US20080319174A1 - Chimera humanized vascular endothelial growth factor - Google Patents

Chimera humanized vascular endothelial growth factor Download PDF

Info

Publication number
US20080319174A1
US20080319174A1 US12/142,601 US14260108A US2008319174A1 US 20080319174 A1 US20080319174 A1 US 20080319174A1 US 14260108 A US14260108 A US 14260108A US 2008319174 A1 US2008319174 A1 US 2008319174A1
Authority
US
United States
Prior art keywords
vegf
amino acid
chimera
protein
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/142,601
Inventor
Masabumi Shibuya
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US12/142,601 priority Critical patent/US20080319174A1/en
Publication of US20080319174A1 publication Critical patent/US20080319174A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to chimera vascular endothelial growth factors (VEGF). More particularly, the present invention relates to a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a corresponding sequence of a human-derived VEGF analogous protein.
  • VEGF vascular endothelial growth factors
  • the present invention also relates to a medicament comprising the chimera protein, DNA encoding the chimera protein, an expression vector comprising the DNA, a medicament comprising the expression vector, a transformant having the expression vector, and a process for producing the chimera protein using the transformant.
  • Circulatory disorders caused by vascular system abnormalities are observed in numerous diseases, and specific examples of such diseases include angina pectoris, heart infarction, lower extremity circulatory failure caused by diabetes, and arterial occlusive disease. These diseases not only impart a great deal of pain to patients but also often lead patients to death.
  • VEGF vascular endothelial growth factors
  • Flt-1, KDR vascular endothelial growth factors
  • VEGF vascular endothelial growth factor
  • an analogous protein thereof or a vector for expressing them into subcutaneous tissue or muscular tissue of cardiac muscle or lower extremity to accelerate vascularization by these vascularization factors.
  • Clinical experiments on VEGF have already stated, and VEGF are known to bind to and activate both Flt-1 (VEGF receptor-1) and KDR (VEGF receptor-2) (Shibuya M. et al. Current Topics in Microbiology and Immunology, 237, 59-83, 1999).
  • KDR VEGF receptor-2
  • VEGF receptor-1 VEGF receptor-1
  • Monocytes and macrophage cells are known to secrete various cytokines and the like to induce inflammation, and are likely to disturb vascularization therapy.
  • VEGF analogous protein which binds to only KDR (VEGF receptor-2) and can activate it, is understood as more suitable for vascularization therapy.
  • VEGF-E NZ-7 was reported as a protein that binds to only KDR (VEGF receptor-2) (Ogawa S. et al. Journal of Biological Chemistry, 273, 31273-31282, 1998). Although this gene per se was found in the Orf virus genome of Parapox in 1994, its property still remains unknown, and its characteristic features that it binds to only KDR (VEGF receptor-2) and has potent vascularization activity were elucidated for the first time by Ogawa et al. (Lyttle D. J. et al. Journal of Virology, 68, 8492, 1994; Ogawa S. et al. Journal of Biological Chemistry, 273, 31273-31282, 1998).
  • VEGF-E D1701 and VEGF-E NZ-2 which are allied with VEGF-E NZ-7 , were similarly reported as binding to only KDR (VEGF receptor-2) ( FIG. 1 ) (Meyer M. et al. EMBO Journal 18, 363-374, 1999).
  • VEGF-E NZ-7 binds to only KDR (VEGF receptor-2), has substantially the same vascularization activity as VEGF, and does not stimulate the chemotaxis of monocytes and macrophages.
  • VEGF-E NZ-7 is considered to be a protein which is clinically highly applicable, but it has some drawbacks remaining to be solved, i.e., reduction or elimination of antigenicity. Specifically, since the VEGF-E NZ-7 gene is not derived from human genome, its product, the VEGF-E NZ-7 protein, is regarded as a foreign substance which has a certain degree of antigenicity to the human immune system, and thus there is a possibility that antibodies would be generated. Accordingly, although a potent vascularization effect can be expected at the early stage of administration, if the antibody is generated in the individual patient it is predicted that VEGF-E NZ-7 may be absorbed by the antibody even though it is readministered and its effect would deteriorate.
  • an object of the present invention is to provide a chimera VEGF-E having a reduced antigenicity while maintaining the activity of VEGF-E. Further, it is another object of the present invention to provide a medicament comprising the chimera VEGF-E, DNA encoding the chimera VEGF-E, and a process for producing the chimera VEGF-E using the DNA.
  • the present inventor has conducted concentrated studies in order to attain the above objects. As a result, they succeeded in reducing and eliminating only antigenicity and foreign property while maintaining VEGF-E NZ-7 activity by separating, by means of domain analysis, a portion which is involved in the VEGF-E NZ-7 activity from a portion which is expected to have relatively high antigenicity, and substituting the portion expected to have relatively high antigenicity with a known human protein. This has led to the completion of the present invention.
  • the present invention provides a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a corresponding sequence of a human-derived VEGF analogous protein.
  • One aspect of the present invention provides a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting the amino terminus and/or carboxyl terminus of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with the amino terminus and/or carboxyl terminus of a human-derived VEGF analogous protein, respectively.
  • a chimera protein obtained by substituting 10 to 50 amino acid residues at the amino terminus of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with the amino terminus of a human derived VEGF analogous protein and/or substituting 10 to 50 amino acid residues at the carboxyl terminus of the VEGF analogous protein with the carboxyl terminus of the human-derived VEGF analogous protein.
  • Another aspect of the present invention provides a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting a part of the internal sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a corresponding sequence of a human-derived VEGF analogous protein.
  • a chimera protein which is obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a human-derived VEGF analogous protein in such a way that at least the sequences of the loop 1 region (amino acid residues 47 to 80) and the loop 3 region (amino acid residues 89 to 132) of the VEGF analogous protein are maintained.
  • a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) belongs to the VEGF-E family. More preferably, it is VEGF-E NZ-7 , VEGF-E D1701 , or VEGF-E NZ-2 .
  • a human-derived VEGF analogous protein is PIGF.
  • the chimera protein of the present invention is obtained by substituting 10 to 50 amino acid residues at the carboxyl terminus of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with the carboxyl terminus of a human-derived VEGF analogous protein.
  • the VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) belongs to the VEGF-E family, and the loop 1 region of amino acid residues 47 to 80 and the loop 3 region of amino acid residues 89 to 132 in the protein belonging to the VEGF-E family are substantially retained.
  • chimera protein having any of the following amino acid sequences:
  • (C) an amino acid sequence having 60% or more homology to the amino acid sequence as shown in SEQ ID NO: 8, 9, or 10 and having an activity of growing vascular endothelial cells.
  • Embodiments of the present invention provide a chimera protein comprising: any of the amino acid sequences as shown in (A) to (F) below; an amino acid sequence derived from any of the amino acid sequences as shown in (A) to (F) below by deletion, substitution, and/or addition of one or several amino acids and having an activity of growing vascular endothelial cells; or an amino acid sequence having 60% or more homology to any of the amino acid sequences as shown in (A) to (F) below and having an activity of growing vascular endothelial cells.
  • (C) an amino acid sequence having 60% or more homology to the amino acid sequence as shown in SEQ ID NO: 15 and having an activity of growing vascular endothelial cells.
  • Another aspect of the present invention provides a medicament comprising any of the aforementioned chimera proteins of the present invention.
  • a further aspect of the present invention provides an activator for KDR (VEGF receptor-2) receptor comprising any of the chimera proteins of the present invention.
  • a further aspect of the present invention provides an agent for growing vascular endothelial cells comprising any of the chimera proteins of the present invention.
  • a further aspect of the present invention provides DNA encoding any of the chimera proteins of the present invention.
  • a further aspect of the present invention provides an expression vector comprising the DNA according to the present invention.
  • a further aspect of the present invention provides a medicament comprising the expression vector according to the present invention.
  • a further aspect of the present invention provides an activator for KDR (VEGF receptor-2) receptor comprising the expression vector according to the present invention.
  • a further aspect of the present invention provides an agent for growing vascular endothelial cells comprising the expression vector according to the present invention.
  • a further aspect of the present invention provides a transformant having the expression vector according to the present invention.
  • a further aspect of the present invention provides a process for producing any of the chimera proteins of the present invention wherein the transformant according to the present invention is used.
  • FIG. 1 shows an interrelationship between VEGF-E N27 protein and VEGF receptor.
  • FIG. 2 shows the structures of VEGF-E N27 chimera proteins (VEGF-E-NP, VEGF-F-CP, VEGF-E-NP/CP).
  • FIG. 3 shows the preparation of VEGF-E N27 chimera protein.
  • FIG. 4 shows the result of the experiment for competitive inhibition of VEGF-E N27 chimera protein on the KDR receptor.
  • FIG. 5 shows the result of the experiment for assaying the autophosphorylation of KDR receptor.
  • FIG. 6 shows the result of the experiment on vascular endothelial cell growth.
  • FIG. 7 shows the nucleotide sequence (SEQ ID NO: 16) and the amino acid sequence (SEQ ID NO: 7) of VEGF-E-His.
  • FIG. 8 shows the nucleotide sequence (SEQ ID NO: 17) and the amino acid sequence (SEQ ID NO: 8) of VEGF-E-NP-His.
  • FIG. 9 shows the nucleotide sequence (SEQ ID NO: 18) and the amino acid sequence (SEQ ID NO: 9) of VEGF-E-CP-His.
  • FIG. 10 shows the nucleotide sequence (SEQ ID NO: 19) and the amino acid sequence (SEQ ID NO: 10) of VEGF-E-NP/CP-His.
  • FIG. 11 shows the nucleotide sequence (SEQ ID NO: 20) and the amino acid sequence (SEQ ID NO: 11) of hPIGF-I-His.
  • FIG. 12 shows the structures of VEGF-E chimera proteins #19 to #27 and a summary of the results of the experiment for assaying the autophosphorylation of the KDR receptor and the experiment on vascular endothelial cell growth.
  • FIG. 13 shows the results of the experiment on competitive inhibition on the KDR receptor using the VEGF-E chimera proteins #19 to #27.
  • FIG. 14 shows the results of the experiment on vascular endothelial cell growth using the VEGF-E chimera proteins #19 to #27.
  • FIG. 15 shows the structures of VEGF-E chimera proteins #31 to #33 and a summary of the results of the experiment for assaying the autophosphorylation of the KDR receptor and the experiment on vascular endothelial cell growth.
  • FIG. 16 shows the results of the experiment on competitive inhibition on the KDR motor using the VEGF-E chimera proteins #31 to #33.
  • FIG. 17 shows the results of the experiment on vascular endothelial cell growth using the VEGF-E chimera proteins #31 to #33.
  • the chimera protein having an activity of growing vascular endothelial cells according to the present invention can be obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a corresponding sequence of a human derived VEGF analogous protein.
  • VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) is not particularly limited, and specific examples thereof include a protein belonging to the VEGF-E family. More specific examples include VEGF-E NZ-7 , VEGF-E D1701 , and VEGF-E 2 (Ogawa S. et al. Journal of Biological Chemistry, 273, 31273-31282, 1998; and Meyer M. et al. EMBO Journal 18, 363-374, 1999).
  • the amino terminus and/or carboxyl terminus of a VEGF analogous protein having an activity of vascularization is substituted with the amino terminus and/or carboxyl terminus of a human-derived VEGF analogous protein.
  • the region that is substituted with the human-derived VEGF analogous protein may be only the amino terminus or only the carboxyl terminus of the VEGF analogous protein, or may be both the amino and carboxyl termini.
  • the length of the amino terminus to be substituted is not particularly limited as long as the resulting chimera protein remains the activity of growing vascular endothelial cells.
  • amino acid residues Preferably 10 to 50 amino acid residues, more preferably 20 to 40 amino acid residues, and particularly preferably 20 to 30 amino acid residues at the amino terminus are substituted with the amino terminus of a human-derived VEGF analogous protein.
  • the length of the carboxyl terminus to be substituted is not particularly limited as long as the resulting chimera protein remains the activity of growing vascular endothelial cells.
  • 10 to 50 amino acid residues, more preferably 10 to 40 amino acid residues, further preferably 10 to 30 amino acid residues, and particularly preferably 10 to 20 amino acid residues at the carboxyl terminus are substituted with the carboxyl terminus of a human-derived VEGF analogous protein.
  • a part of the internal sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) is substituted with a corresponding sequence of a human-derived VEGF analogous protein.
  • a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) is substituted with a human-derived VEGF analogous protein in such a way that at least the sequences of the loop 1 region (amino acid residues 47 to 80) and the loop 3 region (amino acid residues 89 to 132) of the VEGF analogous protein are maintained.
  • the amino terminus and/or carboxyl terminus of a VEGF analogous protein having an activity of vascularization is substituted with the ammo terminus and/or carboxyl terminus of a human-derived VEGF analogous protein, and at thy same time, a part of the internal sequence of the VEGF analogous protein is substituted with a corresponding sequence of the human-derived VEGF analogous protein.
  • the VEGF analogous protein having an activity of vascularization according to the present invention belongs to the VEGF-E family.
  • VEGF-E is a protein of 149 amino acids, and is composed of:
  • amino terminal region comprising a signal peptide (amino acid residues 1 to 46);
  • V the carboxyl terminal region (amino acid residues 133 to 148) (Ogawa S. et al., Journal of Biological Chemistry, 273, 31273-31282, 1998).
  • the chimera protein of the present invention substantially maintains the loop 3 region of amino acid residues 89 to 132 of VEGF-E.
  • the chimera protein of the present invention is obtained by substituting the amino terminus and/or carboxyl terminus of a VEGF analogous protein with the amino terminus and/or carboxyl terminus of a human-derived VEGF analogous protein, respectively. This can lower the antigenicity of the VEGF analogous protein.
  • the types of human-derived VEGF analogous proteins are not particularly limited, and examples thereof include PIGF, and particularly, hPIGF1.
  • the aforementioned chimera proteins may have addition, deletion, substitution, and/or modification in a portion of their amino acid sequence, as long as the proteins remain the activity of growing vascular endothelial cells.
  • chimera proteins of the present invention include those having any of the following amino acid sequences:
  • (C) an amino acid sequence having 60% or more homology to the amino acid sequences as defined in (A) and having an activity of growing vascular endothelial cells.
  • an amino acid sequence derived from . . . by deletion, substitution, and/or addition of one or several amino acids refers to an amino acid sequence in which, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, and further preferably 1 to 5 amino acids are deleted, substituted, and/or added.
  • the amino acid sequence having 60% or more homology to the amino acid sequence refers to having homology of at least 60%. Homology is preferably 70% or more, more preferably 80% or more, further preferably 90% or more, and particularly preferably 95% or more.
  • the proteins which have an amino acid sequence derived from a certain amino acid sequence by deletion, substitution, and/or addition of one or several amino acids and having an activity of growing vascular endothelial cells or an amino acid sequence having 60% or more homology with a certain amino acid sequence and having an activity of growing vascular endothelial cells can be produced or obtained using common recombinant techniques including site-specific mutagenesis) described in, for example, Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989), or Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997) and using DNA encoding a protein having an amino acid sequence as shown in any of SEQ ID Nos: 7 to 11.
  • a gene encoding a VEGF analogous protein (e.g., the VEGF-E gene) that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) and has an activity of vascularization or a modified gene thereof is used as a starting material, and DNA fragment is cut out using a suitable restriction enzyme.
  • a desired DNA fragment which encodes the VEGF analogous protein is prepared by PCR or the like.
  • DNA which encodes the amino terminus and/or carboxyl terminus of the human-derived VEGF analogous protein to be substituted or a partial internal sequence thereof is prepared.
  • the DNA which encodes the amino terminus and/or carboxyl terminus of the human-derived VEGF analogous protein or a partial internal sequence thereof may be obtained by cleaving out a desired DNA fragment using a suitable restriction enzyme from a gene encoding the human-derived VEGF analogous protein.
  • a desired DNA fragment may by amplified by PCR or may be obtained by chemical synthesis using a DNA synthesizer.
  • the DNA fragments obtained above can be bound to each other using a suitable DNA ligase.
  • an oligonucleotide may be inserted to align the reading frames, or a part of the nucleotide sequence may be altered to create an identical restriction site.
  • Any plasmid to which DNA is to be inserted can be used as long as it can be replicated and retained in a host, and examples include pBR322 and pUC18 derived from Escherichia coli , and pET-3c constructed based thereon.
  • Examples of methods for inserting DNA into plasmid include a method described in T. Maniatis et al., Molecular Cloning, Cold Spring Harbor Laboratory, p. 239 (1982).
  • a cloned gene encoding a chimera protein can be used to construct an expression vector by ligating the gene downstream of the promoter in a vector which is suitable for expression.
  • expression vectors examples include: the plasmid derived from Escherichia coli (pBR322, pBR325, pUC12, pUC13, pET-3); plasmid derived from Bacillus subtilis (pUB110, pTP5, pC194); plasmid derived from yeast (pSH19, pSH15); bacteriophage such as ⁇ phage or its derivative; animal viruses such as retrovirus and vaccinia virus; and insect viruses (e.g., baculovirus).
  • Escherichia coli pBR322, pBR325, pUC12, pUC13, pET-3
  • Bacillus subtilis pUB110, pTP5, pC194
  • plasmid derived from yeast pSH19, pSH15
  • bacteriophage such as ⁇ phage or its derivative
  • animal viruses such as retrovirus and vaccinia virus
  • insect viruses e.g., baculovirus
  • the gene may have at its 5′ terminus ATG as a translation initiation codon, and may have at its 3′ terminus TAA, TGA, or TAG as a translation termination codon.
  • a promoter is connected upstream thereof. Any promoter can be used in the present invention as long as it is suitable in respect of the host that is used in the gene expression.
  • trp promoter When the host for transformation is Escherichia coli , trp promoter, lac promoter, rec A promoter, ⁇ PL promoter, Ipp promoter, T7 promoter, and the like are preferable.
  • a host Bacillus subtilis , SP01 promoter, SP02 promoter, penP promoter, and the like are preferable.
  • a host When a host is yeast, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, and the like are preferable.
  • preferable promoters include SV40-derived promoter and a retrovirus promoter.
  • a vector comprising recombinant DNA having DNA encoding the chimera protein of the present invention thus prepared is used to prepare a transformant which has the vector.
  • hosts include Escherichia coli (e.g., BL21, BL21(DE3), BL21(DE3)pLysS, and BL21(DE3)pLysE), Bacillus subtilis (e.g., Bacillus subtilis DB105), yeast (e.g., Pichia pastoris , and Saccharomyces cerevisiae ), animal cells (e.g., COS cell CHO cell, BHK cell, NIH3T3 cell, BALB/c3T3 cell, HUVE cell, and LEII cell), and insect cells.
  • Escherichia coli e.g., BL21, BL21(DE3), BL21(DE3)pLysS, and BL21(DE3)pLysE
  • Bacillus subtilis e.g., Bacillus subtilis DB105
  • yeast e.g., Pichia pastoris
  • animal cells e.g.
  • a host is Escherichia coli
  • a vector comprising recombinant DNA is introduced by the heat shock method, electroporation, or the like into a competent cell that was prepared by the calcium method or other methods.
  • a host is yeast
  • a vector comprising recombinant DNA is introduced by the heat shock method, electroporation, or the like into a competent cell that was prepared by the lithium method or other methods.
  • a host is an animal cell a vector comprising recombinant DNA is introduced into a cell by the calcium phosphate method, lipofection method, electroporation method, or the like.
  • a transformant which has an expression vector comprising DNA that encodes the chimera protein of the present invention can be obtained by the above method.
  • the chimera protein of the present invention can be produced by culturing the transformant in a suitable medium.
  • a commonly used medium can be used for each host.
  • LB Medium can be used in the case of Escherichia coli
  • YPD Medium can be used in the case of yeast
  • a medium prepared by adding animal serum to Dulbecco's MEM can be used in the case of the animal cell.
  • a transformant can be cultured under general conditions for each host. For example, when a host is Escherichia coli , culturing is conducted at about 30 to 37° C. for about 3 to 24 hours, and if necessary, aeration or agitation can be applied. When a host is yeast, culturing is conducted at about 25 to 37° C. for about 12 hours to 2 weeks, and if necessary, aeration or agitation can be applied. When a host is an animal cell culturing is conducted at about 32 to 37° C. under 5% CO 2 and 100% humidity for about 24 hours to 2 weeks, and if necessary, the condition of the gas phase can be altered or agitation can be applied.
  • chimera protein of the present invention When the chimera protein of the present invention is expressed using an insect cell as a host, a protein can be expressed in accordance with the method described in, for example, Baculovirus Expression Vectors, A Laboratory Manual; Current Protocols in Molecular Biology; and Bio/Technology, 6, 47 (1988).
  • a recombinant gene-introduced vector and baculovirus are co-introduced into an insect cell so as to obtain a recombinant virus in a culture supernatant of the insect cell. Thereafter, the insect cell is further infected with the recombinant virus, thereby expressing the protein.
  • Examples of a vector for introducing the gene that is used in the above method include pVL1392, pVL1393, and pBlueBacIII (all available from Invitrogen).
  • baculovirus for example, Autographa californica nuclear polyhedrosis virus, which is a virus infecting an insect belonging to the genus Mamestra , can be used.
  • insect cell for example, ovarian cells of Spodoptera frugiperda, Sf 9 and Sf21 (Baculovirus Expression Vectors, A laboratory Manual, W. H. Freeman and Company, New York, 1992) and an ovarian cell of Trichoplusia ni , High5, (Invitrogen) can be used.
  • Examples of methods for co-introducing the recombinant gene-introduced vector and the baculovirus in the insect cell for the preparation of the recombinant virus include the calcium phosphate method (JP Patent Publication (Unexamined Application) No. 2-227075) and lipofection method (Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)).
  • Medium that can be used for culturing the transformant obtained by using the insect cell as a host cell includes commonly used TNM-FH medium (Pharmingen), Sf-900 II SFM medium (GIBCO BRL), ExCell 400 and ExCell 405 (JRH Biosciences), and Grace's Insect Medium (Gram, T. C. C., Nature, 195, 788 (1962)).
  • Culturing is generally conducted under conditions of, for example, pH 6 to 7 at 25 to 30° C. for 1 to 5 days. If necessary, an antibiotic such as gentamicin may be added to the medium during the culture.
  • the chimera protein may be directly purified from the culture supernatant, or alternatively after culturing of the transformant, microorganisms or cells are disrupted by means of a homogenizer, French press, ultrasound, lysozyme, and/or freeze and thawing to eluate the chimera protein of interest extracellularly, and thereby obtain the chimera protein from the soluble fraction.
  • a method for collecting bacterial bodies or cells can be performed by first disrupting bacterial bodies or cells, collecting insoluble fractions by centrifugation, and solubilizing them by a buffer comprising guanidine hydrochloride and the like.
  • bacterial bodies or cells are directly disrupted by a buffer comprising a protein denaturing agent such as guanidin hydrochloride to eluate the chimera protein of interest extracellularly.
  • the chimera protein of the present invention can be purified from the aforementioned soluble fractions by suitably combining conventional separation and purification methods.
  • separation and purification methods include salting-out, solvent precipitation, dialysis, ultrafiltration, gel filtration, SDS-polyacrylamide gel electrophoresis, ion-exchange chromatography, affinity chromatography, reverse phase high-performance liquid chromatography, and isoelectric focusing.
  • a nickel carrier such as Ni-NTA agarose can be used to specifically adsorb the histidine tag-fused chimera protein for the recovery.
  • the chimera protein of the present invention has an activity of growing vascular endothelial cells. Circulatory disorders caused by a vascular system abnormality are observed in numerous diseases, and specific examples of such diseases include angina pectoris, heart infarction, lower extremity circulatory failures caused by diabetes, and arterial occlusive diseases. Administration of the chimera protein of the present invention or an expression vector comprising DNA encoding the chimera protein to the patients suffering from the aforementioned diseases can impart therapeutic effects through the growth action on vascular endothelial cells. Since the chimera protein of the present invention can activate the KDR (VEGF receptor-2) receptor, it is also useful as a therapeutic or preventive agent for diseases involving abnormality in the activity of the KDR (VEGF receptor-2) receptor.
  • KDR VEGF receptor-2
  • the chimera protein of the present invention is useful as a medicament.
  • the chimera protein of the present invention can be formulated into pharmaceutical compositions such as solutions, injections, powders, granules, tablets, suppositories, enteric pills or tablets, and capsules by using, for example, a pharmaceutically acceptable solvent, excipient, carrier, and adjuvant in accordance with conventional techniques.
  • the content of the chimera protein of the present invention which is an active ingredient in the pharmaceutical composition may be about 0000001 to 1.0% by weight.
  • These pharmaceutical compositions can be safely administered to mammal animals such as human, mouse, rat, rabbit, dog, and cat, and particularly preferably to human as an activator for KDR (VEGF receptor-2) receptor or an agent for growing vascular endothelial cells. Any route of administration such as local, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, or percutaneous administration can be employed.
  • the dose of the chimera protein of the present invention should be properly increased or decreased depending on conditions such as age, sex, weight, or symptom of the patient, and route of administration.
  • the chimera protein when administered to mammalian animals including human, can be administered in an amount of approximately 0.01 ⁇ g to 10 mg/kg (body weight) per day.
  • An expression vector comprising DNA encoding the chimera protein of the present invention can be formulated in order to be administered in any route of administration such as local, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, or percutaneous administration.
  • the expression vector is used in a form of injection.
  • the expression vector of the present invention can be mixed with a pharmaceutically acceptable excipient to prepare an injection.
  • injections include an aseptic solution and an isotonic solution.
  • it can be formulated as a dry composition, particularly as a freeze-dried composition, and these can be formulated into an injection by adding sterilized water or physiological saline at the time of use thereof.
  • the dose of the expression vector of the present invention should be properly increased or decreased depending on conditions such as age, sex, weight, or symptom of the patient, and route of administration.
  • the amount of DNA as an active ingredient is in the range of about 1 ⁇ g/kg to 1000 mg/kg per day per adult, and preferably in the range of about 10 ⁇ g/kg to 100 mg/kg per day per adult.
  • Ex-Cell 400 JRH Biosciences, Lenexa, Kans. was used as a culture solution for Sf9 insect cells (Invitrogen, CA, USA).
  • the NIH3T3-KDR cell was produced by Sawano et al. (Sawano A. et al. Cell growth and Differentiation, 7, 213-221, 1996).
  • the NIH3T3 cell and the NIH3T3-KDR cell were maintained in a medium obtained by adding 10% bovine serum, 2 mM L-glutamine, and 200 ⁇ g/ml G418 (Geneticin; Life Technologies, Inc., Grand Island, N.Y.) to Dulbecco's Modified Eagle's Medium (DMEM, Nissui, Tokyo).
  • DMEM Dulbecco's Modified Eagle's Medium
  • Human umbilical vein endothelial cells (HUVEC, Morinaga, Tokyo) were maintained in HUVE culture medium (Morinaga, Tokyo) and used in the assay for the endothelial cell growth.
  • Recombinant human VEGF 165 was forcibly expressed in the Sf9 cells by baculovirus system and then purified from the culture supernatant using a haparin column and used.
  • Fc-fused 7N-sKDR free KDR was used in the experiment for ligand binding (Shinkai A. et al. J. Biol. Chem. 273, 31283-31288, 1998).
  • VEGF-E-NP VEGF-E-NP
  • VEGF-E-CP VEGF-E-NP/CP
  • hPIGF-1 human PIGF-1
  • chimera protein VEGF-E-NP prepared by substituting 34 amino acid residues at the amino terminus of VEGF-E N27 with 40 amino acid residues at the amino terminus of hPIGF-1;
  • VEGF-E-CP prepared by substituting 18 amino acid residues at the carboxyl terminus of VEGF-E N27 with 21 amino acid residues at the carboxyl terminus of hPIGF-1;
  • VEGF-E-NP/CP prepared by substituting both the amino and carboxyl terminuses of VEGF-E N27 with those of hPIGF-1.
  • VEGF-E-His The nucleotide sequence and the amino acid sequence of VEGF-E-His are shown in FIG. 7 and SEQ ID NO: 7, the nucleotide sequence and the amino acid sequence of VEGF-E-NP-His are shown in FIG. 8 and SEQ ID NO: 8, the nucleotide sequence and the amino acid sequence of VEGF-E-CP-His are shown in FIG. 9 and SEQ ID NO: 9, the nucleotide sequence and the amino acid sequence of VEGF-E-NP/CP-His are shown in FIG. 10 and SEQ ID NO: 10, and the nucleotide sequence and the amino acid sequence of hPIGF-1-His are shown in FIG. 11 and SEQ ID NO: 11. (VEGF-E-CP and VEGF-E-NP)
  • pUC18-VEGF-E-His which is plasmid DNA prepared by subcloning a full-length DNA of the VEGF-E gene fused with a histidine tag at its carboxyl terminus into pUC18, was cleaved with a restriction enzyme.
  • a fragment (3 kb) that was obtained by cleaving with DraIII and EcoRI and a fragment (about 3 kb) obtained by cleaving with Pf1MI and BamHI were purified by the gene clean method.
  • 6 oligonucleotides were produced and purified by HPLC (Amersham Pharmacia Biotech (Tokyo)):
  • the DNA fragment of DraIII/EcoRI and oligonucleotides of S150/S151 and S155/S156 were ligated for VEGF-E-CP by DNA ligase.
  • the DNA fragment of Pf1MI/BamHI and oligonucleotides of S166/S167 were ligated for VEGF-E-NP by DNA ligase.
  • a histidine tag was fused to the carboxyl terminus.
  • the full-length DNAs which encoded VEGF-E-CP and VEGF-E-NP were subcloned into the pUC18 plasmid vector.
  • the plasmids were respectively designated as pUCE-CP and pUCE-NP.
  • pUCE-CP and pUCE-NP were Cleaved with BsrGI and EcoRI and 200 bp and 3 kb DNA fragments respectively obtained therefrom were purified by the gene clean method, followed by ligation with DNA ligase. Thus, a histidine tag was fused to the carboxyl terminus.
  • the full-length DNA which encoded the VEGF-E-NP/CP was subcloned into pUC18, and this plasmid DNA was designated as pUCE-NP/CP.
  • each of the subcloned DNAs was cleaved out and subcloned into a baculovirus vector.
  • Each DNA of pUCE-CP, pUCE-NP and pUCE-NP/CP was cleaved with BamHI and EcoRI and 450 bp fragments were purified by the gene clean method. The fragments were cloned into the BamHI and EcoRI site in the multicloning sites of pVL1393 (Invitrogen) which is a baculovirus vector.
  • pVL3E-CP pVL3E-NP
  • pVL3E-NP/CP pVL3E-NP/CP.
  • transfection into Sf9 cells was performed by lipofectin met Recombinant viruses having DNA encoding the chimera protein were amplified by repeating incubation for 3 to 4 days.
  • infection with the recombinant virus Sf9 cells was carried out at the multiplicity of infection (MOI) (i.e., the number of virus particles per cell) of 10. After the incubation for 3 days, a culture solution to which the chimera protein had been secreted was collected.
  • MOI multiplicity of infection
  • the culture solution was concentrated.
  • an agitation-type ultrafilter device (MILLIPORE, USA) was used.
  • the concentrate was subjected to dialysis in 20 mM sodium phosphate buffer (pH 8.0), 10 mM imidazole, 300 mM NaCl, and 20% glycerol in order to negatively charge the histidine tag that was fused with the recombinant protein.
  • the histidine tag-fused protein was specifically adsorbed using Ni-NTA agarose (QIAGEN, Germany).
  • Ni-NTA agarose to which the recombinant protein had been adsorbed was introduced into a column and washed with 20 mM sodium phosphate buffer (pH 8.0), 50 mM imidazole, 300 mM NaCl, and 20% glycerol, and the chimera protein of interest was eluted using 20 mM sodium phosphate buffer (pH 8.0), 250 mM imidazole, 300 mM NaCl, and 20% glycerol.
  • the eluate was subjected to dialysis in 20 mM sodium phosphate buffer (pH 7.4), 50 mM NaCl, and 20% glycerol.
  • the purified chimera protein was electrophoresed in 15% SDS-PAGE and analyzed by Coomassie staining and Western blotting using anti-histidine tag monoclonal antibody (anti-His-tagmAb), anti-VEGF-E serum, and anti-PIGF antibody.
  • the purification level of the chimera protein was 80% or higher ( FIG. 3 ).
  • Fc-fused 7N-sKDR was diluted to 3 ⁇ g/ml in physiological saline (hereinafter abbreviated to “PBS”), 50 ⁇ l thereof was added to each well of a 96-well cell culture plate (Immunon (registered trademark) 2HB, DYNEX TECHNOLOGIES, INC, VA), allowed to stand at 4° C. for 12 hours, and s KDR was then adsorbed on the plate. The plate was washed twice with a blocking buffer (PBS containing 1% bovine serum albumin), and blocking was carried out using the blocking buffer at 25° C. for 30 minutes.
  • PBS physiological saline
  • VEGF-E-NP three types of chimera VEGF-E N27 proteins (VEGF-E-NP, VEGF-E-CP, VEGF-E-NP/CP) efficiently inhibited the binding of VEGF to KDR. This strongly indicates that the chimera VEGF-E N27 protein binds to KDR with high affinity ( FIG. 4 ).
  • the cells were washed twice in ice-cooled PBS containing 0.1 mM Na 3 VO 4 , and then dissolved with a 1% Triton X-100 buffer solution (50 mM HEPES pH 7.4, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl, 2% trasylol, 1 mM PMSF, 50 mM NaF, 10 mM Na 4 P 2 O 7 , 2 mM Na 3 VO 4 ). The dissolved sample was centrifuged at 15,000 rpm for 10 minutes, and the supernatant was collected.
  • Triton X-100 buffer solution 50 mM HEPES pH 7.4, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl, 2% trasylol, 1 mM PMSF, 50 mM NaF, 10 mM Na 4 P 2 O 7 , 2
  • the protein concentration in the supernatant was assayed using the Bio-Rad Protein Assay Kit (Richmond, Calif.), and an equivalent protein was used in the analysis.
  • the dissolved sample was electrophoresed in 7.5% SDS-PAGE and then transferred to a nitrocellulose membrane.
  • the transferred nitrocellulose membrane was blocked with a blocking buffer (a washing buffer containing 5% BSA [20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Tween 20]), and binding reaction was then carried out with a blocking buffer containing a primary antibody.
  • VEGF-E-NP the three types of chimera VEGF-E N27 proteins (VEGF-E-NP, VEGF-E-CP, VEGF-E-NP/CP) were found to activate the tyrosine kinase of the KDR receptor in a dosage-dependent manner ( FIG. 5 ).
  • the HUVEC (Morinaga, Tokyo) which were cultured in the medium for HUVE culture (Nissui) containing growth factors, FGF, added thereto, were inoculated on a 24-well plate (CellTite C-1 Plate 24F, Akita Sumitomo Bakelite Co., Ltd., Akita) in amounts of 4,000 cells, and allowed to stand in an incubator at 37° C. for 4 hours to adsorb the cells.
  • the chimera VEGF-ED protein was directly added to the medium to a final concentration of 50 ng/ml, and cultured for 3 days. The cells were fixed with formalin and then stained with Crystal Violet. The number of cells was counted, and relatively compared to analyze the endothelial cell growth. The results showed that the chimera protein had the equivalent activity of endothelial cell growth as the VEGF-E protein in vitro ( FIG. 6 ).
  • VEGF-E-NP chimera VEGF-E N27 proteins
  • VEGF-E N27 proteins VEGF-E-NP, VEGF-E-CP, VEGF-E-NP/CP
  • VEGF-E-NP/CP chimera VEGF-E N27 proteins
  • the amino acid sequence of the substituted region is shown below.
  • the nucleotide sequence of PIGF was used for that of the substituted region.
  • Structures of the chimera VEGF-E proteins #19 to #27 are shown in FIG. 12 .
  • #19 the amino acid sequence from residues #54-57 (YLGE) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (DVVS) (SEQ ID NO: 21) of the corresponding region in human PIGF.
  • #20 the amino acid sequence from residues #62-64 (STN) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (EVE) of the corresponding region in human PIGF.
  • #21 the amino acid sequence from residues #65-68 (LQYN) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (HMFS) (SEQ ID NO: 22) of the corresponding region in human PIGF.
  • #22 the amino acid sequence from residues #3743 (WMRTLDK) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (FQEVWGR) (SEQ ID NO: 23) of the corresponding region in human PIGF.
  • #23 the amino acid sequence from residues #47-52 (KPRDTV) ( ⁇ chain #1) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (RALERL) (SEQ ID NO: 24) of the corresponding region in human PIGF.
  • VTVS VTVS
  • ⁇ chain #6, between cysteine 6 and cysteine 7 of VEGF-E SEQ ID NO: 7
  • MQLL amino acid sequence (SEQ ID NO: 26) of the corresponding region in human PIGF
  • #25 the amino acid sequence from residues #102-104 (VTG) (a portion of loop 3) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (KTR) of the corresponding region in human PIGF.
  • #26 the amino acid sequence from residues #119-122 (LQRI) ( ⁇ chain #7, 11 amino acid residues upstream region from the 7th cysteine) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (YVEL) (SEQ ID NO: 25) of the corresponding region in human PIGF.
  • #27 the amino acid sequence from residues #111-118 (TNSGVSTN) (VEGF-E-specific amino acid sequence) of VEGF-E (SEQ ID NO: 7) is removed (deletion mutation).
  • the structures of the chimera proteins are shown below as nucleotide sequences.
  • the structures of chimera VEGF-E proteins #31 to #33 are shown in FIG. 15 .
  • cysteine sites (the 2nd, 3rd, 4th, and 5th)
  • DNA fragments having the above sequences were constructed by conventional gene recombinant techniques, and VEGF-E chimera proteins (#19 to #27 and #31 to #33) were prepared in the same manner as in Example 3.
  • VEGF-E chimera proteins (#19 to #27 and #31 to #33) prepared in Example 7 were used to perform an experiment on competitive inhibition on the KDR receptor (in the same manner as in Example 4), an experiment for assaying autophosphorylation of the KDR receptor (in the same manner as in Example 5), and an experiment on vascular endothelial cell growth (in the same manner as in Example 6).
  • FIG. 12 shows the structures of VEGF-E chimera proteins #19 to #27 and summarized results of the experiment for assaying the autophosphorylation of the KDR receptor and the experiment on vascular endothelial cell growth.
  • FIG. 13 shows the assay result obtained by the experiment on competitive inhibition on KDR receptor.
  • FIG. 14 shows the assay result obtained by the experiment on vascular endothelial cell growth.
  • FIG. 15 shows the structures of VEGF-E chimera proteins #31 to #33 and a summary of the results of the experiment for assaying the autophosphorylation of KDR receptor and the experiment of vascular endothelial cell growth.
  • FIG. 16 shows the assay result obtained by the experiment on competitive inhibition on KDR receptor
  • FIG. 17 shows the assay result obtained by the experiment on vascular endothelial cell growth.
  • the chimera VEGF-E of the present invention can be used as a safe vascularization factor since its antigenicity is reduced while maintaining the activity of growing vascular endothelial cells.

Abstract

An object of the present invention is to provide a chimera VEGF-E having a reduced antigenicity while maintaining the activity of VEGF-E. The present invention provides a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF, receptor-1) with a corresponding sequence of a human-derived VEGF analogous protein.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a divisional of application Ser. No. 10/343,825 which is a national stage of PCT/JP01/06856, filed Aug. 9, 2001, which claims priority to Japanese Application No. 2000-242629, filed Aug. 10, 2000. The disclosures of application Ser. No. 10/343,825 and PC/JP01/06856 are incorporated by reference herein in their entireties.
    • TECHNICAL FIELD
  • The present invention relates to chimera vascular endothelial growth factors (VEGF). More particularly, the present invention relates to a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a corresponding sequence of a human-derived VEGF analogous protein. The present invention also relates to a medicament comprising the chimera protein, DNA encoding the chimera protein, an expression vector comprising the DNA, a medicament comprising the expression vector, a transformant having the expression vector, and a process for producing the chimera protein using the transformant.
    • BACKGROUND ART
  • Circulatory disorders caused by vascular system abnormalities are observed in numerous diseases, and specific examples of such diseases include angina pectoris, heart infarction, lower extremity circulatory failure caused by diabetes, and arterial occlusive disease. These diseases not only impart a great deal of pain to patients but also often lead patients to death. In order to overcome his problem, a great deal of research has been conducted regarding vascularization, and as a result, vascular endothelial growth factors (hereinafter abbreviated to “VEGF”) and their receptors (Flt-1, KDR) were found to play central roles therein (Ferrara N. and Davis-Smyth T., Endocrine Review, 18, 4-25, 1997, Shibuya A, Advances in Cancer Research, 67, 281-316, 1995).
  • A possible method to ameliorate various circulatory failures is carried out by administering VEGF, an analogous protein thereof, or a vector for expressing them into subcutaneous tissue or muscular tissue of cardiac muscle or lower extremity to accelerate vascularization by these vascularization factors. Clinical experiments on VEGF have already stated, and VEGF are known to bind to and activate both Flt-1 (VEGF receptor-1) and KDR (VEGF receptor-2) (Shibuya M. et al. Current Topics in Microbiology and Immunology, 237, 59-83, 1999). Approximately 90% of vascularization signals are sent from KDR (VEGF receptor-2) (Takahashi T. et al. Oncogene, 18, 2221-2230, 1999), while Flt-1 (VEGF receptor-1) sends out signals for the chemotaxis of monocytes and macrophages and relatively weak vascularization signals (Barleon B. et al. Blood, 87, 3336-3343, 1996, Clauss M. et al. Journal of Biological Chemistry, 271, 17629-17634, 1996). Monocytes and macrophage cells are known to secrete various cytokines and the like to induce inflammation, and are likely to disturb vascularization therapy. Accordingly, a VEGF analogous protein which binds to only KDR (VEGF receptor-2) and can activate it, is understood as more suitable for vascularization therapy. VEGF-ENZ-7 was reported as a protein that binds to only KDR (VEGF receptor-2) (Ogawa S. et al. Journal of Biological Chemistry, 273, 31273-31282, 1998). Although this gene per se was found in the Orf virus genome of Parapox in 1994, its property still remains unknown, and its characteristic features that it binds to only KDR (VEGF receptor-2) and has potent vascularization activity were elucidated for the first time by Ogawa et al. (Lyttle D. J. et al. Journal of Virology, 68, 8492, 1994; Ogawa S. et al. Journal of Biological Chemistry, 273, 31273-31282, 1998).
  • Thereafter, VEGF-ED1701 and VEGF-ENZ-2, which are allied with VEGF-ENZ-7, were similarly reported as binding to only KDR (VEGF receptor-2) (FIG. 1) (Meyer M. et al. EMBO Journal 18, 363-374, 1999). As described above, VEGF-ENZ-7 binds to only KDR (VEGF receptor-2), has substantially the same vascularization activity as VEGF, and does not stimulate the chemotaxis of monocytes and macrophages.
    • DISCLOSURE OF THE INVASION
  • As mentioned above, VEGF-ENZ-7 is considered to be a protein which is clinically highly applicable, but it has some drawbacks remaining to be solved, i.e., reduction or elimination of antigenicity. Specifically, since the VEGF-ENZ-7 gene is not derived from human genome, its product, the VEGF-ENZ-7 protein, is regarded as a foreign substance which has a certain degree of antigenicity to the human immune system, and thus there is a possibility that antibodies would be generated. Accordingly, although a potent vascularization effect can be expected at the early stage of administration, if the antibody is generated in the individual patient it is predicted that VEGF-ENZ-7 may be absorbed by the antibody even though it is readministered and its effect would deteriorate.
  • Specifically, an object of the present invention is to provide a chimera VEGF-E having a reduced antigenicity while maintaining the activity of VEGF-E. Further, it is another object of the present invention to provide a medicament comprising the chimera VEGF-E, DNA encoding the chimera VEGF-E, and a process for producing the chimera VEGF-E using the DNA.
  • The present inventor has conducted concentrated studies in order to attain the above objects. As a result, they succeeded in reducing and eliminating only antigenicity and foreign property while maintaining VEGF-ENZ-7 activity by separating, by means of domain analysis, a portion which is involved in the VEGF-ENZ-7 activity from a portion which is expected to have relatively high antigenicity, and substituting the portion expected to have relatively high antigenicity with a known human protein. This has led to the completion of the present invention.
  • Thus, the present invention provides a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a corresponding sequence of a human-derived VEGF analogous protein.
  • One aspect of the present invention provides a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting the amino terminus and/or carboxyl terminus of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with the amino terminus and/or carboxyl terminus of a human-derived VEGF analogous protein, respectively. Preferably, there is provided a chimera protein obtained by substituting 10 to 50 amino acid residues at the amino terminus of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with the amino terminus of a human derived VEGF analogous protein and/or substituting 10 to 50 amino acid residues at the carboxyl terminus of the VEGF analogous protein with the carboxyl terminus of the human-derived VEGF analogous protein.
  • Another aspect of the present invention provides a chimera protein having an activity of growing vascular endothelial cells, which is obtained by substituting a part of the internal sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a corresponding sequence of a human-derived VEGF analogous protein. Preferably, there is provided a chimera protein which is obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a human-derived VEGF analogous protein in such a way that at least the sequences of the loop 1 region (amino acid residues 47 to 80) and the loop 3 region (amino acid residues 89 to 132) of the VEGF analogous protein are maintained.
  • Preferably, a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) belongs to the VEGF-E family. More preferably, it is VEGF-ENZ-7, VEGF-ED1701, or VEGF-ENZ-2.
  • Preferably, a human-derived VEGF analogous protein is PIGF.
  • Preferably, the chimera protein of the present invention is obtained by substituting 10 to 50 amino acid residues at the carboxyl terminus of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with the carboxyl terminus of a human-derived VEGF analogous protein.
  • Preferably in the chimera protein of the present invention, the VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) belongs to the VEGF-E family, and the loop 1 region of amino acid residues 47 to 80 and the loop 3 region of amino acid residues 89 to 132 in the protein belonging to the VEGF-E family are substantially retained.
  • According to embodiments of the present invention, there is provided a chimera protein having any of the following amino acid sequences:
  • (A) the amino acid sequence as shown in SEQ ID NO: 8, 9, or 10;
  • (B) amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 8, 9, or 10 by deletion, substitution, and/or addition of one or several amino acids and having an activity of growing vascular endothelial cells; and
  • (C) an amino acid sequence having 60% or more homology to the amino acid sequence as shown in SEQ ID NO: 8, 9, or 10 and having an activity of growing vascular endothelial cells.
  • Embodiments of the present invention provide a chimera protein comprising: any of the amino acid sequences as shown in (A) to (F) below; an amino acid sequence derived from any of the amino acid sequences as shown in (A) to (F) below by deletion, substitution, and/or addition of one or several amino acids and having an activity of growing vascular endothelial cells; or an amino acid sequence having 60% or more homology to any of the amino acid sequences as shown in (A) to (F) below and having an activity of growing vascular endothelial cells.
  • (A) an amino acid sequence obtained by substituting the sequence Tyr-Leu-Gly-Glu (amino acids 54 to 57 of SEQ ID NO: 7) with Asp-Val-Val-Ser (SEQ ID NO: 21) in the amino acid sequence as shown in SEQ ID NO: 7;
  • (B) an amino acid sequence obtained by substituting the sequence Ser-Thr-Asn (amino acids 62 to 64) with Glu-Val-Glu in the amino acid sequence as shown in SEQ ID NO: 7;
  • (C) an amino acid sequence obtained by substituting the sequence Leu-Gln-Tyr-Asn (amino acids 65 to 68 of SEQ ID NO: 7)) with His-Met-Phe-Ser (SEQ ID NO: 22) in the amino acid sequence as shown in SEQ ID NO: 7;
  • (D) an amino acid sequence obtained by substituting the sequence Trp-Met-Arg-Thr-Leu-Asp-Lys (amino acids 37 to 43 of SEQ ID NO: 7) with Phe-Gln-Glu-Val-Trp-Gly-Arg (SEQ ID NO: 23) in the amino acid sequence as shown in SEQ ID NO: 7;
  • (E) an amino acid sequence obtained by substituting the sequence Lys-Pro-Arg-Asp-Thr-Val (amino acids 47 to 52 of SEQ ID NO: 7) with Arg-Ala-Leu-Glu-Arg-Leu (SEQ ID NO: 24) in the amino acid sequence as shown in SEQ ID NO: 7; or
  • (F) an amino acid sequence obtained by substituting the sequence Leu-Gln-Arg-Ile (amino acids 119 to 122 of SEQ ID NO: 7)) with Tyr-Val-Glu-Leu (SEQ ID NO: 25) in the amino acid sequence as shown in SEQ ID NO: 7.
  • Embodiments of the present invention provide a chimera protein which has any of the amino acid sequences shown below:
  • (A) an amino acid sequence as shown in SEQ ID NO: 15;
  • (B) an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 15 by deletion, substitution, and/or addition of one or several amino acids and having an activity of growing vascular endothelial cells, and
  • (C) an amino acid sequence having 60% or more homology to the amino acid sequence as shown in SEQ ID NO: 15 and having an activity of growing vascular endothelial cells.
  • Another aspect of the present invention provides a medicament comprising any of the aforementioned chimera proteins of the present invention.
  • A further aspect of the present invention provides an activator for KDR (VEGF receptor-2) receptor comprising any of the chimera proteins of the present invention.
  • A further aspect of the present invention provides an agent for growing vascular endothelial cells comprising any of the chimera proteins of the present invention.
  • A further aspect of the present invention provides DNA encoding any of the chimera proteins of the present invention.
  • A further aspect of the present invention provides an expression vector comprising the DNA according to the present invention.
  • A further aspect of the present invention provides a medicament comprising the expression vector according to the present invention.
  • A further aspect of the present invention provides an activator for KDR (VEGF receptor-2) receptor comprising the expression vector according to the present invention.
  • A further aspect of the present invention provides an agent for growing vascular endothelial cells comprising the expression vector according to the present invention.
  • A further aspect of the present invention provides a transformant having the expression vector according to the present invention.
  • A further aspect of the present invention provides a process for producing any of the chimera proteins of the present invention wherein the transformant according to the present invention is used.
    • BRIEF DESCRIPTION OF DRAWINGS
  • FIG. 1 shows an interrelationship between VEGF-EN27 protein and VEGF receptor.
  • FIG. 2 shows the structures of VEGF-EN27 chimera proteins (VEGF-E-NP, VEGF-F-CP, VEGF-E-NP/CP).
  • FIG. 3 shows the preparation of VEGF-EN27 chimera protein.
  • FIG. 4 shows the result of the experiment for competitive inhibition of VEGF-EN27 chimera protein on the KDR receptor.
  • FIG. 5 shows the result of the experiment for assaying the autophosphorylation of KDR receptor.
  • FIG. 6 shows the result of the experiment on vascular endothelial cell growth.
  • FIG. 7 shows the nucleotide sequence (SEQ ID NO: 16) and the amino acid sequence (SEQ ID NO: 7) of VEGF-E-His.
  • FIG. 8 shows the nucleotide sequence (SEQ ID NO: 17) and the amino acid sequence (SEQ ID NO: 8) of VEGF-E-NP-His.
  • FIG. 9 shows the nucleotide sequence (SEQ ID NO: 18) and the amino acid sequence (SEQ ID NO: 9) of VEGF-E-CP-His.
  • FIG. 10 shows the nucleotide sequence (SEQ ID NO: 19) and the amino acid sequence (SEQ ID NO: 10) of VEGF-E-NP/CP-His.
  • FIG. 11 shows the nucleotide sequence (SEQ ID NO: 20) and the amino acid sequence (SEQ ID NO: 11) of hPIGF-I-His.
  • FIG. 12 shows the structures of VEGF-E chimera proteins #19 to #27 and a summary of the results of the experiment for assaying the autophosphorylation of the KDR receptor and the experiment on vascular endothelial cell growth.
  • FIG. 13 shows the results of the experiment on competitive inhibition on the KDR receptor using the VEGF-E chimera proteins #19 to #27.
  • FIG. 14 shows the results of the experiment on vascular endothelial cell growth using the VEGF-E chimera proteins #19 to #27.
  • FIG. 15 shows the structures of VEGF-E chimera proteins #31 to #33 and a summary of the results of the experiment for assaying the autophosphorylation of the KDR receptor and the experiment on vascular endothelial cell growth.
  • FIG. 16 shows the results of the experiment on competitive inhibition on the KDR motor using the VEGF-E chimera proteins #31 to #33.
  • FIG. 17 shows the results of the experiment on vascular endothelial cell growth using the VEGF-E chimera proteins #31 to #33.
    •  BEST MODES FOR CARRYING OUT THE INVENTION
  • Processes and embodiments for carrying out the present invention are hereafter described in detail.
  • (1) Chimera Protein having an Activity of Growing Vascular Endothelial Cells
  • The chimera protein having an activity of growing vascular endothelial cells according to the present invention can be obtained by substituting a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) with a corresponding sequence of a human derived VEGF analogous protein.
  • The type of VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) is not particularly limited, and specific examples thereof include a protein belonging to the VEGF-E family. More specific examples include VEGF-ENZ-7, VEGF-ED1701, and VEGF-E 2 (Ogawa S. et al. Journal of Biological Chemistry, 273, 31273-31282, 1998; and Meyer M. et al. EMBO Journal 18, 363-374, 1999).
  • In one embodiment of the chimera protein of the present invention, the amino terminus and/or carboxyl terminus of a VEGF analogous protein having an activity of vascularization is substituted with the amino terminus and/or carboxyl terminus of a human-derived VEGF analogous protein. The region that is substituted with the human-derived VEGF analogous protein may be only the amino terminus or only the carboxyl terminus of the VEGF analogous protein, or may be both the amino and carboxyl termini. The length of the amino terminus to be substituted is not particularly limited as long as the resulting chimera protein remains the activity of growing vascular endothelial cells. Preferably 10 to 50 amino acid residues, more preferably 20 to 40 amino acid residues, and particularly preferably 20 to 30 amino acid residues at the amino terminus are substituted with the amino terminus of a human-derived VEGF analogous protein. Similarly, the length of the carboxyl terminus to be substituted is not particularly limited as long as the resulting chimera protein remains the activity of growing vascular endothelial cells. Preferably 10 to 50 amino acid residues, more preferably 10 to 40 amino acid residues, further preferably 10 to 30 amino acid residues, and particularly preferably 10 to 20 amino acid residues at the carboxyl terminus are substituted with the carboxyl terminus of a human-derived VEGF analogous protein.
  • In another embodiment of the chimera protein of the present invention, a part of the internal sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) is substituted with a corresponding sequence of a human-derived VEGF analogous protein. Preferably, a part of the sequence of a VEGF analogous protein having an activity of vascularization that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) is substituted with a human-derived VEGF analogous protein in such a way that at least the sequences of the loop 1 region (amino acid residues 47 to 80) and the loop 3 region (amino acid residues 89 to 132) of the VEGF analogous protein are maintained.
  • In another embodiment of the chimera protein of the present invention, the amino terminus and/or carboxyl terminus of a VEGF analogous protein having an activity of vascularization is substituted with the ammo terminus and/or carboxyl terminus of a human-derived VEGF analogous protein, and at thy same time, a part of the internal sequence of the VEGF analogous protein is substituted with a corresponding sequence of the human-derived VEGF analogous protein.
  • Preferably, the VEGF analogous protein having an activity of vascularization according to the present invention belongs to the VEGF-E family. VEGF-E is a protein of 149 amino acids, and is composed of:
  • (I) the amino terminal region comprising a signal peptide (amino acid residues 1 to 46);
  • (II) loop 1 region (amino acid residues 47 to 80);
  • (III) loop 2 region (amino acid residues 81 to 88);
  • (IV) loop 3 region (amino acid residues 89 to 132); and
  • (V) the carboxyl terminal region (amino acid residues 133 to 148) (Ogawa S. et al., Journal of Biological Chemistry, 273, 31273-31282, 1998). Among the aforementioned regions, since the importance of the loop 3 region in binding with KDR (VEGF receptor-2) is suggested, it is preferred that the chimera protein of the present invention substantially maintains the loop 3 region of amino acid residues 89 to 132 of VEGF-E.
  • The chimera protein of the present invention is obtained by substituting the amino terminus and/or carboxyl terminus of a VEGF analogous protein with the amino terminus and/or carboxyl terminus of a human-derived VEGF analogous protein, respectively. This can lower the antigenicity of the VEGF analogous protein. The types of human-derived VEGF analogous proteins are not particularly limited, and examples thereof include PIGF, and particularly, hPIGF1.
  • The aforementioned chimera proteins may have addition, deletion, substitution, and/or modification in a portion of their amino acid sequence, as long as the proteins remain the activity of growing vascular endothelial cells.
  • Specific examples of the chimera proteins of the present invention include those having any of the following amino acid sequences:
  • (A) the amino acrid sequence as shown in SEQ ID NO: 8, 9, 10, or 15 or the amino acid sequence having the substitution specified herein in the amino acid sequence of SEQ ID NO: 7;
  • (B) an amino acid sequence derived from the amino acid sequences as defined in (A) by deletion, substitution, and/or addition of one or several amino acids and having an activity of growing vascular endothelial cells; and
  • (C) an amino acid sequence having 60% or more homology to the amino acid sequences as defined in (A) and having an activity of growing vascular endothelial cells.
  • The phrase “an amino acid sequence derived from . . . by deletion, substitution, and/or addition of one or several amino acids” used herein refers to an amino acid sequence in which, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, and further preferably 1 to 5 amino acids are deleted, substituted, and/or added.
  • The term “the amino acid sequence having 60% or more homology to the amino acid sequence” used herein refers to having homology of at least 60%. Homology is preferably 70% or more, more preferably 80% or more, further preferably 90% or more, and particularly preferably 95% or more.
  • The proteins which have an amino acid sequence derived from a certain amino acid sequence by deletion, substitution, and/or addition of one or several amino acids and having an activity of growing vascular endothelial cells or an amino acid sequence having 60% or more homology with a certain amino acid sequence and having an activity of growing vascular endothelial cells, can be produced or obtained using common recombinant techniques including site-specific mutagenesis) described in, for example, Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1989), or Current Protocols in Molecular Biology, John Wiley & Sons (1987-1997) and using DNA encoding a protein having an amino acid sequence as shown in any of SEQ ID Nos: 7 to 11.
  • (2) Process for Producing Chimera Protein having an Activity of Growing Vascular Endothelial Cells
  • A process for producing the chimera protein of the present invention is hereafter described in detail.
  • A gene encoding a VEGF analogous protein (e.g., the VEGF-E gene) that binds to KDR (VEGF receptor-2) but does not bind to Flt-1 (VEGF receptor-1) and has an activity of vascularization or a modified gene thereof is used as a starting material, and DNA fragment is cut out using a suitable restriction enzyme. Alternatively, a desired DNA fragment which encodes the VEGF analogous protein is prepared by PCR or the like.
  • Separately, DNA which encodes the amino terminus and/or carboxyl terminus of the human-derived VEGF analogous protein to be substituted or a partial internal sequence thereof is prepared. The DNA which encodes the amino terminus and/or carboxyl terminus of the human-derived VEGF analogous protein or a partial internal sequence thereof may be obtained by cleaving out a desired DNA fragment using a suitable restriction enzyme from a gene encoding the human-derived VEGF analogous protein. Alternatively, a desired DNA fragment may by amplified by PCR or may be obtained by chemical synthesis using a DNA synthesizer.
  • Subsequently, the DNA fragments obtained above can be bound to each other using a suitable DNA ligase. In this case, an oligonucleotide may be inserted to align the reading frames, or a part of the nucleotide sequence may be altered to create an identical restriction site.
  • Any plasmid to which DNA is to be inserted can be used as long as it can be replicated and retained in a host, and examples include pBR322 and pUC18 derived from Escherichia coli, and pET-3c constructed based thereon.
  • Examples of methods for inserting DNA into plasmid include a method described in T. Maniatis et al., Molecular Cloning, Cold Spring Harbor Laboratory, p. 239 (1982).
  • A cloned gene encoding a chimera protein can be used to construct an expression vector by ligating the gene downstream of the promoter in a vector which is suitable for expression.
  • Examples of expression vectors that can be used in the present invention include: the plasmid derived from Escherichia coli (pBR322, pBR325, pUC12, pUC13, pET-3); plasmid derived from Bacillus subtilis (pUB110, pTP5, pC194); plasmid derived from yeast (pSH19, pSH15); bacteriophage such as λphage or its derivative; animal viruses such as retrovirus and vaccinia virus; and insect viruses (e.g., baculovirus).
  • The gene may have at its 5′ terminus ATG as a translation initiation codon, and may have at its 3′ terminus TAA, TGA, or TAG as a translation termination codon. In order to express the gene, a promoter is connected upstream thereof. Any promoter can be used in the present invention as long as it is suitable in respect of the host that is used in the gene expression.
  • When the host for transformation is Escherichia coli, trp promoter, lac promoter, rec A promoter, λPL promoter, Ipp promoter, T7 promoter, and the like are preferable. When a host is Bacillus subtilis, SP01 promoter, SP02 promoter, penP promoter, and the like are preferable. When a host is yeast, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, and the like are preferable. When a host is an animal cell, preferable promoters include SV40-derived promoter and a retrovirus promoter.
  • A vector comprising recombinant DNA having DNA encoding the chimera protein of the present invention thus prepared is used to prepare a transformant which has the vector.
  • Examples of hosts include Escherichia coli (e.g., BL21, BL21(DE3), BL21(DE3)pLysS, and BL21(DE3)pLysE), Bacillus subtilis (e.g., Bacillus subtilis DB105), yeast (e.g., Pichia pastoris, and Saccharomyces cerevisiae), animal cells (e.g., COS cell CHO cell, BHK cell, NIH3T3 cell, BALB/c3T3 cell, HUVE cell, and LEII cell), and insect cells.
  • The aforementioned transformation can be carried out in accordance with commonly employed methods regarding each host. For example, when a host is Escherichia coli, a vector comprising recombinant DNA is introduced by the heat shock method, electroporation, or the like into a competent cell that was prepared by the calcium method or other methods. When a host is yeast, a vector comprising recombinant DNA is introduced by the heat shock method, electroporation, or the like into a competent cell that was prepared by the lithium method or other methods. When a host is an animal cell a vector comprising recombinant DNA is introduced into a cell by the calcium phosphate method, lipofection method, electroporation method, or the like.
  • A transformant which has an expression vector comprising DNA that encodes the chimera protein of the present invention can be obtained by the above method. The chimera protein of the present invention can be produced by culturing the transformant in a suitable medium.
  • When a transformant is cultured, a commonly used medium can be used for each host. For example, LB Medium can be used in the case of Escherichia coli, YPD Medium can be used in the case of yeast, and a medium prepared by adding animal serum to Dulbecco's MEM can be used in the case of the animal cell.
  • A transformant can be cultured under general conditions for each host. For example, when a host is Escherichia coli, culturing is conducted at about 30 to 37° C. for about 3 to 24 hours, and if necessary, aeration or agitation can be applied. When a host is yeast, culturing is conducted at about 25 to 37° C. for about 12 hours to 2 weeks, and if necessary, aeration or agitation can be applied. When a host is an animal cell culturing is conducted at about 32 to 37° C. under 5% CO2 and 100% humidity for about 24 hours to 2 weeks, and if necessary, the condition of the gas phase can be altered or agitation can be applied.
  • When the chimera protein of the present invention is expressed using an insect cell as a host, a protein can be expressed in accordance with the method described in, for example, Baculovirus Expression Vectors, A Laboratory Manual; Current Protocols in Molecular Biology; and Bio/Technology, 6, 47 (1988).
  • Specifically, a recombinant gene-introduced vector and baculovirus are co-introduced into an insect cell so as to obtain a recombinant virus in a culture supernatant of the insect cell. Thereafter, the insect cell is further infected with the recombinant virus, thereby expressing the protein.
  • Examples of a vector for introducing the gene that is used in the above method include pVL1392, pVL1393, and pBlueBacIII (all available from Invitrogen).
  • As the baculovirus, for example, Autographa californica nuclear polyhedrosis virus, which is a virus infecting an insect belonging to the genus Mamestra, can be used.
  • As the insect cell, for example, ovarian cells of Spodoptera frugiperda, Sf9 and Sf21 (Baculovirus Expression Vectors, A laboratory Manual, W. H. Freeman and Company, New York, 1992) and an ovarian cell of Trichoplusia ni, High5, (Invitrogen) can be used.
  • Examples of methods for co-introducing the recombinant gene-introduced vector and the baculovirus in the insect cell for the preparation of the recombinant virus include the calcium phosphate method (JP Patent Publication (Unexamined Application) No. 2-227075) and lipofection method (Proc. Natl. Acad. Sci. USA, 84, 7413 (1987)).
  • Medium that can be used for culturing the transformant obtained by using the insect cell as a host cell includes commonly used TNM-FH medium (Pharmingen), Sf-900 II SFM medium (GIBCO BRL), ExCell 400 and ExCell 405 (JRH Biosciences), and Grace's Insect Medium (Gram, T. C. C., Nature, 195, 788 (1962)). Culturing is generally conducted under conditions of, for example, pH 6 to 7 at 25 to 30° C. for 1 to 5 days. If necessary, an antibiotic such as gentamicin may be added to the medium during the culture.
  • In order to extract the chimera protein of the present invention from the microorganisms or cell of the aforementioned culture product, the chimera protein may be directly purified from the culture supernatant, or alternatively after culturing of the transformant, microorganisms or cells are disrupted by means of a homogenizer, French press, ultrasound, lysozyme, and/or freeze and thawing to eluate the chimera protein of interest extracellularly, and thereby obtain the chimera protein from the soluble fraction. When a chimera protein of interest is contained in insoluble fractions, a method for collecting bacterial bodies or cells can be performed by first disrupting bacterial bodies or cells, collecting insoluble fractions by centrifugation, and solubilizing them by a buffer comprising guanidine hydrochloride and the like. Alternatively, bacterial bodies or cells are directly disrupted by a buffer comprising a protein denaturing agent such as guanidin hydrochloride to eluate the chimera protein of interest extracellularly.
  • The chimera protein of the present invention can be purified from the aforementioned soluble fractions by suitably combining conventional separation and purification methods. Examples of such methods include salting-out, solvent precipitation, dialysis, ultrafiltration, gel filtration, SDS-polyacrylamide gel electrophoresis, ion-exchange chromatography, affinity chromatography, reverse phase high-performance liquid chromatography, and isoelectric focusing.
  • When a histidine tag is fused with the chimera protein of the present invention and the fused protein is expressed, a nickel carrier such as Ni-NTA agarose can be used to specifically adsorb the histidine tag-fused chimera protein for the recovery.
  • (3) Medicament Comprising a Chimera Protein having an Activity of Growing Vascular Endothelial Cells or an Expression Vector Comprising DNA Encoding a Chimera Protein having an Activity of Growing Vascular Endothelial Cells
  • The chimera protein of the present invention has an activity of growing vascular endothelial cells. Circulatory disorders caused by a vascular system abnormality are observed in numerous diseases, and specific examples of such diseases include angina pectoris, heart infarction, lower extremity circulatory failures caused by diabetes, and arterial occlusive diseases. Administration of the chimera protein of the present invention or an expression vector comprising DNA encoding the chimera protein to the patients suffering from the aforementioned diseases can impart therapeutic effects through the growth action on vascular endothelial cells. Since the chimera protein of the present invention can activate the KDR (VEGF receptor-2) receptor, it is also useful as a therapeutic or preventive agent for diseases involving abnormality in the activity of the KDR (VEGF receptor-2) receptor.
  • As described above, the chimera protein of the present invention is useful as a medicament.
  • The chimera protein of the present invention can be formulated into pharmaceutical compositions such as solutions, injections, powders, granules, tablets, suppositories, enteric pills or tablets, and capsules by using, for example, a pharmaceutically acceptable solvent, excipient, carrier, and adjuvant in accordance with conventional techniques.
  • The content of the chimera protein of the present invention which is an active ingredient in the pharmaceutical composition may be about 0000001 to 1.0% by weight. These pharmaceutical compositions can be safely administered to mammal animals such as human, mouse, rat, rabbit, dog, and cat, and particularly preferably to human as an activator for KDR (VEGF receptor-2) receptor or an agent for growing vascular endothelial cells. Any route of administration such as local, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, or percutaneous administration can be employed.
  • The dose of the chimera protein of the present invention should be properly increased or decreased depending on conditions such as age, sex, weight, or symptom of the patient, and route of administration. For example, when administered to mammalian animals including human, the chimera protein can be administered in an amount of approximately 0.01 μg to 10 mg/kg (body weight) per day.
  • An expression vector comprising DNA encoding the chimera protein of the present invention can be formulated in order to be administered in any route of administration such as local, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, or percutaneous administration. Preferably, the expression vector is used in a form of injection. For example, the expression vector of the present invention can be mixed with a pharmaceutically acceptable excipient to prepare an injection. Examples of injections include an aseptic solution and an isotonic solution. Alternatively, it can be formulated as a dry composition, particularly as a freeze-dried composition, and these can be formulated into an injection by adding sterilized water or physiological saline at the time of use thereof.
  • The dose of the expression vector of the present invention should be properly increased or decreased depending on conditions such as age, sex, weight, or symptom of the patient, and route of administration. In general, the amount of DNA as an active ingredient is in the range of about 1 μg/kg to 1000 mg/kg per day per adult, and preferably in the range of about 10 μg/kg to 100 mg/kg per day per adult.
  • The present invention will be described in more detail with reference to the following examples, but the present invention is not limited by these examples.
    • EXAMPLES Example 1 Cells and Culture Conditions
  • Ex-Cell 400 (JRH Biosciences, Lenexa, Kans.) was used as a culture solution for Sf9 insect cells (Invitrogen, CA, USA). NIH3T3 mouse fibroblast and a cell strain NIH3T3-KDR which strongly expresses a human VEGF receptor, KDR (VEGFR-2), were used in the experiment for assaying the KDR autophosphorylation by ligand binding. The NIH3T3-KDR cell was produced by Sawano et al. (Sawano A. et al. Cell growth and Differentiation, 7, 213-221, 1996). The NIH3T3 cell and the NIH3T3-KDR cell were maintained in a medium obtained by adding 10% bovine serum, 2 mM L-glutamine, and 200 μg/ml G418 (Geneticin; Life Technologies, Inc., Grand Island, N.Y.) to Dulbecco's Modified Eagle's Medium (DMEM, Nissui, Tokyo). Human umbilical vein endothelial cells (HUVEC, Morinaga, Tokyo) were maintained in HUVE culture medium (Morinaga, Tokyo) and used in the assay for the endothelial cell growth. Recombinant human VEGF165 was forcibly expressed in the Sf9 cells by baculovirus system and then purified from the culture supernatant using a haparin column and used. Fc-fused 7N-sKDR (free KDR) was used in the experiment for ligand binding (Shinkai A. et al. J. Biol. Chem. 273, 31283-31288, 1998).
    • Example 2 Production of Mutant Chimera VEGF-EN27 Proteins VEGF-E-NP, VEGF-E-CP, VEGF-E-NP/CP
  • The following three types of VEGF-EN27/human PIGF-1 (hereinafter referred to as “hPIGF-1”) chimera proteins were produced (FIG. 2):
  • (1) chimera protein VEGF-E-NP prepared by substituting 34 amino acid residues at the amino terminus of VEGF-EN27 with 40 amino acid residues at the amino terminus of hPIGF-1;
  • (2) VEGF-E-CP prepared by substituting 18 amino acid residues at the carboxyl terminus of VEGF-EN27 with 21 amino acid residues at the carboxyl terminus of hPIGF-1; and
  • (3) VEGF-E-NP/CP prepared by substituting both the amino and carboxyl terminuses of VEGF-EN27 with those of hPIGF-1.
  • The above three types of chimera proteins were fused with histidine tags to simplify the purification. The method in which DNA encoding each chimera protein was prepared and subcloned into vector pUC18 is described below.
  • The nucleotide sequence and the amino acid sequence of VEGF-E-His are shown in FIG. 7 and SEQ ID NO: 7, the nucleotide sequence and the amino acid sequence of VEGF-E-NP-His are shown in FIG. 8 and SEQ ID NO: 8, the nucleotide sequence and the amino acid sequence of VEGF-E-CP-His are shown in FIG. 9 and SEQ ID NO: 9, the nucleotide sequence and the amino acid sequence of VEGF-E-NP/CP-His are shown in FIG. 10 and SEQ ID NO: 10, and the nucleotide sequence and the amino acid sequence of hPIGF-1-His are shown in FIG. 11 and SEQ ID NO: 11. (VEGF-E-CP and VEGF-E-NP)
  • pUC18-VEGF-E-His, which is plasmid DNA prepared by subcloning a full-length DNA of the VEGF-E gene fused with a histidine tag at its carboxyl terminus into pUC18, was cleaved with a restriction enzyme. A fragment (3 kb) that was obtained by cleaving with DraIII and EcoRI and a fragment (about 3 kb) obtained by cleaving with Pf1MI and BamHI were purified by the gene clean method. Also, 6 oligonucleotides were produced and purified by HPLC (Amersham Pharmacia Biotech (Tokyo)):
  • S155:
    (SEQ ID NO: 1)
    5′-GTGCGAATGCC-3′
    S156:
    (SEQ ID NO: 2)
    5′-CATTCGCACTTT-3′
    S150:
    (SEQ ID NO: 3)
    5′-GGCCTCTGCGGGAGAAGATGAAGCCGGAAAGGTGCGGCGATGCTGTT
    CCCCGGAGGCACCATCACCATCACCATTAAG-3′
    S151:
    (SEQ ID NO: 4)
    5′-AATTCTTAATGGTGATGGTGGATGGTGCCTCCGGGGAACAGCATCGC
    CGCACCTTTCCGGCTTCATCTTCTCCCGCAGAGGCCGG-3′
    S166:
    (SEQ ID NO: 5)
    5′-GATCCATGCCGGTCATGAGGCTGTTCCCTTGCTTCCTGCAGCTCCTG
    GCCGGGCTGGCGCTGCCTGCTGTGCCCCCCCAGCAGTGGGCCTTGTCTGC
    TGGGAACGGCTCGTCAGAGGTGGAAGTGAATGA-3′
    S167:
    (SEQ ID NO: 6)
    5′-TTCACTTCCACCTCTGACGAGCCGTTCCCAGCAGACAAGGCCCACTG
    CTGGGGGGGCACACGAGGCAGCGCCAGCCCGGCCAGGAGCTGCAGGAAGC
    AAGGGAACAGCCTCATGACCGGCATG-3′
  • S150 and S151, S155 and S156, and S166 and S167 (10 μg/ml each) were boiled under conditions of 10 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 1 mM DTT, and 100 mM NaCl for 10 minutes, and then allowed to stand at room temperature for annealing. Subsequently, a DNA fragment comprising VEGF-E purified by the gene clean method and the annealed oligonucleotides were ligated to each other by DNA ligase, followed by molecular cloning on the plasmid vector. The DNA fragment of DraIII/EcoRI and oligonucleotides of S150/S151 and S155/S156 were ligated for VEGF-E-CP by DNA ligase. The DNA fragment of Pf1MI/BamHI and oligonucleotides of S166/S167 were ligated for VEGF-E-NP by DNA ligase. Thus, a histidine tag was fused to the carboxyl terminus. The full-length DNAs which encoded VEGF-E-CP and VEGF-E-NP were subcloned into the pUC18 plasmid vector. The plasmids were respectively designated as pUCE-CP and pUCE-NP.
    • (VEGF-E-NP/CP)
  • pUCE-CP and pUCE-NP were Cleaved with BsrGI and EcoRI and 200 bp and 3 kb DNA fragments respectively obtained therefrom were purified by the gene clean method, followed by ligation with DNA ligase. Thus, a histidine tag was fused to the carboxyl terminus. The full-length DNA which encoded the VEGF-E-NP/CP was subcloned into pUC18, and this plasmid DNA was designated as pUCE-NP/CP.
  • Subsequently, each of the subcloned DNAs was cleaved out and subcloned into a baculovirus vector. Each DNA of pUCE-CP, pUCE-NP and pUCE-NP/CP was cleaved with BamHI and EcoRI and 450 bp fragments were purified by the gene clean method. The fragments were cloned into the BamHI and EcoRI site in the multicloning sites of pVL1393 (Invitrogen) which is a baculovirus vector. These plasmid DNAs were designated as pVL3E-CP, pVL3E-NP, and pVL3E-NP/CP.
    • Example 3 Preparation of VEGF-E Chimera Protein
  • By using DNAs of pVL3E-CP, pVL3E-NP and pVL3E-NP/CP and Baculogold (Pharmingen, San Diego, Calif.) of baculovirus DNA, transfection into Sf9 cells was performed by lipofectin met Recombinant viruses having DNA encoding the chimera protein were amplified by repeating incubation for 3 to 4 days. In order to express the chimera protein, infection with the recombinant virus Sf9 cells was carried out at the multiplicity of infection (MOI) (i.e., the number of virus particles per cell) of 10. After the incubation for 3 days, a culture solution to which the chimera protein had been secreted was collected.
  • Subsequently, the culture solution was concentrated. In order to concentrate 150 ml of culture solution to 15 ml, an agitation-type ultrafilter device (MILLIPORE, USA) was used. The concentrate was subjected to dialysis in 20 mM sodium phosphate buffer (pH 8.0), 10 mM imidazole, 300 mM NaCl, and 20% glycerol in order to negatively charge the histidine tag that was fused with the recombinant protein.
  • After the dialysis, the histidine tag-fused protein was specifically adsorbed using Ni-NTA agarose (QIAGEN, Germany). The Ni-NTA agarose to which the recombinant protein had been adsorbed was introduced into a column and washed with 20 mM sodium phosphate buffer (pH 8.0), 50 mM imidazole, 300 mM NaCl, and 20% glycerol, and the chimera protein of interest was eluted using 20 mM sodium phosphate buffer (pH 8.0), 250 mM imidazole, 300 mM NaCl, and 20% glycerol. Finally, the eluate was subjected to dialysis in 20 mM sodium phosphate buffer (pH 7.4), 50 mM NaCl, and 20% glycerol. The purified chimera protein was electrophoresed in 15% SDS-PAGE and analyzed by Coomassie staining and Western blotting using anti-histidine tag monoclonal antibody (anti-His-tagmAb), anti-VEGF-E serum, and anti-PIGF antibody. The purification level of the chimera protein was 80% or higher (FIG. 3).
    • Example 4 Experiment on Competitive Inhibition of VEGF-E Chimera Protein on KDR Receptor
  • Fc-fused 7N-sKDR was diluted to 3 μg/ml in physiological saline (hereinafter abbreviated to “PBS”), 50 μl thereof was added to each well of a 96-well cell culture plate (Immunon (registered trademark) 2HB, DYNEX TECHNOLOGIES, INC, VA), allowed to stand at 4° C. for 12 hours, and sKDR was then adsorbed on the plate. The plate was washed twice with a blocking buffer (PBS containing 1% bovine serum albumin), and blocking was carried out using the blocking buffer at 25° C. for 30 minutes. In the experiment on competitive inhibition, 50 μl of sample containing 16 μg/ml of 125I-radioactively labeled VEGF (1,200-1,800 Ci/mmol; Amersham Pharmacia Biotech) and 16-1,000 μg/ml of chimera protein was added to the sKDR-coated wells, a reaction was carried out at 25° C. for 3 hours, and the wells were then washed with a blocking buffer. The 125I-radioactively labeled VEGF bound to sKDR of each well was assayed using a γ-counter.
  • The results showed that the three types of chimera VEGF-EN27 proteins (VEGF-E-NP, VEGF-E-CP, VEGF-E-NP/CP) efficiently inhibited the binding of VEGF to KDR. This strongly indicates that the chimera VEGF-EN27 protein binds to KDR with high affinity (FIG. 4).
    • Example 5 Experiment for Assaying Autophosphorylation of KDR Receptor
  • In order to confirm that the chimera VEGF-EN27 proteins directly bind to and activate KDR, an experiment was carried out to assay the autophosphorylation of the KDR receptor by these proteins. Before the NIH3T3-KDR cells were stimulated with the chimera proteins, the cells were cultured until 60% confluent. Thereafter, the cells were exposed to low-concentration serum conditions in DMEM containing 0.5% bovine serum overnight. The cells were stimulated by each of the chimera proteins at a concentration of 1 to 500 ng/ml at 37° C. for 5 minutes. The cells were washed twice in ice-cooled PBS containing 0.1 mM Na3VO4, and then dissolved with a 1% Triton X-100 buffer solution (50 mM HEPES pH 7.4, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1.5 mM MgCl, 2% trasylol, 1 mM PMSF, 50 mM NaF, 10 mM Na4P2O7, 2 mM Na3VO4). The dissolved sample was centrifuged at 15,000 rpm for 10 minutes, and the supernatant was collected. The protein concentration in the supernatant was assayed using the Bio-Rad Protein Assay Kit (Richmond, Calif.), and an equivalent protein was used in the analysis. In the immunoblotting for analyzing the autophosphorylated KDR, the dissolved sample was electrophoresed in 7.5% SDS-PAGE and then transferred to a nitrocellulose membrane. The transferred nitrocellulose membrane was blocked with a blocking buffer (a washing buffer containing 5% BSA [20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Tween 20]), and binding reaction was then carried out with a blocking buffer containing a primary antibody.
  • Signals obtained by Western blotting were analyzed using horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence reagents (ECL, Amersham).
  • As a result, the three types of chimera VEGF-EN27 proteins (VEGF-E-NP, VEGF-E-CP, VEGF-E-NP/CP) were found to activate the tyrosine kinase of the KDR receptor in a dosage-dependent manner (FIG. 5).
    • Example 6 Experiment for Vascular Endothelial Cell Growth
  • The HUVEC (Morinaga, Tokyo) which were cultured in the medium for HUVE culture (Nissui) containing growth factors, FGF, added thereto, were inoculated on a 24-well plate (CellTite C-1 Plate 24F, Akita Sumitomo Bakelite Co., Ltd., Akita) in amounts of 4,000 cells, and allowed to stand in an incubator at 37° C. for 4 hours to adsorb the cells. The chimera VEGF-ED protein was directly added to the medium to a final concentration of 50 ng/ml, and cultured for 3 days. The cells were fixed with formalin and then stained with Crystal Violet. The number of cells was counted, and relatively compared to analyze the endothelial cell growth. The results showed that the chimera protein had the equivalent activity of endothelial cell growth as the VEGF-E protein in vitro (FIG. 6).
    • (Summary of Examples 1 to 6)
  • From the above results, the three types of chimera VEGF-EN27 proteins (VEGF-E-NP, VEGF-E-CP, VEGF-E-NP/CP) were found to bind to KDR with high affinity, accelerate the autophosphorylation of KDR, and stimulate the vascular endothelial cell growth. The antigenicity of the protein is known to be relatively strong at free termini such as an ammo or carboxyl terminus, however, both termini of VEGF-E were found to be unnecessary for activating KDR tyrosine kinase and could be substituted with a human-derived protein such as PIGF used in the Example Accordingly, these chimera VEGF-EN27 proteins (VEGF-E-NP, VEGF-E-CP, VEGF-E-NP/CP) are considered to be usable as safer vascularization factors than the original VEGF-EN27 proteins.
    • Example 7 Production of Chimera VEGF-E Proteins #19 to #27 and #31 to #33
  • (1) Production of Chimera VEGF-E Proteins #19 to #27
  • The amino acid sequence of the substituted region is shown below. The nucleotide sequence of PIGF was used for that of the substituted region. Structures of the chimera VEGF-E proteins #19 to #27 are shown in FIG. 12.
  • #19: the amino acid sequence from residues #54-57 (YLGE) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (DVVS) (SEQ ID NO: 21) of the corresponding region in human PIGF.
    #20: the amino acid sequence from residues #62-64 (STN) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (EVE) of the corresponding region in human PIGF.
    #21: the amino acid sequence from residues #65-68 (LQYN) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (HMFS) (SEQ ID NO: 22) of the corresponding region in human PIGF.
    #22: the amino acid sequence from residues #3743 (WMRTLDK) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (FQEVWGR) (SEQ ID NO: 23) of the corresponding region in human PIGF.
    #23: the amino acid sequence from residues #47-52 (KPRDTV) (β chain #1) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (RALERL) (SEQ ID NO: 24) of the corresponding region in human PIGF.
    #24: the amino acid sequence from residues #98-101 (VTVS) (β chain #6, between cysteine 6 and cysteine 7) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (MQLL) (SEQ ID NO: 26) of the corresponding region in human PIGF.
    #25: the amino acid sequence from residues #102-104 (VTG) (a portion of loop 3) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (KTR) of the corresponding region in human PIGF.
    #26: the amino acid sequence from residues #119-122 (LQRI) ( β chain # 7, 11 amino acid residues upstream region from the 7th cysteine) of VEGF-E (SEQ ID NO: 7) is substituted with the amino acid sequence (YVEL) (SEQ ID NO: 25) of the corresponding region in human PIGF.
    #27: the amino acid sequence from residues #111-118 (TNSGVSTN) (VEGF-E-specific amino acid sequence) of VEGF-E (SEQ ID NO: 7) is removed (deletion mutation).
  • (2) Production of Chimera VEGF-E Proteins #31 to #33
  • The structures of the chimera proteins are shown below as nucleotide sequences. The structures of chimera VEGF-E proteins #31 to #33 are shown in FIG. 15.
  • Boxed portions: cysteine sites (the 2nd, 3rd, 4th, and 5th)
  • Underlined portions: VEGF-E sequences
  • Fundamental nucleotide sequence: PIGF-I
  • #31 (SEQ ID NO: 12): the amino acid sequence between the 2nd cysteine and the 3rd cysteine of human PIGF is substituted with the corresponding amino acid sequence of VEGF-E
  • Figure US20080319174A1-20081225-C00001
  • #32 (SEQ ID NO: 13): the amino acid sequence between the 4th cysteine and the 5th cysteine of human PIGF is substituted with the corresponding amino acid sequence of VEGF-E
  • Figure US20080319174A1-20081225-C00002
  • #33 (SEQ ID NO: 14): the amino acid sequence between the 2nd cysteine and the 3th cysteine and the amino acid sequence between the 4th cysteine and the 5th cysteine of human PIGF are substituted with the corresponding amino acid sequences of VEGF-E
  • Figure US20080319174A1-20081225-C00003
  • DNA fragments having the above sequences were constructed by conventional gene recombinant techniques, and VEGF-E chimera proteins (#19 to #27 and #31 to #33) were prepared in the same manner as in Example 3.
    • Example 8 Physiological Activities of Chimera VEGF-E Proteins #19 to #27 and #31 to #33
  • The VEGF-E chimera proteins (#19 to #27 and #31 to #33) prepared in Example 7 were used to perform an experiment on competitive inhibition on the KDR receptor (in the same manner as in Example 4), an experiment for assaying autophosphorylation of the KDR receptor (in the same manner as in Example 5), and an experiment on vascular endothelial cell growth (in the same manner as in Example 6).
  • FIG. 12 shows the structures of VEGF-E chimera proteins #19 to #27 and summarized results of the experiment for assaying the autophosphorylation of the KDR receptor and the experiment on vascular endothelial cell growth. FIG. 13 shows the assay result obtained by the experiment on competitive inhibition on KDR receptor. FIG. 14 shows the assay result obtained by the experiment on vascular endothelial cell growth.
  • FIG. 15 shows the structures of VEGF-E chimera proteins #31 to #33 and a summary of the results of the experiment for assaying the autophosphorylation of KDR receptor and the experiment of vascular endothelial cell growth. FIG. 16 shows the assay result obtained by the experiment on competitive inhibition on KDR receptor FIG. 17 shows the assay result obtained by the experiment on vascular endothelial cell growth.
  • As is apparent from the results shown in FIGS. 12 to 14, it was found that all the chimera proteins other than #24, #25, and #27 bind to KDR with high affinity, accelerate the autophosphorylation of KDR, and stimulate the growth of vascular endothelial cells. Accordingly, it was clarified that not only both termini of VEGF-E but also some internal sequences in VEGF-E can be substituted with human-derived protein such as PIGF.
  • As is apparent from the results shown in FIGS. 15 to 17, it was found that #33, which was obtained by substituting the amino acid sequence between the 2nd cysteine and the 3rd cysteine in human PIGF that exhibits no autophosphorylation of KDR receptor and no vascular endothelial cell growth (including loop 1 in the core region of human PIGF) and the amino acid sequence between the 4th cysteine and the 5th cysteine (including loop 3 in the core region of human PIGF) with the corresponding amino acid sequences of VEGF-E (respectively including loop 1 and loop 3 in the core region of VEGF-E), accelerates the autophosphorylation of KDR and stimulates the growth of vascular endothelial cells. Accordingly, loop 1 and loop 3 in the core region possibly play a role in the expression of physiological activities of VEGF-E.
    • INDUSTRIAL APPLICABILITY
  • The chimera VEGF-E of the present invention can be used as a safe vascularization factor since its antigenicity is reduced while maintaining the activity of growing vascular endothelial cells.

Claims (6)

1. A chimera protein which has any of the amino acid sequences shown below:
(A) the amino acid sequence which is obtained by deleting 1-20 amino acids of signal peptide at the amino-terminal region of the amino acid sequence as shown in SEQ ID NO: 15, or
(B) the amino acid sequence as shown in (A), in which one to ten amino acids are deleted, substituted, and/or added and which has an activity of growing vascular endothelial cells.
2. A chimera protein which has any of the amino acid sequences shown below:
(A) the amino acid sequence which is obtained by deleting 6 amino acids of histidine-tag at the carboxyl-terminal region from the amino acid sequence as shown in SEQ ID NO: 15, or
(B) the amino acid sequence as shown in (A), in which one to ten amino acids are deleted, substituted, and/or added and which has an activity of growing vascular endothelial cells.
3. A chimera protein which has any of the amino acid sequences shown below:
(A) the amino acid sequence which is obtained by deleting 1-20 amino acids of signal peptide at the amino-terminal region and 6 amino acids of histidine-tag at the carboxyl-terminal region from the amino acid sequence as shown in SEQ ID NO: 15, or
(B) the amino acid sequence as shown in (A), in which one to ten amino acids are deleted, substituted, and/or added and which has an activity of growing vascular endothelial cells.
4. The chimera protein according to claim 3, wherein the amino acid sequence is obtained by deleting 1-15 amino acids of signal peptide at the amino-terminal region and 6 amino acids of histidine-tag at the carboxyl-terminal region from the amino acid sequence as shown in SEQ ID NO: 15.
5. The chimera protein according to claim 3, wherein the amino acid sequence is obtained by deleting 1-10 amino acids of signal peptide at the amino-terminal region and 6 amino acids of histidine-tag at the carboxyl-terminal region from the amino acid sequence as shown in SEQ ID NO: 15.
6. The chimera protein according to claim 3, wherein the amino acid sequence is obtained by deleting 1-5 amino acids of signal peptide at the amino-terminal region and 6 amino acids of histidine-tag at the carboxyl-terminal region from the amino acid sequence as shown in SEQ ID NO: 15.
US12/142,601 2000-08-10 2008-06-19 Chimera humanized vascular endothelial growth factor Abandoned US20080319174A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/142,601 US20080319174A1 (en) 2000-08-10 2008-06-19 Chimera humanized vascular endothelial growth factor

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
JP2000-242629 2000-08-10
JP2000242629 2000-08-10
PCT/JP2001/006856 WO2002014367A1 (en) 2000-08-10 2001-08-09 Chimeric human-type vascular endothelial cell growth factor
US10/343,825 US7405278B2 (en) 2000-08-10 2001-08-09 Chimeric human-type vascular endothelial cell growth factor
US12/142,601 US20080319174A1 (en) 2000-08-10 2008-06-19 Chimera humanized vascular endothelial growth factor

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/JP2001/006856 Division WO2002014367A1 (en) 2000-08-10 2001-08-09 Chimeric human-type vascular endothelial cell growth factor
US10/343,825 Division US7405278B2 (en) 2000-08-10 2001-08-09 Chimeric human-type vascular endothelial cell growth factor

Publications (1)

Publication Number Publication Date
US20080319174A1 true US20080319174A1 (en) 2008-12-25

Family

ID=18733629

Family Applications (3)

Application Number Title Priority Date Filing Date
US10/343,825 Expired - Fee Related US7405278B2 (en) 2000-08-10 2001-08-09 Chimeric human-type vascular endothelial cell growth factor
US12/142,601 Abandoned US20080319174A1 (en) 2000-08-10 2008-06-19 Chimera humanized vascular endothelial growth factor
US12/142,613 Abandoned US20080319178A1 (en) 2000-08-10 2008-06-19 Chimera humanized vascular endothelial growth factor

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/343,825 Expired - Fee Related US7405278B2 (en) 2000-08-10 2001-08-09 Chimeric human-type vascular endothelial cell growth factor

Family Applications After (1)

Application Number Title Priority Date Filing Date
US12/142,613 Abandoned US20080319178A1 (en) 2000-08-10 2008-06-19 Chimera humanized vascular endothelial growth factor

Country Status (4)

Country Link
US (3) US7405278B2 (en)
EP (1) EP1323736A4 (en)
AU (1) AU2001277733A1 (en)
WO (1) WO2002014367A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001277733A1 (en) * 2000-08-10 2002-02-25 Center For Advanced Science And Technology Incubation, Ltd. Chimeric human-type vascular endothelial cell growth factor
WO2010083495A2 (en) 2009-01-18 2010-07-22 The Board Of Trustees Of The Leland Stanford Junior University Polypeptides targeting vascular endothelial growth factor receptor-2 and alpha v beta 3 integrin
US11210554B2 (en) 2019-03-21 2021-12-28 Illumina, Inc. Artificial intelligence-based generation of sequencing metadata

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5994300A (en) * 1991-03-28 1999-11-30 Merck & Co., Inc. Vascular endothelial cell growth factor C subunit
US20040038341A1 (en) * 2000-08-10 2004-02-26 Masabumi Shibuya Chimeric human-type vascular endothelial cell growth factor
US20050267024A1 (en) * 2000-02-25 2005-12-01 Ludwig Institute For Cancer Research Materials and methods involving hybrid vascular endothelial growth factor DNAs and proteins

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1680442A (en) * 1997-04-25 2005-10-12 科莱特诺医疗公司 Truncated VEGF-related proteins

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5994300A (en) * 1991-03-28 1999-11-30 Merck & Co., Inc. Vascular endothelial cell growth factor C subunit
US6140073A (en) * 1991-03-28 2000-10-31 Merck & Co., Inc. Vascular endothelial cell growth factor C subunit
US6569434B1 (en) * 1991-03-28 2003-05-27 Merck & Co., Inc. Vascular endothelial cell growth factor C subunit
US20050267024A1 (en) * 2000-02-25 2005-12-01 Ludwig Institute For Cancer Research Materials and methods involving hybrid vascular endothelial growth factor DNAs and proteins
US20040038341A1 (en) * 2000-08-10 2004-02-26 Masabumi Shibuya Chimeric human-type vascular endothelial cell growth factor
US7405278B2 (en) * 2000-08-10 2008-07-29 Masabumi Shibuya Chimeric human-type vascular endothelial cell growth factor

Also Published As

Publication number Publication date
US20080319178A1 (en) 2008-12-25
EP1323736A1 (en) 2003-07-02
US20040038341A1 (en) 2004-02-26
AU2001277733A1 (en) 2002-02-25
EP1323736A4 (en) 2005-08-24
US7405278B2 (en) 2008-07-29
WO2002014367A1 (en) 2002-02-21

Similar Documents

Publication Publication Date Title
KR101651703B1 (en) FGF21 Mutants and Uses Thereof
JP6608799B2 (en) Highly soluble leptin
US7576190B2 (en) FGF-21 fusion proteins
EP2763689B1 (en) Fibroblast growth factor 21 variants
KR100879662B1 (en) Glp-1 analog fusion protein formulations
KR100758755B1 (en) -1 glp-1 analog fusion proteins
EP2858662B1 (en) Fibroblast growth factor 21 proteins
JP4477013B2 (en) Fibroblast growth factor 21 mutein
JP2708099B2 (en) Erythropoietin analog
US20090111742A1 (en) Use of fgf-21 and thiazolidinedione for treating type 2 diabetes
WO2011153965A1 (en) Fusion protein of exendin-4 and its analog, preparation method and use thereof
CA2232749C (en) Truncated glial cell line-derived neurotrophic factor
US20220017584A1 (en) Growth differentiation factor 15 fusion proteins
WO2007047829A2 (en) Novel heterodimeric proteins and uses thereof
JP3946638B2 (en) Fusion protein with enhanced erythropoietin activity in vivo
US20080319174A1 (en) Chimera humanized vascular endothelial growth factor
KR20210010365A (en) Fusion tag for preparing protein or polypeptide
RU2812047C1 (en) Human interferon-beta variant with double mutation and method for improving stability of human interferon-beta variant
WO2023123776A1 (en) Growth hormone fusion protein and preparation method and use thereof
CN115989239A (en) Human interferon beta variants with double mutations and methods for improving the stability of human interferon beta variants
JP2001511641A (en) Interleukin-5 antagonist
WO2000078804A1 (en) Immune response regulatory proteins

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION