US20080227736A1 - Targeting Pseudotyped Retroviral Vectors - Google Patents
Targeting Pseudotyped Retroviral Vectors Download PDFInfo
- Publication number
- US20080227736A1 US20080227736A1 US11/628,586 US62858605A US2008227736A1 US 20080227736 A1 US20080227736 A1 US 20080227736A1 US 62858605 A US62858605 A US 62858605A US 2008227736 A1 US2008227736 A1 US 2008227736A1
- Authority
- US
- United States
- Prior art keywords
- vector
- sindbis
- cell
- cells
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/867—Retroviral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/10041—Use of virus, viral particle or viral elements as a vector
- C12N2740/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/10041—Use of virus, viral particle or viral elements as a vector
- C12N2740/10045—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16045—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/36011—Togaviridae
- C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
- C12N2770/36122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
- C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
- C12N2810/609—Vectors comprising as targeting moiety peptide derived from defined protein from viruses positive strand RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
- C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
- C12N2810/85—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
- C12N2810/855—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from receptors; from cell surface antigens; from cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
Definitions
- the present invention relates to lentiviral vectors pseudotyped with Sindbis envelope and targeted to specific cell types via a targeting moiety linked to the envelope.
- Oncoretroviral- and lentiviral-based vectors have several properties that make them ideal for use in gene therapy (Sandrin et al., Curr. Top. Microbiol. Immunol. 281:137-78, 137-178 (2003)). Efficient integration of retroviral DNA into the host genome enables stable long-term transgene expression. Unlike oncoretroviral vectors, lentiviral vectors are capable of transducing non-dividing cells. The application of specific targeting with retroviral vectors has been problematic and the few studies of retroviral vector targeting in living animals are not efficient (Martin et al., Mol. Ther. 5, 269-274 (2002); Jiang and Domburg, Gene Ther. 6, 1982-1987 (1999)).
- Sindbis virus is a member of the Alphavirus genius (Schlesinger and Schlesinger, Fundamental Virology 523-539, Raven, Philadelphia (1996)).
- the plus-stranded RNA viral genome is complexed with the capsid protein to form an icosahedral nucleocapsid surrounded by a lipid bilayer embedded with two integral membrane glycoproteins, E1 and E2, that form a heterodimer and function as a unit.
- E1 and E2 are anchored in the membrane independently.
- E2 binds to the host cell receptor.
- E1 can mediate membrane fusion as long as it is exposed to the low pH of the endosome and in the absence of a specific interaction with a receptor.
- Monoclonal antibodies capable of neutralizing virus infection are usually E2 specific, and mutation of E2 is frequently associated with altered host range and virulence. E2 can be modified substantially yet retain viral infectivity. This property of E2 has been exploited to develop Sindbis virus vectors that target specific cells (Ohno et al., Nat. Biotechnol. 15, 763-767 (1997)). However, since Sindbis virus vectors are cytotoxic (Tseng et al. Systemic tumor targeting and killing by Sindbis viral vectors, Nat. Biotechnol . (2003)) and unable to stably transduce their target cells, they cannot be used where stable expression is desired.
- Sindbis virus envelope (with E1 and E2) is able to pseudotype oncoretroviruses and lentiviruses (Morizono et al., J. Virol ., September; 75.(17.):8015.-20. 75, 8016-8020 (2001)).
- ZZ SINDBIS modified Sindbis virus envelope
- Sindbis virus has a broad natural host range.
- the high-affinity laminin receptor Wang et al., J. Virol. 66, 4992-5001 (1992)
- heparin sulfate are among the known receptors (Klimstra et al., J, Virol. 72, 7357-7366 (1998)).
- Their wide distribution and highly conserved nature may be in part responsible for the residual non-specific tropism observed with the ZZ SINDBIS pseudotyped vector. Accordingly, there exists a need for targeted retroviral vectors with decreased binding of endogenous receptors.
- the present invention fulfills this and other needs.
- the present invention therefore provides targeted lentiviral vectors that are pseudotyped with mutated Sindbis envelopes.
- mutations in the E2 protein and are used to alter viral titer, specificity, specificity index, tropism, and susceptibility to host immune response.
- the pseudotyped, targeted lentiviral vectors of the invention are used to transduce heterologous genes into a cell and can be used for in vivo and ex vivo therapeutic applications, as well as for diagnostic and research tool applications.
- the invention provides a pseudotyped, targeted retroviral vector comprising:
- the vector further comprises a retroviral-based nucleic acid genome.
- the retroviral-based nucleic acid genome is a lentivirus or an oncoretrovirus genome.
- the genome can also optionally comprise a heterologous gene.
- the vector is isolated. Typically, one or more of the E1, E2, or E3 proteins can be mutated at one or more amino acid positions.
- the vector comprises the following envelope protein mutations in comparison to wild-type Sindbis virus envelope proteins: (i) deletion of E3 amino acids 61-64; (ii) E2 KE159-160AA; and (iii) E2 SLKQ68-71AAAA (SEQ ID NOs: 3-4).
- the vector additionally comprises the envelope protein mutation E1 AK226-227SG.
- the vectors can also have a protein binding domain that specifically binds a protein of interest (i.e., a targeting moiety, including an antibody, an integrin, a transferrin receptor).
- the targeting moiety is an antibody.
- the invention further encompasses a packaging system comprising a cell comprising one or more nucleic acids encoding the pseudotyped, targeted retroviral vectors described herein.
- the invention provides expression vectors comprising one or more nucleic acids encoding Sindbis envelope proteins E1, E2, and E3, wherein at least one of E1, E2 or E3 is mutated as compared to a wild-type sequence.
- the invention provides methods of making the pseudotyped, targeted retroviral vectors of the invention, the methods comprising the steps of expressing in a cell one or more nucleic acids comprising Sindbis envelope proteins E1, E2, and E3.
- the vector can optionally comprise a nucleic acid comprising the retroviral based nucleic acid genome.
- the Sindbis envelope proteins E1, E2 and E3 and the retroviral-based nucleic acid genome can be encoded on the same or separate nucleic acids.
- the invention provides a method for delivering a pseudotyped, targeted retroviral vector across the blood brain barrier in a subject, the method comprising the step of contacting a cell with a pseudotyped, targeted retroviral vector of the present invention, wherein the targeting moiety specifically binds to a transferrin receptor.
- “Sindbis envelope,” “ZZSINDBIS,” and “m168” refer to a viral envelope comprising the Sindbis E1, E2, and E3 proteins.
- the terms “Sindbis E1 protein,” “Sindbis E2 protein” and “Sindbis E3 protein” or a nucleic acid encoding “Sindbis E1 protein,” “Sindbis E2 protein” and “Sindbis E3 protein” refer to nucleic acids and polypeptide polymorphic variants, alleles, mutants, and interspecies homologs that: (1) have a nucleotide sequence that has greater than about 60% nucleotide sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater nucleotide sequence identity, preferably over a region of at least about 25, 50, 100, 200, 500, 1000, or more nucleic acids, up to the full length sequence
- Togaviridae family envelopes e.g., from the Alphavirus genus, e.g., Semliki Forest Virus, Ross River Virus, and equine encephalitis virus, can also be used to pseudotype the vectors of the invention.
- the envelope protein sequences for such Alphaviruses are known in the art.
- “Pseudotype” refers to a virus particle, where the envelope or capsid includes heterologous viral proteins.
- Nucleic acid genome refers to the genomic or nucleic acid component of a virus particle, which encodes the genome of the virus particle, including any proteins required for replication and/or integration of the genome, if required, and optionally a heterologous protein operably linked to a promoter, the promoter being either native to the protein or heterologous (viral or non-viral).
- the nucleic acid genome can be based on any virus, and have an RNA or DNA genome, either single stranded or double stranded.
- the nucleic acid genome is from the family Retroviridae.
- “Lentiviral vector” refers to viruses comprising nucleic acid genomes based on viruses of the Lentiviral genus of the family Retroviridae. Optionally, the vector encodes a heterologous gene.
- Targeting moiety refers to a heterologous protein linked, either covalently or non-covalently, to a pseudotyped virus particle, typically linked to an envelope protein, e.g., E1, E2, or E3.
- the targeting moiety binds to a protein on the cell surface of a selected cell type.
- Representative targeting moieties include antibodies and receptor ligands.
- a viral “capsid,” as used herein, refers to the principal structural protein of the virion core derived from the central region of the Gag polyprotein.
- the capsid protein in a mature viral particle forms a shell surrounding the ribonucleoprotein complex that contains the genomic nucleic acid. This shell, which includes additional proteins, is also referred to as a capsid.
- a capsid shell can exist as a component of a virion without surrounding a genomic nucleic acid.
- a “virion” refers to a retrovirus body, including the outer lipid bilayer which surrounds a capsid shell which in turn surrounds a genomic nucleic acid, when present.
- a virion of the invention can, but need not, have a genomic nucleic acid.
- “Mutated Sindbis envelope” refers to a point mutation, insertion, or deletion in the amino acid sequence of a wild-type Sindbis E1, E2, or E3 protein.
- the E1, E2, or E3 protein can have one or more mutations.
- combinations of mutations in E1, E2, and E3 are encompassed by the invention, e.g., mutations in E1 and E2, or in E2 and E3, or E3 and E1, or E1, E2, and E3.
- Exemplary wild type sequences of E1, E2, and E3 proteins from Sindbis strains include Accession No. VHWVB, VHWVB2, and P03316.
- sequences are then said to be “substantially identical.”
- This definition also refers to, or may be applied to, the compliment of a test sequence.
- the definition also includes sequences that have deletions and/or additions, as well as those that have substitutions.
- the preferred algorithms can account for gaps and the like.
- identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
- a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.
- Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, and complements thereof.
- the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
- Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
- a particular nucleic acid sequence also implicitly encompasses “splice variants.”
- a particular protein encoded by a nucleic acid implicitly encompasses any protein encoded by a splice variant of that nucleic acid.
- “Splice variants,” as the name suggests, are products of alternative splicing of a gene. After transcription, an initial nucleic acid transcript may be spliced such that different (alternate) nucleic acid splice products encode different polypeptides.
- Mechanisms for the production of splice variants vary, but include alternate splicing of exons. Alternate polypeptides derived from the same nucleic acid by read-through transcription are also encompassed by this definition.
- polypeptide “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues.
- the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
- “Conservatively modified variants” applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
- amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant” where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
- recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
- recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
- heterologous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature.
- the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source.
- a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
- the T m is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T m , 50% of the probes are occupied at equilibrium).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- a positive signal is at least two times background, preferably 10 times background hybridization.
- Exemplary stringent hybridization conditions can be as following: 50% formamide, 5 ⁇ SSC, and 1% SDS, incubating at 42° C., or, 5 ⁇ SSC, 1% SDS, incubating at 65° C., with wash in 0.2 ⁇ SSC, and 0.1% SDS at 65° C.
- Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions.
- Exemplary “moderately stringent hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 1 ⁇ SSC at 45° C. A positive hybridization is at least twice background.
- Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. Additional guidelines for determining hybridization parameters are provided in numerous reference, e.g., and Current Protocols in Molecular Biology , ed. Ausubel, et al.
- a temperature of about 36° C. is typical for low stringency amplification, although annealing temperatures may vary between about 32° C. and 48° C. depending on primer length.
- a temperature of about 62° C. is typical, although high stringency annealing temperatures can range from about 50° C. to about 65° C., depending on the primer length and specificity.
- Typical cycle conditions for both high and low stringency amplifications include a denaturation phase of 90° C.-95° C. for 30 sec-2 min., an annealing phase lasting 30 sec.-2 min., and an extension phase of about 72° C. for 1-2 min. Protocols and guidelines for low and high stringency amplification reactions are provided, e.g., in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications , Academic Press, Inc. N.Y.).
- Antibody refers to a polypeptide comprising a framework region from an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen.
- the recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes.
- Light chains are classified as either kappa or lambda.
- Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
- the antigen-binding region of an antibody will be most critical in specificity and affinity of binding.
- An exemplary immunoglobulin (antibody) structural unit comprises a tetramer.
- Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kD) and one “heavy” chain (about 50-70 kD).
- the N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
- the terms variable light chain (V L ) and variable heavy chain (V H ) refer to these light and heavy chains respectively.
- Antibodies exist, e.g., as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases.
- pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)′ 2 , a dimer of Fab which itself is a light chain joined to V H -C H 1 by a disulfide bond.
- the F(ab)′ 2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)′ 2 dimer into an Fab′ monomer.
- the Fab′ monomer is essentially Fab with part of the hinge region (see Fundamental Immunology (Paul ed., 3d ed.
- antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology.
- antibody also includes antibody fragments either produced by the modification of whole antibodies, or those synthesized de novo using recombinant DNA methodologies (e.g., single chain Fv) or those identified using phage display libraries (see, e.g., McCafferty et al., Nature 348:552-554 (1990))
- antibodies e.g., recombinant, monoclonal, or polyclonal antibodies
- many technique known in the art can be used (see, e.g., Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, Inc. (1985); Coligan, Current Protocols in Immunology (1991); Harlow & Lane, Antibodies, A Laboratory Manual (1988); and Goding, Monoclonal Antibodies: Principles and Practice (2d ed. 1986)).
- the genes encoding the heavy and light chains of an antibody of interest can be cloned from a cell, e.g., the genes encoding a monoclonal antibody can be cloned from a hybridoma and used to produce a recombinant monoclonal antibody.
- Gene libraries encoding heavy and light chains of monoclonal antibodies can also be made from hybridoma or plasma cells. Random combinations of the heavy and light chain gene products generate a large pool of antibodies with different antigenic specificity (see, e.g., Kuby, Immunology (3 rd ed. 1997)). Techniques for the production of single chain antibodies or recombinant antibodies (U.S. Pat. No. 4,946,778, U.S. Pat. No.
- transgenic mice or other organisms such as other mammals, may be used to express humanized or human antibodies (see, e.g., U.S. Pat. Nos.
- phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990); Marks et al., Biotechnology 10:779-783 (1992)).
- Antibodies can also be made bispecific, i.e., able to recognize two different antigens (see, e.g., WO 93/08829, Traunecker et al., EMBO J. 10:3655-3659 (1991); and Suresh et al., Methods in Enzymology 121:210 (1986)).
- Antibodies can also be heteroconjugates, e.g., two covalently joined antibodies, or immunotoxins (see, e.g., U.S. Pat. No. 4,676,980, WO 91/00360; WO 92/200373; and EP 03089).
- a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers (see, e.g., Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science 239:1534-1536 (1988) and Presta, Curr. Op. Struct. Biol.
- humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
- a “chimeric antibody” is an antibody molecule in which (a) the constant region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class, effector function and/or species, or an entirely different molecule which confers new properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced or exchanged with a variable region having a different or altered antigen specificity.
- the antibody is conjugated to an “effector” moiety.
- the effector moiety can be any number of molecules, including labeling moieties such as radioactive labels or fluorescent labels, or can be a therapeutic moiety.
- the antibody modulates the activity of the protein.
- This selection may be achieved by subtracting out antibodies that cross-react with other molecules.
- a variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein.
- solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).
- terapéuticaally effective dose herein is meant a dose that produces effects for which it is administered.
- the exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); and Pickar, Dosage Calculations (1999)).
- FIG. 1 Schematic representation of FUhLucW, FUIntronRW and CCRMDRsc1.
- FUhLucW and FUIntronRW have the CMV enhancer and CCRMDRsc1 has the RSV enhancer/promoter substituted for the U3 region of the 5′ LTR.
- AU3 denotes a deletion in the U3 region of the 3′ LTR that renders the 5′ LTR of the integrated provirus transcriptionally inactive.
- FUhLucW and FUIntronRW have the Ubiqutin-C promoter as an internal promoter to express humanized Firefly luciferase or humanized Renilla luciferase respectively.
- CCRMDRsc1 has the CMV promoter as internal promoter to express MDRsc1 (P-glycoprotein). All vectors have the central polypurine tract (cPPT). FUhLucW and FUIntronRW contain the Woodchuck hepatitis virus post transcriptional element (WRE). CCRMDRsc1 has the human hepatitis virus post-transcriptional element (PRE). FUIntronRW has a chimeric intron derived from phRL-CMV.
- FIG. 2 HIV vector pseudotyped by ZZ SINDBIS has non-specific infectivity in the absence of target specific antibody in vitro and in vivo.
- TRIP GFP ZZ SINDBIS
- VSV-G TRIP GFP
- TRIP GFP ZZ SINDBIS
- TRIP GFP VSV-G
- FUhLucW VSV-G
- FUhLucW Sindbis
- FUhLucW ZZ SINDBIS
- mice were anesthetized and injected intraperitonially with 30 ⁇ g of D-luciferin.
- the reporter gene (Firefly luciferase) expression was imaged using a CCCD camera for 1 min prior to imaging. The acquisition time was determined to avoid saturation of the signal.
- FIG. 4 Schematic representation of mutated domains and mutants.
- FIG. 5 Analysis of the m168 mutant by flow cytometry and Western blotting.
- 293T cells (1 ⁇ 10 5 ) were infected with 200 ⁇ l of unconcentrated TRIP GFP (ZZ SINDBIS) (24 ng HIV p24) or TRIP GFP (m168) (40 ng HIV p24) with or without anti-HLA (1 ⁇ g/ml).
- ZZ SINDBIS unconcentrated TRIP GFP
- m168 40 ng HIV p24
- Ultracentrifuged samples of HIV vectors (FUhLucW) pseudotyped by ZZ SINDBIS or m168 were lysed and subjected to SDS-polyacrylamide gel electrophoresis and Western blotting as described in the Methods section.
- the amount of virus for each sample was normalized by the amount of HIV p24 antigen (5 ng/sample).
- Viral proteins were detected with anti-Sindbis virus mouse immune ascites fluid.
- the band at approximately 65 kD in the ZZ SINDBIS lane is the chimeric E2 protein.
- the band at approximately 75 kD in the m168 lane is chimeric E2 protein with uncleaved E3 protein.
- FIG. 6 The m168 pseudotyped lentiviral vector has reduced non-specific infectivity in vivo.
- FUhLucW ZZ SINDBIS
- FUhLucW m168
- D-luciferin 30 ⁇ g
- the reporter gene (Firefly luciferase) expression was imaged in the dorsal and abdominal aspects of the mice using a CCCD camera for 1 min. The acquisition time was determined to avoid saturation of the signal.
- FIG. 7 The m168 pseudotyped lentiviral vector mediates antibody-directed targeted gene transduction after systemic injection into mouse. Renilla luciferase expressing B16F10MDR5 (2 ⁇ 10 5 cells in 150 ⁇ l of PBS) were injected into mice via the tail vein. Thirty minutes later, FUhLucW (ZZ SINDBIS) or FUhLucW (m168) to which we had added anti P-glycoprotein monoclonal antibody or isotype (IgG2a) control antibody (10 ⁇ g/ml) was injected into the tail vein. The amount of each virus used for injection was normalized to the amount of HIV p24 (36 ⁇ g of HIV p24 in 150 ⁇ l PBS).
- FIG. 8 Nucleic acid sequence encoding ZZ SINDBIS.
- FIG. 9 Nucleic acid sequence encoding m168.
- FIG. 10 Immunohistochemical analysis of metastasized tumors targeted by FUGW (m168) with anti-P-Glycoprotein.
- Frozen sections were prepared from the lungs of mice injected with B16F10 MDR5 cells and FUGW (m168) plus anti-P-Glycoprotein. Serial 10 ⁇ m sections were prepared and processed.
- HE hematoxylin-eosin
- An adjacent serial section (to that shown in (a)) was stained for transgene expression (EGFP) and nuclei (DAPI).
- DAPI transgene expression
- S-100 transgene expression
- S-100 melanoma antigen
- S-100 melanoma antigen
- FIG. 11 Confocal microscopy analysis of frozen liver sections prepared from mice which had been injected with B16F10 MDR5 cells, and FUGW (VSV-G) or FUGW (m168) and anti-P-Glycoprotein. The sections were stained for Kupffer cell marker F4/80 (red) and EGFP (green).
- FIG. 12 a) Flow cytometric analysis of Mac-1 expression on splenocytes of NOD/SCID mice. b) Flow cytometric analysis of EGFP expression in splenocytes isolated from mice injected with B16F10MDR5 cells, and FUGW (VSV-G) or FUGW (m168) and anti-P-Glycoprotein. The cells were stained to determine Mac-1 expression. EGFP expression in Mac-1 positive and negative population was analyzed.
- FIG. 13 (a) B16F10MDR5 cells were injected into mice via the tail vein. Twelve days later, FUhLucW (m168), to which we had added anti-P-glycoprotein monoclonal antibody or isotype control antibody, or FUhLucW (VSV-G) was injected into the tail vein. The amount of each virus used for injection was normalized to the amount of HIV p24 (2.5 ⁇ g of HIV p24 in 250 ⁇ l PBS). Fifteen days after virus injection, virus infection was determined by imaging the level of Firefly luciferase reporter gene expression. (b) The mice were sacrificed immediately after whole body imaging and each organ was isolated to image luciferase expression.
- FIG. 14 Prostate cells can be targeted in vitro through the prostate stem cell antigen.
- LPSCA4 cells were derived from LNCaP cells after stable transfection of the prostate stem cell antigen (PSCA). 1 ⁇ 10 5 LNCaP and LPSCA4 cells were infected with FUGW pseudotyped with m168 envelope (12 ng HIV-1 p24) without Ab targeting, or with ⁇ HLA or 1G8 mAb (1G8 mAB recognizes PSCA (Saffran, et al., Proc Natl Acad Sci (2001) 98:2658-2663)). Three days after infection, eGFP expression was analyzed by flow cytometry (ten thousand events acquired per sample). The x-axis indicates eGFP fluorescence intensity.
- Percentage and mean flourescence intensity of the positive population (R2) is indicated in each plot. Infection of LPSCA4 cells targeted with 1G8 is comparable to infection targeted with ⁇ HLA, whereas in LNCaP cells targeting with 1G8 antibody gives background levels similar to those without any antibody targeting.
- FIG. 15 Transcription from the PSE-BC promoter in vitro in prostate cell lines (A) and non-prostate cell lines (B). 1 ⁇ 10 5 cells were infected with lentivirus vectors expressing eGFP under the control of the ubiquitin-C promoter (FUGW) or the PSE-BC promoter (FPGW) pseudotyped with VSV G (40 ng of HIV-1 p24). Three days after infection eGFP expression was analyzed by flow cytometry (ten thousand events acquired per sample). The x-axis indicates eGFP fluorescence intensity. Percentage and mean fluorescence intensity of the positive population (R2) is indicated in each plot. Expression from the PSE-BC promoter is comparable to ubiquitin-C promoter in prostate cell lines and up to 30 times lower in non-prostate cell lines.
- FIG. 16 New targeting envelope (2.2), comprised of m168+E1 AK226-227SG, mediated transferrin receptor (TfR) targeted gene transduction more efficiently than previous targeting envelope (m168).
- 4 ⁇ 10 4 HUVEC cells were infected with lentiviral vector (40 ng HIV-1 p24) pseudotyped with m168 envelope protein or 2.2 envelope protein with or without anti-transferrin receptor antibody (2 ⁇ g/ml).
- the lentiviral vector carried EGFP as reporter gene.
- FIG. 17 Targeting envelope mediates targeted gene transduction to CNS via transferrin receptor (TfR).
- Lentiviral vector (3 ⁇ g HIV-1 p24) pseudotyped with 2.2 envelope protein was injected into NOD/SCID mice via the tail vein with or without anti-transferrin receptor antibody (50 ⁇ g/ml).
- the lentiviral vector carried Firefly luciferase as reporter gene.
- mice Five days after injection, mice were anesthetized and injected intraperitoneally with D-luciferin (30 ng). The reporter gene expression was imaged using a CCCD camera. Luciferase expression from the brain and spinal column was confirmed by removing the skin from the back after sacrifice.
- Targeted gene transduction to specific tissues and organs via intravenous injection would be the ultimate preferred method of gene delivery.
- a lentiviral vector pseudotyped with a modified chimeric Sindbis virus envelope After intravenous administration into mice, the previously reported parental vector has non-specific infectivity in liver and spleen due to the residual natural tropism of Sindbis virus. Mutagenesis of domains within the Sindbis envelope ablated regions necessary for this natural tropism. M168 pseudotypes had significantly less non-specific infectivity to liver and spleen and these pseudotypes have high titer and high targeting specificity.
- a murine cancer model for metastatic melanoma was utilized to test specific targeting with m168.
- Human P-glycoprotein was ectopically expressed on the surface of melanoma cells and targeted by the m168 pseudotyped lentiviral vector conjugated with anti P-glycoprotein antibody.
- M168 pseudotypes successfully targeted metastatic melanoma cells growing in the lung after systemic administration via tail vein injection. This targeting technology has applications not only for cancers but also for genetic, infectious and autoimmune diseases.
- At least one of the E1, E2, or E3 proteins has one or more mutations (preferably point mutations) in comparison to a wild type sequence in order to provide altered titer, specificity, specificity index, tropism, or host immune reaction. Combinations of mutated E1, E2, and E3 are also contemplated by the invention.
- the mutated Sinbis viral envelope proteins of the present invention have a decreased ability to bind to endogenous receptors, including glycosaminoglycans (e.g., heparin sulfate).
- the pseudotyped virus vectors are isolated.
- the mutation is exemplified by the m168 sequence (SEQ ID NO:4), which comprises the mutations m1 (deletion of E3 amino acids 61-64), m6 (E2 KE159-160AA), and m8 (E2 SLKQ68-71AAAA).
- the m168 sequence comprises a further mutation in the E1 domain that makes the m168 titer 2-10 fold higher.
- the sequence “aagccttccgccaag” on the sequence of m168 was modified to “aagccttcctcggg” (SEQ ID NOs: 5 and 6).
- the m168 sequence is further modified to eliminate cholesterol dependence for cell entry, (e.g. E1 AK226-227SG).
- Mutations into one or more of the Sindbis viral envelope protein sequences can be introduced using any known methods in the art. Mutations can be targeted or random. For example, targeted mutations can be introduced using site-directed mutagenesis, for instance employing overlapping PCR or overlap extension PCR (see, for example, Aiyar, et al., Methods Mol Biol (1996) 57:177-91; and Pogulis, et al., Methods Mol Biol (1996) 57:167-76).
- mutations can be introduced by taking advantage of the error prone replication process of Sindbis viruses, which lack proof-reading and mismatch repair activities, and recombination between quasispecies in a virus population, for instance, by using a replication competent virus (see, Domingo and Holland, Annu Rev Microbiol (1997) 51:151-178).
- Mutant Sindbis virus envelope proteins of particular interest have a diminished ability to bind to endogenous receptors and therefore demonstrate decreased background infectivity in comparison to wild-type sequences.
- the mutated Sinbis virus envelope proteins of the present invention have a decreased ability to bind to glycosaminoglycans (GAGs), including heparin sulfate (HS), in comparison to wild-type sequences.
- GAGs glycosaminoglycans
- HS heparin sulfate
- the targeting moiety is covalently or non-covalently linked to the E1, E2, or E3 protein, preferably the E2 or E3 protein, or is linked to another portion of the envelope.
- the targeting moiety is linked to E1, E2, or E3 via non-covalent interactions with a protein binding domain, where the protein binding domain is fused with E1, E2, or E3.
- the protein binding domain is fused with E2 or E3.
- Exemplary protein binding domains include, e.g., the ZZ domain of protein A, streptavidin, avidin, a leucine zipper, a STAT protein N terminal domain, an FK506 binding protein, integrin binding sequence “4C-RGD” (CDCRGDCFC encoded by tgcgactgtagaggcgactgtttctgc), and transferrin receptor targeting sequence “B6” (GHKAKGPRK encoded by ggacataaagctaagggtcctagaaag) (see, e.g., O'Shea, Science 254: 539 (1991), Barahmand-Pour et al., Curr. Top. Microbiol. Immunol.
- the targeting moiety is a fusion protein with either the E1, E2, or E3 protein.
- the targeting moiety is fused with the E2 or the E3 protein.
- the targeting moiety can be, e.g., an antibody, such as a monoclonal or single chain antibody that specifically binds to an antigen or a cell surface molecule, or a ligand or binding partner of a cell surface molecule.
- the targeting moiety can target normal or diseased tissue.
- the targeting antigen can be directed to a transferrin receptor for delivery of the present vectors across the blood-brain barrier.
- the targeting moiety also can be directed to marker proteins indicative of diseases including cancers (e.g., breast, lung, ovarian, prostate, colon, lymphoma, leukemia, and melanoma); autoimmune disease (e.g., myasthenia gravis, multiple sclerosis, systemic lupus erythymatosis, rheumatoid arthritis, and diabetes mellitus); infectious disease, including infection by HIV, HCV, HBV, CMV, and HPV; and genetic diseases including sickle cell anemia, cystic fibrosis, Tay-Sachs, ⁇ -thalassemia, neurofibromatosis, polycystic kidney disease, hemophilia, etc.
- cancers e.g., breast, lung, ovarian, prostate, colon, lymphoma, leuk
- antigens and cell surface molecules for targeting include, e.g., P-glycoprotein, Her2/Neu, erythropoietin (EPO), epidermal growth factor receptor (EGFR), vascular endothelial growth factor receptor (VEGF-R), cadherin, carcinoembryonic antigen (CEA), CD4, CD8, CD19, CD20, CD33, CD34, CD45, CD117 (c-kit), CD133, HLA-A, HLA-B, HLA-C, chemokine receptor 5 (CCR5), stem cell marker ABCG2 transporter, ovarian cancer antigen CA125, immunoglobulins, integrins, prostate specific antigen (PSA), prostate stem cell antigen (PSCA), dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN), thyroglobulin, granulocyte-macrophage colony stimulating factor (GM-CSF), myogenic differentiation promoting factor-1 (MyoD-1), Le
- the pseudotyped, targeted vectors of the invention can optionally comprise a genomic nucleic acid.
- the nucleic acid genome can be from any suitable virus and in one embodiment, is derived from the Retroviridae family of viruses, e.g., from the lentiviral genus: HIV1, HIV2, SIV, FIV, BIV, Visna, CAEV, and EIAV; and from oncogenic retroviruses or oncoretroviruses, e.g., avian sarcoma/leucosis viruses (ASLV); mammalian C-type viruses (murine leukemia viruses (MuLV); feline leukemia viruses (FeLV)); B-type viruses (mouse mammary tumor viruses (MMTV); D-type viruses; and HTLV-BLV group of viruses (human T cell leukemia viruses (HTLV).
- retroviridae family of viruses e.g., from the lentiviral genus: HIV1, HIV2, SIV, FIV, BIV,
- Retroviral nucleic acid genomes known to those of skill in the art can be used in the invention, or made according to methods known to those of skill in the art (see, Coffin, et al, supra).
- the E1, E2, E3 and optional heterologous gene sequences can be encoded as individual polypeptides, or one or more fusion proteins.
- the E1, E2, E3 and optional heterologous gene sequences can be on the same or separate nucleic acid sequences.
- the nucleic acid genome can be RNA or DNA.
- the genome also optionally comprises a heterologous gene operably linked to a promoter, either a viral promoter or a heterologous promoter.
- the heterologous gene can be a marker gene, a cytotoxic gene, a gene encoding an inhibitory sequence or protein for therapeutic applications, or a gene encoding a wild type protein for gene therapy applications.
- Exemplary marker genes include luciferase, a fluorescent protein (green fluorescent protein, red fluorescent protein, yellow fluorescent protein), and ⁇ -galactosidase.
- Exemplary cytotoxic genes include ricin, tumor necrosis factor (TNF) and apoptin.
- the promoter can be a constitutive promoter (e.g., ubiquitin, actin) or an inducible promoter (e.g. metallothionein).
- the promoter allows for preferential expression of a heterologous gene in tissues of interest, including for example, prostate tissue (e.g., a prostate specific antigen (PSA) promoter (PSE-BC; see, Adams, et al., Nat Med (2002) 8:891-897; and Wu, et al., Gene Ther (2001) 8:1416-1426); testis tissue (Grimes, Gene (2004) 343:11-22; cardiovascular tissue (Beck, et al., Curr Gene Ther (2004) 4:457-467; breast tissue (e.g., a mammoglobin promoter; see, Goedegebuure, et al., Curr Cancer Drug Targets (2004) 4:531-542); thyroid tissue (e.g., a thyroglobulin promoter; see, DeGroot,
- Tissue specific promoters of use in cancer gene therapy are reviewed in Saukkonen and Hemminki, Expert Opin Biol Ther (2004) 4:683-96.
- Tissue specific promoters of use in the gene therapy treatment of prostate cancer are reviewed in Shiradawa, et al., Mol Urol (2000) 4:73-82. Additional tissue specific promoters of use in the present vectors and methods include those reviewed in Hart, Semin Oncol (1996) 23:154-8.
- the pseudotyped virus of the invention can be used for diagnostic and therapeutic applications, as well as for research tool applications. Diagnostic applications include both in vitro, ex vivo, and in vivo uses, e.g., in vivo imaging. Therapeutic applications include both in vivo, in vitro, and ex vivo uses.
- the present invention also provides methods of purifying the virus from cells.
- the virus is purified from cells by the following method: Virus is filtered through 0.22-microM-pore-size filter before concentration. Virus (30 mL) was loaded onto sucrose cushion (7 mL) and spinned using SW32 (Beckman) roter. 20% Sucrose (wt/wt) in 1 ⁇ PBS with 1 mM EDTA was used for cushion. The spinning condition is 40000 ⁇ g for 90 min at 4 degree. The supernatant is discarded and pellet is resuspended in 300 microL of Hanks Balanced Salt Solution. The concentrated virus is filtered again using same size filter before administration into animal.
- compositions of the present invention are determined in part by the particular composition being administered (e.g., nucleic acid, protein, virus or transduced cell), as well as by the particular method used to administer the composition. Accordingly, there are a wide variety of suitable formulations of pharmaceutical compositions of the present invention (see, e.g., Remington's Pharmaceutical Sciences, 17 th ed., 1989). Administration can be in any convenient manner, e.g., by injection, oral administration, inhalation, transdermal application, or rectal administration.
- compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally.
- Parenteral administration and intravenous administration are the preferred methods of administration.
- the formulations of commends can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.
- the dose administered to a patient should be sufficient to effect a beneficial therapeutic response in the patient over time.
- the dose will be determined by the efficacy of the particular vector employed and the condition of the patient, as well as the body weight or surface area of the patient to be treated.
- the size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular vector, or transduced cell type in a particular patient.
- FUhLucW was constructed from FUGW (kindly provided by Dr. David Baltimore) and pGL3-Basic (Promega, Madison, Wis.).
- FUIntronRW was constructed from FUGW and phRL-CMV (Promega).
- B16F10MDR 5 cells were generated by stable gene transduction of CCRMDRsc1 (VSV-G). After lentiviral gene transduction, cells were cloned by limiting dilution. The clones were analyzed for the expression of MDR-1 (P-gp) by flow cytometry. The clone designated B16F10MDR5 showed the highest level of the expression of the MDR-1 gene and was used for all further experiments.
- lentivirus vectors were produced by calcium phosphate-mediated transient transfection of 293T cells.
- 293 T cells (1.8 ⁇ 10 7 ) were transfected with pCMVR8.2DVPR (12.5 ⁇ g), the appropriate lentiviral vector plasmid (12.5 ⁇ g), and pHCMVG (5 ⁇ g) or pIntron SINDBIS, pIntron ZZ SINDBIS or mutants derived thereof (10 ⁇ g).
- TRIP GFP (kindly provided by Dr. Pierre Charneau) (Zennou et al., Cell, 101, 173-185 (2000)) was used as the lentiviral vector plasmid.
- CCRMDRsci was used as the lentiviral vector and pHCMVG as the envelope plasmid for generation of the MDR-1 expressing lentiviral vector.
- the Renilla luciferase expressing lentiviral vector was generated using FUIntronRW as the lentiviral vector plasmid and pHCMVG as the envelope plasmid.
- FUhLucW was used as the lentivirus vector for generation of the humanized Firefly luciferase expressing lentivirus vector.
- Antibodies Anti-HLA ABC was purchased from Sigma (St. Louis, Mo.). Anti-P-gp (multiple drug resistant gene-1 product) was purchased from Kamiya Biomedical Company (Seattle, Wash.). Anti-Sindbis virus ascites fluid and control ascites fluid were purchased from ATCC. Anti-mouse IL-2 receptor beta-chain (TM-Beta 1) was kindly provided by Dr. Masayukiso Miyasaka.
- Anti-Sindbis virus ascites fluid or control acites fluid was added to unconcentrated TRIP GFP (VSV-G), TRIP GFP (Sindbis) or TRIP GFP (ZZ SINDBIS) (0.1% volume) and incubated for 1 hour at 4° C.
- the virus was used for infection of 293T cells and infectivity was analyzed as previously described.
- HIV vectors (FUhLucW) pseudotyped with ZZ SINDBIS or m168 were concentrated 100-fold by ultracentrifugation and resuspended in PBS.
- the concentrated virus was mixed with equal volume of electrophoresis loading buffer [glycerol (20%), ⁇ -mercaptoethanol (10%), sodium dodecyl sulfate (4%), Tris-HCl pH 6.8 (125 mM), bromophenol blue (0.02%)] and boiled for 5 min.
- electrophoresis loading buffer [glycerol (20%), ⁇ -mercaptoethanol (10%), sodium dodecyl sulfate (4%), Tris-HCl pH 6.8 (125 mM), bromophenol blue (0.02%)] and boiled for 5 min.
- the amount of virus sample was normalized to the amount of HIV p24 (5 ⁇ g of p24/lane).
- the samples were subjected to electrophoresis through an SDS polyacrylamide gel (10%) as described previously (Morizono et al., J. Virol ., September; 75.(17.):8015.-20. 75, 8016-8020 (2001)). Immunoblot analysis was performed with anti-Sindbis virus ascites fluid and horseradish peroxidase-conjugated anti-mouse antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.). The protein bands were visualized by enhanced chemiluminescence (Pierce, Rockford, Ill.).
- HIV vector pseudotyped by VSV-G, Sindbis virus, ZZ SINDBIS or m168 were injected into the tail vein of 6-week old female NOD/SCID mouse.
- the amount injected for each virus was normalized to the amount of HIV p24 (30 pg of HIV p24 in 300 ⁇ l PBS).
- D-luciferin 3 mg/mouse
- CCCD images were obtained using a cooled IVIS CCD camera (Xenogen), and analyzed with IGOR-PRO Living Image Software.
- the primers for the analysis of vector copy number were Fluc-a (gagatacgccctggttcctg) and Fluc-b (gcatacgacgattctgtgatttg).
- the standard for quantitation of vector copy number was FUhLucW.
- the primers for the analysis of cell number were beta-actin-F (caactccatcatgaagtgtgac) and beta-actin-R (ccacacggagtacttgcgctc).
- the standard for the analysis of cell number was made using genomic DNA isolated from normal mouse peripheral blood mononuclear cell.
- B16F10MDR5 cells (1 ⁇ 10 4 ) were seeded on 48-well plate at the day before infection. The cells were incubated with FUhLucW (ZZ SINDBIS) or FUhLucW (m168) (10 ng HIV p24) with or without anti-P-gap antibody (1 ⁇ g/ml) for 2 hours at 37° C. with 5% CO 2 . The virus was subsequently removed and replaced with fresh medium (500 ⁇ l). Three days post infection, cells were lysed in passive lysis buffer (Promega) and Firefly luciferase activity was measured following the manufacturer's protocol.
- Renilla luciferase As a marker, the human P-gp expressing mouse cell line, B16F10MDR5, was transduced by the lentiviral vector FUIntronRW (VSV-G). One day prior to subsequent cell and virus injection, TMbeta-1 (1 mg) was injected into 6-week old female NOD/SCID mice. Renilla luciferase expressing B16F10MDR5 (2 ⁇ 10 5 cells in 150 ⁇ l of PBS) were injected into mouse via the tail vein.
- B16F10MDR5 cells were trypsinized, counted, stained by anti-P-Glycoprotein monoclonal antibody conjugated to PE (BD) and analyzed by flow cytometry. More than 99% of cells expressed P-gp demonstrating that nearly all of the cells we harvested were B16F10MDR5 cells. Cells were not recovered from control mice that did not receive tumor cells. One million cells were then harvested and lysed in passive lysis buffer (200 ⁇ l) (Promega) and analyzed for Firefly luciferase activity following the manufacturer's protocol. Genomic DNA was isolated using a DNeasy kit (QIAGEN). The primers and standard for quantitation of vector copy number were the same as those used to quantitate the background level of infection as previously described. Quantitation of the cell number was performed using primers for murine beta-actin as described above and the standard was generated by using known numbers of B16F10MDR5 cells.
- HIV Vector Pseudotyped by ZZ Sindbis has Non-Specific Infectivity In Vivo.
- FIG. 2 a shows the typical enhancement in infectivity of the ZZ SINDBIS pseudotyped virus vector in vitro using a monoclonal antibody directed to HLA.
- a monoclonal antibody directed to HLA We observed approximately a 30-fold enhancement of EGFP + cells in the presence of anti-HLA antibody relative to that seen in the absence of monoclonal antibody.
- VSV-G envelope pseudotyped virus infected cells at a high level in the absence of antibody.
- the titer of ZZ SINDBIS virus is usually about 5-fold lower than that of VSV-G pseudotyped virus but, like VSV-G pseudotypes can be further concentrated at least 100-fold by ultracentrifugation.
- ZZ SINDBIS pseudotyped virus vectors expressing Firefly luciferase were utilized to quantitate the level and specificity of targeting in transduced cells in the organs of live mice.
- a lentiviral vector containing the Ubiquitin-C promoter for in vivo experiments since this vector has been shown to express well in all mouse tissues (Lois et al., Science, 295, 868-872 (2002)).
- ZZ SINDBIS virus vectors were injected into the tail vein in the absence of monoclonal antibody. The expression of virus was monitored by luciferase expression utilizing CCCD imaging ( FIG. 2 b ).
- VSV-G and wild type Sindbis pseudotypes resulted in a strong signal.
- ZZ SINDBIS gave a weaker signal, consistent with its infectivity in vitro, there was still clear expression in liver and spleen. Injection of recombinant luciferase did not show a signal in major organs, indicating that the signal observed with ZZ SINDBIS was due to infection of cells in the organs (data not shown).
- the infectivity of mutants was tested on two different cell types, 293T, a human kidney cell line used for standard titration of virus stocks and HepG2 cells, derived from a human hepatocellular carcinoma (Table 1).
- 293T a human kidney cell line used for standard titration of virus stocks
- HepG2 cells derived from a human hepatocellular carcinoma (Table 1).
- We tested infectivity in HepG2 cells because of the background infectivity we observed in liver cells in vivo.
- We identified several E2 mutants with reduced levels of nonspecific infectivity and thus, an enhanced selectivity for targeting. Since some of these mutations also reduced the titer of viruses produced, we combined the mutations conferring enhanced selectivity with other mutations that enhanced infectivity.
- Five domains of Sindbis E2 previously reported to affect the infectivity of Sindbis virus were analyzed for their level of infectivity.
- Mutation ml in domain R1 enhanced the selectivity on 293T cells relative to wild type ZZ SINDBIS virus. However, this mutation also resulted in a decrease in virus titer. Mutations in domain R4 enhanced the titer without altering the specificity. Combining mutation m1 and m6 resulted in partial restoration of the titer and maintenance of the higher selectivity of ml. A double mutant of m1 and m8 resulted in enhanced selectivity on HepG2 liver cells.
- FIG. 5 a A representative experiment illustrating enhanced specificity of m168 infection in 293T cells, in the presence of an HLA monoclonal antibody is shown in FIG. 5 a .
- the background level of infectivity is reduced when compared to the ZZ SINDBIS virus and the levels of infectivity and stability are maintained.
- a Western blot of m168 pseudotyped virions shows the E2 envelope protein expressed from wild type ZZ SINDBIS and m168 ( FIG. 5 b ). Note that the m168 envelope protein is larger as a result of mutation ml that prevents cleavage of E2 and E3. This mutant was used in subsequent experiments.
- the ultimate goal of these studies is to develop a gene transfer vector capable of delivery directly into the bloodstream to target specific tissues or cells.
- the ability of the genetically modified M168 lentiviral pseudotypes to infect target cells in live mice was tested.
- Viruses bearing luciferase reporter genes were injected via the tail vein into SCID mice and the location of the infectivity was assessed using a CCCD camera to determine the level of luciferase expression in the mice.
- the modified m168 ZZ SINDBIS pseudotyped virus displayed a substantially lower infectivity in the liver and spleen of inoculated animals, relative to the parental ZZ SINDBIS pseudotyped virus ( FIG. 6 ).
- the intensity of the CCCD imaging for luciferase expression can be influenced by a number of variables such as depth of tissue and positioning of the animal during imaging, we confirmed these results by isolation of organs and PCR analysis for vector DNA sequences (Table 2). These results confirm that infectivity in liver and spleen is substantially reduced. Of note, we could not detect infection in ovaries indicating that transduction of our vector into germ line cells was unlikely to occur. Having successfully reduced the background infectivity, we tested the ability of these m168 pseudotypes to target cancer cells in the presence of monoclonal antibody directed to a tumor specific cell surface antigen, P-gp in mice.
- Malignant melanoma is an aggressive human tumor that metastasizes to multiple tissues including remote skin, soft tissue, lympho node and lung (Allen and Coit, Curr. Opin. Oncol. 14, 221-226 (2002)).
- MDR multi-drug resistant
- P-gp transports neutral and cationic hydrophobic compounds across the cell membrane. Selection for tumor cells that are resistant to natural product amphiphilic anticancer drugs can induce expression of P-gp.
- the murine model for human malignant metastatic melanoma where the tumor cells migrate through the bloodstream to engraft and form tumors in the lungs.
- the tumor cells were first marked in vitro by transducing with a vector expressing Renilla luciferase. This allowed us to differentially identify the location of vector expression in the tumor cells.
- the localization of vector expression and tumor cells in the mice was visualized using different substrates for the two luciferase genes, Firefly and Renilla, respectively ( FIG. 7 ).
- the tumor cells migrate to the lungs and can be visualized by CCCD imaging for Renilla luciferase.
- the virus bearing m168 and anti P-gp antibody was injected via the tail vein. Vectors injected in the absence of anti P-gp antibody, show no signal for Firefly luciferase.
- Firefly luciferase co-localizes in the lung with that of Renilla luciferase (tumor melanoma cells).
- the virus would encounter multiple cell types and thus, an increased potential for non-specific infectivity.
- the parental (first generation) ZZ SINDBIS pseudotyped vector retains infectivity in the liver and spleen, the pseudotypes bearing modified Sindbis virus envelope show a substantially decreased level of infectivity in these organs.
- Metastatic competent tumor cells migrate from the site of the primary lesion and subsequently grow at distant anatomical sites including the liver and lungs. Pulmonary metastases are the most common site of visceral metastasis with between 15% and 35% of recurrence occurring in this location (Allen and Coit, Curr. Opin. Oncol. 14, 221-226 (2002)). Only 4% of patients with pulmonary metastases survive 5 years.
- the murine melanoma model we chose to evaluate the specificity of our mutants mimics the progression of human melanoma to a metastatic stage often found in the lung. This system was ideal for testing specific targeting of our modified ZZ virus vectors to metastatic tumor cells by directly injecting them into the bloodstream of mice.
- P-gp as a tumor antigen can be useful not only for metastatic melanoma, but for many other tumors, which express this gene and are thus rendered resistant to multiple chemotherapeutic drugs (Ambudkar et al., Oncogene. 22, 7468-7485 (2003)).
- P-gp is also expressed on some normal cells, thus the targeting of tumor cells that express P-gp would be most successful in those situations where the P-gp was significantly over-expressed in the tumor cells.
- a specific targeting gene therapy vector is broad.
- Early treatment of metastatic cells is of significant therapeutic value.
- metastases could be targeted well before they grow to a size to be visualized by current technologies. Residual tumor cells following localized treatment with radiation and/or surgery could also be targeted and eliminated.
- hematopoeitic progenitor cells currently require purification of the hematopoeitic stem cells followed by transduction ex vivo.
- Specific targeting vectors can be developed that target antigens specific for hematopoeitic stem cells and thus, allow direct introduction of therapeutic genes into the stem cells through bone marrow and/or systemic injection after progenitor cell mobilization.
- targeting vectors that circulate and home to specific cells could allow early therapeutic intervention in the case of diseases such as cancer, and residual cells of chronic or latent infections by infectious agents.
- Hormone independent outgrowths can be selected after castration of the mice, and micrometastasis can eventually be detected in half of the mice, recapitulating the clinical progression of human prostate cancer (Klein, et al., Nature Med (1997) 3:402-408).
- PSCA encodes a 123-aa protein with an amino-terminal signal sequence, a carboxyl-terminal GPI-anchoring sequence, and multiple N-glycosylation sites (Gu, et al., Oncogene (2000) 19:1288-96; and Reiter, et al., Proc Natl Acad Sci USA (1998) 95:1735-1740).
- PSCA mRNA expression is prostate-specific in normal male tissues and is highly up-regulated in both androgen-dependent and -independent prostate cancer xenografts.
- the key regulatory elements of the PSA enhancer include a proximal promoter ( ⁇ 541 to +12) comprising two binding sites for the androgen receptor (AREI and II) and a distal enhancer, which contains a 390-bp androgen responsive core region (Schuur, et al., J Biol Chem (1996) 8:1416-1426; and Cleutjens, et al., J Biol Chem (1996) 271:6379-6388).
- the core region contains a cluster of closely spaced androgen response elements (AREs) and sites for other transcription factors.
- the androgen receptor (AR) binds cooperatively to the enhancer and mediates synergistic transcription, and other factors within and outside of the enhancer contribute to prostate specificity (Reid, et al., J Biol Chem (2001) 276:2943-2952); and Huang, et al., (1999) J Biol Chem (1999) 274: 25756-25768).
- the PSE-BC promoter was generated by duplication of the PSA enhancer core and insertion of this duplicated element closer to the proximal promoter (200 bp upstream). After these modifications PSE-BC produced 20-fold higher expression levels than the parental construct, yet retained androgen inducibility and tissue specificity (Wu, et al, Gene Ther (2001) 8:1416-1426).
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Neurology (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Neurosurgery (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11/628,586 US20080227736A1 (en) | 2004-06-03 | 2005-06-03 | Targeting Pseudotyped Retroviral Vectors |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US57724804P | 2004-06-03 | 2004-06-03 | |
US11/628,586 US20080227736A1 (en) | 2004-06-03 | 2005-06-03 | Targeting Pseudotyped Retroviral Vectors |
PCT/US2005/019624 WO2005118802A2 (fr) | 2004-06-03 | 2005-06-03 | Ciblage de vecteurs retroviraux pseudotypes |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2005/019624 A-371-Of-International WO2005118802A2 (fr) | 2004-06-03 | 2005-06-03 | Ciblage de vecteurs retroviraux pseudotypes |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/623,265 Continuation US8449875B2 (en) | 2004-06-03 | 2009-11-20 | Targeting pseudotyped retroviral vectors |
Publications (1)
Publication Number | Publication Date |
---|---|
US20080227736A1 true US20080227736A1 (en) | 2008-09-18 |
Family
ID=35463452
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US11/628,586 Abandoned US20080227736A1 (en) | 2004-06-03 | 2005-06-03 | Targeting Pseudotyped Retroviral Vectors |
US12/623,265 Expired - Fee Related US8449875B2 (en) | 2004-06-03 | 2009-11-20 | Targeting pseudotyped retroviral vectors |
US13/902,067 Expired - Fee Related US9163248B2 (en) | 2004-06-03 | 2013-05-24 | Targeting pseudotyped retroviral vectors |
Family Applications After (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US12/623,265 Expired - Fee Related US8449875B2 (en) | 2004-06-03 | 2009-11-20 | Targeting pseudotyped retroviral vectors |
US13/902,067 Expired - Fee Related US9163248B2 (en) | 2004-06-03 | 2013-05-24 | Targeting pseudotyped retroviral vectors |
Country Status (2)
Country | Link |
---|---|
US (3) | US20080227736A1 (fr) |
WO (1) | WO2005118802A2 (fr) |
Cited By (34)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20020127697A1 (en) * | 1998-10-01 | 2002-09-12 | University Of Southern California | Gene delivery system and methods of use |
US20100120140A1 (en) * | 2006-07-21 | 2010-05-13 | California Institute Of Technology | Targeted gene delivery for dendritic cell vaccination |
US20100189690A1 (en) * | 2006-09-27 | 2010-07-29 | Bundesrepublik Deutschland, Letztvertreten Durch D En Prasidenten Des Paul-Ehrich-Instituts | Pseudotyping of retroviral vectors, methods for production and use thereof for targeted gene transfer and high throughput screening |
WO2010127166A3 (fr) * | 2009-04-30 | 2011-03-10 | The Regents Of The University Of California | Vecteurs d'association anti-vih, vecteurs de ciblage, et procédés d'utilisation |
US20110212530A1 (en) * | 2005-06-01 | 2011-09-01 | California Institute Of Technology | Method of targeted gene delivery using viral vectors |
US8187872B2 (en) | 2009-07-24 | 2012-05-29 | Immune Design Corp. | Lentiviral vectors pseudotyped with a sindbis virus envelope glycoprotein |
US8323662B1 (en) | 2012-03-30 | 2012-12-04 | Immune Design Corp. | Methods useful for generating highly mannosylated pseudotyped lentiviral vector particles comprising a Vpx protein |
US8772459B2 (en) | 2009-12-02 | 2014-07-08 | Imaginab, Inc. | J591 minibodies and Cys-diabodies for targeting human prostate specific membrane antigen (PSMA) and methods for their use |
US8829173B2 (en) | 2008-09-26 | 2014-09-09 | Tocagen Inc. | Recombinant vectors |
US8940871B2 (en) | 2006-03-20 | 2015-01-27 | The Regents Of The University Of California | Engineered anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting |
US8940298B2 (en) | 2007-09-04 | 2015-01-27 | The Regents Of The University Of California | High affinity anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting and detection |
US8951737B2 (en) | 1996-05-06 | 2015-02-10 | Cornell Research Foundation, Inc. | Treatment and diagnosis of cancer |
US9642921B2 (en) | 2012-12-20 | 2017-05-09 | Tocagen Inc. | Cancer combination therapy and recombinant vectors |
US9669049B2 (en) | 2010-10-31 | 2017-06-06 | Tocagen Inc. | Compositions comprising gamma retrovirus vectors and methods of treating proliferative disorders |
US9713635B2 (en) | 2012-03-30 | 2017-07-25 | Immune Design Corp. | Materials and methods for producing improved lentiviral vector particles |
US10035983B2 (en) | 2008-09-26 | 2018-07-31 | Tocagen Inc. | Gene therapy vectors and cytosine deaminases |
US10494647B2 (en) | 2016-07-08 | 2019-12-03 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
US10517969B2 (en) | 2009-02-17 | 2019-12-31 | Cornell University | Methods and kits for diagnosis of cancer and prediction of therapeutic value |
US10548914B2 (en) | 2008-10-17 | 2020-02-04 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
US10767183B2 (en) | 2016-03-09 | 2020-09-08 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
US10772905B2 (en) | 2016-01-15 | 2020-09-15 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
US10888613B2 (en) | 2016-02-08 | 2021-01-12 | American Gene Technologies International Inc. | Method of producing cells resistant to HIV infection |
US10993999B2 (en) | 2012-03-30 | 2021-05-04 | Immune DesignCorp. | Materials and methods for producing improved lentiviral vector particles |
US11065311B2 (en) | 2012-10-25 | 2021-07-20 | Denovo Biopharma Llc | Retroviral vector with mini-promoter cassette |
US11254744B2 (en) | 2015-08-07 | 2022-02-22 | Imaginab, Inc. | Antigen binding constructs to target molecules |
US11266745B2 (en) | 2017-02-08 | 2022-03-08 | Imaginab, Inc. | Extension sequences for diabodies |
US11279949B2 (en) | 2015-09-04 | 2022-03-22 | Denovo Biopharma Llc | Recombinant vectors comprising 2A peptide |
US11352646B2 (en) | 2018-11-05 | 2022-06-07 | American Gene Technologies International Inc. | Vector system for expressing regulatory RNA |
US11519006B2 (en) | 2016-01-15 | 2022-12-06 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
US11583562B2 (en) | 2016-07-21 | 2023-02-21 | American Gene Technologies International Inc. | Viral vectors for treating Parkinson's disease |
WO2023114884A3 (fr) * | 2021-12-15 | 2023-08-17 | Interius Biotherapeutics, Inc. | Particules virales pseudotypées, compositions les comprenant et leurs utilisations |
US11820999B2 (en) | 2017-04-03 | 2023-11-21 | American Gene Technologies International Inc. | Compositions and methods for treating phenylketonuria |
US11976292B2 (en) | 2016-06-08 | 2024-05-07 | American Gene Technologies International Inc. | Non-integrating viral delivery system and methods related thereto |
US11980663B2 (en) | 2015-07-08 | 2024-05-14 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
Families Citing this family (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005118802A2 (fr) * | 2004-06-03 | 2005-12-15 | The Regents Of The University Of California | Ciblage de vecteurs retroviraux pseudotypes |
SI2048955T1 (sl) * | 2006-07-21 | 2013-11-29 | California Institute Of Technology | Usmerjena genska dostava za imuniziranje z dendritičnimi celicami |
US11266736B2 (en) | 2008-04-17 | 2022-03-08 | Vin De Bona Trading Company Pte Ltd | Method of painting micro vesicles |
EP2281033B1 (fr) | 2008-04-17 | 2014-10-15 | Vin de Bona Trading Co Pte | Modification post-libération d'enveloppes virales |
CN102238549B (zh) * | 2010-04-30 | 2016-09-14 | 索尼公司 | 在异构网络中管理资源的系统和方法 |
CA3004132A1 (fr) | 2015-11-09 | 2017-05-18 | Immune Design Corp. | Vecteur retroviral pour l'administration et l'expression d'un replicon arn exprimant des acides nucleiques heterologues |
CN111182913A (zh) * | 2017-10-02 | 2020-05-19 | 西奈医疗中心 | 用于通过多个生物屏障进行有效递送的方法和组合物 |
WO2020069463A1 (fr) * | 2018-09-28 | 2020-04-02 | The Regents Of The University Of California | Vecteurs de ciblage dirigés contre des ligands |
US20220372110A1 (en) * | 2019-09-24 | 2022-11-24 | Providence Health & Services - Oregon | Fusion polypeptides binding antibody fc domains and integrin and methods of use |
WO2021119335A1 (fr) * | 2019-12-10 | 2021-06-17 | The University Of North Carolina At Chapel Hill | Système de transfert de gènes |
WO2023220603A1 (fr) | 2022-05-09 | 2023-11-16 | Regeneron Pharmaceuticals, Inc. | Vecteurs et procédés de production d'anticorps in vivo |
WO2023240124A1 (fr) | 2022-06-07 | 2023-12-14 | Regeneron Pharmaceuticals, Inc. | Particules virales pseudotypées pour le ciblage de cellules exprimant un tcr |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6589533B1 (en) * | 1997-09-18 | 2003-07-08 | Research Development Foundation | Genetically-engineered alphaviruses, flaviviruses, and bunyaviruses with modified envelope transmembrane glycoproteins and altered host-range phenotype |
US7060811B2 (en) * | 2000-10-13 | 2006-06-13 | Board Of Regents, The University Of Texas System | WWOX: a tumor suppressor gene mutated in multiple cancers |
US7267978B1 (en) * | 1999-10-14 | 2007-09-11 | The Regents Of The University Of California | Chimeric transcriptional regulatory element compositions and methods for increasing prostate-targeted gene expression |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20010055596A1 (en) | 2000-03-24 | 2001-12-27 | Meagher Madeleine Joy | Compositions and methods for therapy and diagnosis of colon cancer |
CA2440890C (fr) | 2001-03-27 | 2011-07-19 | New York University | Traitement de tumeurs au moyen de vecteurs bases sur l'alphavirus et cibles sur des recepteurs a haute affinite de la laminine |
AT413486B (de) * | 2002-07-03 | 2006-03-15 | Igeneon Krebs Immuntherapie | Verwendung eines antikörpers gerichtet gegen lewis-antigene |
WO2005118802A2 (fr) * | 2004-06-03 | 2005-12-15 | The Regents Of The University Of California | Ciblage de vecteurs retroviraux pseudotypes |
-
2005
- 2005-06-03 WO PCT/US2005/019624 patent/WO2005118802A2/fr active Application Filing
- 2005-06-03 US US11/628,586 patent/US20080227736A1/en not_active Abandoned
-
2009
- 2009-11-20 US US12/623,265 patent/US8449875B2/en not_active Expired - Fee Related
-
2013
- 2013-05-24 US US13/902,067 patent/US9163248B2/en not_active Expired - Fee Related
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6589533B1 (en) * | 1997-09-18 | 2003-07-08 | Research Development Foundation | Genetically-engineered alphaviruses, flaviviruses, and bunyaviruses with modified envelope transmembrane glycoproteins and altered host-range phenotype |
US7267978B1 (en) * | 1999-10-14 | 2007-09-11 | The Regents Of The University Of California | Chimeric transcriptional regulatory element compositions and methods for increasing prostate-targeted gene expression |
US7060811B2 (en) * | 2000-10-13 | 2006-06-13 | Board Of Regents, The University Of Texas System | WWOX: a tumor suppressor gene mutated in multiple cancers |
Cited By (63)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8951737B2 (en) | 1996-05-06 | 2015-02-10 | Cornell Research Foundation, Inc. | Treatment and diagnosis of cancer |
US20020127697A1 (en) * | 1998-10-01 | 2002-09-12 | University Of Southern California | Gene delivery system and methods of use |
US8741279B2 (en) | 1998-10-01 | 2014-06-03 | University Of Southern California | Gene delivery system and methods of use |
US8652460B2 (en) | 1998-10-01 | 2014-02-18 | University Of Southern California | Gene delivery system and method of use |
US8821856B2 (en) | 2005-06-01 | 2014-09-02 | California Institute Of Technology | Method of targeted gene delivery using viral vectors |
US20110212530A1 (en) * | 2005-06-01 | 2011-09-01 | California Institute Of Technology | Method of targeted gene delivery using viral vectors |
US9994867B2 (en) | 2005-06-01 | 2018-06-12 | California Institute Of Technology | Method of targeting gene delivery using viral vectors |
US8940871B2 (en) | 2006-03-20 | 2015-01-27 | The Regents Of The University Of California | Engineered anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting |
US10266847B2 (en) | 2006-07-21 | 2019-04-23 | California Institute Of Technology | Methods of delivering a pseudotyped lentivirus |
US8329162B2 (en) | 2006-07-21 | 2012-12-11 | California Institute Of Technology | Targeted gene delivery for dendritic cell vaccination |
US8372390B2 (en) | 2006-07-21 | 2013-02-12 | California Institute Of Technology | Recombiant lentivirus comprising an E2 alphavirus glycoprotein that binds to DC-SIGN |
US8273345B2 (en) | 2006-07-21 | 2012-09-25 | California Institute Of Technology | Targeted gene delivery to dendritic cells |
US8715640B2 (en) | 2006-07-21 | 2014-05-06 | California Institute Of Technology | Packaging cells for producing retrovirus pseudotyped with an E2 alphavirus glycoprotein |
US9840721B2 (en) | 2006-07-21 | 2017-12-12 | California Institute Of Technology | Recombinant retrovirus pseudotyped with E2 alphavirus glycoprotein |
US10696984B2 (en) | 2006-07-21 | 2020-06-30 | California Institute Of Technology | Packaging cell for making a pseudotyped lentivirus |
US9303072B2 (en) | 2006-07-21 | 2016-04-05 | California Institute Of Technology | Method of stimulating an immune response using a pseudotyped lentivirus |
US20100120122A1 (en) * | 2006-07-21 | 2010-05-13 | California Institute Of Technology | Targeted gene delivery for dendritic cell vaccination |
US20100120140A1 (en) * | 2006-07-21 | 2010-05-13 | California Institute Of Technology | Targeted gene delivery for dendritic cell vaccination |
US8906359B2 (en) | 2006-07-21 | 2014-12-09 | California Institute Of Technology | Recombinant retrovirus pseudotyped with a E2 alphavirus glycoprotein |
US9862971B2 (en) * | 2006-09-27 | 2018-01-09 | Bundesrepublik Deutschland, Letztvertreten Durch Den Prasidenten Des Paul-Ehrlich-Instituts | Pseudotyping of retroviral vectors, methods for production and use thereof for targeted gene transfer and high throughput screening |
US20100189690A1 (en) * | 2006-09-27 | 2010-07-29 | Bundesrepublik Deutschland, Letztvertreten Durch D En Prasidenten Des Paul-Ehrich-Instituts | Pseudotyping of retroviral vectors, methods for production and use thereof for targeted gene transfer and high throughput screening |
US10415057B2 (en) | 2006-09-27 | 2019-09-17 | Bundersrepublik Deutschland, Letzvertreten Durch Den Präsidenten Des Paul-Ehrlich-Instituts | Pseudotyping of retroviral vectors, methods for production and use thereof for targeted gene transfer and high throughput screening |
US8940298B2 (en) | 2007-09-04 | 2015-01-27 | The Regents Of The University Of California | High affinity anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting and detection |
US9527919B2 (en) | 2007-09-04 | 2016-12-27 | The Regents Of The University Of California | High affinity anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting and detection |
US10035983B2 (en) | 2008-09-26 | 2018-07-31 | Tocagen Inc. | Gene therapy vectors and cytosine deaminases |
US8829173B2 (en) | 2008-09-26 | 2014-09-09 | Tocagen Inc. | Recombinant vectors |
US10407666B2 (en) | 2008-09-26 | 2019-09-10 | Tocagen Inc. | Recombinant vectors |
US11617760B2 (en) | 2008-10-17 | 2023-04-04 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
US10548914B2 (en) | 2008-10-17 | 2020-02-04 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
US11007209B2 (en) | 2008-10-17 | 2021-05-18 | American Gene Technologies International Inc. | Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules |
US10517969B2 (en) | 2009-02-17 | 2019-12-31 | Cornell University | Methods and kits for diagnosis of cancer and prediction of therapeutic value |
WO2010127166A3 (fr) * | 2009-04-30 | 2011-03-10 | The Regents Of The University Of California | Vecteurs d'association anti-vih, vecteurs de ciblage, et procédés d'utilisation |
US8728458B2 (en) | 2009-04-30 | 2014-05-20 | The Regents Of The University Of California | Combination anti-HIV vectors, targeting vectors, and methods of use |
US9309535B2 (en) | 2009-04-30 | 2016-04-12 | The Regents Of The University Of California | Combination anti-HIV vectors, targeting vectors, and methods of use |
US8187872B2 (en) | 2009-07-24 | 2012-05-29 | Immune Design Corp. | Lentiviral vectors pseudotyped with a sindbis virus envelope glycoprotein |
US8772459B2 (en) | 2009-12-02 | 2014-07-08 | Imaginab, Inc. | J591 minibodies and Cys-diabodies for targeting human prostate specific membrane antigen (PSMA) and methods for their use |
US11180570B2 (en) | 2009-12-02 | 2021-11-23 | Imaginab, Inc. | J591 minibodies and cys-diabodies for targeting human prostate specific membrane antigen (PSMA) and methods for their use |
US9669049B2 (en) | 2010-10-31 | 2017-06-06 | Tocagen Inc. | Compositions comprising gamma retrovirus vectors and methods of treating proliferative disorders |
US9713635B2 (en) | 2012-03-30 | 2017-07-25 | Immune Design Corp. | Materials and methods for producing improved lentiviral vector particles |
US8323662B1 (en) | 2012-03-30 | 2012-12-04 | Immune Design Corp. | Methods useful for generating highly mannosylated pseudotyped lentiviral vector particles comprising a Vpx protein |
US10391157B2 (en) | 2012-03-30 | 2019-08-27 | Immune Design Corp. | Materials and methods for producing improved lentiviral vector particles |
US10993999B2 (en) | 2012-03-30 | 2021-05-04 | Immune DesignCorp. | Materials and methods for producing improved lentiviral vector particles |
US11065311B2 (en) | 2012-10-25 | 2021-07-20 | Denovo Biopharma Llc | Retroviral vector with mini-promoter cassette |
US9642921B2 (en) | 2012-12-20 | 2017-05-09 | Tocagen Inc. | Cancer combination therapy and recombinant vectors |
US11980663B2 (en) | 2015-07-08 | 2024-05-14 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
US11254744B2 (en) | 2015-08-07 | 2022-02-22 | Imaginab, Inc. | Antigen binding constructs to target molecules |
US11279949B2 (en) | 2015-09-04 | 2022-03-22 | Denovo Biopharma Llc | Recombinant vectors comprising 2A peptide |
US11519006B2 (en) | 2016-01-15 | 2022-12-06 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
US10772905B2 (en) | 2016-01-15 | 2020-09-15 | American Gene Technologies International Inc. | Methods and compositions for the activation of gamma-delta T-cells |
US10888613B2 (en) | 2016-02-08 | 2021-01-12 | American Gene Technologies International Inc. | Method of producing cells resistant to HIV infection |
US11242527B1 (en) | 2016-03-09 | 2022-02-08 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
US10975374B2 (en) | 2016-03-09 | 2021-04-13 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
US10767183B2 (en) | 2016-03-09 | 2020-09-08 | American Gene Technologies International Inc. | Combination vectors and methods for treating cancer |
US11976292B2 (en) | 2016-06-08 | 2024-05-07 | American Gene Technologies International Inc. | Non-integrating viral delivery system and methods related thereto |
US11911458B2 (en) | 2016-07-08 | 2024-02-27 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
US11090379B2 (en) | 2016-07-08 | 2021-08-17 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
US10494647B2 (en) | 2016-07-08 | 2019-12-03 | American Gene Technologies International Inc. | HIV pre-immunization and immunotherapy |
US11583562B2 (en) | 2016-07-21 | 2023-02-21 | American Gene Technologies International Inc. | Viral vectors for treating Parkinson's disease |
US11266745B2 (en) | 2017-02-08 | 2022-03-08 | Imaginab, Inc. | Extension sequences for diabodies |
US11820999B2 (en) | 2017-04-03 | 2023-11-21 | American Gene Technologies International Inc. | Compositions and methods for treating phenylketonuria |
US11352646B2 (en) | 2018-11-05 | 2022-06-07 | American Gene Technologies International Inc. | Vector system for expressing regulatory RNA |
US11767366B1 (en) | 2021-12-15 | 2023-09-26 | Interius Biotherapeutics, Inc. | Pseudotyped viral particles, compositions comprising the same, and uses thereof |
WO2023114884A3 (fr) * | 2021-12-15 | 2023-08-17 | Interius Biotherapeutics, Inc. | Particules virales pseudotypées, compositions les comprenant et leurs utilisations |
Also Published As
Publication number | Publication date |
---|---|
US8449875B2 (en) | 2013-05-28 |
US20100184206A1 (en) | 2010-07-22 |
WO2005118802A2 (fr) | 2005-12-15 |
WO2005118802A3 (fr) | 2006-04-20 |
US20140017766A1 (en) | 2014-01-16 |
US9163248B2 (en) | 2015-10-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9163248B2 (en) | Targeting pseudotyped retroviral vectors | |
Palu et al. | Progress with retroviral gene vectors | |
Blond et al. | An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor | |
ES2287977T3 (es) | Rabdovirus con cubiertas rediseñadas. | |
Marin et al. | Targeted infection of human cells via major histocompatibility complex class I molecules by Moloney murine leukemia virus-derived viruses displaying single-chain antibody fragment-envelope fusion proteins | |
JP4548865B2 (ja) | プロテインAのIgG結合ドメインを含むキメラ・エンベロープタンパク質を有するウイルスベクター | |
US20210180083A1 (en) | Adapter-based retroviral vector system for the selective transduction of target cells | |
Tai et al. | Antibody-mediated targeting of replication-competent retroviral vectors | |
Metharom et al. | Novel bovine lentiviral vectors based on Jembrana disease virus | |
EP1713511B1 (fr) | Agent therapeutique pour le traitement du cancer comportant un gene lk68 ou lk8 des kringles de l'apolipoproteine (a) en tant que principe actif, et procede de traitement du cancer utilisant cet agent therapeutique | |
Piechaczyk | Cell targeting by murine retroviral vectors | |
Morizono et al. | Redirecting lentiviral vectors by insertion of integrin‐tageting peptides into envelope proteins | |
Howe et al. | Vector systems for prenatal gene therapy: principles of retrovirus vector design and production | |
KR100555688B1 (ko) | 암세포 표적성 유전자 전달방법 | |
US6762031B2 (en) | Targeting viral vectors to specific cells | |
US7138272B1 (en) | Gene transfer in human lymphocytes using retroviral scFv cell targeting | |
Metharom et al. | Development of disabled, replication-defective gene transfer vectors from the Jembrana disease virus, a new infectious agent of cattle | |
Rey et al. | The C domain in the surface envelope glycoprotein of subgroup C feline leukemia virus is a second receptor-binding domain | |
Bupp et al. | Selection of feline leukemia virus envelope proteins from a library by functional association with a murine leukemia virus envelope | |
Bahrami et al. | Mutational library analysis of selected amino acids in the receptor binding domain of envelope of Akv murine leukemia virus by conditionally replication competent bicistronic vectors | |
Jiang et al. | A genetically engineered spleen necrosis virus-derived retroviral vector that displays the HIV type 1 glycoprotein 120 envelope peptide | |
CA2524892A1 (fr) | Polypeptide purifie, acides nucleiques isoles le codant, vecteurs et utilisation correspondante | |
Schüle et al. | Selective gene transfer to T lymphocytes using coreceptor-specific [MLV (HIV)] pseudotype vectors in a transgenic mouse model | |
Fonseca | Lentiviral target-specific strategy for molecular therapy | |
Dornburg | Reticuloendotheliosis viruses and derived vectors for human gene therapy |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA, CALIF Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHEN, IRVIN S. Y.;MORIZONO, KOUKI;REEL/FRAME:020075/0812;SIGNING DATES FROM 20070726 TO 20070727 |
|
AS | Assignment |
Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF CALIFORNIA LOS ANGELES;REEL/FRAME:022459/0548 Effective date: 20090324 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |