US20070237793A1 - Anti-bacterial vaccine compositions - Google Patents

Anti-bacterial vaccine compositions Download PDF

Info

Publication number
US20070237793A1
US20070237793A1 US11/251,464 US25146405A US2007237793A1 US 20070237793 A1 US20070237793 A1 US 20070237793A1 US 25146405 A US25146405 A US 25146405A US 2007237793 A1 US2007237793 A1 US 2007237793A1
Authority
US
United States
Prior art keywords
seq
bacterium
gene
virulence
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/251,464
Other languages
English (en)
Inventor
David Lowery
Troy Fuller
Michael Kennedy
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pharmacia and Upjohn Co
Original Assignee
Pharmacia and Upjohn Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pharmacia and Upjohn Co filed Critical Pharmacia and Upjohn Co
Priority to US11/251,464 priority Critical patent/US20070237793A1/en
Publication of US20070237793A1 publication Critical patent/US20070237793A1/en
Priority to US12/425,599 priority patent/US7763262B2/en
Priority to US12/816,485 priority patent/US20100322975A1/en
Priority to US13/162,023 priority patent/US8974798B2/en
Priority to US14/640,586 priority patent/US9289486B2/en
Abandoned legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/102Pasteurellales, e.g. Actinobacillus, Pasteurella; Haemophilus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/285Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pasteurellaceae (F), e.g. Haemophilus influenza
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated

Definitions

  • the present invention relates generally to the identification of genes responsible for virulence of Pasteurella multocida and Actinobacillus pleuropneumoniae bacteria, thereby allowing for production of novel attenuated mutant strains useful in vaccines and identification of new anti-bacterial agents that target the virulence genes and their products.
  • Pasteurellaceae encompasses several significant pathogens that infect a wide variety of animals.
  • prominent members of the family include Pasteurella haemolytica, Actinobacillus pleuropneumoniae and Haemophilus somnus.
  • P. multocida is a gram-negative, nonmotile coccobacillus which is found in the normal flora of many wild and domestic animals and is known to cause disease in numerous animal species worldwide [Biberstein, In M. Kilian, W. Frederickson, and E. L. Biberstein (ed.), Haemophilus, Pasteurella, and Actinobacillus . Academic Press, London, p. 61-73 (1981)].
  • the disease manifestations following infection include septicemias, bronchopneumonias, rhinitis, and wound infections [Reviewed in Shewen, et al., In C. L. Gyles and C. O. Thoen (ed.), Pathogenesis of Bacterial Infections in Animals. Iowa State University Press, Ames, p. 216-225 (1993), incorporated herein by reference].
  • P. multocida Infection by P. multocida generally results from invasion during periods of stress, but transmission may also occur by aerosol or contact exposure, or via flea and tick vectors.
  • P. multocida infection gives rise to acute to peracute septicemia, particularly prevalent in domestic turkeys and wild waterfowl under stress conditions associated with overcrowding, laying, molting, or severe climatic change.
  • a similar hemorrhagic septicemia follows infection and manifests conditions including high fever and depression, generally followed by quick death. Transmission is most likely through aerosol contact, but infection can also arise during periods of significant climatic change.
  • P. multocida strains are normally designated by capsular serogroup and somatic serotype.
  • Five capsular serogroups (A, B, D, E, and F) and 16 somatic serotypes are distinguished by expression of characteristic heat-stable antigens.
  • Most strains are host specific and rarely infect more than one or two animals.
  • the existence of different serotypes presents a problem for vaccination because traditional killed whole cell bacteria normally provide only serotype-specific protection.
  • natural infection with one serotype can lead to immunological protection against multiple serotypes [Shewen, et al., In C. L. Gyles and C. O. Thoen (Ed.), Pathogenesis of Bacterial Infections in Animals.
  • A. pleuropneumoniae exhibits strict host specificity for swine and is the causative agent of highly contagious porcine pleuropneumonia. Infection normally arises in intensive breeding conditions, and is believed to occur by a direct mode of transmission. The disease is often fatal and, as a result, leads to severe economic loss in the swine producing industry.
  • A. pleuropneumoniae infection may be chronic or acute, and infection is characterized by a hemorrhagic, necrotic bronchopneumonia with accompanying fibrinous pleuritis.
  • bacterial virulence has been attributed to structural proteins, including serotype-specific capsular polysaccharides, lipopolysaccharides, and surface proteins, as well as extracellular cytolytic toxins.
  • structural proteins including serotype-specific capsular polysaccharides, lipopolysaccharides, and surface proteins, as well as extracellular cytolytic toxins.
  • RTX toxins are produced by many Gram negative bacteria, including E. coli, Proteus vulgarisa, and Pasteurella haemolytica, and the proteins generally share structural and functional characteristics. Toxins from the various serotypes differ, however, in host specificity, target cells, and biological activities.
  • the major A. pleuropneumoniae RTX toxins include ApxI, ApxII, and ApxIII.
  • ApxI and ApxII have haemolytic activity, with ApxI being more potent.
  • ApxIII shows no haemolytic activity, but is cytotoxic for alveolar macrophages and neutrophils.
  • Most A. pleuropneumoniae serotypes produce two of these three toxins. For example, serotypes 1, 5, 9, and 11 express ApxI and ApxII, and serotypes 2, 3, 4, 6, and 8 express ApxII and ApxIII. Serotype 10, however, produces only ApxI, and serotypes 7 and 12 express only ApxII.
  • Those A. pleuropneumoniae serotypes that produce both ApxI and ApxII are the most virulent strains of the bacteria.
  • Apx toxins were demonstrated to be virulence factors in murine models and swine infection using randomly mutated wild type bacteria [Tascon, et al., Mol. Microbiol. 14:207-216 (1994)].
  • Other A. pleuropneumoniae mutants have also been generated with targeted mutagenesis to inactivate the gene encoding the AopA outer membrane virulence protein [Mulks and Buysee, Gene 165:61-66 (1995)].
  • vaccine compositions of the invention comprise attenuated species in the Pasteurellaceae family of bacteria, which is known in the art and described, in part, in Dewhirst, et al., J. Bacteriol. 174:2002-2013 (1992), incorporated herein by reference in its entirety.
  • Species in the family include, but are not limited to, A. actinomycetemcomitans, A. capsulatus, A. equuli, A. lignieresii, A. pleuropneumoniae ( H. pleuropneumoniae ), A. seminis, A. suis ( H.
  • H. aegyptius H. aphrophilus
  • H. aphrophilus H. parainfluenzae
  • H. ducreyi H. haemoglobinophilus
  • H. haemolyticus H. influenzae
  • H. paracuniculus H. paragallinarum
  • H. parahaemolyticus H. parainfluenzae
  • H. paraphrophilus H. paraphrohaemolyticus
  • H. parasuis H. parasuis type 5 H. segnis, H.
  • vaccine compositions comprise attenuated Pasteurella haemolytica, Actinobacillus pleuropneumoniae, Haemophilus somnus, or Pasteurella multocida bacteria.
  • vaccine compositions of the invention comprise attenuated Pasteurella multocida and A. plueropneumoniae bacterial strains.
  • One aspect of the invention provides gram negative bacterial organisms containing a functional mutation in a gene sequence represented by any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, or species homologs thereof, wherein the mutation inhibits or abolishes expression and/or biological activity of an encoded gene product (i.e., the polypeptide encoded by a gene); said functional mutation resulting in attenuated virulence of the bacterial strain
  • species homologs include genes found in two or more different species which possess substantial polynucleotide sequence homology and possess the same, or similar, biological functions and/or properties.
  • polynucleotide sequences which represent species homologs will hybridize under moderately stringent conditions, as described herein by example, and possess the same or similar biological activities and or properties.
  • polynucleotides representing species homologs will share greater than about 60% sequence homology, greater than about 70% sequence homology, greater than about 80% sequence homology, greater than about 90% sequence homology or greater than about 95% sequence homology.
  • Functional mutations that modulate (i.e., increase or decrease) expression and/or biological activity of a gene product include insertions or deletions in the protein coding region of the gene itself or in sequences responsible for, or involved in, control of gene expression.
  • Deletion mutants include those wherein all or part of a specific gene sequence is deleted. In one aspect, the mutation results in deletion of at least about 10%, at least about 20%, at least about 30%, at least about 40% at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about. 98%, or at least about 99% of said gene.
  • the mutation results in an insertion in the gene, wherein the insertion causes decreased expression of a gene product encoded by the mutated gene and/or expression of an inactive gene product encoded by the mutated gene.
  • compositions, and preferably vaccine compositions comprising mutated and attenuated gram negative bacterial organisms, optionally comprising a suitable adjuvant and/or a. pharmaceutically acceptable diluent or carrier.
  • the attenuation must be significant enough to prevent the pathogen from evoking severe clinical symptoms, but also insignificant enough to allow limited replication and growth of the bacteria in the host.
  • the invention also provides polynucleotides encoding gene products that are required for virulence in gram negative bacteria.
  • Polynucleotides of the invention include DNA, such as complementary DNA, genomic DNA including complementary or anti-sense DNA, and wholly or partially synthesized DNA; RNA, including sense and antisense strands; and peptide nucleic acids as described, for example in Corey, TIBTECH 15:224-229 (1997).
  • Virulence gene polynucleotides of the invention include those set forth in SEQ ID NOs:1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, or species homologs thereof, polynucleotides encoding a virulence gene product encoded by a polynucleotide of SEQ D NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57,
  • the invention therefore comprehends gene sequences from Pasteurellaceae set out in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, as well as related gene sequences from other gram negative bacterial organisms, including naturally occurring (i.e., species homologs) and artificially induced variants thereof.
  • SEQ ID NOs 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57
  • the invention also comprehends polynucleotides which encode polypeptides deduced from any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, and 164, and species homologs thereof.
  • Knowledge of the sequence of a polynucleotide of the invention makes readily available every possible fragment of that polynucleotide. The invention therefore provides fragments of a polynucleotide of the invention.
  • the invention further embraces expression constructs comprising polynucleotides of the invention.
  • Host cells transformed, transfected or electroporated with a polynucleotide of the invention are also contemplated.
  • the invention provides methods to produce a polypeptide encoded by a polynucleotide of the invention comprising the steps of growing a host cell of the invention uider conditions that permit, and preferably promote, expression of a gene product encoded by the polynucleotide, and isolating the gene product from the host cell or the medium of its growth.
  • Polypeptides of the invention include full length and fragment, or truncated, proteins; variants thereof; fusion, or chimeric proteins; and analogs, including those wherein conservative amino acid substitutions have been introduced into wild-type polypeptides.
  • Antibodies that specifically recognize polypeptides of the invention are also provided, and include monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, humanized antibodies, human antibodies, and complementary determining region (CDR)-grafted antibodies, as well as compounds that include CDR sequences which specifically recognize a polypeptide of the invention.
  • the invention also provides anti-idiotype antibodies immunospecific for antibodies of the invention.
  • methods are provided for identifying novel anti-bacterial agents that modulate the function of gram negative bacteria virulence genes or gene products.
  • Methods of the invention include screening potential agents for the ability to interfere with expression of virulence gene products encoded by the DNA sequences set forth in any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, or species homologs thereof, or screening potential agents for the ability to interfere with biological function of
  • agents that interfere with the expression of virulence gene products include anti-sense polynucleotides and ribozymes that are complementary to the virulence gene sequences.
  • the invention further embraces methods to modulate transcription of gene products of the invention through use of oligonucleotide-directed triplet helix formation.
  • Agents that interfere with the function of virulence gene products include variants of virulence gene products, binding partners of the virulence gene products and variants of such binding partners, and enzyme inhibitors (where the product is an enzyme).
  • Novel anti-bacterial agents identified by the methods described herein are provided, as well as methods for treating a subject suffering from infection with gram negative bacteria involving administration of such novel anti-bacterial agents in an amount effective to reduce bacterial presence.
  • Virulence genes are genes whose function or products are required for successful establishment and/or maintenance of bacterial infection in a host animal. Thus, virulence genes and/or the proteins encoded thereby are involved in pathogenesis in the host organism, but may not be necessary for growth.
  • “Signature-tagged mutagenesis (STM),” as used herein, is a method generally described in International Patent Publication No. WO 96/17951, incorporated herein by reference, and includes, for example, a method for identifying bacterial genes required for virulence in a murine model of bacteremia.
  • bacterial strains that each have a random mutation in the genome are produced using transposon integration; each insertional mutation carries a different DNA signature tag which allows mutants to be differentiated from each other.
  • the tags comprise 40 bp variable central regions flanked by invariant “arms” of 20 bp which allow the central portions to be co-amplified by polymerase chain reaction (PCR).
  • Tagged mutant strains are assembled in microtiter dishes, then combined to form the “inoculum pool” for infection studies. At an appropriate time after inoculation, bacteria are isolated from the animal and pooled to form the “recovered pool.” The tags in the recovered pool and the tags in the inoculum pool are separately amplified, labeled, and then used to probe filters arrayed with all of the different tags representing the mutants in the inoculum. Mutant strains with attenuated virulence are those which cannot be recovered from the infected animal, i.e., strains with tags that give hybridization signals when probed with tags from the inoculum pool but not when probed with tags from the recovered pool. In a variation of this method, non-radioactive detection methods such as chemiluminescence can be used
  • Signature-tagged mutagenesis allows a large number of insertional mutant strains to be screened simultaneously in a single animal for loss of virulence. Screening nineteen pools of mutant P. multocida strains resulted in the identification of more than 60 strains with reduced virulence, many of which were confirmed to be attenuated in virulence by subsequent determination of an approximate LD 50 , for the individual mutants. Screening of A. pleuropneumoniae mutants resulted in identification of more than 100 strains having mutations in 35 different genes. Of these, mutations in 22 genes results in significantly attenuated A. pleuropneumoniae strains.
  • nucleotide sequence of the open reading frame disrupted by the transposon insertion was determined by sequencing both strands and an encoded amino acid sequence was deduced. Novelty of both the polynucleotide and amino acid sequences was determined by comparison of the sequences with DNA and protein database sequences.
  • the identification of bacterial, and more particularly P. multocida and A. pleuropneumoniae virulence genes provides for microorganisms exhibiting reduced virulence (i.e., attenuated strains), which are useful in vaccines.
  • Such microorganisms include Pasteurellaceae mutants containing at least one functional mutation inactivating a gene represented by any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164.
  • a “functional mutation” may occur in protein coding regions of a gene of the invention, as well as in regulatory regions that modulate transcription of the virulence gene RNA.
  • Attenuated P. multocida and A. pleuropneumoniae strains of the invention include those bearing more than one functional mutation. More than one mutation may result in additive or synergistic degrees of attenuation. Multiple mutations can be prepared by design or may fortuitously arise from a deletion event originally intended to introduce a single mutation.
  • An example of an attenuated strain with multiple deletions is a Salmonella typhimurium strain wherein the cya and crp genes are functionally deleted. This mutant S. typhimurium strain has shown promise as a live vaccine.
  • Identification of virulence genes in P. multocida and A. pleuropneumoniae can provide information regarding similar genes, i.e., species homologs, in other pathogenic species.
  • identification of the aroA gene led to identification of conserved genes in a diverse number of pathogens, including P. haemolytica, Aeromonas hydrophila, Aeromonas salmonicida, Salmonella typhimurium, Salmonella enteritidis, Salmonella dublin, Salmonella gallanerum, Bordella pertussis, Yersinia entericolitica, Neisseria gonorrhoeae, and Bacillus anthracis.
  • Attenuated bacterial strains bearing mutations in the aroA gene have proven to be effective in vaccine formulations.
  • similar or homologous genes can be identified in other organisms, particularly within the Pasteurella family, as well as A. pleuropneumoniae and Haemophilus somnus .
  • identification of A. pleuropneumoniae virulence genes can permit identification of related genes in other organisms.
  • Southern hybridization using the P. multocida and A. pleuropneumoniae genes as probes can identify these related genes in chromosomal libraries derived from other organisms.
  • PCR can be equally effective in gene identification across species boundaries.
  • P. multocida mutant with a chromosomal library from other species can also be used to identify genes having the same or related virulence activity. Identification of related virulence genes can therefore lead to production of an attenuated strain of the other organism which can be useful as still another vaccine formulation.
  • P. multocida genes that have been demonstrated to exist in other species (e.g. P. haemolytica, A. pleuropneumoniae and H. somnus ) include genes exbB, atpG, and pnp
  • Attenuated P. multocida strains identified using STM are insertional mutants wherein a virulence gene has been rendered non-functional through insertion of transposon sequences in either the open reading frame or regulatory DNA sequences.
  • the attenuated P. multocida strains, as well as other gram-negative mutant bacterial strains of the invention can bear one or more mutations which result in an insertion in the gene, with the insertion causing decreased expression of a gene product encoded by the mutated gene and/or expression of an inactive gene product encoded by the mutated gene.
  • multocida strains as well as other gram-negative mutant bacterial strains of the invention therefore include those bearing one or more mutation which results in deletion of at least about 10%, at least about 20%, at least about 30%, at least about 40% at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% of the virulence gene.
  • the vaccine properties ofan attenuated insertional mutant identified using STM are expected to be the same or similar to those of a bacteria bearing a deletion in the same gene. However, it is possible that an insertion mutation may exert “polar” effects on adjoining gene sequences, and as a result, the insertion mutant may possess characteristic distinct from a mutant strain with a deletion in the same gene sequence. Deletion mutants can be constructed using any of a number oftechniques well known and routinely practiced in the art.
  • a strategy using counterselectable markers can be employed which has commonly been utilized to delete genes in many bacteria.
  • a double selection strategy is often employed wherein a plasmid is constructed encoding both a selectable and counterselectable marker, with flanking DNA sequences derived from both sides of the desired deletion.
  • the selectable marker is used to select for bacteria in which the plasmid has integrated into the genome in the appropriate location and manner.
  • the counterselecteable marker is used to select for the very small percentage of bacteria that have spontaneously eliminated the integrated plasmid. A fraction of these bacteria will then contain only the desired deletion with no other foreign DNA present.
  • the key to the use of this technique is the availability of a suitable counterselectable marker.
  • the cre-lox system is used for site specific recombination of DNA.
  • the system consists of 34 base pair lox sequences that are recognized by the bacterial cre recombinase gene. If the lox sites are present in the DNA in an appropriate orientation, DNA flanked by the lox sites will be excised by the cre recombinase, resulting in the deletion of all sequences except for one remaining copy of the lox sequence.
  • a selectable marker e.g., a gene coding for kanamycin resistance
  • Transient expression by electroporation of a suicide plasmid containing the cre gene under control of a promoter that functions in P. multocida or A. pleuropneumoniae ) of the cre recombinase should result in efficient elimination of the lox flanked marker. This process would result in a mutant containing the desired deletion mutation and one copy of the lox sequences.
  • a desired deleted sequence in the P. multocida or A. pleuropneumoniae genome with a marker gene, such as green fluorescent protein (GFP), ⁇ -galactosidase, or luciferase.
  • GFP green fluorescent protein
  • DNA segments flanking a desired deletion are prepared by PCR and cloned into a suicide (non-replicating) vector for P. multocida or A. pleuropneumoniae.
  • An expression cassette, containing a promoter active in P. multocida or A. pleuropneumoniae and the appropriate marker gene is cloned between the flanking sequences.
  • the plasmid is introduced into wild-type P. multocida or A. pleuropneumoniae.
  • Bacteria that incorporate and express the marker gene are isolated and examined for the appropriate recombination event (i.e., replacement of the wild type gene with the marker gene).
  • the reduced virulence of these organisms and their immunogenicity may be confirmed by administration to a subject animal. While it is possible for an avirulent microorganism of the invention to be administered alone, one or more of such mutant microorganisms are preferably administered in a vaccine composition containing suitable adjuvant(s) and pharmaceutically acceptable diluent(s) or carrier(s).
  • the carrier(s) must be “acceptable” in the sense of being compatible with the avirulent microorganism of the invention and not deleterious to the subject to be immunized. Typically, the carriers will be water or saline which will be sterile and pyrogen free.
  • the subject to be immunized is a subject needing protection from a disease caused by a virulent form of P. multocida, A. pleuropneumoniae, or other pathogenic microorganisms.
  • the vaccine of the invention may be useful in the fields of human medicine and veterinary medicine.
  • the subject to be immunized may be a human or other animal, for example, farm animals including cows, sheep, pigs, horses, goats and poultry (e.g., chickens, turkeys, ducks and geese) companion animals such as dogs and cats; exotic and/or zoo animals; and laboratory animals including mice, rats, rabbits, guinea pigs, and hamsters.
  • the invention also provides polypeptides and corresponding polynucleotides required for P. multocida or A. pleuropneumoniae virulence.
  • the invention includes both naturally occurring and non-naturally occurring polynucleotides and polypeptide products thereof.
  • Naturally occurring virulence products include distinct gene and polypeptide species as well as corresponding species homologs expressed in organisms other than P. multocida or A. pleuropneumoniae strains.
  • Non-naturally occurring virulence products include variants of the naturally occurring products such as analogs and virulence products which include covalent modifications.
  • the invention provides virulence polynucleotides comprising the sequences set forth in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof, and polypeptides having amino acids sequences encoded by the polynucleotides.
  • the present invention provides novel purified and isolated P. multocida and A. pleuropneumoniae polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary aritisense strands) encoding the bacterial virulence gene products.
  • DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences.
  • Genomic DNA of the invention comprises the protein coding region for a polypeptide of the invention and includes variants that may be found in other bacterial strains of the same species. “Synthesized,” as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides.
  • P. multocida virulence gene products are set out in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof.
  • pleuropneumoniae DNA sequences encoding virulence gene products are set out in SEQ ID NOs: 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof.
  • the preferred DNA of the invention comprises a double stranded molecule, for example, molecules having the sequences set forth in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof, along with the complementary molecule (the “non-coding strand” or “complement”) having a sequence deducible from the sequence of SEQ ID NO: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23,
  • polynucleotides encoding the gene products encoded by any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof.
  • the invention further embraces species, preferably bacterial, homologs of the P. multocida and A. pleuropneumoniae DNA.
  • polynucleotide sequence information makes possible the identification and isolation of polynucleotides encoding related bacterial virulence molecules by well known techniques including Southern and/or Northern hybridization, and polymerase chain reaction (PCR).
  • Examples of related polynucleotides include polynucleotides encoding polypeptides homologous to a virulence gene product encoded by any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150,
  • the invention also embraces DNA sequences encoding bacterial gene products which hybridize under moderately to highly stringent conditions to the non-coding strand, or complement, of any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof DNA sequences encoding virulence polypeptides which would hybridize thereto but for the degeneracy of the genetic code are contemplated
  • Exemplary high stringency conditions include a final wash in buffer comprising 0.2 ⁇ SSC/0.1% SDS, at 65° C. to 75° C.
  • exemplary moderate stringency conditions include a final wash in buffer comprising 2 ⁇ SSC/0.1% SDS, at 35° C. to 45° C. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described in Ausubel, et al. (Eds.), Protocols in Molecular Biology, John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing of the probe.
  • GC guanosine/cytosine
  • hybridization conditions can be calculated as described in Sambrook, et al., (Eds.), Molecular Cloning: A Labratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y. (1989), pp. 9;47 to 9.51.
  • virulence polypeptide-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator.
  • the virulence genes may be cloned by PCR, using P. multocida genomic DNA as the template.
  • PCR primers are chosen so that the PCR-amplified gene has a restriction enzyme site at the 5′ end preceding the initiation codon ATG, and a restriction enzyme site at the 3′ end after the termination codon TAG, TGA or TAA.
  • the codons in the gene are changed, without changing the amino acids, according to E. coli codon preference described by Grosjean and Fiers, Gene, 18:199-209 (1982), and Konigsberg and Godson, Proc. Natl. Acad. Sci. ( USA ), 80:687-691 (1983). Optimization of codon usage may lead to an increase in the expression of the gene product when produced in E. coli. If the gene product is to be produced extracellularly, either in the periplasm of E. coli or other bacteria, or into the cell culture medium, the gene is cloned without its initiation codon and placed into an expression vector behind a signal sequence.
  • host cells including procaryotic and eukaryotic cells, either stably or transiently transformed, transfected, or electroporated with polynucleotide sequences of the invention in a manner which permits expression of virulence polypeptides of the invention.
  • Expression systems of the invention include bacterial, yeast, fungal, viral, invertebrate, and mammalian cells systems.
  • Host cells of the invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with the virulence gene product.
  • Host cells of the invention are conspicuously useful in methods for large scale production of virulence polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification or any of the multitude of purification techniques well known and routinely practiced in the art.
  • Any suitable host cell may be used for expression of the gene product, such as E. coli, other bacteria, including P. multocida, Bacillus and S. aureus, yeast, including Pichia pastoris and Saccharomyces cerevisiae, insect cells, or mammalian cells, including CHO cells, utilizing suitable vectors known in the art.
  • Proteins may be produced directly or fused to a peptide or polypeptide, and either intracellularly or extracellularly by secretion into the periplasmic space of a bacterial cell or into the cell culture medium.
  • Secretion of a protein requires a signal peptide (also known as pre-sequence); a number of signal sequences from prokaryotes and eukaryotes are known to function for the secretion of recombinant proteins.
  • the signal peptide is removed by signal peptidase to yield the mature protein.
  • a purification tag may be added either at the 5′ or 3′ end of the gene coding sequence.
  • Commonly used purification tags include a stretch of six histidine residues (U.S. Pat. Nos. 5,284,933 and 5,310,663), a streptavidin-affinity tag described by Schmidt and Skerra, Protein Engineering, 6:109-122 (1993), a FLAG peptide [Hopp et al., Biotechnology, 6:1205-1210 (1988)], glutathione S-transferase [Smith and Johnson, Gene, 67:31-40 (1988)], and thioredoxin [LaVallie et al., Bio/Technology, 11:187-193 (1993)].
  • a proteolytic cleavage recognition site may be inserted at the fusion junction.
  • Commonly used proteases are factor Xa, thrombin, and enterokinase.
  • the invention also provides purified and isolated P. multocida and A. pleuropneumoniae virulence polypeptides encoded by a polynucleotide of the invention.
  • polypeptides comprising the amino acid sequences encoded by any one of the polynucleotides set out in SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118,and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, and 164, and species homologs thereof.
  • the invention embraces virulence polypeptides encoded by a DNA selected from the group consisting of: a) the DNA sequence set out in any one of SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, and 164, and species homologs thereof; b) DNA molecules encoding P.
  • pleuropneumoniae polypeptides encoded by any one of SEQ ID NOs: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82, 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, and 164, and species homologs thereof; and c) a DNA molecule, encoding a virulence gene product, that hybridizes under moderately stringent conditions to the DNA of (a) or (b).
  • the invention also embraces polypeptides, i.e., species homologs and orthologs, that have at least about 99%, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, and at least about 50% identity and/or homology to the preferred polypeptides of the invention.
  • polypeptides i.e., species homologs and orthologs, that have at least about 99%, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, and at least about 50% identity and/or homology to the preferred polypeptides of the invention.
  • Percent amino acid sequence “identity” with respect to the preferred polypeptides of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the virulence gene product sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Percent sequence “homology” with respect to the preferred polypeptides of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in one of the virulence polypeptide sequences after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part of the sequence identity.
  • Polypeptides of the invention may be isolated from natural bacterial cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention.
  • Virulence gene products of the invention may be full length polypeptides, biologically active fragments, or variants thereof which retain specific biological or immunological activity.
  • Variants may comprise virulence polypeptide analogs wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more non-specified amino acids are added: (1) without loss of one or more of the biological activities or immunological characteristics specific for the virulence gene product; or (2) with specific disablement of a particular biological activity of the virulence gene product.
  • Deletion variants contemplated also include fragments lacking portions of the polypeptide not essential for biological activity, and insertion variants include fusion polypeptides in which the wild-type polypeptide or fragment thereof have been fused to another polypeptide.
  • Variant virulence polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding polypeptides of the invention.
  • Conservative substitutions are recognized in the art to classify amino acids according to their related physical properties and can be defined as set out in Table A (from WO 97/09433, page 10, published Mar. 13, 1997 (PCT/GB96/02197, filed Sep. 6, 1996).
  • conservative amino acids can be grouped as defined in Lehninger, [ Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY (1975), pp.71-77] as set out in Table B. TABLE B Conservative Substitutions II SIDE CHAIN CHARACTERISTIC AMINO ACID Non-polar (hydrophobic) A.
  • Variant virulence products of the invention include mature virulence gene products, i.e., wherein leader or signal sequences are removed, having additional amino terminal residues.
  • Virulence gene products having an additional methionine residue at position-1 are contemplated, as are virulence products having additional methionine and lysine residues at positions-2 and -1.
  • Variants of these types are particularly useful for recombinant protein production in bacterial cell types.
  • Variants of the invention also include gene products wherein amino terminal sequences derived from other proteins have been introduced, as well as variants comprising amino terminal sequences that are not found in naturally occurring proteins.
  • the invention also embraces variant polypeptides having additional amino acid residues which result from use of specific expression systems.
  • use of commercially available vectors that express a desired polypeptide as a fusion protein with glutathione-S-transferase (GST) provide the desired polypeptide having an additional glycine residue at position-1 following cleavage of the GST component from the desired polypeptide.
  • GST glutathione-S-transferase
  • antibodies e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, humanized, human, and CDR-grafted antibodies, including compounds which include CDR sequences which specifically recognize a polypeptide of the invention
  • binding proteins specific for virulence gene products or fragments thereof.
  • the term “specific for” indicates that the variable regions of the antibodies of the invention recognize and bind a virulence polypeptide exclusively (i.e., are able to distinguish a single virulence polypeptides from related virulence polypeptides despite sequence identity, homology, or similarity found in the family of polypeptides), but may also interact with other proteins (for example, S.
  • aureus protein A or other antibodies in ELISA techniques through interactions with sequences outside the variable region of the antibodies, and in particular, in the constant region of the molecule.
  • Screening assays to determine binding specificity of an antibody of the invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor, N.Y. (1988), Chapter 6.
  • Antibodies that recognize and bind fragments of the virulence polypeptides of the invention are also contemplated, provided that the antibodies are first and foremost specific for, as defined above, a virulence polypeptide of the invention from which the fragment was derived.
  • the DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of the virulence genes and their encoded gene products.
  • Knowledge of a polynucleotide encoding a virulence gene product of the invention also makes available anti-sense polynucleotides which recognize and hybridize to polynucleotides encoding a virulence polypeptide of the invention. Full length and fragment anti-sense polynucleotides are provided.
  • fragment anti-sense molecules of the invention include (i) those which specifically recognize and hybridize to a specific RNA (as determined by sequence comparison of DNA encoding a virulence polypeptide of the invention to DNA encoding other known molecules) as well as (ii) those which recognize and hybridize to RNA encoding variants of the family of virulence proteins.
  • Antisense polynucleotides that hybridize to RNA encoding other members of the virulence family of proteins are also identifiable through sequence comparison to identify characteristic, or signature, sequences for the family of molecules.
  • Ribozyme technology can be utilized to inhibit translation of mRNA in a sequence specific manner through (i) the hybridization of a complementary RNA to a target mRNA and (ii) cleavage of the hybridized mRNA through nuclease activity inherent to the complementary strand.
  • Ribozymes can be identified by empirical methods but more preferably are specifically designed based on accessible sites on the target mRNA [Bramlage, et al., Trends in Biotech 16:434-438 (1998)].
  • ribozymes to target cells can be accomplished using either exogenous or endogenous delivery techniques well known and routinely practiced in the art.
  • Exogenous delivery methods can include use of targeting liposomes or direct local injection.
  • Endogenous methods include use of viral vectors and non-viral plasmids.
  • Ribozymes can specifically modulate expression of virulence genes when designed to be complementary to regions unique to a polynucleotide encoding a virulence gene product. “Specifically modulate” therefore is intended to mean that ribozymes of the invention recognizes only a single polynucleotide. Similarly, ribozymes can be designed to modulate expression of all or some of a family of proteins. Ribozymes of this type are designed to recognize polynucleotide sequences conserved in all or some of the polynucleotides which encode the family of proteins.
  • the invention further embraces methods to modulate transcription of a virulence gene of the invention through use of oligonucleotide-directed triplet helix formation.
  • oligonucleotide-directed triplet helix formation is accomplished using sequence specific oligonucleotides which hybridize to double stranded DNA in the major groove as defined in the Watson-Crick model. Hybridization of a sequence specific oligonucleotide can thereafter modulate activity of DNA-binding proteins, including, for example, transcription factors and polymerases.
  • Preferred target sequences for hybridization include transcriptional regulatory regions that modulate virulence gene product expression.
  • Oligonucleotides which are capable of triplet helix formation are also useful for site-specific covalent modification of target DNA sequences. Oligonucleotides useful for covalent modification are coupled to various DNA damaging agents as described in Lavrovsky, et al. [supra].
  • P. multocida and A. pleuropneumoniae virulence genes renders the genes and gene products useful in methods for identifying anti-bacterial agents.
  • Such methods include assaying potential agents for the ability to interfere with expression of virulence gene products represented by the DNA sequences set forth in any one of SEQ ID NOS: 1, 3, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 29, 31, 33, 37, 39, 41, 51, 53, 55, 57, 58, 60, 68, 70, 72, 74, 76, 78, 80, 82 84, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, and 120, 122, 124, 126, 128, 130, 132, 134, 135, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 163, and 164, and species homologs thereof (i.e., the genes represented by DNA sequence
  • the virulence gene products produced by the methods described above are used in high throughput assays to screen for inhibitory agents.
  • the sources for potential agents to be screened are chemical compound libraries, fermentation media of Streptomycetes, other bacteria and fungi, and cell extracts of plants and other vegetations.
  • assays are established based on the activity, and a large number of potential agents are screened for ability to inhibit the activity.
  • binding assays are established to measure such interaction directly, and the potential agents are screened for ability to inhibit the binding interaction.
  • assays known in the art are contemplated according to this aspect of the invention.
  • function of the virulence gene product is known or predicted by sequence similarity to a known gene product
  • potential inhibitors can be screened in enzymatic or other types of biological and/or biochemical assays keyed to the function and/or properties of the gene product.
  • inhibitors of the interaction can be screened directly in binding assays.
  • the invention contemplates a multitude of assays to screen and identify inhibitors of binding by the virulence gene product.
  • the virulence gene product is immobilized and interaction with a binding partner is assessed in the presence and absence of a putative inhibitor compound.
  • interaction between the virulence gene product and its binding partner is assessed in a solution assay, both in the presence and absence of a putative inhibitor compound.
  • an inhibitor is identified as a compound that decreases binding between the virulence gene product and its binding partner.
  • Other assays are also contemplated in those instances wherein the virulence gene product binding partner is a protein.
  • di-hybrid assay variations of the di-hybrid assay are contemplated wherein an inhibitor of protein/protein interactions is identified by detection of a positive signal in a transformed or transfected host cell as described in PCT publication number WO 95/20652, published Aug. 3, 1995.
  • Candidate inhibitors contemplated by the invention include compounds selected from libraries of potential inhibitors. There are a number of different libraries used for the identification of small molecule modulators, including: (1) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules. Chemical libraries consist of structural analogs of known compounds or compounds that are identified as “hits” or “leads” via natural product screening. Natural product libraries are collections of microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms.
  • Natural product libraries include polyketides, non-ribosomal peptides, and variants (non-naturally occurring) thereof. For a review, see Science 282:63-68 (1998).
  • Combinatorial libraries are composed of large numbers of peptides, oligonucleotides, or organic compounds as a mixture. They are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning, or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries. Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries. For a review of combinatorial chemistry and libraries created therefrom, see Myers, Curr. Opin. Biotechnol. 8:701-707 (1997). Identification of modulators through use of the various libraries described herein permits modification of the candidate “hit” (or “lead”) to optimize the capacity of the “hit” to modulate activity.
  • binding partners as used herein broadly encompasses antibodies, antibody fragments, and modified compounds comprising antibody domains that are immunospecific for the expression product of the identified virulence gene.
  • binding partner i.e., ligand
  • Other assays may be used when a binding partner (i.e., ligand) for the virulence gene product is not known, including assays that identify binding partners of the target protein through measuring direct binding of test binding partner to the target protein, and assays that identify binding partners of target proteins through affinity ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and analytical methods.
  • binding interactions are evaluated indirectly using the yeast two-hybrid system described in Fields and Song, Nature, 340:245-246 (1989), and Fields and Sternglanz, Trends in Genetics, 10:286-292 (1994), both of which are incorporated herein by reference.
  • the two-hybrid system is a genetic assay for detecting interactions between two proteins or polypeptides. It can be used to identify proteins that bind to a known protein of interest, or to delineate domains or residues critical for an interaction. Variations on this methodology have been developed to clone genes that encode DNA-binding proteins, to identify peptides that bind to a protein, and to screen for drugs.
  • the two-hybrid system exploits the ability of a pair of interacting proteins to bring a transcription activation domain into close proximity with a DNA-binding domain that binds to an upstream activation sequence (UAS) of a reporter gene, and is generally performed in yeast.
  • UAS upstream activation sequence
  • the assay requires the construction of two hybrid genes encoding (1) a DNA-binding domain that is fused to a first protein and (2) an activation domain fused to a second protein.
  • the DNA-binding domain targets the first hybrid protein to the UAS of the reporter gene; however, because most proteins lack an activation domain, this DNA-binding hybrid protein does not activate transcription of the reporter gene.
  • the second hybrid protein which contains the activation domain, cannot by itself activate expression of the reporter gene because it does not bind the UAS. However, when both hybrid proteins are present, the noncovalent interaction of the first and second proteins tethers the activation domain to the UAS, activating transcription of the reporter gene.
  • this assay can be used to detect agents that interfere with the binding interaction.
  • Expression of the reporter gene is monitored as different test agents are added to the system; the presence of an inhibitory agent results in lack of a reporter signal.
  • the yeast two-hybrid assay can also be used to identify proteins that bind to the gene product.
  • an assay to identify proteins that bind to the first protein (the target protein) a large number of hybrid genes each encoding different second proteins are produced and screened in the assay.
  • the second protein is encoded by a pool of plasmids in which total cDNA or genomic DNA is ligated to the activation domain.
  • This system is applicable to a wide variety of proteins, and it is not even necessary to know the identity or function of the second binding protein.
  • the system is highly sensitive and can detect interactions not revealed by other methods; even transient interactions may trigger transcription to produce a stable mRNA that can be repeatedly translated to yield the reporter protein.
  • test ligands may be used to search for agents that bind to the target protein.
  • One such screening method to identify direct binding of test ligands to a target protein is described in U.S. Pat. No. 5,585,277, incorporated herein by reference. This method relies on the principle that proteins generally exist as a mixture of folded and unfolded states, and continually alternate between the two states.
  • the target protein molecule bound by the ligand remains in its folded state.
  • the folded target protein is present to a greater extent in the presence of a test ligand which binds the target protein, than in the absence of a ligand. Binding of the ligand to the target protein can be determined by any method which distinguishes between the folded and unfolded states of the target protein. The function of the target protein need not be known in order for this assay to be performed. Virtually any agent can be assessed by this method as a test ligand, including, but not limited to, metals, polypeptides, proteins, lipids, polysaccharides, polynucleotides and small organic molecules.
  • the inhibitors/binders identified by the initial screens are evaluated for their effect on virulence in in vivo mouse models of P. multocida infections. Models of bacteremia, endocarditis, septic arthritis, soft tissue abscess, or pneumonia may be utilized. Models involving use of other animals are also comprehended by the invention. For example, rabbits can be challenged with a wild type P. multocida strain before or after administration of varying amounts of a putative inhibitor/binder compound. Control animals, administered only saline instead of putative inhibitor/binder compound provide a standard by which deterioration of the test animal can be determined. Other animal models include those described in the Animal and Plant Health Inspection Service, USDA , Jan.
  • Inhibitors/binders that interfere with bacterial virulence are can prevent the establishment of an infection or reverse the outcome of an infection once it is established.
  • any adjuvant known in the art may be used in the vaccine composition, including oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant, mycolate-based adjuvants (e.g., trehalose dimycolate), bacterial lipopolysaccharide (LPS), peptidoglycans (i.e., mureins, mucopeptides, or glycoproteins such as N-Opaca, muramyl dipeptide [MDP], or MDP analogs), proteoglycans (e.g., extracted from Klebsiella pneumoniae ), streptococcal preparations (e.g.
  • oil-based adjuvants such as Freund's Complete Adjuvant and Freund's Incomplete Adjuvant
  • mycolate-based adjuvants e.g., trehalose dimycolate
  • LPS bacterial lipopolysaccharide
  • peptidoglycans i.e., mureins,
  • the vaccine compositions optionally may include vaccine-compatible pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media.
  • vaccine-compatible pharmaceutically acceptable i.e., sterile and non-toxic
  • liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media.
  • Any diluent known in the art may be used.
  • Exemplary diluents include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of the obroma.
  • the vaccine compositions can be packaged in forms convenient for delivery.
  • the compositions can be enclosed within a capsule, caplet, sachet, cachet, gelatin, paper, or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form.
  • the dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets.
  • the vaccine compositions may be introduced into the subject to be immunized by any conventional method including, e.g., by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, or subcutaneous injection; by oral, sublingual, nasal, anal, or vaginal, delivery.
  • the treatment may consist of a single dose or a plurality of doses over a period of time.
  • the invention also comprehends use of an attenuated bacterial strain of the invention for manufacture of a vaccine medicament to prevent or alleviate bacterial infection and/or symptoms associated therewith.
  • the invention also provides use of inhibitors of the invention for manufacture of a medicament to prevent or alleviate bacterial infection and/or symptoms associated therewith.
  • Example 1 describes constructions of P. multocida mutants.
  • Example 2 relates to screening for P. multocida mutants.
  • Example 3 addresses methods to determine virulence of the P. multocida mutants.
  • Example 4 describes cloning of P. multocida virulence genes.
  • Example 5 addresses identification of genes in other species related to P. multocida virulence genes.
  • Example 6 describes construction of A. pleuropneumoniae mutants.
  • Example 7 addresses screening for attenuated A. pleuropneumoniae mutants.
  • Example 8 relates to identification of A. pleuropneumoniae virulence genes.
  • Example 9 describes competition challenge of A. pleuropneumoniae mutants and wild type bacteria.
  • Example 10 characterizes A. pleuropneumoniae genes identified.
  • Example 11 addresses efficacy of A. pleuropneumoniae mutant to protect against wild type bacterial challenge.
  • Plasmid pLOF/Km was constructed as a modification of suicide vector pGP704 and included a transposase gene under control of the Tac promoter as well as the mini-Tnl transposable element encoding kanamycin resistance. Plasmid pTEF-1 was constructed as described below by modifying pLOF/Km to accept sequence tags which contained a semi-random [NK]35 sequence.
  • Plasmid pLOF/Km was first modified to eliminate the unique KpnI restriction site in the multiple cloning region and then to introduce a new KpnI site in the mini-Tn10 region.
  • the plasmid was digested with KpnI and the resulting overhanging ends Were filled in with Klenow polymerase according to manufacturer's suggested protocol. Restriction digests and ligations described herein were performed according to manufacturer's suggested protocols (Gibco BRL, Gaithersburg, Md. and Boehringer Mannheim, Indianapolis, Ind.). The blunt end product was self-ligated to produce a plasmid designated pLOF/Km-KpnI which was transformed into E.coli DH5 ⁇ : ⁇ pir for amplification.
  • E.coli DH5 ⁇ ( ⁇ pir ⁇ 80dlacZ ⁇ M15, recA1, endA1, gyrA96, thi-1, hsdR17(r k ⁇ , m k , supE44, relA1, deoR, ⁇ (lacZYA-argF)U169, was propagated at 37° C. in Luria-Bertani (LB) medium. Plasmids were prepared using QIAGEN SpinPreps from QIAGEN Inc. (Santa Clarita, Calif.) and digested with SfiI which cuts at a unique site within the mini-Tn10 transposable element.
  • a SfiI-KpnI-SfiI adaptor was prepared by annealing oligonucleotides TEF1 (SEQ ID NO: 86) and TEF3 (SEQ ID NO: 87) and the resulting double-stranded adapter was ligated into the SfiI site to create plasmid pTEF-1.
  • Oligonucleotides TEF1 and TEF3 were synthesized by Genosys Biotechnologies (The Woodlands, TX).
  • TEF1 SEQ ID NO:86 5′-AGGGCGGTACCGGCCGGCT
  • SEQ ID NO:87 5′-CGGCCGGTACCGGCCTAGG
  • Unique sequence tags for insertion into the KpnI site of pTEF-1 were prepared as follows. PCR was carried out to generate double stranded DNA tags using a GeneAmp XL PCR Kit (PE Applied Biosystems, Foster City, Calif.) under conditions including 250 ⁇ M each dNTP, 1.5 mM Mg(OAc) 2 , 100 pmol each primer TEF14 (SEQ ID NO: 88) and TEF15 (SEQ ID NO: 89), 1 ng TEF26 (SEQ ID NO: 90) as template DNA and 2.5 units recombinant Tth DNA Polymerase XL.
  • a GeneAmp XL PCR Kit PE Applied Biosystems, Foster City, Calif.
  • the PCR products were digested with KpnI and purified using a QIAGEN Nucleotide Removal Kit (QIAGEN, Inc., Chatsworth, Ga.) according to the manufacturer's suggested protocol.
  • the unique tag sequences were ligated into the mini-Tn10 element of linearized pTEF-1, previously digested with KpnI and dephosphorylated with calf intestinal alkaline phosphatase (Boehringer Mannheim) using standard procedures.
  • the resulting plasmid library was transformed into E.coli DH5 ⁇ : ⁇ pir. Colony blot analysis was performed according to the DIG User's Guide (Boehringer-Mannheim) with hybridization and detection performed as follows.
  • Hybridizations were essentially performed according to the Genius Non-Radioactive User's Guide (Boehringer Mannheim Biochemicals), the product sheet for the DIG-PCR labeling kit (Boehringer Mannheim Biochemicals), and the product sheet for CSPD (Boehringer Mannheim Biochemicals).
  • a 100 ⁇ l primary PCR reaction was set up using Amplitaq PCR buffer (PE Applied Biosystems), 200 ⁇ M dNTPs, 140 pmol each of primers TEF5 (SEQ ID NO: 91) and TEF6 (SEQ ID NO: 92),2 MM MgCl 2 , 2.5 units Amplitaq (PE Applied Biosystems) and 1 ng of plasmid DNA.
  • TEF5 SEQ ID NO:91 5′-TACCTACAACGTCAAGCT
  • TEF6 SEQ ID NO:92 5′-TACCCATTCTAACCAAGC
  • Cycle conditions included an initial incubation at 95° C. for two minutes, followed by 35 cycles of 95° C. for 30 seconds, 50° C. for 45 seconds, 72° C. for 15 seconds and a final incubation at 72° C. for three minutes.
  • the amplification products were separated using electrophoresis on a 2%-3:1 NuSieve GTG (FMC BioProducts, Rockland, Me., USA):Agarose gel and the 109 bp product was excised and purified. Gel extractions were carried out using a QIAGEN Gel Extraction kit (QIAGEN).
  • TEF24 SEQ ID NO:93 5′-TACCTACAACCTCAAGCTT TEF25 SEQ ID NO:94 5′-TACCCATTCTAACCAAGCTT PCR conditions included an initial incubation at 95° C. for four minutes, followed by 25 cycles of 95° C. for 30 seconds, 50° C. for 45 seconds, 72° C. for 15 seconds and a final incubation at 72° C. for three minutes.
  • the labeled PCR product was digested with HindIII in a total reaction volume of 90 ⁇ l and purified from the constant primer arms using a 2%-3:1 NuSieve GTG (FMC BioProducts):Agarose gel. The region containing the labeled variable tag was excised and the entire gel slice was dissolved and denatured in 10 ml of DIG EasyHyb at 95° C. for ten minutes.
  • Dot blots were prepared using a Hybond®-N + membrane (Amersham-Pharmacia Biotech). Target DNA for each tag was prepared in 96 well plates using approximately 30 ng of PCR product. An equal volume of 0.1 N NaOH was added to denature the sample and each sample was applied to the membrane with minimal vacuum using a Minifold FM Dot-Blot Apparatus from Schleicher and Schuell (Keene, N.H., USA). Each well was washed with 150 ⁇ l of Neutralization Solution (0.5 M Tris/3 M NaCl, pH 7.5) and 150 ⁇ l of 2 ⁇ SSC.
  • Neutralization Solution 0.5 M Tris/3 M NaCl, pH 7.5
  • Membranes were UV-crosslinked in a Stratalinker (Stratagene, La Jolla, Calif., USA) and prehybridized for one hour in 20 mls DIG EasyHyb Buffer at 42° C. The denatured probe was added and hybridization carried out overnight at 42° C. The membrane was washed two times in 2 ⁇ SSC containing 0.1% SDS for five minutes each wash. Two high stringency washes were performed in 50 ml of pre-warmed 0.1 ⁇ SSC buffer containing 0.1% SDS at 68° C. for 15 minutes before proceeding with standard Genius Detection protocols (Genius Manual).
  • PCR was used to generate [NK] 35 sequence tags as the target DNA in dot blots rather than the entire plasmids containing the tagged transposons after detecting background hybridization from the transposon itself Using these modifications background was eliminated making chemiluminescent/non-radioactive screening more effective.
  • P. multocida strain TF5 is a spontaneous nalidixic acid resistant mutant derived from UC6731, a bovine clinical isolate.
  • P. multocida strains were grown on brain heart infusion (BHI) media (Difco Laboratories, Detroit, Mich., USA) at 37° C. and in 5% CO 2 when grown on plates.
  • BHI brain heart infusion
  • Matings were set up by growing each E.coli S 17-1 : ⁇ pir/pTEF1:[NK]35 clone and the TF5 strain to late log phase. Fifty ⁇ l of culture for each tagged-pTEF-1 clone, was mixed with 200 ⁇ l of the TF5 culture and 50 ⁇ l of each mating mixture was spotted onto 0.22 TM filters previously placed on BHI plates containing 100 mM IPTG and 10 mM MgSO 4 .
  • Overnight plates were subcultured by transferring 10 ⁇ l from each well to a new flat bottomed 96-well plate (Corning Costar) containing 100 ⁇ l of BHI per well and incubating at 37° C. with shaking at approximately 150 rpm.
  • the OD 540 was monitored using a micro-titer plate reader. At an OD 540 of approximately 0.2 to 0.25, each plate was pooled to form the “input pool” by combining 100 ⁇ l from each of the wells of the micro-titer plate.
  • the culture was diluted appropriately in BHI to doses of approximately 10 4 , 10 5 , 10 6 CFU/ml and 0.2 ml of each dilution was used to infect female 14-16 g BALB/c mice by intraperitoneal administration. At two days post-infection, one or two surviving mice were euthanized and the spleens harvested. The entire spleen was homogenized in 1.0 ml sterile 0.9% saline. Dilutions of the homogenate from 10 ⁇ 2 to 10 ⁇ 5 were prepared and plated onto BHIN 50 K 50 plates.
  • Each potential mutant which exhibited reduced recovery from splenic tissue was isolated from the original pool plate and used individually in a challenge experiment to verify and roughly estimate the attenuation caused by the transposon mutation.
  • Individual candidate mutants from in vivo screens were grown on Sheep Blood Agar plates overnight in 5% CO 2 at 37° C. Approximately six colonies of each mutant were inoculated into BHI broth and allowed to grow for six hours, Dilutions were prepared and five mice each were infected as described above with 10 2 , 10 3 , 10 4 and 10 5 CFU each. Attenuation was determined by comparing mortality after six days relative to the wild type. Surviving mice were presumed to be protected and then challenged with a dose of wild type P. multocida at a concentration approximately 200-fold greater than the LD 50 for the wild type strain. Survival rate was then determined for each challenged group of mice.
  • the clones and their approximate LD 50 values are listed in Table 1.
  • a control experiment with the wild type strain was run in parallel with each set of challenges and in all cases mortality in wild type-challenged groups was 100%.
  • Each transposon mutant which was verified to be attenuated was analyzed further to determine the identity of the disrupted open reading frame.
  • DNA from each mutant was amplified, purified, and digested with restriction enzymes that were known not to cut within the transposon and generally produced 4-8 kb fragments that hybridized with the transposon.
  • restriction enzymes that were known not to cut within the transposon and generally produced 4-8 kb fragments that hybridized with the transposon.
  • at least one fragment for each transposon mutant was cloned.
  • Sequencing reactions were performed using the BigDyeTM Dye Terminator Chemistry kit from PE Applied Biosystems (Foster City, Calif.) and run on an ABI Prism 377 DNA Sequencer. Double stranded sequence for putative interrupted open reading frames was obtained for each clone. Sequencer3.0 software (Genecodes, Corp., Ann Arbor, Mich.) was used to assemble and analyze sequence data. GCG programs [Devereux, et al., 1997. Wisconsin Package Version 9.0, 9.0 ed. Genetics Computer Group, Inc., Madison] were used to search for homologous sequences in currently available databases.
  • STM was also performed using Actinobacillus pleuropneumoniae (App).
  • App strains contained an insertion in a gene that was sequenced (SEQ ID NO: 97) and identified as a species homolog of the P. multocida atpG gene. This result suggested the presence in other bacterial species of homologs to previously unknown P. multocida genes that can also be mutated to produce attenuated strains of the other bacterial species for use in vaccine compositions.
  • Southern hybridization was performed on genomic DNA from other species using the A. pleuropneumoniae atpG gene as a probe.
  • Actinobacillus pleuropneumoniae, Pasteurella haemolytica (Ph), P. multocida, and Haemophilus somnus (Hs) genomic DNA was isolated using the CTAB method and digested with EcoRI and HindIII for two hours at 37° C. Digested DNA was separated on a 0.7% agarose gel at 40V in TAE buffer overnight. The gel was immersed sequentially in 0.1 M HCL for 30 minutes, twice in 0.5 M NaOH/1.5 M NaCl for 15 minutes each, and twice in 2.5 M NaCl/1 M Tris, pH 7.5. The DNA was transferred to nitrocellulose membranes (Amersham Hybond N + ) overnight using 20 ⁇ SSC buffer (3 M NaCl/0.3 M sodium citrate).
  • the DNA was crosslinked to the membrane using a UV Stratalinker on autocrosslink setting (120 millijoules).
  • the membrane was prehybridized in 5 ⁇ SSC/1% blocking solution/0.1% sodium lauroyl sarcosine/0.02% SDS at 50° C. for approximately seven hours and hybridized overnight at 50° C. in the same solution containing a PCR generated atgG probe.
  • the probe was prepared using primers DEL-1 389 (SEQ ID NO: 98) and TEF-46 (SEQ ID NO: 99) in a with a GeneAmp XL PCR kit in a GeneAmp PCR System 2400. Template was genomic A. pleuropneumoniae DNA. DEL-1389 SEQ ID NO:98 TCTCCATTCCCTTGCTGCGGCAGGG TEF-46 SEQ ID NO:99 GGAATTACAGCCGGATCCGGG
  • the PCR was performed with an initial heating step at 94° C. for five minutes, 30 cycles of denaturation t 94° C. for 30 sec, annealing at 50° C. for 30 sec, and elongation at 72° C. for three minutes, and a final extension step at 72° C. for five minutes.
  • the amplification products were separated on an agarose gel, purified using a QIAquick gel purification kit (QIAGEN), and labeled using a DIG-High Primer kit (Boehringer Mannheim).
  • the blot was removed from the hybridization solution and rinsed in 2 ⁇ SSC and washed two times for five minutes each wash in the same buffer. The blot was then washed two times for 15 minutes each in 0.5 ⁇ SSC at 60° C. Homologous bands were visualized using a DIG Nucleic Acid Detection Kit (Boehringer Mannheim).
  • pleuropneumoniae strains were grown on Brain Heart Infusion (BHI) (Difco Laboratories, Detroit, Mich.) media with 10 ⁇ g/ml B-nicotinamide adenine dinucleotide (V 10 ), (Sigma, St. Louis, Mo.) at 37° C. and in 5% CO 2 when grown on plates.
  • BHI Brain Heart Infusion
  • V 10 B-nicotinamide adenine dinucleotide
  • Antibiotics when necessary were used at 100 ⁇ g/ml ampicillin (Sigma), 50 ⁇ g/ml nalidixic acid (N 50 )(Sigma), and 50 (K 50 ) or 100 (K 100 ) ⁇ g/ml of kanamycin (Sigma).
  • Matings were set up by growing each E. coli S17-1 : ⁇ pir/pTEF1:[NK] 35 clone and the AP225 strain to late log phase. A 50 ⁇ l aliquot of culture for each tagged-pTEF-1 clone was mixed with 150 ⁇ l of the APP225 culture, and then 50 ⁇ l of each mating mixture was spotted onto 0.22 ⁇ M filters previously placed onto BHIV 10 plates containing 100 ⁇ M IPTG and 10 mM MgSO 4 . Following overnight incubation at 37° C. with 5% CO 2 , mating mixtures were washed off of each filter into 2 ml of PBS and 200 ⁇ l of each was plated onto BHIV 10 N 50 K 100 plates.
  • APP does not appear to have as much bias towards multiple insertions of the mini-Tn10 element as did P. multocida. Only approximately 3% of the mutants were determined to contain multiple insertions, which is in agreement with the 4% previously reported [Tascon, et al., J Bacteriol. 175:5717-22(1993)].
  • a problem in APP consisted of identifying numerous mutants (discussed below) containing insertions into 23S RNA regions: 28 total mutants with insertions into 13 unique sites. This may indicate that 23S RNA contains preferential insertion sites and that the growth of APP is affected by these insertions enough to result in differential survival within the host.
  • A. pleuropneumoniae transposon mutants containing a total of approximately 800 mutants, were screened using a porcine intratracheal infection model. Each pool was screened in two separate animals.
  • Frozen plates of pooled A. pleuropneumoniae transposon mutants were removed from ⁇ 80° C. storage and subcultured by transferring 20 ⁇ l from each well to a new 96 well round bottom plate (Corning Costar, Cambridge, Mass., USA) containing 180 ⁇ l of BHIV 10 N 50 K 50 . Plates were incubated without shaking overnight at 37° C. in 5% CO 2 . Overnight plates were then subcultured by transferring 10 ⁇ l from each well to a new flat bottomed 96 well plate (Coming Costar) containing 100 ⁇ l of BHIV 10 per well and incubating at 37° C. with shaking at 150 rpm. The OD 562 was monitored using a microtiter plate reader.
  • each plate was pooled to form the “input pool” by combining 100 ⁇ l from each of the wells of the microtiter plate.
  • the culture was diluted appropriately in BHI to approximately 2 ⁇ 10 6 CFU/ml.
  • 4.0 ml was used to infect 10-20 kg SPF pigs (Whiteshire-Hamroc, Albion, Ind.) by intratracheal administration using a tracheal tube.
  • SPF pigs Whiteshire-Hamroc, Albion, Ind.
  • the lavage fluid was recovered, and the process was repeated a second time.
  • the lavage fluid was centrifuged at 450 ⁇ g for 10 minutes to separate out large debris. Supernatants were then centrifuged at 2,800 ⁇ g to pellet the bacteria. Pellets were resuspended in 5 mls BHI and plated in dilutions ranging from 10 ⁇ 2 to 10 ⁇ 5 onto BHIV 10 N 50 K 50 plates. Following overnight growth, at least 100,000 colonies were pooled in 10 mls BHlbroth to form the “recovered pools”.
  • Dot blots were performed and evaluated both by visual inspection and by semi-quantitative analysis as described previously. All hybridizations and detections were performed as described. Briefly, probes were prepared by a primary PCR amplification, followed by agarose gel purification of the desired product and secondary PCR amplification incorporating dig-dUTP. Oligonucleotides including TEF5, TEF6, TEF24, TEF25, TEF48 and TEF62, were synthesized by Genosys Biotechnologies (The Woodlands, TX). Primers TEF69, TEF65, and TEF66 were also used for inverse PCR reactions and sequencing.
  • the labeled PCR product was then digested with HindIII to separate the constant primer arms from the unique tag region.
  • the region containing the labeled variable tag was excised and the entire gel slice was then dissolved and denatured in DIG EasyHyb.
  • Dot blots were prepared and detected using the standard CSPD detection protocol. Film exposures were made for visual evaluation, and luminescent counts per second (LCPS) were determined for each dot blot sample. The LCPS input /LCPS recovered ratio for each mutant was used to determine mutants likely to be attenuated.
  • Clones selected as being present in the input pool but highly reduced in the recovered pool were selected for further study. Additional clones with questionable input/recovered ratios were also selected after visually evaluating films made from the dot blots. A total of 110 clones were selected.
  • flanking sequence was determined for each of the 110 mutants by inverse PCR and direct product sequencing. Inverse PCR was used to generate flanking DNA products for direct sequencing as described above. Sequencing reactions were performed using the BigDye tm Dye Terminator Chemistry kit from PE Applied Biosystems (Foster City, Calif.) and run on an ABI Prism 377 DNA Sequencer. Sequencher 3.0 software (Genecodes, Corp., Ann Arbor, Mich.) was used to assemble and analyze sequence data. GCG programs [Devereux and Haeberli, Wisconsin Package Version 9.0, 9.0 ed. Genetics Computer Group, Inc., Madison (1997)] were used to search for homologous sequences in currently available databases.
  • Table 2 shows the A. pleuropneumoniae genes identified and extent to which open reading frames were determinable. Sequence identification numbers are provided for nucleotide sequences as well as deduced amino acid sequences where located. TABLE 2 A. pleuropneumoniae Open Reading Frames Complete Open Reading Frame atpH SEQ ID NO:134 aptG SEQ ID NO:132 exbB SEQ ID NO:140 OmpP5 SEQ ID NO:152 OmpP5-2 SEQ ID NO:150 tig SEQ ID NO:160 fkpA SEQ ID NO:142 hupA SEQ ID NO:146 rpmF SEQ ID NO:158 Start Codon - NO Stop Codon lpdA SEQ ID NO:148 potD SEQ ID NO:156 yaeE SEQ ID NO:164 apvC SEQ ID NO:128 NO Start Codon - Stop Codon dksA SEQ ID NO:136 dnaK SEQ ID NO:138 HI0379 SEQ ID NO:144
  • the putative identities listed in Table 3 (below, Example 9) were assigned by comparison with bacterial databases.
  • the 110 mutants represented 35 groups of unique transposon insertions. The number of different mutations per loci varied, with some clones always containing an insertion at a single site within an ORF to clones containing insertions within different sites of the same ORF. Three multiple insertions were detected in the 110 mutants screened as determined by production of multiple PCR bands and generation of multiple sequence electropherograms.
  • a representative clone from each of the unique attenuated mutant groups identified above that was absent or highly reduced in the recovered population was isolated from the original pool plate and used in a competition challenge experiment with the wild type strain (AP225) to verify the relative attenuation caused by the transposon mutation.
  • Mutant and wild type strains were grown in BHIV 10 to an OD 590 of 0.6 - 0.9. Approximately 5.0 ⁇ 10 6 CFU each of the wild type and mutant strains were added to. 4 mls BHI. The total 4 ml dose was used infect a 10-20 kg SPF pig by intratracheal administration with a tracheal tube. At approximately 20 hours post-infection, all surviving animals were euthanized and the lungs removed.
  • Lung lavages were performed as described above. Plate counts were carried out on BHIV 10 N 50 and BHIV 10 N 50 K 100 to determine the relative numbers of wild type to mutant in both the input cultures and in the lung lavage samples.
  • a Competitive Index (CI) was calculated as the [mutant CFU/wild type CFU] input /[mutant CFU/wild type CFU] recovered .
  • transposon mutants 22 were significantly attenuated, having a competitive index (CI) of less than 0.2.
  • CI competitive index
  • a transposon mutant that did not seem to be attenuated based on the STM screening results was chosen from one of the pools as a positive control. This mutant had a CI in vivo of approximately 0.6. An in vitro competition was also done for this mutant resulting in a CI of 0.8. The mutant was subsequently determined to contain an insertion between 2 phenylalanine tRNA's.
  • the A.pleuropneumoniae genes identified represent four broad functional classes: biosynthetic enzymes, cellular transport components, cellular regulation components and unknowns.
  • the atpG gene encoding the F1- ⁇ subunit of the F 0 F 1 H+-ATPase complex, can function in production of ATP or in the transport of protons by hydrolyzing ATP.
  • a related atpG attenuated mutant was also identified in P. multocida.
  • Another atp gene, atpH, that encodes the F 1 ⁇ subunit was also identified.
  • Phenotypes of atp mutants include non-adaptable acid-sensitivity phenotype [Foster, J Bacteriol. 173:6896-6902 (1991)], loss of virulence in Salmonella typhimurium [Garcia del Portillo, et al., Infect Immun. 61:4489-4492 (1993)] and P. multocida (above) and a reduction in both transformation frequencies and induction of competence regulatory genes in Haemophilus influenzae Rd [Gwinn, et al., J Bacteriol. 179:7315-20 (1997)].
  • LpdA is a dihydrolipoamide dehydrogenase that is a component of two enzymatic complexes: pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase. While the relationship to virulence is unknown production of LpdA is induced in Salmonella typhimurium when exposed to a bactericidal protein from human which may suggest that this induction may be involved in attempts to repair the outer membrane [Qi, et al., Mol Microbiol. 17:523-31 (1995)].
  • ExbB is a part of the TonB transport complex [Hantke, and Zimmerman, Microbiology Letters. 49:31-35 (1981)], interacting with TonB in at least two distinct ways [Karlsson, et al., Mol Microbiol. 8:389-96 (1993), Karlsson, et al., Mol Microbiol. 8:379-88 (1993)]. Iron acquisition is essential for pathogens. In this work, attenuated exbB mutants in both APP and P. multocida have been identified. Several TonB-dependent iron receptors have been identified in other bacteria [Biswas, et al., Mol. Microbiol.
  • A. pleuropneumoniae produces 2 transferrin-binding proteins, which likely depend on the ExbB/ExbD/TonB system, for acquisition of iron.
  • PotD is a periplasmic binding protein that is required for spermidine (a polyamine) transport [Kashiwagi, et al., J Biol Chem.
  • Pasteurella haemolytica Another member of the Pasteurellaceae family, Pasteurella haemolytica, contains a homologue of potD (Lpp38) that is a major immunogen m convalescent or outer membrane protein vaccinated calves [Pandher and Murphy, Vet Microbiol 51:33141 (1996)].
  • potD appeared to be associated with both the inner and outer membranes.
  • the role of PotD in virulence or in relationship to protective antibodies is unknown although previous work has shown potD mutants of Streptococcus pneumoniae to be attenuated [Polissi, et al., Infect. Immun. 66:5620-9 (1998)].
  • H. influenzae OMP P5 is a major outer membrane protein that is related to the OmpA porin family of proteins [Munson, et al., M Infect Immun. 61:4017-20 (1993)].
  • OMP P5 in nontypeable Haemophilus influenzae has been shown to encode a fimbrial subunit protein expressed as a filamentous structure [Sirakova, et al., Infect Immun.
  • FkpA is a periplasmic protein that is a member of the FK506-binding protein family [Home and Young, Arch Microbiol. 163:357-65 (1995); Missiakas, et al., Mol Microbiol. 21:871-84 (1996)]. FkpA has been shown to contribute to intracellular survival of Salmonella typhimurium [Home, et al., Infect Immun.
  • Bacterial pathogens employ many mechanisms to coordinately regulate gene expression in order to survive a wide variety of environmental conditions within the host. Differences in mRNA stability can modulate gene expression in prokaryotes [Belasco and Higgins, Gene 72:15-23 (1988)].
  • rnr vacB
  • Shigella flexneri Tobe, et al., J Bacteriol. 174:6359-67 (1992)] and encodes the RnaseR ribonuclease [Cheng, et al., J. Biol. Chem. 273:14077-14080 (1998)].
  • PNP is a polynucleotide phosphorylase that is involved in the degradation of mRNA. Null pnp/rnr mutants are lethal, suggesting a probable overlap of function. It therefore is possible that both rnr and pnp are involved in the regulation of virulence gene expression.
  • a pnp mutant of P. multocida is a virulent in a mouse septicemic model (Example 2)].
  • Other pnp-associated phenotypes include competence deficiency and cold sensitivity in Bacillus subtilis [Wang and Bechhofer, J Bacteriol. 178:2375-82 (1996)].
  • HupA is a bacterial histone-like protein, which in combination with HupB constitute the HU protein in E. coli. Reports have suggested that hupa and hupB single mutants do not demonstrate any observable phenotype [Huisman, et al., J Bacteriol. 171:3704-12 (1989), Wada, et al., J Mol Biol. 204:581-91 (1988)], however, hupA-hupB double mutants have been shown to be cold sensitive, sensitive to heat shock and blocked in many forms of site-specific DNA recombination [Wada, et al., J Mol Biol. 204:581-91 (1988), Wada, et al., Gene.
  • DnaK is a well known and highly conserved heat shock protein involved in regulatory responses to various stressful environmental changes [reviewed in Lindquist and Craig, Annu Rev Genet. 22:631-77 (1988)]. DnaK is also one of the most significantly induced stress proteins in Yersinia enterocolitica after being phagocytosed by macrophages [Yamamoto, et al., Microbiol Immunol. 38:295-300 (1994)] and a Brucella suis dnaK mutant failed to multiply within human macrophage-like cells [Kohler, et al., Mol Microbiol. 20:701-12 (1996)].
  • a dnaK mutant of Vibrio cholera affected the production of ToxR and its regulated virulence factors in vitro but similar results were not obtained from in vivo grown cells [Chakrabarti, et al., Infect Immun. 67:1025-1033 (1999)].
  • the CI of A. pleuropneumonia dnaK mutant was higher than most of the attenuated mutants although still approximately half of the positive control strain.
  • DksA is a dosage dependent suppressor of filamentous and temperature-sensitive growth in a dnak mutant of E. coli [Kang and Craig, J Bacteriol. 172:2055-64 (1990)].
  • DksA has been identified as being critical for the virulence of Salmonella typhimurium in chickens and newly hatched chicks [Turner, et al., Infect Immun. 66:2099-106 (1998)].
  • the dksA mutant did not grow well with glucose or histidine but did grow well with glutamine or glutamate as the sole carbon source. This observation may indicate that the dksA mutant is somehow impaired in the biosynthesis of glutamate [Turner, et al., Infect Immun. 66:2099-106 (1998)].
  • tRNA-leu Three genes were identified that have roles in protein synthesis: tRNA-leu, tRNA-glu and rpmF. Excluding protein synthesis, tRNA's also have a wide variety of functional roles in peptidoglycan synthesis [Stewart, et al., Nature 230:36-38 (1971)], porphyrin ring synthesis [Jahn, et al., Trends Biochem Sci. 17:215-8 (1992)], targeting of proteins for degradation [Tobias, et al., Science 254:1374-7(1991)], post-translational addition of amino acids to proteins [Leibowitz and Soffer, B.B.R.C.
  • tRNA-leu may have any one of a wide range of functions.
  • RpmF is a ribosomal protein whose gene is also part of an operon containing fatty acid biosynthesis enzymes in E. coli. Further work will be required to indicate if this is the case in A.
  • fab genes and rpmF pleuropneumoniae, although the same clustering of fab genes and rpmF occurs in Haemophilus influenzae [Fleischmann, et al., Science 269:496-512 (1995)).
  • the expression of the fab genes is not necessarily dependent on transcripts originating upstream of rpmF as there has been a secondary promoter identified within rpmF [Zhang and Cronan, Jr., J Bacteriol. 180:3295-303 (1998)].
  • the final class of attenuated mutants includes mutations within genes of unknown function or genes that have not been previously identified. Homologs of yaeA and HI0379 have previously been identified in Escherichia coli [Blattner, et al., Science 277:1453-1474 (1997)] and Haemophilus influenzae [Fleischmann, et al., Science 269:496-512 (1995)], respectively. The remaining unknowns have been designated Actinobacillus pleuropneumoniae virulence genes (apv).
  • the apvC gene shows significant similarity to HI0893, however, the proposed similarity of HI0893 as a transcriptional repressor similar to the fatty acid response regulator Bm3R1 [Palmer, J Biol Chem. 273:18109-16 (1998)] is doubtful.
  • the apvD gene is also most similar to a putative membrane protein (b0878) with unknown function from E. coli [Blattner, et al., Science 277:1453-1474(1997)]. Two other unknowns, apvA and apvB had no significant matches in the public databases.
  • the exbB, atpG, pnp, and yaeA mutants caused no mortality when administered at a dosage of 10 10 CFU intranasally.
  • the fkpA and tig mutant groups had one death each and the HI0379 group (highest Apr. 6, 2000CI of the 7 mutants tested shown in Example 9) had four deaths.
  • Wildtype LD 50 using this model was generally 1 ⁇ 10 7 CFU, indicating that each of these mutants is at least 100 fold attenuated and that there is a reasonable correlation between CI and attenuation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Communicable Diseases (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Oncology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
US11/251,464 1999-04-09 2005-10-14 Anti-bacterial vaccine compositions Abandoned US20070237793A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US11/251,464 US20070237793A1 (en) 1999-04-09 2005-10-14 Anti-bacterial vaccine compositions
US12/425,599 US7763262B2 (en) 1999-04-09 2009-04-17 Attenuated yiaO mutants of Pasteurellaceae bacteria
US12/816,485 US20100322975A1 (en) 1999-04-09 2010-06-16 Anti-bacterial Vaccine Compositions
US13/162,023 US8974798B2 (en) 1999-04-09 2011-06-16 Anti-bacterial vaccine compositions with a mutated yleA gene
US14/640,586 US9289486B2 (en) 1999-04-09 2015-03-06 Attenuated fhaC mutants of Pasteurellaceae bacteria and vaccine compositions thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US12868999P 1999-04-09 1999-04-09
US15345399P 1999-09-10 1999-09-10
US54519900A 2000-04-06 2000-04-06
US11/251,464 US20070237793A1 (en) 1999-04-09 2005-10-14 Anti-bacterial vaccine compositions

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US54519900A Continuation 1999-04-09 2000-04-06

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/425,599 Continuation US7763262B2 (en) 1999-04-09 2009-04-17 Attenuated yiaO mutants of Pasteurellaceae bacteria

Publications (1)

Publication Number Publication Date
US20070237793A1 true US20070237793A1 (en) 2007-10-11

Family

ID=26826843

Family Applications (5)

Application Number Title Priority Date Filing Date
US11/251,464 Abandoned US20070237793A1 (en) 1999-04-09 2005-10-14 Anti-bacterial vaccine compositions
US12/425,599 Expired - Fee Related US7763262B2 (en) 1999-04-09 2009-04-17 Attenuated yiaO mutants of Pasteurellaceae bacteria
US12/816,485 Abandoned US20100322975A1 (en) 1999-04-09 2010-06-16 Anti-bacterial Vaccine Compositions
US13/162,023 Expired - Fee Related US8974798B2 (en) 1999-04-09 2011-06-16 Anti-bacterial vaccine compositions with a mutated yleA gene
US14/640,586 Expired - Fee Related US9289486B2 (en) 1999-04-09 2015-03-06 Attenuated fhaC mutants of Pasteurellaceae bacteria and vaccine compositions thereof

Family Applications After (4)

Application Number Title Priority Date Filing Date
US12/425,599 Expired - Fee Related US7763262B2 (en) 1999-04-09 2009-04-17 Attenuated yiaO mutants of Pasteurellaceae bacteria
US12/816,485 Abandoned US20100322975A1 (en) 1999-04-09 2010-06-16 Anti-bacterial Vaccine Compositions
US13/162,023 Expired - Fee Related US8974798B2 (en) 1999-04-09 2011-06-16 Anti-bacterial vaccine compositions with a mutated yleA gene
US14/640,586 Expired - Fee Related US9289486B2 (en) 1999-04-09 2015-03-06 Attenuated fhaC mutants of Pasteurellaceae bacteria and vaccine compositions thereof

Country Status (14)

Country Link
US (5) US20070237793A1 (enrdf_load_stackoverflow)
EP (5) EP1171577A2 (enrdf_load_stackoverflow)
JP (4) JP4892134B2 (enrdf_load_stackoverflow)
KR (4) KR20060116041A (enrdf_load_stackoverflow)
CN (1) CN1351653A (enrdf_load_stackoverflow)
AR (1) AR029622A1 (enrdf_load_stackoverflow)
AU (2) AU780887B2 (enrdf_load_stackoverflow)
BR (1) BR0009663A (enrdf_load_stackoverflow)
CA (1) CA2366520C (enrdf_load_stackoverflow)
ES (2) ES2439645T3 (enrdf_load_stackoverflow)
HK (1) HK1045856A1 (enrdf_load_stackoverflow)
MX (1) MXPA01010207A (enrdf_load_stackoverflow)
NZ (2) NZ530012A (enrdf_load_stackoverflow)
WO (1) WO2000061724A2 (enrdf_load_stackoverflow)

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6790950B2 (en) * 1999-04-09 2004-09-14 Pharmacia & Upjohn Company Anti-bacterial vaccine compositions
EP1171577A2 (en) * 1999-04-09 2002-01-16 PHARMACIA & UPJOHN COMPANY Anti-bacterial vaccine compositions
JP4124732B2 (ja) * 2001-09-26 2008-07-23 協和醗酵工業株式会社 α1,4−ガラクトース転移酵素およびガラクトース含有複合糖質の製造法
DE60230717D1 (de) * 2002-04-05 2009-02-26 Merial Sas Attenuirte Gram-negative Bakterien
US7449178B2 (en) 2002-04-05 2008-11-11 Merial Limited Attenuated gram negative bacteria
GB0228691D0 (en) * 2002-12-09 2003-01-15 Imp College Innovations Ltd Bacterial virulence genes
DE602004029868D1 (de) * 2003-03-05 2010-12-16 Chemo Sero Therapeut Res Inst Verfahren zur herstellung eines heterologen proteins in e. coli
US8937154B2 (en) 2006-10-05 2015-01-20 New York Blood Center, Inc. Stabilized therapeutic small helical antiviral peptides
WO2008045238A2 (en) * 2006-10-05 2008-04-17 New York Blood Center, Inc. Stabilized therapeutic small helical antiviral peptides
CA2725227A1 (en) 2008-05-06 2009-11-12 Asim Kumar Debnath Antiviral cell penetrating peptides
DE102011016772B8 (de) * 2011-04-12 2024-08-14 Mercedes-Benz Group AG Verfahren und Vorrichtung zur Überwachung zumindest eines Fahrzeuginsassen und Verfahren zum Betrieb zumindest einer Assistenzvorrichtung
EP3062816B1 (en) 2013-11-01 2020-08-05 Boehringer Ingelheim Animal Health USA Inc. Attenuated pasteurella multocida vaccines & methods of making & use thereof
BR112019016564A2 (pt) 2017-02-10 2020-03-31 Epitopix, Llc Composições de imunizantes contendo proteínas pasteurella, kit para detectar anticorpo que se liga a proteína e seus usos
TW202219269A (zh) * 2020-09-30 2022-05-16 美國農業部 新型多殺性巴斯德氏菌株及具有hyaC與nanP缺失之疫苗
WO2022072431A1 (en) 2020-09-30 2022-04-07 Zoetis Services Llc Novel pasteurella multocida strains and vaccines having hyac and nanp deletions
CN113567415A (zh) * 2021-07-05 2021-10-29 广西大学 表面增强拉曼散射结合免疫层析技术检测布鲁氏杆菌方法
CN115925536B (zh) * 2022-08-01 2025-02-28 北京农学院 靶向抑制DksA的小分子抑制剂和应用
CN116593695B (zh) * 2022-12-29 2025-08-05 重庆澳龙生物制品有限公司 一种牛多杀性巴氏杆菌荚膜a型elisa抗体检测试剂盒及其制备方法和应用

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4735801A (en) * 1982-09-07 1988-04-05 Board Of Trustees Of Leland Stanford Jr. University Novel non-reverting salmonella live vaccines
US4877612A (en) * 1985-05-20 1989-10-31 Frank M. Berger Immunological adjuvant and process for preparing the same, pharmaceutical compositions, and process
US5077044A (en) * 1980-05-19 1991-12-31 The Board Of Trustees Of The Leland Stanford Jr. University Novel non-reverting shigella live vaccines
US5284933A (en) * 1987-03-10 1994-02-08 Hoffmann-La Roche Inc. Affinity peptides
US5389368A (en) * 1987-06-04 1995-02-14 Washington University Avirulent microbes and uses therefor
US5547664A (en) * 1991-03-05 1996-08-20 Burroughs Wellcome Co. Expression of recombinant proteins in attenuated bacteria
US5585277A (en) * 1993-06-21 1996-12-17 Scriptgen Pharmaceuticals, Inc. Screening method for identifying ligands for target proteins
US5840312A (en) * 1991-05-02 1998-11-24 Institut Pasteur Recombinant Bacillus anthracis strains unable to produce the lethal factor protein or edema factor protein
US5876931A (en) * 1994-12-09 1999-03-02 Rpms Technology Limited Identification of genes

Family Cites Families (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL52815A (en) * 1977-08-24 1983-03-31 Israel State Fowl cholera vaccine and process for producing an attenuated non-virulent strain of pasteurella multocida
SE8205892D0 (sv) 1982-10-18 1982-10-18 Bror Morein Immunogent membranproteinkomplex, sett for framstellning och anvendning derav som immunstimulerande medel och sasom vaccin
DE3426532A1 (de) 1984-07-18 1986-01-30 Gesellschaft für Biotechnologische Forschung mbH (GBF), 3300 Braunschweig Verwendung einer dna-sequenz zur expression sowie dna-struktur und expressionsvektor mit der dna-sequenz
SE8405493D0 (sv) 1984-11-01 1984-11-01 Bror Morein Immunogent komplex samt sett for framstellning derav och anvendning derav som immunstimulerande medel
ATE71303T1 (de) 1986-01-14 1992-01-15 Nederlanden Staat Verfahren zur herstellung immunologischer komplexe und diese enthaltende pharmazeutische zusammensetzung.
US4806352A (en) 1986-04-15 1989-02-21 Ribi Immunochem Research Inc. Immunological lipid emulsion adjuvant
US5376369A (en) * 1987-11-03 1994-12-27 Syntex (U.S.A.) Inc. Vaccine adjuvant
DK46693D0 (enrdf_load_stackoverflow) * 1993-04-23 1993-04-23 Novo Nordisk As
CA2148829A1 (en) * 1992-11-06 1994-05-26 Keum Hwa Choi Avirulent live vaccine and method for immunizing animals against p. multocida pasteurellosis
US5587305A (en) 1993-12-06 1996-12-24 The United States Of America As Represented By The Department Of Agriculture Pasteurella haemolytica transformants
WO1995020652A1 (de) 1994-01-28 1995-08-03 Medigene Gmbh Verfahren zur bestimmung der aktivität eines regulatorischen faktors sowie verwendung dieses verfahrens
JP3709564B2 (ja) 1994-08-30 2005-10-26 味の素株式会社 L−バリン及びl−ロイシンの製造法
CA2170839A1 (en) * 1995-03-01 1996-09-02 Janet Macinnes Bacterial preparations, method for producing same, and their use as vaccines
US6355450B1 (en) 1995-04-21 2002-03-12 Human Genome Sciences, Inc. Computer readable genomic sequence of Haemophilus influenzae Rd, fragments thereof, and uses thereof
GB9518220D0 (en) 1995-09-06 1995-11-08 Medical Res Council Checkpoint gene
US5994066A (en) 1995-09-11 1999-11-30 Infectio Diagnostic, Inc. Species-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US5925354A (en) 1995-11-30 1999-07-20 Michigan State University Riboflavin mutants as vaccines against Actinobacillus pleuropneumoniae
US5840556A (en) * 1996-05-08 1998-11-24 The United States Of America As Represented By The Department Of Agriculture Molecular genetic construction of vaccine strains of pasteurellaceae
ZA974809B (en) * 1996-05-31 1998-01-23 Akzo Nobel Nv Live attenuated RTX-producing bacteria of the family pasteurellaceae.
US6020474A (en) 1997-01-15 2000-02-01 Incyte Pharmaceuticals, Inc. ATP synthase subunits
US6673538B1 (en) 1997-07-25 2004-01-06 The Trustees Of Boston University Methods and compositions for designing vaccines
EP1171577A2 (en) * 1999-04-09 2002-01-16 PHARMACIA & UPJOHN COMPANY Anti-bacterial vaccine compositions
US6790950B2 (en) 1999-04-09 2004-09-14 Pharmacia & Upjohn Company Anti-bacterial vaccine compositions
WO2000078922A2 (en) 1999-06-21 2000-12-28 North Carolina State University Acid-inducible promoters for gene expression
WO2001004347A1 (en) 1999-07-12 2001-01-18 Xoma Technology Ltd. Method to identify inhibitors f1/f0 atpase

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5077044A (en) * 1980-05-19 1991-12-31 The Board Of Trustees Of The Leland Stanford Jr. University Novel non-reverting shigella live vaccines
US4735801A (en) * 1982-09-07 1988-04-05 Board Of Trustees Of Leland Stanford Jr. University Novel non-reverting salmonella live vaccines
US4877612A (en) * 1985-05-20 1989-10-31 Frank M. Berger Immunological adjuvant and process for preparing the same, pharmaceutical compositions, and process
US5284933A (en) * 1987-03-10 1994-02-08 Hoffmann-La Roche Inc. Affinity peptides
US5310663A (en) * 1987-03-10 1994-05-10 Hoffman-La Roche Inc. Affinity peptides
US5389368A (en) * 1987-06-04 1995-02-14 Washington University Avirulent microbes and uses therefor
US5547664A (en) * 1991-03-05 1996-08-20 Burroughs Wellcome Co. Expression of recombinant proteins in attenuated bacteria
US5840312A (en) * 1991-05-02 1998-11-24 Institut Pasteur Recombinant Bacillus anthracis strains unable to produce the lethal factor protein or edema factor protein
US5585277A (en) * 1993-06-21 1996-12-17 Scriptgen Pharmaceuticals, Inc. Screening method for identifying ligands for target proteins
US5876931A (en) * 1994-12-09 1999-03-02 Rpms Technology Limited Identification of genes

Also Published As

Publication number Publication date
EP2281835A3 (en) 2011-11-23
KR20060116041A (ko) 2006-11-13
ES2535961T3 (es) 2015-05-19
EP2281834A3 (en) 2011-11-23
EP2281834A2 (en) 2011-02-09
JP4892134B2 (ja) 2012-03-07
JP2002541790A (ja) 2002-12-10
EP2281835B1 (en) 2013-11-06
EP2281833A3 (en) 2011-11-30
EP2281833A2 (en) 2011-02-09
JP2013121347A (ja) 2013-06-20
JP5377433B2 (ja) 2013-12-25
CN1351653A (zh) 2002-05-29
EP1860117A2 (en) 2007-11-28
US20100322975A1 (en) 2010-12-23
AR029622A1 (es) 2003-07-10
EP2281834B1 (en) 2015-03-04
AU2005203189B2 (en) 2007-12-20
KR20070011622A (ko) 2007-01-24
WO2000061724A3 (en) 2001-02-01
NZ530012A (en) 2005-10-28
KR20060134225A (ko) 2006-12-27
JP5973634B2 (ja) 2016-08-23
US9289486B2 (en) 2016-03-22
US7763262B2 (en) 2010-07-27
MXPA01010207A (es) 2003-07-21
EP1171577A2 (en) 2002-01-16
CA2366520C (en) 2013-10-01
AU780887B2 (en) 2005-04-21
NZ514883A (en) 2004-03-26
EP2281833B1 (en) 2014-07-02
US20120148625A1 (en) 2012-06-14
CA2366520A1 (en) 2000-10-19
EP1860117A3 (en) 2008-09-03
AU4077600A (en) 2000-11-14
KR20010112937A (ko) 2001-12-22
JP2010284165A (ja) 2010-12-24
US8974798B2 (en) 2015-03-10
AU2005203189A1 (en) 2005-08-18
US20150182615A1 (en) 2015-07-02
US20090202594A1 (en) 2009-08-13
JP2016019528A (ja) 2016-02-04
EP2281835A2 (en) 2011-02-09
WO2000061724A2 (en) 2000-10-19
ES2439645T3 (es) 2014-01-24
BR0009663A (pt) 2002-04-09
HK1045856A1 (zh) 2002-12-13

Similar Documents

Publication Publication Date Title
US9289486B2 (en) Attenuated fhaC mutants of Pasteurellaceae bacteria and vaccine compositions thereof
US7476391B2 (en) Anti-bacterial vaccine compositions
AU2002240033A1 (en) Anti-bacterial vaccine compositions
CA2815566C (en) Pasteurellaceae bacteria comprising a mutated virulence gene and an anti-bacterial vaccine prepared therefrom
AU2013201267B2 (en) Anti-bacterial vaccine compositions
AU2007242960B2 (en) Anti-bacterial vaccine compositions
AU2010201539C1 (en) Anti-bacterial vaccine compositions

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION