US20060134661A1 - Treatment of cancer and compositions - Google Patents

Treatment of cancer and compositions Download PDF

Info

Publication number
US20060134661A1
US20060134661A1 US11/249,589 US24958905A US2006134661A1 US 20060134661 A1 US20060134661 A1 US 20060134661A1 US 24958905 A US24958905 A US 24958905A US 2006134661 A1 US2006134661 A1 US 2006134661A1
Authority
US
United States
Prior art keywords
seq
expression
cancer
compounds
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/249,589
Other languages
English (en)
Inventor
Richard Essner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
John Wayne Cancer Institute
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US11/249,589 priority Critical patent/US20060134661A1/en
Publication of US20060134661A1 publication Critical patent/US20060134661A1/en
Assigned to JOHN WAYNE CANCER INSTITUTE reassignment JOHN WAYNE CANCER INSTITUTE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ESSNER, RICHARD
Priority to US13/243,914 priority patent/US9156898B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates generally to cancer diagnosis, prognosis, and treatment.
  • the invention relates to detection of genetic markers indicative of cancer such as melanoma, breast cancer, colon cancer, lung cancer, and merkel cell carcinoma in biological samples.
  • the invention also relates to compositions for preventing and treating diseases, e.g., by administering the compositions topically to a subject.
  • Regional LN status is the single most important prognostic factor in melanoma.
  • Patients with regional LN metastasis (AJCC stage III disease) have worse prognosis than those without (AJCC stage I/II), even if they have the same Breslow thickness.[5]
  • the patients with no history of intervening stage III disease (no history of regional lymph node metastasis) have significantly better prognosis than those with history of intervening stage III disease (history of regional lymph node metastasis).
  • These findings suggest that lymph node metastasis is not just a passive event dependent on time, but rather an active event based upon differential metastatic potential among different primary lesions.
  • One object of the invention is to provide genetic markers and methods for diagnosis, prognosis, and treatment of cancer. Another object of the invention is to provide compositions for preventing and treating diseases.
  • the invention features a method of identifying a gene associated with stage III primary cancer or lymph node metastasis.
  • the method comprises identifying a metastasis-associated gene differentially expressed in stage I or II primary cancer than in stage III primary cancer, analyzing the expression of the gene in the stage I or II primary cancer and the stage III primary cancer or lymph node metastasis, and relating the expression of the gene to the stage III primary cancer, the lymph node metastasis, or a combination thereof.
  • the invention features a method of determining whether a subject is likely to be suffering from stage III cancer.
  • the method comprises providing a test sample from a subject and detecting the expression of one or more genes selected from a first group consisting of CAV1 (caveolin 1), CST3 (cystatin C), LIMK1 (LIM domain kinase 1), MMP2 (matrix metallopeptidase 2), MMP15 (matrix metallopeptidase 15), VEGF (vascular endothelial growth factor), ETV4 (ETS variant gene 4), MMP9 (matrix metallopeptidase 9), PIK3C2B (phosphoinositide-3-kinase, class 2, beta polypeptide), and SERPIN1 (serpin peptidase inhibitor 1) in the sample.
  • CAV1 caveolin 1
  • CST3 cystatin C
  • LIMK1 LIM domain kinase 1
  • MMP2 matrix metallopeptida
  • control value is the expression level of the gene in a stage I or II primary tumor sample.
  • the invention also provides a method of staging cancer.
  • the method comprises providing a test sample from a subject and detecting the expression of one or more genes selected from a first group consisting of CAV1, LIMK1, MMP15, and VEGF in the sample.
  • the level of the expression of the one or more genes indicates that the subject is likely to be suffering from stage I or II primary cancer, stage III primary cancer with micrometastasis, stage III primary cancer with macrometastasis, or lymph node metastasis.
  • the one or more genes are selected from a second group consisting of CAV1, LIMK1, and VEGF, and the level of the expression of the one or more genes indicates that the subject is likely to be suffering from stage III primary cancer with micrometastasis or stage III primary cancer with macrometastasis.
  • the one or more genes are selected from a third group consisting of LIMK1 and VEGF.
  • the invention further provides a method of identifying a candidate compound for treating stage III cancer.
  • the method comprises providing a stage III cancer cell that expresses one or more genes selected from a first group consisting of CAV1, CST3, LIMK1, MMP2, MMP15, VEGF, ETV4, MMP9, PIK3C2B, and SERPIN1, contacting the cell with a test compound, and detecting the expression of the one or more genes selected from the first group in the cell.
  • Another method of identifying a candidate compound for treating cancer comprises providing a system that expresses one or more genes selected from a first group consisting of CAV1, CST3, MMP15, ETV4, MMP9, PIK3C2B, and SERPIN1, contacting the system with a test compound, and detecting the expression of the one or more genes selected from the first group in the system.
  • the expression of one or more genes selected from a second group consisting of CAV1, CST3, and MMP15, if lower than its respective control value, the expression of one or more genes selected from a third group consisting of ETV4, MMP9, PIK3C2B, and SERPIN1, if higher than its respective control value, or a combination thereof, indicates that the test compound is a candidate for treating cancer.
  • stage III cancer Also within the invention is a method of treating stage III cancer.
  • the method comprises identifying a subject suffering from stage III cancer and administering to the subject one or more compounds that decrease the expression of one or more genes selected from a first group consisting of CAV1, CST3, LIMK1, MMP2, MMP15, and VEGF, increase the expression of one or more genes selected from a second group consisting of ETV4, MMP9, PIK3C2B, and SERPIN1, or a combination thereof, in the subject.
  • the invention features a method of treating cancer.
  • the method comprises identifying a subject suffering from cancer as staged using the method described above and administering to the subject one or more compounds that decrease the expression of one or more genes selected from a first group consisting of CAV1, CST3, LIMK1, MMP2, MMP15, and VEGF, increase the expression of one or more genes selected from a second group consisting of ETV4, MMP9, PIK3C2B, and SERPIN1, or a combination thereof, in the subject.
  • Another method of treating cancer comprises identifying a subject suffering from cancer and administering to the subject one or more compounds selected from a group consisting of a first compound that inhibits the expression of CAV1, a second compound that inhibits the expression of CST3, a third compound that inhibits the expression of MMP15, a fourth compound that enhances the expression of ETV4, a fifth compound that enhances the expression of MMP9, a sixth compound that enhances the expression of PIK3C2B, and a seventh compound that enhances the expression of SERPIN1.
  • An alternative method of treating cancer comprises identifying a subject suffering from cancer and administering to the subject a combination of at least two (e.g., at least three, four, five, six, seven, eight, nine, and ten) compounds selected from the group consisting of a first compound that inhibits the expression of CAV1, a second compound that inhibits the expression of CST3, a third compound that inhibits the expression of LIMK1, a fourth compound that inhibits the expression of MMP2, a fifth compound that inhibits the expression of MMP15, a sixth compound that inhibits the expression of VEGF, a seventh compound that enhances the expression of ETV4, an eighth compound that enhances the expression of MMP9, a ninth compound that enhances the expression of PIK3C2B, and a tenth compound that enhances the expression of SERPIN1.
  • the combination is not a first combination of the third and fourth compounds, a second combination of the third and sixth compounds, a third combination of the fourth and sixth compounds, or a fourth combination of the third, fourth,
  • a test sample from a subject can be a freshly prepared tumor sample, a frozen tumor sample, a paraffin-embedded tumor sample, a primary tumor sample, a metastasis sample, or a blood sample.
  • a compound When a compound is administered to a subject, it may be administered topically.
  • the compound is administered with a transdermal drug delivery agent.
  • the compounds may be admixed with a lotion, cream (e.g., sunscreen cream), emulsion, oil, liquid, or gel, or embedded in a patch.
  • the invention features a composition for preventing and treating diseases.
  • the composition comprises one or more therapeutic compounds and a transdermal drug delivery agent such as a lotion, cream (e.g., sunscreen cream), emulsion, oil, liquid, gel, or patch.
  • the one or more compounds may regulate the expression of one or more genes in a subject.
  • the one or more genes are associated with cancer such as melanoma, breast cancer, colon cancer, lung cancer, or merkel cell carinoma. Examples of such genes include, but are not limited to, CAV1, CST3, LIMK1, MMP2, MMP15, VEGF, ETV4, MMP9, PIK3C2B, and SERPIN1.
  • composition of the invention comprises a combination of at least two (e.g., at least three, four, five, six, seven, eight, nine, and ten) compounds selected from the group consisting of a first compound that inhibits the expression of CAV1, a second compound that inhibits the expression of CST3, a third compound that inhibits the expression of LIMK1, a fourth compound that inhibits the expression of MMP2, a fifth compound that inhibits the expression of MMP15, a sixth compound that inhibits the expression of VEGF, a seventh compound that enhances the expression of ETV4, an eighth compound that enhances the expression of MMP9, a ninth compound that enhances the expression of PIK3C2B, and a tenth compound that enhances the expression of SERPIN1.
  • a first compound that inhibits the expression of CAV1 e.g., a second compound that inhibits the expression of CST3, a third compound that inhibits the expression of LIMK1, a fourth compound that inhibits the expression of MMP2, a fifth compound that
  • the combination is not a first combination of the third and fourth compounds, a second combination of the third and sixth compounds, a third combination of the fourth and sixth compounds, or a fourth combination of the third, fourth, and sixth compounds.
  • the compounds may be admixed with or embedded in a transdermal drug delivery agent.
  • a compound of the invention can be an siRNA, ribozyme, antisense nucleotide, transcription factor decoy, or small molecule.
  • a compound that decreases the expression of LIMK1 may be an siRNA targeting LIMK1 mRNA at CCGCUACUGCCCCCCAAACUG, CUGGCCGGCCACCUGCCACUG, ACCGCUACUGCCCCCCAAACU, CUGGCUCCCACCUGCCCCACA, CCGAGACCUCAACUCCCACAA, GGACCGCUACUGCCCCCCAAA, CCGGCGGCGAGAGCGGACU, GAGACCUCAACUCCCACAACU, CUGCCCCCCGAGCUUCUUCCC, UGGGUGCUCUGAGCAAAUCAC, or GGGCAGCUCUGCCCGGCAGAA, or an siRNA targeting dLIMK1 mRNA at CAGCCGCCUGCUCCAGCUGAC, CCAUGGGUGCUCUGAGCAAAU, CAUGGGUGCUCUGAGCAAAUC, AUGGGUGGG
  • a compound that decreases the expression of VEGF may be an siRNA targeting VEGF mRNA at GCGCAGCUACUGCCAUCCAAU, CAGCGCAGCUACUGCCAUCCA, UUGGAGCCUUGCCUUGCUGCU, CAGGCUGCACCCAUGGCAGAA, GUGGGCCUUGCUCAGAGCGGA, AGGCGAGGCAGCUUGAGUUAA, GGCGAGGCAGCUUGAGUUAAA, UUGCUCAGAGCGGAGAAAGCA, UGCCCACUGAGGAGUCCAACA, or GCCCACUGAGGAGUCCAACAU.
  • the invention provides a kit for detecting gene expression.
  • the kit consists of a combination of at least two (e.g., at least three, four, five, six, seven, eight, nine, and ten) agents selected from the group consisting of a first agent for detecting the expression of CAV1, a second agent for detecting the expression of CST3, a third agent for detecting the expression of LIMK1, a fourth agent for detecting the expression of MMP2, a fifth agent for detecting the expression of MMP15, a sixth agent for detecting the expression of VEGF, a seventh agent for detecting the expression of ETV4, an eighth agent for detecting the expression of MMP9, a ninth agent for detecting the expression of PIK3C2B, and a tenth agent for detecting the expression of SERPIN1, wherein the combination is not a first combination of the third and fourth agents, a second combination of the third and sixth agents, a third combination of the fourth and sixth agents, or a fourth combination of the third, fourth, and sixth
  • one or more refers to any and every combination of genes, compounds, etc. It encompasses a combination of at least two, three, four, five, six, seven, eight, nine, ten, and more genes, compounds, etc.
  • FIG. 1 depicts trend analysis of 10 genes noted to be differentially expressed between stage I/II and stage III primary melanoma. Regression lines and associated 95% confidence intervals are shown. CAV1, LIMK1, MMP15, and VEGF were noted to show a significant trend of increase as the melanoma progressed from stage I/II primary lesion to lymph node metastasis. Five primary melanomas from stage I/II, and 4 matching pairs of stage III primary melanoma and lymph node metastasis were used; 2 matching pairs were cell lines (CRL 7425 & 7426, and IGR 37 & 39) and 2 other matching pairs were from 2 different stage III patients (primary and sentinel lymph node metastasis).
  • FIG. 2 shows the results of a test verifying whether the genes identified in trend analysis retain the same trend when additional prognostic category was added.
  • Stage III patients were divided into 2 sub-prognostic groups (sentinel lymph node metastasis ⁇ 2 mm vs. ⁇ 2 mm). Regression lines and associated 95% confidence intervals are shown. Whereas CAV1, LIMK1, and VEGF maintained significance, MMP15 failed to retain a significant trend.
  • the ability of a tumor to metastasize to regional LNs may require expression of particular sets of metastasis genes by a cluster of cells within the primary tumor, resulting in clonal heterogeneity and selective clonal metastasis.[7, 8]
  • the genes that may aid in cellular extravasation, motility, neovascularization, and growth factors have all been implicated in process of tumor invasion, metastasis, and growth.[9-12]
  • a recent in vitro study using allogeneic human melanoma cell lines shows that primary and metastatic melanoma express different sets of genes.[13]
  • Another in vitro study shows that melanoma cell lines with different metastatic potential express different metastasis-associated genes.[14]
  • the method comprises identifying a metastasis-associated gene differentially expressed in stage I or II primary cancer than in stage III primary cancer, analyzing the expression of the gene in the stage I or II primary cancer and the stage III primary cancer or lymph node metastasis, and relating the expression of the gene to the stage III primary cancer, the lymph node metastasis, or a combination thereof.
  • Primary cancer is the first or original cancer.
  • Metastasis refers to the migration of cancer cells from the original tumor site through the blood and lymph vessels to produce cancer in other tissues. The term is also used to refer to a secondary cancer growing at a distant site.
  • Cancer stages are defined according to the AJCC Manual for Staging of Cancer. Generally, at stage I and II, the cancer is limited to the primary site. At stage III, the cancer spreads to the regional or adjacent lymph nodes. Rather than profiling via mass-gene arrays, focused analysis of gene-expression using functionally relevant gene microarrays can identify genes that are functionally significant.
  • Metastasis-associated genes are genes differentially expressed in non-metastatic or normal tissues than in metastatic tissues. They can be identified by comparing the expression levels of genes in non-metastatic or normal tissues and metastatic tissues. Many metastasis-associated genes are known in the art. To identify metastasis-associated genes differentially expressed in stage I or II primary cancer and stage III primary cancer, the expression levels of metastasis-associated genes in stage I or II primary cancer and stage III primary cancer can be determined and compared.
  • gene expression can be detected and quantified at mRNA or protein level using a number of means well known in the art.
  • cells in biological samples e.g., cultured cells, tissues, and body fluids
  • RNA levels in the lysates or in RNA purified or semi-purified from the lysates determined by any of a variety of methods familiar to those in the art.
  • Such methods include, without limitation, hybridization assays using detectably labeled gene-specific DNA or RNA probes and quantitative or semi-quantitative RT-PCR methodologies using appropriate gene-specific oligonucleotide primers.
  • quantitative or semi-quantitative in situ hybridization assays can be carried out using, for example, unlysed tissues or cell suspensions, and detectably (e.g., fluorescently or enzyme-) labeled DNA or RNA probes.
  • Additional methods for quantifying mRNA levels include RNA protection assay (RPA), cDNA and oligonucleotide microarrays, representation difference analysis (RDA), differential display, EST sequence analysis, and SAGE.
  • Some of these protein-measuring assays can be applied to bodily fluids or to lysates of test cells and others (e.g., immunohistological methods or fluorescence flow cytometry) applied to unlysed tissues or cell suspensions. Methods of measuring the amount of a label depend on the nature of the label and are known in the art.
  • stage III primary cancer Once a metastasis-associated gene is found to be differentially expressed in stage I or II primary cancer than in stage III primary cancer, the expression of the gene in stage I or II primary cancer and stage III primary cancer or lymph node metastasis is analyzed. The expression of the gene is then related to stage III primary cancer, lymph node metastasis, or a combination thereof, using statistical methods well known in the art. Such statistical methods include, without limitation, Wilcoxon rank sum, Fisher's exact, Kruskal-Wallis, and Pearson goodness-of-fit tests, Spearman's (rho) rank correlation, Receiver-Operator Characteristic (ROC) curves, linear and ordinal regression models, and Sommers' D statistical significance determination. Genes identified as being related to stage III primary cancer, lymph node metastasis, or a combination thereof, are useful for diagnosis and prognosis of cancer, drug screening, and treatment of cancer as markers.
  • ROC Receiver-Operator Characteristic
  • the diagnostic and prognostic methods involve identifying a subject suffering from cancer, providing a test sample from the subject, detecting gene expression in the sample, comparing the expression level to a control value, thereby determining the stage of the cancer or predicting the outcome of the cancer.
  • a “subject,” as used herein, refers to human and non-human animals, including all vertebrates, e.g., mammals, such as non-human primates (particularly higher primates), sheep, dog, rodent (e.g., mouse or rat), guinea pig, goat, pig, cat, rabbits, cow, and non-mammals, such as chickens, amphibians, reptiles, etc.
  • the subject is a human.
  • the subject is an experimental animal or animal suitable as a disease model. Identification of a candidate subject can be in the judgment of the subject or a health care professional, and can be subjective (e.g., opinion) or objective (e.g., measurable by a test or diagnostic method).
  • a test sample from a subject can be a tissue sample (e.g., a freshly prepared tumor sample, a frozen tumor tissue specimen, a paraffin-embedded tumor sample, a primary tumor sample, or a metastasis sample) or a body fluid sample (e.g., any body fluid in which cancer cells may be present, including, without limitation, blood, bone marrow, cerebral spinal fluid, peritoneal fluid, pleural fluid, lymph fluid, ascites, serous fluid, sputum, lacrimal fluid, stool, or urine).
  • the tissues and body fluids can be collected using any of the methods well known in the art.
  • CAV1, CST3, LIMK1, MMP2, MMP15, and VEGF were significantly up-regulated in stage III primary melanoma.
  • Four genes (ETV4, MMP9, PIK3C2B, and SERPIN1; p ⁇ 0.05) were significantly down-regulated in stage III primary melanoma.
  • Three genes (CAV1, LIMK1, and VEGF) were progressively up-regulated as the disease progressed.
  • the control value is a predetermined expression level, e.g., an expression level relative to that of a reference gene (e.g., a housekeeping gene such as ⁇ -actin or GAPDH), or the expression level of a gene in a stage I or II primary tumor sample.
  • a reference gene e.g., a housekeeping gene such as ⁇ -actin or GAPDH
  • a second diagnostic method of the invention involves providing a test sample from a subject, detecting the expression of CAV1, LIMK1, MMP15, and VEGF in the sample, comparing the gene expression level to its respective control value, and determining whether the subject is likely to be suffering from stage I or II primary cancer, stage III primary cancer with micrometastasis (e.g., sentinel lymph node metastasis ⁇ 2 mm), stage III primary cancer with macrometastasis (e.g., sentinel lymph node metastasis ⁇ 2 mm), or lymph node metastasis.
  • stage III primary cancer with micrometastasis e.g., sentinel lymph node metastasis ⁇ 2 mm
  • stage III primary cancer with macrometastasis e.g., sentinel lymph node metastasis ⁇ 2 mm
  • lymph node metastasis e.g., sentinel lymph node metastasis ⁇ 2 mm
  • the control value is a predetermined expression level, e.g., an expression level relative to that of a reference gene, the expression level of a gene in a control stage I or II primary cancer sample, the expression level of a gene in a control stage III primary cancer sample, the expression level of a gene in a control stage III primary cancer sample from a subject suffering from stage III primary cancer with micrometastasis, the expression level of a gene in a control stage III primary cancer sample from a subject suffering from stage III primary cancer with macrometastasis, or the expression level of a gene in a control lymph node metastasis sample.
  • a predetermined expression level e.g., an expression level relative to that of a reference gene, the expression level of a gene in a control stage I or II primary cancer sample, the expression level of a gene in a control stage III primary cancer sample, the expression level of a gene in a control stage III primary cancer sample from a subject suffering from stage III primary cancer with micrometastasis, the expression level of a gene
  • test compounds of the present invention can be obtained using any of the numerous approaches known in the art.
  • siRNAs, ribozymes, antisense nucleotides, transcription factor decoys can be designed and synthesized using methods known in the art. See, e.g., Stevenson (2004) N Engl J Med 351: 1772-7; Mann and Conte (2003) Am J Cardiovasc Drugs 3(2): 79-85.
  • Other test compounds may be obtained, for example, using combinatorial library methods known in the art. See, e.g., U.S. Pat. No. 6,462,187.
  • Such libraries include, without limitation, peptide libraries, peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone that is resistant to enzymatic degradation), spatially addressable parallel solid phase or solution phase libraries, synthetic libraries obtained by deconvolution or affinity chromatography selection, and the “one-bead one-compound” libraries.
  • Compounds in the last three libraries can be peptides, non-peptide oligomers, or small molecules. Examples of methods for synthesizing molecular libraries can be found in the art. Libraries of compounds may be presented in solution, or on beads, chips, bacteria, spores, plasmids, or phages.
  • kits may generally comprise agents (e.g., pre-selected primers or probes) specific for a panel of marker genes. Also included may be enzymes suitable for amplifying nucleic acids including various polymerases (reverse transcriptase, Tag, etc.), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification. Such kit may further comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each marker primer pair or probe.
  • agents e.g., pre-selected primers or probes
  • enzymes suitable for amplifying nucleic acids including various polymerases (reverse transcriptase, Tag, etc.), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification.
  • Such kit may further comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each marker primer pair or probe.
  • Kits of the present invention may include a means for containing the reagents in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired reagent are retained.
  • a means for containing the reagents in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired reagent are retained.
  • Other containers suitable for conducting certain steps of the disclosed methods also may be provided.
  • One kit that can be used in the diagnostic, prognostic, and drug screening methods of the invention consists of a combination of at least two agents selected from the group consisting of a first agent for detecting the expression of CAV1, a second agent for detecting the expression of CST3, a third agent for detecting the expression of LIMK1, a fourth agent for detecting the expression of MMP2, a fifth agent for detecting the expression of MMP15, a sixth agent for detecting the expression of VEGF, a seventh agent for detecting the expression of ETV4, an eighth agent for detecting the expression of MMP9, a ninth agent for detecting the expression of PIK3C2B, and a tenth agent for detecting the expression of SERPIN1.
  • the combination is not a first combination of the third and fourth agents, a second combination of the third and sixth agents, a third combination of the fourth and sixth agents, or a fourth combination of the third, fourth, and sixth agents.
  • This invention additionally provides methods for treating cancer.
  • treating is defined as administration of a substance to a subject with the purpose to cure, alleviate, relieve, remedy, prevent, or ameliorate a disorder, symptoms of the disorder, a disease state secondary to the disorder, or predisposition toward the disorder.
  • Identification of a candidate subject can be in the judgment of the subject or a health care professional, and can be subjective (e.g., opinion) or objective (e.g., measurable by a test or diagnostic method).
  • a subject to be treated can be identified by determining gene expression in a test sample prepared from the subject. If the expression of a gene is different (higher or lower) from a control value, the patient is a candidate for treatment with an effective amount of a compound that regulates (decreases or increases) the expression of the gene.
  • An “effective amount” is an amount of the compound that is capable of producing a medically desirable result in a treated subject.
  • the medically desirable result may be objective (i.e., measurable by some test or marker, e.g., decreased or increased expression of the gene) or subjective (i.e., subject gives an indication of or feels an effect).
  • the treatment methods can be performed alone or in conjunction with other drugs and/or radiotherapy. See, e.g., U.S. Patent Application 20040224363.
  • a therapeutic compound e.g., a compound that regulates the expression of a gene or a compound identified as described above
  • a “therapeutic compound” can mean a compound the administration of which results in complete abolishment of the symptoms of a disease, a decrease in the severity of the symptoms of the disease, or prevention of the symptoms of a disease.
  • the compound will be suspended in a pharmaceutically-acceptable carrier and administered orally, or by intravenous (i.v.) infusion, or injected or implanted subcutaneously, intramuscularly, intrathecally, intraperitoneally, intrarectally, intravaginally, intranasally, intragastrically, intratracheally, or intrapulmonarily.
  • Pharmaceutically acceptable carriers are biologically compatible vehicles that are suitable for administration to a subject, e.g., physiological saline or liposomes.
  • the compound is preferably delivered directly to tumor cells, e.g., to a tumor or a tumor bed following surgical excision of the tumor, in order to kill any remaining tumor cells.
  • the compound can be administered to, for example, a subject that has not yet developed detectable invasion and metastases but whose primary tumor was found to express the gene.
  • the dosage required depends on the choice of the route of administration, the nature of the formulation, the nature of the subject's illness, the subject's size, weight, surface area, age, and sex, other drugs being administered, and the judgment of the attending physician. Suitable dosages are in the range of 0.01-100.0 mg/kg. Wide variations in the needed dosage are to be expected in view of the variety of compounds available and the different efficiencies of various routes of administration. For example, oral administration would be expected to, require higher dosages than administration by i.v. injection.
  • Topical administration of a therapeutic compound is useful when the desired treatment involves areas or organs readily accessible by topical application.
  • the compound can be formulated with a suitable ointment containing the compound suspended or dissolved in a carrier.
  • Carriers for topical administration of the compound include, but are not limited to, mineral oil, liquid petroleum, white petroleum, propylene glycol, polyoxyethylene or polyoxypropylene compound, emulsifying wax, and water.
  • the compound can be formulated with a suitable lotion or cream containing the compound suspended or dissolved in a carrier with suitable emulsifying agents.
  • polynucleotides such as siRNAs, ribozymes, antisense nucleotides, and transcription factor decoys are administered to a subject.
  • Polynucleotides can be delivered to target cells by, for example, the use of polymeric, biodegradable microparticle or microcapsule devices known in the art. Another way to achieve uptake of the nucleic acid is using liposomes, prepared by standard methods.
  • the polynucleotides can be incorporated alone into these delivery vehicles or co-incorporated with tissue-specific or tumor-specific antibodies. Alternatively, one can prepare a molecular conjugate composed of a polynucleotide attached to poly-L-lysine by electrostatic or covalent forces.
  • Poly-L-lysine binds to a ligand that can bind to a receptor on target cells.
  • naked DNA i.e., without a delivery vehicle
  • a preferred dosage for administration of polynucleotide is from approximately 106 to 1012 copies of the polynucleotide molecule.
  • Double-stranded interfering RNA (RNAi; including siRNA) homologous to a target gene can also be used to reduce the expression of the target gene.
  • RNAi double-stranded interfering RNA
  • the sense and antisense RNA strands can be individually constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • each strand can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the sense and antisense strands, e.g., phosphorothioate derivatives and acridine substituted nucleotides.
  • the sense or antisense strand can also be produced biologically using an expression vector into which a target gene sequence (full-length or a fragment) has been subcloned in a sense or antisense orientation.
  • the sense and antisense RNA strands can be annealed in vitro before delivery of the dsRNA to target cells. Alternatively, annealing can occur in vivo after the sense and antisense strands are sequentially delivered to the cancer cells.
  • Double-stranded RNA interference can also be achieved by introducing into target cells a polynucleotide from which sense and antisense RNAs can be transcribed under the direction of separate promoters, or a single RNA molecule containing both sense and antisense sequences can be transcribed under the direction of a single promoter.
  • a polynucleotide containing a nucleic acid sequence that is transcribed into an antisense RNA complementary to the mRNA of a target gene can be delivered to target cells.
  • the polynucleotide can include one or more sequences complementary to the sense strand of a target gene and a catalytic sequence known to be responsible for mRNA cleavage.
  • a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a target mRNA.
  • a target mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules.
  • the nucleic acid sequence encoding the antisense RNA is operatively linked to a promoter or enhancer-promoter combination.
  • Enhancers provide expression specificity in terms of time, location, and level. Unlike a promoter, an enhancer can function when located at variable distances from the transcription initiation site, provided a promoter is present. An enhancer can also be located downstream of the transcription initiation site.
  • Suitable expression vectors include plasmids and viral vectors such as herpes viruses, retroviruses, vaccinia viruses, attenuated vaccinia viruses, canary pox viruses, adenoviruses and adeno-associated viruses, among others.
  • Transcription factor decoys are double-stranded nucleic acid molecules with high binding affinity for targeted transcription factors. See, e.g., Mann and Conte (2003) Am J Cardiovasc Drugs 3(2): 79-85; U.S. Pat. No. 6,821,956. Transcription factors are endogenous, sequence-specific double-stranded DNA binding proteins which modulate (increase or decrease) the rate of transcription of one or more specific genes in a cell. Methods for identifying transcription factor binding sequences are known in the art.
  • the length, structure, and nucleotide sequence of a decoy varies depending on the target transcription factor, the indication, route of administration, etc. In addition to binding affinity, decoys are also selected for binding specificity.
  • a decoy contains sufficient nucleotide sequence to ensure target transcription factor binding specificity and affinity sufficient for therapeutic effectiveness.
  • a transcription factor requires at least six base pairs, usually at least about eight base pairs for sufficient binding specificity and affinity.
  • providing a decoy with flanking sequences (ranging from about 5 to 50 bp) beside the binding site enhances binding affinity and/or specificity.
  • the strands may be synthesized in accordance with conventional ways using phosphoramidite synthesis, commercially available automatic synthesizes, and the like.
  • One treatment method of the invention involves identifying a subject suffering from stage III cancer and administering to the subject therapeutic compounds to decrease the expression of CAV1, CST3, LIMK1, MMP2, MMP15, or VEGF, to increase the expression of ETV4, MMP9, PIK3C2B, or SERPIN1, or a combination thereof, in the subject.
  • Another treatment method of the invention involves identifying a subject suffering from cancer as staged using the method described above and administering to the subject therapeutic compounds to decrease the expression of CAV1, CST3, LIMK1, MMP2, MMP15, or VEGF, to increase the expression of ETV4, MMP9, PIK3C2B, or SERPIN1, or a combination thereof, in the subject.
  • a fourth treatment method of the invention involves identifying a subject suffering from cancer and administering to the subject a combination of at least two compounds selected from the group consisting of a first compound that inhibits the expression of CAV1, a second compound that inhibits the expression of CST3, a third compound that inhibits the expression of LIMK1, a fourth compound that inhibits the expression of MMP2, a fifth compound that inhibits the expression of MMP15, a sixth compound that inhibits the expression of VEGF, a seventh compound that enhances the expression of ETV4, an eighth compound that enhances the expression of MMP9, a ninth compound that enhances the expression of PIK3C2B, and a tenth compound that enhances the expression of SERPIN1.
  • the combination is not a first combination of the third and fourth compounds, a second combination of the third and sixth compounds, a third combination of the fourth and sixth compounds, or a fourth combination of the third, fourth, and sixth compounds.
  • a therapeutic compound that decreases the expression of LIMK1 may be an siRNA targeting LIMK1 mRNA at position 1869: CCGCUACUGCCCCCCAAACUG, at position 1996: CUGGCCGGCCACCUGCCACUG, at position 1868: ACCGCUACUGCCCCCCAAACU, at position 629: CUGGCUCCCACCUGCCCCACA, at position 1539: CCGAGACCUCAACUCCCACAA, at position 1866: GGACCGCUACUGCCCCCCAAA, at position 2061: CCGGCGGCGAGAGCGGACU, at position 1541: GAGACCUCAACUCCCACAACU, at position 1887: CUGCCCCCCGAGCUUCUUCCC, at position 420: UGGGUGCUCUGAGCAAAUCAC, at position 1017: GGGCAGCUCUGCCCGGCAGAA, or an siRNA targeting the splice variant of LIMK1 mRNA (dLIMK) at position 903: CAGCCGCCUGCUCCAGCU
  • a therapeutic compound that decreases the expression of VEGF may be an siRNA targeting VEGF mRNA at position 1182: GCGCAGCUACUGCCAUCCAAU, at position 1180: CAGCGCAGCUACUGCCAUCCA, at position 1065: UUGGAGCCUUGCCUUGCUGCU, at position 1111: CAGGCUGCACCCAUGGCAGAA, at position 1538: GUGGGCCUUGCUCAGAGCGGA, at position 1628: AGGCGAGGCAGCUUGAGUUAA, at position 1629: GGCGAGGCAGCUUGAGUUAAA, at position 1545: UUGCUCAGAGCGGAGAAAGCA, at position 1322: UGCCCACUGAGGAGUCCAACA, or at position 1323: GCCCACUGAGGAGUCCAACAU.
  • the composition comprises one or more therapeutic compounds and a transdermal drug delivery agent.
  • a transdermal drug delivery agent refers to a substance that can be used to facilitate administration of a drug to a subject. Examples of such agent include, and are not limited to, a lotion, cream (e.g., sunscreen cream to protect a subject from the UV light), emulsion, oil, liquid, gel, or patch.
  • the compounds may regulate the expression of one or more genes in a subject.
  • the genes may be associated with cancer such as melanoma, breast cancer, colon cancer, lung cancer, or merkel cell carinoma. Examples of such genes include, without limitation, CAV1, CST3, LIMK1, MMP2, MMP15, VEGF, ETV4, MMP9, PIK3C2B, and SERPIN1.
  • compositions typically include the compounds and pharmaceutically acceptable carriers.
  • a pharmaceutical composition is formulated to be compatible with its intended route of administration. See, e.g., U.S. Pat. No. 6,756,196.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents, antibacterial agents such as benzyl alcohol or methyl parabens, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as ethylenediaminetetraacetic acid, buffers such as acetates, citrates, or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • compositions that are suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.), or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifingal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, and sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the compounds in the required amounts in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the compounds into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier.
  • the compounds can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules.
  • Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.
  • Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin, an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch, a lubricant such as magnesium stearate or Sterotes, a glidant such as colloidal silicon dioxide, a sweetening agent such as sucrose or saccharin, or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose
  • a disintegrating agent such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g., with conventional suppository bases such as cocoa butter and other glycerides
  • retention enemas for rectal delivery.
  • the compounds are prepared with carriers that will protect the compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
  • the materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated, each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • compositions can be included in a container, pack, or dispenser together with instructions for administration to form packaged products.
  • a packaged product may comprise a container, an effective amount of a compound of the invention, and an insert associated with the container, indicating administering the compound for treating cancer.
  • a particular composition of the invention comprises a combination of at least two therapeutic compounds selected from the group consisting of a first compound that inhibits the expression of CAV1, a second compound that inhibits the expression of CST3, a third compound that inhibits the expression of LIMK1, a fourth compound that inhibits the expression of MMP2, a fifth compound that inhibits the expression of MMP15, a sixth compound that inhibits the expression of VEGF, a seventh compound that enhances the expression of ETV4, an eighth compound that enhances the expression of MMP9, a ninth compound that enhances the expression of PIK3C2B, and a tenth compound that enhances the expression of SERPIN1.
  • the combination is not a first combination of the third and fourth compounds, a second combination of the third and sixth compounds, a third combination of the fourth and sixth compounds, or a fourth combination of the third, fourth, and sixth compounds.
  • the compounds may be admixed with or embedded in a transdermal drug delivery agent.
  • This study utilized primary melanomas and/or sentinel LN (SLN) metastases from 12 AJCC clinical stage I/II (no palpable LN metastasis) melanoma patients and 2 matching pairs of cell lines derived from primary melanoma and LN metastasis from 2 different patients.
  • the samples were divided into 4 groups as shown in Table 1.
  • the study was divided into 2 stages. The first stage compared gene-expression differences between Group 1 and Group 2 by using a 96-gene cDNA microarray that is functionally-focused to metastasis-associated genes.
  • stage I/II primary melanoma Group 1
  • stage III primary melanoma Group 3
  • LN metastasis Group 4
  • the samples are divided into 4 separate groups.
  • the samples from Groups 3 & 4 are from 4 different patients (matching pairs of primary melanoma and LN metastasis).
  • the SLN was localized by using a hand-held gamma probe and by visual inspection for the presence of blue dye, which was used as the gold standard for identifying the SLNs.[17]
  • the SLNs were evaluated for presence of metastasis by using routine H&E and immunohistochemical staining against S-100, HMB-45, and MART-1.
  • RNAlater Quality of Service
  • RNA 6000 Nano Assay Kit The final concentration, quality, and purity of total RNA were determined by using the RNA 6000 Nano Assay Kit on the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, Calif.) per manufacturer's instructions (Agilent Bioanalyzer Handbook).
  • CRL-7425 and CRL-7426 were derived from the primary melanoma and its lymph node metastasis in the same patient, respectively.
  • IGR-37 and IGR-39 were derived from a primary melanoma and its lymph node metastasis, respectively.
  • CRL-7425 and CRL-7426 cell lines were grown in ATCC medium (90% DMEM with 4 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate and 4.5 g/L glucose, and 10% fetal bovine serum) and antibiotics at 37° C. in 5% CO 2 and 30% O 2 .
  • IGR-37 and IGR-39 cell lines were grown in 85% DMEM and 15% FBS with antibiotics at 37° C. in 5% CO 2 and 30% O 2 .
  • RNA was extracted as described in previous section.
  • GEArray Q series Human Tumor Metastasis Gene Array Kits (SuperArray, Bethesda, Md.)—were used per manufacturer's instructions with minor modifications (Modified protocol per courtesy of Dr. Y. Liu, JWCI).
  • Each Q series array evaluates expression of 96 functionally-focused genes; the 112 gene-spots include 10 positive controls, 3 blanks, and 3 negative controls. Each gene-spot is sub-spotted 4 times to assure uniform hybridization.
  • This cDNA microarray platform along with LPR amplification protocol has been cross-validated with RT-PCR by the manufacturer.
  • RNA was reverse-transcribed into cDNA and then amplified into biotinylated (Biotin-16-dUTP) cDNA by LPR amplification protocol, per manufacturer's instructions.
  • Biotin-16-dUTP biotinylated cDNA
  • the biotinylated cDNA was placed on a microarray membrane that had been pre-hybridized with heat-denatured salmon sperm DNA, and hybridized overnight at 60° C. in a Lab-Line Instruments Hybridization Incubator 300 Series (Bamstead International, Dubuque, Iowa) while being continuously agitated at 10 rpm. Next day, the hybridization was blocked with blocking buffer, and arrays were washed with the washing buffer, both supplied by the manufacturer.
  • SLN metastasis Of 12 patients enrolled in the study, 5 had no SLN metastasis (AJCC stage I/II) and 7 had SLN metastasis (AJCC stage III). Among the 7 patients with SLN metastasis, 2 patients had RNA from primary melanoma and matching macroscopic ( ⁇ 2 mm) SLN metastasis available for in vivo matched-pair comparison; these 2 patients were excluded from the first stage of study (initial comparison of clinicopathologic features of Group 1 and Group 2 patients, and gene expression levels of their primary melanomas) so that they can be used later for a partially validative trend analysis in the second stage. Clinicopathologic features of the 2 groups are shown in Table 2.
  • the two groups differed significantly by Breslow thickness of the primary and status of the SLNs, but not by other factors (age, gender, and ulceration).
  • Gene-expression levels of these two groups were compared.
  • 6 were significantly up-regulated (CAV1, CST3, LIMK1, MMP2, MMP15, and VEGF; p ⁇ 0.05)
  • 4 were significantly down-regulated in stage III primary melanoma (ETV4, MMP9, PIK3C2B, and SERPIN1; p ⁇ 0.05).
  • in vitro cell lines are clonally pure, but genes identified from them may represent in vitro artifact from the culture medium and conditions. However, if a gene is up-regulated (or down-regulated) in both in vivo tissue and in vitro cell lines, then its expression level most likely represents what happens real life, as it unlikely due to in vivo tissue impurity/contamination or in vitro artifact. In addition, the genes noted to be significant would have further in vitro testability.
  • stage III primary melanomas were subcategorized by the size of their corresponding SLN metastasis ( ⁇ 2 mm vs.
  • ROC Receiver-Operator Characteristic
  • the documented AUCs for screening mammogram and MRI for high risk breast cancer patients are 0.686 and 0.827, respectively.[26]
  • stage I/II primary melanoma vs. stage III primary melanoma with micrometastasis vs. stage III primary melanoma with macrometastasis vs. LN metastasis a multivariate ordinal regression analysis was performed.
  • the covariates included in the model were CAV1, LIMK1, and VEGF. A stepwise selection of the covariates was used.
  • cDNA microarray studies utilized universal reference mRNA, cell lines, or pooled tumor samples as the reference standard for comparison and determination of up- or down-regulation.[27-30] Although these strategies enable formulation of gene-expression profiles that can be correlated to a disease state or an outcome, the individual genes identified as up- or down-regulated cannot be considered biologically significant since their differential expressions were based on biologically irrelevant reference samples.
  • Other investigators utilized surrounding “normal tissue” as the reference for comparison,[9, 10, 31, 32] however surrounding tissue contains more than just the cells that initiated tumor formation. The surrounding tissue lacks cellular homogeneity. In case of melanoma, ideal reference cells would be matching melanocytes, but for obvious reasons, this would be extremely difficult.
  • stage I/II and stage III primary melanomas for our initial analysis.
  • Our macro-dissection of the collected sample grossly yielded >80% melanoma (a very conservative estimate) for primary melanomas and near 100% melanoma for macroscopic sentinel lymph node metastases.
  • Our control experiments showed that melanoma contains average of 5-fold greater amount of RNA than matching surrounding skin.
  • maximum amount of skin RNA contamination per ⁇ g of sample RNA would then be 4% (20% of 20%).
  • stage III Our trend analyses including 2 sub-prognostic groups within the stage III patients show that CAV1, LIMK1, and VEGF are progressively up-regulated as melanoma progressed from stage I/II primary melanoma to lymph node metastasis ( FIG. 2 ).
  • VEGF tumor progression and metastasis has been shown in various tumor models, including melanoma.[11, 33, 34]
  • VEGF expression by immunohistochemistry
  • Another in vitro human study by Simonetti et al. showed that none of the nevi, but 25% of in situ melanomas and 77% of primary invasive melanomas showed expression of VEGF detected by immunohistochemistry.
  • Their study also showed that MMP2 expression was higher in invasive melanomas when compared to in situ melanomas. This difference was not observed with MMP9.
  • LIMK1 an important factor in actin cytoskeleton regulation and cellular cytokinesis, in melanoma progression and metastasis.
  • LIMK1 is activated by ROCK (Rho associated serine-threonine protein kinase) and can inhibit cofilin activity by phosphorylation.[35-39]
  • Cofilin plays a crucial role in actin depolymerization, and to date, is the only known target of LIMK1.
  • In vitro experiments using breast and prostate cancer cell lines, as well as in vivo animal experiments show mechanistic importance of LIMK1 over-expression in cancer invasion.[39] Since melanocytes have neuroectodermal embryonic origin, it is important to note that LIMK1 is highly expressed in neural tissue, and mice lacking LIMK1 gene show synaptic dysfunction.[39, 40] Although high expression of LIMK1 in melanoma has been previously reported,[39] to our knowledge, we are the first to report the importance of LIM
  • Presence of lymph node metastasis remains one of the strongest prognostic factors in melanoma. Rather than profiling via mass-gene arrays, focused analysis of gene expression using functionally relevant gene microarray can identify genes that are functionally significant.
  • LIMK1 cell motility regulatory gene
  • VEGF pro-angiogenic gene
  • LIMK1 cell motility regulatory gene
  • VEGF pro-angiogenic gene

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hospice & Palliative Care (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US11/249,589 2004-10-12 2005-10-12 Treatment of cancer and compositions Abandoned US20060134661A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US11/249,589 US20060134661A1 (en) 2004-10-12 2005-10-12 Treatment of cancer and compositions
US13/243,914 US9156898B2 (en) 2004-10-12 2011-09-23 Treatment of cancer and compositions

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US61840904P 2004-10-12 2004-10-12
US11/249,589 US20060134661A1 (en) 2004-10-12 2005-10-12 Treatment of cancer and compositions

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/243,914 Continuation US9156898B2 (en) 2004-10-12 2011-09-23 Treatment of cancer and compositions

Publications (1)

Publication Number Publication Date
US20060134661A1 true US20060134661A1 (en) 2006-06-22

Family

ID=36149041

Family Applications (2)

Application Number Title Priority Date Filing Date
US11/249,589 Abandoned US20060134661A1 (en) 2004-10-12 2005-10-12 Treatment of cancer and compositions
US13/243,914 Active US9156898B2 (en) 2004-10-12 2011-09-23 Treatment of cancer and compositions

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/243,914 Active US9156898B2 (en) 2004-10-12 2011-09-23 Treatment of cancer and compositions

Country Status (5)

Country Link
US (2) US20060134661A1 (de)
EP (1) EP1812596A4 (de)
AU (1) AU2005295130A1 (de)
CA (1) CA2588057A1 (de)
WO (1) WO2006042328A2 (de)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070161004A1 (en) * 2004-05-28 2007-07-12 David Brown Methods and compositions involving microRNA
US20090131354A1 (en) * 2007-05-22 2009-05-21 Bader Andreas G miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
US20090131348A1 (en) * 2006-09-19 2009-05-21 Emmanuel Labourier Micrornas differentially expressed in pancreatic diseases and uses thereof
US20090176228A1 (en) * 2007-11-19 2009-07-09 Celera Corporation Lung cancer markers, and uses thereof
US20090186015A1 (en) * 2007-10-18 2009-07-23 Latham Gary J Micrornas differentially expressed in lung diseases and uses thereof
US20090233297A1 (en) * 2008-03-06 2009-09-17 Elizabeth Mambo Microrna markers for recurrence of colorectal cancer
US7960359B2 (en) 2004-11-12 2011-06-14 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8071562B2 (en) 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
US8258111B2 (en) 2008-05-08 2012-09-04 The Johns Hopkins University Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US8361714B2 (en) 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
CN114176586A (zh) * 2012-12-14 2022-03-15 明德拉公司 用于检测和获取生物标志物的方法和装置

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008032323A2 (en) * 2006-09-11 2008-03-20 Seng Enterprises Ltd. Method of determining lymph node metastasis
CA2697737A1 (en) * 2007-09-07 2009-03-12 The University Of Tokushima Method for promoting expression of p53, and p53 expression promoter for use in the method
WO2018112122A1 (en) * 2016-12-16 2018-06-21 Drexel University Methods of identifying and treating tumors with sigma1 inhibitors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7332290B2 (en) * 2001-08-02 2008-02-19 The Regents Of The University Of Michigan Dectection of AMACR cancer markers in urine

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6444195B1 (en) * 2001-06-18 2002-09-03 Johnson & Johnson Consumer Companies, Inc. Sunscreen compositions containing a dibenzoylmethane derivative
BR0211111A (pt) * 2001-07-12 2004-06-22 Univ Massachusetts Molécula de ácido nucleico isolada, vetor, célula hospedeira, transgene, precursor de rna engenheirado, animal transgênico não humano, e, método de induzir a interferência de ácido ribonucleico de um gene alvo em uma célula
US20070203333A1 (en) * 2001-11-30 2007-08-30 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US7250496B2 (en) * 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
US7504385B2 (en) * 2003-12-17 2009-03-17 Avon Products, Inc. si-RNA-mediated gene silencing technology to inhibit tyrosinase and reduce pigmentation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7332290B2 (en) * 2001-08-02 2008-02-19 The Regents Of The University Of Michigan Dectection of AMACR cancer markers in urine

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8465914B2 (en) 2004-05-28 2013-06-18 Asuragen, Inc. Method and compositions involving microRNA
US10047388B2 (en) 2004-05-28 2018-08-14 Asuragen, Inc. Methods and compositions involving MicroRNA
US8568971B2 (en) 2004-05-28 2013-10-29 Asuragen, Inc. Methods and compositions involving microRNA
US7888010B2 (en) 2004-05-28 2011-02-15 Asuragen, Inc. Methods and compositions involving microRNA
US8003320B2 (en) 2004-05-28 2011-08-23 Asuragen, Inc. Methods and compositions involving MicroRNA
US7919245B2 (en) 2004-05-28 2011-04-05 Asuragen, Inc. Methods and compositions involving microRNA
US20070161004A1 (en) * 2004-05-28 2007-07-12 David Brown Methods and compositions involving microRNA
US9382537B2 (en) 2004-11-12 2016-07-05 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8058250B2 (en) 2004-11-12 2011-11-15 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9506061B2 (en) 2004-11-12 2016-11-29 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9447414B2 (en) 2004-11-12 2016-09-20 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US7960359B2 (en) 2004-11-12 2011-06-14 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9068219B2 (en) 2004-11-12 2015-06-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8173611B2 (en) 2004-11-12 2012-05-08 Asuragen Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US9051571B2 (en) 2004-11-12 2015-06-09 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8765709B2 (en) 2004-11-12 2014-07-01 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US8946177B2 (en) 2004-11-12 2015-02-03 Mima Therapeutics, Inc Methods and compositions involving miRNA and miRNA inhibitor molecules
US8563708B2 (en) 2004-11-12 2013-10-22 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US20090131348A1 (en) * 2006-09-19 2009-05-21 Emmanuel Labourier Micrornas differentially expressed in pancreatic diseases and uses thereof
US20090131354A1 (en) * 2007-05-22 2009-05-21 Bader Andreas G miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
US8361714B2 (en) 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
US9080215B2 (en) 2007-09-14 2015-07-14 Asuragen, Inc. MicroRNAs differentially expressed in cervical cancer and uses thereof
US20090186015A1 (en) * 2007-10-18 2009-07-23 Latham Gary J Micrornas differentially expressed in lung diseases and uses thereof
US20090176228A1 (en) * 2007-11-19 2009-07-09 Celera Corporation Lung cancer markers, and uses thereof
US7892760B2 (en) 2007-11-19 2011-02-22 Celera Corporation Lung cancer markers, and uses thereof
US8071562B2 (en) 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
US20090233297A1 (en) * 2008-03-06 2009-09-17 Elizabeth Mambo Microrna markers for recurrence of colorectal cancer
US9365852B2 (en) 2008-05-08 2016-06-14 Mirna Therapeutics, Inc. Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US8258111B2 (en) 2008-05-08 2012-09-04 The Johns Hopkins University Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US9644241B2 (en) 2011-09-13 2017-05-09 Interpace Diagnostics, Llc Methods and compositions involving miR-135B for distinguishing pancreatic cancer from benign pancreatic disease
US10655184B2 (en) 2011-09-13 2020-05-19 Interpace Diagnostics, Llc Methods and compositions involving miR-135b for distinguishing pancreatic cancer from benign pancreatic disease
CN114176586A (zh) * 2012-12-14 2022-03-15 明德拉公司 用于检测和获取生物标志物的方法和装置

Also Published As

Publication number Publication date
CA2588057A1 (en) 2006-04-20
WO2006042328A2 (en) 2006-04-20
WO2006042328A3 (en) 2009-04-16
AU2005295130A1 (en) 2006-04-20
US20120258056A1 (en) 2012-10-11
EP1812596A4 (de) 2010-07-14
US9156898B2 (en) 2015-10-13
EP1812596A2 (de) 2007-08-01

Similar Documents

Publication Publication Date Title
US9156898B2 (en) Treatment of cancer and compositions
Bianchini et al. Comparative study of gene expression by cDNA microarray in human colorectal cancer tissues and normal mucosa
JP6430560B2 (ja) 前立腺癌マーカーとしてのホスホジエステラーゼ４ｄ７
JP6446381B2 (ja) ｃ−ＭＡＦを用いた前立腺がん転移の診断、予後診断および処置のための方法
WO2007013665A2 (en) Method of diagnosing small cell lung cancer
US8029981B2 (en) Hypoxia-inducible protein 2 (HIG2), a diagnostic marker for clear cell renal cell carcinoma
CA2690281A1 (en) Biomarkers for melanoma
WO2012045905A2 (es) Método para el diagnóstico, pronóstico y tratamiento de la metástasis de cáncer de mama
US20110236396A1 (en) Methods and compositions for diagnosing and treating a colorectal adenocarcinoma
EP2035577B1 (de) Verfahren zur diagnose von leberzellenkarzinomen
US20050003405A1 (en) Treatment and diagnostics of cancer
CN112626207A (zh) 一种用于区分非侵袭性和侵袭性无功能垂体腺瘤的基因组合
US7888033B2 (en) Use of ID4 for diagnosis and treatment of cancer
WO2008031165A1 (en) Methods and compositions for the diagnosis and treatment of tumours
AU2012200624A1 (en) Treatment of cancer and compositions
WO2010067307A2 (en) In vitro methods and compositions for the diagnosis and/or treatment of adenocarcinoma
WO2001001151A2 (en) Evaluation of adenocarcinoma of the prostate and breast using anti-dystroglycan antibodies
WO2015006543A1 (en) Method for predicting and detecting tumor metastasis in kidney cancer

Legal Events

Date Code Title Description
AS Assignment

Owner name: JOHN WAYNE CANCER INSTITUTE, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ESSNER, RICHARD;REEL/FRAME:021989/0686

Effective date: 20081121

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION