US20090291857A1 - Methods to identify inhibitors of the unfolded protein response - Google Patents

Methods to identify inhibitors of the unfolded protein response Download PDF

Info

Publication number
US20090291857A1
US20090291857A1 US12/280,794 US28079407A US2009291857A1 US 20090291857 A1 US20090291857 A1 US 20090291857A1 US 28079407 A US28079407 A US 28079407A US 2009291857 A1 US2009291857 A1 US 2009291857A1
Authority
US
United States
Prior art keywords
cells
xbp
compounds
irestatin
hypoxia
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/280,794
Other languages
English (en)
Inventor
Albert C. Koong
Douglas E. Feldman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Leland Stanford Junior University
Original Assignee
Leland Stanford Junior University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Leland Stanford Junior University filed Critical Leland Stanford Junior University
Priority to US12/280,794 priority Critical patent/US20090291857A1/en
Assigned to THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY reassignment THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FELDMAN, DOUGLAS E., KOONG, ALBERT C.
Assigned to THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY reassignment THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: FELDMAN, DOUGLAS E., KOONG, ALBERT C.
Publication of US20090291857A1 publication Critical patent/US20090291857A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D221/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00
    • C07D221/02—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00 condensed with carbocyclic rings or ring systems
    • C07D221/04—Ortho- or peri-condensed ring systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5041—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways

Definitions

  • the present invention relates generally to methods to identify inhibitors of the unfolded protein response.
  • Inhibitors identified by the instant methods are of use, for example, in the treatment of disorders characterized by cell growth in hypoxic conditions, such as cancers, in particular solid tumors.
  • the present invention includes methods to monitor the activity of IRE1 in cells under stress, in particular hypoxic stress.
  • a defining feature of solid tumors is their capacity to divide aggressively and disseminate metastases under conditions of nutrient deprivation and limited oxygen availability. These severe stresses arise from inadequate perfusion as the primary tumor rapidly outgrows its initial blood supply, and from dramatic structural abnormalities of tumor vessels that can lead to disturbed microcirculation (Hockel and Vaupel, Semin. Oncol. 28(2 Suppl 8):36-41, 2001; Vaupel, et al. Med. Oncol. 18:243-59, 2001). As a result, regions of low O 2 tension, or hypoxia, are heterogeneously distributed within the tumor mass. While tumor hypoxia is a physiological barrier to cell survival, it paradoxically drives malignant progression by imposing a powerful selective pressure for cells that can best adapt to this stress and subsequently resume cell division.
  • Tumor hypoxia also correlates with a more aggressive disease course and increased failure following radiation and chemotherapy.
  • the presence of hypoxia has been demonstrated in a wide variety of human cancers, including cervix, breast, lung, brain, pancreas, head and neck, and prostate (Evans S., & Koch C. Cancer Lett. 195:1-16, 2003). Many of these tumors contained regions of severe hypoxia ( ⁇ 5 mmHg oxygen). Clinically, the duration of disease- and progression-free survival correlates inversely with the degree of tumor hypoxia.
  • hypoxia has a profound impact on tumor growth and clinical outcome.
  • hypoxia-inducible factor a heterodimeric transcription factor that exerts control over a broad range of cellular pathways including glycolysis, angiogenesis and erythropoiesis
  • HIF hypoxia-independent, adaptive responses that contribute to increased survival under low oxygen conditions.
  • hypoxia an immediate reaction to hypoxia is a reduction in the rates of global protein synthesis, which reduces energy demands when oxygen and ATP levels are low (Hochachka et al., Proc. Natl. Acad. Sci. USA, 93:9493-8, 1996).
  • hypoxia causes a sharp increase in the expression of molecular chaperones, which assist in protein refolding and in the degradation of terminally misfolded conformers.
  • UCR unfolded protein response
  • the endoplasmic reticulum is an extensive intracellular membrane network that extends throughout the cytoplasm and functions primarily to process newly synthesized secretory and transmembrane proteins. Accumulation of unfolded proteins in this compartment causes ER stress, with prolonged ER stress resulting in cell death.
  • the cellular response to ER stress consists of at least two coordinated pathways: 1) rapid translational arrest mediated by PERK (pancreatic ER kinase or PKR-like ER kinase); and 2) transcriptional activation of unfolded protein response (UPR) target genes (Ron D. J. Clin. Invest. 110:1383-1388, 2002; Harding H., et al. Annu. Rev. Cell. Dev. Biol.
  • a critical feature of malignant tumors is their capacity to survive and seed distant metastases under conditions of nutrient deprivation and limited oxygen availability.
  • Hockel and Vaupel Seminars in Oncology 28: 36-41 (2001); Vaupel et al., Methods in Enzymology 381: 335-354 (2004); Subarsky and Hill, Clin Exp Metastasis 20: 237-250 (2003).
  • Intratumoral hypoxia arises solid tumors through severe structural abnormalities of tumor vasculature and disturbed microcirculation, resulting in tissue regions of extremely low O 2 partial pressures distributed heterogeneously within the tumor mass.
  • PERK an ER transmembrane protein
  • ATF4 activating transcription factor 4
  • PERK ⁇ / ⁇ MEFs where unable to phosphorylate eIF2 ⁇ and had decreased survival after exposure to hypoxia compared to the wild-type MEFs. They concluded that PERK plays an important role in hypoxia-induced translation attenuation, further supporting a role for hypoxia in the development of ER stress (Koumenis et al., Mol. Cell. Biol. 22:7405-7416 (2002)). A rapid decrease in de novo protein synthesis upon exposure to hypoxia has also been observed (Chen et al., Cancer Res. 64:7302-7310 (2004)). Downstream of PERK, ATF4 is also activated by hypoxia in a HIF-1 independent manner. One consequence of ATF4 activation is induction of a GADD34 which feeds back to desphosphorylate eIF2 ⁇ and release cells from translational inhibition.
  • the UPR In coordination with the inhibition of protein synthesis, the UPR is also responsible for the transcriptional activation of a discrete set of genes. These genes function to increase the cellular folding capacity through the induction of ER chaperone proteins and folding enzymes.
  • the UPR is a conserved stress response and many of its downstream target genes have been characterized in yeast and mammalian cells. In mammalian cells, activating transcription factor 6 (ATF6) and X-box binding protein (XBP1) are critical regulators of the transcriptional response to ER stress.
  • ATF6 activating transcription factor 6
  • XBP1 X-box binding protein
  • IRE1 The ER resident transmembrane protein IRE1 is conserved in throughout eukaryotic phylogeny and functions as both a proximal sensor of ER stress and as a critical UPR signal transducer via its dual cytoplasmic kinase and endoribonuclease domains. Tirasophon et al., Genes Dev 12: 1812-1824 (1998). Mammalian IREL1 ⁇ , the major functional homolog of yeast IREL1 ⁇ , excises a 26-nucleotide intron from the mRNA encoding the bZIP transcription factor XBP-1.
  • XBP-1s drives an expansion of ER capacity through the increased expression of molecular chaperones and components of the ER-associated protein degradation (ERAD) machinery that is required for the clearance of terminally misfolded proteins.
  • ESD ER-associated protein degradation
  • IRE1 ⁇ is extensively activated in hypoxic regions of human tumor xenografts throughout tumorigenesis (Feldman et al., Mol Cancer Res 3: 597-605 (2005)), and transformed mouse fibroblasts genetically deleted for XBP-1 exhibit increased sensitivity to hypoxia and fail to grow as tumors when implanted into immune-deficient mice (Romero-Ramirez et al., Cancer Research 64: 5943-5947 (2004)).
  • IRE1 ⁇ Activation of IRE1 ⁇ by ER stress triggers multiple signaling outputs that extend beyond the splice-activation of XBP-1, including IRE1 ⁇ endonuclease-mediated cleavage of a subset of mRNAs encoding secretory proteins (Hollien and Weissman, Science 313: 104-107 (2006)), and activation of autophagy and apoptosis pathways through the IRE1 ⁇ kinase domain and its downstream effectors caspase-12, ASK1, and JNK1 (Ogata et al., Mol Cell Biol (2006); Urano et al., Science 287: 664-666 (2000)).
  • IRE1 ⁇ may participate in both cytoprotective and pro-apoptotic pathways.
  • FIG. 1 A schematic of the UPR pathway is shown in FIG. 1 .
  • GRP78 regulates each of the major branches of the UPR by direct association with ATF6, IRE1 and PERK. Given its importance in regulating the UPR, GRP78 levels can be increased by downstream signaling from each of these pathways, indicating that significant overlap occurs in activation of the UPR.
  • UPR regulated genes such as GRP94 and protein disulfide isomerase (PDI) have also been implicated in mediating neuronal survival after ischemia/reperfusion injury (Sullivan D., et al., J. Biol. Chem. 278:47079-47088, 2003; Bando Y., et al., Eur. J. Neurosci. 18, 2003.).
  • oxygen regulated protein 150 kDal ORP150, also known as GRP170
  • GRP170 oxygen regulated protein 150 kDal
  • GRP170 another ER chaperone protein
  • the methods also fail to account for the effects of tumor microenvironment, such as, for example, hypoxia, on the activity of potential therapeutic compounds.
  • the methods also lack steps to counterscreen for compounds causing non-specific effects on the detectable marker and for compounds that are toxic to cells even in the absence of ER stress. The methods would therefore falsely identify compounds that have nothing to do with the UPR and that would be unsuitable for therapeutic use. Furthermore, the methods have not been shown to be suitable for use in high throughput screening assays.
  • inhibitors Due to the importance of the unfolded protein response in cellular metabolism, and, in particular, in pathological processes, there is great interest in developing inhibitors with defined specificities against this process. Such inhibitors can help to identify target enzymes in cells, particularly where the cells are associated with particular indications, and can provide new drug candidates. There is thus a need for inhibitors of the unfolded protein response and novel methods of inhibiting this pathway, as well as methods of treating or preventing disorders of the unfolded protein response and methods of identifying novel inhibitors of the pathway.
  • the present invention addresses these problems by providing novel methods to identify inhibitors of the unfolded protein response.
  • the invention provides methods comprising the steps of:
  • the mRNA fusion sequence comprises a first mRNA segment comprising an unprocessed XBP-1 transcription factor gene sequence and a second mRNA segment comprising a reporter gene sequence, and wherein the first mRNA segment is processed by IRE1 to form a frameshifted mRNA fusion sequence that is translatable by a cell to produce a detectable protein;
  • the library of compounds comprises at least 50, at least 100, at least 500, at least 1000, or at least 5000 different compounds.
  • the first array of cells comprises a microtiter plate.
  • the detectable protein is an enzyme
  • the enzyme is luciferase.
  • the detectable protein is a fluorescent protein.
  • the detectable protein is detected using an antibody.
  • the method further comprises the step of counterscreening the library of compounds to identify a compound that is not toxic to cells grown in air.
  • the method further comprises the step of stimulating the unfolded protein response prior to contacting the first array of cells with the library of compounds.
  • the unfolded protein response is stimulated by treatment of the cells with tunicamycin and thapsigargin.
  • the unfolded protein response is stimulated by treatment of the cells with hypoxic conditions.
  • the library of compounds comprises at least 50, at least 100, at least 500, at least 1000, or at least 5000 different compounds.
  • the first array of cells comprises a microtiter plate.
  • the detectable protein is an enzyme
  • the enzyme is luciferase.
  • the detectable protein is a fluorescent protein.
  • the detectable protein is detected using an antibody.
  • the method further comprises the step of counterscreening the library of compounds to identify a compound that is not toxic to cells grown in air.
  • the method further comprises the step of counterscreening the library of compounds to identify a compound that inhibits detection of the detectable protein.
  • the counterscreening step comprises the use of a second array of cells that constituitively express the detectable protein.
  • the library of compounds comprises at least 50, at least 100, at least 500, at least 1000, or at least 5000 different compounds.
  • the first array and second array each comprise a microtiter plate.
  • the detectable protein is an enzyme
  • the enzyme is luciferase.
  • the detectable protein is a fluorescent protein.
  • the detectable protein is detected using an antibody.
  • the method further comprises the step of counterscreening the library of compounds to identify a compound that is not toxic to cells grown in air.
  • the method further comprises the steps of stimulating the unfolded protein response prior to contacting the first array of cells with the library of compounds; and counterscreening the library of compounds to identify a compound that inhibits detection of the detectable protein.
  • the unfolded protein response is stimulated by treatment of the cells with tunicamycin and thapsigargin.
  • the unfolded protein response is stimulated by treatment of the cells with hypoxic conditions.
  • the counterscreening step comprises the use of a second array of cells that constituitively express the detectable protein.
  • the library of compounds comprises at least 50, at least 100, at least 500, at least 1000, or at least 5000 different compounds.
  • the first array and second array each comprise a microtiter plate.
  • the detectable protein is an enzyme
  • the enzyme is luciferase.
  • the detectable protein is a fluorescent protein.
  • the detectable protein is detected using an antibody.
  • the method further comprises the step of counterscreening the library of compounds to identify a compound that is not toxic to cells grown in air.
  • the invention provides methods to identify inhibitors of IRE1, wherein the processing by IRE1 is an RNA splicing reaction.
  • the invention provides methods to identify inhibitors of IRE1, wherein the compound inhibiting the activity of IRE1 inhibits the endonuclease activity of IRE1.
  • the method further comprises the step of counterscreening the library of compounds to identify a compound that is not toxic to cells grown in air.
  • the invention provides methods wherein the identifying step comprises comparing the amount of detectable protein in cells treated with the compound to the amount of detectable protein in untreated cells.
  • the cells in the first array of cells are cancer cells.
  • the cancer cells are solid tumor cells.
  • the solid tumor cells are selected from the group consisting of sarcoma cells, carcinoma cells, and lymphoma cells.
  • the cells are fibrosarcoma cells.
  • the cells are adenocarcinoma cells.
  • the cancer cells are selected from the group consisting of: multiple myeloma, cervical cancer, brain cancer, pancreatic cancer, head and neck cancers, prostate cancer, breast cancer, soft tissue sarcomas, primary and metastatic liver cancer, primary and metastatic lung cancer, esophageal cancer, colorectal cancer, lymphoma, and leukemia.
  • FIG. 1 is a schematic of the unfolded protein response (UPR) signaling pathway.
  • FIG. 2A is a schematic of a fusion protein in which unspliced XBP-1 is fused in frame with luciferase.
  • IRE1 splices a 26 nt sequence in XBP-1 causing a translational frameshift that allows read through of a stop codon, resulting in the production of an XBP-1-luciferase fusion protein.
  • FIG. 2B shows the fold change in luciferase activity (RLU), detected after 24 hours of exposure to hypoxia, when HT1080 cells stably expressing the IRE1 reporter are allowed to reoxygenate.
  • RLU luciferase activity
  • FIG. 3 is a schematic of an initial screen of a 66,000 small molecule library for specific inhibitors of XBP-1.
  • FIG. 4 shows a “heat map” view of a single plate from the primary screen for inhibitors of XBP-1.
  • FIG. 5A shows examples of individual compounds tested at 1 uM, 2 uM and 6 uM for inhibition of tunicamycin-(Tm) induced transactivation of a 5 repeat XBP-1 promoter element (5X-UPRE)-luciferase reporter construct transiently transfected into HT1080 cells.
  • FIG. 5B shows individual compounds tested for inhibition of hypoxia (48 hours) induced transactivation of the same UPRE-luciferase report construct transiently transfected into HT1080 cells.
  • 5X-UPRE 5 repeat XBP-1 promoter element
  • FIG. 6A shows XBP-1 expression as determined by RT-PCR in HT1080 cells treated with hypoxia in the presence of various candidate inhibitors compounds.
  • FIG. 6B shows the inhibition of XBP-luciferase reporter activity in hypoxia by the inventive irestatins.
  • HT1080 fibrosarcoma cells stably expressing the Xbp-luciferase reporter were treated with 1 ⁇ M of each Irestatin or left untreated, and incubated in hypoxia (0.01% of oxygen) for 48 hours at 37° C. Cells were harvested, lysed in reporter lysis buffer, and assayed for luminescence using a luminometer.
  • FIGS. 7A and B show the hypoxia-specific cytotoxicity of candidate IRE1 inhibitors on HT1080 sarcoma cells and MiaPACA-2 cells, respectively, as determined in a clonogenic survival assay.
  • FIG. 7C shows the inhibition of hypoxia survival of human tumor cells by candidate IRE1 inhibitors.
  • FIG. 8 shows the inhibition of IRE1-mediated XBP-1 splicing in hypoxia by the inventive irestatins.
  • FIGS. 9A-D illustrate the effects of administration of two different potential irestatins to nude mice implanted with HT1080 cells stably expressing XBP-1s-luciferase.
  • FIG. 9A shows bioluminescent activity prior to injection
  • FIG. 9B shows activity 8 hours after injection
  • FIG. 9C shows activity 24 hours after injection
  • FIG. 9D shows activity 8 hours after a second injection of the potential irestatins.
  • FIG. 10 shows the ability of the inventive irestatins to inhibit tumor growth in vivo in a mouse model. Dose: 60 mg/kg ip bolus injection every 48 hours. 5 total doses. 5-7 tumors per group. PANC1 pancreatic adenocarcinoma cell line.
  • FIG. 11 shows the inhibitory effects of Irestatin 9389 on the IRE1 ⁇ /XBP-1 pathway.
  • FIG. 12 shows the inhibitory effects of Irestatin 9389 on the endonuclease function of IRE1 ⁇ .
  • FIG. 13 shows that exposure to irestatin 9389 induces apoptosis and impairs cell survival under hypoxia and ER stress.
  • FIG. 14 shows the in vivo antitumor activity of irestatin 9389.
  • FIG. 15 shows expression of XBP-1s in human pancreas tissue specimens.
  • FIG. 16 shows histopathological analysis of mouse pancreas and liver tissues.
  • the present invention provides methods for identifying compounds that are capable of inhibiting the unfolded protein response, in particular the activity of IRE1.
  • Methods for identifying compounds that modulate activity of IRE1 comprise providing a construct in which a reporter gene (e.g., a gene encoding a detectable protein such as, for example, firefly luciferase, Renilla luciferase, beta-galactosidase, green fluorescent protein, red fluorescent protein, yellow fluorescent protein, thymidine kinase, or a protein detectable by the binding of a further detector molecule, such as an antibody) is fused downstream and in frame with unspliced XBP-1, and stably transfecting this construct into a cell line, for example a tumor cell line such as fibrosarcoma or pancreatic adenocarcinoma cell lines (e.g.
  • a reporter gene e.g., a gene encoding a detectable protein such as, for example, firefly
  • Panc1, MiaPaca and HT1080 or commonly used cell lines such as MDCK or HEK293.
  • the transformed cells are then subjected to ER stress, for example, by adding drugs known to cause ER stress, such as tunicamycin and/or thapsigargin, or subjected to hypoxia, thereby activating the unfolded protein response.
  • the cells are then incubated with a candidate inhibitor of the unfolded protein response, and the activity of the reporter gene in the treated cells is compared with that control, untreated, cells. If a reduction in reporter gene activity is observed, the candidate modulator is an inhibitor of the unfolded protein response, and in particular, of IRE1 activity.
  • the instant invention provides a method for identifying a compound as an inhibitor of IRE-1 activity, comprising:
  • methods are provided wherein a reduction in the activity of the reporter gene in the treated cells compared to the activity of the reporter gene in control, untreated cells, indicates that the test compound is an inhibitor of IRE1 activity, wherein the reporter gene is firefly luciferase, wherein the cells are tumor cells, wherein the cells are human fibrosarcoma cells, wherein ER stress is induced by contacting the transformed cells with a compound known to induce ER stress, wherein the compound is selected from the group consisting of: tunicamycin and thapsigargin, and wherein the ER stress is induced by subjecting the transformed cells to hypoxia.
  • compositions that contain one or more inhibitors of IRE1 activity may be effectively employed in the treatment of cancers, particularly those cancers characterized by the presence of moderate to severe hypoxia.
  • cancers include solid tumors and secretory cell malignancies, including multiple myeloma.
  • solid tumor cells include sarcomas, carcinomas, and lymphomas.
  • Cancers that may be effectively treated employing the inventive compositions include, for example, cervix, brain, pancreas, breast, head and neck, and prostate cancers, and soft tissue sarcomas. Accordingly, the methods for identifying inhibitors of IRE1 may make use of cells derived from any of the above cancers or tissues.
  • the methods of the instant invention take advantage of high throughput screening techniques.
  • the methods of the invention can be performed, for example, using common disposable laboratory assay platforms such as microtiter plates and microarray slides.
  • Microtiter plates and microarray slides suitable for use in the methods of the instant invention may conventionally contain, for example, 24, 96, 384, 768, or 1536 separate spots or wells. Alternative formats and sizes are, however, considered within the scope of the invention.
  • Each separate microarray spot or microtiter plate well may contain cells expressing, for example, a fusion of unprocessed XBP-1 and a detectable protein.
  • a microarray spot or microtiter plate well may contain control cells expressing the detectable protein alone or control cells lacking any expression construct.
  • the microarray spots or microtiter plate wells will further contain an appropriate culture medium for proper maintenance and/or growth of the cultured cells, as would be understood by one of skill in the art.
  • the detectable protein of the instant invention may be, for example, firefly luciferase, Renilla luciferase, ⁇ -galactosidase, green fluorescent protein, red fluorescent protein, yellow fluorescent protein, thymidine kinase, or a protein detectable by the binding of a further detctor molecule, such as an antibody.
  • the detectable protein may be ⁇ -galactosidase, alkaline phosphatase, horseradish peroxidase, exoglucanase, Bar1, Pho5 acid phosphatase, chitinase, or chloramphenicol acetyl transferase.
  • the detectable protein is an antigen that is specifically recognized by an antibody or fragment of an antibody that is itself detectable.
  • the detectable protein is luciferase.
  • the high throughput screening techniques disclosed herein permit the rapid analysis of large chemical libraries to identify inhibitors of the unfolded protein response, and in particular of the activity of IRE1.
  • the compound libaries screened according to the instant techniques may comprise, for example, at least 50, at least 100, at least 500, at least 1000, at least 5000 different compounds, or even more distinct compounds.
  • ER stress and the unfolded protein response may in some cases be stimulated in the cells of the instant methods prior to contacting the cells with the compounds of the compound library.
  • ER stress and the unfolded protein response may be stimulated in a variety of ways, any of which may be usefully employed in this aspect of the invention.
  • ER stress and the unfolded protein response is stimulated by treatment of the cells with tunicamycin and thapsigargin, either separately or in combination.
  • ER stress and the unfolded protein response is stimulated by treatment of the cells with hypoxic conditions. Other methods to cause ER stress and the unfolded protein response are likewise considered within the scope of this aspect of the invention.
  • the methods of the instant invention may in some embodiments include the step of counterscreening the library of compounds to identify those compounds that are not toxic to cells grown in the absence of ER stress or the unfolded protein response.
  • Such compounds would be expected to display an increased specificity of activity toward cells associated with a disease in which the UPR has been implicated, such as, for example, cancer, conformational diseases, diabetes, cardiovascular disease, atherosclerosis, viral infection, and cerebrovascular disease.
  • Compounds may be screened on cells grown in the absence of ER stress or the unfolded protein response by, for example, omitting tunicamycin and/or thapsigargin from the culture media. Alternatively, or in combination, compounds may be screened, for example, on cells grown in air.
  • Compounds displaying stronger inhibitory activity toward cells subjected to ER stress and the unfolded protein response and low toxicity toward cells in the absence of ER stress and the unfolded protein response would generally be of most interest for use as therapeutics.
  • the methods of the instant invention may likewise in some embodiments include the step of counterscreening the library of compounds to identify those compounds that inhibit detection of the detectable protein.
  • Such compounds could, for example, inhibit the activity of an enzyme or quench the fluorescence of a fluorescent protein used as the detectable protein.
  • such compounds could, for example, inhibit the binding of an antibody to the detectable protein and thus inhibit the detection of the protein.
  • Such counterscreens may, in some cases, make use of a second array of cells that constituitively express the detectable protein. Any effects of a compound on the detection of the detectable protein could therefore be identified in these cells. Such effects could be considered in assessing the therapeutic potential of the compound.
  • inhibitor compounds identified using the methods of the instant invention may be usefully employed in the treatment of disorders in which the UPR has been implicated, such as, for example, cancers characterized by the presence of moderate to severe hypoxia.
  • Cells used in the instant methods are therefore preferably cultured cells from tissues affected by these disorders, such as, for example, cultured cancer cells.
  • the cells of the instant methods may include cells from solid tumors and secretory cell malignancies, including multiple myeloma.
  • solid tumor cells useful in the methods of the instant invention include sarcomas, carcinomas, and lymphomas.
  • Other cultured cancer cells that may be usefully employed in the methods of the instant invention include, for example, cervix, brain, pancreas, breast, head and neck, prostate cancers, soft tissue sarcomas, primary and metastatic liver cancer, primary and metastatic lung cancer, esophageal cancer, colorectal cancer, lymphoma, and leukemia.
  • the cells are fibrosarcoma cells or adenocarcinoma cells.
  • UPR related genes represent a major class of genes that are transcriptionally induced under hypoxia, that XBP-1 is activated during hypoxia in a HIF-1 independent manner, and that cell survival and apoptosis under hypoxia was mediated by XBP-1 (Romero L., et al. Cancer Res. 64:5943-5947, 2004).
  • XBP-1 is essential for tumor growth.
  • MEFs mouse embryonic fibroblasts
  • XBP-1 expression was regulated using a tetracycline inducible XBP-1 shRNA expression vector.
  • XBP-1 expression was inhibited in the presence of doxycycline, allowing us to determine the effect of inhibiting XBP-1 on an established tumor.
  • doxycycline was added into the drinking water of tumor bearing mice when the tumors reached a size of 50-100 mm 3 .
  • doxycycline there was a significant delay in the growth of these tumors as compared to the controls.
  • pancreatic tumors were assessed for their clinical significance.
  • pancreatic tumors are ideal tumors for the development of hypoxia targeted therapies.
  • a high throughput screen for small molecule inhibitors of IRE1 activity was developed as detailed below.
  • the sequence for XBP-1 is described in, for example, Liou, H-C. et al. Science 247:1581-1584, 1990; and Yoshimura, T. et al. EMBO J. 9:2537-2542, 1990.
  • the amino acid sequence for unspliced XBP-1 protein is provided in SEQ ID NO: 1, with corresponding cDNA sequence being provided in SEQ ID NO: 3.
  • the amino acid sequence for the spliced form is provided in SEQ ID NO: 2.
  • luciferase was fused downstream and in frame with the unspliced form of XBP-1, containing the IRE-1 splice site.
  • the unspliced form no luciferase is translated because of an endogenous stop codon.
  • IRE1 a 26 nt sequence is spliced out by IRE1 resulting in a frame-shift and read-through of the stop codon (Iwawaki et al., Nat. Med. 10:98-102, 2004).
  • XBP1-luciferase fusion protein in which luciferase activity is detected only when XBP-1 is spliced by IRE1.
  • This construct was stably transfected into HT1080 cells (human fibrosarcoma cell line).
  • HT1080 cells human fibrosarcoma cell line.
  • luciferase activity detected after 24 hours of exposure to hypoxia, rapidly decreases when the HT1080 cells are allowed to reoxygenate, demonstrating that XBP-1 splicing is tightly controlled and largely restricted to hypoxic/ER stress conditions.
  • tumor cells were used to screen a 66,000 chemically diverse small molecule library for inhibitors of XBP-1 splicing (Stanford High Throughput Facility compound library, which contains compounds from: SPECS & BioSPECS (Wakefield R.I.), Chembridge (San Diego, Calif.), and ChemRx libraries (Disclovery Partners International, San Diego, Calif.)).
  • SPECS & BioSPECS Wakefield R.I.
  • Chem thapsigargin
  • Tg an inhibitor of ER Ca-ATPase
  • HT1080 fibrosarcoma cells stably transfected with the unspliced XBP-1-luciferase reporter construct (3000/well) were plated onto a solid white 384 well microplate with a multidrop dispenser (40 ⁇ L per well). The plates were then placed into an automated incubator. After 24 hours of growth, a mixture of tunicamycin (1 ⁇ g/ml) and thapsigargin (100 nM) inducers were added, and candidate compounds were then added to the plates. After 24 hours, luciferase reagent (10 ⁇ l) was added to each well and the plates were read in a Molecular Devices Analyst GT (0.2 second read per well). Compounds that blocked IRE1 activation showed reduced levels of luciferase activity compared to control wells.
  • FIG. 4 A “heat map” view of a single plate from the primary screen is shown in FIG. 4 .
  • HT1080 cells stably expressing the XBP1-luciferase construct described above were plated in 384 well format (4,000 cells/well) and a different compound was added robotically into each individual well. Compounds were selected for further testing based upon demonstrating >95% inhibition of luciferase activity.
  • the two lanes on the far left of FIG. 4 were negative controls (tunicamycin/thapsigargin alone) and the two lanes on the far right were positive controls (media alone).
  • FIG. 5A shows examples of compounds that were tested individually at 1 uM, 2 uM and 6 uM for inhibition of a UPRE-luciferase reporter following exposure to tunicamycin (Tm).
  • Tm tunicamycin
  • the luciferase reporter was under the control of 5 repeats of the XBP-1 promoter element (5X-UPRE).
  • FIG. 5B shows compounds that were tested for inhibition of hypoxia (48 hours) induced transactivation of the same UPRE-luciferase report construct transiently transfected into HT1080 cells.
  • HT1080 fibrosarcoma cells transiently transfected with a luciferase reporter under the control of 5 repeats of the XBP-1 promoter element (5X-UPRE) were treated with 1 ⁇ M of each irestatin or left untreated, and incubated in normoxia or hypoxia (0.1% oxygen) for 48 hrs at 37° C.
  • Cells were harvested, lysed in reporter lysis buffer, and assayed for luminescence using a luminometer. Fold induction is calculated as the luminesence in hypoxia divided by the normoxic luminescence value.
  • the irestatin used is identified by a four-digit number below each bar.
  • FIG. 6A Individual testing of the most promising compounds for inhibition of endogenous XBP-1 splicing ( FIG. 6A ) was also performed.
  • HT1080 cells were treated with hypoxia in the presence of various compounds and XBP-1 was amplified by RT-PCR. Not every compound inhibited XBP-1 splicing in this assay. Under aerobic conditions, only the unspliced form of XBP-1 XBP-1u) was detectable (lane 1). The spliced form of XBP-1 (XBP-1s) was detectable under hypoxia (lane 2). The ability of each individual compound to inhibit XBP-1 splicing was variable. In this set of compounds, only two were effective inhibitors of XBP-1 splicing (lanes 5 and 7). Interestingly, two compounds (lanes 3 and 4) resulted in inhibition of both the spliced and unspliced forms of XBP-1.
  • FIG. 6B shows the results of studies in which HT1080 fibrosarcoma cells stably expressing the XBP-luciferase reporter were treated with 1 uM of each irestatin or left untreated, and incubated in hypoxia (0.01% oxygen) for 48 hrs at 37° C. Cells were harvested, lysed in reporter lysis buffer, and assayed for luminescence using a luminometer.
  • FIG. 7A is an example of some of the candidate irestatins that demonstrated selective sensitization of HT1080 cells to hypoxia.
  • HT1080 fibrosarcoma cells stably were treated with 1 uM of the indicated irestatin or left untreated, and incubated in hypoxia (0.01% oxygen) for 48 hrs at 37° C. Cells were harvested and counted, and allowed to form colonies under normal oxygen tension. Survival rate is expressed as the fraction of colonies formed divided by the total number of cells seeded for each condition. For all experiments, cells were plated in triplicate, and all experiments were repeated at least three times.
  • FIG. 7C shows results of experiments demonstrating that candidate irestatins inhibit survival of human tumor cells in hypoxia.
  • PANC1 pancreatic adenocarcinoma cells were treated with 1 uM of the indicated irestatin or left untreated, and incubated in hypoxia (0.01% oxygen) for 48 hrs at 37° C. Cells were harvested and counted, and allowed to form colonies under normal oxygen tension. After 10-11 days, colony formation was analyzed by staining with crystal violet.
  • FIG. 8 shows the results of studies in which HT1080 fibrosarcoma cells were treated with 1 uM of each Irestatin or left untreated, and incubated in hypoxia (0.01% oxygen) for 24 hrs at 37° C.
  • Cells were harvested, lysed, and analyzed by Western blot using anti-XBP-1 antisera (lower panel) or anti-HIF-1 antisera (top panel) to confirm hypoxia exposure.
  • the results confirm that the tested irestatins inhibit IRE1 signaling and XBP-1 splicing during hypoxia.
  • XBP-1 splicing activity was undetectable 8 hrs after irestatin 3281 injection and became detectable within 16 hrs later. Following a second injection, XBP-1 splicing was again inhibited after 8 hrs.
  • a second candidate irestatin (5500) was tested in the same manner and did not have any affect on XBP-1 splicing, at least at the time points assayed.
  • inhibitors of the inventive inhibitors of IRE1 activity were examined in a mouse model as follows.
  • PANC1 pancreatic adenocarcinoma cells were implanted subcutaneously into nude mice. Mice were then given a bolus injection of one of the inventive irestatins (1401, 9337, 3611 or 9389) at a dose of 60 mg/kg every 48 hours for a total of 5 doses, with 5-7 tumors being treated per group. As shown in FIG. 10 , significant tumor growth was observed in untreated mice, but not in mice treated with the irestatins. These results indicate that the inventive irestatins may be effectively employed to inhibit tumor growth in vivo.
  • mice of IREla or XBP-1 causes embryonic lethality (Reimold et al., Genes Dev 14: 152-157 (2000); Harding et al., Mol Cell 7: 1153-1163 (2001)), and PERK and XBP-1 are required for the correct development of secretory organs such as the liver, pancreas and salivary gland (Lee et al., Embo J 24: 4368-4380 (2005); Zhang et al., Cell Metab 4: 491-497 (2006)).
  • the UPR is necessary for the survival of tissues exposed to physiological levels of ER stress during fetal and postnatal development.
  • the identification of small-molecule inhibitors provides an alternate strategy to inactivate IRE1 ⁇ , enabling a functional analysis of this core UPR component in diverse cell types, including transformed cells cultured under hypoxia. This approach can also yield potential drug leads that may be utilized to address whether inactivation of a core UPR component can be tolerated in animals and applied as an antitumor strategy.
  • HT1080 fibrosarcoma cells stably expressing the XBP-luciferase reporter were plated in a 384 well microplate (4000 cells/well). After 24 hours, cells were treated with a mixture of tunicamycin (4 ⁇ g/ml) and thapsigargin (0.4 ⁇ M), followed by the addition of one compound per well (10 ⁇ M). We screened a total of 66,000 diverse molecules obtained from Specs, Chembridge and ChemRX. Twenty-four hours post-induction, BriteGlo luciferase substrate (10 ⁇ l) was added to each well and the signal intensity determined in a plate reader (0.2 s read per well).
  • Hits were determined as compounds that significantly (>75%) inhibited activation of the XBP-luciferase signal by ER stress.
  • the human fibrosarcoma cell line HT1080 and myeloma cell line RPMI-8226 were obtained from American Type Culture Collection (ATCC, Manassas, Va.). Cells were maintained at 37° C. with 5% CO 2 in DMEM (HT1080) or RPMI 1640 media (RPMI-8226 cells) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin antibiotics. Rabbit polyclonal antisera raised against human XBP-1 and phospho-IRE1 ⁇ were a gift from Dr. Fumihiko Urano (University of Massachusetts, Worcester, Mass.).
  • N-terminally Flag-tagged, unspliced human XBP-1 (amino acids 1-208) was amplified by PCR using Pfx polymerase (Invitrogen, San Diego, Calif.). The PCR product was digested with EcoRI and BamHI, and subcloned into pEGFP-N1 (Clontech, Mountain View, Calif.) to generate pFlag-XBP1(1-208)-EGFP. This plasmid was subsequently digested with BamHI and Not I to remove EGFP.
  • Firefly luciferase containing BamHI and Not I sites was amplified by PCR and subcloned downstream of XBP-1 such that luciferase is translated only in the ‘spliced’ reading frame. All constructs were verified by sequencing.
  • Cells (2 ⁇ 10 6 ) were cultured in 10-cm dishes, collected using a cell scraper at 4° C., and lysed by addition of 150 ⁇ l cell lysis buffer [50 mM Tris pH 7.4, 150 mM NaCl, 10% glycerol, 0.5% Triton X-100. 0.5% NP-40, 2 mM Na 3 VO 4 , 20 mM beta-glycerophosphate, 10 mM NaF, 1 mM DTT, 1 mM PMSF). Lysates were centrifuged for 5 min at 10,000 ⁇ g, and proteins ( ⁇ 40 ⁇ g) were resolved by SDS-PAGE followed by semi-dry transfer to nitrocellulose membranes.
  • 150 ⁇ l cell lysis buffer [50 mM Tris pH 7.4, 150 mM NaCl, 10% glycerol, 0.5% Triton X-100. 0.5% NP-40, 2 mM Na 3 VO 4 , 20 mM beta-glycerophosphate, 10
  • Membranes were blocked in TBS-5% milk supplemented with 0.1% Tween-20. The blots were then probed overnight with relevant antibodies, washed, and incubated for 2 hours with species-specific secondary antibodies conjugated to horseradish peroxidase. After washing in block solution, immunoreactive material was detected by enhanced chemiluminescence (SuperSignal West Dura Extended, Pierce, Inc., Rockville, Ill.).
  • HT1080 cells stably expressing the XBP-luciferase construct were grown in 60 mm dishes to 60-70% confluency. Following hypoxia treatment, cells were washed twice with PBS, lysed in 400 ⁇ l 1 ⁇ reporter lysis buffer (RLB) (Promega, Madison Wis.) for 30 min at 24° C. Lysates (100 ⁇ l) were mixed with an equal volume of luciferase substrate (Promega), and assayed using a luminometer.
  • RLB reporter lysis buffer
  • RNA was resolved on a 1% agarose-formaldehyde gel.
  • 32 P-labeled probes were prepared using the Rediprime II random-prime labeling kit (GE-Amersham, Buckinghamshire, UK). The primers used to PCR amplify probes are as follows. P58 IPK : 5′GTGGCCCCCGGCTCCGTGACCAGCCGGCTGGGCTCGGTA 3′ (SEQ ID NO: 4); 5′ ACGCTTCAGTATTATCATTCTTCAACTTTGACGCAGCTTT 3′ (SEQ ID NO: 5).
  • DER-1 5′ GTCGGACATCGGAGACTGGTTCAGGAGCATCCCGGCGAT 3′ (SEQ ID NO: 6); 5′TCCTACTGGGCAGCCAGCGGTACAAAAACTGAGGGTGTGG 3′ (SEQ ID NO: 7). Blots were incubated with probe overnight, washed three times in 2 ⁇ SSC/0.2% SDS, dried, and exposed to a phosphorimager screen overnight. Images were analyzed using ImageQuant software (Molecular Dynamics).
  • IRE1 ⁇ -cyto The in vitro ribonuclease assays were carried out using purified IRE1 ⁇ -cyto essentially as described. Gonzalez and Walter, Methods Mol Biol 160: 25-36 (2001); Gonzalez et al., Embo J 18: 3119-3132 (1999).
  • 5 ⁇ g purified IRE1 ⁇ -cyto was incubated with 300 ng of fluorescein-labeled RNA stem-loop substrate at 37° C. in a total volume of 300 ⁇ l. Aliquots (50 ⁇ l) were withdrawn at the indicated times and mixed with an equal volume of stop solution. Id. Reactions were analyzed by SDS-PAGE using 10-20% acrylamide gradient gels.
  • RNAse A cleavage assay 300 ng of labeled XBP-1 RNA substrate were incubated with 1 ng bovine RNAse A (Sigma) in the presence of RNAsin (40 units), irestatin 9389 (2 ⁇ M) or DMSO vehicle control at 30° C. for the indicated times.
  • Tumor-bearing mice were injected i.p. with hypoxyprobe (50 mg/kg) 1 hour prior to sacrifice. Mice were euthanised under anesthesia by cervical dislocation, and tumors were surgically resected, embedded in OCT compound (Sakura Tissue Tek), and frozen at ⁇ 80° C. Tumors were sectioned at 8 ⁇ m, fixed in 4% paraformaldehyde, and blocked in PBS-4% BSA. Tissue sections were incubated overnight in block solution containing antisera specific for hypoxyprobe (1:250) and cleaved caspase-3 (1:400).
  • CBC's Complete blood counts
  • H&E hematoxylin and eosin
  • hypoxia survival assays cells were grown in 60 mm dishes until reaching at 50-70% confluence and shifted to hypoxia (0.1% O 2 ) for 48 hrs. Cells were trypsinized, counted using a hemocytometer, and replated in triplicate at 1,000-20,000 cells per plate in normal culture medium. After 10-12 days of growth under normal oxygen conditions, colonies were stained with 0.2% crystal violet in ethanol and counted. Survival values are expressed as the number of colonies divided by the total number of cells seeded for each condition, normalized to the plating efficiency under normal oxygen conditions. At least three independent experiments were performed.
  • HT1080 fibrosarcoma cells (2 ⁇ 10 6 ) stably expressing the XBP-luciferase reporter were implanted s.c. into severe combined immune deficient (SCID) mice.
  • SCID severe combined immune deficient mice
  • mice were injected i.p. with D-luciferin (150 mg/kg) solubilized in PBS.
  • Optical bioluminescence imaging was performed using the IVIS charged-coupled device camera system (Caliper Life Sciences, Hopkinton, Mass.). Mice were imaged for 1-4 minutes per acquisition scan. Signal intensities were analyzed using Living Image software (Caliper).
  • FIG. 11 shows the identification of Irestatin 9389 as a potent inhibitor of the IRE1 ⁇ /XBP-1 pathway.
  • A XBP-luciferase reporter construct. Firefly luciferase was inserted downstream of the IRE1 ⁇ splice site in human XBP-1 to enable the conditional translation of luciferase under ER stress in an IRE1 ⁇ -dependent manner.
  • B Selective inhibition of the XBP-luciferase reporter by irestatin 9389.
  • HT1080 human fibrosarcoma cells stably expressing the XBP-luciferase reporter or CMV-luciferase were cultured in the presence of Tm (4 ⁇ g/ml) and Tg (0.4 ⁇ M) and irestatin 9389 at the indicated concentrations. After 24 hours, luciferase activity was analyzed in an automated plate reader. For each cell line, values are expressed as the percent inhibition of the median for Tm/Tg-treated wells, corrected for background.
  • D XBP-luciferase reporter assay.
  • HT1080 cells stably expressing the XBP-luciferase reporter were exposed to Tm (4 ⁇ g/ml) for 24 hours or hypoxia (0.1% oxygen) for 24 or 48 hours, in the presence of DMSO or irestatin 9389 (1 ⁇ M) as indicated. Values are expressed as the fold increases over uninduced levels.
  • HT1080 cells were left untreated (lane 2) or exposed to Tm (4 ⁇ g/ml) for 20 hours in the presence of DMSO vehicle (lane 1) or the indicated irestatins (2 ⁇ M; lanes 3-6). Cell lysates were resolved by SDS-PAGE and immunoblotting using antisera specific for XBP-1s (top panel) or actin and GAPDH (bottom panel) as loading controls.
  • G. Irestatin 9389 blocks the accumulation of XBP-1s under hypoxic conditions.
  • HT1080 cells were treated with DMSO or exposed to irestatin 9389 (2 ⁇ M; lane 3) in normoxia (N) or under hypoxia for 24 hours (H 24; lanes 2,3). Cells were harvested, lysed, and analyzed by immunoblotting with antisera specific for HIF-1 ⁇ (top), XBP-1s (middle) or actin (bottom). H. Northern blot analysis of XBP-1s transcription targets. Cells were exposed to Tm (4 ⁇ g/ml) or hypoxia for 24 hours (H 24) in the absence or presence of irestatin 9389 (2 ⁇ M). Total RNA was analyzed by Northern blotting using radiolabeled probes specific for P58 IPK or DER-1. Total rRNA is shown as loading control.
  • FIG. 12 shows that irestatin 9389 inhibits the endonuclease function of IRE1 ⁇ .
  • Irestatin 9389 does not modulate the expression of Grp78.
  • HT1080 cells were exposed to DMSO vehicle (lane 1), irestatin 9389 (2.5 ⁇ M; lane 2) for 16 hours or Tm (5 ⁇ g/ml; lane 3) for 8 hours. Following treatments, cells were harvested, lysed, and analyzed by immunoblotting using anti-Grp78 antibody (top) or anti-actin (bottom) as a loading control.
  • HT1080 cells were preincubated for 16 hours with either vehicle or irestatin 9389 (2.5 ⁇ M), followed by addition of Tm (5 ⁇ g/ml) for the indicated times.
  • Cell lysates were analyzed by Western immunoblotting using anti-IRE1 ⁇ (bottom) or anti-phospho-IRE1 ⁇ antibodies (top).
  • HT1080 cells were untreated (lane 1), exposed to TNF- ⁇ (10 ng/ml, 10 min), or Tm (4 ⁇ g/ml, 1.5 hrs) (lanes 3-8) following a 2 hour preincubation in the presence of vehicle (lane 3) or the indicated irestatins (2.5 ⁇ M; lanes 4-8).
  • IRE1 ⁇ -cytosolic 6x-His-IRE1 ⁇ -cyto containing the IRE1 ⁇ kinase and endonuclease was expressed in bacteria (lane 1) and isolated by Nickel resin affinity chromatography to >95% purity (lane 2).
  • RNA minisubstrate 300 ng
  • RNA minisubstrate 300 ng
  • His6-IRE1 ⁇ -cyto 5 ⁇ g
  • vehicle or irestatin 9389 2.5 ⁇ M
  • the reactions were stopped at the indicated times and reaction aliquots were resolved by SDS-PAGE and visualized by UV illumination.
  • F Quantification of RNA cleavage kinetics. Results represent the mean from 3 independent experiments +/ ⁇ SEM.
  • RNAse A 1 ng was exposed for the indicated times to RNAse A (1 ng) in the presence of either RNAse inhibitor (40 units), irestatin 9389 (2.5 ⁇ M), or vehicle only for the indicated times. Samples were analyzed as in (E).
  • FIG. 13 shows that exposure to irestatin 9389 induces apoptosis and impairs cell survival under hypoxia and ER stress.
  • A Effect of irestatin 9389 on PERK and ATF6 pathways.
  • HT1080 cells were treated with vehicle alone (lanes 1-4) or 2.5 ⁇ M irestatin 9389 (lanes 5-8) and cultured under aerobic conditions for 18 hours (N) or shifted to hypoxia for the indicated times.
  • Protein lysates were analyzed by Western blot analysis using antisera specific for ATF6 (top), CHOP/GADD153 (middle) or actin (bottom). Arrow indicates the cleaved, transcriptionally active form of ATF6.
  • B Effect of irestatin 9389 on PERK and ATF6 pathways.
  • HT1080 cells were treated with vehicle alone (lanes 1-4) or 2.5 ⁇ M irestatin 9389 (lanes 5-8) and cultured under aerobic conditions for 18 hours (N) or shifted to
  • HT1080 cells were cultured in normoxia (N) or under hypoxia for 36 hours (H 36) in absence or presence of irestatin 9389 (2.5 ⁇ M). Arrows indicate proteolytically cleaved caspase-3.
  • D Quantification of clonogenic survival assay. Values represent the mean+/ ⁇ SEM from at least 4 independent experiments.
  • F Quantification of TUNEL-positive cells. Values represent the mean+/ ⁇ SEM from at least 3 experiments.
  • FIG. 14 shows the in vivo antitumor activity of irestatin 9389.
  • Irestatin 9389 impairs IREla activity in implanted tumor xenografts. Equal numbers (2 ⁇ 10 6 ) of XBP-luciferase or CMV-luciferase reporter cells were implanted s.c. into SCID mice. After one week, mice were treated with irestatin 9389 (50 mg/kg), followed by optical bioluminescence imaging.
  • B Inhibition of tumor growth by irestatin 9389.
  • HT1080 s.c. tumor xenografts were established in SCID mice and allowed to reach a mean volume of 150 mm 3 before treatment.
  • Irestatin 9389 50 mg/kg or vehicle control was administered q 2d by i.p. injection and continued for 2 weeks, for a total of 6 doses.
  • Tumor volumes were calculated based on caliper measurements taken every 3-5 days. Data points represent the mean volume calculated from at least 7 tumors per group, with SEM shown in one direction. Mean mouse weights +/ ⁇ SEM are shown in bottom graph. C.
  • Tissue sections prepared from cryo-preserved tumors following 3 doses with either vehicle control or irestatin 9389 were immunostained using hypoxyprobe (pimonidazole) or antisera specific for cleaved caspase-3.
  • D. Quantification of tumor immunohistochemistry At least 8 randomly chosen fields (>300 cells/field) per tumor were scored for pimonidazole and cleaved caspase-3 staining. A minimum of 3 tumors (250-300 mm 3 at harvest) were analyzed per treatment group. Values represent mean+/ ⁇ SEM.
  • FIG. 15 shows the expression of XBP-1s in human pancreas tissue specimens. Tissues surgically recovered from normal pancreas, chronic pancreatitis, or pancreatic tumors were sectioned and stained using antisera specific for XBP-1s (400 ⁇ magnification). Images were scored on the basis of staining intensity and quantified as shown in the table.
  • FIG. 16 shows the histopathological analysis of mouse pancreas and liver tissues.
  • Pancreas and liver specimens recovered from mice treated with three doses of either vehicle (top) or irestatin 9389 (50 mg/kg; bottom) were sectioned and stained with hematoxylin and eosin.
  • a HT1080 fibrosarcoma cell line stably expressing a fusion of unprocessed XBP-1 inserted upstream of firefly luciferase has been developed to identify small molecule inhibitors of the IRE1 ⁇ /XBP-1 signaling module.
  • IRE1 ⁇ catalyzes the removal of a 26-nt intronic sequence from the XBP-1 mRNA, introducing a shift in reading frame that allows for the translation of luciferase ( FIG. 11A ).
  • irestatin 9389 Exposure to irestatin 9389 also diminished activation of the XBP-luciferase reporter under hypoxia for 24 or 48 hours. Whereas control (DMSO-treated) cells increased XBP-luciferase activity by 95-fold after 48 hours of hypoxia, the addition of irestatin 9389 robustly inhibited this response ( FIG. 11D , right panel).
  • HT1080 cells were transfected with a firefly luciferase reporter under the transcriptional control of 5 tandem repeats of the unfolded protein response element (5X-UPRE), a canonical DNA binding site for XBP-1s identified in the promoter regions of XBP-1 target genes.
  • 5X-UPRE unfolded protein response element
  • luciferase activity increased by ⁇ 12-fold over untreated cells, while cells exposed to both Tm and irestatin 9389 exhibited less than a 4-fold induction ( FIG. 11E ).
  • Irestatin 9389 also robustly inhibited UPRE promoter activity under hypoxic conditions. After 48 hours of hypoxia, vehicle-treated cells increased luciferase activity by 170-fold, while the addition of irestatin 9389 diminished this response by more than 90% ( FIG. 11E , right panel).
  • western immunoblot analysis demonstrated that irestatin 9389 blocked the accumulation of XBP-1s following treatment with Tm, while structurally unrelated irestatin candidates exhibited little or no effect ( FIG.
  • irestatin 9389 decreased levels of XBP-1s following 24 hours of hypoxia ( FIG. 11G ), while the expression of HIF-1 ⁇ , a hypoxia-inducible transcription factor that functions independently of the UPR (Romero-Ramirez et al., Cancer Research 64: 5943-5947 (2004)), was not affected by irestatin 9389 ( FIG. 11G , top panel).
  • irestatin 9389 specifically blocks the production or accumulation of XBP-1s following ER stress and diminishes the expression of its downstream effectors.
  • HT1080 cells were incubated with vehicle or irestatin 9389 (2.5 ⁇ M) for 16 hours, followed by western immunoblot analysis using Grp78 antisera.
  • As a positive control cells were treated with Tm for 8 hours, which robustly induced Grp78 ( FIG. 12A , lane 3).
  • irestatin 9389 had no effect on Grp78 levels ( FIG. 12A ) at 16 hours or following longer treatments of 24 or 36 hours (data not shown).
  • cells incubated in the presence of irestatin 9389 for 16 hours exhibited no significant changes in the total level of IRE1 ⁇ , as judged by Western immunoblotting ( FIG. 12B , lower panel).
  • IRE1 ⁇ kinase Activation of IRE1 ⁇ is preceded by ATP binding and autophosphorylation, and the IRE1 ⁇ kinase is required for endonuclease activity. Tirasophon et al., Genes & Development 14:2725-2736 (2000).
  • irestatin 9389 inhibits the IRE1 ⁇ kinase
  • HT1080 cells were preincubated for 16 hours with irestatin or vehicle followed by addition of Tm to induce ER stress. Cells were then harvested at regular intervals, and activation of the IRE1 ⁇ kinase was assessed by immunoblotting using anti-phospho-IRE1 ⁇ antisera.
  • RNA hairpin corresponding to the 3′ intron-exon boundary of human XBP-1 serves as a cleavage substrate for the IRE1 ⁇ nuclease. Because the isolated IRE1 ⁇ endonuclease lacks significant catalytic activity (Dong et al., RNA 7: 361-373 (2001); Nock et al., Methods Enzymol 342: 3-10 (2001); D. F. and A.
  • irestatin is not a general ribonuclease inhibitor, as a >100-fold molar excess of irestatin 9389 failed to inhibit degradation of the XBP-1 3′ intronic loop by RNAse A ( FIG. 11G ).
  • irestatin 9389 functions as a selective inhibitor of the IRE1 ⁇ endoribonuclease without impairing IRE1 ⁇ kinase function.
  • IRE1 ⁇ Activation of IRE1 ⁇ alleviates ER stress through the splice-activation of XBP-1 and by the co-translational cleavage of mRNAs encoding secreted proteins. Hollien and Weissman, Science 313: 104-107 (2006).
  • ATF6 and PERK Two other major UPR pathways
  • irestatin 9389 had a minimal effect on the survival of hypoxic cells expressing Flag-XBP-1s ( FIG. 13H ).
  • inhibition of the IRE1 ⁇ /XBP-1s signaling module, and not an off-pathway effect of the irestatin is primarily responsible for the poor survival of irestatin-treated tumor cells under hypoxia.
  • exposure to irestatin 9389 also strongly inhibited the growth of the myeloma cell line RPMI 8226, a secretory plasmacytoma, in a dose-dependent manner ( FIG. 13I , right panel).
  • irestatin 9389 In contrast, exposure to the same concentrations of irestatin 9389 had a negligible effect on the growth rate of HT1080 cells cultured under normal conditions ( FIG. 13I , left panel). We conclude that irestatin 9389 selectively impairs the growth and survival of a variety of transformed cell types subjected to mechanistically distinct forms of ER stress.
  • IRE1 ⁇ signaling could impact tumor growth.
  • >50% (16/30) of surgically resected human pancreatic adenocarcinoma specimens exhibited moderate or strong immunoreactivity for XBP-1s.
  • XBP-1s was not detected in normal pancreas specimens (0/20), and infrequently observed in chronic pancreatitis (1/29) ( FIG. 15 ).
  • Vehicle Irestatin 9389 mean SEM mean SEM Chemistry Panel Glucose mg/dL 112.5 20.56696 124.5 7.14 AST IU/L 107.6 22.92408 117.775 14.25 ALT IU/L 30 10.15513 29.4 6.68 Total Bilirubin mg/dL 0.525 0.287228 0.3 0 Cholesterol mg/dL 102.25 8.261356 102 8.8 Electrolyte Panel Sodium mM 151.5 2.12132 152.25 1.89 Potassium mM 7.875 0.388909 7.5175 0.49 Chloride mM 116 1.414214 116.75 2.22 Carbon Dioxide mM 22.55 0.777817 25.075 0.71 Na/K Ratio mM 19.25 1.202082 20.325 1.36 Anion Gap mM 20.9 0.565685 17.975 0.71 Complete Blood Count WBC K/uL 5.55 1.340398 5.19
  • Severe hypoxia triggers the accumulation of misfolded proteins in the ER (Koumenis et al., Molecular & Cellular Biology 22: 7405-7416 (2002)), a potentially lethal condition that is remedied through the action of the UPR.
  • Irestatins therefore define a novel category of ER stress-selective antitumor agents specifically targeted to the underlying physiological response of tumor cells to the tumor microenvironment.
  • irestatin 9389 potently blocks the induction of the XBP-1 targets DER-1 and P58 IPK , essential components of the ERAD machinery that mediate clearance of misfolded proteins from the ER.
  • Inhibition of the UPR may also sensitize tumors to vascular targeting agents or anti-angiogenic drugs, which increase the fraction of hypoxic or nutrient-deprived tumor tissues (El-Emir et al., Eur J Cancer 41: 799-806 (2005); Boyle and Travers, Anticancer Agents Med Chem 6: 281-286 (2006); Dong et al., Cancer Research 65: 5785-5791 (2005)), or to radiation therapy, which preferentially kills oxygenated cell populations (Vaupel et al., Medical Oncology 18: 243-259 (2001); Vaupel et al., Seminars in Oncology 28: 29-35 (2001)).
  • proteasome inhibitors such as bortezomib (Velcade) have been shown to cause ER stress, while also inhibiting the UPR.
  • bortezomib Velcade
  • a combination of an irestatin and one or more proteasome inhibitors may exhaust the protective capacity of the UPR, pushing tumor cells into a decompensated state and ultimately cell death.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Transplantation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
US12/280,794 2006-02-27 2007-02-27 Methods to identify inhibitors of the unfolded protein response Abandoned US20090291857A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/280,794 US20090291857A1 (en) 2006-02-27 2007-02-27 Methods to identify inhibitors of the unfolded protein response

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US77745806P 2006-02-27 2006-02-27
PCT/US2007/062918 WO2007101225A2 (fr) 2006-02-27 2007-02-27 Procedes permettant d'identifier les inhibiteurs de reponse aux proteines depliees
US12/280,794 US20090291857A1 (en) 2006-02-27 2007-02-27 Methods to identify inhibitors of the unfolded protein response

Publications (1)

Publication Number Publication Date
US20090291857A1 true US20090291857A1 (en) 2009-11-26

Family

ID=38459802

Family Applications (3)

Application Number Title Priority Date Filing Date
US12/280,793 Expired - Fee Related US8372861B2 (en) 2006-02-27 2007-02-27 Inhibitors of the unfolded protein response and methods for their use
US12/280,794 Abandoned US20090291857A1 (en) 2006-02-27 2007-02-27 Methods to identify inhibitors of the unfolded protein response
US13/764,200 Abandoned US20130150399A1 (en) 2006-02-27 2013-02-11 Inhibitors of the unfolded protein response and methods for their use

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US12/280,793 Expired - Fee Related US8372861B2 (en) 2006-02-27 2007-02-27 Inhibitors of the unfolded protein response and methods for their use

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/764,200 Abandoned US20130150399A1 (en) 2006-02-27 2013-02-11 Inhibitors of the unfolded protein response and methods for their use

Country Status (5)

Country Link
US (3) US8372861B2 (fr)
EP (1) EP1999303A4 (fr)
AU (2) AU2007220039A1 (fr)
CA (2) CA2638734A1 (fr)
WO (2) WO2007101225A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120028933A1 (en) * 2010-07-28 2012-02-02 Baust John M Cell Culture Media Supplement and Method of Molecular Stress Control
WO2013160291A2 (fr) 2012-04-23 2013-10-31 Imba - Institut Für Molekulare Biotechnologie Gmbh Archéase en tant que membre d'un complexe d'arn ligase
US20150018406A1 (en) * 2012-03-09 2015-01-15 Cornell University Modulation of breast cancer growth by modulation of xbp1 activity
US8993617B2 (en) 2010-11-10 2015-03-31 The Board Of Trustees Of The Leland Stanford Junior University Ire1alpha endonuclease specific inhibitor with cytotoxic activity
US20160237429A1 (en) * 2013-09-25 2016-08-18 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US9956236B2 (en) 2011-02-07 2018-05-01 Cornell University Methods for increasing immune responses using agents that directly bind to and activate IRE-1

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2007220039A1 (en) 2006-02-27 2007-09-07 The Board Of Trustees Of The Leland Stanford Junior University Inhibitors of the unfolded protein response and methods for their use
CN102015606B (zh) 2007-06-08 2015-02-04 满康德股份有限公司 IRE-1α抑制剂
CA2749947A1 (fr) * 2009-01-30 2010-08-05 Bayer Healthcare Llc Methodes de traitement de cancer positif aux recepteurs oestrogeniques par inhibition de la proteine de liaison a la boite x 1 (xbp1)
ES2782357T3 (es) 2009-11-03 2020-09-14 Fosun Orinove Pharmatech Inc Inhibidores de IRE 1 alfa
WO2012138715A2 (fr) * 2011-04-04 2012-10-11 Georgetown University Inhibiteurs à petites molécules de l'épissage de xbp1
CA2832680A1 (fr) * 2011-04-13 2012-10-18 Eric Ogier-Denis Procedes de criblage et compositions pharmaceutiques pour le traitement de syndromes abdominaux inflammatoires
WO2014052669A1 (fr) 2012-09-26 2014-04-03 The Regents Of The University Of California Modulation de ire1
WO2015002729A2 (fr) 2013-06-13 2015-01-08 Biomatrica, Inc. Stabilisation de cellules
KR101643281B1 (ko) * 2014-01-15 2016-08-11 한국원자력의학원 벤조[ｄ]옥사졸 유도체를 유효성분으로 함유하는 항암활성 보조제
US9447054B2 (en) * 2014-01-15 2016-09-20 Korea Institute Of Radiological & Medical Sciences Anticancer supplement agent including benzo[D]oxazol derivative as effective ingredient
EA031804B1 (ru) 2014-02-03 2019-02-28 Вайтаи Фармасьютиклз, Инк. Дигидропирролопиридиновые ингибиторы ror-гамма
WO2015178770A1 (fr) * 2014-05-19 2015-11-26 Stichting Het Nederlands Kanker Instituut Compositions pour le traitement du cancer
JP6564029B2 (ja) 2014-10-14 2019-08-21 ヴァイティー ファーマシューティカルズ，エルエルシー Ｒｏｒ−ガンマのジヒドロピロロピリジン阻害剤
US9663515B2 (en) 2014-11-05 2017-05-30 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
US9845308B2 (en) 2014-11-05 2017-12-19 Vitae Pharmaceuticals, Inc. Isoindoline inhibitors of ROR-gamma
WO2016081599A1 (fr) * 2014-11-18 2016-05-26 Rutgers, The State University Of New Jersey Nouveaux découplants mitochondriaux pour le traitement de maladies métaboliques et du cancer
ES2856931T3 (es) 2015-08-05 2021-09-28 Vitae Pharmaceuticals Llc Moduladores de ROR-gamma
EP3377482B1 (fr) 2015-11-20 2021-05-12 Vitae Pharmaceuticals, LLC Modulateurs de ror-gamma
TW202220968A (zh) 2016-01-29 2022-06-01 美商維它藥物有限責任公司 ＲＯＲ－γ調節劑
JP7017523B2 (ja) 2016-05-18 2022-02-08 ラットガーズ、ザ ステート ユニバーシティ オブ ニュージャージー 代謝性疾患および癌の治療のための新規のミトコンドリア脱共役剤
US9481674B1 (en) 2016-06-10 2016-11-01 Vitae Pharmaceuticals, Inc. Dihydropyrrolopyridine inhibitors of ROR-gamma
EP3548035A4 (fr) 2016-11-30 2020-07-22 Case Western Reserve University Combinaisons d'inhibiteurs de 15-pgdh avec des corcostéroïdes et/ou des inhibiteurs du tnf et leurs utilisations
WO2018145080A1 (fr) 2017-02-06 2018-08-09 Case Western Reserve University Compositions et procédés de modulation de l'activité de la déshydrogénase à chaîne courte
US10392367B2 (en) 2017-06-01 2019-08-27 Quentis Therapeutics, Inc. IRE1 small molecule inhibitors
US20180346446A1 (en) 2017-06-01 2018-12-06 Quentis Therapeutics, Inc. Ire1 small molecule inhibitors
AR112461A1 (es) 2017-07-24 2019-10-30 Vitae Pharmaceuticals Inc PROCESOS PARA LA PRODUCCIÓN DE SALES Y FORMAS CRISTALINAS DE INHIBIDORES DE RORg
WO2019018975A1 (fr) 2017-07-24 2019-01-31 Vitae Pharmaceuticals, Inc. Inhibiteurs de ror gamma
US11525165B2 (en) 2017-12-20 2022-12-13 Inserm Method of selection of an IRE1-inhibitor therapy for patient suffering from cancer
WO2019232384A1 (fr) * 2018-06-01 2019-12-05 Promega Corporation Inhibiteurs de complexes bioluminescents dérivés de la luciférase oplophorus
CN109574920B (zh) * 2018-12-25 2022-03-04 药大制药有限公司 3-腈基-6环丙基吡啶类ido1抑制剂及其用途

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4172896A (en) * 1978-06-05 1979-10-30 Dainippon Pharmaceutical Co., Ltd. Methane-sulfonamide derivatives, the preparation thereof and composition comprising the same
US5358970A (en) * 1993-08-12 1994-10-25 Burroughs Wellcome Co. Pharmaceutical composition containing bupropion hydrochloride and a stabilizer
US5427798A (en) * 1992-08-14 1995-06-27 Burroughs Wellcome Co. Controlled sustained release tablets containing bupropion
US5541231A (en) * 1993-07-30 1996-07-30 Glaxo Wellcome Inc. Stabilized Pharmaceutical
US5731000A (en) * 1993-07-30 1998-03-24 Glaxo Wellcome Inc. Stabilized pharmaceutical composition containing bupropion
US5958703A (en) * 1996-12-03 1999-09-28 Glaxo Group Limited Use of modified tethers in screening compound libraries
US6110973A (en) * 1998-01-29 2000-08-29 Sepracor Methods for treating obesity and weight gain using optically pure (-)-bupropion
US20030049701A1 (en) * 2000-09-29 2003-03-13 Muraca Patrick J. Oncology tissue microarrays
US20030224428A1 (en) * 2002-04-12 2003-12-04 David Ron Method of screening test substances for treating or preventing a disease mediated by plasma cells
US20060041006A1 (en) * 2004-05-06 2006-02-23 Ibrahim Prabha N PDE4B inhibitors and uses therefor
US20060247320A1 (en) * 2005-03-09 2006-11-02 Schering Corporation Compounds for inhibiting KSP kinesin activity

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997031113A1 (fr) * 1996-02-23 1997-08-28 Ariad Pharmaceuticals, Inc. Essai a base de cellules
US20040170622A1 (en) * 2002-08-30 2004-09-02 President And Fellows Of Harvard College Methods and compositions for modulating XBP-1 activity
AU2007220039A1 (en) 2006-02-27 2007-09-07 The Board Of Trustees Of The Leland Stanford Junior University Inhibitors of the unfolded protein response and methods for their use

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4172896A (en) * 1978-06-05 1979-10-30 Dainippon Pharmaceutical Co., Ltd. Methane-sulfonamide derivatives, the preparation thereof and composition comprising the same
US5427798A (en) * 1992-08-14 1995-06-27 Burroughs Wellcome Co. Controlled sustained release tablets containing bupropion
US5541231A (en) * 1993-07-30 1996-07-30 Glaxo Wellcome Inc. Stabilized Pharmaceutical
US5731000A (en) * 1993-07-30 1998-03-24 Glaxo Wellcome Inc. Stabilized pharmaceutical composition containing bupropion
US5763493A (en) * 1993-07-30 1998-06-09 Glaxo Wellcome Inc. Stabilized pharmaceutical
US5358970A (en) * 1993-08-12 1994-10-25 Burroughs Wellcome Co. Pharmaceutical composition containing bupropion hydrochloride and a stabilizer
US5958703A (en) * 1996-12-03 1999-09-28 Glaxo Group Limited Use of modified tethers in screening compound libraries
US6110973A (en) * 1998-01-29 2000-08-29 Sepracor Methods for treating obesity and weight gain using optically pure (-)-bupropion
US20030049701A1 (en) * 2000-09-29 2003-03-13 Muraca Patrick J. Oncology tissue microarrays
US20030224428A1 (en) * 2002-04-12 2003-12-04 David Ron Method of screening test substances for treating or preventing a disease mediated by plasma cells
US20060041006A1 (en) * 2004-05-06 2006-02-23 Ibrahim Prabha N PDE4B inhibitors and uses therefor
US20060247320A1 (en) * 2005-03-09 2006-11-02 Schering Corporation Compounds for inhibiting KSP kinesin activity

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120028933A1 (en) * 2010-07-28 2012-02-02 Baust John M Cell Culture Media Supplement and Method of Molecular Stress Control
US10336984B2 (en) 2010-07-28 2019-07-02 Cpsi Holdings Llc Method of molecular stress control
US8993617B2 (en) 2010-11-10 2015-03-31 The Board Of Trustees Of The Leland Stanford Junior University Ire1alpha endonuclease specific inhibitor with cytotoxic activity
US9956236B2 (en) 2011-02-07 2018-05-01 Cornell University Methods for increasing immune responses using agents that directly bind to and activate IRE-1
US20150018406A1 (en) * 2012-03-09 2015-01-15 Cornell University Modulation of breast cancer growth by modulation of xbp1 activity
US10655130B2 (en) 2012-03-09 2020-05-19 Cornell University Modulation of breast cancer growth by modulation of XBP1 activity
WO2013160291A2 (fr) 2012-04-23 2013-10-31 Imba - Institut Für Molekulare Biotechnologie Gmbh Archéase en tant que membre d'un complexe d'arn ligase
US20160237429A1 (en) * 2013-09-25 2016-08-18 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US9957506B2 (en) * 2013-09-25 2018-05-01 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US10421965B2 (en) 2013-09-25 2019-09-24 Cornell University Compounds for inducing anti-tumor immunity and methods thereof
US10450566B2 (en) * 2013-09-25 2019-10-22 Cornell University Compounds for inducing anti-tumor immunity and methods thereof

Also Published As

Publication number Publication date
CA2638734A1 (fr) 2007-09-07
WO2007101224A2 (fr) 2007-09-07
US20130150399A1 (en) 2013-06-13
AU2007220040A1 (en) 2007-09-07
AU2007220039A1 (en) 2007-09-07
EP1999303A2 (fr) 2008-12-10
WO2007101225A2 (fr) 2007-09-07
EP1999303A4 (fr) 2010-09-08
WO2007101225A3 (fr) 2009-04-02
CA2638735A1 (fr) 2007-09-07
WO2007101224A3 (fr) 2008-10-16
US8372861B2 (en) 2013-02-12
US20090312362A1 (en) 2009-12-17

Similar Documents

Publication Publication Date Title
US20090291857A1 (en) Methods to identify inhibitors of the unfolded protein response
Kranz et al. PDI is an essential redox-sensitive activator of PERK during the unfolded protein response (UPR)
WO2017099034A1 (fr) Polythérapie à base d'inhibiteurs de signal pd-1
Compton et al. Active vacuolar H+ ATPase and functional cycle of Rab5 are required for the vacuolation defect triggered by PtdIns (3, 5) P2 loss under PIKfyve or Vps34 deficiency
Cheng et al. Bruceine D inhibits hepatocellular carcinoma growth by targeting β-catenin/jagged1 pathways
US11312676B2 (en) Small molecule stimulators of steroid receptor coactivator proteins and their use in the treatment of cancer
EP3060204B1 (fr) Bêta-caténine
WO2018053373A1 (fr) Utilisations d'inhibiteurs de kinase inductible par un sel (sik) pour traiter l'ostéoporose
KR20210113162A (ko) Kras 종양유전자 활성화의 억제를 위한 플라배글린 유도체
Chatterjee et al. Combined 2-deoxy glucose and metformin improves therapeutic efficacy of sodium-iodide symporter-mediated targeted radioiodine therapy in breast cancer cells
CN108309982B (zh) 3位取代的5H-[1,2,4]三嗪[5,6-b]吲哚衍生物的用途
Shao et al. Blockade of deubiquitinase YOD1 degrades oncogenic PML/RARα and eradicates acute promyelocytic leukemia cells
Gupta et al. Assays for induction of the unfolded protein response and selective activation of the three major pathways
Zhang et al. PXR triggers YAP-TEAD binding and Sirt2-driven YAP deacetylation and polyubiquitination to promote liver enlargement and regeneration in mice
US20130210772A1 (en) Androgen induced oxidative stress inhibitors
Fortin et al. ASK1-P38 pathway is important for anoikis induced by microtubule-targeting aryl chloroethylureas
CN113194942A (zh) 用于抑制和/或治疗生长相关疾病和/或其临床病症的组合物和方法
US9752151B2 (en) Composition for treatment or metastasis suppression of cancers which includes p34 expression inhibitor or activity inhibitor as active ingredient
US20220009941A1 (en) Dimers of Covalent NFKB Inhibitors
KR101655697B1 (ko) 신규한 피라졸린 유도체 및 이의 용도
WO2020230701A1 (fr) Agent antitumoral et agent de formulation
US9895370B2 (en) Pharmaceutical composition for preventing or treating of cirrhosis of liver comprising G protein coupled receptor 119 ligand as an active ingredient
US9874553B2 (en) Targeted chemical high-throughput screening method
US6569638B1 (en) Method for screening compounds for the treatment of neoplasia
US20100233172A1 (en) Methods of inhibiting quiescent tumor proliferation

Legal Events

Date Code Title Description
AS Assignment

Owner name: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KOONG, ALBERT C.;FELDMAN, DOUGLAS E.;REEL/FRAME:021645/0044

Effective date: 20070226

Owner name: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KOONG, ALBERT C.;FELDMAN, DOUGLAS E.;REEL/FRAME:021645/0080

Effective date: 20070226

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION