said cancer stem cell line is modified to (i) express or increase expression of at least 2 immunostimulatory factors, (ii) inhibit or decrease expression of at least 2 immunosuppressive factor, and (iii) increase expression of at least 2 tumor associated antigens (TAAs) that are either not expressed or minimally expressed by the cancer stem cell line.
  • TAAs tumor associated antigens
  • the cancer stem cell line is selected from the group consisting of JHOM-2B, OVCAR-3, OV56, JHOS-4, JHOC-5, OVCAR-4, JHOS-2, EFO-21, CFPAC-1, Capan-1, Panc 02.13, SUIT-2, Panc 03.27, SK-MEL-28, RVH-421, Hs 895.T, Hs 940.T, SK-MEL-1, Hs 936.T, SH-4, COLO 800, UACC-62, NCI-H2066, NCI-H1963, NCI-H209, NCI-H889, COR-L47, NCI-H1092, NCI-H1436, COR-L95, COR-L279, NCI-H1048, NCI-H69, DMS 53, HuH-6, Li7, SNU-182, JHH-7, SK-HEP-1, Hep 3B2.1-7, SNU-1066, SNU-1041, SNU-1076,
  • a composition comprising a therapeutically effective amount of small cell lung cancer cell line DMS 53, wherein said cell line DMS 53 is (i) modified to knockdown TGF ⁇ 2, (ii) knockout CD276, and (iii) upregulate expression of GM-CSF, membrane bound CD40L, and IL-12.
  • a composition comprising a therapeutically effective amount of small cell lung cancer cell line DMS 53, wherein said cell line DMS 53 is (i) modified to knockdown TGF ⁇ 2, (ii) knockout CD276, and (iii) upregulate expression of GM-CSF and membrane bound CD40L.
  • a vaccine composition comprising a therapeutically effective amount of small cell lung cancer cell line DMS 53, wherein said composition stimulates an immune response specific to at least 1 tumor associated antigen (TAA) expressed by said cell line DMS 53.
  • TAA tumor associated antigen
  • a composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein at least 1 of the cell lines comprises cells that are modified to express or increase expression of at least 1 immunostimulatory factor, and wherein at least 1 of the cell lines is small cell lung cancer cell line DMS 53 and comprises cells that are modified to express or increase expression of at least 1 immunostimulatory factor or inhibit or decrease expression of at least 1 immunosuppressive factor.
  • composition comprising a therapeutically effective amount of at least 2 cancer cell lines, wherein at least 1 cell line comprises cells that are modified to express or increase expression of at least 1 immunostimulatory factor, and wherein 1 cell line is small cell lung cancer DMS 53.
  • compositions comprising a therapeutically effective amount of small cell lung cancer cell line DMS 53, wherein said cell line is modified to (i) express or increase expression of at least 1 immunostimulatory factor, and (ii) inhibit or decrease expression of at least 1 immunosuppressive factor.
  • a composition comprising a therapeutically effective amount of 3 cancer cell lines, wherein each cell line comprises cells that are modified to (i) express or increase expression of at least 2 immunostimulatory factors, and (ii) inhibit or decrease expression of at least 1 immunosuppressive factors, and wherein 1 of the cell lines is small cell lung cancer cell line DMS 53.
  • an aforementioned composition wherein said composition is a vaccine composition. In some embodiments, an aforementioned composition is provided wherein said composition is capable of eliciting an immune response in a subject. In some embodiments, an aforementioned composition is provided wherein said composition comprises 3, 4, 5, 6, 7, 8, 9 or 10 cancer cell lines. In some embodiments, an aforementioned composition is provided wherein said composition comprises modifications to express or increase expression of 2, 3, 4, 5, 6, 7, 8, 9, or 10 immunostimulatory factors. In some embodiments, an aforementioned composition is provided wherein said composition comprises modifications to inhibit or decrease expression of 2, 3, 4, 5, 6, 7, 8, 9, or 10 immunosuppressive factors.
  • an aforementioned composition wherein said composition comprises modifications to express or increase expression of 2, 3, 4, 5, 6, 7, 8, 9, or 10 TAAs.
  • the amino acid sequence of one or more of the TAAs has been modified to include a mutation or a neoepitope.
  • an aforementioned composition wherein said immune response is an innate immune response, an adaptive immune response, a cellular immune response, and/or a humoral response.
  • the immune response is an adaptive immune response.
  • the adaptive immune response comprises the production of antigen specific cells selected from the group consisting of CD4 + T cells, CD8 + T cells, gamma-delta T cells, natural killer T cells, and B cells.
  • the antigen specific CD4 + T cells comprise memory cells, T helper type 1 cells, T helper type 9 cells, T helper type 17 cells, T helper type 22 cells, and T follicular helper cells.
  • the antigen specific CD8 + T cells comprise memory cells and cytotoxic T lymphocytes.
  • the antigen specific B cells comprise memory cells, immunoglobulin M, immunoglobulin G, immunoglobulin D, immunoglobulin E, and immunoglobulin A.
  • each cell line or a combination of the cell lines express at least 10 TAAs.
  • the TAAs are also expressed in a cancer of a subject intended to receive said composition.
  • an aforementioned composition wherein the therapeutically effective amount comprises approximately 8 ⁇ 10 6 cells of each cell line. In another embodiment, the therapeutically effective amount comprises approximately 1 ⁇ 10 7 cells of each cell line. In some embodiments, the therapeutically effective amount comprises approximately 1.0 ⁇ 10 6 -6.0 ⁇ 10 7 cells of each cell line. In some embodiments, an aforementioned composition is provided wherein the therapeutically effective amount comprises approximately an equal number of cells of each cell line.
  • an aforementioned composition is provided herein the cell lines are genetically heterogeneous allogeneic, genetically homogeneous allogeneic, genetically heterogeneous xenogeneic, genetically homogeneous xenogeneic, or a combination of allogeneic and xenogeneic.
  • the cell lines are from parental cell lines of solid tumors originating from the lung, prostate, testis, breast, colon, bladder, gastrointestinal system, brain, spinal cord, urinary tract, colon, rectum, stomach, head and neck, liver, kidney, central nervous system, endocrine system, mesothelium, ovaries, endometrium, pancreas, esophagus, neuroendocrine system, uterus, or skin.
  • the parental cell lines comprise cells selected from the group consisting of squamous cells, carcinoma cells, adenocarcinoma cells, adenosquamous cells, large cell cells, small cell cells, sarcoma cells, clear cell carcinoma cells, carcinosarcoma cells, mixed mesodermal cells, and teratocarcinoma cells.
  • the sarcoma cells comprise osteosarcoma, chondrosarcoma, leiomyosarcoma, rhabdomyosarcoma, mesothelioma, fibrosarcoma, angiosarcoma, liposarcoma, glioma, gliosarcoma, astrocytoma, myxosarcoma, mesenchymous or mixed mesodermal.
  • the cell line or cell lines are non-small cell lung cancer cell lines or small cell lung cancer cell lines.
  • the cell lines are selected from the group consisting of NCI-H460, NCIH520, A549, DMS 53, LK-2, and NCI-H23.
  • the cell line or cell lines are small cell lung cancer cell lines.
  • the cell lines are selected from the group consisting of DMS 114, NCI-H196, NCI-H1092, SBC-5, NCI-H510A, NCI-H889, NCI-H1341, NCIH-1876, NCI-H2029, NCI-H841, DMS 53, and NCI-H1694.
  • the cell line or cell lines are prostate cancer cell lines or testicular cancer cell lines.
  • the cell lines are selected from the group consisting of PC3, DU-145, LNCAP, NEC8, and NTERA-2cl-D1.
  • the cell line or cell lines are colorectal cancer cell lines.
  • the cell lines are selected from the group consisting of HCT-15, RKO, HuTu-80, HCT-116, and LS411N.
  • the cell line or cell lines are breast or triple negative breast cancer cell lines.
  • the cell lines are selected from the group consisting of Hs 578T, AU565, CAMA-1, MCF-7, and T-47D.
  • the cell line or cell lines are bladder or urinary tract cancer cell lines.
  • the cell lines are selected from the group consisting of UM-UC-3, J82, TCCSUP, HT-1376, and SCaBER. In other embodiments, the cell line or cell lines are head and neck cancer cell lines. In some embodiments, the cell lines are selected from the group consisting of HSC-4, Detroit 562, KON, HO-1-N-1, and OSC-20. In other embodiments, the cell line or cell lines are gastric or stomach cancer cell lines. In some embodiments, the cell lines are selected from the group consisting of Fu97, MKN74, MKN45, OCUM-1, and MKN1. In other embodiments, the cell line or cell lines are liver cancer or hepatocellular cancer (HCC) cell lines.
  • HCC hepatocellular cancer
  • the cell lines are selected from the group consisting of Hep-G2, JHH-2, JHH-4, JHH-5, JHH-6, Li7, HLF, HuH-1, HuH-6, and HuH-7.
  • the cell line or cell lines are glioblastoma cancer cell lines.
  • the cell lines are selected from the group consisting of DBTRG-05MG, LN-229, SF-126, GB-1, and KNS-60.
  • the cell line or cell lines are ovarian cancer cell lines.
  • the cell lines are selected from the group consisting of TOV-112D, ES-2, TOV-21G, OVTOKO, and MCAS.
  • the cell line or cell lines are esophageal cancer cell lines. In other embodiments, the cell lines are selected from the group consisting of TE-10, TE-6, TE-4, EC-GI-10, OE33, TE-9, TT, TE-11, OE19, and OE21. In some embodiments, the cell line or cell lines are kidney or renal cell carcinoma cancer cell lines. In some embodiments, the cell lines are selected from the group consisting of A-498, A-704, 769-P, 786-O, ACHN, KMRC-1, KMRC-2, VMRC-RCZ, and VMRC-RCW. In other embodiments, the cell line or cell lines are pancreatic cancer cell lines.
  • the cell lines are selected from the group consisting of PANC-1, KP-3, KP-4, SUIT-2, and PSN11.
  • the cell line or cell lines are endometrial cancer cell lines.
  • the cell lines are selected from the group consisting of SNG-M, HEC-1-B, JHUEM-3, RL95-2, MFE-280, MFE-296, TEN, JHUEM-2, AN3-CA, and Ishikawa.
  • the cell line or cell lines are skin or melanoma cancer cell lines.
  • the cell lines are selected from the group consisting of RPMI-7951, MeWo, Hs 688(A).T, COLO 829, C32, A-375, Hs 294T, Hs 695T, Hs 852T, and A2058.
  • the cell line or cell lines are mesothelioma cancer cell lines.
  • the cell lines are selected from the group consisting of NCI-H28, MSTO-211H, IST-Mes1, ACC-MESO-1, NCI-H2052, NCI-H2452, MPP 89, and IST-Mes2.
  • the present disclosure provides an aforementioned composition further comprising a cancer stem cell line. In some embodiments, the present disclosure provides an aforementioned composition further comprising cell line DMS 53. In some embodiments, the present disclosure provides an aforementioned composition wherein 1 of the cell lines is of a different cancer than at least 1 of the other cell lines. In another embodiment, at least 3 cell lines are each of the same type of cancer. In some embodiments, at least 3 cell lines are each of a different cell histology type or molecular subtype. In some embodiments, the present disclosure provides an aforementioned composition wherein the cell histology type is selected from the group consisting of squamous, carcinoma, adenocarcinoma, large cell, small cell, and sarcoma.
  • the present disclosure provides an aforementioned composition wherein the modification to increase expression of the at least 1 immunostimulatory factor comprises use of a lentiviral vector or vectors encoding the at least 1 immunostimulatory factor.
  • the at least 1 immunostimulatory factor is expressed at a level at least 2.0-fold higher compared to unmodified cell lines.
  • the at least 1 immunostimulatory factor is selected from the group consisting of GM-CSF, membrane bound CD40L, GITR, IL-15, IL-23, and IL-12.
  • the immunostimulatory factors are GM-CSF, membrane bound CD40L, and IL-12.
  • the immunostimulatory factors are GM-CSF, membrane bound CD40L, and IL-15.
  • the GM-CSF comprises SEQ ID NO: 8.
  • the membrane bound CD40L comprises SEQ ID NO: 3.
  • the IL-12 comprises SEQ ID NO: 10.
  • the present disclosure provides an aforementioned composition wherein the modification to inhibit or decrease expression of the at least 1 immunosuppressive factor comprises a knockout or a knockdown of said at least 1 immunosuppressive factor.
  • expression of the at least 1 immunosuppressive factor is decreased by at least approximately 5, 10, 15, 20, 25, or 30%.
  • the modification is a knockdown.
  • the present disclosure provides an aforementioned composition wherein the modifications to inhibit or decrease expression of the at least 1 immunosuppressive factor comprise a combination of knocking down expression of the at least 1 immunosuppressive factor and knocking out expression of a different immunosuppressive factor.
  • the at least 1 immunosuppressive factor is selected from the group consisting of CD276, CD47, CTLA4, HLA-E, HLA-G, IDO1, IL-10, TGF ⁇ 1, TGF ⁇ 2, and TGF ⁇ 3.
  • the at least 1 immunosuppressive factor is selected from the group consisting of CD276, HLA-E, HLA-G, TGF ⁇ 1, and TGF ⁇ 2.
  • the immunosuppressive factors are TGF ⁇ 1, TGF ⁇ 2, and CD276. In still another embodiment, the immunosuppressive factors are TGF ⁇ 2 and CD276. In yet another embodiment of the present disclosure, the immunosuppressive factors are TGF ⁇ 1 and CD276. In some embodiments, the TGF ⁇ 1 is knocked down using short hairpin RNA comprising SEQ ID NO: 25. In other embodiments, TGF ⁇ 2 is knocked down using short hairpin RNA comprising SEQ ID NO: 24. In still other embodiments, CD276 is knocked out using a zinc finger nuclease pair that targets a CD276 genomic DNA sequence comprising SEQ ID NO: 26.
  • the present disclosure provides an aforementioned composition wherein the composition comprises cell lines that express a heterogeneity of HLA supertypes, and wherein at least 2 different HLA-A and at least 2 HLA-B supertypes are represented.
  • the composition expresses major histocompatibility complex molecules in the HLA-A24, HLA-A01, HLA-A03, HLA-B07, HLA-B08, HLA-B27, and HLA-B44 supertypes.
  • the composition expresses major histocompatibility complex molecules in the HLA-A24, HLA-A03, HLA-A01, HLA-B07, HLA-B27, and HLA-B44 supertypes.
  • the composition expresses HLA-A01, HLA-A03, HLA-B07, HLA-B08, and HLA-B44 supertypes.
  • the present disclosure provides an aforementioned composition wherein the cell line(s) is a genetically homogeneous cell line. In some embodiments, the present disclosure provides an aforementioned composition wherein the cell line(s) is a genetically heterogeneous cell line.
  • the present disclosure provides a method of stimulating an immune response in a subject comprising administering to the subject a therapeutically effective amount of an aforementioned composition.
  • the present disclosure provides a method of stimulating an immune response specific to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more tumor associated antigens (TAAs) in a subject comprising administering to the subject a therapeutically effective amount of an aforementioned composition.
  • TAAs tumor associated antigens
  • provided herein is a method of stimulating an immune response in a subject comprising administering to the subject a therapeutically effective amount of 2 aforementioned compositions. In one embodiment, provided herein is a method of stimulating an immune response in a subject comprising administering to the subject a therapeutically effective amount of 2 or more compositions described herein, wherein the compositions comprise different combinations of cell lines. In one embodiment, provided herein is a method of stimulating an immune response in a subject comprising administering to the subject a therapeutically effective amount of 2 compositions described herein, wherein the compositions each comprise 3 different cell lines. In some embodiments, the immune response comprises increased production of antigen specific or vaccine specific immunoglobulin G antibodies.
  • the immune response comprises increased production of one or more of IL-1 ⁇ , IL-6, IL-8, IL-12, IL-17A, IL-20, IL-22, TNF ⁇ , IFN ⁇ , CCL5, or CXCL10. In one embodiment, the immune response comprises increased production of IFN ⁇ . In some embodiments, the immune response comprises increased production of Granzyme A, Granzyme B, Perforin, and CD107a. In other embodiments, the immune response comprises decreased levels of regulatory T cells, mononuclear monocyte derived suppressor cells, and polymorphonuclear derived suppressor cells.
  • the immune response comprises decreased levels of circulating tumor cells (CTCs), neutrophil to lymphocyte ratio (NLR), and platelet to lymphocyte ratio (PLR). In other embodiments, the immune response comprises changes in immune infiltrate in the tumor microenvironment.
  • CTCs circulating tumor cells
  • NLR neutrophil to lymphocyte ratio
  • PLR platelet to lymphocyte ratio
  • provided herein is a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of a composition described herein. In one embodiment, provided herein is a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of 2 or more compositions described herein, wherein the compositions comprise different combinations of cell lines. In one embodiment, provided herein is a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of 2 compositions described herein, wherein the compositions each comprise 3 different cell lines.
  • provided herein is a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of a composition described herein, and further comprising administering to the subject a therapeutically effective amount of a chemotherapeutic agent.
  • a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of one or more compositions described herein, and further comprising administering to the subject a therapeutically effective amount of cyclophosphamide.
  • the therapeutically effective amount of cyclophosphamide comprises 50 mg/day for 1-10 days prior to the administration of the therapeutically effective amount of the composition.
  • the present disclosure provides a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of a composition described herein, and further comprising administering to the subject a therapeutically effective amount of a checkpoint inhibitor.
  • the checkpoint inhibitor is selected from the group consisting of an inhibitor of CTLA-4, 4-1BB (CD137), 4-1BBL (CD137L), PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, TIM3, B7H3, B7H4, VISTA, KIR, BTLA, SIGLEC9, and 2B4.
  • the checkpoint inhibitor is selected from the group consisting of pembrolizumab, avelumab, atezolizumab, cetrelimab, dostarlimab, cemiplimab, spartalizumab, camrelizumab, durvalumab, and nivolumab.
  • an aforementioned method is provided further comprising administering to the subject an isolated tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of a composition described herein, and further comprising administering to the subject one or more inhibitors selected from the group consisting of inhibitors of ALK, PARP, VEGFRs, EGFR, FGFR1-3, HIF1 ⁇ , PDGFR1-2, c-Met, c-KIT, Her2, Her3, AR, PR, RET, EPHB4, STAT3, Ras, HDAC1-11, mTOR, and CXCR4.
  • provided herein is a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of a composition provided herein, and further comprising administering to the subject a therapeutically effective amount of radiation therapy.
  • a method of treating cancer in a subject comprising administering a therapeutically effective amount of a composition described herein, and further comprising administering to the patient a cancer treatment surgery.
  • a method of concurrently treating two or more cancers in a subject comprising administering to the subject a therapeutically effective amount of a composition described herein.
  • a method of preparing a vaccine composition described herein comprising the steps of: (a) selecting one or more cancer cell lines that express at least, 5, 10, 15 or 20 or more TAAs; and (b) modifying each of the one or more cancer cell lines of (a), wherein the cell line or a combination of the cell lines comprises cells that are modified to (i) express or increase expression of at least 1 immunostimulatory factor, and/or (ii) increase expression of at least 1 TAA that is either not expressed or minimally expressed by 1 cell line or the combination of the cell lines.
  • the cell line or a combination of the cell lines comprises cells that are additionally modified to inhibit or decrease expression of at least 1 immunosuppressive factor.
  • the modifying step comprises introducing one or more vectors into one or more of the cell lines.
  • the one or more vectors are lentiviral vectors.
  • the method further comprises the step of adapting the modified cell lines to a xeno-free media.
  • the method further comprises the step of irradiating the cell lines.
  • the method further comprises the step of adapting the cells to a cryopreservation media.
  • the present disclosure provides an aforemention method wherein the composition or compositions are administered to the subject by a route selected from the group consisting of parenteral, enteral, oral, intramuscular, intradermal, subcutaneous, intratumoral, intranodal, intranasal, transdermal, inhalation, mucosal, and topical.
  • the route is intradermal.
  • the composition or compositions are administered to an administration site on the subject selected from the group consisting of arm or arms, thigh or thighs, and back.
  • the compositions are intradermally administered at different administration sites on the subject.
  • the composition is intradermally administered by injection with a syringe positioned at an angle between 5 and 15 degrees from the surface of the administration site.
  • a method of treating cancer in a subject comprising administering to the subject a therapeutically effective amount of a first dose and therapeutically effective amounts of subsequent doses of one or more compositions provided herein, wherein the one or more compositions are administered 1-24 times in year one, 1-16 times in year two, and 1-14 times in year three.
  • the present disclosure provides a method of stimulating an immune response in a subject comprising administering to the subject a first dose of a therapeutically effective amount of two compositions provided herein, wherein the first four doses are administered every 21 days up to day 63, and then every 42 days for three additional doses up to day 189.
  • the method further comprises administering five additional doses at 42-day intervals up to day 399, and then at least at two 84-day intervals thereafter.
  • the present disclosure provides a method of stimulating an immune response in a subject comprising administering to the subject a first dose and subsequent doses of a therapeutically effective amount of two compositions provided herein, wherein the first four doses are administered every 14 days up to day 42, and then every 42 days for three additional doses up to day 168.
  • the method further comprises administering to the subject five additional doses at 42-day intervals up to day 378, and then at least at two 84-day intervals thereafter.
  • the present disclosure provides a method of treating a cancer in a subject comprising administering to the subject a therapeutically effective amount of two compositions, wherein each composition comprises at least 2 cancer cell lines modified to (i) express or increase expression of at least 1 immunostimulatory factor, (ii) inhibit or decrease expression of at least 1 immunosuppressive factor, and (iii) increase expression of at least 1 tumor associated antigen (TAA) that is either not expressed or minimally expressed by 1 cell line or the combination of the cell lines, wherein one composition is administered to the upper body of the subject, and the other composition is administered to the lower body of the subject.
  • TAA tumor associated antigen
  • the present disclosure provides a method of treating a cancer in a subject comprising administering to the subject a first dose and subsequent doses of a therapeutically effective amount of two compositions, wherein each composition comprises at least 2 cancer cell lines modified to (i) express or increase expression of one or more of GM-CSF, IL-12, and membrane bound CD40L, (ii) inhibit or decrease expression of one or more of TGF ⁇ 1, TGF ⁇ 2, and CD276, and (iii) increase expression of at least 1 TAA that is either not expressed or minimally expressed by 1 cell line or the combination of the cell lines, wherein one composition is administered to the upper body of the subject , and the other composition is administered to the lower body of the subject.
  • each composition comprises at least 2 cancer cell lines modified to (i) express or increase expression of one or more of GM-CSF, IL-12, and membrane bound CD40L, (ii) inhibit or decrease expression of one or more of TGF ⁇ 1, TGF ⁇ 2, and CD276, and (iii) increase expression of at least 1 T
  • the methods provided herein further comprises administering to the subject one or more therapeutic agents or treatments.
  • the subject refrains from treatment with other vaccines or therapeutic agents.
  • the therapeutic agent or treatment is selected from the group consisting of radiotherapy, chemotherapy, surgery, small molecule inhibitors, and checkpoint inhibitors.
  • the therapeutic agent is cyclophosphamide.
  • the checkpoint inhibitor is selected from the group consisting of an inhibitor of CTLA-4, 4-1BB (CD137), 4-1BBL (CD137L), PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, TIM3, B7H3, B7H4, VISTA, KIR, BTLA, SIGLEC9, and 2B4.
  • the checkpoint inhibitor is pembrolizumab, avelumab, atezolizumab, cetrelimab, dostarlimab, cemiplimab, spartalizumab, camrelizumab, durvalumab, or nivolumab.
  • the one or more therapeutic agents or treatments are administered prior to at least 1 administration of said first dose and/or said subsequent doses. In other embodiments, the one or more therapeutic agents or treatments are administered prior to, concurrently, or subsequent to each administration of said composition. In still other embodiments, a first therapeutic agent is administered prior to said first dose, and wherein a second therapeutic agent is administered concurrently with said first dose and said subsequent doses.
  • the present disclosure provides a method of stimulating an immune response in a subject comprising: a. administering to the subject a first dose of a therapeutically effective amount of two compositions provided herein, wherein said two compositions are administered concurrently at different sites, and administering to the subject subsequent doses of said two compositions after administering said first dose, wherein said two compositions are administered concurrently at different sites; and b. optionally administering to the subject therapeutically effective doses cyclophosphamide for 1-10 days prior to administering the first dose of (a), and optionally for 1-10 days prior to administering said subsequent doses of (a); c.
  • the present disclosure provides a method of treating cancer in a subject comprising: a. administering to the subject a first dose of a therapeutically effective amount of two compositions described herein, and administering to the subject subsequent doses of said two compositions after administering said first dose, wherein said two compositions are administered concurrently at different sites; b. optionally administering to the subject cyclophosphamide for 1-10 days prior to administering the first dose of (a), and optionally for 1-10 days prior to administering said subsequent doses of (a); c.
  • the present disclosure provides a method of treating cancer in a subject comprising: a. administering to the subject a first dose of a therapeutically effective amount of two compositions according to any one of claims 1 - 138 , and administering to the subject subsequent doses of said two compositions after administering said first dose, wherein said two compositions are administered concurrently at different sites, and wherein said subsequent doses are administered at 3, 6, 9, 15, 21, and 27 weeks following administration of said first dose; b.
  • cyclophosphamide daily for 7 days prior to administering said first dose and said subsequent doses of (a); c. administering to the subject a checkpoint inhibitor at 3, 6, 9, 12, 15, 18, 21, 24, and 27 weeks following said first dose of (a).
  • cyclophosphamide is administered orally and the checkpoint inhibitor is pembrolizumab and is administered intravenously.
  • cyclophosphamide is administered orally at a dosage of 50 mg and the checkpoint inhibitor is pembrolizumab and is administered intravenously at a dosage of 200 mg.
  • the present disclosure provides a method of treating cancer in a subject comprising: a. administering to the subject a first dose of a therapeutically effective amount of two compositions provided herein, and administering to the subject subsequent doses of said two compositions after administering said first dose, wherein said two compositions are administered concurrently at different sites, and wherein said subsequent doses are administered at 2, 4, 6, 12, 18, and 24 weeks following administration of said first dose; b. administering to the subject cyclophosphamide daily for 7 days prior to administering said first dose and said subsequent doses of (a); and c. administering to the subject a checkpoint inhibitor at 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30 weeks following said first dose of (a).
  • cyclophosphamide is administered orally at a dosage of 50 mg and the checkpoint inhibitor is durvalumab and is administered intravenously at a dosage of 10 mg/kg.
  • the methods further comprise the step of abstaining from cannabinoid administration for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days prior to administration of the compositions and 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days after administration of the compositions.
  • each embraced in groups or individually suffers from a cancer selected from the group consisting of lung cancer, prostate cancer, breast cancer, esophageal cancer, colorectal cancer, bladder cancer, gastric cancer, head and neck cancer, liver cancer, renal cancer, glioma, endometrial cancer, ovarian cancer, pancreatic cancer, melanoma, and mesothelioma.
  • the breast cancer is triple negative breast cancer.
  • the glioma is an astrocytoma.
  • the astrocytoma is glioblastoma multiform (GBM).
  • kits comprising one or more compositions provided herein.
  • the present disclosure provides a kit comprising at least 1 vial, said vial comprising a composition described herein.
  • the present disclosure provides a kit comprising a first vaccine composition in a first vial and a second vaccine composition in a second vial, wherein said first and second vaccine compositions each comprise at least 2 cancer cell lines that are modified to express or increase expression of at least 2 immunostimulatory factors.
  • the present disclosure provides a A kit comprising 6 vials, wherein the vials each contain a composition comprising a cancer cell line, and wherein at least 4 of the 6 vials comprise a cancer cell line that is modified to (i) express or increase expression of at least 2 immunostimulatory factors, and/or (ii) inhibit or decrease expression of at least 2 immunosuppressive factors, and/or (iii) increase expression of at least 1 TAA that is either not expressed or minimally expressed by 1 cell line or the combination of the cell lines, wherein at least 4 of the vials contain different compositions.
  • the kit further comprises instructions for use.
  • the kit is used for the treatment of cancer.
  • Unit doses of the composition provided herein are also contemplated.
  • the present disclosure provides a unit dose of a medicament for treating cancer comprising 6 compositions of different cancer cell lines, wherein at least 4 compositions comprise a cell line that is modified to (i) express or increase expression of at least 2 immunostimulatory factors, and (ii) inhibit or decrease expression of at least 2 immunosuppressive factors.
  • cell lines comprise: (a) non-small cell lung cancer cell lines and/or small cell lung cancer cell lines selected from the group consisting of NCI-H460, NCIH520, A549, DMS 53, LK-2, and NCI-H23; (b) DMS 53 and five small cell lung cancer cell lines selected from the group consisting of DMS 114, NCI-H196, NCI-H1092, SBC-5, NCI-H510A, NCI-H889, NCI-H1341, NCIH-1876, NCI-H2029, NCI-H841, DMS 53, and NCI-H1694; (c) DMS 53 and prostate cancer cell lines or testicular cancer cell lines PC3, DU-145, LNCAP, NEC8, and NTERA-2cl-D1; (d) DMS 53 and colorectal cancer cell lines HCT-15, RKO, HuTu-80, HCT-116, and LS411N; (e) DMS 53 and breast or triple negative breast cancer cell
  • the present disclosure provides a unit dose of a medicament for treating cancer comprising 6 compositions of different cancer cell lines, wherein each cell line is modified to (i) express or increase expression of at least 2 immunostimulatory factors, (ii) inhibit or decrease expression of at least 2 immunosuppressive factors, and/or (iii) express or increase expression of at least 1 TAA that is either not expressed or minimally expressed by the cancer cell lines.
  • each cell line is modified to (i) express or increase expression of at least 2 immunostimulatory factors, (ii) inhibit or decrease expression of at least 2 immunosuppressive factors, and/or (iii) express or increase expression of at least 1 TAA that is either not expressed or minimally expressed by the cancer cell lines.
  • two compositions comprising 3 cell lines each are mixed.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of lung cancer cell lines NCI-H460, NCI-H520, and A549; wherein (a) NCI-H460 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (b) NCI-H520 is modified to (i) increase expression of GM-CSF and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) A549 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of lung cancer cell lines NCI-H460, NCIH520, and A549; wherein (a) NCI-H460 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (b) NCI-H520 is modified to (i) increase expression of GM-CSF and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) A549 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; wherein said therapeutically effective amount is approximately 1.0 ⁇ 10 7 cells for each cell line or approximately 6 ⁇ 10 7 cells.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of lung cancer cell lines DMS 53, LK-2, and NCI-H23, wherein (a) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 2 and CD276; (b) LK-2 is modified to (i) increase expression of GM-CSF and membrane bound CD40L, (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276, and (iii) to express MSLN and CT83; and (c) NCI-H23 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of lung cancer cell lines DMS 53, LK-2, and NCI-H23; wherein (a) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 2 and CD276; (b) LK-2 is modified to (i) increase expression of GM-CSF and membrane bound CD40L, (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276, and (iii) to express MSLN and CT83; and (c) NCI-H23 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; wherein said therapeutically effective amount is approximately 1.0 ⁇ 10 7 cells for each cell line or approximately 6 ⁇ 10 7 cells.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines LN-229, GB-1, and SF-126, wherein: (a) LN-229 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; and (iii) modified to express modPSMA; (b) GB-1 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) SF-126 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTERT.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines DBTRG-05MG, KNS 60, and DMS 53, wherein: (a) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276; (b) DBTRG-05MG is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) KNS 60 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modMAGEA1, EGFRvIII, and hCMV pp65.
  • DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines HCT-15, RKO, and HuTu-80, wherein: (a) HCT-15 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) RKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) HuTu- 80 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines HCT-116, LS411N and DMS 53, wherein: (a) HCT-116 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; and (iii) modified to express modTBXT, modWT1, KRAS G12D and KRAS G12V; (b) LS411N is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines PC3, NEC8, NTERA-2cl-D1, wherein: (a) PC3 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTBXT and modMAGEC2; (b) NEC8 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; and (c) NTERA-2cl-D1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines DU-145, LNCaP, and DMS 53, wherein: (a) DU-145 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of CD276; and (iii) modified to express modPSMA; (b) LNCaP is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; and (c) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines J82, HT-1376, and TCCSUP, wherein: (a) J82 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modPSMA; (b) HT-1376 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) TCCSUP is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines SCaBER, UM-UC-3 and DMS 53, wherein: (a) SCaBER is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modWT1 and modFOLR1; (b) UM-UC-3 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines OVTOKO, MCAS, TOV-112D, wherein: (a) OVTOKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) MCAS is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modhTERT; (c) TOV-112D is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modFSHR and modMAGEA10.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines TOV-21G, ES-2 and DMS 53, wherein: (a) TOV-21G is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of CD276; and (iii) modified to express modWT1 and modFOLR1; (b) ES2 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modBORIS; and (c) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines HSC-4, HO-1-N-1, and DETROIT 562, wherein: (a) HSC-4 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) HO-1-N-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPRAME and modTBXT; and (c) DETROIT 562 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines KON, OSC-20 and DMS 53, wherein: (a) KON is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express HPV16 E6 and E7 and HPV18 E6 and E7; (b) OSC-20 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276; and (c) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines MKN-1, MKN-45, and MKN-74, wherein: (a) MKN-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA and modLYK6; (b) MKN-45 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) MKN-74 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines OCUM-1, Fu97 and DMS 53, wherein: (a) OCUM-1 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; (ii) decrease expression of CD276; (b) Fu97 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (iii) modified to express modWT1 and modCLDN18; and (c) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines CAMA-1, AU565, and HS-578T, wherein: (a) CAMA-1 is modified to (i) increase expression of GM- CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) AU565 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modTERT; and (c) HS-578T is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2 and CD276.
  • the present disclosure provides a vaccine composition comprising therapeutically effective amounts of cancer cell lines MCF-7, T47D and DMS 53, wherein: (a) MCF-7 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2 and CD276; (b) T47D is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; and (iii) modified to express modTBXT and modBORIS; and (c) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • the present disclosure provides an aforementioned vaccine composition wherein said therapeutically effective amount is approximately 1.0 ⁇ 10 7 cells for each cell line or approximately 6 ⁇ 10 7 cells.
  • the present disclosure provides a composition comprising a first cocktail and a second cocktail; wherein said first cocktail comprises therapeutically effective amounts of at least 2 irradiated cancer cell lines modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and wherein said second cocktail comprises cell line DMS 53 modified to (i) increase expression of GM-CSF and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • said first cocktail comprises therapeutically effective amounts of at least 2 irradiated cancer cell lines modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276
  • said second cocktail comprises cell line DMS 53 modified to (i) increase expression of GM-CSF and membrane bound CD40L, and (ii) decrease expression of TGF ⁇ 2 and CD276.
  • said first cocktail and/or said second cocktail comprises one or more cell lines modified to express or increase expression of CT83, MSLN, TERT, PSMA, MAGEA1, EGFRvIII, hCMV pp65, TBXT, BORIS, FSHR, MAGEA10, MAGEC2, WT1, KRAS, FBP, TDGF1, Claudin 18, LYK6K, PRAME, HPV16/18 E6/E7, or mutated versions thereof.
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with non-small cell lung cancer (NSCLC) in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of lung cancer cell lines NCI-H460, NCI-H520, and A549; wherein (a) NCI-H460 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (b) NCI-H520 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) A549 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and
  • the present disclosure provides a method of treating non-small cell lung cancer (NSCLC) cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of lung cancer cell lines NCI-H460, NCI-H520, and A549; wherein (a) NCI-H460 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (b) NCI-H520 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) A549 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (ii) a therapeutically effective amount of a second vaccine composition
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with glioblastoma in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines LN-229, GB-1, SF-126; wherein: (a) LN-229 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; and (iii) modified to express modPSMA; (b) GB-1 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) SF-126 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified
  • the present disclosure provides a method of treating glioblastoma in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines LN-229, GB-1, SF-126; wherein: (a) LN-229 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; and (iii) modified to express modPSMA; (b) GB-1 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) SF-126 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTERT; and (ii) a therapeutically effective amount
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with colorectal cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines HCT-15, RKO, and HuTu-80, wherein: (a) HCT-15 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) RKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) HuTu-80 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; and (ii
  • the present disclosure provides a method of treating colorectal cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines HCT-15, RKO, and HuTu-80, wherein: (a) HCT-15 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) RKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; and (c) HuTu-80 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; and (ii) a therapeutically effective amount of a second vaccine composition comprising therapeutically
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with prostate cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines PC3, NEC8, NTERA-2cl-D1, wherein: (a) PC3 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTBXT and modMAGEC2; (b) NEC8 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; and (c) NTERA-2cl-D1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; and (ii) a
  • the present disclosure provides a method of treating prostate cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines PC3, NEC8, NTERA-2cl-D1, wherein: (a) PC3 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTBXT and modMAGEC2; (b) NEC8 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; and (c) NTERA-2cl-D1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; and (ii) a therapeutically effective amount of a second vaccine composition comprising therapeutically effective amounts of
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with bladder cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines J82, HT-1376, and TCCSUP, wherein: (a) J82 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modPSMA; (b) HT-1376 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) TCCSUP is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (i) a
  • the present disclosure provides a method of treating bladder cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines J82, HT-1376, and TCCSUP, wherein: (a) J82 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modPSMA; (b) HT-1376 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) TCCSUP is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (ii) a therapeutically effective amount of a second vaccine composition comprising therapeutic
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with ovarian cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines OVTOKO, MCAS, TOV-112D, wherein: (a) OVTOKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) MCAS is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modhTERT; (c) TOV-112D is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and
  • the present disclosure provides a method of treating ovarian cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines OVTOKO, MCAS, TOV-112D, wherein: (a) OVTOKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) MCAS is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modhTERT; (c) TOV-112D is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modFSHR and modMAGEA10
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with head and neck cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines HSC-4, HO-1-N-1, DETROIT 562, wherein: (a) HSC-4 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) HO-1-N-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPRAME and modTBXT; and (c) DETROIT 562 is modified to (i) increase expression of GM-CSF, IL-12, and membrane
  • the present disclosure provides a method of treating head and neck cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines HSC-4, HO-1-N-1, DETROIT 562, wherein: (a) HSC-4 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) HO-1-N-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPRAME and modTBXT; and (c) DETROIT 562 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1,
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with gastric cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines MKN-1, MKN-45, and MKN-74; wherein (a) MKN-1is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA and modLYK6; (b) MKN-45 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; (c) MKN-74 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, and
  • the present disclosure provides a method of treating gastric cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines MKN-1, MKN-45, and MKN-74; wherein (a) MKN-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA and modLYK6; (b) MKN-45 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; (c) MKN-74 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, and CD276; and (ii) a therapeutically effective amount of a first vaccine
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with breast cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines CAMA-1, AU565, HS-578T, MCF-7, T47D and DMS 53, wherein: (a) CAMA-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) AU565 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modTERT; and (c) HS-578T is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (
  • the present disclosure provides a method of treating breast cancer in a human subject comprising administering (i) a therapeutically effective amount of a first vaccine composition comprising therapeutically effective amounts of cancer cell lines CAMA-1, AU565, and HS-578T, wherein: (a) CAMA-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) AU565 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modTERT; and (c) HS-578T is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2 and CD276; and (ii) a therapeutically
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with NSCLC in a human subject comprising: a. orally administering cyclophosphamide daily for one week at a dose of 50 mg/day; b.
  • TAAs tumor associated antigens
  • a vaccine comprising a first and second composition
  • the first composition comprises therapeutically effective amounts of lung cancer cell lines NCI-H460, NCI-H520, and A549; wherein (a) NCI-H460 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (b) NCI-H520 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) A549 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and the second composition comprises therapeutically effective amounts of lung cancer cell lines DMS 53, LK-2, and NCI-H23; wherein (d)
  • the present disclosure provides a method of stimulating an immune response specific to tumor associated antigens (TAAs) associated with a cancer in a human subject comprising: a. orally administering cyclophosphamide daily for one week at a dose of 50 mg/day; b. after said one week in (a), further administering a first dose of a vaccine comprising a first and second composition, wherein the first composition is a composition provided herein; and the second composition is a different composition provided herein; c. after said one week in (a), further administering via injection a first dose of a composition comprising pembrolizumab at a dosage of 200 mg; d.
  • TAAs tumor associated antigens
  • the present disclosure provides a method of stimulating an immune response specific to TAAs associated with NSCLC in a human subject comprising: a. orally administering cyclophosphamide daily for one week at a dose of 50 mg/day; b.
  • a vaccine comprising a first and second composition
  • the first composition comprises therapeutically effective amounts of lung cancer cell lines NCI-H460, NCI-H520, and A549; wherein (a) NCI-H460 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (b) NCI-H520 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (c) A549 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and the second composition comprises therapeutically effective amounts of lung cancer cell lines DMS 53, LK-2, and NCI-H23; wherein (d)
  • composition comprising durvalumab at 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 and 30 weeks following said first dose in (c) at a dosage of 10 mg/kg; wherein the first composition is administered intradermally in the subject's arm, and the second composition is administered intradermally in the subject's thigh.
  • the present disclosure provides a method of stimulating an immune response specific to TAAs associated with NSCLC in a human subject comprising: a. orally administering cyclophosphamide daily for one week at a dose of 50 mg/day; b. after said one week in (a), further administering a first dose of a vaccine comprising a first and second composition, wherein the first composition is a composition provided herein and the second composition is a different composition provided herein; c. after said one week in (a), further administering via injection a first dose of a composition comprising durvalumab at a dosage of 10 mg/kg; d.
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises cells of lung cancer cell lines NCI-H460, NCIH520, A549, DMS 53, LK-2, and NCI-H23, and wherein: (a) NCI-H460 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (b) NCI-H520 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (c) A549 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (d) DMS 53 is modified to (i) increase expression of GM-CSF, and membrane bound CD40L; and (ii
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises cells of cancer cell lines LN-229, GB-1, SF-126, DBTRG-05MG, KNS 60, and DMS 53, wherein: (a) LN-229 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; and (iii) modified to express modPSMA; (b) GB-1 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (c) SF-126 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTERT; (d) DMS 53 is modified to (i) increase expression of GM-CSF and
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises cells of cancer cell lines HCT-15, RKO, HuTu-80, HCT-116, LS411N and DMS 53, wherein: (a) HCT-15 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) RKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (c) HuTu-80 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (d) HCT-116 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; (ii
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises cells of cancer cell lines PC3, NEC8, NTERA-2cl-D1, DU-145, LNCaP, and DMS 53, wherein: (a) PC3 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTBXT and modMAGEC2; (b) NEC8 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; (c) NTERA-2cl-D1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; (d) DU-145 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L;
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises cells of cancer cell lines J82, HT-1376, TCCSUP, SCaBER, UM-UC-3 and DMS 53, wherein: (a) J82 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modPSMA; (b) HT-1376 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (c) TCCSUP is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (d) SCaBER is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises cells of cancer cell lines OVTOKO, MCAS, TOV-112D, TOV-21G, ES-2and DMS 53, wherein: (a) OVTOKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) MCAS is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modhTERT; (c) TOV-112D is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modFSHR and modMAGEA10; (d) TOV-21G is
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises cells of cancer cell lines HSC-4, HO-1-N-1, DETROIT 562, KON, OSC-20 and DMS 53, wherein: (a) HSC-4 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) HO-1-N-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPRAME and modTBXT; (c) DETROIT 562 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (d)
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises approximately cells of cancer cell lines MKN-1, MKN-45, MKN-74, OCUM-1, Fu97 and DMS 53, wherein: (a) MKN-1is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA and modLYK6; (b) MKN-45 is modified to (i) increase expression of GM-CSF, IL- 12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; (c) MKN-74 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, and CD276; (d) OCUM-1 is modified to (i) increase expression of GM-C
  • the present disclosure provides a kit comprising six vials, wherein each vial comprises cells of cancer cell lines CAMA-1, AU565, HS-578T, MCF-7, T47D and DMS 53, wherein: (a) CAMA-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) AU565 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modTERT; and (c) HS-578T is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2 and CD276; (d) MCF-7 is modified to (i) increase expression of GM-
  • the present disclosure provides a unit dose of a lung cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of lung cancer cell lines NCI-H460, NCIH520, A549, DMS 53, LK-2, and NCI-H23; wherein: (a) NCI-H460 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (b) NCI-H520 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (c) A549 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (d) DMS 53 is modified to (i) increase expression of GM-CSF and membrane bound CD
  • the present disclosure provides a unit dose of a cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of cancer cell lines LN-229, GB-1, SF-126, DBTRG-05MG, KNS 60, and DMS 53, wherein: (a) LN-229 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; and (iii) modified to express modPSMA (b) GB-1 is modified to (i) increase expression of GM-CSF and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (c) SF-126 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modhTERT; (d) DMS 53 is modified to (i)
  • the present disclosure provides a unit dose of a cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of cancer cell lines HCT-15, RKO, HuTu-80, HCT-116, LS411N and DMS 53, wherein: (a) HCT-15 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) RKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (c) HuTu-80 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (d) HCT-116 is modified to (i) increase expression of GM-CSF and
  • the present disclosure provides a unit dose of a cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of cancer cell lines PC3, NEC8, NTERA-2cl-D1, DU-145, LNCaP, and DMS 53, wherein: (a) PC3 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTBXT and modMAGEC2; (b) NEC8 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; (c) NTERA-2cl-D1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of CD276; (d) DU-145 is modified to (i) increase expression of GM-CSF
  • the present disclosure provides a unit dose of a cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of cancer cell lines J82, HT-1376, TCCSUP, SCaBER, UM-UC-3 and DMS 53, wherein: (a) J82 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modPSMA; (b) HT-1376 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (c) TCCSUP is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; (d) SCaBER is modified to (i) increase expression of GM-C
  • the present disclosure provides a unit dose of a cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of cancer cell lines OVTOKO, MCAS, TOV-112D, TOV-21G, ES-2and DMS 53, wherein: (a) OVTOKO is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1 and CD276; (b) MCAS is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modTERT; (c) TOV-112D is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modFSHR and modMAGEA10;
  • the present disclosure provides a unit dose of a cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of cancer cell lines HSC-4, HO-1-N-1, DETROIT 562, KON, OSC-20 and DMS 53, wherein: (a) HSC-4 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) HO-1-N-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPRAME and modTBXT; (c) DETROIT 562 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF
  • the present disclosure provides a unit dose of a cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of cancer cell lines MKN-1, MKN-45, MKN-74, OCUM-1, Fu97 and DMS 53, wherein: (a) MKN-1is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA and modLYK6; (b) MKN-45 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 1 and CD276; (c) MKN-74 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, and CD276; (d) OCUM-1 is modified to (i)
  • the present disclosure provides a unit dose of a cancer vaccine comprising six compositions wherein each composition comprises approximately 1.0 ⁇ 10 7 cells of cancer cell lines CAMA-1, AU565, HS-578T, MCF-7, T47D and DMS 53, wherein: (a) CAMA-1 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2, and CD276; and (iii) modified to express modPSMA; (b) AU565 is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; (ii) decrease expression of TGF ⁇ 2 and CD276; and (iii) modified to express modTERT; and (c) HS-578T is modified to (i) increase expression of GM-CSF, IL-12, and membrane bound CD40L; and (ii) decrease expression of TGF ⁇ 1, TGF ⁇ 2 and CD276 (d) MCF-7 is modified to
  • an aforementioned composition wherein DMS 53 is further modified to increase expression of IL-12.
  • the present disclosure provides an aforementioned unit dose wherein DMS 53 is further modified to increase expression of IL-12.
  • an aforementioned kit is provided wherein DMS 53 is further modified to increase expression of IL-12.
  • the present disclosure provides an aforementioned method wherein DMS 53 is further modified to increase expression of IL-12.
  • FIGS. 1A and B show reduction of HLA-G mRNA and protein expression in cells stably transduced with shRNA knocking down HLA-G in comparison to controls.
  • FIGS. 2A and B show reduction of HLA-G expression increases IFN ⁇ production.
  • FIGS. 3A-C show reduction of CD47 expression in the A549 ( FIG. 3A ), NCI-H460 ( FIG. 3B ), and NCI-H520 ( FIG. 3C ) cell lines by zinc-finger nuclease (ZFN)-mediated gene editing.
  • ZFN zinc-finger nuclease
  • FIGS. 4A and B show reduction of CD47 in the NCI-H520 cell line increases phagocytosis ( FIG. 4A ) by monocyte-derived dendritic cells and macrophages and increases IFN ⁇ responses ( FIG. 4B ) in the ELISpot assay.
  • FIG. 5 shows ZFN-mediated gene editing of PD-L1 in the NCI-H460 cell line results in a 99% decrease in PD-L1 expression.
  • FIG. 6 shows ZFN-mediated gene editing of BST2 in the NCI-H2009 cell line results in a 98.5% reduction in BST2 expression.
  • FIGS. 7A-C show reduction of TGF ⁇ 1 and TGF ⁇ 2 in NCI-H460 cell line by shRNA ( FIG. 7A ), Cas9 ( FIG. 7B ), and ZFN-mediated ( FIG. 7C ) gene editing.
  • FIGS. 8A and B show shRNA mediated knockdown of TGF ⁇ 1 and/or TGF ⁇ 2 in the DMS 53 ( FIG. 8A ) cell line and NCI-H520 ( FIG. 8B ) cell line.
  • FIGS. 9A-E show the reduction of TGF ⁇ 1 and/or TGF ⁇ 2 in the NCI-H2023 ( FIG. 9A ), NCI-H23 ( FIG. 9B ), A549 ( FIG. 9C ), LK-2 ( FIG. 9D ), and NCI-H1703 ( FIG. 9E ) cell lines.
  • FIGS. 10A-C show that knockdown of TGF ⁇ 1, TGF ⁇ 2, or TGF ⁇ 1 and TGF ⁇ 2 in the NCI-H460 cell line significantly increases IFN ⁇ responses against the parental NCI-H460 cells and the Survivin (BIRC5) antigen.
  • FIGS. 11A and B show that loading dendritic cells (DCs) with lysate from NCI-H520 TGF ⁇ 1 KD cells increases IFN ⁇ responses against parental NCI-H460 cells upon re-stimulation in the IFN ⁇ ELISpot assay and in the mixed lymphocyte co-culture assay.
  • DCs dendritic cells
  • FIG. 12 shows the IFN ⁇ response comparison between TGF ⁇ 1 TGF ⁇ 2 knockdown and knockout.
  • FIG. 13 shows the proteomic comparison between TGF ⁇ 1 TGF ⁇ 2 knockdown and knockout.
  • FIGS. 14A-F show IFN ⁇ responses against unmodified parental cell lines elicited by exemplary combinations of TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines.
  • FIGS. 15A and B show IFN ⁇ responses to cancer antigens elicited by exemplary combinations of TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines.
  • FIGS. 16A and B show reduction of HLA-E expression in the RERF-LC-Ad1 cell line increases cellular immune responses.
  • FIGS. 17A and B show reduction of CTLA-4 expression in the NCI-H520 cell line increases cellular immune responses.
  • FIGS. 18A and B show reduction of CD276 in the A549 cell line increases cellular immune responses.
  • FIGS. 19A-D show reduction of CD47 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the NCI-H2023 cell line.
  • FIGS. 20A-D show reduction of CD47 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the NCI-H23 cell line.
  • FIGS. 21A-D show reduction of CD47 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the A549 cell line.
  • FIGS. 22A-D show reduction of CD47 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the NCI-H460 cell line.
  • FIGS. 23A-C show reduction of CD47 expression and TGF ⁇ 1 secretion in the NCI-H1703 cell line.
  • FIGS. 24A-C show reduction of CD47 expression and TGF ⁇ 2 secretion in the LK-2 cell line.
  • FIGS. 25A-C show reduction of CD47 expression and TGF ⁇ 2 secretion in the DMS 53 cell line.
  • FIGS. 26A-C show reduction of CD47 expression and TGF ⁇ 2 secretion in the NCI-H520 cell line.
  • FIGS. 27A-D show reduction of CD276 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the NCI-H2023 cell line.
  • FIGS. 28A-D show reduction of CD276 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the NCI-H23 cell line.
  • FIGS. 29A-D show reduction of CD276 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the A549 cell line.
  • FIGS. 30A-D show reduction of CD276 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the NCI-H460 cell line.
  • FIGS. 31A-C show reduction of CD276 expression and TGF ⁇ 1 secretion in the NCI-H1703 cell line.
  • FIGS. 32A-C show reduction of CD276 expression and TGF ⁇ 2 secretion in the LK-2 cell line.
  • FIGS. 33A-C show reduction of CD276 expression an TGF ⁇ 2 secretion in the DMS 53 cell line.
  • FIGS. 34A-C show reduction of CD276 expression and TGF ⁇ 2 secretion in the NCI-H520 cell line.
  • FIGS. 35A and B show reduction of CD276 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the NCI-H460 ( FIG. 35A ) and A549 ( FIG. 35B ) cell lines increases cellular immune responses.
  • FIGS. 36A-D show reduction of CD47 and CD276 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion in the A549 cell line.
  • FIGS. 37A and B show reduction of CD47 and CD276 expression and TGF ⁇ 1 and TGF ⁇ 2 secretion increases immunogenicity.
  • FIGS. 38A-D show expression of membrane bound CD40L in the A549 cell line increases dendritic cell (DC) maturation and cellular immune responses.
  • DC dendritic cell
  • FIG. 39 shows overexpression of GM-CSF in the NCI-H460 cell line increases cellular immune responses.
  • FIG. 40 shows expression of IL-12 in the A549 cell line increases cellular immune responses.
  • FIGS. 41A-D show expression of GITR in the NCI-H520 ( FIG. 41A ), A549 ( FIG. 41B ), LK-2 ( FIG. 41C ), and NCI-H460 ( FIG. 41D ) cell lines.
  • FIGS. 42A-D show expression of GITR enhances cellular immune responses.
  • FIGS. 43A and B show expression of IL-15 enhances cellular immune responses.
  • FIGS. 44A and B show expression of IL-23 enhances cellular immune responses.
  • FIG. 45 shows the expression of XCL1.
  • FIGS. 46A-E show expression of Mesothelin and increased mesothelin-specific IFN ⁇ responses in the NCI-H520 cell line ( FIG. 46A ), LK-2 cell line ( FIG. 46B and FIG. 46E ), A549 cell line ( FIG. 46C ), and NCI-H460 cell line ( FIG. 46D ).
  • FIG. 47 shows the expression of CT83.
  • FIGS. 48A-E show secretion of GM-CSF and expression of membrane bound CD40L in the A549 TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO cell line.
  • FIGS. 49A-E show secretion of GM-CSF and expression of membrane bound CD40L in the NCI-H460 TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO cell line.
  • FIGS. 50A-E show secretion of GM-CSF and expression of membrane bound CD40L in the A549 TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO cell line.
  • FIGS. 51A-E show secretion of GM-CSF and expression of membrane bound CD40L in the NCI-H460 TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO cell line.
  • FIGS. 52A-C show secretion of GM-CSF and expression of membrane bound CD40L in TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO or TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO cell lines increases cellular immune responses and DC maturation.
  • FIGS. 53A-F show secretion of GM-CSF, expression of membrane bound CD40L, and secretion of IL-12 in the A549 TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO cell line.
  • FIGS. 54A-F show secretion of GM-CSF, expression of membrane bound CD40L, and secretion of IL-12 in the NCI- H460 TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO cell line.
  • FIGS. 55A and B show secretion of GM-CSF, expression of membrane bound CD40L, and secretion of IL-12 by the A549 ( FIG. 55A ) and NCI-H460 ( FIG. 55B ) TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO cell lines increases antigen specific responses.
  • FIG. 56 shows the secretion of GM-CSF, expression of membrane bound CD40L, and secretion of IL-12 in the A549 TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO cell line.
  • FIGS. 57A-F show secretion of GM-CSF, expression of membrane bound CD40L, and secretion of IL-12 in the NCI-H460 TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO cell line.
  • FIGS. 58A-D show secretion of GM-CSF, expression of membrane bound CD40L, and secretion of IL-12 by the A549 and NCI-H460 TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO cell lines increases DC maturation and antigen specific responses.
  • FIG. 59 shows that HLA mismatch results in increased immunogenicity.
  • FIG. 60 shows the expression of NSCLC antigens in certain cell lines.
  • FIGS. 61A-C show a comparison of endogenous TAA expression profiles of NSCLC vaccines and Belagenpumatucel-L.
  • FIGS. 62A and B show IFN ⁇ responses elicited by single lines compared to cocktails of cell lines.
  • FIG. 63 shows IFN ⁇ responses against selected antigens.
  • FIG. 64 shows expression of membrane bound CD40L on the NSCLC vaccine cell lines.
  • FIGS. 65A and B show expression of CT83 and Mesothelin by the LK-2 cell line and IFN ⁇ responses to the CT83 and mesothelin antigens.
  • FIGS. 66A and B show a comparison of IFN ⁇ responses generated by belagenpumatucel-L and NSCLC vaccine.
  • FIGS. 67A and B show a comparison of IFN ⁇ responses generated by belagenpumatucel-L and NSCLC vaccine in individual donors.
  • FIGS. 68A-C show endogenous expression of GBM antigens ( FIG. 68A ) and GBM CSC-like markers in candidate vaccine cell lines ( FIG. 68B ) and GBM patient tumor samples ( FIG. 68C ).
  • FIGS. 69A-C show IFN ⁇ responses elicited by single candidate GBM vaccine cell lines ( FIG. 69A ) and in cocktails of cell lines ( FIGS. 69B-C ).
  • FIGS. 70A and B show endogenous expression of GBM antigens by the GBM vaccine cell lines ( FIG. 70A ) and the number of GBM antigens expressed by the vaccine cell lines also expressed in GBM patient tumors ( FIG. 70B ).
  • FIGS. 71A-K show the expression of and IFN ⁇ responses to antigens introduced in the GBM vaccine cell lines compared to unmodified controls.
  • Expression of modMAGEA1, EGFRvIII and pp65 by KNS 60 FIGS. 71C-F
  • IFN ⁇ responses to MAGEA1, EGFRvIII and pp65 FIGS. 71I-K
  • FIG. 72 shows expression of membrane bound CD40L by the GBM vaccine component cell lines.
  • FIG. 73A-C shows antigen specific IFN ⁇ responses induced by the unit dose of the GBM vaccine ( FIG. 73A ), GBM vaccine-A ( FIG. 73B ), and GBM vaccine-B ( FIG. 73C ) compared to unmodified controls.
  • FIG. 74 shows antigen specific IFN ⁇ responses induced by the unit dose of the GBM vaccine in individual donors compared to unmodified controls.
  • FIGS. 75A-C show endogenous expression of CRC antigens ( FIG. 75A ) and CRC CSC-like markers in selected cell lines ( FIG. 75B ) and CRC patient tumor samples ( FIG. 75C ).
  • FIGS. 76A-C show IFN ⁇ responses elicited by single candidate CRC vaccine cell lines ( FIG. 76A ) and in cocktails ( FIGS. 76B and C).
  • FIG. 77 shows IFN ⁇ responses elicited by single candidate CRC vaccine cell lines alone compared to cocktails of cell lines.
  • FIG. 78A and B shows endogenous expression of CRC antigens by the CRC vaccine cell lines ( FIG. 78A ) and the number of CRC antigens expressed by the vaccine cell lines also expressed in CRC patient tumors ( FIG. 78B ).
  • FIGS. 79A-J show the expression of and IFN ⁇ responses to antigens introduced in the CRC vaccine cell lines compared to unmodified controls.
  • FIG. 80 shows expression of membrane bound CD40L by the CRC vaccine component cell lines.
  • FIGS. 81A-C show antigen specific IFN ⁇ responses induced by the unit dose of the CRC vaccine ( FIG. 81A ), CRC vaccine-A ( FIG. 81B ) and CRC vaccine-B ( FIG. 81C ) compared to unmodified controls.
  • FIG. 82 shows antigen specific IFN ⁇ responses induced by the unit dose of the CRC vaccine in individual donors compared to unmodified controls.
  • FIG. 83 shows antigen specific IFN ⁇ responses induced by CRC vaccine cell lines alone and in cocktails of cell lines.
  • FIG. 84 shows endogenous expression of PCa antigens in candidate and final PCa vaccine cell line components.
  • FIGS. 85A and B show antigens expressed by the PCa vaccine in PCa patient tumors ( FIG. 85A ) and the number of PCa antigens expressed by the vaccine cell lines also expressed in PCa patient tumors ( FIG. 85B ).
  • FIGS. 86A-D show IFN ⁇ responses elicited by individual PCa candidate vaccine cell lines alone ( FIG. 86A ) and in cocktails ( FIGS. 86B-C ) of cell lines and that unmodified LNCaP, NEC8, and NTERA-2cl-D1cell lines are more immunogenic in cocktails ( FIG. 86D )
  • FIGS. 87A-F show the expression of and IFN ⁇ responses to antigens introduced in the PCa vaccine cell lines compared to unmodified controls.
  • FIG. 88 shows expression of membrane bound CD40L by the PCa vaccine component cell lines.
  • FIGS. 89A-C show antigen specific IFN ⁇ responses induced by the unit dose of the PCa vaccine ( FIG. 89A ), PCa vaccine-A ( FIG. 89B ) and PCa vaccine-B ( FIG. 89C ) compared to unmodified controls.
  • FIG. 90 shows antigen specific IFN ⁇ responses induced by the unit dose of the PCa vaccine in individual donors compared to unmodified controls.
  • FIGS. 91A-E show the Pca vaccine cell lines as cocktails of cell lines are more immunogenic than single cell lines.
  • FIG. 91A shows IFN ⁇ responses to individual PCA vaccine-A cell lines.
  • Pca vaccine-A FIG. 91B and FIG. 91D
  • PCa vaccine-B FIG. 91C and FIG. 91E
  • FIGS. 92A and B show endogenous expression of bladder cancer antigens ( FIG. 92A ) and bladder cancer CSC-like markers ( FIG. 92B ) by candidate UBC vaccine cell lines.
  • FIGS. 93A-C show IFN ⁇ responses elicited by individual UBC candidate vaccine cell lines alone ( FIG. 93A ) and in cocktails ( FIG. 93B and FIG. 93C ).
  • FIGS. 94A-C show endogenous expression of bladder cancer antigens by UBC vaccine cell lines (94A), expression of these antigens patient tumors ( FIG. 94B ) and the number of bladder cancer antigens expressed by the UBC vaccine cell lines also expressed in bladder cancer patient tumors ( FIG. 94C ).
  • FIGS. 95A-H show the expression of and IFN ⁇ responses to antigens introduced in the UBC vaccine cell lines compared to unmodified controls.
  • FIG. 96 shows expression of membrane bound CD40L by the UBC vaccine component cell lines.
  • FIGS. 97A-C show antigen specific IFN ⁇ responses induced by the unit dose of the UBC vaccine ( FIG. 97A ), UBC vaccine-A ( FIG. 97B ), and UBC vaccine-B ( FIG. 97C ) compared to unmodified controls.
  • FIG. 98 shows antigen specific IFN ⁇ responses induced by the unit dose of the UBC vaccine in individual donors compared to unmodified controls.
  • FIGS. 99A and B show endogenous expression of ovarian cancer antigens ( FIG. 99A ) and ovarian cancer CSC-like markers ( FIG. 99B ) by candidate ovarian cancer vaccine component cell lines.
  • FIGS. 100A-C show IFN ⁇ responses elicited by individual OC candidate vaccine cell lines alone ( FIG. 100A ) and in cocktails ( FIG. 100B and FIG. 100C ).
  • FIGS. 101A-C show endogenous antigen expression by selected OC vaccine component cell lines ( FIG. 101A ) expression of these antigens patient tumors ( FIG. 101B ) and the number of ovarian cancer antigens expressed by the OC vaccine cell lines also expressed in ovarian cancer patient tumors ( FIG. 101C ).
  • FIGS. 102A-L show the expression of and IFN ⁇ responses to antigens introduced in the OC vaccine cell lines compared to unmodified controls.
  • FIG. 103A and B show IFN ⁇ responses to the unmodified and vaccine component cell lines TOV-21G ( FIG. 103A ) and ES-2 ( FIG. 103B ) cell lines.
  • FIG. 104 shows expression of membrane bound CD40L by the OC vaccine component cell lines.
  • FIGS. 105A-C show antigen specific IFN ⁇ responses induced by the unit dose of the OC vaccine ( FIG. 105A ), OC vaccine-A ( FIG. 105B ), and OC vaccine-B ( FIG. 105C ) compared to unmodified controls.
  • FIG. 106 shows antigen specific IFN ⁇ responses induced by the unit dose of the OC vaccine in individual donors compared to unmodified controls.
  • FIGS. 107A and B show endogenous expression of head and neck cancer antigens ( FIG. 107A ) and of head and neck cancer CSC-like markers ( FIG. 107B ) by candidate and selected head and neck cancer vaccine component cell lines.
  • FIGS. 108A and B show expression of antigens in patient tumors also expressed by selected HN vaccine component cell lines ( FIG. 108A ) and the number of head and neck cancer antigens expressed by the HN vaccine cell lines also expressed in head and neck cancer patient tumors ( FIG. 108B ).
  • FIGS. 109A-E show IFN ⁇ responses elicited by individual HN candidate vaccine cell lines alone ( FIG. 109A ), and in cocktails of cell lines ( FIG. 109B and FIG. 109C ), most HN cell lines are more immunogenic in cocktails ( FIG. 109D ), and the modified HN vaccine component cell lines are more immunogenic than the parental cell lines ( FIG. 109E ).
  • FIGS. 110A-K show expression of modPSMA by HSC-4 ( FIG. 110A ) and IFN ⁇ responses to PSMA ( FIG. 110E ), expression of modPRAME ( FIG. 110B ) and modTBXT ( FIG. 110C ) by HO-1-N-1 ( FIG. 110A ) and IFN ⁇ responses to PRAME ( FIG. 110F ) and TBXT ( FIG. 110G ), expression of HPV16 and HPV18 E6 and E7 by KON ( FIG. 110D ) and IFN ⁇ responses to HPV16 E6 and E7 in all donors ( FIG. 110H ) and individual donors ( FIG. 110I ), and IFN ⁇ responses to HPV18 E6 and E7 in all donors ( FIG. 110J ) and individual donors ( FIG. 110K ).
  • FIG. 111 shows expression of membrane bound CD40L by the HN vaccine component cell lines.
  • FIGS. 112A-F show antigen specific IFN ⁇ responses induced by the unit dose of the HN vaccine ( FIG. 112A ) all HN antigens and non-viral HN antigens ( FIG. 112D ), HN vaccine-A ( FIG. 112B ) to all HN antigens and to non-viral HN antigens ( FIG. 112E ) and HN vaccine-B to all HN antigens ( FIG. 112C ) and non-viral HN antigens ( FIG. 112F ) compared to unmodified controls.
  • FIGS. 113A and B show antigen specific responses in individual donors to all HN antigens (top panel) and to non-viral HN antigens (bottom panel).
  • FIGS. 114A and B show endogenous expression of gastric cancer antigens ( FIG. 114A ) and gastric cancer CSC-like markers ( FIG. 114B ) by candidate ovarian cancer vaccine component cell lines.
  • FIGS. 115A-C show IFN ⁇ responses elicited by individual GCA candidate vaccine cell lines alone ( FIG. 115A ) and in cocktails ( FIG. 115B and FIG. 115C ).
  • FIGS. 116A-C show endogenous antigen expression by selected GCA vaccine component cell lines ( FIG. 116A ) expression of these antigens patient tumors ( FIG. 116B ) and the number of gastric cancer antigens expressed by the GCA vaccine cell lines also expressed in gastric cancer patient tumors ( FIG. 116C ).
  • FIGS. 117A-H show expression of modPSMA ( FIG. 117A ) and modLY6K ( FIG. 117B ) by MKN-1 and IFN ⁇ responses to PSMA ( FIG. 117E ) and LY6K ( FIG. 117F ), show expression of modWT1 ( FIG. 117C ) and modCLDN18 ( FIG. 117D ) by Fu97 and IFN ⁇ responses to WT1 ( FIG. 117G ) and CLDN18 ( FIG. 117H ).
  • FIG. 118 shows expression of membrane bound CD40L by the GCA vaccine component cell lines.
  • FIGS. 119A-C show antigen specific IFN ⁇ responses induced by the unit dose of the GCA vaccine ( FIG. 119A ), GCA vaccine-A ( FIG. 119B ), and GCA vaccine-B ( FIG. 119C ) compared to unmodified controls.
  • FIG. 120 shows antigen specific IFN ⁇ responses induced by the unit dose of the GCA vaccine in individual donors compared to unmodified controls.
  • FIGS. 121A and B show endogenous expression of breast cancer antigens ( FIG. 121A ) and breast cancer CSC-like markers ( FIG. 121B ) by candidate breast cancer vaccine component cell lines.
  • FIGS. 122A-D show IFN ⁇ responses elicited by individual BRC candidate vaccine cell lines alone ( FIG. 122A and FIG. 122C ) and in cocktails ( FIG. 122B , FIG. 122C , and FIG. 122D ).
  • FIGS. 123A-C show endogenous antigen expression by selected BRC vaccine component cell lines ( FIG. 123A ) expression of these antigens in patient tumors ( FIG. 123B ) and breast cancer patient tumors ( FIG. 123C ).
  • FIGS. 124A-H show expression of modPSMA by CAMA-1 ( FIG. 124A ) and IFN ⁇ responses to PSMA ( FIG. 124E ), show expression of modTERT by AU565 ( FIG. 124B ) and IFN ⁇ responses to TERT ( FIG. 124F ), and show expression of modTBXT ( FIG. 124C ) and ModBORIS ( FIG. 124D ) by T47D and IFN ⁇ responses to TBXT ( FIG. 124G ) and BORIS ( FIG. 124H ).
  • FIG. 125 shows expression of membrane bound CD40L by the BRC vaccine component cell lines.
  • FIGS. 126A-C show antigen specific IFN ⁇ responses induced by the unit dose of the BRC vaccine ( FIG. 126A ), BRC vaccine-A ( FIG. 126B ) and BRC vaccine-B ( FIG. 126C ) compared to unmodified controls.
  • FIGS. 127 shows antigen specific IFN ⁇ responses induced by the unit dose of the BRC vaccine in individual donors compare to unmodified controls.
  • FIGS. 128A-D show BRC vaccine-A ( FIG. 128A and FIG. 128C ) and BRC vaccine-B ( FIG. 128B and FIG. 128D ) compositions induce a greater breadth and magnitude of antigen specific responses compared to single component cell lines.
  • FIG. 129 shows the sequence alignment between human native PSMA (huPSMA; SEQ ID NO: 70) and the designed PSMA with non-synonymous mutations (NSMs) (PSMAmod; SEQ ID NO: 38).
  • FIG. 130A-C shows HLA supertype frequency pairs in a population.
  • FIG. 131 shows the number of neoepitopes existing in the cell lines of a vaccine composition and designed neoepitopes in GBM recognized by donors expressing HLA-A and HLA-B supertype pairs within the population subsets described in FIG. 131 .
  • FIG. 132 shows the number of neoepitopes targeted by four different mRNA immunotherapies.
  • Embodiments of the present disclosure provide a platform approach to cancer vaccination that provides both breadth, in terms of the types of cancer amenable to treatment by the compositions, methods, and regimens disclosed, and magnitude, in terms of the immune responses elicited by the compositions, methods, and regimens disclosed.
  • intradermal injection of an allogenic whole cancer cell vaccine induces a localized inflammatory response recruiting immune cells to the injection site.
  • antigen presenting cells APCs
  • VME skin microenvironment
  • LCs Langerhans cells
  • DCs dermal dendritic cells
  • TAAs tumor associated antigens
  • the priming occurs in vivo and not in vitro or ex vivo.
  • the multitude of TAAs expressed by the vaccine cell lines are also expressed a subject's tumor. Expansion of antigen specific T cells at the draining lymph node and the trafficking of these T cells to the tumor microenvironment (TME) can initiate a vaccine-induced anti-tumor response.
  • Immunogenicity of an allogenic vaccine can be enhanced through genetic modifications of the cell lines comprising the vaccine composition to introduce TAAs (native/wild-type or designed/mutated as described herein). Immunogenicity of an allogenic vaccine can be further enhanced through genetic modifications of the cell lines comprising the vaccine composition to reduce expression of immunosuppressive factors and/or increase the expression or secretion of immunostimulatory signals. Modulation of these factors can enhance the uptake of vaccine cell components by LCs and DCs in the dermis, facilitate the trafficking of DCs and LCs to the draining lymph node, and enhance effector T cell and B cell priming in the draining lymph node, thereby providing more potent anti-tumor responses.
  • the present disclosure provides an allogeneic whole cell cancer vaccine platform that includes compositions and methods for treating cancer, and/or preventing cancer, and/or stimulating an immune response.
  • Criteria and methods according to embodiments of the present disclosure include without limitation: (i) criteria and methods for cell line selection for inclusion in a vaccine composition, (ii) criteria and methods for combining multiple cell lines into a therapeutic vaccine composition, (iii) criteria and methods for making cell line modifications, and (iv) criteria and methods for administering therapeutic compositions with and without additional therapeutic agents.
  • the present disclosure provides an allogeneic whole cell cancer vaccine platform that includes, without limitation, administration of multiple cocktails comprising combinations of cell lines that together comprise one unit dose, wherein unit doses are strategically administered over time, and additionally optionally includes administration of other therapeutic agents such as cyclophosphamide and additionally optionally a checkpoint inhibitor.
  • the present disclosure provides, in some embodiments, compositions and methods for tailoring a treatment regimen for a subject based on the subject's tumor type.
  • the present disclosure provides a cancer vaccine platform whereby allogeneic cell line(s) are identified and optionally modified and administered to a subject.
  • the tumor origin (primary site) of the cell line(s), the amount and number of TAAs expressed by the cell line(s), the number of cell line modifications, and the number of cell lines included in a unit dose are each customized based on the subject's tumor type, stage of cancer, and other considerations
  • the tumor origin of the cell lines may be the same or different than the tumor intended to be treated.
  • the cancer cell lines may be cancer stem cell lines.
  • cell refers to a cell line that originated from a cancerous tumor as described herein, and/or originates from a parental cell line of a tumor originating from a specific source/organ/tissue.
  • the cancer cell line is a cancer stem cell line as described herein.
  • the cancer cell line is known to express or does express multiple tumor-associated antigens (TAAs) and/or tumor specific antigens (TSAs).
  • TAAs tumor-associated antigens
  • TSAs tumor specific antigens
  • a cancer cell line is modified to express, or increase expression of, one or more TAAs.
  • the cancer cell line includes a cell line following any number of cell passages, any variation in growth media or conditions, introduction of a modification that can change the characteristics of the cell line such as, for example, human telomerase reverse transcriptase (hTERT) immortalization, use of xenografting techniques including serial passage through xenogenic models such as, for example, patient-derived xenograft (PDX) or next generation sequencing (NGS) mice, and/or co-culture with one or more other cell lines to provide a mixed population of cell lines.
  • hTERT human telomerase reverse transcriptase
  • the term “cell line” includes all cell lines identified as having any overlap in profile or segment, as determined, in some embodiments, by Short Tandem Repeat (STR) sequencing, or as otherwise determined by one of skill in the art.
  • the term “cell line” also encompasses any genetically homogeneous cell lines, in that the cells that make up the cell line(s) are clonally derived from a single cell such that they are genetically identical. This can be accomplished, for example, by limiting dilution subcloning of a heterogeneous cell line.
  • cell line also encompasses any genetically heterogeneous cell line, in that the cells that make up the cell line(s) are not expected to be genetically identical and contain multiple subpopulations of cancer cells.
  • Various examples of cell lines are described herein. Unless otherwise specifically stated, the term “cell line” or “cancer cell line” encompasses the plural “cell lines.”
  • tumor refers to an accumulation or mass of abnormal cells. Tumors may be benign (non-cancerous), premalignant (pre-cancerous, including hyperplasia, atypia, metaplasia, dysplasia and carcinoma in situ), or malignant (cancerous). It is well known that tumors may be “hot” or “cold”. By way of example, melanoma and lung cancer, among others, demonstrate relatively high response rates to checkpoint inhibitors and are commonly referred to as “hot” tumors.
  • compositions and methods provided herein are useful to treat or prevent cancers with associated hot tumors.
  • compositions and methods provided herein are useful to treat or prevent cancers with cold tumors.
  • Embodiments of the vaccine compositions of the present disclosure can be used to convert cold (i.e., treatment-resistant or refractory) cancers or tumors to hot (i.e., amenable to treatment, including a checkpoint inhibition-based treatment) cancers or tumors.
  • compositions described herein comprise a multitude of potential neoepitopes arising from point-mutations that can generate a multitude of exogenous antigenic epitopes. In this way, the patients' immune system can recognize these epitopes as non-self, subsequently break self-tolerance, and mount an anti-tumor response to a cold tumor, including induction of an adaptive immune response to wide breadth of antigens (See Leko, V. et al. J Immunol (2019)).
  • cancer stem cells are responsible for initiating tumor development, cell proliferation, and metastasis and are key components of relapse following chemotherapy and radiation therapy.
  • a cancer stem cell line or a cell line that displays cancer stem cell characteristics is included in one or more of the vaccine compositions.
  • cancer stem cell CSC
  • cancer stem cell line refers to a cell or cell line within a tumor that possesses the capacity to self-renew and to cause the heterogeneous lineages of cancer cells that comprise the tumor.
  • CSCs are highly resistant to traditional cancer therapies and are hypothesized to be the leading driver of metastasis and tumor recurrence.
  • a cell line that displays cancer stem cell characteristics is included within the definition of a “cancer stem cell”.
  • Exemplary cancer stem cell markers identified by primary tumor site are provided in Table 2 and described herein. Cell lines expressing one or more of these markers are encompassed by the definition of “cancer stem cell line”. Exemplary cancer stem cell lines are described herein, each of which are encompassed by the definition of “cancer stem cell line”.
  • each cell line or a combination of cell lines refers to, where multiple cell lines are provided in a combination, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more or the combination of the cell lines.
  • the phrase “each cell line or a combination of cell lines have been modified” refers to, where multiple cell lines are provided in combination, modification of one, some, or all cell lines, and also refers to the possibility that not all of the cell lines included in the combination have been modified.
  • composition comprising a therapeutically effective amount of at least 3 cancer cell lines, wherein each cell line or a combination of the cell lines comprises cells that have been modified . . . ” means that each (i.e., all three) of the cell lines have been modified or that one or two of the three cell lines have been modified.
  • oncogene refers to a gene involved in tumorigenesis.
  • An oncogene is a mutated gene that contributes to the development of a cancer.
  • onocgenes are called proto-oncogenes, and they play roles in the regulation of cell division.
  • the phrase “identifying one or more . . . mutations,” for example in the process for preparing compositions useful for stimulating an immune response or treating cancer as described herein, refers to newly identifying, identifying within a database or dataset or otherwise using a series of criteria or one or more components thereof as described herein and, optionally, selecting the oncogene or mutation for use or inclusion in a vaccine composition as described herein.
  • TAAs tumor associated antigens
  • CCLE Cancer Cell Line Encyclopedia
  • the phrase “ . . . that is either not expressed or minimally expressed . . . ” means that the referenced gene or protein (e.g., a TAA or an immunosuppressive protein or an immunostimulatory protein) is not expressed by a cell line or is expressed at a low level, where such level is inconsequential to or has a limited impact on immunogenicity.
  • a TAA may be present or expressed in a cell line in an amount insufficient to have a desired impact on the therapeutic effect of a vaccine composition including said cell line.
  • the present disclosure provides compositions and methods to increase expression of such a TAA.
  • the term “equal” generally means the same value +/ ⁇ 10%.
  • a measurement such as number of cells, etc.
  • the term “approximately” refers to within 1, 2, 3, 4, or 5 such residues.
  • the term “approximately” refers to +/ ⁇ 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10%.
  • the phrase “ . . . wherein said composition is capable of stimulating a 1.3-fold increase in IFN ⁇ production compared to unmodified cancer cell lines . . . ” means, when compared to a composition of the same cell line or cell lines that has/have not been modified, the composition comprising a modified cell line or modified cell lines is capable of stimulating at least 1.3-fold more IFN ⁇ production.
  • “at least 1.3” means 1.3, 1.4, 1.5, etc., or higher.
  • IFN ⁇ production including, but not limited to, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 4.0, or 5.0-fold or higher increase in IFN ⁇ production compared to unmodified cancer cell lines (e.g., a modified cell line compared to an modified cell line, a composition of 2 or 3 modified cell lines (e.g., a vaccine composition) compared cell lines to the same composition comprising unmodified cell lines, or a unit dose comprising 6 modified cell lines compared to the same unit dose comprising unmodified cell lines).
  • unmodified cancer cell lines e.g., a modified cell line compared to an modified cell line, a composition of 2 or 3 modified cell lines (e.g., a vaccine composition) compared cell lines to the same composition comprising unmodified cell lines, or a unit dose comprising 6 modified cell lines compared to
  • the IFN ⁇ production is increased by approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-fold or higher compared to unmodified cancer cell lines.
  • the present disclosure provides compositions of modified cells or cell lines that are compared to unmodified cells or cell lines on the basis of TAA expression, immunostimulatory factor expression, immunosuppressive factor expression, and/or immune response stimulation using the methods provided herein and the methods known in the art including, but not limited to, ELISA, IFN ⁇ ELISpot, and flow cytometry.
  • fold increase refers to the change in units of expression or units of response relative to a control.
  • ELISA fold change refers to the level of secreted protein detected for the modified cell line divided by the level of secreted protein detected, or the lower limit of detection, by the unmodified cell line.
  • fold change in expression of an antigen by flow cytometry refers to the mean fluorescence intensity (MFI) of expression of the protein by a modified cell line divided by the MFI of the protein expression by the unmodified cell line.
  • IFN ⁇ ELISpot fold change refers to the average IFN ⁇ spot-forming units (SFU) induced across HLA diverse donors by the test variable divided by the average IFN ⁇ SFU induced by the control variable. For example, the average total antigen specific IFN ⁇ SFU across donors by a composition of three modified cell lines divided by the IFN ⁇ SFU across the same donors by a composition of the same three unmodified cell lines.
  • the fold increase in IFN ⁇ production will increase as the number of modifications (e.g., the number of immunostimulatory factors and the number of immunosuppressive factors) is increased in each cell line. In some embodiments, the fold increase in IFN ⁇ production will increase as the number of cell lines (and thus, the number of TAAs), whether modified or unmodified, is increased. The fold increase in IFN ⁇ production, in some embodiments, is therefore attributed to the number of TAAs and the number of modifications.
  • modified means genetically modified to express, overexpress, increase, decrease, or inhibit the expression of one or more protein or nucleic acid.
  • exemplary proteins include, but are not limited to immunostimulatory factors.
  • exemplary nucleic acids include sequences that can be used to knockdown (KD) (i.e., decrease expression of) or knockout (KO) (i.e., completely inhibit expression of) immunosuppressive factors.
  • KD knockdown
  • KO knockout
  • the term “decrease” is synonymous with “reduce” or “partial reduction” and may be used in association with gene knockdown.
  • inhibitor is synonymous with “complete reduction” and may be used in the context of a gene knockout to describe the complete excision of a gene from a cell.
  • the terms “patient”, “subject”, “recipient”, and the like are used interchangeably herein to refer to any mammal, including humans, non-human primates, domestic and farm animals, and other animals, including, but not limited to dogs, horses, cats, cattle, sheep, pigs, mice, rats, and goats.
  • Exemplary subjects are humans, including adults, children, and the elderly.
  • the subject can be a donor.
  • treat refers to reversing, alleviating, inhibiting the process of disease, disorder or condition to which such term applies, or one or more symptoms of such disease, disorder or condition and includes the administration of any of the compositions, pharmaceutical compositions, or dosage forms described herein, to prevent the onset of the symptoms or the complications, alleviate the symptoms or the complications, or eliminate the disease, condition, or disorder.
  • treatment can be curative or ameliorating.
  • preventing means preventing in whole or in part, controlling, reducing, or halting the production or occurrence of the thing or event to which such term applies, for example, a disease, disorder, or condition to be prevented.
  • Embodiments of the methods and compositions provided herein are useful for preventing a tumor or cancer, meaning the occurrence of the tumor is prevented or the onset of the tumor is significantly delayed.
  • the methods and compositions are useful for treating a tumor or cancer, meaning that tumor growth is significantly inhibited as demonstrated by various techniques well-known in the art such as, for example, by a reduction in tumor volume.
  • Tumor volume may be determined by various known procedures, (e.g., obtaining two dimensional measurements with a dial caliper). Preventing and/or treating a tumor can result in the prolonged survival of the subject being treated.
  • the term “stimulating”, with respect to an immune response is synonymous with “promoting”, “generating”, and “eliciting” and refers to the production of one or more indicators of an immune response.
  • Indicators of an immune response are described herein. Immune responses may be determined and measured according to the assays described herein and by methods well-known in the art.
  • a therapeutically effective amount indicates an amount necessary to administer to a subject, or to a cell, tissue, or organ of a subject, to achieve a therapeutic effect, such as an ameliorating or a curative effect.
  • the therapeutically effective amount is sufficient to elicit the biological or medical response of a cell, tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor, clinician, or healthcare provider.
  • a therapeutically effective amount of a composition is an amount of cell lines, whether modified or unmodified, sufficient to stimulate an immune response as described herein.
  • a therapeutically effective amount of a composition is an amount of cell lines, whether modified or unmodified, sufficient to inhibit the growth of a tumor as described herein. Determination of the effective amount or therapeutically effective amount is, in certain embodiments, based on publications, data or other information such as, for example, dosing regimens and/or the experience of the clinician.
  • administering refers to any mode of transferring, delivering, introducing, or transporting a therapeutic agent to a subject in need of treatment with such an agent.
  • modes include, but are not limited to, oral, topical, intravenous, intraarterial, intraperitoneal, intramuscular, intratumoral, intradermal, intranasal, and subcutaneous administration.
  • the term “vaccine composition” refers to any of the vaccine compositions described herein containing one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) cell lines. As described herein, one or more of the cell lines in the vaccine composition may be modified. In certain embodiments, one or more of the cell lines in the vaccine composition may not be modified.
  • the terms “vaccine”, “tumor cell vaccine”, “cancer vaccine”, “cancer cell vaccine”, “whole cancer cell vaccine”, “vaccine composition”, “composition”, “cocktail”, “vaccine cocktail”, and the like are used interchangeably herein. In some embodiments, the vaccine compositions described herein are useful to treat or prevent cancer.
  • the vaccine compositions described herein are useful to stimulate or elicit an immune response.
  • the term “immunogenic composition” is used.
  • the vaccine compositions described herein are useful as a component of a therapeutic regimen to increase immunogenicity of said regimen.
  • dose refers to one or more vaccine compositions that comprise therapeutically effective amounts of one more cell lines.
  • a “dose” or “unit dose” of a composition may refer to 1, 2, 3, 4, 5, or more distinct compositions or cocktails.
  • a unit dose of a composition refers to 2 distinct compositions administered substantially concurrently (i.e., immediate series).
  • one dose of a vaccine composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 separate vials, where each vial comprises a cell line, and where cell lines, each from a separate vial, are mixed prior to administration.
  • a dose or unit dose includes 6 vials, each comprising a cell line, where 3 cell lines are mixed and administered at one site, and the other 3 cell lines are mixed and administered at a second site. Subsequent “doses” may be administered similarly. In still other embodiments, administering 2 vaccine cocktails at 2 sites on the body of a subject for a total of 4 concurrent injections is contemplated.
  • cancer refers to diseases in which abnormal cells divide without control and are able to invade other tissues.
  • the phrase “ . . . associated with a cancer of a subject” refers to the expression of tumor associated antigens, neoantigens, or other genotypic or phenotypic properties of a subject's cancer or cancers.
  • TAAs associated with a cancer are TAAs that expressed at detectable levels in a majority of the cells of the cancer. Expression level can be detected and determined by methods described herein. There are more than 100 different types of cancer.
  • cancers are named for the organ or type of cell in which they start; for example, cancer that begins in the colon is called colon cancer; cancer that begins in melanocytes of the skin is called melanoma.
  • Cancer types can be grouped into broader categories. In some embodiments, cancers may be grouped as solid (i.e., tumor-forming) cancers and liquid (e.g., cancers of the blood such as leukemia, lymphoma and myeloma) cancers.
  • carcinoma meaning a cancer that begins in the skin or in tissues that line or cover internal organs, and its subtypes, including adenocarcinoma, basal cell carcinoma, squamous cell carcinoma, and transitional cell carcinoma
  • sarcoma meaning a cancer that begins in bone, cartilage, fat, muscle, blood vessels, or other connective or supportive tissue
  • leukemia meaning a cancer that starts in blood-forming tissue (e.g., bone marrow) and causes large numbers of abnormal blood cells to be produced and enter the blood
  • lymphoma and myeloma meaning cancers that begin in the cells of the immune system
  • central nervous system cancers meaning cancers that begin in the tissues of the brain and spinal cord).
  • myelodysplastic syndrome refers to a type of cancer in which the bone marrow does not make enough healthy blood cells (white blood cells, red blood cells, and platelets) and there are abnormal cells in the blood and/or bone marrow.
  • Myelodysplastic syndrome may become acute myeloid leukemia (AML).
  • compositions and methods described herein are used to treat and/or prevent the cancer described herein, including in various embodiments, lung cancer (e.g., non-small cell lung cancer or small cell lung cancer), prostate cancer, breast cancer, triple negative breast cancer, metastatic breast cancer, ductal carcinoma in situ, invasive breast cancer, inflammatory breast cancer, Paget disease, breast angiosarcoma, phyllodes tumor, testicular cancer, colorectal cancer, bladder cancer, gastric cancer, head and neck cancer, liver cancer, renal cancer, glioma, gliosarcoma, astrocytoma, ovarian cancer, neuroendocrine cancer, pancreatic cancer, esophageal cancer, endometrial cancer, melanoma, mesothelioma, and/or hepatocellular cancers.
  • lung cancer e.g., non-small cell lung cancer or small cell lung cancer
  • breast cancer triple negative breast cancer
  • metastatic breast cancer ductal carcinoma in situ
  • invasive breast cancer inflammatory
  • carcinomas include, without limitation, giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in an adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor; branchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; f
  • sarcomas include, without limitation, glomangiosarcoma; sarcoma; fibrosarcoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyo sarcoma; alveolar rhabdomyo sarcoma; stromal sarcoma; carcinosarcoma; synovial sarcoma; hemangiosarcoma; kaposi's sarcoma; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibros
  • leukemias include, without limitation, leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; and hairy cell leukemia.
  • lymphomas and myelomas include, without limitation, malignant lymphoma; hodgkin's disease; hodgkin's; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-hodgkin's lymphomas; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; and multiple myeloma.
  • brain/spinal cord cancers include, without limitation, pinealoma, malignant; chordoma; glioma, gliosarcoma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; and neurilemmoma, malignant.
  • cancers include, without limitation, a thymoma; an ovarian stromal tumor; a thecoma; a granulosa cell tumor; an androblastoma; a leydig cell tumor; a lipid cell tumor; a paraganglioma; an extra-mammary paraganglioma; a pheochromocytoma; blue nevus, malignant; fibrous histiocytoma, malignant; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; mesothelioma, malignant; dysgerminoma; teratoma, malignant; struma ovarii, malignant; mesonephroma, malignant; hemangioendothelioma, malignant; hemangiopericyto
  • the present disclosure is directed to a platform approach to cancer vaccination that provides breadth, with regard to the scope of cancers and tumor types amenable to treatment with the compositions, methods, and regimens disclosed, as well as magnitude, with regard to the level of immune responses elicited by the compositions and regimens disclosed.
  • Embodiments of the present disclosure provide compositions comprising cancer cell lines. In some embodiments, the cell lines have been modified as described herein.
  • compositions of the disclosure are designed to increase immunogenicity and/or stimulate an immune response.
  • the vaccines provided herein increase IFN ⁇ production and the breadth of immune responses against multiple TAAs (e.g., the vaccines are capable of targeting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more TAAs, indicating the diversity of T cell receptor (TCR) repertoire of these anti-TAA T cell precursors.
  • TCR T cell receptor
  • the immune response produced by the vaccines provided herein is a response to more than one epitope associated with a given TAA (e.g., the vaccines are capable of targeting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 epitopes or more on a given TAA), indicating the diversity of TCR repertoire of these anti-TAA T cell precursors.
  • TAAs tumor-associated antigens
  • VME vaccine microenvironment
  • TAAs tumor-associated antigens
  • NSMs non-synonymous mutations
  • neoepitopes administering a vaccine composition comprising at least 1 cancer stem cell; and/or any combination thereof.
  • the one or more cell lines of the vaccine composition can be modified to reduce production of more than one immunosuppressive factor (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more immunosuppressive factors).
  • the one or more cell lines of a vaccine can be modified to increase production of more than one immunostimulatory factor (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more immunostimulatory factors).
  • the one or more cell lines of the vaccine composition can naturally express, or be modified to express more than one TAA, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more TAAs.
  • the vaccine compositions can comprise cells from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more cell lines. Further, as described herein, cell lines can be combined or mixed, e.g., prior to administration. In some embodiments, production of one or more immunosuppressive factors from one or more or the combination of the cell lines can be reduced or eliminated. In some embodiments, production of one or more immunostimulatory factors from one or more or the combination of the cell lines can be added or increased. In certain embodiments, the one or more or the combination of the cell lines can be selected to express a heterogeneity of TAAs. In some embodiments, the cell lines can be modified to increase the production of one or more immunostimulatory factors, TAAs, and/or neoantigens. In some embodiments, the cell line selection provides that a heterogeneity of HLA supertypes are represented in the vaccine composition. In some embodiments, the cells lines are chosen for inclusion in a vaccine composition such that a desired complement of TAAs are represented.
  • the vaccine composition comprises a therapeutically effective amount of cells from at least one cancer cell line, wherein the cell line or the combination of cell lines expresses more than one of the TAAs of Tables 7-23.
  • a vaccine composition is provided comprising a therapeutically effective amount of cells from at least two cancer cell lines, wherein each cell line or the combination of cell lines expresses at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten of the TAAs of Tables 7-23.
  • a vaccine composition comprising a therapeutically effective amount of cells from at least one cancer cell line, wherein the at least one cell line is modified to express at least one of the immunostimulatory factors of Table 4, at least two of the immunostimulatory factors of Table 4, or at least three of the immunostimulatory factors of Table 4.
  • a vaccine composition is provided comprising a therapeutically effective amount of cells from at least one cancer cell line, wherein each cell line or combination of cell lines is modified to reduce at least one of the immunosuppressive factors of Table 6, or at least two of the immunosuppressive factors of Table 6.
  • the expressed TAAs may or may not have the native coding sequence of DNA/protein. That is, expression may be codon optimized or modified. Such optimization or modification may enhance certain effects (e.g., may lead to reduced shedding of a TAA protein from the vaccine cell membrane).
  • the expressed TAA protein is a designed antigen comprising one or more nonsynonymous mutations (NSMs) identified in cancer patients.
  • NSMs nonsynonymous mutations
  • the NSMs introduces CD4, CD8, or CD4 and CD8 neoepitopes.
  • Any of the vaccine compositions described herein can be administered to a subject in order to treat cancer, prevent cancer, prolong survival in a subject with cancer, and/or stimulate an immune response in a subject.
  • the cell lines comprising the vaccine compositions and used in the methods described herein originate from parental cancer cell lines.
  • cancer cell lines are available from numerous sources as described herein and are readily known in the art.
  • cancer cell lines can be obtained from the American Type Culture Collection (ATCC, Manassas, Va.), Japanese Collection of Research Bioresources cell bank (JCRB, Kansas City, Mo.), Cell Line Service (CLS, Eppelheim, Germany), German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany), RI KEN BioResource Research Center (RCB, Tsukuba, Japan), Korean Cell Line Bank (KCLB, Seoul, South Korea), NIH AIDS Reagent Program (NIH-ARP/Fisher BioServices, Rockland, Md.), Bioresearch Collection and Research Center (BCRC, Hsinchu, Taiwan), Interlab Cell Line Collection (ICLC, Genova, Italy), European Collection of Authenticated Cell Cultures (ECACC, Salisbury, United Kingdom), Kunming Cell Bank (KCB, Yunnan, China), National Cancer Institute Development Therapeutics Program (NCI-DTP, Bethe
  • the cell lines in the compositions and methods described herein are from parental cell lines of solid tumors originating from the lung, prostate, testis, breast, urinary tract, colon, rectum, stomach, head and neck, liver, kidney, nervous system, endocrine system, mesothelium, ovaries, pancreas, esophagus, uterus or skin.
  • the parental cell lines comprise cells of the same or different histology selected from the group consisting of squamous cells, adenocarcinoma cells, adenosquamous cells, large cell cells, small cell cells, sarcoma cells, carcinosarcoma cells, mixed mesodermal cells, and teratocarcinoma cells.
  • the sarcoma cells comprise osteosarcoma, chondrosarcoma, leiomyosarcoma, rhabdomyosarcoma, mesothelioma, fibrosarcoma, angiosarcoma, liposarcoma, glioma, gliosarcoma, astrocytoma, myxosarcoma, mesenchymous or mixed mesodermal cells.
  • the cell lines comprise cancer cells originating from lung cancer, non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), prostate cancer, glioblastoma, colorectal cancer, breast cancer including triple negative breast cancer (TNBC), bladder or urinary tract cancer, squamous cell head and neck cancer (SCCHN), liver hepatocellular (HCC) cancer, kidney or renal cell carcinoma (RCC) cancer, gastric or stomach cancer, ovarian cancer, esophageal cancer, testicular cancer, pancreatic cancer, central nervous system cancers, endometrial cancer, melanoma, and mesothelium cancer.
  • NSCLC non-small cell lung cancer
  • SCLC small cell lung cancer
  • TNBC triple negative breast cancer
  • TNBC triple negative breast cancer
  • SCCHN squamous cell head and neck cancer
  • HCC liver hepatocellular
  • RRCC renal cell carcinoma
  • gastric or stomach cancer ovarian cancer
  • esophageal cancer testicular cancer
  • the cell lines are allogeneic cell lines (i.e., cells that are genetically dissimilar and hence immunologically incompatible, although from individuals of the same species.)
  • the cell lines are genetically heterogeneous allogeneic.
  • the cell lines are genetically homogeneous allogeneic.
  • Allogeneic cell-based vaccines differ from autologous vaccines in that they do not contain patient-specific tumor antigens.
  • Embodiments of the allogeneic vaccine compositions disclosed herein comprise laboratory-grown cancer cell lines known to express TAAs of a specific tumor type.
  • Embodiments of the allogeneic cell lines of the present disclosure are strategically selected, sourced, and modified prior to use in a vaccine composition.
  • Vaccine compositions of embodiments of the present disclosure can be readily mass-produced. This efficiency in development, manufacturing, storage, and other areas can result in cost reductions and economic benefits relative to autologous-based therapies.
  • Tumors are typically made up of a highly heterogeneous population of cancer cells that evolve and change over time. Therefore, it can be hypothesized that a vaccine composition comprising only autologous cell lines that do not target this cancer evolution and progression may be insufficient in the elicitation of a broad immune response required for effective vaccination. As described in embodiments of the vaccine composition disclosed herein, use of one or more strategically selected allogeneic cell lines with certain genetic modification(s) addresses this disparity.
  • the allogeneic cell-based vaccines are from cancer cell lines of the same type (e.g., breast, prostate, lung) of the cancer sought to be treated.
  • various types of cell lines i.e., cell lines from different primary tumor origins
  • the cell lines in the vaccine compositions are a mixture of cell lines of the same type of the cancer sought to be treated and cell lines from different primary tumor origins.
  • Exemplary cancer cell lines including, but not limited to those provided in Table 1, below, are contemplated for use in the compositions and methods described herein.
  • the Cell Line Sources identified herein are for exemplary purposes only.
  • the cell lines described in various embodiments herein may be available from multiple sources.
  • one or more non-small cell lung (NSCLC) cell lines are prepared and used according to the disclosure.
  • NSCLC cell lines are contemplated: NCI-H460, NCIH520, A549, DMS 53, LK-2, and NCI-H23. Additional NSCLC cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising NSCLC cell lines is also contemplated.
  • one or more prostate cancer cell lines are prepared and used according to the disclosure.
  • the following prostate cancer cell lines are contemplated: PC3, DU-145, LNCAP, NEC8, and NTERA-2cl-D1. Additional prostate cancer cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising prostate cancer cell lines is also contemplated.
  • one or more colorectal cancer (CRC) cell lines are prepared and used according to the disclosure.
  • CRC colorectal cancer
  • the following colorectal cancer cell lines are contemplated: HCT-15, RKO, HuTu-80, HCT-116, and LS411N. Additional colorectal cancer cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising CRC cell lines is also contemplated.
  • one or more breast cancer or triple negative breast cancer (TNBC) cell lines are prepared and used according to the disclosure.
  • TNBC cell lines are contemplated: Hs 578T, AU565, CAMA-1, MCF-7, and T-47D. Additional breast cancer cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising breast and/or TNBC cancer cell lines is also contemplated.
  • one or more bladder or urinary tract cancer cell lines are prepared and used according to the disclosure.
  • the following urinary tract or bladder cancer cell lines are contemplated: UM-UC-3, J82, TCCSUP, HT-1376, and SCaBER. Additional bladder cancer cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising bladder or urinary tract cancer cell lines is also contemplated.
  • stomach or gastric cancer cell lines are prepared and used according to the disclosure.
  • the following stomach or gastric cancer cell lines are contemplated: Fu97, MKN74, MKN45, OCUM-1, and MKN1. Additional stomach cancer cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising stomach or gastric cancer cell lines is also contemplated.
  • one or more squamous cell head and neck cancer (SCCHN) cell lines are prepared and used according to the disclosure.
  • SCCHN cell lines are contemplated: HSC-4, Detroit 562, KON, HO-1-N-1, and OSC-20. Additional SCCHN cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising SCCHN cancer cell lines is also contemplated.
  • one or more small cell lung cancer (SCLC) cell lines are prepared and used according to the disclosure.
  • SCLC cell lines are contemplated: DMS 114, NCI-H196, NCI-H1092, SBC-5, NCI-H510A, NCI-H889, NCI-H1341, NCIH-1876, NCI-H2029, NCI-H841, and NCI-H1694. Additional SCLC cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising SCLC cell lines is also contemplated.
  • one or more liver or hepatocellular cancer (HCC) cell lines are prepared and used according to the disclosure.
  • HCC cell lines are contemplated: Hep-G2, JHH-2, JHH-4, JHH-6, Li7, HLF, HuH-6, JHH-5, and HuH-7. Additional HCC cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising liver or HCC cancer cell lines is also contemplated.
  • kidney cancer such as renal cell carcinoma (RCC) cell lines are prepared and used according to the disclosure.
  • RCC renal cell carcinoma
  • the following RCC cell lines are contemplated: A-498, A-704, 769-P, 786-O, ACHN, KMRC-1, KMRC-2, VMRC-RCZ, and VMRC-RCW. Additional RCC cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising kidney or RCC cancer cell lines is also contemplated.
  • one or more glioblastoma (GBM) cancer cell lines are prepared and used according to the disclosure.
  • GBM cell lines are contemplated: DBTRG-05MG, LN-229, SF-126, GB-1, and KNS-60. Additional GBM cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising GBM cancer cell lines is also contemplated.
  • one or more ovarian cancer cell lines are prepared and used according to the disclosure.
  • the following ovarian cell lines are contemplated: TOV-112D, ES-2, TOV-21G, OVTOKO, and MCAS. Additional ovarian cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising ovarian cancer cell lines is also contemplated.
  • one or more esophageal cancer cell lines are prepared and used according to the disclosure.
  • the following esophageal cell lines are contemplated: TE-10, TE-6, TE-4, EC-GI-10, OE33, TE-9, TT, TE-11, OE19, OE21. Additional esophageal cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising esophageal cancer cell lines is also contemplated.
  • pancreatic cancer cell lines are prepared and used according to the disclosure.
  • pancreatic cell lines are contemplated: PANC-1,KP-3, KP-4, SUIT-2, and PSN1. Additional pancreatic cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising pancreatic cancer cell lines is also contemplated.
  • one or more endometrial cancer cell lines are prepared and used according to the disclosure.
  • the following endometrial cell lines are contemplated: SNG-M, HEC-1-B, JHUEM-3, RL95-2, MFE-280, MFE-296, TEN, JHUEM-2, AN3-CA, and Ishikawa. Additional endometrial cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising endometrial cancer cell lines is also contemplated.
  • one or more melanoma cancer cell lines are prepared and used according to the disclosure.
  • the following melanoma cell lines are contemplated: RPMI-7951, MeWo, Hs 688(A).T, COLO 829, C32, A-375, Hs 294T, Hs 695T, Hs 852T, and A2058. Additional melanoma cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising melanoma cancer cell lines is also contemplated.
  • one or more mesothelioma cancer cell lines are prepared and used according to the disclosure.
  • the following mesothelioma cell lines are contemplated: NCI-H28, MSTO-211H, IST-Mes1, ACC-MESO-1, NCI-H2052, NCI-H2452, MPP 89, and IST-Mes2. Additional mesothelioma cell lines are also contemplated by the present disclosure.
  • inclusion of a cancer stem cell line such as DMS 53 in a vaccine comprising mesothelioma cancer cell lines is also contemplated.
  • a vaccine composition may comprise cancer cell lines that originated from the same type of cancer.
  • a vaccine composition may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NSCLC cell lines, and such a composition may be useful to treat or prevent NSCLC.
  • the vaccine composition comprising NCSLC cell lines may be used to treat or prevent cancers other than NSCLC, examples of which are described herein.
  • a vaccine composition may comprise cancer cell lines that originated from different types of cancer.
  • a vaccine composition may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NSCLC cell lines, plus 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more SCLC cancer cell lines, optionally plus one or other cancer cell lines, such as cancer stem cell lines, and so on, and such a composition may be useful to treat or prevent NSCLC, and/or prostate cancer, and/or breast cancer, and so on.
  • the vaccine composition comprising different cancer cell lines as described herein may be used to treat or prevent various cancers.
  • the targeting of a TAA or multiple TAAs in a particular tumor is optimized by using cell lines derived from different tissues or organs within a biological system to target a cancer of primary origin within the same system.
  • cell lines derived from tumors of the reproductive system e.g., ovaries, fallopian tubes, uterus, vagina, mammary glands, testes, vas deferens, seminal vesicles, and prostate
  • cell lines derived from tumors of the digestive system e.g., salivary glands, esophagus, stomach, liver, gallbladder, pancreas, intestines, rectum, and anus
  • cell lines from tumors of the respiratory system e.g., pharynx, larynx, bronchi, lungs, and diaphragm
  • cell lines derived from tumors of the urinary system e.g., kidneys,
  • the disclosure provides compositions comprising a combination of cell lines.
  • cell line combinations are provided below.
  • cell line DMS 53 whether modified or unmodified, is combined with 5 other cancer cell lines in the associated list.
  • One or more of the cell lines within each recited combination may be modified as described herein. In some embodiments, none of the cell lines in the combination of cell lines are modified.
  • DMS 53, Hs 578T, AU565, CAMA-1, MCF-7, and T-47D for the treatment and/or prevention of breast cancer including triple negative breast cancer (TNBC);
  • DMS 53, NCI-H28, MSTO-211H, IST-Mes1, ACC-MESO-1, NCI-H2052, NCI-H2452, MPP 89, and IST-Mes2 for the treatment and/or prevention of mesothelioma.
  • the cell lines in the vaccine compositions and methods described herein include one or more cancer stem cell (CSC) cell lines, whether modified or unmodified.
  • CSC cancer stem cell
  • DMS 53 small cell lung cancer cell line
  • CSCs display unique markers that differ depending on the anatomical origin of the tumor.
  • CSC markers include: prominin-1 (CD133), A2B5, aldehyde dehydrogenase (ALDH1), polycomb protein (Bmi-1), integrin- ⁇ 1 (CD29), hyaluronan receptor (CD44), Thy-1 (CD90), SCF receptor (CD117), TRA-1-60, nestin, Oct-4, stage-specific embryonic antigen-1 (CD15), GD3 (CD60a), stage-specific embryonic antigen-1 (SSEA-1) or (CD15), stage-specific embryonic antigen-4 (SSEA-4), stage-specific embryonic antigen-5 (SSEA-5), and Thomsen-Friedenreich antigen (CD176).
  • prominin-1 CD133
  • A2B5 aldehyde dehydrogenase
  • ALDH1 aldehyde dehydrogenase
  • Bmi-1 polycomb protein
  • CD29 integrin- ⁇ 1
  • CD44 hyaluronan receptor
  • CD90 CD90
  • SCF receptor CD117
  • Cancer stem cell markers identified by primary tumor site are provided in Table 2 and are disclosed across various references (e.g., Gilbert, C A &Ross, A H. J Cell Biochem. (2009); Karsten, U & Goletz, S. SpringerPlus (2013); Zhao, Wet al. Cancer Transl Med. (2017)).
  • Exemplary cell lines expressing one or more markers of cancer stem cell-like properties specific for the anatomical site of the primary tumor from which the cell line was derived are listed in Table 2. Exemplary cancer stem cell lines are provided in Table 3. Expression of CSC markers was determined using RNA-seq data from the Cancer Cell Line Encyclopedia (CCLE) (retrieved from www.broadinstitute.org/ccle on Nov. 23, 2019; Barretina, J et al. Nature. (2012)). The HUGO Gene Nomenclature Committee gene symbol was entered into the CCLE search and mRNA expression downloaded for each CSC marker. The expression of a CSC marker was considered positive if the RNA-seq value (FPKM) was greater than 0.
  • CCLE Cancer Cell Line Encyclopedia
  • CSC markers by primary tumor anatomical origin Anatomical Site of CSC Marker
  • CSC Marker Primary Tumor Common Name Gene Symbol Ovaries Endoglin, CD105 ENG CD117, cKIT KIT CD44 CD44 CD133 PROM1 SALL4 SAL4 Nanog NANOG Oct-4 POU5F1 Pancreas ALDH1A1 ALDH1A1 c-Myc MYC EpCAM, TROP1 EPCAM CD44 CD44 Cd133 PROM1 CXCR4 CXCR4 Oct-4 POU5F1 Nestin NES BMI-1 BMI1 Skin CD27 CD27 ABCB5 ABCB5 ABCG2 ABCG2 CD166 ALCAM Nestin NES CD133 PROM1 CD20 MS4A1 NGFR NGFR Lung ALDH1A1 ALDH1A1 EpCAM, TROP1 EPCAM CD90 THY1 CD117, cKIT KIT CD133 PROM1 ABCG2 ABCG2 SOX2 SOX2 Liver Nanog NANOG CD90/thy1 T
  • the vaccine compositions comprising a combination of cell lines are capable of stimulating an immune response and/or preventing cancer and/or treating cancer.
  • the present disclosure provides compositions and methods of using one or more vaccine compositions comprising therapeutically effective amounts of cell lines.
  • the amount (e.g., number) of cells from the various individual cell lines in a cocktail or vaccine compositions can be equal (as defined herein) or different.
  • the number of cells from a cell line or from each cell line (in the case where multiple cell lines are administered) in a vaccine composition is approximately 1.0 ⁇ 10 6 , 2.0 ⁇ 10 6 , 3.0 ⁇ 10 6 , 4.0 ⁇ 10 6 , 5.0 ⁇ 10 6 , 6.0 ⁇ 10 6 , 7.0 ⁇ 10 6 , 8 ⁇ 10 6 , 9.0 ⁇ 10 6 , 1.0 ⁇ 10 7 , 2.0 ⁇ 10 7 , 3.0 ⁇ 10 7 , 4.0 ⁇ 10 7 , 5.0 ⁇ 10 7 , 6.0 ⁇ 10 7 , 8.0 ⁇ 10 7 , or 9.0 ⁇ 10 7 cells.
  • the total number of cells administered to a subject can range from 1.0 ⁇ 10 6 to 9.0 ⁇ 10 7 .
  • the number of cell lines included in each administration of the vaccine composition can range from 1 to 10 cell lines. In some embodiments, the number of cells from each cell line are not equal and different ratios of cell lines are used. For example, if one cocktail contains 5.0 ⁇ 10 7 total cells from 3 different cell lines, there could be 3.33 ⁇ 10 7 cells of one cell line and 8.33 ⁇ 10 6 of the remaining 2 cell lines.
  • HLA mismatch occurs when the subject's HLA molecules are different from those expressed by the cells of the administered vaccine compositions.
  • the process of HLA matching involves characterizing 5 major HLA loci, which include the HLA alleles at three Class I loci HLA-A, -B and -C and two class II loci HLA-DRB1 and -DQB1. As every individual expresses two alleles at each loci, the degree of match or mismatch is calculated on a scale of 10, with 10/10 being a perfect match at all 10 alleles.
  • the response to mismatched HLA loci is mediated by both innate and adaptive cells of the immune system.
  • recognition of mismatches in HLA alleles is mediated to some extent by monocytes.
  • monocytes the sensing of “non-self” by monocytes triggers infiltration of monocyte-derived DCs, followed by their maturation, resulting in efficient antigen presentation to na ⁇ ve T cells.
  • Alloantigen-activated DCs produce increased amounts of IL-12 as compared to DCs activated by matched syngeneic antigens, and this increased IL-12 production results in the skewing of responses to Th1 T cells and increased IFN gamma production.
  • HLA mismatch recognition by the adaptive immune system is driven to some extent by T cells.
  • 1-10% of all circulating T cells are alloreactive and respond to HLA molecules that are not present in self. This is several orders of magnitude greater than the frequency of endogenous T cells that are reactive to a conventional foreign antigen.
  • the ability of the immune system to recognize these differences in HLA alleles and generate an immune response is a barrier to successful transplantation between donors and patients and has been viewed an obstacle in the development of cancer vaccines.
  • the vaccine compositions provided herein exhibit a heterogeneity of HLA supertypes, e.g., mixtures of HLA-A supertypes, and HLA-B supertypes.
  • HLA supertypes e.g., mixtures of HLA-A supertypes, and HLA-B supertypes.
  • various features and criteria may be considered to ensure the desired heterogeneity of the vaccine composition including, but not limited to, an individual's ethnicity (with regard to both cell donor and subject receiving the vaccine). Additional criteria are described herein (e.g., Example 22).
  • a vaccine composition expresses a heterogeneity of HLA supertypes, wherein at least two different HLA-A and at least two HLA-B supertypes are represented.
  • compositions comprising therapeutically effective amounts of multiple cell lines are provided to ensure a broad degree of HLA mismatch on multiple class I and class II HLA molecules between the tumor cell vaccine and the recipient.
  • the vaccine composition expresses a heterogeneity of HLA supertypes, wherein the composition expresses a heterogeneity of major histocompatibility complex (MHC) molecules such that two of HLA-A24, HLA- A03, HLA-A01, and two of HLA-B07, HLA-B08, HLA-B27, and HLA-B44 supertypes are represented.
  • MHC major histocompatibility complex
  • the vaccine composition expresses a heterogeneity HLA supertypes, wherein the composition expresses a heterogeneity of MHC molecules and at least the HLA-A24 is represented.
  • the composition expresses a heterogeneity of MHC molecules such that HLA-A24, HLA-A03, HLA-A01, HLA-B07, HLA-B27, and HLA-B44 supertypes are represented. In other exemplary embodiments, the composition expresses a genetic heterogeneity of MHC molecules such that HLA-A01, HLA-A03, HLA-B07, HLA-B08, and HLA-B44 supertypes are represented.
  • HLA types that act as markers of self.
  • increasing the heterogeneity of HLA-supertypes within the vaccine cocktail has the potential to augment the localized inflammatory response when the vaccine is delivered conferring an adjuvant effect.
  • increasing the breadth, magnitude, and immunogenicity of tumor reactive T cells primed by the cancer vaccine composition is accomplished by including multiple cell lines chosen to have mismatches in HLA types, chosen, for example, based on expression of certain TAAs.
  • Embodiments of the vaccine compositions provided herein enable effective priming of a broad and effective anti-cancer response in the subject with the additional adjuvant effect generated by the HLA mismatch.
  • Various embodiments of the cell line combinations in a vaccine composition express the HLA-A supertypes and HLA-B supertypes. Non- limiting examples are provided in Example 22 herein.
  • the vaccine compositions comprise cells that have been modified.
  • Modified cell lines can be clonally derived from a single modified cell, i.e., genetically homogenous, or derived from a genetically heterogenous population.
  • Cell lines can be modified to express or increase expression of one or more immunostimulatory factors, to inhibit or decrease expression of one or more immunosuppressive factors, and/or to express or increase expression of one or more TAAs, including optionally TAAs that have been mutated in order to present neoepitopes (e.g., designed or enhanced antigens with NSMs) as described herein. Additionally, cell lines can be modified to express or increase expression of factors that can modulate pathways indirectly, such expression or inhibition of microRNAs. Further, cell lines can be modified to secrete non- endogenous or altered exosomes.
  • the present disclosure also contemplates co-administering one or more TAAs (e.g., an isolated TAA or purified and/or recombinant TAA) or immunostimulatory factors (e.g., recombinantly produced therapeutic protein) with the vaccines described herein.
  • TAAs e.g., an isolated TAA or purified and/or recombinant TAA
  • immunostimulatory factors e.g., recombinantly produced therapeutic protein
  • the present disclosure provides a unit dose of a vaccine comprising (i) a first composition comprising a therapeutically effective amount of at least 1, 2, 3, 4, 5 or 6 cancer cell lines, wherein the cell line or a combination of the cell lines comprises cells that express at least 5, 10, 15, 20, 25, 30, 35, or 40 tumor associated antigens (TAAs) associated with a cancer of a subject intended to receive said composition, and wherein the composition is capable of eliciting an immune response specific to the at least 5, 10, 15, 20, 25, 30, 35, or 40 TAAs, and (ii) a second composition comprising one or more isolated TAAs.
  • the first composition comprises a cell line or cell lines that is further modified to (a) express or increase expression of at least 1 immunostimulatory factor, and/or (ii) inhibit or decrease expression of at least 1 immunosuppressive factor.
  • An immunostimulatory protein is one that is membrane bound, secreted, or both that enhances and/or increases the effectiveness of effector T cell responses and/or humoral immune responses.
  • immunostimulatory factors can potentiate antitumor immunity and increase cancer vaccine immunogenicity.
  • these factors may impact the antigen-presentation mechanism or the T cell mechanism. Insertion of the genes for these factors may enhance the responses to the vaccine composition by making the vaccine more immunostimulatory of anti-tumor response.
  • expression of immunostimulatory factors by the combination of cell lines included in the vaccine in the vaccine microenvironment can modulate multiple facets of the adaptive immune response.
  • Expression of secreted cytokines such as GM-CSF and IL-15 by the cell lines can induce the differentiation of monocytes, recruited to the inflammatory environment of the vaccine delivery site, into dendritic cells (DCs), thereby enriching the pool of antigen presenting cells in the VME.
  • DCs dendritic cells
  • LCs Langerhans cells
  • Expression of certain cytokines can promote DCs and LCs to prime T cells towards an effector phenotype.
  • DCs that encounter vaccine cells expressing IL-12 in the VME should prime effector T cells in the draining lymph node and mount a more efficient anti-tumor response.
  • engagement of certain immunostimulatory factors with their receptors on DCs can promote the priming of T cells with an effector phenotype while suppressing the priming of T regulatory cells (Tregs).
  • Engagement of certain immunostimulatory factors with their receptors on DCs can promote migration of DCs and T cell mediated acquired immunity.
  • modifications to express the immunostimulatory factors are not made to certain cell lines or, in other embodiments, all of the cell lines present in the vaccine composition.
  • vaccine compositions comprising a therapeutically effective amount of cells from at least one cancer cell line (e.g., GBM cell line), wherein the cell line is modified to increase production of at least one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) immunostimulatory factors.
  • the immunostimulatory factors are selected from those presented in Table 4.
  • NCBI Gene IDs that can be utilized by a skilled artisan to determine the sequences to be introduced in the vaccine compositions of the disclosure. These NCBI Gene IDs are exemplary only.
  • the cell lines of the vaccine composition can be modified (e.g., genetically modified) to express, overexpress, or increase the expression of one or more immunostimulatory factors selected from Table 4.
  • the immunostimulatory sequence can be a native human sequence.
  • the immunostimulatory sequence can be a genetically engineered sequence. The genetically engineered sequence may be modified to increase expression of the protein through codon optimization, or to modify the cellular location of the protein (e.g., through mutation of protease cleavage sites).
  • At least one (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of the cancer cell lines in any of the vaccine compositions described herein may be genetically modified to express or increase expression of one or more immunostimulatory factors.
  • the immunostimulatory factors expressed by the cells within the composition may all be the same, may all be different, or any combination thereof.
  • a vaccine composition comprises a therapeutically effective amount of cells from at least one cancer cell line, wherein the at least one cell line is modified to express 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the immunostimulatory factors of Table 4.
  • the composition comprises a therapeutically effective amount of cells from 2, 3, 4, 5, 6, 7, 8, 9, or 10 cancer cell lines.
  • the at least one cell line is modified to increase the production of at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 immunostimulatory factors of Table 5.
  • the composition comprises a therapeutically effective amount of cells from 2, 3, 4, 5, 6, 7, 8, 9, or 10 cancer cell lines, and each cell line is modified to increase the production of at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 immunostimulatory factors of Table 4.
  • the composition comprises a therapeutically effective amount of cells from 3 cancer cells lines wherein 1, 2, or all 3 of the cell lines have been modified to express or increase expression of GM-CSF, membrane bound CD40L, and IL-12.
  • Exemplary combinations of modifications e.g., where a cell line or cell lines have been modified to express or increase expression of more than one immunostimulatory factor include but are not limited to: GM-CSF+IL-12; CD40L+IL-12; GM-CSF+CD40L; GM-CSF+IL-12+CD40L; GM-CSF+IL-15; CD40L+IL-15; GM-CSF+CD40L; and GM-CSF+IL-15+CD40L, among other possible combinations.
  • tumor cells express immunostimulatory factors including the IL-12A (p35 component of IL-12), GM-CSF (kidney cell lines), and CD40L (leukemia cell lines).
  • IL-12A p35 component of IL-12
  • GM-CSF kidney cell lines
  • CD40L leukemia cell lines
  • cell lines may also be modified to increase expression of one or more immunostimulatory factors.
  • the cell line combination of or cell lines that have been modified as described herein to express or increase expression of one or more immunostimulatory factors will express the immunostimulatory factor or factors at least 2, 3, 4, 5, 6, 7, 8, 9, 10-fold or more relative to the same cell line or combination of cell lines that have not been modified to express or increase expression of the one or more immunostimulatory factors.
  • Methods to increase immunostimulatory factors in the vaccine compositions described herein include, but are not limited to, introduction of the nucleotide sequence to be expressed by way of a viral vector or DNA plasmid.
  • the expression or increase in expression of the immunostimulatory factors can be stable expression or transient expression.
  • the cancer cells in any of the vaccine compositions described herein are genetically modified to express CD40 ligand (CD40L).
  • CD40L is membrane bound.
  • the CD40L is not membrane bound.
  • CD40L refers to membrane bound CD40L.
  • the cancer cells in any of the vaccine compositions described herein are genetically modified to express GM-CSF, membrane bound CD40L, GITR, IL-12, and/or IL-15. Exemplary amino acid and nucleotide sequences useful for expression of the one or more of the immunostimulatory factors provided herein are presented in Table 5.
  • GITR protein comprising the amino acid sequence of SEQ ID NO: 4, or a nucleic acid sequence encoding the same, e.g., SEQ ID NO: 5.
  • a vaccine composition comprising one or more cell lines expressing the same.
  • a GM-CSF protein comprising the amino acid sequence of SEQ ID NO: 8, or a nucleic acid sequence encoding the same, e.g., SEQ ID NO: 6 or SEQ ID NO: 7.
  • a vaccine composition comprising one or more cell lines expressing the same.
  • an IL-12 protein comprising the amino acid sequence of SEQ ID NO: 10, or a nucleic acid sequence encoding the same, e.g., SEQ ID NO: 9.
  • a vaccine composition comprising one or more cell lines expressing the same.
  • an IL-15 protein comprising the amino acid sequence of SEQ ID NO: 12, or a nucleic acid sequence encoding the same, e.g., SEQ ID NO: 11.
  • a vaccine composition comprising one or more cell lines expressing the same.
  • an IL-23 protein comprising the amino acid sequence of SEQ ID NO: 14, or a nucleic acid sequence encoding the same, e.g., SEQ ID NO: 13.
  • a vaccine composition comprising one or more cell lines expressing the same.
  • a XCL1 protein comprising the amino acid sequence of SEQ ID NO: 16, or a nucleic acid sequence encoding the same, e.g., SEQ ID NO: 15.
  • a vaccine composition comprising one or more cell lines expressing the same.
  • the cancer cells in any of the vaccine compositions described herein are genetically modified to express one or more of CD28, B7-H2 (ICOS LG), CD70, CX3CL1, CXCL10(IP10), CXCL9, LFA-1(ITGB2), SELP, ICAM-1, ICOS, CD40, CD27(TNFRSF7), TNFRSF14(HVEM), BTN3A1, BTN3A2, ENTPD1, GZMA, and PERF1.
  • vectors contain polynucleotide sequences that encode immunostimulatory molecules.
  • immunostimulatory molecules may include any of a variety of cytokines.
  • cytokine refers to a protein released by one cell population that acts on one or more other cells as an intercellular mediator. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones.
  • cytokines include growth hormones such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factor-alpha and -beta; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as NGF-beta; platelet-growth factor; transforming growth factors (TGFs) such as TGF-alpha and TGF-beta; insulin-like growth factor-I and-II; erythropoietin (EPO
  • polynucleotides encoding the immunostimulatory factors are under the control of one or more regulatory elements that direct the expression of the coding sequences.
  • more than one (i.e., 2, 3, or 4) immunostimulatory factors are encoded on one expression vector.
  • more than one (i.e., 2, 3, 4, 5, or 6) immunostimulatory factors are encoded on separate expression vectors.
  • Lentivirus containing a gene or genes of interest are produced in various embodiments by transient co-transfection of 293T cells with lentiviral transfer vectors and packaging plasmids (OriGene) using LipoD293TM In Vitro DNA Transfection Reagent (SignaGen Laboratories).
  • cell lines are seeded in a well plate (e.g., 6-well, 12-well) at a density of 1-10 ⁇ 10 5 cells per well to achieve 50-80% cell confluency on the day of infection. Eighteen—24 hours after seeding, cells are infected with lentiviruses in the presence of 10 ⁇ g/mL of polybrene. Eighteen—24 hours after lentivirus infection, cells are detached and transferred to larger vessel. After 24-120 hours, medium is removed and replaced with fresh medium supplemented with antibiotics.
  • a well plate e.g., 6-well, 12-well
  • a density of 1-10 ⁇ 10 5 cells per well to achieve 50-80% cell confluency on the day of infection. Eighteen—24 hours after seeding, cells are infected with lentiviruses in the presence of 10 ⁇ g/mL of polybrene. Eighteen—24 hours after lentivirus infection, cells are detached and transferred to larger vessel. After 24-120 hours, medium is removed and replaced with fresh medium supplemente
  • An immunosuppressive factor is a protein that is membrane bound, secreted, or both and capable of contributing to defective and reduced cellular responses.
  • Various immunosuppressive factors have been characterized in the context of the tumor microenvironment (TME).
  • TEE tumor microenvironment
  • certain immunosuppressive factors can negatively regulate migration of LCs and DCs from the dermis to the draining lymph node.
  • TGF ⁇ 1 is a suppressive cytokine that exerts its effects on multiple immune cell subsets in the periphery as well as in the TME.
  • TGF ⁇ 1 negatively regulates migration of LCs and DCs from the dermis to the draining lymph node.
  • TGF ⁇ 2 is secreted by most tumor cells and exerts immunosuppressive effects similar to TGF ⁇ 1. Modification of the vaccine cell lines to reduce TGF ⁇ 1 and/or TGF ⁇ 2 secretion in the VME ensures the vaccine does not further TGF ⁇ -mediated suppression of LC or DC migration.
  • CD47 expression is increased on tumor cells as a mode of tumor escape by preventing macrophage phagocytosis and tumor clearance.
  • DCs also express SIRP ⁇ , and ligation of SIRP ⁇ on DCs can suppress DC survival and activation.
  • Additional immunosuppressive factors in the vaccine that could play a role in the TME and VME include CD276 (B7-H3) and CTLA4.
  • CD276 B7-H3
  • CTLA4 cytoplasmic acid
  • DC contact with a tumor cell expressing CD276 or CTLA4 in the TME dampens DC stimulatory capabilities resulting in decreased T cell priming, proliferation, and/or promotes proliferation of T cells.
  • Expression of CTLA4 and/or CD276 on the vaccine cell lines could confer the similar suppressive effects on DCs or LCs in the VME.
  • production of one or more immunosuppressive factors can be inhibited or decreased in the cells of the cell lines contained therein.
  • production (i.e., expression) of one or more immunosuppressive factors is inhibited (i.e., knocked out or completely eliminated) in the cells of the cell lines contained in the vaccine compositions.
  • the cell lines can be genetically modified to decrease (i.e., reduce) or inhibit expression of the immunosuppressive factors.
  • the immunosuppressive factor is excised from the cells completely.
  • one or more of the cell lines are modified such that one or more immunosuppressive factor is produced (i.e., expressed) at levels decreased or reduced by at least 5, 10, 15, 20, 25, or 30% (i.e., at least 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%).
  • the one or more immunosuppressive factors is selected from the group presented
  • one or more immunostimulatory factors, TAAs, and/or neoantigens can be increased in the vaccine compositions as described herein.
  • one or more (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of the cell types within the compositions also can be genetically modified to increase the immunogenicity of the vaccine, e.g., by ensuring the expression of certain immunostimulatory factors, and/or TAAs.
  • any combinations of these actions, modifications, and/or factors can be used to generate the vaccine compositions described herein.
  • the combination of decreasing or reducing expression of immunosuppressive factors by at least 5, 10, 15, 20, 25, or 30% and increasing expression of immunostimulatory factors at least 2-fold higher than an unmodified cell line may be effective to improve the anti-tumor response of tumor cell vaccines.
  • the combination of reducing immunosuppressive factors by at least 5, 10, 15, 20, 25, or 30% and modifying cells to express certain TAAs in the vaccine composition may be effective to improve the anti-tumor response of tumor cell vaccines.
  • a cancer vaccine comprises a therapeutically effective amount of cells from at least one cancer cell line, wherein the cell line is modified to reduce production of at least one immunosuppressive factor by the cell line, and wherein the at least one immunosuppressive factor is CD47 or CD276.
  • expression of CTLA4, HLA-E, HLA-G, TGF ⁇ 1, and/or TGF ⁇ 2 are also reduced.
  • one or more, or all, cell lines in a vaccine composition are modified to inhibit or reduce expression of CD276, TGF ⁇ 1, and TGF ⁇ 2.
  • a vaccine composition is provided comprising three cell lines that have each been modified to inhibit (e.g., knockout) expression of CD276, and reduce expression of (e.g., knockdown) TGF ⁇ 1 and TGF ⁇ 2.
  • a cancer vaccine composition comprises a therapeutically effective amount of cells from a cancer cell line wherein the cell line is modified to reduce expression of at least CD47.
  • the CD47 is excised from the cells or is produced at levels reduced by at least 5, 10, 15, 20, 25, or 30% (i.e., at least 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or
  • CD47 is excised from the cells or is produced at levels reduced by at least 90%. Production of additional immunosuppressive factors can be reduced in one or more cell lines. In some embodiments, expression of CD276, CTLA4, HLA-E, HLA-G, TGF ⁇ 1, and/or TGF ⁇ 2 are also reduced or inhibited. Production of one or more immunostimulatory factors, TAAs, or neoantigens can be increased in one or more cell lines in these vaccine compositions.
  • a cancer vaccine composition comprising a therapeutically effective amount of cells from a cancer cell line wherein the cell line is modified to reduce production of at least CD276.
  • the CD276 is excised from the cells or is produced at levels reduced by at least 5, 10, 15, 20, 25, or 30% (i.e., at least 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97
  • CD276 is excised from the cells or is produced at levels reduced by at least 90%. Production of additional immunosuppressive factors can be reduced in one or more cell lines. In some embodiments, expression of CD47, CTLA4, HLA-E, HLA-G, TGF ⁇ 1, and/or TGF ⁇ 2 are also reduced or inhibited. Production of one or more immunostimulatory factors, TAAs, or neoantigens can be increased in one or more cell lines in these vaccine compositions.
  • a cancer vaccine composition comprising a therapeutically effective amount of cells from a cancer cell line wherein the cell line is modified to reduce production of at least HLA-G.
  • the HLA-G is excised from the cells or is produced at levels reduced by at least 5, 10, 15, 20, 25, or 30% (i.e., at least 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
  • HLA-G is excised from the cells or is produced at levels reduced by at least 90%. Production of additional immunosuppressive factors can be reduced in one or more cell lines. In some embodiments, expression of CD47, CD276, CTLA4, HLA-E, TGF ⁇ 1, and/or TGF ⁇ 2 are also reduced or inhibited. Production of one or more immunostimulatory factors, TAAs, or neoantigens can be increased in one or more cell lines in these vaccine compositions.
  • a cancer vaccine composition comprising a therapeutically effective amount of cells from a cancer cell line wherein the cell line is modified to reduce production of at least CTLA4.
  • the CTLA4 is excised from the cells or is produced at levels reduced by at least 5, 10, 15, 20, 25, or 30% (i.e., at least 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97,
  • CTLA4 is excised from the cells or is produced at levels reduced by at least 90%. Production of additional immunosuppressive factors can be reduced in one or more cell lines. In some embodiments, expression of CD47, CD276, HLA-E, TGF ⁇ 1, and/or TGF ⁇ 2 are also reduced or inhibited. Production of one or more immunostimulatory factors, TAAs, or neoantigens can be increased in one or more cell lines in these vaccine compositions.
  • a cancer vaccine composition comprising a therapeutically effective amount of cells from a cancer cell line wherein the cell line is modified to reduce production of at least HLA-E.
  • the HLA-E is excised from the cells or is produced at levels reduced by at least 5, 10, 15, 20, 25, or 30% (i.e., at least 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
  • HLA-E is excised from the cells or is produced at levels reduced by at least 90%. Production of additional immunosuppressive factors can be reduced in one or more cell lines. In some embodiments, expression of CD47, CD276, CTLA4, TGF ⁇ 1, and/or TGF ⁇ 2 are also reduced or inhibited. Production of one or more immunostimulatory factors, TAAs, or neoantigens can be increased in one or more cell lines in these vaccine compositions.
  • a cancer vaccine composition comprising a therapeutically effective amount of cells from a cancer cell line wherein the cell line is modified to reduce production of TGF ⁇ 1, TGF ⁇ 2, or both TGF ⁇ 1 and TGF ⁇ 2.
  • TGF ⁇ 1, TGF ⁇ 2, or both TGF ⁇ 1 and TGF ⁇ 2 is excised from the cells or is produced at levels reduced by at least 5, 10, 15, 20, 25, or 30% (i.e., at least 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87
  • TGF ⁇ 1, TGF ⁇ 2, or both TGF ⁇ 1 and TGF ⁇ 2 expression is reduced via a short hairpin RNA (shRNA) delivered to the cells using a lentiviral vector. Production of additional immunosuppressive factors can be reduced.
  • expression of CD47, CD276, CTLA4, HLA-E, and/or HLA-G are also reduced in one or more cell lines where TGF ⁇ 1, TGF ⁇ 2, or both TGF ⁇ 1 and TGF ⁇ 2 expression is reduced. Production of one or more immunostimulatory factors, TAAs, or neoantigens can also be increased in one or more cell lines in embodiments of these vaccine compositions.
  • the immunosuppressive factor selected for knockdown or knockout may be encoded by multiple native sequence variants. Accordingly, the reduction or inhibition of immunosuppressive factors can be accomplished using multiple gene editing/knockdown approaches known to those skilled in the art. As described herein, in some embodiments complete knockout of one or more immunosuppressive factors may be less desirable than knockdown.
  • TGF ⁇ 1 contributes to the regulation of the epithelial-mesenchymal transition, so complete lack of TGF ⁇ 1 (e.g., via knockout) may induce a less immunogenic phenotype in tumor cells.
  • Table 6 provides exemplary immunosuppressive factors that can be incorporated or modified as described herein, and combinations of the same. Also provided are exemplary NCBI Gene IDs that can be utilized for a skilled artisan to determine the sequence to be targeted for knockdown strategies. These NCBI Gene IDs are exemplary only.
  • the production of the following combination of immunosuppressive factors is reduced or inhibited in the vaccine composition: CD47+TGF ⁇ 1, CD47+TGF ⁇ 2, or CD47+TGF ⁇ 1+TGF ⁇ 2.
  • the production of the following combination of immunosuppressive factors is reduced or inhibited in the vaccine composition: CD276+TGF ⁇ 1, CD276+TGF ⁇ 2, or CD276+TGF ⁇ 1+TGF ⁇ 2.
  • the production of the following combination of immunosuppressive factors is reduced or inhibited in the vaccine composition: CD47+TGFB1+CD276, CD47+TGF ⁇ 2+CD276, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276.
  • the production of the following combination of immunosuppressive factors is reduced or inhibited in the vaccine composition: CD47+TGF ⁇ 1+B7-H3, CD47+TGF ⁇ 2+CD276, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276.
  • the production of the following combination of immunosuppressive factors is reduced or inhibited in the vaccine composition: CD47+TGF ⁇ 1+CD276+BST2, CD47+TGF ⁇ 2+CD276+BST2, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276+BST2.
  • the production of the following combination of immunosuppressive factors is reduced or inhibited in the vaccine composition: CD47+TGF ⁇ 1+CD276+CTLA4, CD47+TGF ⁇ 2+CD276+CTLA4, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276+CTLA4.
  • the production of the following combination of immunosuppressive factors is reduced or inhibited in the vaccine composition: CD47+TGF ⁇ 1+CD276+CTLA4, CD47+TGF ⁇ 2+CD276+CTLA4, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276+CTLA4.
  • the production of the following combination of immunosuppressive factors is reduced or inhibited in the vaccine composition: CD47+TGF ⁇ 1+CD276+CTLA4, CD47+TGF ⁇ 2+CD276+CTLA4, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276+CTLA4, CD47+TGF ⁇ 2 or TGF ⁇ 1+CTLA4, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276+HLA-E or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276+HLA-G, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276+HLA-G +CTLA-4, or CD47+TGF ⁇ 1+TGF ⁇ 2+CD276+HLA-E+CTLA-4.
  • At least one (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of the cell lines within the composition has a knockdown or knockout of at least one immunosuppressive factor (e.g., one or more of the factors listed in Table 6).
  • the cell lines within the composition may have a knockdown or knockout of the same immunosuppressive factor, or a different immunosuppressive factor for each cell line, or of some combination thereof.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the cell lines within the composition may be further genetically modified to have a knockdown or knockout of one or more additional immunosuppressive factors (e.g., one or more of the factors listed in Table 6).
  • additional immunosuppressive factors e.g., one or more of the factors listed in Table 6
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the cell lines within the composition may be further genetically modified to have a knockdown or knockout of the same additional immunosuppressive factor, of a different additional immunosuppressive factor for each cell line, or of some combination thereof.
  • a cancer vaccine composition comprising a therapeutically effective amount of cells from a cancer cell line wherein the cell line is modified to reduce production of SLAMF7, BTLA, EDNRB, TIGIT, KIR2DL1, KIR2DL2, KIR2DL3, TIM3(HAVCR2), LAG3, ADORA2A and ARG1.
  • At least one of the cells within any of the vaccine compositions described herein may undergo one or more (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) genetic modifications in order to achieve the partial or complete knockdown of immunosuppressive factor(s) described herein and/or the expression (or increased expression) of immunostimulatory factors described herein, TAAs, and/or neoantigens.
  • at least one cell line in the vaccine composition undergoes less than 5 (i.e., less than 4, less than 3, less than 2, 1, or 0) genetic modifications.
  • at least one cell in the vaccine composition undergoes no less than 5 genetic modifications.
  • Cancer cell lines are modified according to some embodiments to inhibit or reduce production of immunosuppressive factors.
  • Provided herein are methods and techniques for selection of the appropriate technique(s) to be employed in order to inhibit production of an immunosuppressive factor and/or to reduce production of an immunosuppressive factor. Partial inhibition or reduction of the expression levels of an immunosuppressive factor may be accomplished using techniques known in the art.
  • the cells of the cancer lines are genetically engineered in vitro using recombinant DNA techniques to introduce the genetic constructs into the cells.
  • DNA techniques include, but are not limited to, transduction (e.g., using viral vectors) or transfection procedures (e.g., using plasmids, cosmids, yeast artificial chromosomes (YACs), electroporation, liposomes). Any suitable method(s) known in the art to partially (e.g., reduce expression levels by at least 5, 10, 15, 20, 25, or 30%) or completely inhibit any immunosuppressive factor production by the cells can be employed.
  • genome editing is used to inhibit or reduce production of an immunosuppressive factor by the cells in the vaccine.
  • genome editing techniques include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the CRISPR-Cas system.
  • the reduction of gene expression and subsequently of biological active protein expression can be achieved by insertion/deletion of nucleotides via non-homologous end joining (NHEJ) or the insertion of appropriate donor cassettes via homology directed repair (HDR) that lead to premature stop codons and the expression of non-functional proteins or by insertion of nucleotides.
  • NHEJ non-homologous end joining
  • HDR homology directed repair
  • spontaneous site-specific homologous recombination techniques that may or may not include the Cre-Lox and FLP-FRT recombination systems are used.
  • methods applying transposons that integrate appropriate donor cassettes into genomic DNA with higher frequency, but with little site/gene-specificity are used in combination with required selection and identification techniques.
  • Non-limiting examples are the piggyBac and Sleeping Beauty transposon systems that use TTAA and TA nucleotide sequences for integration, respectively.
  • techniques for inhibition or reduction of immunosuppressive factor expression may include using antisense or ribozyme approaches to reduce or inhibit translation of mRNA transcripts of an immunosuppressive factor; triple helix approaches to inhibit transcription of the gene of an immunosuppressive factor; or targeted homologous recombination.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to mRNA of an immunosuppressive factor.
  • the antisense oligonucleotides bind to the complementary mRNA transcripts of an immunosuppressive factor and prevent translation. Absolute complementarity may be preferred but is not required.
  • a sequence “complementary” to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex. In the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may be tested, or triplex formation may be assayed.
  • oligonucleotides complementary to either the 5′ or 3′-non-translated, non-coding regions of an immunosuppressive factor could be used in an antisense approach to inhibit translation of endogenous mRNA of an immunosuppressive factor.
  • inhibition or reduction of an immunosuppressive factor is carried out using an antisense oligonucleotide sequence within a short-hairpin RNA.
  • lentivirus-mediated shRNA interference is used to silence the gene expressing the immunosuppressive factor.
  • MicroRNAs are stably expressed RNAi hairpins that may also be used for knocking down gene expression.
  • ribozyme molecules-designed to catalytically cleave mRNA transcripts are used to prevent translation of an immunosuppressive factor mRNA and expression.
  • ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy mRNAs.
  • the use of hammerhead ribozymes that cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA are used.
  • RNA endoribonucleases can also be used.
  • endogenous gene expression of an immunosuppressive factor is reduced by inactivating or “knocking out” the gene or its promoter, for example, by using targeted homologous recombination.
  • endogenous gene expression is reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the promoter and/or enhancer genes of an immunosuppressive factor to form triple helical structures that prevent transcription of the immunosuppressive factor gene in target cells.
  • promoter activity is inhibited by a nuclease dead version of Cas9 (dCas9) and its fusions with KRAB, VP64 and p65 that cannot cleave target DNA.
  • the dCas9 molecule retains the ability to bind to target DNA based on the targeting sequence. This targeting of dCas9 to transcriptional start sites is sufficient to reduce or knockdown transcription by blocking transcription initiation.
  • the activity of an immunosuppressive factor is reduced using a “dominant negative” approach in which genetic constructs that encode defective immunosuppressive factors are used to diminish the immunosuppressive activity on neighboring cells.
  • the administration of genetic constructs encoding soluble peptides, proteins, fusion proteins, or antibodies that bind to and “neutralize” intracellularly any other immunosuppressive factors are used.
  • genetic constructs encoding peptides corresponding to domains of immunosuppressive factor receptors, deletion mutants of immunosuppressive factor receptors, or either of these immunosuppressive factor receptor domains or mutants fused to another polypeptide (e.g., an IgFc polypeptide) can be utilized.
  • genetic constructs encoding anti-idiotypic antibodies or Fab fragments of anti-idiotypic antibodies that mimic the immunosuppressive factor receptors and neutralize the immunosuppressive factor are used. Genetic constructs encoding these immunosuppressive factor receptor peptides, proteins, fusion proteins, anti-idiotypic antibodies or Fabs can be administered to neutralize the immunosuppressive factor.
  • genetic constructs encoding antibodies that specifically recognize one or more epitopes of an immunosuppressive factor, or epitopes of conserved variants of an immunosuppressive factor, or peptide fragments of an immunosuppressive factor can also be used.
  • Such antibodies include but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab′)2 fragments, fragments produced by a Fab expression library, and epitope binding fragments of any of the above. Any technique(s) known in the art can be used to produce genetic constructs encoding suitable antibodies.
  • the enzymes that cleave an immunosuppressive factor precursor to the active isoforms are inhibited to block activation of the immunosuppressive factor. Transcription or translation of these enzymes may be blocked by a means known in the art.
  • pharmacological inhibitors can be used to reduce enzyme activities including, but not limited to COX-2 and IDO to reduce the amounts of certain immunosuppressive factors.
  • TAAs Tumor Associated Antigens
  • Vector-based and protein-based vaccine approaches are limited in the number of TAAs that can be targeted in a single formulation.
  • embodiments of the allogenic whole cell vaccine platform as described herein allow for the targeting of numerous, diverse TAAs.
  • the breadth of responses can be expanded and/or optimized by selecting allogenic cell line(s) that express a range of TAAs and optionally genetically modifying the cell lines to express additional antigens, including neoantigens or nonsynonymous mutations (NSMs), of interest for a desired therapeutic target (e.g., cancer type).
  • NSMs nonsynonymous mutations
  • TAA tumor-associated antigen(s) and can refer to “wildtype” antigens as naturally expressed from a tumor cell or can optionally refer to a mutant antigen, e.g., a design antigen or designed antigen or enhanced antigen or engineered antigen, comprising one or more mutations such as a neoepitope or one or more NSMs as described herein.
  • TAAs are proteins that can be expressed in normal tissue and tumor tissue, but the expression of the TAA protein is significantly higher in tumor tissue relative to healthy tissue.
  • TAAs may include cancer testis antigens (CTs), which are important for embryonic development but restricted to expression in male germ cells in healthy adults. CTs are often expressed in tumor cells.
  • CTs cancer testis antigens
  • Neoantigens or neoepitopes are aberrantly mutated genes expressed in cancer cells.
  • a neoantigen can be considered a TAA because it is expressed by tumor tissue and not by normal tissue.
  • Targeting neoepitopes has many advantages since these neoepitopes are truly tumor specific and not subject to central tolerance in thymus.
  • a cancer vaccine encoding full length TAAs with neoepitopes arising from nonsynonymous mutations (NSMs) has potential to elicit a more potent immune response with improved breadth and magnitude.
  • a nonsynonymous mutation is a nucleotide mutation that alters the amino acid sequence of a protein.
  • a missense mutation is a change in one amino acid in a protein, arising from a point mutation in a single nucleotide.
  • a missense mutation is a type of nonsynonymous substitution in a DNA sequence. Additional mutations are also contemplated, including but limited to truncations, frameshifts, or any other mutation that change the amino acid sequence to be different than the native antigen protein.
  • an antigen is designed by (i) referencing one or more publicly-available databases to identify NSMs in a selected TAA; (ii) identifying NSMs that occur in greater than 2 patients; (iii) introducing each NSM identified in step (ii) into the related TAA sequence; (iv) identifying HLA-A and HLA-B supertype-restricted MHC class I epitopes in the TAA that now includes the NSM; and and (v) including the NSMs that create new epitopes (SB and/or WB) or increases peptide-MHC affinity into a final TAA sequence.
  • Exemplary NSMs predicted to create HLA-A and HLA-B supertype-restricted neoepitopes are provided herein (Table 135).
  • an NSM identified in one patient tumor sample is included in the designed antigen (i.e., the mutant antigen arising from the introduction of the one or more NSMs).
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more NSMs are introduced into a TAA to generate the designed antigen.
  • target antigens could have a lower number NSMs and may need to use NSMs occurring only 1 time to reach the targeted homology to native antigen protein range (94-97%).
  • target antigens could have a high number of NSMs occurring at the 2 occurrence cut-off and may need to use NSMs occurring 3 times to reach the targeted homology to native antigen protein range (94-97%). Including a high number NSMs in the designed antigen would decrease the homology of the designed antigen to the native antigen below the target homology range (94-98%).
  • 1, 2, 3, 4, 5 or 6 cell lines of a tumor cell vaccine according to the present disclosure comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more NSMs (and thus 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more designed antigens) in at least one TAA.
  • sequence homology of the mutant (e.g., designed antigen) to the native full-length protein is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% over the full length of the antigen.
  • the designed antigen is incorporated into a therapeutic allogenic whole cell cancer vaccine to induce antigen-specific immune responses to the designed TAAs and existing TAAs.
  • the vaccine can be comprised of a therapeutically effective amount of at least one cancer cell line, wherein the cell line or the combination of the cell lines express at least one designed TAA. In other embodiments, the vaccine comprises a therapeutically effective amount of at least one cancer cell line, wherein the cell line or the combination of the cell lines expresses at least 2, 3, 4, 5, 6, 7, 8, 9 10 or more designed TAAs.
  • vaccine compositions comprising a therapeutically effective amount of cells from at least one cancer cell line, wherein the at least one cancer cell line expresses (either natively, or is designed to express) one or more TAAs, neoantigens (including TAAs comprising one or more NSMs), CTs, and/or TAAs.
  • the cells are transduced with a recombinant lentivector encoding one or more TAAs, including TAAs comprising one or more NSMs, to be expressed by the cells in the vaccine composition.
  • the TAAs including TAAs comprising one or more NSMs or neoepitopes, and/or other antigens may endogenously be expressed on the cells selected for inclusion in the vaccine composition.
  • the cell lines may be modified (e.g., genetically modified) to express selected TAAs, including TAAs comprising one or more NSMs, and/or other antigens (e.g., CTs, TSAs, neoantigens).
  • any of the tumor cell vaccine compositions described herein may present one or more TAAs, including TAAs comprising one or more NSMs or neoepitopes, and induce a broad antitumor response in the subject. Ensuring such a heterogeneous immune response may obviate some issues, such as antigen escape, that are commonly associated with certain cancer monotherapies.
  • At least one cell line of the vaccine composition may be modified to express one or more neoantigens, e.g., neoantigens implicated in lung cancer, non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), prostate cancer, glioblastoma, colorectal cancer, breast cancer including triple negative breast cancer (TNBC), bladder or urinary tract cancer, squamous cell head and neck cancer (SCCHN), liver hepatocellular (HCC) cancer, kidney or renal cell carcinoma (RCC) cancer, gastric or stomach cancer, ovarian cancer, esophageal cancer, testicular cancer, pancreatic cancer, central nervous system cancers, endometrial cancer, melanoma, and mesothelium cancer.
  • one or more of the cell lines expresses an unmutated portion of a neoantigen protein.
  • one or more of the cell lines expresses a mut
  • At least one of the cancer cells in any of the vaccine compositions described herein may naturally express, or be modified to express one or more TAAs, including TAAs comprising one or more NSMs, CTs, or TSAs/neoantigens.
  • more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of the cancer cell lines in the vaccine composition may express, or may be genetically modified to express one or more of the TAAs, including TAAs comprising one or more NSMs, CTs, or TSAs/neoantigens.
  • the TAAs, including TAAs comprising one or more NSMs, CTs, or TSAs/neoantigens expressed by the cell lines within the composition may all be the same, may all be different, or any combination thereof.
  • the vaccine compositions may contain multiple (i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) cancer cell lines of different types and histology
  • TAAs including TAAs comprising one or more NSMs, and/or neoantigens may be present in the composition (Table 7-23).
  • the number of TAAs that can be targeted using a combination of cell lines e.g., 5-cell line combination, 6-cell line combination, 7-cell line combination, 8-cell line combination, 9-cell line combination, or 10-cell line combination
  • expression levels of the TAAs is higher for the cell line combination compared to individual cell lines in the combination.
  • At least one (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of the cancer cells in any of the vaccine compositions described herein may express, or be modified to express one or more TAAs, including TAAs comprising one or more NSMs or neoepitopes.
  • the TAAs, including TAAs comprising one or more NSMs, expressed by the cells within the composition may all be the same, may all be different, or any combination thereof.
  • the TAAs are specific to NSCLC.
  • the TAAs are specific to GBM.
  • the TAAs are specific to prostate cancer.
  • a vaccine composition comprising a therapeutically effective amount of engineered cells from least one cancer cell line, wherein the cell lines or combination of cell lines express at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more of the TAAs in Tables 7-23.
  • the TAAs in Tables 7-23 are modified to include one or more NSM as described herein.
  • a vaccine composition comprising a therapeutically effective amount of engineered cells from at least one cancer cell line, wherein the cell lines express at least 2, 3, 4, 5, 6, 7, 8, 9, 10 of the TAAs in Tables 7-23 (or the TAAs in Tables 7-23 that have been modified to include one or more NSM).
  • the cell lines express at least 2, 3, 4, 5, 6, 7, 8, 9, 10 of the TAAs in Tables 7-23 (or the TAAs in Tables 7-23 that have been modified to include one or more NSM) and are optionally modified to express or increase expression of one or more immunostimulatory factors of Table 4, and/or inhibit or decrease expression of one or more immunosuppressive factors in Table 6.
  • TAA TAA Name NCBI Gene Symbol (Gene ID) Survivin BIRC5 (332) CD44 CD44 (960) CD44v6 CD44 (960) CEA CEACAM5 (1048) CT83 CT83 (203413) DEPDC1 DEPDC1 (55635) DLL3 DLL3 (10683) NYESO1 CTAG1 (1485) BORIS CTCFL (140690) EGFR EGFR (1956) Her2 ERBB2 (2064) PSMA FOLH1 (2346) KOC1 IGF2BP3 (10643) VEGFR KDR (3791) FLT1 (2321) KIF20A KIF20A (10112) MPHOSPH1 KIF20B (9585) KRAS KRAS (3845) LY6K LY6K (54742) MAGE-A1 MAGEA1 (4100) MAGE-A3 MAGEA3 (4102) MAGE-A4 MAGEA4 (4103) MAGE-A6 MAGEA
  • TAAs expressed in glioblastoma cancer Name NCBI Gene Symbol (Gene ID) AIM2 AIM2 (9447) B4GALNT1 B4GALNT1 (2583) Survivin BIRC5 (4582) Basigin (BSG) BSG (682) Cyclin B1 CCNB1 (891) CDH5 CDH5 (1003) GP39 CHI3L1 (1116) Trp2 DCT (1638) DLL3 DLL3 (10683) DRD2 DRD2 (1813) EGFRvIII EGFR (1956) Epha2 EPHA2 (1969) Epha3 EPHA3 (2042) Her2 ERBB2 (2064) EZH2 EZH2 (2146) PSMA FOLH1 (2346) FOSL1 FOSL1 (8061) GSK3B GSK3B (2932) IDH1 IDH1 (3417) IDH2 IDH2 (3418) IL13RA2 IL13RA2 (3598) IL4R IL4
  • TAAs expressed in ovarian cancer Name NCBI Gene Symbol (Gene ID) OY-TES-1 ACRBP (84519) A-Kinase Anchoring Protein 3 AKAP3 (10566) Anti-Mullerian Hormone Receptor AMHR2 (269) Axl Receptor Tyrosine Kinase AXL (558) Survivin BIRC5 (332) Bruton's Tyrosine Kinase BTK (695) CD44 CD44 (960) Cell Cycle Checkpoint Kinase 1 CHEK1 (1111) (CHK1) Claudin 6 CLDN6 ((074) NY-ESO-1 CTAG1B (1485) LAGE1 CTAG2 (30848) BORIS CTCFL (140690) Dickkopf-1 DKK1 (22943) DLL4 DLL4 (54567) Her2 ERBB2 (2064) HER3 ERBB3 (2065) FOLR1/FBP FOLR1 (2348) GAGE1 GAGE1 (2543) GAGE2 GAGE
  • TAAs expressed in colorectal cancer Name NCBI Gene Symbol (Gene ID) Survivin BIRC5 (332) B-RAF BRAF (673) CEA CEACAM5 (1048) ⁇ HCG CGB3 (1082) NYESO1 CTAG1B (1485) EPCAM EPCAM (4072) EPH receptor A2 EPHA2 (1969) Her2 ERBB2 (2064) GUCY2C GUCY2C (2984) PSMA FOLH1 (2346) KRAS KRAS (3845) MAGE-A1 MAGEA1 (4100) MAGE-A3 MAGEA3 (4102) MAGE-A4 MAGEA4 (4103) MAGE-A6 MAGEA6 (4105) Mesothelin MSLN (10232) MUC1 MUC1 (4582) PRAME PRAME (23532) CD133 PROM1 (8842) RNF43 RNF43 (54894) SART3 SART3 (9733) STEAP1 STEAP1 (26872) Brachyury/
  • TAAs expressed in breast cancer TAA Name NCBI Gene Symbol (Gene ID) Survivin BIRC5 (332) Cyclin B1 CCNB1 (891) Cadherin-3 CDH3 (1001) CEA CEACAM5 (1048) CREB binding protein CREBBP (1387) CS1 CSH1 (1442) CT83 CT83 (203413) NYESO1 CTAG1B (1485) BORIS CTCFL (140690) Endoglin ENG (2022) PSMA FOLH1 (2346) FOS like 1 FOSL1 (8061) FOXM1 FOXM1 (2305) GPNMB GPNMB (10457) MAGE A1 MAGEA1 (4100) MAGE A3 MAGEA3 (4102) MAGE A4 MAGEA4 (4103) MAGE A6 MAGEA6 (4105) Mesothelin MSLN (10232) MMP11 MMP11 (4320) MUC1 MUC1 (4582) PRAME PRAME (23532) CD133 PROM1 (8842) PTK
  • TAAs expressed in head and/or neck cancer Name NCBI Gene Symbol (Gene ID) Survivin BIRC5 (332) BTK BTK (695) cyclin D1 CCND1 (595) CDK4 CDK4 (1019) CDK6 CDK6 (1021) P16 CDKN2A (1029) CEA CEACAM5 (1048) EGFR EGFR (1956) EPH receptor B4 EPHB4 (2050) Her2 ERBB2 (2064) HER3 ERBB3 (2065) FGFR1 FGFR1 (2260) FGFR2 FGFR2 (2263) FGFR3 FGFR3 (2261) PSMA FOLH1 (2346) IGF2BP3 IGF2BP3 (10643) IMP3 IMP3 (55272) MPHOSPH1 KIF20B (9585) LY6K LY6K (54742) MAGE-A10 MAGEA10 (4109) MAGE-A3 MAGEA3 (4102) MAGE-A4 MAGE
  • TAA TAA Name NCBI Gene Symbol (Gene ID) TEM-8 (ANTXR1) ANTXR1 (84168) Annexin A2 (ANXA2) ANXA2 (302) Survivin BIRC5 (332) CCKBR CCKBR (887) Cadherin 17 CDH17 (1015) CDKN2A CDKN2A (1029) CEA CEACAM5 (1048) Claudin 18 CLDN18 (51208) CT83 CT83 (203413) EPCAM EPCAM (4072) Her2 ERBB2 (2064) Her3 ERBB3 (2065) PSMA FOLH1 (2346) FOLR1 FOLR1 (2348) FOXM1 FOXM1 (2305) FUT3 FUT3 (2525) Gastrin GAST (2520) KIF20A KIF20A (10112) LY6K LY6K (54742) MAGE-A1 MAGEA1 (4100) MAGE-A3 MAGEA3 (4102) MMP9 MMP9 (4
  • TAAs expressed in esophageal cancer Name NCBI Gene Symbol (Gene ID) ABCA1 ABCA1 (19) NYESO1 CTAG1B (1485) LAGE1 CTAG2 (30848) DKK1 DKK1 (22943) EGFR EGFR (1956) EpCAM EPCAM (4072) Her2 ERBB2 (2065) Her3 ERBB3 (2064) FOLR1 FOLR1 (2348) Gastrin (GAST) GAST (2520) IGF2BP3 IGF2BP3 (10643) IMP3 IMP3 (55272) LY6K LY6K (54742) MAGE-A1 MAGEA1 (4100) MAGE-A3 MAGEA3 (4102) MAGE-A4 MAGEA4 (4103) MAGE-A11 MAGEA11 (4110) Mesothelin (MSLN) MSLN (10232) NUF2 NUF2 (83540) PRAME PRAME (23532) PTPN11 PTPN11 (5781) hTERT
  • TAA Exemplary TAAs expressed in kidney cancer TAA Name NCBI Gene Symbol (Gene ID) apolipoprotein L1 APOL1 (8542) Axl Receptor Tyrosine Kinase AXL (558) Survivin BIRC5 (332) G250 CA9 (768) cyclin D1 CCND1 (595) CXCR4 CXCR4 (7852) EPH receptor B4 EPHB4 (2050) FAP FAP (2191) VEGFR FLT3 (2322) GUCY2C GUCY2C (2984) INTS1 INTS1 (26173) c-KIT/CD117 KIT (3815) c-Met MET (4233) MMP7 MMP7 (4316) RAGE1 MOK (5891) Muc1 MUC1 (4582) PDGFR ⁇ PDGFRA (5156) PDGFR ⁇ PDGFRB (5159) M2PK PKM (5315) perilipin 2 PLIN2 (123) PRAME PRAME (23532) PRUNE2 PRUNE2 (158471
  • TAAs expressed in pancreatic cancer Name NCBI Gene Symbol (Gene ID) Survivin BIRC5 (332) BTK BTK (695) Connective Tissue Growth Factor CCN2 (1490) CEA CEACAM5 (1048) Claudin 18 CLDN18 (51208) NYESO1 CTAG1B (1495) CXCR4 CXCR4 (7852) EGFR EGFR (1956) FAP FAP (2191) PSMA FOLH1 (2346) MAGE-A4 MAGEA4 (4103) Perlecan HSPG2 (3339) Mesothelin MSLN (10232) MUC1 MUC1 (4582) Muc16 MUC16 (94025) Mucin 5AC MUC5AC (4586) CD73 NT5E (4907) G17 (gastrin1-17) PBX2 (5089) uPA PLAU (5328) uPAR (CD87) PLAUR (5329) PRAME PRAME (23532) PSCA PSCA (8000) Focal adhe
  • TAAs expressed in skin cancer Name NCBI Gene Symbol (Gene ID) B4GALNT1 B4GALNT1 (2583) Survivin BIRC5 (332) Endosialin (CD248) CD248 (57124) CDKN2A CDKN2A (1029) CSAG2 CSAG2 (102423547) CSPG4 CSPG4 (1464) NYESO1 CTAG1B (1485) Trp2 (DCT) DCT (1638) MAGE-A1 MAGEA1 (4100) MAGE-A2 MAGEA2 (4101) MAGE-A3 MAGEA3 (4102) MAGE-A4 MAGEA4 (4103) MAGE-A6 MAGEA6 (4105) MAGE-A10 MAGEA10 (4109) MITF MITF (4286) MART-1 MLANA (2315) NFE2L2 NFE2L2 (4780) PMEL PMEL (6490) PRAME PRAME (23532) NY-MEL-1 RAB38
  • TAAs expressed in mesothelial cancer Name NCBI Gene Symbol (Gene ID) APEX1 APEX1 (328) CHEK1 CHEK1 (1111) NYESO1 CTAG1B (1485) DHFR DHFR (1719) DKK3 DKK3 (27122) EGFR EGFR (1956) ESR2 ESR2 (2100) EZH1 EZH1 (2145) EZH2 EZH2 (2146) MAGE-A1 MAGEA1 (4100) MAGE-A3 MAGEA3 (4102) MAGE-A4 MAGEA4 (4103) MCAM MCAM (4162) Mesothelin MSLN (10232) MUC1 MUC1 (4582) PTK2 PTK2 (5747) SSX-2 SSX2 (6757) STAT3 STAT3 (6774) THBS2 THBS2 (7058) 5T4 (TPBG) TPBG (7162) WT1 WT1 (7490)
  • TAA TAA Name NCBI Gene Symbol (Gene ID) AIM2 AIM2 (9447) AKR1C3 AKR1C3 (8644) ASCL1 ASCL1 (429) B4GALNT1 B4GALNT1 (2583) Survivin BIRC5 (332) Cyclin B1 CCNB1 (891) CEA CEACAM5 (1048) CKB CKB (1152) DDC DDC (1644) DLL3 DLL3 (10863) Enolase 2 ENO2 (2026) Her2 ERBB2 (2064) EZH2 EZH2 (2146) Bombesin GRP (2922) KDM1A KDM1A (23028) MAGE-A1 MAGEA1 (4100) MAGE-A3 MAGEA3 (4102) MAGE-A4 MAGA4 (4103) MAGE-A10 MAGEA10 (4109) MDM2 MDM2 (4193) MUC1 MUC1 (4582) NCAM-1 NCAM1 (4684)
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the cell lines within the composition may be genetically modified to express or increase expression of the same immunostimulatory factor, TAA, including TAAs comprising one or more NSMs, and/or neoantigen; of a different immunostimulatory factor, TAA, and/or neoantigen; or some combination thereof.
  • the TAA sequence can be the native, endogenous, human TAA sequence.
  • the TAA sequence can be a genetically engineered sequence of the native endogenous, human TAA sequence. The genetically engineered sequence may be modified to increase expression of the TAA through codon optimization or the genetically engineered sequence may be modified to change the cellular location of the TAA (e.g., through mutation of protease cleavage sites).
  • NCBI Gene IDs are presented in Table 7-23. As provided herein, these Gene IDs can be used to express (or overexpress) certain TAAs in one or more cell lines of the vaccine compositions of the disclosure.
  • one or more of the cell lines in a composition described herein is modified to express mesothelin (MSLN), CT83 (kita-kyushu lung cancer antigen 1) TERT, PSMA, MAGEA1, EGFRvIII, hCMV pp65, TBXT, BORIS, FSHR, MAGEA10, MAGEC2, WT1, FBP, TDGF1, Claudin 18, LY6K, PRAME, HPV16/18 E6/E7, FAP, or mutated versions thereof (Table 24).
  • MSLN mesothelin
  • CT83 kita-kyushu lung cancer antigen 1
  • TAAs or other TAAs provided herein, that comprise one or more mutations (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more substitution mutations), including neopepitopes or NSMs, as described herein.
  • mutations e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more substitution mutations
  • one or more of the cell lines in a composition described herein is modified to express modMesothelin (modMSLN), modTERT, modPSMA, modMAGEA1, modEGFRvIII, modhCMV pp65, modTBXT, modBORIS, modFSHR, modMAGEA10, modMAGEC2, modWT1, modKRAS, modFBP, modTDGF1, modClaudin 18, modLY6K, modFAP, modPRAME, KRAS G12D mutation, KRAS G12V mutation, and/or modHPV16/18 E6/E7.
  • modMSLN modMesothelin
  • modMSLN modTERT
  • modPSMA modMAGEA1
  • modEGFRvIII modhCMV pp65
  • modTBXT modBORIS
  • modFSHR modMAGEA10
  • modMAGEC2 modWT1
  • modKRAS modFBP
  • modTDGF1 modClaudin 18
  • modLY6K modFAP
  • the TAA or “mutated version thereof” may comprise fusions of 1, 2, or 3 or more of the TAAs or mutated versions provided herein.
  • the fusions comprises a native or wild-type sequence fused with a mutated TAA.
  • the individual TAAs in the fusion construct are separated by a cleavage site, such as a furin cleavage site.
  • TAA fusion proteins such as CT83-MSLN or modCT83-MSLN, modMAGEA1-EGFRvIII-pp65, modTBXT-modBORIS, modFSHR-modMAGEA10, modTBXT-modMAGEC2, modTBXT- modWT1, modTBXT-modWT1 (KRAS), modWT1-modFBP, modPSMA-modTDGF1, modWT1-modClaudin 18, modPSMA-modLY6K, modFAP-modClaudin 18, and modPRAME-modTBXT
  • Sequences for native TAAs can be readily obtained from the NCBI database (www.ncbi.nlm.nih.gov/protein). Sequences for the aforementioned TAAs, mutated versions, and fusions are provided in Table 24.
  • a vaccine composition comprising a therapeutically effective amount of cells from at least two cancer cell lines, wherein each cell line or a combination of the cell lines expresses at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the TAAs of Tables 7-23.
  • the TAAs in Tables 7-23 are modified to include one or more NSMs as described herein.
  • at least one cell line is modified to increase production of at least 1, 2, or 3 immunostimulatory factors, e.g., immunostimulatory factors from Table 4.
  • a vaccine composition comprising a therapeutically effective amount of the cells from at least one cancer cell line, wherein each cell line or combination of cell lines is modified to reduce at least 1, 2, or 3 immunosuppressive factors, e.g., immunosuppressive factors from Table 6.
  • a vaccine composition comprising two cocktails, wherein each cocktail comprises three cell lines modified to express 1, 2, or 3 immunostimulatory factors and to inhibit or reduce expression of 1, 2, or 3 immunosuppressive factors, and wherein each cell line expresses at least 10 TAAs or TAAs comprising one or more NSMs.
  • Methods and assays for determining the presence or expression level of a TAA in a cell line according to the disclosure or in a tumor from a subject are known in the art.
  • Warburg-Christian method Lowry Assay, Bradford Assay, spectrometry methods such as high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC/MS), immunoblotting and antibody-based techniques such as western blot, ELISA, immunoelectrophoresis, protein immunoprecipitation, flow cytometry, and protein immunostaining are all contemplated by the present disclosure.
  • HPLC high performance liquid chromatography
  • LC/MS liquid chromatography-mass spectrometry
  • immunoblotting and antibody-based techniques such as western blot, ELISA, immunoelectrophoresis, protein immunoprecipitation, flow cytometry, and protein immunostaining are all contemplated by the present disclosure.
  • the antigen repertoire displayed by a patient's tumor can be evaluated in some embodiments in a biopsy specimen using next generation sequencing and antibody-based approaches.
  • the antigen repertoire of potential metastatic lesions can be evaluated using the same techniques to determine antigens expressed by circulating tumor cells (CTCs).
  • Assessment of antigen expression in tumor biopsies and CTCs can be representative of a subset of antigens expressed.
  • a subset of the antigens expressed by a patient's primary tumor and/or CTCs are identified and, as described herein, informs the selection of cell lines to be included in the vaccine composition in order to provide the best possible match to the antigens expressed in a patient's tumor and/or metastatic lesions.
  • Embodiments of the present disclosure provides compositions of cell lines that (i) are modified as described herein and (ii) express a sufficient number and amount of TAAs such that, when administered to a patient afflicted with a cancer, cancers, or cancerous tumor(s), a TAA-specific immune response is generated.
  • the vaccine compositions described herein may be administered to a subject in need thereof.
  • administration of any one of the vaccine compositions provided herein can increase pro-inflammatory cytokine production (e.g., IFN ⁇ secretion) by leukocytes.
  • administration of any one of the vaccine compositions provided herein can increase pro-inflammatory cytokine production (e.g., IFN ⁇ secretion) by leukocytes by at least 1.5-fold, 1.6-fold, 1.75-fold, 2-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4.0-fold, 4.5-fold, 5.0-fold or more.
  • the IFN ⁇ production is increased by approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-fold or higher compared to unmodified cancer cell lines.
  • the increase in pro-inflammatory cytokine production e.g., IFN ⁇ secretion
  • leukocytes is a result of either indirect or direct interaction with the vaccine composition.
  • administration of any one of the vaccine compositions provided herein comprising one or more modified cell lines as described herein can increase the uptake of cells of the vaccine composition by phagocytic cells, e.g., by at least 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 2-fold, 2.5-fold or more, as compared to a composition that does not comprise modified cells.
  • the vaccine composition is provided to a subject by an intradermal injection.
  • the intradermal injection in at least some embodiments, generates a localized inflammatory response recruiting immune cells to the injection site.
  • APCs antigen presenting cells
  • LCs Langerhans cells
  • DCs dermal dendritic cells
  • DCs or LCs that have phagocytized the vaccine cell line components are expected to prime na ⁇ ve T cells and B cells.
  • TAAs tumor associated antigens
  • TAE tumor microenvironment
  • immunogenicity of the allogenic vaccine composition can be further enhanced through genetic modifications that reduce expression of immunosuppressive factors while increasing the expression or secretion of immunostimulatory signals. Modulation of these factors aims to enhance the uptake vaccine cell line components by LCs and DCs in the dermis, trafficking of DCs and LCs to the draining lymph node, T cell and B cell priming in the draining lymph node, and, thereby resulting in more potent anti-tumor responses.
  • the breadth of TAAs targeted in the vaccine composition can be increased through the inclusion of multiple cell lines. For example, different histological subsets within a certain tumor type tend to express different TAA subsets. As a further example, in NSCLC, adenocarcinomas, and squamous cell carcinomas express different antigens.
  • the magnitude and breadth of the adaptive immune response induced by the vaccine composition can, according to some embodiments of the disclosure, be enhanced through the inclusion of additional cell lines expressing the same or different immunostimulatory factors. For example, expression of an immunostimulatory factor, such as IL-12, by one cell line within a cocktail of three cell lines can act locally to enhance the immune responses to all cell lines delivered into the same site.
  • an immunostimulatory factor such as IL-12
  • an immunostimulatory factor by more than one cell line within a cocktail can increase the amount of the immunostimulatory factor in the injection site, thereby enhancing the immune responses induced to all components of the cocktail.
  • the degree of HLA mismatch present within a vaccine cocktail may further enhance the immune responses induced by that cocktail.
  • a method of stimulating an immune response specific to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more TAAs in a subject comprising administering a therapeutically effective amount of a vaccine composition comprising modified cancer cell lines.
  • an “immune response” is a response of a cell of the immune system, such as a B cell, T cell, or monocyte, to a stimulus, such as a cell or antigen (e.g., formulated as an antigenic composition or a vaccine).
  • a cell or antigen e.g., formulated as an antigenic composition or a vaccine.
  • An immune response can be a B cell response, which results in the production of specific antibodies, such as antigen specific neutralizing antibodies.
  • An immune response can also be a T cell response, such as a CD4+response or a CD8+response.
  • B cell and T cell responses are aspects of a “cellular” immune response.
  • An immune response can also be a “humoral” immune response, which is mediated by antibodies.
  • the response is specific for a particular antigen (that is, an “antigen specific response”), such as one or more TAAs, and this specificity can include the production of antigen specific antibodies and/or production of a cytokine such as interferon gamma which is a key cytokine involved in the generation of a Th 1 T cell response and measurable by ELISpot and flow cytometry.
  • an antigen specific response such as one or more TAAs
  • Vaccine efficacy can be tested by measuring the T cell response CD4+ and CD8+ after immunization, using flow cytometry (FACS) analysis, ELISpot assay, or other method known in the art.
  • Exposure of a subject to an immunogenic stimulus such as a cell or antigen (e.g., formulated as an antigenic composition or vaccine), elicits a primary immune response specific for the stimulus, that is, the exposure “primes” the immune response.
  • a subsequent exposure, e.g., by immunization, to the stimulus can increase or “boost” the magnitude (or duration, or both) of the specific immune response.
  • boosting increases the magnitude of an antigen (or cell) specific response, (e.g., by increasing antibody titer and/or affinity, by increasing the frequency of antigen specific B or T cells, by inducing maturation effector function, or a combination thereof).
  • the immune responses that are monitored/assayed or stimulated by the methods described herein include, but not limited to: (a) antigen specific or vaccine specific IgG antibodies; (b) changes in serum cytokine levels that may include and is not limited to: IL-1 ⁇ , IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IL-17A, IL-20, IL-22, TNF ⁇ , IFN ⁇ , TGF ⁇ , CCL5, CXCL10; (c) IFN ⁇ responses determined by ELISpot for CD4 and CD8 T cell vaccine and antigen specific responses; (d) changes in IFN ⁇ responses to TAA or vaccine cell components; (e) increased T cell production of intracellular cytokines in response to antigen stimulation: IFN ⁇ , TNF ⁇ , and IL-2 and indicators of cytolytic potential: Granzyme A, Granzyme B, Perforin, and CD107a; (f) decreased levels of regulatory T cells (Tregs), mononuclear monocyte derived
  • DC maturation can be assessed, for example, by assaying for the presence of DC maturation markers such as CD80, CD83, CD86, and MHC II. (See Dudek, A., et al., Front. Immunol., 4:438 (2013)).
  • Antigen specific or vaccine specific IgG antibodies can be assessed by ELISA or flow cytometry.
  • Serum cytokine levels can be measured using a multiplex approach such as Luminex or Meso Scale Discovery Electrochemiluminescence (MSD).
  • MSD Meso Scale Discovery Electrochemiluminescence
  • T cell activation and changes in lymphocyte populations can be measured by flow cytometry.
  • CTCs can be measured in PBMCs using a RT-PCR based approach.
  • NLR and PLR ratios can be determined using standard complete blood count (CBC) chemistry panels. Changes in immune infiltrate in the TME can be assessed by flow cytometry, tumor biopsy and next-generation sequencing (NGS), or positron emission tomography (PET) scan of a subject.
  • CBC complete blood count
  • NGS next-generation sequencing
  • PET positron emission tomography
  • compositions that can treat multiple different cancers.
  • one vaccine composition comprising two cocktails of three cell lines each may be administered to a subject suffering from two or more types of cancers and said vaccine composition is effective at treating both, additional or all types of cancers.
  • the same vaccine composition comprising modified cancer cell lines is used to treat prostate cancer and testicular cancer, gastric and esophageal cancer, or endometrial, ovarian, and breast cancer in the same patient (or different patients).
  • TAA overlap can also occur within subsets of hot tumors or cold tumors.
  • TAA overlap occurs in GBM and SCLC, both considered cold tumors.
  • Exemplary TAAs included in embodiments of the vaccine composition include GP100, MAGE-A1, MAGE-A4, MAGE-A10, Sart-1, Sart-3, Trp-1, and Sox2.
  • cell lines included in the vaccine composition can be selected from two tumor types of similar immune landscape to treat one or both of the tumor types in the same individual.
  • changes in or “increased production” of, for example a cytokine such as IFN ⁇ refers to a change or increase above a control or baseline level of production/secretion/expression and that is indicative of an immunostimulatory response to an antigen or vaccine component.
  • compositions described herein may be formulated as pharmaceutical compositions.
  • pharmaceutically acceptable refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material.
  • Each component must be “pharmaceutically acceptable” in the sense of being compatible with the other ingredients of a pharmaceutical formulation. It must also be suitable for use in contact with tissue, organs or other human component without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications, commensurate with a reasonable benefit/risk ratio.
  • Embodiments of the pharmaceutical composition of the disclosure is formulated to be compatible with its intended route of administration (i.e., parenteral, intravenous, intra-arterial, intradermal, subcutaneous, oral, inhalation, transdermal, topical, intratumoral, transmucosal, intraperitoneal or intra-pleural, and/or rectal administration).
  • parenteral i.e., parenteral, intravenous, intra-arterial, intradermal, subcutaneous, oral, inhalation, transdermal, topical, intratumoral, transmucosal, intraperitoneal or intra-pleural, and/or rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; dimethyl sulfoxide (DMSO); antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • a sterile diluent such as water, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • DMSO dimethyl sulfoxide
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes, or one or more vials comprising glass or polymer (e.g., polypropylene).
  • vial as used herein means any kind of vessel, container, tube, bottle, or the like that is adapted to store embodiments of the vaccine composition as described herein.
  • the composition further comprises a pharmaceutically acceptable carrier.
  • carrier as used herein encompasses diluents, excipients, adjuvants, and combinations thereof.
  • Pharmaceutically acceptable carriers are well known in the art (See Remington: The Science and Practice of Pharmacy, 21st Edition).
  • Exemplary “diluents” include sterile liquids such as sterile water, saline solutions, and buffers (e.g., phosphate, tris, borate, succinate, or histidine).
  • Exemplary “excipients” are inert substances that may enhance vaccine stability and include but are not limited to polymers (e.g., polyethylene glycol), carbohydrates (e.g., starch, glucose, lactose, sucrose, or cellulose), and alcohols (e.g., glycerol, sorbitol, or xylitol).
  • polymers e.g., polyethylene glycol
  • carbohydrates e.g., starch, glucose, lactose, sucrose, or cellulose
  • alcohols e.g., glycerol, sorbitol, or xylitol.
  • the vaccine compositions and cell line components thereof are sterile and fluid to the extent that the compositions and/or cell line components can be loaded into one or more syringes.
  • the compositions are stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion, by the use of surfactants, and by other means known to one of skill in the art.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, and/or sodium chloride in the composition.
  • prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
  • sterile injectable solutions can be prepared by incorporating the active compound(s) in the required amount(s) in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated herein.
  • embodiments of methods of preparation include vacuum drying and freeze-drying that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the innate immune system comprises cells that provide defense in a non-specific manner to infection by other organisms. Innate immunity in a subject is an immediate defense, but it is not long-lasting or protective against future challenges. Immune system cells that generally have a role in innate immunity are phagocytic, such as macrophages and dendritic cells. The innate immune system interacts with the adaptive (also called acquired) immune system in a variety of ways.
  • the vaccine compositions alone activate an immune response (i.e., an innate immune response, an adaptive immune response, and/or other immune response).
  • one or more adjuvants are optionally included in the vaccine composition or are administered concurrently or strategically in relation to the vaccine composition, to provide an agent(s) that supports activation of innate immunity in order to enhance the effectiveness of the vaccine composition.
  • An “adjuvant” as used herein is an “agent” or substance incorporated into the vaccine composition or administered simultaneously or at a selected time point or manner relative to the administration of the vaccine composition.
  • the adjuvant is a small molecule, chemical composition, or therapeutic protein such as a cytokine or checkpoint inhibitor.
  • An agent may act to enhance an acquired immune response in various ways and many types of agents can activate innate immunity.
  • Organisms like bacteria and viruses, can activate innate immunity, as can components of organisms, chemicals such as 2′-5′ oligo A, bacterial endotoxins, RNA duplexes, single stranded RNA and other compositions. Many of the agents act through a family of molecules referred to herein as “toll-like receptors” (TLRs).
  • TLRs toll-like receptors
  • Engaging a TLR can also lead to production of cytokines and chemokines and activation and maturation of dendritic cells, components involved in development of acquired immunity.
  • the TLR family can respond to a variety of agents, including lipoprotein, peptidoglycan, flagellin, imidazoquinolines, CpG DNA, lipopolysaccharide and double stranded RNA. These types of agents are sometimes called pathogen (or microbe)-associated molecular patterns.
  • the adjuvant is a TLR4 agonist.
  • MALA monoacid lipid A
  • MPL® adjuvant as described in, e.g., Ulrich J. T. and Myers, K. R., Chapter 21 in Vaccine Design, the Subunit and Adjuvant Approach, Powell, M. F. and Newman, M. J., eds. Plenum Press, NY (1995).
  • the adjuvant may be “alum”, where this term refers to aluminum salts, such as aluminum phosphate and aluminum hydroxide.
  • the adjuvant may be an emulsion having vaccine adjuvant properties.
  • emulsions include oil-in-water emulsions. Incomplete Freund's adjuvant (IFA) is one such adjuvant.
  • IFA Incomplete Freund's adjuvant
  • MF-59TM adjuvant which contains squalene, polyoxyethylene sorbitan monooleate (also known as Tween® 80 surfactant) and sorbitan trioleate.
  • emulsion adjuvants are MontanideTM adjuvants (Seppic Inc., Fairfield N.J.) including MontanideTM ISA 50V which is a mineral oil-based adjuvant, MontanideTM ISA 206, and MontanideTM IMS 1312. While mineral oil may be present in the adjuvant, in one embodiment, the oil component(s) of the compositions of the present disclosure are all metabolizable oils.
  • the adjuvant may be AS02TM adjuvant or ASO4TM adjuvant.
  • AS02TM adjuvant is an oil-in-water emulsion that contains both MPL TM adjuvant and QS-21TM adjuvant (a saponin adjuvant discussed elsewhere herein).
  • ASO4TM adjuvant contains MPLTM adjuvant and alum.
  • the adjuvant may be Matrix-MTM adjuvant.
  • the adjuvant may be a saponin such as those derived from the bark of the Quillaja saponaria tree species, or a modified saponin, see, e.g., U.S. Pat. Nos.
  • the product QS-21TM adjuvant sold by Antigenics, Inc. is an exemplary saponin-containing co-adjuvant that may be used with embodiments of the composition described herein.
  • the adjuvant may be one or a combination of agents from the ISCOMTM family of adjuvants, originally developed by Iscotec (Sweden) and typically formed from saponins derived from Quillaja saponaria or synthetic analogs, cholesterol, and phospholipid, all formed into a honeycomb-like structure.
  • the adjuvant or agent may be a cytokine that functions as an adjuvant, see, e.g., Lin R. et al. Clin. Infec. Dis. 21(6):1439-1449 (1995); Taylor, C. E., Infect. Immun. 63(9):3241-3244 (1995); and Egilmez, N. K., Chap. 14 in Vaccine Adjuvants and Delivery Systems, John Wiley & Sons, Inc. (2007).
  • the cytokine may be, e.g., granulocyte-macrophage colony-stimulating factor (GM-CSF); see, e.g., Change D.Z. et al.
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • an interferon such as a type I interferon, e.g., interferon- ⁇ (IFN- ⁇ ) or interferon- ⁇ (IFN- ⁇ ), or a type II interferon, e.g., interferon- ⁇ (IFN ⁇ ), see, e.g., Boehm, U. et al. Ann. Rev. Immunol. 15:749-795 (1997); and Theofilopoulos, A. N. et al. Ann. Rev. Immunol.
  • interleukin specifically including interleukin-1 ⁇ (1L-1 ⁇ ), interleukin-1 ⁇ (IL-1 ⁇ ), interleukin-2 (IL-2); see, e.g., Nelson, B. H., J. Immunol. 172(7): 3983-3988 (2004); interleukin-4 (IL-4), interleukin-7 (IL-7), interleukin-12 (IL-12); see, e.g., Portielje, J. E., et al., Cancer Immunol. Immunother. 52(3): 133-144 (2003) and Trinchieri. G. Nat. Rev. Immunol.
  • interleukin-15 II-15
  • interleukin-18 IL-18
  • F1t3L fetal liver tyrosine kinase 3 ligand
  • TNF ⁇ tumor necrosis factor ⁇
  • the adjuvant may be unmethylated CpG dinucleotides, optionally conjugated to the antigens described herein.
  • immunopotentiators examples include: MPLTM; MDP and derivatives; oligonucleotides; double-stranded RNA; alternative pathogen-associated molecular patterns (PAMPS); saponins; small-molecule immune potentiators (SMIPs); cytokines; and chemokines.
  • the relative amounts of the multiple adjuvants may be selected to achieve the desired performance properties for the composition which contains the adjuvants, relative to the antigen alone.
  • an adjuvant combination may be selected to enhance the antibody response of the antigen, and/or to enhance the subject's innate immune system response.
  • Activating the innate immune system results in the production of chemokines and cytokines, which in turn may activate an adaptive (acquired) immune response.
  • An important consequence of activating the adaptive immune response is the formation of memory immune cells so that when the host re-encounters the antigen, the immune response occurs quicker and generally with better quality.
  • the adjuvant(s) may be pre-formulated prior to their combination with the compositions described herein.
  • Embodiments of the vaccine compositions described herein may be administered simultaneously with, prior to, or after administration of one or more other adjuvants or agents, including therapeutic agents.
  • agents may be accepted in the art as a standard treatment or prevention for a particular cancer.
  • agents contemplated include cytokines, growth factors, steroids, NSAIDs, DMARDs, anti-inflammatories, immune checkpoint inhibitors, chemotherapeutics, radiotherapeutics, or other active and ancillary agents.
  • the agent is one or more isolated TAA as described herein.
  • a vaccine composition provided herein is administered to a subject that has not previously received certain treatment or treatments for cancer or other disease or disorder.
  • the phrase “wherein the subject refrains from treatment with other vaccines or therapeutic agents” refers to a subject that has not received a cancer treatment or other treatment or procedure prior to receiving a vaccine of the present disclosure.
  • the subject refrains from receiving one or more therapeutic vaccines (e.g. flu vaccine, covid-19 vaccine such as AZD1222, BNT162b2, mRNA-1273, and the like) prior to the administration of the therapeutic vaccine as described in various embodiments herein.
  • the subject refrains from receiving one or more antibiotics prior to the administration of the therapeutic vaccine as described in various embodiments herein.
  • Immuno tolerance is a state of unresponsiveness of the immune system to substances, antigens, or tissues that have the potential to induce an immune response.
  • the vaccine compositions of the present disclosure are administered to avoid the induction of immune tolerance or to reverse immune tolerance.
  • the vaccine composition is administered in combination with one or more active agents used in the treatment of cancer, including one or more chemotherapeutic agents.
  • active agents include alkylating agents such as thiotepa and cyclophosphamide (CYTOXANTM); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethylenethiophosphaoramide and trimethylolomelamine; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine,
  • anti-hormonal agents that act to regulate or inhibit hormone action on tumors
  • anti-estrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (Fareston); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
  • cancer active agents include sorafenib and other protein kinase inhibitors such as afatinib, axitinib, bevacizumab, cetuximab, crizotinib, dasatinib, erlotinib, fostamatinib, gefitinib, imatinib, lapatinib, lenvatinib, mubritinib, nilotinib, panitumumab, pazopanib, pegaptanib, ranibizumab, ruxolitinib, trastuzumab, vandetanib, vemurafenib, and sunitinib; sirolimus (rapamycin), everolimus and other mTOR inhibitors.
  • protein kinase inhibitors such as afatinib, axitinib, bevacizumab, cetuximab, crizotinib, dasatinib,
  • the vaccine composition is administered in combination with a TLR4 agonist, TLR8 agonist, or TLR9 agonist.
  • a TLR4 agonist may be selected from peptidoglycan, polyl:C, CpG, 3M003, flagellin, and Leishmania homolog of eukaryotic ribosomal elongation and initiation factor 4a (LeIF).
  • the vaccine composition is administered in combination with a cytokine as described herein.
  • the compositions disclosed herein may be administered in conjunction with molecules targeting one or more of the following: Adhesion: MAdCAM1, ICAM1, VCAM1, CD103; Inhibitory Mediators: IDO, TDO; MDSCs/Tregs: NOS1, arginase, CSFR1, FOXP3, cyclophosphamide, PI3Kgamma, PI3Kdelta, tasquinimod; Immunosuppression: TGF ⁇ , IL-10; Priming and Presenting: BATF3, XCR1/XCL1, STING, INFalpha; Apoptotic Recycling: IL-6, surviving, IAP, mTOR, MCL1, PI3K; T-Cell Trafficking: CXCL9/10/11, CXCL1/13, CCL2/5, anti-LIGHT, anti-CCR5; Oncogenic Activation: WNT-beta-cat, MEK
  • compositions disclosed herein may be administered in conjunction with a histone deacetylase (HDAC) inhibitor.
  • HDAC inhibitors include hydroxamates, cyclic peptides, aliphatic acids and benzamides.
  • Illustrative HDAC inhibitors contemplated for use herein include, but are not limited to, Suberoylanilide hydroxamic acid (SAHA/Vorinostat/Zolinza), Trichostatin A (TSA), PXD-101, Depsipeptide (FK228/romidepsin/ISTODAX®), panobinostat (LBH589), MS-275, Mocetinostat (MGCD0103), ACY-738, TMP195, Tucidinostat, valproic acid, sodium phenylbutyrate, 5-aza-2′-deoxycytidine (decitabine).
  • SAHA/Vorinostat/Zolinza Suberoylanilide hydroxamic acid
  • TSAHA Trichostatin A
  • HDAC inhibitors include Vorinostat (SAHA, MK0683), Entinostat (MS-275), Panobinostat (LBH589), Trichostatin A (TSA), Mocetinostat (MGCD0103), ACY-738, Tucidinostat (Chidamide), TMP195, Citarinostat (ACY-241), Belinostat (PXD101), Romidepsin (FK228, Depsipeptide), MC1568, Tubastatin A HCI, Givinostat (ITF2357), Dacinostat (LAQ824), CUDC-101, Quisinostat (JNJ-26481585) 2HCI, Pracinostat (SB939), PCI-34051, Droxinostat, Abexinostat (PCI-24
  • the vaccine composition is administered in combination with chloroquine, a lysosomotropic agent that prevents endosomal acidification and which inhibits autophagy induced by tumor cells to survive accelerated cell growth and nutrient deprivation.
  • the compositions comprising heterozygous viral vectors as described herein may be administered in combination with active agents that act as autophagy inhibitors, radiosensitizers or chemosensitizers, such as chloroquine, misonidazole, metronidazole, and hypoxic cytotoxins, such as tirapazamine.
  • active agents that act as autophagy inhibitors, radiosensitizers or chemosensitizers, such as chloroquine, misonidazole, metronidazole, and hypoxic cytotoxins, such as tirapazamine.
  • such combinations of a heterozygous viral vector with chloroquine or other radio or chemo sensitizer, or autophagy inhibitor can be used in further combination with other cancer
  • the vaccine composition is administered in combination with one or more small molecule drugs that are known to result in killing of tumor cells with concomitant activation of immune responses, termed “immunogenic cell death”, such as cyclophosphamide, doxorubicin, oxaliplatin and mitoxantrone.
  • small molecule drugs that are known to result in killing of tumor cells with concomitant activation of immune responses, termed “immunogenic cell death”, such as cyclophosphamide, doxorubicin, oxaliplatin and mitoxantrone.
  • patupilone epothilone B
  • epidermal-growth factor receptor EGFR
  • histone deacetylase inhibitors e.g., vorinostat, romidepsin, panobinostat, belinostat, and entinostat
  • the n3-polyunsaturated fatty acid docosahexaenoic acid furthermore proteasome inhibitors (e.g., bortezomib), shikonin (the major constituent of the root of Lithospermum erythrorhizon,) and oncolytic viruses, such as TVec (talimogene laherparepvec).
  • compositions comprising heterozygous viral vectors as described herein may be administered in combination with epigenetic therapies, such as DNA methyltransferase inhibitors (e.g., decitabine, 5-aza-2′-deoxycytidine) which may be administered locally or systemically.
  • epigenetic therapies such as DNA methyltransferase inhibitors (e.g., decitabine, 5-aza-2′-deoxycytidine) which may be administered locally or systemically.
  • the vaccine composition is administered in combination with one or more antibodies that increase ADCC uptake of tumor by DCs.
  • embodiments of the present disclosure contemplate combining cancer vaccine compositions with any molecule that induces or enhances the ingestion of a tumor cell or its fragments by an antigen presenting cell and subsequent presentation of tumor antigens to the immune system.
  • These molecules include agents that induce receptor binding (e.g., Fc or mannose receptors) and transport into the antigen presenting cell such as antibodies, antibody-like molecules, multi-specific multivalent molecules and polymers.
  • Such molecules may either be administered intratumorally with the composition comprising heterozygous viral vector or administered by a different route.
  • compositions comprising heterozygous viral vector as described herein may be administered intratumorally in conjunction with intratumoral injection of rituximab, cetuximab, trastuzumab, Campath, panitumumab, ofatumumab, brentuximab, pertuzumab, Ado-trastuzumab emtansine, Obinutuzumab, anti-HER1, -HER2, or -HER3 antibodies (e.g., MEHD7945A; MM-111; MM-151; MM-121; AMG888), anti-EGFR antibodies (e.g., nimotuzumab, ABT-806), or other like antibodies.
  • Any multivalent scaffold that is capable of engaging Fc receptors and other receptors that can induce internalization may be used in the combination therapies described herein (e.g., peptides and/or proteins capable of binding targets that are linked to Fc fragments or polymers capable of engaging receptors).
  • the vaccine composition may be further combined with an inhibitor of ALK, PARP, VEGFRs, EGFR, FGFR1-3, HIF1 ⁇ , PDGFR1-2, c-Met, c-KIT, Her2, Her3, AR, PR, RET, EPHB4, STAT3, Ras, HDAC1-11, mTOR, and/or CXCR4.
  • a cancer vaccine composition may be further combined with an antibody that promotes a co- stimulatory signal (e.g., by blocking inhibitory pathways), such as anti-CTLA-4, or that activates co-stimulatory pathways such as an anti-CD40, anti-CD28, anti-ICOS, anti-OX40, anti-CD27, anti-ICOS, anti-CD127, anti-GITR, IL-2, IL-7, IL-15, IL-21, GM-CSF, IL-12, and INF ⁇ .
  • a co- stimulatory signal e.g., by blocking inhibitory pathways
  • co-stimulatory pathways e.g., by blocking inhibitory pathways
  • co-stimulatory pathways e.g., by blocking inhibitory pathways
  • co-stimulatory pathways e.g., by blocking inhibitory pathways
  • co-stimulatory pathways e.g., by blocking inhibitory pathways
  • co-stimulatory pathways e.g., by blocking inhibitory pathways
  • co-stimulatory pathways e.g
  • a checkpoint inhibitor molecule is administered in combination with the vaccine compositions described herein.
  • Immune checkpoints refer to a variety of inhibitory pathways of the immune system that are crucial for maintaining self-tolerance and for modulating the duration and amplitude of an immune responses. Tumors use certain immune- checkpoint pathways as a major mechanism of immune resistance, particularly against T cells that are specific for tumor antigens. (See Pardoll, 2012 Nature 12:252; Chen and Mellman Immunity 39:1 (2013)). Immune checkpoint inhibitors include any agent that blocks or inhibits in a statistically significant manner, the inhibitory pathways of the immune system.
  • Such inhibitors may include antibodies, or antigen binding fragments thereof, that bind to and block or inhibit immune checkpoint receptors or antibodies that bind to and block or inhibit immune checkpoint receptor ligands.
  • Illustrative immune checkpoint molecules that may be targeted for blocking or inhibition include, but are not limited to, CTLA-4, 4-1BB (CD137), 4-1BBL (CD137L), PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, TIM3, B7H3, B7H4, VISTA, KIR, BTLA, SIGLEC9, 2B4 (belongs to the CD2 family of molecules and is expressed on all NK, ⁇ , and memory CD8+ ( ⁇ ) T cells), CD160 (also referred to as BY55), and CGEN-15049.
  • Immune checkpoint inhibitors include antibodies, or antigen binding fragments thereof, or other binding proteins, that bind to and block or inhibit the activity of one or more of CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, TIM3, B7H3, B7H4, VISTA, KIR, BTLA, SIGLEC9, 2B4, CD160, and CGEN-15049.
  • Illustrative immune checkpoint inhibitors include anti-PD1, anti-PDL1, and anti-PDL2 agents such as A167, AB122, ABBV-181, ADG-104, AK-103, AK-105, AK-106, AGEN2034, AM0001, AMG-404, ANB-030, APL-502, APL-501, zimberelimab, atezolizumab, AVA-040, AVA-040-100, avelumab, balstilimab, BAT-1306, BCD-135, BGB-A333, BI-754091, budigalimab, camrelizumab, CB-201, CBT-502, CCX-4503, cemiplimab, cosibelimab, cetrelimab, CS-1001, CS-1003, CX-072, CX-188, dostarlimab, durvalumab, envafolimab, sugemalimab, HBM9167, F-520,
  • Illustrative multi-specific immune checkpoint inhibitors where at least one target is anti-PD1, anti-PDL1, or anti-PDL2, include ABP-160 (CD47 ⁇ PD-L1), AK-104 (PD-1 ⁇ CTLA-4), AK-112 (PD-1 ⁇ VEGF), ALPN-202 (PD-L1 ⁇ CTLA-4 ⁇ CD28), AP-201 (PD-L1 ⁇ OX-40), AP-505 (PD-L1 ⁇ VEGF), AVA-0017 (PD-L1 ⁇ LAG-3), AVA-0021 (PD-L1 ⁇ LAG-3), AUPM-170 (PD-L1 ⁇ VISTA), BCD-217 (PD-1 ⁇ CTLA-4), BH-2950 (PD-1 ⁇ HER2), BH-2996h (PD-1 ⁇ PD-L1), BH-29xx (PD-L1 ⁇ CD47), bintrafusp alfa (PD-L1 ⁇ TGF ⁇ ), CB-213 (PD-1 ⁇ LAG-3), CDX-527 (CD27 ⁇ PD-L1), CS
  • Additional illustrative immune checkpoint inhibitors include anti-CTLA4 agents such as: ADG-116, AGEN-2041, BA-3071, BCD-145, BJ-003, BMS-986218, BMS-986249, BPI-002, CBT-509, CG-0161, Olipass-1, HBM-4003, HLX-09, IBI-310, ipilimumab, JS-007, KN-044, MK-1308, ONC-392, REGN-4659, RP-2, tremelimumab, and zalifrelimab.
  • anti-CTLA4 agents such as: ADG-116, AGEN-2041, BA-3071, BCD-145, BJ-003, BMS-986218, BMS-986249, BPI-002, CBT-509, CG-0161, Olipass-1, HBM-4003, HLX-09, IBI-310, ipilimumab, JS-007, KN-044,
  • Additional illustrative multi-specific immune checkpoint inhibitors where at least one target is anti-CTLA4, include: AK-104 (PD-1 ⁇ CTLA-4), ALPN-202 (PD-L1 ⁇ CTLA-4 ⁇ CD28), ATOR-1015 (CTLA-4 ⁇ 0X40), ATOR-1144 (CTLA-4 ⁇ GITR), BCD-217 (PD-1 ⁇ CTLA-4), DB- 002 (PD-L1 ⁇ CTLA-4), FPT-155 (CD28 ⁇ CTLA-4), KN-046 (PD-L1 ⁇ CTLA-4),), MEDI-5752 (PD-1 ⁇ CTLA-4), MGD-019 (PD- 1 x CTLA-4), PSB-205 (PD-1 ⁇ CTLA-4), XmAb-20717 (CTLA-4 ⁇ PD-1), and XmAb-22841 (CTLA-4 ⁇ LAG-3).
  • AK-104 PD-1 ⁇ CTLA-4
  • ALPN-202 PD-L1 ⁇ CTLA-4 ⁇ CD28
  • ATOR-1015 CTLA-4 ⁇ 0X40
  • Additional illustrative immune checkpoint inhibitors include anti-LAG3 agents such as BI-754111, BJ-007, eftilagimod alfa, GSK-2831781, HLX-26, IBI-110, IMP-701, IMP-761, INCAGN-2385, LBL-007, MK-4280, REGN-3767, relatlimab, Sym-022, TJ-A3, and TSR-033.
  • anti-LAG3 agents such as BI-754111, BJ-007, eftilagimod alfa, GSK-2831781, HLX-26, IBI-110, IMP-701, IMP-761, INCAGN-2385, LBL-007, MK-4280, REGN-3767, relatlimab, Sym-022, TJ-A3, and TSR-033.
  • Additional illustrative multi-specific immune checkpoint inhibitors where at least one target is anti-LAG3, include: CB-213 (PD-1 ⁇ LAG-3), FS-118 (LAG-3 ⁇ PD-L1), MGD-013 (PD-1 ⁇ LAG-3), AVA-0017 (PD-L1 ⁇ LAG-3), AVA-0021 (PD-L1 ⁇ LAG- 3), RO-7247669 (PD-1 ⁇ LAG-3), TSR-075 (PD-1 ⁇ LAG-3), and XmAb-22841 (CTLA-4 ⁇ LAG-3).
  • Additional illustrative immune checkpoint inhibitors include anti-TIGIT agents such as AB-154, ASP8374, BGB-A1217, BMS-986207, CASC-674, COM-902, EOS-884448, HLX-53, IBI-939, JS-006, MK-7684, NB-6253, RXI-804, tiragolumab, and YH-29143. Additional illustrative multi-specific immune checkpoint inhibitors, where at least one target is anti-TIGIT are contemplated.
  • Additional illustrative immune checkpoint inhibitors include anti-TIM3 agents such as: BGB-A425, BMS-986258, ES-001, HLX-52, INCAGN-2390, LBL-003, LY-3321367, MBG-453, SHR-1702, Sym-023, and TSR-022.
  • Additional illustrative multi-specific immune checkpoint inhibitors, where at least one target is anti-TIM3, include: AUPM-327 (PD-L1 ⁇ TIM-3), and RO-7121661 (PD-1 ⁇ TIM-3).
  • Additional illustrative immune checkpoint inhibitors include anti-VISTA agents such as: HMBD-002, and PMC-309.
  • Additional illustrative multi-specific immune checkpoint inhibitors where at least one target is anti-VISTA, include CA-170 (PD-L1 ⁇ VISTA). Additional illustrative immune checkpoint inhibitors include anti-BTLA agents such as: JS-004. Additional illustrative multi-specific immune checkpoint inhibitors, where at least one target is anti-BTLA are contemplated.
  • Illustrative stimulatory immune checkpoints include anti-OX40 agents such as ABBV-368, GSK-3174998, HLX-51, IBI-101, INBRX-106, INCAGN-1949, INV-531, JNJ-6892, and KHK-4083.
  • Additional illustrative multi-specific stimulatory immune checkpoints where at least one target is anti-OX40, include AP-201 (PD-L1 ⁇ OX-40), APVO-603 (CD138/4-1BB ⁇ OX-40), ATOR-1015 (CTLA-4 ⁇ OX-40), and FS-120 (OX40 x CD137/4-1BB).
  • Additional illustrative stimulatory immune checkpoints include anti-GITR agents such as BMS-986256, CK-302, GWN-323, INCAGN-1876, MK-4166, PTZ-522, and TRX-518.
  • Additional illustrative multi-specific stimulatory immune checkpoints, where at least one target is anti-GITR include ATOR-1144 (CTLA-4 ⁇ GITR).
  • Additional illustrative stimulatory immune checkpoints include anti-CD137/4-1BB agents such a: ADG-106, AGEN-2373, AP-116, ATOR-1017, BCY-3814, CTX-471, EU-101, LB-001, LVGN-6051, RTX-4-1BBL, SCB-333, urelumab, utomilumab, and WTiNT.
  • anti-CD137/4-1BB agents such a: ADG-106, AGEN-2373, AP-116, ATOR-1017, BCY-3814, CTX-471, EU-101, LB-001, LVGN-6051, RTX-4-1BBL, SCB-333, urelumab, utomilumab, and WTiNT.
  • Additional illustrative multi-specific stimulatory immune checkpoints where at least one target is anti-CD137/4-1BB, include ALG.APV-527 (CD137/4-1BB ⁇ 5T4), APVO-603 (CD137/4-1BB ⁇ OX40), BT-7480 (Nectin-4 ⁇ CD137/4-1BB), CB-307 (CD137/4-1BB ⁇ PSMA), CUE-201 (CD80 ⁇ CD137/4-1BB), DSP-105 (PD-1 ⁇ CD137/4-1BB), FS-120 (OX40 ⁇ CD137/4-1BB), FS-222 (PD-L1 ⁇ CD137/4-1BB), GEN-1042(CD40 ⁇ CD137/4-1BB), GEN-1046 (PD-L1 ⁇ CD137/4-1BB), INBRX-105 (PD-L1 ⁇ CD137/4-1BB), MCLA-145 (PD-L1 ⁇ CD137/4-1BB), MP-0310 (CD137/4-1BB ⁇ FAP), ND-021 (PD-L1 ⁇ CD137/4-1BB ⁇ HSA), PR
  • Additional illustrative stimulatory immune checkpoints include anti-ICOS agents such as BMS-986226, GSK-3359609, KY-1044, and vopratelimab. Additional illustrative multi-specific stimulatory immune checkpoints, where at least one target is anti-ICOS, include XmAb-23104 (PD-1 ⁇ ICOS). Additional illustrative stimulatory immune checkpoints include anti-CD127 agents such as MD-707 and OSE-703. Additional illustrative multi-specific stimulatory immune checkpoints, where at least one target is anti-CD127 are contemplated.
  • Additional illustrative stimulatory immune checkpoints include anti-CD40 agents such as ABBV-428, ABBV-927, APG-1233, APX-005M, BI-655064, bleselumab, CD-40GEX, CDX-1140, LVGN-7408, MEDI-5083, mitazalimab, and selicrelumab.
  • Additional Illustrative multi-specific stimulatory immune checkpoints, where at least one target is anti-CD40 include GEN-1042 (CD40 ⁇ CD137/4-1BB).
  • Additional illustrative stimulatory immune checkpoints include anti-CD28 agents such as FR-104 and theralizumab.
  • Additional illustrative multi-specific stimulatory immune checkpoints where at least one target is anti-CD28, include ALPN-101 (CD28 ⁇ ICOS), ALPN-202 (PD-L1 ⁇ CD28), CUE-201 (CD80 ⁇ CD137/4-1BB), FPT- 155 (CD28 ⁇ CTLA-4), and REGN-5678 (PSMA ⁇ CD28).
  • Additional illustrative stimulatory immune checkpoints include anti-CD27 agents such as: HLX-59 and varlilumab.
  • Additional illustrative multi-specific stimulatory immune checkpoints, where at least one target is anti-CD27 include DSP-160 (PD-L1 ⁇ CD27/CD70) and CDX-256 (PD-L1 ⁇ CD27).
  • Additional illustrative stimulatory immune checkpoints include anti-IL-2 agents such as ALKS-4230, BNT-151, CUE-103, NL-201, and THOR-707. Additional illustrative multi-specific stimulatory immune checkpoints, where at least one target is anti-IL-2, include CUE-102 (IL-2 ⁇ WT1). Additional illustrative stimulatory immune checkpoints include anti-IL-7 agents such as BNT-152. Additional illustrative multi-specific stimulatory immune checkpoints, where at least one target is anti-IL-7 are contemplated. Additional illustrative stimulatory immune checkpoints include anti-IL-12 agents such as AK-101, M-9241, and ustekinumab. Additional illustrative multi-specific stimulatory immune checkpoints, where at least one target is antilL-12 are contemplated.
  • anti-IL-2 agents such as ALKS-4230, BNT-151, CUE-103, NL-201, and THOR-707. Additional illustrative multi-specific
  • Treg inhibitors are known in the art and include, for example, bempegaldesleukin, fludarabine, gemcitabine, mitoxantrone, Cyclosporine A, tacrolimus, paclitaxel, imatinib, dasatinib, bevacizumab, idelalisib, anti-CD25, anti-folate receptor 4, anti-CTLA4, anti-GITR, anti-OX40, anti-CCR4, anti-CCR5, anti-CCR8, or TLR8 ligands.
  • Treg inhibitors include, for example, bempegaldesleukin, fludarabine, gemcitabine, mitoxantrone, Cyclosporine A, tacrolimus, paclitaxel, imatinib, dasatinib, bevacizumab, idelalisib, anti-CD25, anti-folate receptor 4, anti-CTLA4, anti-GITR, anti-OX40, anti-CCR4, anti-CCR5,
  • a “dose” or “unit dose” as used herein refers to one or more vaccine compositions that comprise therapeutically effective amounts of one more cell lines.
  • a dose can be a single vaccine composition, two separate vaccine compositions, or two separate vaccine compositions plus one or more compositions comprising one or more therapeutic agents described herein.
  • the two or more compositions of the “dose” are meant to be administered “concurrently”.
  • the two or more compositions are administered at different sites on the subject (e.g., arm, thigh, or back).
  • “concurrent” administration of two compositions or therapeutic agents indicates that within about 30 minutes of administration of a first composition or therapeutic agent, the second composition or therapeutic agent is administered.
  • each composition or agent is administered within 30 minutes, wherein timing of such administration begins with the administration of the first composition or agent and ends with the beginning of administration of the last composition or agent.
  • concurrent administration can be completed (i.e., administration of the last composition or agent begins) within about 30 minutes, or within 15 minutes, or within 10 minutes, or within 5 minutes of start of administration of first composition or agent.
  • Administration of a second (or multiple) therapeutic agents or compositions “prior to” or “subsequent to” administration of a first composition means that the administration of the first composition and another therapeutic agent is separated by at least 30 minutes, e.g., at least 1 hour, at least 2 hours, at least 4 hours, at least 6 hours, at least 8 hours, at least 10 hours, at least 12 hours, at least 18 hours, at least 24 hours, or at least 48 hours.
  • the amount (e.g., number) of cells from the various individual cell lines in the vaccine compositions can be equal (as defined herein), approximately (as defined herein) equal, or different.
  • each cell line of a vaccine composition is present in an approximately equal amount.
  • 2 or 3 cell lines of one vaccine composition are present in approximately equal amounts and 2 or 3 different cell lines of a second composition are present in approximately equal amounts.
  • the number of cells from each cell line is approximately 5.0 ⁇ 10 8 , 1.0 ⁇ 10 6 , 2.0 ⁇ 10 6 , 3.0 ⁇ 10 6 , 4.0 ⁇ 10 6 , 5.0 ⁇ 10 6 , 6.0 ⁇ 10 6 , 7.0 ⁇ 10 6 , 8 ⁇ 10 6 , 9.0 ⁇ 10 6 , 1.0 ⁇ 10 7 , 2.0 ⁇ 10 7 , 3.0 ⁇ 10 7 , 4.0 ⁇ 10 7 , 5.0 ⁇ 10 7 , 6.0 ⁇ 10 7 , 8.0 ⁇ 10 7 , 9.0 ⁇ 10 7 , 1.0 ⁇ 10 8 ,1.0 ⁇ 10 8 , 2.0 ⁇ 10 8 , 3.0 ⁇ 10 8 , 4.0 ⁇ 10 8 or 5.0 ⁇ 10 8 cells.
  • approximately 10 million (e.g., 1.0 ⁇ 10 7 ) cells from one cell line are contemplated. In another embodiment, where 6 separate cell lines are administered, approximately 10 million cells from each cell line, or 60 million (e.g., 6.0 ⁇ 10 7 ) total cells are contemplated.
  • the total number of cells administered in a vaccine composition can range from 1.0 ⁇ 10 6 to 3.0 ⁇ 10 8 .
  • 2.0 ⁇ 10 6 , 3.0 ⁇ 10 6 , 4.0 ⁇ 10 6 , 5.0 ⁇ 10 6 , 6.0 ⁇ 10 6 , 7.0 ⁇ 10 6 , 8 ⁇ 10 6 , 9.0 ⁇ 10 6 , 1.0 ⁇ 10 7 , 2.0 ⁇ 10 7 , 3.0 ⁇ 10 7 , 4.0 ⁇ 10 7 , 5.0 ⁇ 10 7 , 6.0 ⁇ 10 7 , 8.0 ⁇ 10 7 , 9.0 ⁇ 10 7 , 1.0 ⁇ 10 8 , 2.0 ⁇ 10 8 , or 3.0 ⁇ 10 8 cells are administered.
  • the number of cell lines contained with each administration of a cocktail or vaccine composition can range from 1 to 10 cell lines. In some embodiments, the number of cells from each cell line are not equal, and different ratios of cell lines are included in the cocktail or vaccine composition. For example, if one cocktail contains 5.0 ⁇ 10 7 total cells from 3 different cell lines, there could be 3.33 ⁇ 10 7 cells of one cell line and 8.33 ⁇ 10 6 of the remaining 2 cell lines.
  • the vaccine compositions and compositions comprising additional therapeutic agents may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir.
  • parenteral as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional, intracranial, transdermal, intradermal, intrapulmonal, intraperitoneal, intracardial, intraarterial and sublingual injection or infusion techniques.
  • additional therapeutic agents e.g., chemotherapeutic agents, checkpoint inhibitors, and the like
  • the vaccine compositions are administered intradermally.
  • the intradermal injection involves injecting the cocktail or vaccine composition at an angle of administration of 5 to 15 degrees.
  • the injections can be provided at a single site (e.g. arm, thigh or back), or at multiple sites (e.g. arms and thighs).
  • the vaccine composition is administered concurrently at two sites, where each site receives a vaccine composition comprising a different composition (e.g., cocktail).
  • the subject receives a composition comprising three cell lines in the arm, and three different, or partially overlapping cell lines in the thigh.
  • the subject receives a composition comprising one or more cell lines concurrently in each arm and in each thigh.
  • the subject receives multiple doses of the cocktail or vaccine composition and the doses are administered at different sites on the subject to avoid potential antigen competition at certain (e.g., draining) lymph nodes.
  • the multiple doses are administered by alternating administration sites (e.g. left arm and right arm, or left thigh and right thigh) on the subject between doses.
  • the multiple doses are administered as follows: a first dose is administered in one arm, and second dose is administered in the other arm; subsequent doses, if administered, continue to alternate in this manner.
  • the multiple doses are administered as follows: a first dose is administered in one thigh, and second dose is administered in the other thigh; subsequent doses, if administered, continue to alternate in this manner.
  • the multiple doses are administered as follows: a first dose is administered in one thigh, and second dose is administered in one arm; subsequent doses if administered can alternate in any combination that is safe and efficacious for the subject.
  • the multiple doses are administered as follows: a first dose is administered in one thigh and one arm, and second dose is administered in the other arm and the other thigh; subsequent doses if administered can alternate in any combination that is safe and efficacious for the subject.
  • the subject receives, via intradermal injection, a vaccine composition comprising a total of six cell lines (e.g., NCI-H460, NCI-H520, DMS 53, LK-2, NCI-H23, and A549 or other 6-cell line combinations described herein) in one, two or more separate cocktails, each cocktail comprising one or a mixture two or more of the 6-cell lines.
  • the subject receives, via intradermal injection, a vaccine composition comprising a mixture of three cell lines (e.g., three of NCI-H460, NCI-H520, DMS 53, LK-2, NCI-H23, and A549 or three cell lines from other 6-cell line combinations described herein).
  • the subject receives, via intradermal injection to the arm (e.g., upper arm), a vaccine composition comprising a mixture of three cell lines, comprising NCI-H460, NCI-H520, and A549; and the subject concurrently receives, via intradermal injection to the leg (e.g., thigh), a vaccine composition comprising a mixture of three cell lines, comprising DMS 53, LK-2, and NCI-H23.
  • the arm e.g., upper arm
  • a vaccine composition comprising a mixture of three cell lines, comprising NCI-H460, NCI-H520, and A549
  • the subject concurrently receives, via intradermal injection to the leg (e.g., thigh), a vaccine composition comprising a mixture of three cell lines, comprising DMS 53, LK-2, and NCI-H23.
  • the doses or multiple doses may be administered via the same or different route as the vaccine composition(s).
  • a composition comprising a checkpoint inhibitor is administered in some embodiments via intravenous injection, and the vaccine composition is administered via intradermal injection.
  • cyclophosphamide is administered orally, and the vaccine composition is administered intradermally.
  • the vaccine compositions according to the disclosure may be administered at various administration sites on a subject, at various times, and in various amounts.
  • the efficacy of a tumor cell vaccine may be impacted if the subject's immune system is in a state that is permissible to the activation of antitumor immune responses.
  • the efficacy may also thus impacted if the subject is undergoing or has received radiation therapy, chemotherapy or other prior treatments.
  • this requires that the immunosuppressive elements of the immune system are inhibited while the activation and effector elements are fully functional.
  • other elements that suppress antitumor immunity include, but are not limited to, T regulatory cells (Tregs) and checkpoint molecules such as CTLA-4, PD-1 and PD-L1.
  • timing of the administration of the vaccine relative to previous chemotherapy and radiation therapy cycles is set in order to maximize the immune permissive state of the subject's immune system prior to vaccine administration.
  • the present disclosure provides methods for conditioning the immune system with one or low dose administrations of a chemotherapeutic agent such as cyclophosphamide prior to vaccination to increase efficacy of whole cell tumor vaccines.
  • a chemotherapeutic agent such as cyclophosphamide
  • metronomic chemotherapy e.g., frequent, low dose administration of chemotherapy drugs with no prolonged drug-free break
  • metronomic chemotherapy allows for a low level of the drug to persist in the blood, without the complications of toxicity and side effects often seen at higher doses.
  • administering cyclophosphamide to condition the immune system includes, in some embodiments, administration of the drug at a time before the receipt of a vaccine dose (e.g., 15 days to 1 hour prior to administration of a vaccine composition) in order to maintain the ratio of effector T cells to regulatory T cells at a level less than 1.
  • a vaccine dose e.g. 15 days to 1 hour prior to administration of a vaccine composition
  • a chemotherapy regimen e.g., myeloablative chemotherapy, cyclophosphamide, and/or fludarabine regimen
  • a chemotherapy regimen may be administered before some, or all of the administrations of the vaccine composition(s) provided herein.
  • Cyclophosphamide CYTOXANTM, NEOSARTM
  • Cyclophosphamide may be administered as a pill (oral), liquid, or via intravenous injection. Numerous studies have shown that cyclophosphamide can enhance the efficacy of vaccines. (See, e.g., Machiels et al., Cancer Res., 61:3689, 2001; Greten, T.
  • “Low dose” cyclophosphamide as described herein is effective in depleting Tregs, attenuating Treg activity, and enhancing effector T cell functions.
  • intravenous low dose administration of cyclophosphamide includes 40-50 mg/kg in divided doses over 2-5 days.
  • Other low dose regimens include 1-15 mg/kg every 7-10 days or 3-5 mg/kg twice weekly.
  • Low dose oral administration in accordance with some embodiments of the present disclosure, includes 1-5 mg/kg per day for both initial and maintenance dosing. Dosage forms for the oral tablet are 25 mg and 50 mg.
  • cyclophosphamide is administered as an oral 50 mg tablet for the 7 days leading up to the first and optionally each subsequent doses of the vaccine compositions described herein.
  • cyclophosphamide is administered as an oral 50 mg tablet on each of the 7 days leading up to the first, and optionally on each of the 7 days preceding each subsequent dose(s) of the vaccine compositions.
  • the patient takes or receives an oral dose of 25 mg of cyclophosphamide twice daily, with one dose being the morning upon rising and the second dose being at night before bed, 7 days prior to each administration of a cancer vaccine cocktail or unit dose.
  • the vaccine compositions are administered intradermally multiple times over a period of years.
  • a checkpoint inhibitor is administered every two weeks or every three weeks following administration of the vaccine composition(s).
  • the patient receives a single intravenous dose of cyclophosphamide of 200, 250, 300, 500 or 600 mg/m 2 at least one day prior to the administration of a cancer vaccine cocktail or unit dose of the vaccine composition.
  • the patient receives an intravenous dose of cyclophosphamide of 200, 250, 300, 500 or 600 mg/m 2 at least one day prior to the administration vaccine dose number 4, 8, 12 of a cancer vaccine cocktail or unit dose.
  • the patient receives a single dose of cyclophosphamide at 1000 mg/kg as an intravenous injection at least one hour prior to the administration of a cancer vaccine cocktail or unit dose.
  • an oral high dose of 200 mg/kg or an IV high dose of 500-1000 mg/m 2 of cyclophosphamide is administered.
  • cyclophosphamide can be via any of the following: oral (e.g., as a capsule, powder for solution, or a tablet); intravenous (e.g., administered through a vein (IV) by injection or infusion); intramuscular (e.g., via an injection into a muscle (IM)); intraperitoneal (e.g., via an injection into the abdominal lining (IP)); and intrapleural (e.g., via an injection into the lining of the lung).
  • oral e.g., as a capsule, powder for solution, or a tablet
  • intravenous e.g., administered through a vein (IV) by injection or infusion
  • intramuscular e.g., via an injection into a muscle (IM)
  • intraperitoneal e.g., via an injection into the abdominal lining (IP)
  • intrapleural e.g., via an injection into the lining of the lung.
  • immunotherapy checkpoint inhibitors may be administered before, concurrently, or after the vaccine composition.
  • pembrolizumab is administered 2 mg/kg every 3 weeks as an intravenous infusion over 60 minutes.
  • pembrolizumab is administered 200 mg every 3 weeks as an intravenous infusion over 30 minutes.
  • pembrolizumab is administered 400 mg every 6 weeks as an intravenous infusion over 30 minutes.
  • durvalumab is administered 10 mg/kg every two weeks.
  • nivolumab is administered 240 mg every 2 weeks (or 480 mg every 4 weeks). In some embodiments, nivolumab is administered 1 mg/kg followed by ipilimumab on the same day, every 3 weeks for 4 doses, then 240 mg every 2 weeks (or 480 mg every 4 weeks). In some embodiments, nivolumab is administered 3 mg/kg followed by ipilimumab 1 mg/kg on the same day every 3 weeks for 4 doses, then 240 mg every 2 weeks (or 480 mg every 4 weeks). In some embodiments, nivolumab is administered or 3 mg/kg every 2 weeks.
  • durvalumab or pembrolizumab is administered every 2, 3, 4, 5, 6, 7 or 8 weeks for up to 8 administrations and then reduced to every 6, 7, 8, 9, 10, 11 or 12 weeks as appropriate.
  • the present disclosure provides that PD-1 and PD-L1 inhibitors are administered with a fixed dosing regimen (i.e., not weight-based).
  • a PD-1 inhibitor is administered weekly or at weeks 2, 3, 4, 6 and 8 in an amount between 100-1200 mg.
  • a PD-L1 inhibitor is administered weekly or at weeks 2, 3, 4, 6 and 8 in an mount between 250-2000 mg.
  • a vaccine composition or compositions as described herein is administered concurrently or in combination with a PD-1 inhibitor dosed either Q1W, Q2W, Q3W, Q4W, Q6W, or Q8W, between 100 mg and 1500 mg fixed or 0.5 mg/kg and 15 mg/kg based on weight.
  • a vaccine composition or compositions as described herein is administered concurrently in combination with PD-L1 inhibitor dosed either Q2W, Q3W, or Q4W between 250 mg and 2000 mg fixed or 2 mg/kg and 30 mg/kg based on weight.
  • the aforementioned regimen is administered but the compositions are administered in short succession or series such that the patient receives the vaccine composition or compositions and the checkpoint inhibitor during the same visit.
  • the plant Cannabis sativa L. has been used as an herbal remedy for centuries and is an important source of phytocannabinoids.
  • the endocannabinoid system (ECS) consists of receptors, endogenous ligands (endocannabinoids) and metabolizing enzymes, and plays a role in different physiological and pathological processes.
  • Phytocannabinoids and synthetic cannabinoids can interact with the components of ECS or other cellular pathways and thus may affect the development or progression of diseases, including cancer.
  • cannabinoids can be used as a part of palliative care to alleviate pain, relieve nausea and stimulate appetite.
  • numerous cell culture and animal studies have demonstrated antitumor effects of cannabinoids in various cancer types.
  • Phytocannabinoids are a group of C21 terpenophenolic compounds predominately produced by the plants from the genus Cannabis .
  • cannabinoids and related breakdown products There are several different cannabinoids and related breakdown products. Among these are tetrahydrocannabinol (THC), cannabidiol (CBD), cannabinol (CBN), cannabichromene (CBC), ⁇ 8-THC, cannabidiolic acid (CBDA), cannabidivarin (CBDV), and cannabigerol (CBG).
  • use of all phytocannabinoids is stopped prior to or concurrent with the administration of a Treg cell inhibitor such as cyclophosphamide, and/or is otherwise stopped prior to or concurrent with the administration of a vaccine composition according to the present disclosure.
  • a Treg cell inhibitor such as cyclophosphamide
  • the cessation optionally occurs prior to or concurrent with each administration.
  • use of phytocannabinoids is not resumed until a period of time after the administration of the vaccine composition(s).
  • abstaining from cannabinoid administration for at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 days prior to administration and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days after administration of cyclophosphamide or a vaccine dose is contemplated.
  • patients will receive the first dose of the vaccine within 6-12 weeks after completion of chemotherapy.
  • High dose chemotherapy used in cancer treatment ablates proliferating cells and depletes immune cell subsets.
  • the immune system Upon completion of chemotherapy, the immune system will begin to reconstitute.
  • the time span for T cells to recur is roughly 2-3 weeks.
  • the cancer vaccine is administered within a window where there are sufficient T cells to prime, yet the subject remains lymphopenic. This environment, in which there are less cells occupying the niche will allow the primed T cells to rapidly divide, undergoing “homeostatic proliferation” in response to increased availability of cytokines (e.g., IL7 and IL15).
  • cytokines e.g., IL7 and IL15
  • a cell line or combination of cell lines is identified for inclusion in a vaccine composition based on several criteria.
  • selection of cell lines is performed stepwise as provided below. Not all cancer indications will require all of the selection steps and/or criteria.
  • RNA-seq data allows for the identification of candidate cell lines that have the potential to display the greatest breadth of antigens specific to a cancer indication of interest and informs on the potential expression of immunosuppressive factors by the cell lines. If the availability of RNA-seq data in the CCLE is limited, RNA-seq data may be sourced from the European Molecular Biology Laboratory-European Bioinformatics Institute (EMBL-EBI) database or other sources known in the art.
  • EBL-EBI European Molecular Biology Laboratory-European Bioinformatics Institute
  • potential expression of a protein of interest e.g., a TAA
  • RNA-seq data is considered “positive” when the RNA-seq value is >0.
  • Step 2 cell lines derived from metastatic sites are prioritized to diversify antigenic breadth and to more effectively target later-stage disease in patients with metastases.
  • Cell lines derived from primary tumors are included in some embodiments to further diversify breadth of the vaccine composition.
  • the location of the metastases from which the cell line are derived is also considered in some embodiments.
  • cell lines can be selected that are derived from lymph node, ascites, and liver metastatic sites instead of all three cell lines derived from liver metastatic sites.
  • Step 3 Cell lines are selected to cover a broad range of classifications of cancer types. For example, tubular adenocarcinoma is a commonly diagnosed classification of gastric cancer. Thus, numerous cell lines may be chosen matching this classification. For indications where primary tumor sites vary, cell lines can be selected to meet this diversity. For example, for small cell carcinoma of the head and neck (SCCHN), cell lines were chosen, in some embodiments, to cover tumors originating from the oral cavity, buccal mucosa, and tongue. These selection criteria enable targeting a heterogeneous population of patient tumor types. In some embodiments, cell lines are selected to encompass an ethnically diverse population to generate a cell line candidate pool derived from diverse histological and ethnical backgrounds.
  • SCCHN small cell carcinoma of the head and neck
  • cell lines are selected based on additional factors. For example, in metastatic colorectal cancer (mCRC), cell lines reported as both microsatellite instable high (MSI-H) and microsatellite stable (MSS) may be included. As another example, for indications that are viral driven, cell lines encoding viral genomes may be excluded for safety and/or manufacturing complexity concerns.
  • mCRC metastatic colorectal cancer
  • MSI-H microsatellite instable high
  • MSS microsatellite stable
  • cell lines are selected to cover a varying degree of genetic complexity in driver mutations or indication-associated mutations. Heterogeneity of cell line mutations can expand the antigen repertoire to target a larger population within patients with one or more tumor types.
  • breast cancer cell lines can be diversified on deletion status of Her2, progesterone receptor, and estrogen receptor such that the final unit dose includes triple negative, double negative, single negative, and wild type combinations.
  • Each cancer type has a complex genomic landscape and, as a result, cell lines are selected for similar gene mutations for specific indications. For example, melanoma tumors most frequently harbor alterations in BRAF, CDKN2A, NRAS and TP53, therefore selected melanoma cell lines, in some embodiments, contain genetic alterations in one or more of these genes.
  • cell lines are further narrowed based on the TAA, TSA, and/or cancer/testis antigen expression based on RNA-seq data.
  • An antigen or collection of antigens associated with a particular tumor or tumors is identified using search approaches evident to persons skilled in the art (See, e.g., such as www.ncbi.nlm.nih.gov/pubmed/, and clinicaltrials.gov).
  • antigens can be included if associated with a positive clinical outcome or identified as highly-expressed by the specific tumor or tumor types while expressed at lower levels in normal tissues.
  • Step 7 the list of remaining cell line candidates are consolidated based on cell culture properties and considerations such as doubling time, adherence, size, and serum requirements. For example, cell lines with a doubling time of less than 80 hours or cell lines requiring media serum (FBS, FCS) ⁇ 10% can be selected. In some embodiments, adherent or suspension cell lines that do not form aggregates can be selected to ensure proper cell count and viability.
  • cell culture properties and considerations such as doubling time, adherence, size, and serum requirements. For example, cell lines with a doubling time of less than 80 hours or cell lines requiring media serum (FBS, FCS) ⁇ 10% can be selected.
  • adherent or suspension cell lines that do not form aggregates can be selected to ensure proper cell count and viability.
  • cell lines are selected based on the expression of immunosuppressive factors (e.g., based on RNA-seq data sourced from CCLE or EMBL as described in Step 1).
  • a biopsy of a patient's tumor and subsequent TAA expression profile of the biopsied sample will assist in the selection of cell lines.
  • Embodiments of the present disclosure therefore provide a method of preparing a vaccine composition comprising the steps of determining the TAA expression profile of the subject's tumor; selecting cancer cell lines; modifying cancer cell lines; and irradiating cell lines prior to administration to prevent proliferation after administration to patients.
  • cells in a modified cell line are irradiated, suspended, and cryopreserved.
  • cells are irradiated 10,000 cGy.
  • cells are irradiated at 7,000 to 15,000 cGy.
  • cells are irradiated at 7,000 to 15,000 cGy.
  • each vial contains a volume of 120 ⁇ 10 ⁇ L (1.2 ⁇ 10 7 cells).
  • the total volume injected per site is 300 ⁇ L or less.
  • the total volume injected per site is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 ⁇ L.
  • the total volume injected is 300 ⁇ L
  • the present disclosure provides, in some embodiments that 3 ⁇ 100 ⁇ L volumes, or 2 ⁇ 150 ⁇ L , are injected, for a total of 300 ⁇ L.
  • the vials of the component cell lines are stored in the liquid nitrogen vapor phase until ready for injection. In some embodiments, each of the component cell lines are packaged in separate vials.
  • the contents of two vials are removed by needle and syringe and are injected into a third vial for mixing. In some embodiments, this mixing is repeated for each cocktail.
  • the contents of six vials are divided into two groups—A and B, where the contents of three vials are combined or mixed, optionally into a new vial (A), and the contents of the remaining three vials are combined or mixed, optionally into a new vial (B).
  • the cells will be irradiated prior to cryopreservation to prevent proliferation after administration to patients. In some embodiments, cells are irradiated at 7,000 to 15,000 cGy in order to render the cells proliferation incompetent.
  • cell lines are grown separately and in the same growth culture media. In some embodiments, cell lines are grown separately and in different cell growth culture media.
  • the cell lines disclosed herein are adapted to xeno-free media composed of growth factors and supplements essential for cell growth that are from human source, prior to large scale cGMP manufacturing.
  • the terms “adapting” and “converting” or “conversion” are used interchangeably to refer to transferring/changing cells to a different media as will be appreciated by those of skill in the art.
  • the xeno-free media formulation chosen can be, in some embodiments, the same across all cell lines or, in other embodiments, can be different for different cell lines.
  • the media composition will not contain any non-human materials and can include human source proteins as a replacement for FBS alone, or a combination of human source proteins and human source recombinant cytokines and growth factors (e.g., EGF).
  • the xeno-free media compositions can, in some embodiments, also contain additional supplements (e.g., amino acids, energy sources) that enhance the growth of the tumor cell lines.
  • the xeno-free media formulation will be selected for its ability to maintain cell line morphology and doubling time no greater than twice the doubling time in FBS and the ability to maintain expression of transgenes comparable to that in FBS.
  • a number of procedures may be instituted to minimize the possibility of inducing IgG, IgA, IgE, IgM and IgD antibodies to bovine antigens. These include but are not limited to: cell lines adapted to growth in xeno-free media; cell lines grown in FBS and placed in xeno-free media for a period of time (e.g., at least three days) prior to harvest; cell lines grown in FBS and washed in xeno-free media prior to harvest and cryopreservation; cell lines cryopreserved in media containing Buminate (a USP-grade pharmaceutical human serum albumin) as a substitute for FBS; and/or cell lines cryopreserved in a medial formulation that is xeno-free, and animal-component free (e.g., CryoStor). In some embodiments, implementation of one or more of these procedures may reduce the risk of inducing anti-bovine antibodies by removing the bovine antigens from the vaccine compositions.
  • the vaccine compositions described herein do not comprise non-human materials.
  • the cell lines described herein are formulated in xeno-free media. Use of xeno-free media avoids the use of immunodominant xenogeneic antigens and potential zoonotic organisms, such as the BSE prion.
  • the cell lines are transitioned to xeno-free media and are expanded to generate seed banks. The seed banks are cryopreserved and stored in vapor-phase in a liquid nitrogen cryogenic freezer.
  • Exemplary xeno-free conversions are provided herein for a NSCLC and GBM vaccine preparations.
  • DCs are derived from monocytes isolated from healthy donor peripheral blood mononuclear cells (PBMCs) and used in downstream assays to characterize immune responses in the presence or absence of one or more immunostimulatory or immunosuppressive factors.
  • the vaccine cell line components are phagocytized by donor-derived immature DCs during co-culture with the unmodified parental vaccine cell line (control) or the modified vaccine cell line components.
  • the effect of modified vaccine cell line components on DC maturation, and thereby subsequent T cell priming, can be evaluated using flow cytometry to detect changes in markers of DC maturation such as CD40, CD83, CD86, and HLA-DR.
  • the immature DCs are matured after co-culture with the vaccine cell line components, the mature DCs are magnetically separated from the vaccine cell line components, and then co-cultured with autologous CD14-PBMCs for 6 days to mimic in vivo presentation and stimulation of T cells.
  • IFN ⁇ production a measurement of T cell stimulatory activity, is measured in the IFN ⁇ ELISpot assay or the proliferation and characterization of immune cell subsets is evaluated by flow cytometry.
  • PBMCs are stimulated with autologous DCs loaded with the unmodified parental vaccine cell line components to assess potential responses against unmodified tumor cells in vivo.
  • the IFN ⁇ ELISpot assay can be used to evaluate the potential of the allogenic vaccine to drive immune responses to clinically relevant TAAs expressed by the vaccine cell lines.
  • the PBMCs are stimulated with peptide pools comprising known diverse MHC-I epitopes for TAAs of interest.
  • the vaccine composition may comprise 3 cell lines that induce IFN ⁇ responses to at least 3, 4, 5, 6, 7, 8, 9, 10, or 11 non-viral antigens, or at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the antigens evaluated for an IFN ⁇ response.
  • the vaccine composition may be a unit dose of 6 cell lines that induce IFN ⁇ responses to at least 5, 6, 7, 8, 9, 10 or 11 non-viral antigens, or at least 60%, 70%, 80%, 90%, or 100% of the antigens evaluated for an IFN ⁇ response.
  • Induction of antigen specific T cells by the allogenic whole cell vaccine can be modeled in vivo using mouse tumor challenge models.
  • the vaccines provided in embodiments herein may not be administered directly to mouse tumor model due to the diverse xenogeneic homology of TAAs between mouse and human.
  • a murine homolog of the vaccines can be generated using mouse tumor cell lines.
  • Some examples of additional immune readouts in a mouse model are: characterization of humoral immune responses specific to the vaccine or TAAs, boosting of cellular immune responses with subsequent immunizations, characterization of DC trafficking and DC subsets at draining lymph nodes, evaluation of cellular and humoral memory responses, reduction of tumor burden, and determining vaccine-associated immunological changes in the TME, such as the ratio of tumor infiltrating lymphocytes (TILs) to Tregs.
  • Standard immunological methods such as ELISA, IFN ⁇ ELISpot, and flow cytometry will be used.
  • the vaccine compositions described herein may be used in the manufacture of a medicament, for example, a medicament for treating or prolonging the survival of a subject with cancer, e.g., lung cancer, non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), prostate cancer, glioblastoma, colorectal cancer, breast cancer including triple negative breast cancer (TNBC), bladder or urinary tract cancer, squamous cell head and neck cancer (SCCHN), liver hepatocellular (HCC) cancer, kidney or renal cell carcinoma (RCC) cancer, gastric or stomach cancer, ovarian cancer, esophageal cancer, testicular cancer, pancreatic cancer, central nervous system cancers, endometrial cancer, melanoma, and mesothelium cancer.
  • NSCLC non-small cell lung cancer
  • SCLC small cell lung cancer
  • TNBC triple negative breast cancer
  • SCCHN squamous cell head and neck cancer
  • HCC liver hepatocellular
  • RRCC renal cell
  • kits for treating or prolonging the survival of a subject with cancer containing any of the vaccine compositions described herein, optionally along with a syringe, needle, and/or instructions for use.
  • Articles of manufacture are also provided, which include at least one vessel or vial containing any of the vaccine compositions described herein and instructions for use to treat or prolong the survival of a subject with cancer. Any of the vaccine compositions described herein can be included in a kit comprising a container, pack, or dispenser together with instructions for administration.
  • kits comprising at least two vials, each vial comprising a vaccine composition (e.g., cocktail A and cocktail B), wherein each vial comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more cell lines, wherein the cell lines are modified to inhibit or reduce production of one or more immunosuppressive factors, and/or express or increase expression of one or more immunostimulatory factors, and/or express a heterogeneity of tumor associated antigens, or neoantigens.
  • a vaccine composition e.g., cocktail A and cocktail B
  • cocktail B e.g., cocktail A and cocktail B
  • each vial comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more cell lines, wherein the cell lines are modified to inhibit or reduce production of one or more immunosuppressive factors, and/or express or increase expression of one or more immunostimulatory factors, and/or express a heterogeneity of tumor associated antigens, or neoantigens.
  • kits comprising 6 separate vials wherein each vial comprises one of the following cell lines: NCI-H460, NCI-H520, DMS 53, LK-2, NCI-H23, and A549.
  • a kit comprising 6 separate vials is provided, wherein each vial comprises one of the following cell lines: DMS 53, DBTRG-05MG, LN-229, SF-126, GB-1, and KNS-60.
  • a kit comprising 6 separate vials is provided, wherein each vial comprises one of the following cell lines: DMS53, PC3, NEC8, NTERA-2cl-D1, DU-145, and LNCAP.
  • kits comprising 6 separate vials wherein each vial comprises one of the following cell lines: DMS 53, HCT-15, HuTu80, LS411N, HCT-116 and RKO.
  • a kit comprising 6 separate vials is provided, wherein each vial comprises one of the following cell lines: DMS 53, OVTOKO, MCAS, TOV-112D, TOV-21G, and ES-2.
  • a kit comprising 6 separate vials is provided, wherein each vial comprises one of the following cell lines: DMS 53, HSC-4, HO-1-N-1, DETROIT 562, KON, and OSC-20.
  • kits comprising 6 separate vials wherein each vial comprises one of the following cell lines: DMS 53, J82, HT-1376, TCCSUP, SCaBER, and UM-UC-3.
  • a kit comprising 6 separate vials is provided, wherein each vial comprises one of the following cell lines: DMS 53, MKN-1, MKN-45, MKN-74, OCUM-1, and Fu97.
  • a kit comprising 6 separate vials is provided, wherein each vial comprises one of the following cell lines: DMS 53, AU565, CAMA-1, HS-578T, MCF-7, and T-47D.
  • a kit comprising 6 separate vials is provided, wherein each vial comprises one of the following cell lines: DMS 53, PANC-1, KP-3, KP-4, SUIT-2, and PSN1.
  • kits comprising at least two vials, each vial comprising a vaccine composition (e.g., cocktail A and cocktail B), wherein each vial comprises at least three cell lines, wherein the cell lines are modified to reduce production or expression of one or more immunosuppressive factors, and/or modified to increase expression of one or more immunostimulatory factors, and/or express a heterogeneity of tumor associated antigens, or neoantigens.
  • the two vials in these embodiments together are a unit dose.
  • Each unit dose can have from about 5 ⁇ 10 6 to about 5 ⁇ 10 7 cells per vial, e.g., from about 5 ⁇ 10 6 to about 3 ⁇ 10 7 cells per vial.
  • kits comprising at least six vials, each vial comprising a vaccine composition, wherein each vaccine composition comprises one cell line, wherein the cell line is modified to inhibit or reduce production of one or more immunosuppressive factors, and/or modified to express or increase expression of one or more immunostimulatory factors, and/or expresses a heterogeneity of tumor associated antigens, or neoantigens.
  • Each of the at least six vials in the embodiments provided herein can be a unit dose of the vaccine composition.
  • Each unit dose can have from about 2 ⁇ 10 6 to about 50 ⁇ 10 6 cells per vial, e.g., from about 2 ⁇ 10 6 to about 10 ⁇ 10 6 cells per vial.
  • kits comprising separate vials, each vial comprising a vaccine composition, wherein each vaccine composition comprises one cell line, wherein the cell line is modified to inhibit or reduce production of one or more immunosuppressive factors, and/or modified to express or increase expression of one or more immunostimulatory factors, and/or expresses, a heterogeneity of tumor associated antigens, or neoantigens.
  • Each of the vials in the embodiments provided herein can be a unit dose of the vaccine composition.
  • Each unit dose can have from about 2 ⁇ 10 6 to about 50 ⁇ 10 6 cells per vial, e.g., from about 2 ⁇ 10 6 to about 10 ⁇ 10 6 cells per vial.
  • a kit comprising two cocktails of 3 cell lines each (i.e., total of 6 cell lines in 2 different vaccine compositions) as follows: 8 ⁇ 10 6 cells per cell line; 2.4 ⁇ 10 7 cells per injection; and 4.8 ⁇ 10 7 cells total dose.
  • 1 ⁇ 10 7 cells per cell line; 3.0 ⁇ 10 7 cells per injection; and 6.0 ⁇ 10 7 cells total dose is provided.
  • a vial of any of the kits disclosed herein contains about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 mL of a vaccine composition of the disclosure.
  • the concentration of cells in a vial is about 5 ⁇ 10 7 cells/mL to about 5 ⁇ 10 8 /cells mL.
  • kits as described herein can further comprise needles, syringes, and other accessories for administration.
  • HLA-G Aberrant expression of HLA-G by tumor cell is associated with tumor immune escape, metastasis and poor prognosis.
  • Ligation of HLA-G with its receptors ILT2 and ILT4 on DCs can promote immune tolerance and priming of T cells with an immunosuppressed phenotype.
  • Reduction of HLA-G expression on cell line component of a whole cell vaccine could improve immunogenicity in the VME.
  • Human adenocarcinoma cell line RERF-LC-Ad1 was transduced with lentiviral particles expressing a short-hairpin ribonucleic acid (shRNA) specific for the knockdown of HLA-G (mature antisense sequence: TACAGCTGCAAGGACAACCAG) (SEQ ID NO: 23).
  • shRNA short-hairpin ribonucleic acid
  • Parental cells or cells transduced with control (non-silencing) shRNA served as controls.
  • HLA-G expression levels following shRNA mediated HLA-G knockdown was determined by cytometry by staining with an APC-conjugated mouse monoclonal antibody human HLA-G (clone 87G) and then FACs sorted to enrich for the HLA-G low population.
  • Modified and unmodified cells were detached and stained with an APC-conjugated mouse monoclonal antibody human HLA-G (clone 87G). After selection with puromycin to enrich for cells stable expressing the shRNA, cells were analyzed for expression of HLA-G at mRNA level by quantitative polymerase chain reaction (qPCR) and at protein level by flow cytometry. For qPCR cells were lysed in Trizol, total RNA isolated and then transcribed into complementary DNA (cDNA). Relative HLA-G mRNA expression was quantified with specific-probes for HLA-G and PSMB4 (for normalization) using the MCt method.
  • qPCR quantitative polymerase chain reaction
  • HLA-G mRNA expression was reduced in cells stable transduced with shRNA for HLA-G in comparison to parental (non-transduced) cells and cells transduced with control (non-silencing) shRNA by at least 75% ( FIG. 1A ).
  • HLA-G cell surface expression was reduced in in cells stable transduced with shRNA for HLA-G in comparison to parental (non-transduced) cells by 70% ( FIG. 1B ).
  • PBMCs were isolated from blood of healthy donors and co-incubated with adenocarcinoma lung cancer cell lines, that were pre-treated with mitomycin C (0.4 ⁇ g/ml for 16 hours) to prevent tumor cell growth and proliferation, at a PBMC to tumor cell ratio of 10 to 1.
  • Interleukin-2 (IL2) was added on day 3 (and 7) of co-culture at different concentrations. On day 7 and/or 10 cell culture supernatant was harvested and IFN ⁇ secretion was measured by ELISA.
  • the increase of IFN ⁇ in the co-culture of PBMCs with tumor cells with reduced HLA-G expression was significant (p ⁇ 0.01) compared to parental and non-silencing tumor cells on day 10 (2way ANOVA with Sidak's multiple comparisons test) ( FIG. 2A ).
  • the significant increase of IFN ⁇ secretion was independent of the IL-2 concentration during co-culture (p ⁇ 0.0001, 2way ANOVA with Tukey's multiple comparisons test) ( FIG. 2B ).
  • CD47 is a cell surface marker for “self” and thereby prevents immunological responses against healthy cells.
  • Primary tumor cells as well as tumor cell lines can express high levels of CD47.
  • the human NSCLC cell lines A549, NCI-H460, and NCI-H520 were electroporated with a zinc finger nuclease (ZFN) pair specific for CD47 targeting the following genomic DNA sequence: CACACAGGAAACTACacttgtGAAGTAACAGAATTA (SEQ ID NO: 27).
  • ZFN zinc finger nuclease
  • Full-allelic knockout cells were identified by flow cytometry after staining with PE-conjugated anti-human CD47 monoclonal antibody (clone CC2C6) and then FACS sorted to enrich for the CD47 negative population.
  • Gene editing of CD47 by ZFN resulted in greater than 99% reduction in CD47 expression by the A549 ( FIG. 3A ), NCI-H460 ( FIG. 3B ), and NCI-H520 ( FIG. 3C ) cell lines.
  • CD47 KO The effect of reducing CD47 expression (CD47 KO) on phagocytosis and immunogenicity was determined using the NCI-H520 cell line. Specifically, the effect of CD47 KO on phagocytosis by human monocyte-derived professional antigen presenting cells (APCs), both DCs and macrophages, was determined using a phagocytosis assay. Immune responses induced by NCI-H520 unmodified parental and CD47 KO evaluated in the IFN ⁇ ELISpot assay.
  • iDCs Human immature dendritic cells
  • MDM M1 macrophages
  • iDCs Human immature dendritic cells
  • iDCs were generated by culturing CD14 + cells in ImmunoCultTM-ACF Dendritic Cell Medium (StemCell Technologies, #10986) in the presence of ImmunoCultTM-ACF Dendritic Cell Differentiation Supplement (StemCell Technologies, #10988) according to the manufacturers instructions.
  • iDCs were harvested for use in the phagocytosis assay on Day 3 and on Day 6 for use in the IFN ⁇ ELISpot assay.
  • MDM were generated by culturing CD14 + cells in RPMI supplemented with 10% FBS in the presence of 100 ng/mL GM-CSF (PeproTech, #300-03-100UG) for 7 days.
  • GM-CSF 100 ng/mL GM-CSF
  • Macrophage-SFM Gibrophage-SFM (Gibco, #12065074) containing 20 ng/mL LPS (InvivoGen, #tlrl-3pelps) and 20 ng/mL IFN ⁇ (PeproTech, 300-02-100UG).
  • MDM were harvested on Day 9 for the phagocytosis assay.
  • Unmodified parental and CD47 KO NCI-H520 cells were treated with 10 ⁇ g/mL mitomycin C (MMC) for 2 hours and rested overnight prior to labelling with 1 ⁇ M of CSFE (Invitrogen, #C34554) for 30 minutes at 37 L.
  • MMC mitomycin C
  • CSFE Invitrogen, #C34554
  • iDC and MDM were co-cultured with the CSFE-labeled unmodified parental and CD47 KO NCI-H520 cells for 4 hours at 37 L.
  • iDC and cell lines were co-cultured at a 1:1 effector to target ratio in 96-well low-adherence U bottom plates.
  • MDM were co-cultured at a 1:4 effector to target ratio in 96-well plates.
  • the co-cultures were surface stained with LIVE/DEAD Aqua (Molecular Probes, #L23105), ⁇ CD45-PE-Cy7 (BD Biosciences, clone H130), and ⁇ CD11c-BV605 (BD Biosciences, clone B-ly6) for iDCs or ⁇ CD11b-BV421 (BD Biosciences, clone ICRF44) for MDM.
  • LIVE/DEAD Aqua Molecular Probes, #L23105
  • ⁇ CD45-PE-Cy7 BD Biosciences, clone H130
  • ⁇ CD11c-BV605 BD Biosciences, clone B-ly6
  • iDCs iDCs
  • ⁇ CD11b-BV421 BD Biosciences, clone ICRF44
  • iDC phagocytosis was defined as the percent of live, CD45 + , CD11c + cells that were also CFSE (FITC + ) positive by flow cytometry. MDM and iDC that were not co-cultured with the unmodified parental or CD47 KO NCI-H520 cells served as controls.
  • Unmodified parental and CD47 KO NCI-H520 cells were x-ray irradiated at 100 Gy (Rad Source 1800 Q) 24 hours prior to loading of iDCs.
  • irradiated unmodified parental and CD47 KO NCI-H520 ATCC HTB-182 were co-cultured with iDCs at a 1:1 ratio for 24 hours in the presence of 25 ⁇ g/mL of Keyhole Limpet Hemocyanin (KLH) (Calbiochem #374807) and 1 ⁇ g/mL soluble CD40L (sCD40L) (PeproTech, #AF31002100UG).
  • KLH Keyhole Limpet Hemocyanin
  • sCD40L 1 ⁇ g/mL soluble CD40L
  • Tumor cell loaded iDCs were than matured overnight by the addition of 100 IU/mL IFN ⁇ (PeproTech, 300-02-100UG), 10 ng/mL LPS (InvivoGen, #tlrl-3pelps) and 2.5 ⁇ g/mL Resiquimod (R848) (InvivoGen, #tlrl-3r848).
  • Mature DCs (mDCs) were labelled with ⁇ CD45-PE (BD Biosciences, clone HI30) and magnetically separated from the co-culture using the EasySepTM Release Human PE Positive Selection Kit (StemCell Technologies, #17654) according to manufacturers instructions.
  • Isolated mDCs were then co-cultured with autologous CD14 ⁇ PBMCs for 6 days at a 1:10 DC to PBMC ratio.
  • CD14 ⁇ PBMCs were isolated from co-culture with mDCs and stimulated with unmodified parental NCI-H520 loaded mDCs for 24 hours.
  • IFN ⁇ spot forming units SFU were detected following the manufacturers instructions, counted (S6 Core Analyzer, ImmunoSpot), and expressed as the number of SFU/10 6 PBMCs above that of the controls.
  • CD47 increased phagocytosis by MDM derived from 2 healthy donors by an average of 1.6-fold (11.1 ⁇ 1.9% live/CD45 + /CD11b + /CFSE + ) relative to phagocytosis of the unmodified parental cell line (7.0 ⁇ 1.2% live/CD45 + /CD11b + /CFSE + ).
  • Reduction of CD47 also increased phagocytosis by iDC derived from 2 healthy donors by an average of 2.2-fold (11.9 ⁇ 2.3% live/CD45 + /CD11b + /CFSE + )) relative to phagocytosis of the unmodified parental cell line (5.5 ⁇ 3.4% live/CD45 + /CD11c + /CFSE + )) ( FIG. 4A ).
  • Binding of PD1 on DCs to PDL1 (CD274) on tumor cells can suppress DC function and potentially reduce priming of inflammatory (Th 1 ) T cells and promote the priming of immunosuppressive (Th 2 ) T cells.
  • NSCLC cell line NCI-H460 was reduced using zinc-finger mediated gene editing.
  • the cell line was electroporated with DNA plasmids coding for a zinc finger nuclease (ZFN) pair specific for PD-L1 targeting the following genomic DNA sequence: CCAGTCACCTCTGAACATGaactgaCATGTCAGGCTGAGGGCT (SEQ ID NO: 28).
  • ZFN zinc finger nuclease
  • Full-allelic knockout cells were identified by flow cytometry after staining with PE-conjugated anti-human CD274 monoclonal antibody (clone MIH1) and then FACS sorted.
  • Gene editing of PD-L1 by ZFNs resulted in greater than 99% PD-L1 negative NCI-H460 cells after sorting ( FIG. 5 ).
  • BST2 is a cell surface marker on primary tumor cells and tumor cell lines that inhibits cytokine production (type I interferons) through interaction with ILT7 (CD85g) on plasmacytoid dendritic cells.
  • the reduction of BST2 expression by the NCI-H2009 cell line was completed using ZFN mediated gene editing.
  • the cell line was electroporated with DNA plasmids coding for a ZFN pair specific for BST2 targeting the following genomic DNA sequence: CCTAATGGCTTCCCTGGATgcagagAAGGCCCAAGGACAAAAG (SEQ ID NO: 34).
  • Full-allelic knockout cells were identified by flow cytometry after staining with BV421-conjugated anti-human BST2 monoclonal antibody (clone HM1.24).
  • Gene editing of BST2 by ZFNs resulted in 98.5% reduction in BST2 expression by NCI-H2009 cells ( FIG. 6 ).
  • the BST2 positive fraction of BST2-ZFN treated NCI-H2009 cells can subsequently be FACS sorted to purity.
  • TGF ⁇ 1 and TGF ⁇ 2 are highly immunosuppressive molecules secreted by tumor cells to evade immune surveillance. This example describes the procedure to generate lung cancer cell lines with reduced or without secretion of TGF ⁇ 1 and TGF ⁇ 2 and how the changes in secretion were verified.
  • the lung cancer cell lines NCI-H460 (ATCC HTB-177), DMS 53 (ATCC CRL-2062), NCI-H520 (ATCC HTB-182), A549 (ATCC CCL-185), NCI-H2023 (ATCC CRL-5912), NCI-H23 (ATCC CRL-5800), and NCI-H1703 (ATCC CRL-5889) were obtained from ATCC and cultured according to ATCC recommendations.
  • LK-2 (JCRB0829) was obtained from the Japanese Collection of Research Biosources Cell Bank (JCRB) and cultured according to JCRB recommendations.
  • the cell lines NCI-H460, DMS 53, and NCI-H520, A549, NCI-H2023, NCI-H23, LK-2, and NCI-H1703 were transduced with lentiviral particles expressing short-hairpin ribonucleic acid (shRNA) specific for the knockdown of TGF ⁇ 1 (shTGF ⁇ 1, mature antisense sequence: TTTCCACCATTAGCACGCGGG (SEQ ID NO: 25)) and TGF ⁇ 2 (shTGF ⁇ 2, mature antisense sequence: AATCTGATATAGCTCAATCCG (SEQ ID NO: 24)).
  • TGF ⁇ 1 shTGF ⁇ 1, mature antisense sequence: TTTCCACCATTAGCACGCGGG (SEQ ID NO: 25)
  • TGF ⁇ 2 mature antisense sequence: AATCTGATATAGCTCAATCCG (SEQ ID NO: 24)
  • TGF ⁇ 1 and TGF ⁇ 2 were completed using CRISPR-Cas9 and ZFN approaches.
  • CRISPR-Cas9 knockouts the NCI-H460 and NCI-H520 cell lines were electroporated with plasmid DNA coding for Cas9 and guide RNA specific for TGF ⁇ 2 targeting the following gDNA sequence: GCTTGCTCAGGATCTGCCCG (SEQ ID NO: 29) or control guide RNA targeting the sequence: GCACTACCAGAGCTAACTCA (SEQ ID NO: 30).
  • Full-allelic knockout clones were screened for secretion of TGF ⁇ 1 and TGF ⁇ 2 by ELISA.
  • ZFN zinc finger nuclease
  • TGF ⁇ 1 and TGF ⁇ 2 knockdown or knockout cells and unmodified or control modified parental cells were plated at 8.33 ⁇ 10 4 cells/well in a 24-well plated in regular growth medium (RPMI containing 10% FBS). Twenty-four hours after plating, adherent cells were thoroughly washed to remove FBS and culture was continued in RPMI+5% CTS. Forty-eight hours after media replacement, the cell culture supernatant was harvested, and stored at ⁇ 70° C. until TGF ⁇ 1 and TGF ⁇ 2 secretion assays were initiated according to the manufacturer's instructions (DB100B and DB250, R&D Systems). TGF ⁇ 1 and TGF ⁇ 2 secretion levels are expressed as ⁇ g/10 6 cells/24 hours.
  • the lower limit of quantification of human TGF ⁇ 1 and TGF ⁇ 2 are 15.4 ⁇ g/mL (92.4 ⁇ g/10 6 cells/24 hours) and 7.0 ⁇ g/mL (42.0 ⁇ g/10 6 cells/24 hours), respectively.
  • the lower limit of quantification of the ELISA assay was used to approximate the percent reduction of TGF ⁇ 1 or TGF ⁇ 2 relative to the unmodified parental cell line shRNA when the modified cell lines secreted levels of TGF ⁇ 1 or TGF ⁇ 2 below the lower limit of quantification of the assay. In cases where TGF ⁇ 1 or TGF ⁇ 2 secretion were below the lower limit of quantification, the lower limit of quantification was used to determine statistical significance at the n for which the assay was completed.
  • TGF ⁇ 1 in NCI-H460 reduced TGF ⁇ 1 secretion by 62%.
  • knockdown of TGF ⁇ 2 in NCI-H460 reduced TGF ⁇ 2 secretion by 84%.
  • the combined knockdown of TGF ⁇ 1 and TGF ⁇ 2 in NCI-H460 reduced TGF ⁇ 1 secretion by 57% and TGF ⁇ 2 secretion by >98% (Table 26) ( FIG. 7A ).
  • Clones derived from Cas9 mediated knockout using TGF ⁇ 2 specific guide RNA in NCI-H460 cells demonstrated clones did not secrete TGF ⁇ 2 (>99% reduction) above the lower limit of detect compared clones from NCI-H460 treated with control guide RNA (3686 ⁇ 1478 ⁇ g/10 6 cells/24 hours) ( FIG. 7B ).
  • Clones derived from NCI-H460 treated with TGF ⁇ 1 specific ZFN pair did not secrete TGF ⁇ 1 above the lower limit of detection of the assay compared to clones from NCI-H460 treated with TGF ⁇ 2 specific ZFN pair.
  • Clones derived from NCI-H460 treated with TGF ⁇ 2 specific ZFN pair did not secrete TGF ⁇ 2 above the lower limit of detection in contrast to clones from NCI-H460 treated with TGF ⁇ 1 specific ZFN pair. Clones derived from NCI-H460 treated with TGF ⁇ 1 specific ZFN pair and with TGF ⁇ 2 specific ZFN pair did not secrete TGF ⁇ 1 or TGF ⁇ 2 above the lower limit of detection ( FIG. 7C ).
  • TGF ⁇ 1 in NCI-H520 could not be evaluated because of the lack of detectable TGF ⁇ 1 secretion by the parental cell line. Knockdown of TGF ⁇ 2 in NCI-H520 reduced TGF ⁇ 2 secretion by >99%.
  • TGF ⁇ 1 secretion was significantly reduced compared to the unmodified parental cell line (p ⁇ 0.0002).
  • TGF ⁇ 1 (pg/10 6 cells/24 hours) TGF ⁇ 2 (pg/10 6 cells/24 hours) Cell line Parental TGF ⁇ 1 KD % Reduction Parental TGF ⁇ 2 KD % Reduction NCI-H460 2263 ⁇ 2080 973 ⁇ 551 57 2096 ⁇ 1023 ⁇ 42 98 NCI-H520 ⁇ 92 ⁇ 92 NA 3657 ⁇ 3394 ⁇ 42 >99* DMS 53 504 ⁇ 407 170 ⁇ 128 53 4869 ⁇ 5024 3293 ⁇ 4161 32 NCI-H2023 933 ⁇ 125 ⁇ 92 >90* 341 ⁇ 32 118 ⁇ 42 65 NCI-H23 1575 ⁇ 125 644 ⁇ 102 59 506 ⁇ 42 48 ⁇ 9 90 A549 5796 ⁇ 339 914 ⁇ 54 84 772 + 49 42 ⁇ 7 95 NCI-H1703 17
  • TGF ⁇ 1 and/or TGF ⁇ 2 Enhances Cellular Immune Responses
  • TGF ⁇ 1 KD, TGF ⁇ 2 KD, or TGF ⁇ 1+ ⁇ 2 KD NCI-H460 cells were treated with 10 ⁇ g/mL MMC for 2 hours and then seeded in 6-well plate 24 hours prior to the addition of healthy donor PBMCs.
  • PBMCs were co-cultured with the MMC treated NCI-H460 for 5-6 days in the presence of IL-2.
  • PBMCs were carefully isolated from the co-culture, counted, and loaded on pre-coated IFN ⁇ ELISpot plates (MabTech).
  • PBMCs were then stimulated with either MMC treated unmodified parental NCI-H460 cells or a mixture of 11 peptides comprising known MHC class I-restricted Survivin epitopes for 36-48 hours.
  • IFN ⁇ SFU were detected following the manufacturer's instructions, counted (CTL CRO Scanning Services), and expressed as the number of SFU/10 6 PBMCs.
  • PBMCs derived from a different donor (HLA-A*01, HLA-A*11) knockdown of TGF ⁇ 1 in NCI-H460 significantly increased cellular immune responses (1883 ⁇ 144 SFU), compared to sensitization with the unmodified parental NCI-H460 (773 ⁇ 236 SFU) (p 0.013) ( FIG. 10B ).
  • PBMCs cultured without tumor cells served as an additional control. IFN ⁇ secretion was measured in the co-culture supernatant by ELISA on day 10 ( FIG. 11A ).
  • TGF ⁇ 1 knockdown on the immunogenicity of NCI-H520 was further evaluated in an autologous PBMC DC co-culture assay.
  • DCs differentiated from monocytes isolated from a healthy donor (HLA-A*24, HLA-A*30), were loaded with cell lysate from NCI-H520 unmodified parental cells, TGF ⁇ 1 KD, TGF ⁇ 2 KD, or TGF ⁇ 1+ ⁇ 2 KD cells.
  • Autologous PBMCs were co-cultured with lysate loaded DCs for 5-6 days in the presence of 20 U/mL of IL-2.
  • FIG. 12 A representative assay is shown in FIG. 12 .
  • Normal donor PBMC were cocultured with either TGF ⁇ 1/TGF ⁇ 2 shRNA modified or NCI-H460 or TGF ⁇ 1/TGF ⁇ 2 ZFN knockout NCI-H460 prior to analysis in an IFN ⁇ ELISpot assay.
  • TGF ⁇ 1 is a key player in regulating the epithelial-mesenchymal transition
  • complete lack of TGF ⁇ 1 induces a less immunogenic phenotype in tumor cells (Miyazono, K et al., Frontiers of Medicine. 2018). This was discernable when compared the ratio of the expression of important immune response-related proteins in TGF ⁇ 1 TGF ⁇ 2 shRNA knockdown in NCI-H460 compared to knockout ( FIG. 13 ). The knockdown cells expressed high levels of immunogenic proteins and TAAs compared to the knockout cells.
  • TGF ⁇ 1 and/or TGF ⁇ 2 can increase cellular immune responses to unmodified parental tumor cells and antigens in the context of an allogenic whole cell vaccine. Further, these data demonstrate that shRNA mediated knockdown induces more robust immune responses compared to knockout of TGF ⁇ 1 and TGF ⁇ 2.
  • Immunogenicity of example combinations of cell lines with reduced TGF ⁇ 1 and/or TGF ⁇ 2 secretion were determined by IFN ⁇ ELISpot as described in Example 2 with modifications. Two different responses were evaluated, first for the combinations of cell lines and second for known tumor associated, tumor-specific, and cancer-testis antigens (collectively referred to as antigens).
  • antigens tumor associated, tumor-specific, and cancer-testis antigens.
  • DCs were loaded at a 1.0:0.33 DC to cell line ratio such that the ratio of DCs to total cell line was 1:1. Specifically, 1.5 ⁇ 10 6 DCs were cocultured with 5.0 ⁇ 10 6 cell line 1, 5.0e 5 cell line 2, and 5.0e 5 cell line 3.
  • CD14 ⁇ PBMCs isolated from co-culture with mDCs on day 6 were stimulated with antigen specific peptide pools in the IFN ⁇ ELISpot assay for 24 hours prior to detection of IFN ⁇ SFU.
  • Antigen specific responses are expressed as the number of SFU/10 6 PBMCs above that of the controls.
  • Immunogenicity of the six example combinations of three TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines were determined by IFN ⁇ ELISpot ( FIG. 14 ).
  • Example vaccine cell line Combination 1 was composed of NCI-2023, NCI-H23, and LK-2 TGF ⁇ 1 and TGF ⁇ 2 modified cell lines.
  • Example vaccine cell line Combination 2 was composed of the NCI-H23, DMS 53, and NCI-H1703 TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines.
  • Example vaccine cell line Combination 3 was composed of NCI-H2023, DMS 53, and NCI-H1703 TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines.
  • Example vaccine cell line Combination 4 consisted of NCI-H23, DMS 53, and LK-2 TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines.
  • Example vaccine cell line Combination 5 consisted of NCI-H2023, DMS 53, and LK-2 TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines.
  • Example vaccine cell line Combination 6 consisted of NCI-H460, NCI-H520, and A549 TGF ⁇ 1 and TGF ⁇ 2 modified cell lines.
  • IFN ⁇ responses against the individual unmodified parental cell lines were enhanced when PBMCs were co-cultured with DCs presenting antigens from three vaccine cell line combinations relative to PBMCs co-cultured with DCs presenting antigens from a single vaccine cell line component (Table 26).
  • the immune responses induced by three cell line combinations were more robust than the responsed induced by each individual cell line.
  • IFN ⁇ responses to 11 antigens were determined for the example vaccine Combination 4 (NCI-H23, DMS 53, and LK-2 TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines).
  • Example vaccine Combination 4 induced antigen specific IFN ⁇ responses greater in magnitude 5,423 ⁇ 427 SFU ( FIG. 15A ) and breadth ( FIG.
  • TGF ⁇ 1 and/or TGF ⁇ 2 modified cell lines NCI-H23 (4,1115 ⁇ 2,118 SFU), DMS 53 (3,661 ⁇ 1,982 SFU), and LK-2 (2,772 ⁇ 2,936 SFU).
  • Responses to specific antigens are in the order indicated in the figure legends.
  • the average IFN ⁇ response to each antigen induced by the single component and combination cell line vaccines are detailed in FIG. 15B .
  • HLA-E belongs to the HLA class I heavy chain paralogues. Human tumor cell surface expression of HLA-E can inhibit the anti-tumor functions of NK, DC, and CD8 T cells through binding to the NKG2A receptor on these immune cell subsets.
  • the human adenocarcinoma cell line RERF-LC-Ad1 was electroporated with a zinc finger nuclease (ZFN) pair specific for HLA-E targeting the following genomic DNA sequence: TACTCCTCTCGGAGGCCCTGgcccttACCCAGACCTGGGCGGGT (SEQ ID NO: 33).
  • ZFN zinc finger nuclease
  • Full-allelic knockout cells were identified by flow cytometry after staining with PE-conjugated anti-human HLA-E (BioLegend, clone 3D12) then FACS sorted. Cells were expanded after sorting and percent knockout determined.
  • the MFI of the unstained control of the HLA-E KO or unmodified parental cell was subtracted from the MFI of the HLA-E KO or unmodified parental cells stained with PE-conjugated anti-human HLA-E (BioLegend, clone 3D12).
  • Gene editing of HLA-E by ZFN resulted in greater than 99% HLA-E negative cells after FACS sorting ( FIG. 16A ).
  • Knockout percentage is expressed as: (RERF-LC-Ad1 HLA-E KO MFI/Parental MFI) ⁇ 100.
  • IFN ⁇ ELISpot was completed as described in Example 8 with one modification.
  • iDC were loaded with only one cell line, RERF-LC-Ad1 parental or HLA-E KO cell lines.
  • 1.5 ⁇ 10 6 DCs were loaded with 1.5 ⁇ 10 6 RERF-LC-Ad1 parental or HLA-E KO cells.
  • CTL-4 Cytotoxic T-Lymphocyte-Associated Protein 4
  • CTLA-4 (CD152) functions as an immune checkpoint and is constitutively expressed on some tumor cells.
  • CTLA-4 binding to CD80 or CD86 on the surface of DCs can negatively regulate DC maturation and inhibit proliferation and effector function of T cells.
  • the NCI-H520 cell line was transfected with siRNA targeting CTLA-4 (Dharmacon, L-016267-00-0050). Cells were seeded at 6 ⁇ 10 5 in each well of a six well plate in antibiotic-free media and incubated at 37° C. in 5% CO 2 . Following DharmaFect siRNA transfection protocol, each well was transfected with a 25nM final concentration of CTLA-4 siRNA using 4uL of DharmaFECT 1 Transfection Reagent (Dharmacon, T-20001-01) per well. Reduction of CTLA-4 expression on live cells was determined by flow cytometry 72 hours after siRNA transfection prior to use in the IFN ⁇ ELISpot assay.
  • NCI-H520 cells were stained with LIVE/DEADTM Aqua (Invitrogen, L34965) and human ⁇ -CTLA4-APC (BioLegend, clone L3D10).
  • siRNA reduced NCI-H520 cell surface expression of CTLA-4 (3.59%) 2.1-fold compared to unmodified parental NCI-H520 (7.59%) ( FIG. 17A ).
  • CTLA-4 The impact of reducing cell surface expression of CTLA-4 on cellular immune responses was evaluated in the IFN ⁇ ELISpot assay using cells derived from an HLA-A 02:01 donor.
  • the ELISpot was initiated 72 hours after siRNA transfection and carried out as described in Example 9.
  • CD276 (B7-H3) is an immune checkpoint member of the B7 and CD28 families. Over expression of CD276 in human solid cancers can induce an immunosuppressive phenotype and preferentially down-regulates Th1-mediated immune responses.
  • CD276 expression in A549 was completed using the CRISPR-Cas9 system with guide RNA specific for TGCCCACCAGTGCCACCACT (SEQ ID NO: 117)(Synthego).
  • the initial heterogenous population contained 71% A549 cells where CD276 expression was reduced.
  • the heterogenous population was surface stained with BB700-conjugated ⁇ -human CD276 (BD Biosciences, clone 7-517) and full allelic knockout cells enriched by cell sorting (BioRad S3e Cell Sorter).
  • CD276 The reduction of CD276 was confirmed by extracellular staining of the sort enriched A540 CD276 KO cells and parental A549 cells with PE ⁇ -human CD276 (BioLegend, clone DCN.70). Unstained and isotype control PE a-mouse IgG1 (BioLegend, clone MOPC-21) stained A549 CD276 KO cells served as controls. Cas9-mediated gene editing of CD276 resulted in >99% reduction of CD276 compared to controls ( FIG. 18A ).
  • the A549, NCI-H460, NCI-H2023, NCI-H23, NCI-H520, LK-2, and NCI-H1703 that were modified to decrease secretion of TGF ⁇ 1 and/or TGF ⁇ 2 were further modified to reduce expression of CD47 as described in Example 2 and additional methods described here.
  • the cell lines were surface stained with FITC-conjugated a-CD47 (BD Biosciences, clone B6H12) and full allelic knockout cells enriched by cell sorting (BioRad S3e Cell Sorter). The cells were collected using a purity sorting strategy to ensure the collection of only CD47 negative cells.
  • the sorted cells were plated in an appropriately sized vessel based on cell number, grown and expanded. After cell enrichment for full allelic knockouts, the TGF ⁇ 1 and/or TGF ⁇ 2 KD CD47 KO cells were passaged 2-5 times and CD47 knockout percentage determined by flow cytometry (BV421-conjugated human ⁇ CD47, BD Biosciences, clone B6H12). The MFI of the unstained controls for the modified or unmodified parental cells were subtracted from the MFI of the modified or unmodified parental cells stained with BV421-conjugated human a-CD47. CD47 knockout percentage is expressed as: (1-(TGF ⁇ 1/TGF ⁇ 2 KD CD47 KO MFI/Parental MFI)) ⁇ 100).
  • TGF ⁇ 1 and TGF ⁇ 2 secretion in TGF ⁇ 1 and/or TGF ⁇ 2 KD cell lines CD47 KO cell lines TGF ⁇ 1 (pg/10 6 cells/24 hours) TGF ⁇ 2 (pg/10 6 cells/24 hours) Cell line Parental TGF ⁇ 1 KD % Reduction Parental TGF ⁇ 2 KD % Reduction NCI-H2023 1262 ⁇ 163 ⁇ 92 >93* 393 ⁇ 168 168 ⁇ 57 57 NCI-H23 1993 ⁇ 540 590 ⁇ 136 70 679 ⁇ 211 ⁇ 42 >94* A549 5962 ⁇ 636 952 ⁇ 77 84 718 ⁇ 82 45 ⁇ 12 94 NCI-H460 1758 ⁇ 75 227 ⁇ 45 87 2564 ⁇ 200 559 ⁇ 147 57 NCI-H1703 1700 ⁇ 300 565 ⁇ 91 67 ⁇ 42 ⁇ 42 NA ⁇ 92 ⁇ 92 NA 111 ⁇ 41 58
  • the human tumor cell lines NCI-H460, NCI-H520, DMS 53, A549, NCI-H2023, NCI-H23, LK-2 and NCI-H1703, in which TGF ⁇ 1 and/or TGF ⁇ 2 secretion was reduced by shRNA in Example 5 were electroporated with a zinc finger nuclease (ZFN) pair specific for CD276 targeting the genomic DNA sequence: GGCAGCCCTGGCATGggtgtgCATGTGGGTGCAGCC. (SEQ ID NO: 26).
  • ZFN zinc finger nuclease
  • the cell lines were surface stained with BB700-conjugated ⁇ -human CD276 (BD Biosciences, clone 7-517) and full allelic knockout cells enriched by cell sorting (BioRad S3e Cell Sorter). The cells were collected using a purity sorting strategy to ensure the collection of only CD276 negative cells. The sorted cells were plated in an appropriately sized vessel based on cell number, grown and expanded.
  • TGF ⁇ 1 and/or TGF ⁇ 2 KD CD276 KO cells were passaged 2-5 times and CD276 knockout percentage by flow cytometry (BV421-conjugated human a-CD276, BD Biosciences, clone 7-517).
  • the MFI of the unstained controls for modified cells or unmodified parental cells were subtracted from the MFI of the modified cells or unmodified parental cells stained with BV421-conjugated human a-CD276. Percent reduction is expressed as: (1-(TGF ⁇ 1/ ⁇ 2 KD CD276 KO MFI/Parental MFI)) ⁇ 100).
  • TGF ⁇ 1 and TGF ⁇ 2 secretion in TGF ⁇ 1 and/or TGF ⁇ 2 KD CD276 KO cell lines TGF ⁇ 1 (pg/10 6 cells/24 hours) TGF ⁇ 2 (pg/10 6 cells/24 hours) Cell line Parental TGF ⁇ 1 KD % Reduction Parental TGF ⁇ 2 KD % Reduction NCI-H2023 1090 ⁇ 279 97 ⁇ 23 91 347 ⁇ 57 153 ⁇ 93 56 NCI-H23 1683 ⁇ 111 706 ⁇ 180 58 523 ⁇ 37 55 ⁇ 18 89 A549 6443 ⁇ 406 770 ⁇ 29 88 757 ⁇ 125 61 ⁇ 8 92 NCI-H460 1415 ⁇ 282 390 ⁇ 14 72 2100 ⁇ 542 680 ⁇ 166 68 NCI-H1703 1682 ⁇ 155 434 ⁇ 53 74 ⁇ 42 ⁇ 42 NA ⁇ 92 ⁇ 92 NA 140 ⁇ 64 76
  • TGF ⁇ 1 and TGF ⁇ 2 KD and CD276 KO Increases Cellular Immune Responses
  • IFN ⁇ ELISpot was carried out as described in Example 9.
  • Cells derived from HLA-A02 and HLA-A03 healthy donors were used to evaluate if reduction of TGF ⁇ 1 and TGF ⁇ 2 secretion and CD276 expression could improve immune responses compared to the unmodified parental cell lines.
  • the A549 cell line was modified to reduce TGF ⁇ 1 and TGF ⁇ 2 secretion using shRNA and reduce expression of CD47 and CD276. Methods used to secretion and determine levels of TGF ⁇ 1 and TGF ⁇ 2 are described in Example 5. Methods employed to reduce expression of CD47 and CD276 and determine expression levels are described in Example 12 and Example 13, respectively. IFN ⁇ ELISpot was completed as described in Example 9.
  • CD47 expression was reduced 99.9% on the modified cell line (136 MFI) relative to the unmodified parental cell line (104,442 MFI) ( FIG. 36A ) (Table 31).
  • CD276 expression was reduced 100% on the modified cell line (0 MFI) relative to the unmodified parental cell line (53,196 MFI) ( FIG. 36B ) (Table 31).
  • HLA-A02 FIG. 37A
  • HLA-A03 FIG. 37A
  • HLA-A24 FIG. 37B
  • IFN ⁇ ELISpot assay to determine if modification of TGF ⁇ 1 and TGF ⁇ 2, CD276, and CD47 in the A549 cell line enhanced immune responses relative to the unmodified parental cell line.
  • IFN ⁇ ELISpot was completed as described in Examples 9.
  • TGF ⁇ 1 TGF ⁇ 2 KD CD47KO TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO
  • TGF ⁇ 1 TGF ⁇ 2 KD CD276 CD47KO TGF ⁇ 1 TGF ⁇ 2 KD CD276 CD47KO
  • CD40 Ligand (CD40L) is transiently expressed on T cells and other non-immune cells under inflammatory condition and binds to the costimulatory molecule CD40 on B cells and professional antigen-presenting cells. The binding of CD40L to CD40 upregulates multiple facets of adaptive cellular and humoral immunity.
  • the cell line A549 cell line was transduced with lentiviral particles expressing a CD40L sequence modified to reduce cleavage by ADAM17 and, thereby, promote membrane bound CD40L expression.
  • Parental, unmodified cell lines served as controls.
  • After antibiotic selection in 200 ⁇ g/mL to enrich for cells stable expressing CD40L cells were analyzed for CD40L expression on the cell surface using flow cytometry and solubilized CD40L detected by ELISA.
  • the sequence of membrane bound CD40L used in this example is shown in SEQ ID NO: 1.
  • Solubilized CD40L was quantified by ELISA.
  • CD40L-transduced and unmodified parental cells were plated at 8.33 ⁇ 10 4 cells/well in a 24-well plated in regular growth medium (RPMI containing 10% FBS). Twenty-four hours after plating, adherent cells were thoroughly washed to remove FBS and culture was continued in RPMI+5% CTS. Forty-eight hours after media replacement, the cell culture supernatant was harvested, and stored at ⁇ 70° C. until the assays were completed according to the manufacturers instructions (BioLegend, DCDL40). The lower limit of quantification of human CD40L is 62.5 ⁇ g/mL, or 0.375 ng/10 6 cells/24 hours. Overexpression of CD40L resulted in 2.93 ng/10 6 cells/24 hours of sCD40L ( FIG. 38B ).
  • A549 CD40L expression on DC maturation was characterized by flow cytometry. iDCs and A549 unmodified parental cells, unmodified parental cells with exogenous sCD40L (1 ⁇ g/mL) (PeproTech, #AF31002100UG), or A549 cells overexpressing membrane-bound CD40L were co-cultured at a 1:1 ratio in 96-well low-adherence U bottom plates.
  • CD40L overexpression of CD40L on induction of cellular immune responses was evaluated by IFN ⁇ ELISpot assay as described in Example 9.
  • iDCs loaded were loaded with A549 cells, A549 cells with 1 ⁇ g/mL exogenous sCD40L, or A549 cells overexpressing CD40L.
  • Unmodified parental NCI-H460 cells were transfected with either empty lentiviral vector (control) or a lentiviral vector designed to overexpress GM-CSF (SEQ ID NO: 6).
  • the control and GM-CSF over expressing cell line were grown in the presence of Puromycin (2 ⁇ g/mL) prior to use in the IFN ⁇ ELISpot assay.
  • IFN ⁇ ELISpot was performed as described in Example 6.
  • Interleukin-12 Enhances Cellular Immune Responses
  • IL-12 is a proinflammatory cytokine that promotes DCs and LCs to prime T cells towards an effector phenotype. IL-12 can also act directly on DCs to reverse or prevent the induction of immune tolerance.
  • the A549 cells were transduced with lentiviral particles expressing both the p40 and p35 chains of IL-12 to form the functional IL-12 p70 cytokine protein.
  • the p40 and p35 sequences are separated by a P2A cleavage sequence.
  • the sequence of IL-12 used in this example is shown in SEQ ID NO: 9.
  • Unmodified parental, unmodified cell lines served as controls. After antibiotic selection in 600 ⁇ g/mL zeocin to enrich for cells stably expressing IL-12 immune responses generated by the parental and IL-12 modified cell lines were determined as described in Example 9.
  • GITR Glucocorticoid-Induced TNFR Family Related Gene
  • GITR is surface receptor molecule involved in inhibiting the suppressive activity of T-regulatory cells (Tregs) and extending the survival of T-effector cells. Binding of GITR to its ligand, GITR, on APCs triggers signaling which co-stimulates both CH8 + and CD4 + effector T cells, leading to enhanced T cell expansion and effector function, while suppressing the activity of Tregs.
  • GITR GITR NP_004186
  • BamHI and Xhol restriction endonuclease site of pVAX1 Invitrogen, #V26020
  • GenScript The sequence of GITR used in this example is shown in SEQ ID NO: 4.
  • A549 (5.38 ⁇ 10 6 cells), NCI-H460 (1.79 ⁇ 10 7 cells), LK-2 (2.39 ⁇ 10 7 cells) or NCI-H520 (1.02 ⁇ 10 7 cells) were plated into T175 flasks using 45 mL of complete culture media 18-24 hours prior to transfection and maintained at 37° C./5% CO 2 .
  • Plasmid DNA transfections were performed using the Lipofectamine transfection reagent (Invitrogen, #2075084) according to the manufacturer's instructions. Cells were incubated at 37° C. and 5% CO 2 for 72 hours prior to assessment of GITR expression by flow cytometry.
  • GITR cell surface expression
  • transfected cells and unmodified parental controls were surfaced stained with BV421-conjugated mouse anti-human GITR antibody (BD Biosciences, clone V27-580).
  • Flow cytometry data was acquired on a BD LSRFortessa and analyzed using FlowJo software.
  • Interleukin-15 Enhances Cellular Immune Responses
  • IL-15 is a member of the four a-helix bundle family of cytokines and is produced by a wide range of cells including DCs and is essential for the differentiation of CH + memory T cells.
  • Two isoforms of IL-15 are natively expressed that encode two different N-terminal signal peptides. These signal peptides function to decrease or inhibit secretion of the IL-15 protein from tumor cells.
  • a codon optimized sequence of IL-15 was generated where the native IL-15 long signal peptide region was replaced with IL-2 signal peptide to promote secretion of the IL-15 protein (GenScript). The codon optimized sequence was cloned into the BamHl and Xhol restriction sites of pVAX1. The sequence of IL-15 used in this example is shown in SEQ ID NO: 11.
  • IFN ⁇ ELISpot to evaluate the effect of IL-15 on cellular immune responses was completed as described in Example 9.
  • Interleukin-23 Enhances Cellular Immune Responses
  • IL-23 is a binary complex of a four-helix bundle cytokine (p19) and a soluble class I cytokine receptor p40. IL-23 acts as a proinflammatory cytokine that enhances DC maturation and suppresses DC activation of naive T cell-derived Tregs.
  • IL-23 p19 and p40 sequences were generated and cloned into the BamHl and Xhol restriction sites of pVAX1 (GenScript). The p19 and p40 sequences were separated by a flexible linker GS 3 linker. The sequence of IL-23 used in this example is shown in SEQ ID NO: 13. Transfections were completed as described in Example 18.
  • IFN ⁇ ELISpot to evaluate the effect of IL-23 on cellular immune responses was completed as described in Example 9.
  • the effect of IL-15 secretion by the A549 (ATCC CCL-185) cell line on cellular immune responses was evaluated using immune cells derived from an HLA-A02 healthy donor.
  • the cytokine XCL1 also known as Lymphotactin, binds to the chemokine receptor XCR1, which is selectively expressed on antigen cross-presenting DCs. Expression of XCL1 has the potential to function as an adjuvant for intradermal vaccine administration.
  • a human codon optimized sequence was generated encoding human XCL1 (GenScript) and cloned into the BamHl and Xhol restriction sites of the pVAX1 plasmid. Transient expression and secretion of XCL1 was characterized by ELISA.
  • the sequence of XCL1 used in this example is shown in SEQ ID NO: 15.
  • NCI-H460 and A549 cells were transfected with pVAX1 encoding codon optimized XCL1 as described in Example 18. Twenty-four hours after transfection, supernatants were removed from the cells and assayed for the presence of secreted XCL1 by ELISA. Supernatants were assayed for XCL1 secretion according to the manufacturer's instructions (R&D Systems, #DXCL10).
  • the NCI-H460 and A549 cell lines transiently expressed 418 and 144 and ng/10 6 cells/24 hours of XCL1, respectively ( FIG. 45 ).
  • MSLN is expressed on the surface of many lung adenocarcinomas and expression is correlated with poor prognosis. MSLN is an attractive TAA targeted because antigen specific immune responses to MSLN can predict the survival of patients with brain metastasis resulting from several different primary tumors including ovarian, lung and melanoma. A small subset of lung cancer cell lines express MSLN despite expression of MSLN in many patient tumors. In Example 22, the expression of MSLN was genetically introduced in exemplary vaccine cell lines that do not natively express MSLN to broaden the coverage TAAs potentially important to patients with NSCLC.
  • a codon optimized human MSLN sequence was generated in which the ADAM17 cleavage site replaced with a flexible linker to promote retention of MSLN in the cell membrane (GenScript).
  • the codon optimized sequence was cloned into the BamHl and Xhol restriction sites of pVAX1.
  • the sequence of MSLN used in this example is SEQ ID NO: 17.
  • Transfections of the MSLN encoding plasmid were completed as described in Example 18.
  • transfected cells and unmodified parental controls were surfaced stained with PE-conjugated rat anti-human MSLN antibody (R&D Systems, FAB32652P).
  • Flow cytometry data was acquired on a BD LSRFortessa and analyzed using FlowJo software.
  • Immune responses to the overexpressed MSLN antigen were characterized by IFN ⁇ ELISpot.
  • peptides 15 amino acids in length, overlapping by 11 amino acids, were generated to cover the native protein MSLN protein and used to stimulate PBMCs as described in Example 8.
  • CT83 is expressed by 40% non-small-cell lung cancer tissues and by 31% Stage 1 NSCLC. CT83 is highly expressed in lung tumors compared to normal tissue. Expression of CT83 is also typically associated with poor prognosis. In Example 23, the expression of CT83 was genetically introduced in exemplary vaccine cell lines that do not natively express CT83 to broaden the coverage TAAs potentially relevant to some NSCLC patients.
  • a codon optimized sequence of human CT83 was generated and cloned in frame with codon optimized MSLN (Example 17). SEQ ID NO: 21 was used. The MSLN and CT83 coding sequences were separated by a P2A cleavage site and cloned into the BamHl and Xhol restriction sites of pVAX1.
  • Blots were then probed with primary antibody anti-CT83 rabbit polyclonal (Sigma, HPA004773) in TBST-5% Blotto at 4 ⁇ g/mL overnight at 4° C. The next day, blots were washed 5 ⁇ with TBST and then probed with a 1:5,000 dilution of anti-rabbit IgG HRP conjugated antibody (Southern Biotech, 4030-05) in TBST-5% Blotto for 1 hour at room temperature with shaking. Blots were washed 5 ⁇ with TBST and developed by the addition of 1-Step Ultra TAAB Blotting Solution (Pierce, #37574) ( FIG. 47 ).
  • immunosuppressive suppressive factors in the VME can enhance cellular immune responses.
  • the A549 and NCI-H460 component vaccine cell lines with reduced expression of three immunosuppressive factors were modified to secrete GM-CSF, express membrane bound CD40L, and/or secrete the functional heterodimeric IL-12 p70 cytokine.
  • the ability for GM-CSF to increase IFN ⁇ responses in vitro is described in Example 16.
  • In vivo expression of GM-CSF in the skin enhances DC activation, maturation, and the ability for DCs to promote a more functional, Th1-biased immune response.
  • the immunostimulatory functions of membrane bound CD40L and IL-12 p70 when expressed alone are described in Example 15 and Example 17, respectively.
  • Example 5 The methods used for shRNA mediated knockdown TGF ⁇ 1 and TGF ⁇ 2 secretion, and to determine resulting secretion levels, are described in Example 5.
  • the component vaccine cell lines with three reduced immunosuppressive factors were modified to secrete GM-CSF and to express membrane bound CD40L. In some examples, the component vaccine cell lines with three reduced immunosuppressive factors were modified to secrete GM-CSF, express membrane bound CD40L, and to secrete the functional IL-12 p70 cytokine. Methods used to quantify the expression of membrane bound CD40L are described herein.
  • the vaccine component cell lines A549 and NCI-H460 were transduced with lentiviral particles expressing native human GM-CSF. Unmodified parental, unmodified cell lines served as controls. After antibiotic selection in 100 ⁇ g/mL to enrich for cells stable expressing GM-CSF, cells were analyzed for GM-CSF secretion by ELISA.
  • the sequence of GM-CSF used in this example is shown in SEQ ID NO: 6.
  • GM-CSF-transduced and unmodified parental cells were plated at 8.33 ⁇ 10 4 cells/well in a 24-well plated in regular growth medium (RPMI containing 10% FBS). Twenty-four hours after plating, adherent cells were thoroughly washed to remove FBS and culture was continued in RPMI+5% CTS. Forty-eight hours after media replacement, the cell culture supernatant was harvested, and stored at ⁇ 70° C. until the GM-CSF secretion assay was completed according to the manufacturers specifications (human GM-CSF Quantikine ELISA kit #DGM00, R&D Systems).
  • the lower limit of quantitation of human GM-CSF in the ELISA assay is less than 3.0 pg/mL, or 0.018 ng/10 6 cells/24 hours. GM-CSF secretion by the unmodified parental cell lines was below the lower limit of quantitation of the ELISA assay.
  • IL-12-transduced and unmodified parental cells were plated at 8.33 ⁇ 10 4 cells/well in a 24-well plated in regular growth medium (RPMI containing 10% FBS). Twenty-four hours after plating, adherent cells were thoroughly washed to remove FBS and culture was continued in RPMI+5% CTS. Forty-eight hours after media replacement, the cell culture supernatant was harvested, and stored at ⁇ 70° C. until the IL-12 secretion assays for p40 and p70 were completed according to the manufacturers specifications (BioLegend, human IL-12 p40 LEGEND MAX ELISA kit #430707 and human IL-12 p70 LEGEND MAX ELISA kit #431707).
  • the lower limit of quantification of human IL-12 p40 is 9.5 pg/mL, or 0.057 ng/10 6 cells/24 hours.
  • the lower limit of quantification of human IL-12 p70 is 1.2 pg/mL, or 0.007 ng/10 6 cells/24 hours.
  • IL-12 secretion by the unmodified parental cell lines was below the lower limit of quantitation of the ELISA assay.
  • FIG. 49B reduces the expression of CD47 99.9% ( FIG. 49C ) (Table 33), secrete 940 ⁇ 19 ng/10 6 cells/24 hours of GM-CSF ( FIG. 49D ) (Table 35), and express a 5-fold increase in membrane bound CD40L ( FIG. 49E ) (Table 34).
  • CD40L MFI CD40L MFI Increase A549 2,656 ⁇ 69 9,537 360,236 38 TGF ⁇ 1 and TGF ⁇ 2 KD, CD47 KO NCI-H460 940 ⁇ 19 16,992 84,924 5 TGF ⁇ 1 and TGF ⁇ 2 KD, CD47 KO A549 1,704 ⁇ 60 41,076 1,660,242 40 TGF ⁇ 1 and TGF ⁇ 2 KD, CD276 KO NCI-H460 943 ⁇ 13 16,992 121,555 7 TGF ⁇ 1 and TGF ⁇ 2 KD, CD276 KO GM-CSF secretion and membrane bound CD40L expression by TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO
  • FIG. 51B (Table 32), reduce the expression of CD276 99.1% ( FIG. 51C ) (Table 33), secrete 943 ⁇ 13 ng/10 6 cells/24 hours of GM-CSF ( FIG. 51D ) (Table 34), and express a 7-fold increase in membrane bound CD40L ( FIG. 51D ) (Table 34).
  • IFN ⁇ ELISpot was used to evaluate the effect GM-CSF secretion and membrane bound CD40L expression by TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO and GM-CSF secretion and membrane bound CD40L expression by TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO on cellular immune responses in the A549 cell line.
  • TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO 3,213 ⁇ 287)
  • TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO 3,207 ⁇ 663
  • FIG. 52A Statistical significance was determined using One-Way ANOVA and Holm-Sidak's multiple comparisons test.
  • iDCs derived from three HLA-A02 donors were co-cultured with the unmodified parental A549 or unmodified parental NCI-H460 cell lines, or the modified A549 or NCI-H460 TGF ⁇ 1 and TGF ⁇ 2 KD CD276 KO, that secrete GM-CSF and express membrane bound CD40L.
  • Statistical significance was determined using One-Way ANOVA and Holm-Sidak's multiple comparisons test.
  • TGF ⁇ 1 and TGF ⁇ 2 secretion in TGF ⁇ 1 and TGF ⁇ KD CD47 KO cell lines that secrete GM-CSF, express membrane bound CD40L, and secrete IL-12 TGF ⁇ 1 (pg/10 6 cells/24 hours) TGF ⁇ 2 (pg/10 6 cells/24 hours) Cell line Parental TGF ⁇ 1 KD % Reduction Parental TGF ⁇ 2 KD % Reduction A549 4,767 ⁇ 300 760 ⁇ 55 84 732 ⁇ 14 ⁇ 42 >89* NCI-H460 1,850 ⁇ 1 ⁇ 92 >95* 3,433 ⁇ 271 492 ⁇ 10 86 Parental refers to the unmodified cell line. *Secretion levels are below the lower limit of quantification for TGF ⁇ 1 (92 pg/10 6 cells/24 hours) or TGF ⁇ 2 (42 pg/10 6 cells/24 hours). Lower limit of quantification used to approximate % reduction relative to parental.
  • TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO and TGF ⁇ 1 TGF ⁇ 2 KD CD276 KO cell lines GMCSF CD40L IL-12 p70 (ng/10 6 cells/ Parental Modified Fold (ng/10 6 cells/ Cell line 24 hours) CD40L MFI CD40L MFI Increase 24 hours) A549 2,295 ⁇ 60 9,537 536,953 56 300 ⁇ 24 TGF ⁇ 1 and TGF ⁇ 2 KD, CD47 KO NCI-H460 1,586 ⁇ 24 16,992 154,964 9 434 ⁇ 15 TGF ⁇ 1 and TGF ⁇ 2 KD, CD47 KO A549 1,113 ⁇ 51 41,076 1,476,699 36 263 ⁇ 24 TGF ⁇ 1 and TGF ⁇ 2 KD, CD276 KO NCI-H460 1,234 ⁇ 24 16,992 267,023 16 312 ⁇ 50 TGF ⁇ 1 and
  • TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO A549 A TCC CCL-185) and NCI-H460 (A TCC HTB-177) Cell Lines Increases TAA-Specific IFN ⁇ Responses
  • IFN ⁇ ELISpot was used to evaluate the effect GM-CSF secretion, expression of membrane bound CD40L, and secretion of IL-12 by the TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO A549 and by the TGF ⁇ 1 TGF ⁇ 2 KD CD47 KO NCI-H460 cell lines on IFN ⁇ responses to antigens.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US17/109,757 2019-12-03 2020-12-02 Tumor cell vaccines Abandoned US20210205428A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US17/109,757 US20210205428A1 (en) 2019-12-03 2020-12-02 Tumor cell vaccines
US17/212,372 US20210252122A1 (en) 2019-12-03 2021-03-25 Tumor cell vaccines
US17/396,033 US11369668B1 (en) 2019-12-03 2021-08-06 Tumor cell vaccines
US17/726,295 US11684659B2 (en) 2019-12-03 2022-04-21 Tumor cell vaccines
US18/318,033 US20230414733A1 (en) 2019-12-03 2023-05-16 Tumor cell vaccines

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962943055P 2019-12-03 2019-12-03
US17/109,757 US20210205428A1 (en) 2019-12-03 2020-12-02 Tumor cell vaccines

Related Child Applications (4)

Application Number Title Priority Date Filing Date
US17/212,372 Continuation US20210252122A1 (en) 2019-12-03 2021-03-25 Tumor cell vaccines
US17/396,033 Continuation US11369668B1 (en) 2019-12-03 2021-08-06 Tumor cell vaccines
US17/726,295 Continuation US11684659B2 (en) 2019-12-03 2022-04-21 Tumor cell vaccines
US18/318,033 Continuation US20230414733A1 (en) 2019-12-03 2023-05-16 Tumor cell vaccines

Publications (1)

Publication Number Publication Date
US20210205428A1 true US20210205428A1 (en) 2021-07-08

Family

ID=74046160

Family Applications (5)

Application Number Title Priority Date Filing Date
US17/109,757 Abandoned US20210205428A1 (en) 2019-12-03 2020-12-02 Tumor cell vaccines
US17/212,372 Abandoned US20210252122A1 (en) 2019-12-03 2021-03-25 Tumor cell vaccines
US17/396,033 Active US11369668B1 (en) 2019-12-03 2021-08-06 Tumor cell vaccines
US17/726,295 Active US11684659B2 (en) 2019-12-03 2022-04-21 Tumor cell vaccines
US18/318,033 Pending US20230414733A1 (en) 2019-12-03 2023-05-16 Tumor cell vaccines

Family Applications After (4)

Application Number Title Priority Date Filing Date
US17/212,372 Abandoned US20210252122A1 (en) 2019-12-03 2021-03-25 Tumor cell vaccines
US17/396,033 Active US11369668B1 (en) 2019-12-03 2021-08-06 Tumor cell vaccines
US17/726,295 Active US11684659B2 (en) 2019-12-03 2022-04-21 Tumor cell vaccines
US18/318,033 Pending US20230414733A1 (en) 2019-12-03 2023-05-16 Tumor cell vaccines

Country Status (10)

Country Link
US (5) US20210205428A1 (zh)
EP (1) EP4069284A1 (zh)
JP (1) JP2023504659A (zh)
KR (1) KR20220149505A (zh)
CN (1) CN115551537A (zh)
AU (1) AU2020395765A1 (zh)
CA (1) CA3163732A1 (zh)
IL (1) IL293446A (zh)
TW (1) TW202134430A (zh)
WO (1) WO2021113328A1 (zh)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114099653A (zh) * 2021-10-27 2022-03-01 北京承诺未来科技有限公司 一种单核细胞负载gpc3蛋白抗原的肿瘤疫苗组合物及其制备方法与应用
WO2023158710A1 (en) * 2022-02-17 2023-08-24 MAM Holdings of West Florida, L.L.C. Derived multiple allogeneic proteins paracrine signaling (d-mapps) regenerative biologics platform technology adjuvant therapy for the prevention and targeted treatment of cancer and other disorders

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2020395765A1 (en) * 2019-12-03 2022-06-16 Neuvogen, Inc. Tumor cell vaccines
US20220133868A1 (en) 2020-11-02 2022-05-05 Neuvogen, Inc. Tumor cell vaccines
US11865170B2 (en) * 2020-11-24 2024-01-09 Papivax Biotech Inc. DNA vaccine for human papillomavirus and method for using the same
TW202333803A (zh) * 2021-10-11 2023-09-01 德商拜恩迪克公司 用於肺癌之治療性ｒｎａ（一）
WO2023061550A1 (en) * 2021-10-11 2023-04-20 BioNTech SE Therapeutic rna for lung cancer
WO2023192639A2 (en) * 2022-03-31 2023-10-05 The Johns Hopkins University Combination immunotherapy
WO2024015955A2 (en) * 2022-07-15 2024-01-18 President And Fellows Of Harvard College Mucispirillum compositions and cancer treatment methods thereof
WO2024097051A1 (en) * 2022-10-31 2024-05-10 Pyrojas Inc. Immunotherapy compositions and methods of use
CN117286108B (zh) * 2023-11-24 2024-03-01 领因生物科技(上海)有限公司 一种乳腺癌类器官专用培养基及培养方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5772995A (en) * 1994-07-18 1998-06-30 Sidney Kimmel Cancer Center Compositions and methods for enhanced tumor cell immunity in vivo
US7101543B2 (en) * 2000-03-31 2006-09-05 Novarx Genetically modified cells expressing a TGFβ inhibitor, the cells being lung cancer cells
US20080206288A1 (en) * 2007-01-17 2008-08-28 Suzanne Ostrand-Rosenberg Tumor cells from immune privileged sites as base cells for cell-based cancer vaccines
US8293252B2 (en) * 2006-12-20 2012-10-23 Novarx Corporation Universal tumor cell vaccine for anti cancer therapeutic and prophylactic utilization
US11369668B1 (en) * 2019-12-03 2022-06-28 Neuvogen, Inc. Tumor cell vaccines

Family Cites Families (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5352449A (en) 1986-05-30 1994-10-04 Cambridge Biotech Corporation Vaccine comprising recombinant feline leukemia antigen and saponin adjuvant
US5057540A (en) 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
US5273965A (en) 1992-07-02 1993-12-28 Cambridge Biotech Corporation Methods for enhancing drug delivery with modified saponins
CA2139756A1 (en) 1992-07-08 1994-01-20 Eric M. Bonnem Use of gm-csf as a vaccine adjuvant
DE9319879U1 (de) 1993-12-23 1994-03-17 Ems-Inventa AG, Zürich Sequentiell Coextrudierte Kühlflüssigkeitsleitung
CA2335105C (en) 1998-07-22 2010-05-11 Osprey Pharmaceuticals Limited Methods and compositions for treating secondary tissue damage and other inflammatory conditions and disorders
US7157418B1 (en) 1998-07-22 2007-01-02 Osprey Pharmaceuticals, Ltd. Methods and compositions for treating secondary tissue damage and other inflammatory conditions and disorders
US20020177551A1 (en) 2000-05-31 2002-11-28 Terman David S. Compositions and methods for treatment of neoplastic disease
WO2001054716A2 (en) 2000-01-27 2001-08-02 Sidney Kimmel Cancer Center Genetically engineered tumor cell vaccines
DE60144515D1 (de) 2000-04-01 2011-06-09 Onyvax Ltd Prostata zellinien und deren verwendung
US9200036B2 (en) 2002-07-12 2015-12-01 The Johns Hopkins University Mesothelin vaccines and model systems
US20040191229A1 (en) 2002-10-09 2004-09-30 Link Charles J. Antitumor vaccination using allogeneic tumor cells expressing alpha (1,3)-galactosyltransferase
US20040197312A1 (en) 2003-04-02 2004-10-07 Marina Moskalenko Cytokine-expressing cellular vaccine combinations
WO2005030136A2 (en) 2003-09-26 2005-04-07 University Of Miami Tumor vaccine
WO2005063280A1 (de) 2003-12-30 2005-07-14 Mologen Ag Allogenes tumortherapeutikum
WO2006063301A1 (en) 2004-12-10 2006-06-15 Maxcyte, Inc. Genetically modified tumor cells as cancer vaccines
GB0601598D0 (en) 2006-01-26 2006-03-08 Stathopoulos Apostolos Method
AR060424A1 (es) 2007-04-11 2008-06-18 Consejo Nac Invest Cient Tec Lineas celulares , composiciones para el tratamiento de melanomas que las comprenden procedimientos para preparar las composiciones y metodos de tratamiento
EP2062592A1 (en) 2007-11-20 2009-05-27 BUNDESREPUBLIK DEUTSCHLAND letztvertreten durch das Robert Koch-Institut vertreten durch seinen Präsidenten System for delivery into a XCR1 positive cell and uses thereof
WO2009117566A1 (en) 2008-03-21 2009-09-24 H. Lee Moffitt Cancer Center And Research Institute, Inc. Chemokine gene-modified cells for cancer immunotherapy
CA2740779A1 (en) 2008-10-17 2010-04-22 University Of Miami Tumor vaccine
WO2010147971A2 (en) 2009-06-15 2010-12-23 New York University Il23 modified viral vector for recombinant vaccines and tumor treatment
CN108295087B (zh) 2009-12-23 2021-01-15 格兰达利斯有限公司 弗林蛋白酶敲减和gm-csf增强的(fang)癌症疫苗
JP6148179B2 (ja) 2011-02-28 2017-06-14 カディラ ファーマシューティカルズ リミテッド 治療用癌ワクチン
AU2012257377B2 (en) 2011-05-17 2017-09-07 Hadasit Medical Research Services And Development Ltd. Allogeneic tumor cell vaccination
CN105209063A (zh) 2013-03-15 2015-12-30 宾夕法尼亚大学理事会 具有抗原和作为佐剂的白细胞介素-23的疫苗
US9562219B2 (en) 2013-12-27 2017-02-07 SOTIO a.s. Cryopreservation of apoptotic cancer cells for use in immunotherapy against cancer
US10391158B2 (en) 2014-03-06 2019-08-27 Morphogenesis, Inc. DNA vector and transformed tumor cell vaccines
GB201505305D0 (en) 2015-03-27 2015-05-13 Immatics Biotechnologies Gmbh Novel Peptides and combination of peptides for use in immunotherapy against various tumors
US10404662B1 (en) 2015-11-10 2019-09-03 Source Defense VICE system, method, and medium for protecting a computer browser from third-party computer code interference
US10759859B2 (en) 2016-01-14 2020-09-01 Bps Bioscience, Inc. Anti-PD-1 antibodies and uses thereof
CA3015080A1 (en) 2016-02-25 2017-08-31 Briacell Therapeutics Corp. Whole-cell cancer vaccines and methods for selection thereof
US20200179447A1 (en) 2016-09-23 2020-06-11 The Regents Of The University Of California Autologous irradiated whole cell tumor vaccines lentivirally engineered to express cd80, il-15 and il-15 receptor alpha
US20190365878A1 (en) 2016-11-08 2019-12-05 The Johns Hopkins University Pharmaceutical treatments for preventing or treating pancreatic cancer
AU2017363256B2 (en) * 2016-11-22 2024-04-18 Alloplex Biotherapeutics Allogeneic tumor cell vaccine
EP3717003A4 (en) 2017-11-27 2022-02-16 Heat Biologics, Inc. CANCER THERAPY BASED ON NANOPARTICLES
EP3720450A4 (en) 2017-12-04 2021-07-28 Heat Biologics, Inc. Manufacture of cell-based vaccines
US20210030858A1 (en) 2018-03-29 2021-02-04 Mayo Foundation For Medical Education And Research Methods and materials for treating cancer
WO2020076568A1 (en) 2018-10-10 2020-04-16 University Of Miami Methods and compositions for treating cancer
WO2020185449A1 (en) 2019-03-08 2020-09-17 Stc.Unm Silicified immunogenic cells, methods of making, and methods of using

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5772995A (en) * 1994-07-18 1998-06-30 Sidney Kimmel Cancer Center Compositions and methods for enhanced tumor cell immunity in vivo
US7101543B2 (en) * 2000-03-31 2006-09-05 Novarx Genetically modified cells expressing a TGFβ inhibitor, the cells being lung cancer cells
US8293252B2 (en) * 2006-12-20 2012-10-23 Novarx Corporation Universal tumor cell vaccine for anti cancer therapeutic and prophylactic utilization
US20080206288A1 (en) * 2007-01-17 2008-08-28 Suzanne Ostrand-Rosenberg Tumor cells from immune privileged sites as base cells for cell-based cancer vaccines
US11369668B1 (en) * 2019-12-03 2022-06-28 Neuvogen, Inc. Tumor cell vaccines

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114099653A (zh) * 2021-10-27 2022-03-01 北京承诺未来科技有限公司 一种单核细胞负载gpc3蛋白抗原的肿瘤疫苗组合物及其制备方法与应用
WO2023158710A1 (en) * 2022-02-17 2023-08-24 MAM Holdings of West Florida, L.L.C. Derived multiple allogeneic proteins paracrine signaling (d-mapps) regenerative biologics platform technology adjuvant therapy for the prevention and targeted treatment of cancer and other disorders

Also Published As

Publication number Publication date
CA3163732A1 (en) 2021-06-10
IL293446A (en) 2022-07-01
AU2020395765A1 (en) 2022-06-16
KR20220149505A (ko) 2022-11-08
TW202134430A (zh) 2021-09-16
US11369668B1 (en) 2022-06-28
US20220257737A1 (en) 2022-08-18
US11684659B2 (en) 2023-06-27
EP4069284A1 (en) 2022-10-12
CN115551537A (zh) 2022-12-30
WO2021113328A1 (en) 2021-06-10
US20210252122A1 (en) 2021-08-19
JP2023504659A (ja) 2023-02-06
US20230414733A1 (en) 2023-12-28

Similar Documents

Publication Publication Date Title
US11369668B1 (en) Tumor cell vaccines
Rodriguez-Ruiz et al. Abscopal effects of radiotherapy are enhanced by combined immunostimulatory mAbs and are dependent on CD8 T cells and crosspriming
Jiang et al. Intratumoral delivery of RIG-I agonist SLR14 induces robust antitumor responses
Kroon et al. Radiotherapy and cisplatin increase immunotherapy efficacy by enabling local and systemic intratumoral T-cell activity
Jain et al. Personalized immuno-oncology
JP2017536812A (ja) バイパータイト型およびトリパータイト型のシグナル伝達免疫細胞
JP6893594B2 (ja) 腫瘍微小環境に影響する抗癌剤と組み合わせたβ−グルカン
CN111182917A (zh) 用于治疗癌症的免疫原性组合物
EP3373941A1 (en) Modified immune cells and uses thereof
Oba et al. Neoadjuvant in situ immunomodulation enhances systemic antitumor immunity against highly metastatic tumors
US20230000963A1 (en) Tumor cell vaccines
US20240122986A1 (en) Cd38-nad+ regulated metabolic axis in anti-tumor immunotherapy
Fujii et al. Cancer immunotherapy using artificial adjuvant vector cells to deliver NY‐ESO‐1 antigen to dendritic cells in situ
US20210386780A1 (en) Methods for treating cancer with double stranded rna sensor activators and adoptive cell therapy
US20220133868A1 (en) Tumor cell vaccines
US20220378890A1 (en) Immunogenic egfr peptide compositions and their use in the treatment of cancer
Huang et al. Inhibition of DNMTs increases neoantigen-reactive T-cell toxicity against microsatellite-stable colorectal cancer in combination with radiotherapy
Beck et al. An mRNA-encoded, long-lasting Interleukin-2 restores CD8+ T cell neoantigen immunity in MHC class I-deficient cancers
Gordy EFFICACY IN A MOUSE MELANOMA MODEL OF A DENDRITIC CELL-TARGETING THERAPEUTIC DNA VACCINE AND ENHANCEMENT OF ITS ACTIVITY BY CO-TREATMENT WITH ANTIBODIES TO NEUTRALIZE INTERLEUKIN-10

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED

AS Assignment

Owner name: NEUVOGEN, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FERRARO, BERNADETTE;ARNDT, JUSTIN JAMES;BINDER, TODD MERRILL;AND OTHERS;SIGNING DATES FROM 20201210 TO 20210308;REEL/FRAME:056988/0203

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION