US20060127972A1 - In vivo production of cephalosporins - Google Patents
In vivo production of cephalosporins Download PDFInfo
- Publication number
- US20060127972A1 US20060127972A1 US11/349,381 US34938106A US2006127972A1 US 20060127972 A1 US20060127972 A1 US 20060127972A1 US 34938106 A US34938106 A US 34938106A US 2006127972 A1 US2006127972 A1 US 2006127972A1
- Authority
- US
- United States
- Prior art keywords
- expandase
- apa
- host
- cytosol
- beta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P35/00—Preparation of compounds having a 5-thia-1-azabicyclo [4.2.0] octane ring system, e.g. cephalosporin
Definitions
- the present invention lies in the field of recombinant DNA techniques. More in particular, the invention is in the field of the production of cephalosporins using genetically modified host organisms, host organisms so modified, as well as DNA for use therein. The invention further pertains to modified enzymes expressed from recombinant DNA in said host organisms.
- ⁇ -Lactam antibiotics constitute the most important group of antibiotic compounds, with a long history of clinical use. Among this group, the prominent ones are the penicillins and cephalosporins. These compounds are naturally produced by the filamentous fungi such as Penicillium chrysogenum and Acremonium chrysogenum, respectively.
- the first two steps in the biosynthesis of penicillin in P. chrysogenum are the condensation of the three amino acids L-5-amino-5-carboxypentanoic acid (L- ⁇ -aminoadipic acid) (A), L-cysteine (C) and L-valine (V) into the tripeptide LLD-ACV, followed by cyclisation of this tripeptide to form isopenicillin N.
- L- ⁇ -aminoadipic acid A
- L-cysteine C
- L-valine V
- This compound contains the typical ⁇ -lactam structure.
- the third step involves the exchange of the hydrophilic side chain of L-5-amino-5-carboxypentanoic acid by a hydrophobic side chain by the action of the enzyme acyltransferase.
- the enzymatic exchange reaction mediated by acyltransferase takes place inside a cellular organelle, the microbody, as has been described in EP-A-0 448 180.
- Cephalosporins are much more expensive than penicillins.
- cephalosporins e.g. cephalexin
- Cephalosporin C by far the most important starting material in this respect, is very soluble in water at any pH, thus implying lengthy and costly isolation processes using cumbersome and expensive column technology.
- Cephalosporin C obtained in this way has to be converted into therapeutically used cephalosporins by a number of chemical and enzymatic conversions.
- DOCS desacetoxycephalosporin C synthetase
- the expandase enzyme from the bacterium Streptomyces clavuligerus was found to carry out, in some cases, penicillin ring expansions. When introduced into P. chtysogenum, it can convert the penicillin ring structure into the cephalosporin ring structure in vivo, as described in Cantwell et al., Proc. R. Soc. Lond. B. 248 (1992), 283-289.
- the expandase enzyme has been well characterised (EP-A-0 366 354) both biochemically and functionally, as has its corresponding gene, cefE. Both physical maps of the cefE gene (EP-A-0 341 892), DNA sequence and transformation studies in P. chrysogenum with cefE have been described.
- a ring expansion enzyme is for example the bacterium Nocardia lactamdurans (formerly Streptomyces lactamdurans ) and the fungus Acremonium chrysogenum (formerly Cephalosporum acremonium ).
- the expandase from Cephalosporium is a bifunctional enzyme having expandase (ring-expansion) as well as 3-hydroxylating activity. Both the biochemical properties of the enzyme and the DNA sequence of the gene have been described (Cortés et al., J. Gen. Microbiol. 133 (1987). 3165-3174; and Coque et al., Mol. Gen. Genet. 236 (1993), 453-458, respectively).
- the expandase enzyme is capable of expanding penicillins with non-naturally occurring side chains to the corresponding 7-ADCA derivatives.
- These side chains include adipate (5-carboxyl-pentanoic acid) and various other compounds. This feature of the expandase has been exploited in a process for the in vivo production of adipoyl-7-ADCA in Penicillium chrysogenum as disclosed in EP-A-0 532 341.
- Penicillium chrysogenum strains are transformed with the Streptomyces clavuligerus expandase to produce adipoyl-6-aminopenicillanic acid (adipoyl-6-APA) when these transformants are fed adipic acid. Subsequently, adipoyl-4-APA is “expanded” to adipoyl-7-ADCA Production of various other 7-acylated cephalosporins have been disclosed in WO 95/04148 and WO95/04149.
- the final step in the synthesis of penicillins occurs in the microbody, where the acyltransferase is localised.
- the preferred localisation of expandase is therefore believed to be in the microbody. This is based not only on the fact that the substrate for expandase is believed to be produced in the microbody, but also on the expectation that in the microbody, expandase should be better protected from degradation by proteases, which is a known drawback from the use of P. chrysogenum for the production of enzymes (see for example.
- the invention provides DNA, heterologous host cells capable of transcribing, translating or expressing said DNA and methods employing such host cells and cultures thereof for an improved in vivo production of acylated-cephalosporins with higher yield.
- a host cell comprising an enzyme having expandase activity which is predominantly localised in the cytosol (as opposed to localised mainly in or with the peroxisomes or microbodies) of the host cell.
- the invention provides an isolated DNA fragment coding for a modified expandase, which expandase, after expression of said DNA fragment in a Penicillium chrysogenum host is found predominantly in the cytosol of said Penicillium host.
- a DNA fragment coding for a modified expandase can for example be obtained by modifying DNA encoding an expandase as found with Nocardia lactamdurans (formerly Streptomyces lactamdurans ) and the fungus Acremonium chrysogenum, and other related (i.e. cephalosporin/cephamycin producing) micro-organisms.
- the invention provides an isolated DNA fragment encoding a modified expandase that preferably localises predominantly in the cytosol instead of in the microbody of the heterologous host.
- a DNA fragment is obtainable from Streptomyces clavuigerus DNA encoding an expandase, and modified to obtain an DNA fragment encoding an expandase that, when expressed in a Penicillium chrysogenum host, is found predominantly in the cytosol of said Penicillium host.
- Such a modification comprises cloning by recombinant techniques of a nucleotide sequence encoding said expandase, but preferably comprises modifying by recombinant techniques of a sequence coding for a microbody or peroxisome targeting signal in said expandase.
- Modification can comprise a single or multiple mutation (such as a deletion, insertion, or reversion) of a nucleic acid sequence encoding an expandase, preferably of a sequence encoding a carboxy-terminal amino acid sequence of said expandase.
- proteins destined for the peroxisome or microbody generally contain a C-terminal targeting sequence, the amino acid sequence of which is generally S (serine) K (lysine) L (leucine), or more generally S/C/A/-K/H/R-L.
- a targeting sequence at least in a homologous context, provides the necessary signal for a protein such as an enzyme to be routed to the microbody, where it finds its final localisation.
- Expandase from the bacterium S. clavuligerus generally comprises a C-terminal sequence, SKA (Serine-Lysine-Alanine), that seemingly functions as a peroxisomal targeting sequence when said protein is expressed in a heterologous context in a eukaryotic host.
- SKA Serine-Lysine-Alanine
- Penicillium chrysogenum strains transformed with the S. clavuligerus expandase show localisation of the respective expandase within the peroxisome.
- the enzyme carries an effective targeting signal, causing it to localise, at least predominantly, within the microbody of the heterologous Penicillium chrysogenum host cell.
- the invention now provides an effective modification of an expandase, altering the tendency to localise within the microbody and leading to a predominant localisation of said expandase in the cytosol of a host.
- PTSs N-terminal or C-terminal peroxisome targeting signals
- modification of said PTS substantially preventing such localisation in the microbodies.
- An example of such a modification is a modification in a nucleotide sequence coding for a carboxy terminal tripeptide X 1 -X 2 -X 3 , for instance wherein X 1 is one amino acid residue selected from the group consisting of Serine, Cysteine and Alanine, X 2 is one amino acid residue selected from the group consisting of Lysine, Histidine and Arginine and X 3 is Leucine or Alanine.
- Such tripeptide sequences are also called SKL-like peptides, and the essential sequence of the signal may be a small amino acid at the first, a basic residue at the penultimate and a large non-polar residue at the C-terminal position.
- the invention provides a DNA fragment encoding an expandase wherein said fragment encoding an SKL-like tripeptide has been modified or selected so as to substantially prevent the expandase to be localised in the microbodies and hence to cause the expandase to be localised predominantly in the cytosol of the host cell upon expression in said heterologous cell.
- said DNA fragment is obtained from DNA encoding S. clavuligerus expandase initially comprising a nucleotide sequence coding for a carboxy-terminal tripeptide Serine-Lysine-Alanine which is modified so as to cause the expandase to be localised predominantly in the cytosol of the host cell upon expression therein.
- a modification is particularly exemplified by a DNA fragment of the invention wherein a nucleotide sequence coding for Serine-Lysine-Alanine has been modified into a sequence coding for Serine-Lysine-Aspartic acid, or where the amino acid at the ultimate position has been deleted or replaced by for example another non-hydrophobic residue.
- Yet another modification comprises Serine-Serine-Aspartic acid, or where the amino acid at the penultimate position has been deleted or replaced by a non-positively charged residue.
- modifications comprise deletions of modifications in the first position of the tripeptide that alter the routing of a thus modified protein in a heterologous host and cause it to be predominantly localised in the cytosol of the host cell used.
- modifications comprise deletions or modifications of any of a combination of these three amino acids or codons encoding these carboxy-terminal amino acids.
- proteins in nature are abound, and it is now possible to find micro-organisms that comprise an enzyme such as an expandase, that, when said enzyme would be expressed in a heterologous host, would be predominantly localised in the cytosol of said host.
- proteins or enzymes that have a C-terminal sequence deviant from the above identified targeting sequence are likely candidates to be tested for cytosolic localisation and selected for further use in improving yields of cephalosporin production.
- the invention provides a nucleotide sequence coding for an expandase which upon expression in a Penicillium chrysogenum host cell is localised predominantly in the cytosol, thereby improving cephalosporin yield over those of a host cell expressing a comparable enzyme within or at the microbodies.
- an enzyme as provided by the invention appears to be stable outside the microbodies.
- An expandase, as provided by the invention is still capable of expanding penicillins, even those with non-naturally occurring side chains (see for example EP 97201196.9 and EP 97201197.7) to the corresponding 7-ADCA derivatives.
- the invention also provides an isolated DNA fragment encoding a modified or selected enzyme as provided by the invention, said fragment further comprising regulatory regions for expression of said DNA in a eukaryotic host cell. It is for example within the skill of the artisan to provide a DNA fragment with regulatory regions functional in one or more host cells of various organisms, such as animal or plant or a yeast or fungus, origin. In a preferred embodiment, the invention provides a DNA fragment encoding a modified enzyme as provided by the invention comprising regulatory regions suitable for regulating expression in a host cell derived from a micro-organism such as a yeast or fungus.
- the invention also provides a host cell or host organism (or progeny thereof) having been provided with a modified or selected recombinant DNA fragment encoding a cytosol-localised enzyme as provided by the invention.
- a host organism is for example incorporating, for example as result of transformation of said host organism or ancestor of said host organism, a DNA fragment, optionally comprising regulatory regions or sequences, comprising a nucleotide sequence encoding a modified enzyme as provided by the invention.
- a host is preferably selected from the group consisting of plants and micro-organisms, preferably being a fungus selected from the group consisting of Penicillium chrysogenum, Aspergillus nidulans or A. niger and Cephalosporium acremonium.
- the invention also provides cultures of hosts cells or host organisms as provided by the invention.
- a culture comprises cells wherein a functional expandase capable of expanding penicillins with (non-naturally occurring) side chains to the corresponding 7-ADCA derivatives is predominantly found in the cytosol.
- the invention provides a culture for large scale fermentation wherein a modified expandase localised in the cytosol contributes to higher production levels of adipoyl-7-ADCA than in a comparable scale fermentation culture utilising wild-type expandase of comparable origin.
- the invention provides a host cell, and cultures thereof, having been provided by recombinant techniques with an expandase selected among others for its capacity or tendency to predominantly localise in the cytosol of a heterologous host, be it whether said expandase localises in a homologous context in a microbody or not.
- a host cell can be selected by providing a host cell with a DNA fragment encoding an expandase, and testing whether said expandase localises predominantly in the cytosol. In a preferred embodiment, testing for localisation of said enzyme is performed by electron microscopy, as explained in the experimental part of the description.
- the invention also provides a method for making a host cell or organism provided with a modified or selected DNA fragment encoding a modified or selected enzyme as provided by the invention comprising contacting cells under transforming conditions with a DNA fragment as provided by the invention and selecting for cells having obtained said DNA. Transformation of host cells, for example of P. chrysogenum or other fungi can, in general, be achieved by different means of DNA delivery, like PEG-Ca mediated protoplast uptake, electroporation or particle gun techniques, and selection of transformants.
- the invention also provides a method for expressing a DNA fragment encoding an expandase in a host cell, wherein said DNA fragment codes for an expandase causing the expandase to be produced and localised predominantly in the cytosol.
- a method comprises providing said DNA fragment with a modification in a nucleotide sequence encoding a carboxy-terminal amino acid sequence, preferably a tripeptide sequence such as SKA found with the expandase of Streptomyces clavuligerus.
- Such a method provided by the invention is preferably used with as host a Penicillium chrysogenum cell.
- the invention also provides a method for expanding the 5-membered ring of a beta-lactam compound to form a six-membered cephem compound, comprising the steps of growing a host capable of producing said beta-lactam compound under conditions conducive thereto and allowing said host to express an heterologous expandase derived by recombinant means ands capable of expanding the 5-membered ring of said beta-lactam compound from a DNA fragment encoding it, so as to form the said 6-membered cephem compound, characterised in that the said expandase is expressed from a DNA fragment which has been modified or selected to code for an expandase that is produced or at least is localised predominantly in the cytosol of the host cell.
- the invention provides a method for expanding the 5-membered ring of a beta-lactam compound by a modified expandase wherein said expandase is localised in the cytosol of a host cell due to a modification in the DNA fragment encoding it, whereby a microbody targeting signal has been modified, preferably wherein a targeting signal comprising a tripeptide amino acid sequence such as obtainable from expandase from Streptomyces clavuligerus has been modified.
- a method wherein said beta-lactam compound is selected from the group consisting of phenylacetyl-6-APA, phenoxyacetyl-6-APA, alpha-aminoadipoyl-6-APA, adipoyl-6-APA, glutaryl-6-APA or from suberyl-6-APA, pimelyl-6-APA, trans- ⁇ -hydromuconyl-6-APA or comparable compounds.
- the invention provides a method of making a cephem compound comprising the steps of expanding the 5-membered (penam) ring of said beta-lactam compound in a process or method according to the invention and recovering the cephem compound so formed.
- the invention provides a method a making a cephem compound in a host cell culture for large scale fermentation wherein the expandase that is predominantly localised in the is cytosol of said host cell contributes to higher production levels of adipoyl-7-ADCA than in a method of making a cephem compound via comparable scale fermentation culture utilising an expandase (in wild-type or modified form) of comparable origin that is predominantly localised in a microbody.
- FIG. 1 Schematic representation of plasmid pISEWA.
- FIG. 2 Schematic representation of plasmid ISEWA-SKD.
- FIG. 3 Adipoyl-7-ADCA productivities of a large number (about 80) of transformants derived from transformations with plasmids pISEWA (open bars) and pISEWA-SKD (solid bars).
- X-axis productivity class (arbitrary Units);
- Y-axis % of transformants per class.
- FIG. 4 EM photographs of a transformant expressing wild-type expandase (panel A) and a transformant expressing expandase with a non-targeting signal (SKA ⁇ SKD, panel B).
- the gold particles indicate the presence of expandase.
- N nucleus
- M mitochondrion
- P peroxisome (microbody).
- Transformation of host cells for example of P. chrysogenum or other fungi can, in general, be achieved by different means of DNA delivery, like PEG-Ca mediated protoplast uptake, electroporation or particle gun techniques, and selection of transformants.
- PEG-Ca mediated protoplast uptake like PEG-Ca mediated protoplast uptake, electroporation or particle gun techniques, and selection of transformants.
- Van den Hondel en Punt, Gene and Transfer and Vector Development for Filamentous Fungi in: Applied Molecular Genetics of Fungi (Peberdy, Laten, Ogden, Bennett, eds.), Cambridge University Press (1991). The application of dominant and non-dominant selection markers has been described (Van den Hondel, supra). Selection markers of both homologous ( P. chrysogenum derived) and heterologous (non- P. chrysogenum derived) origin have been described (Gouka et al., J. Biotechnol. 20 (19
- the ring-expansion reaction, mediated by the modified or selected expandase enzyme is introduced into and expressed in this way in P. chrysogenum, for instance in strain Wisconsin 54-1255 (deposited at ATCC under accession number 28089).
- Other strains of P. chrysogenum, including mutants of strain Wisconsin 54-1255, having an improved beta-lactam yield, are also suitable.
- the modified cefE gene is placed under the transcriptional and translational control of fungal gene control elements.
- Those elements can be obtained from cloned fungal genes like the P. chrysogenum IPNS or pcbC gene, the b-tubulin gene, the Aspergillus nidulans gpdA gene, or the Aspergillus niger glcA gene.
- the ⁇ -lactam intermediate adipoyl-7-ADCA is produced in P. chrysogenum transformants expressing expandase by adding adipic acid or a salt or an ester thereof to the medium. Suitable salts are for instance those of sodium or potassium.
- Adipoyl-7-ADCA is efficiently recovered from the medium through a simple solvent extraction, for instance, as follows:
- the broth is filtered and an organic solvent immiscible with water is added to the filtrate.
- the pH is adjusted in order to extract the cephalosporin from the aqueous layer.
- the pH range has to be lower than 4.5; preferably between 4 and 1, more preferably between 2 and 1. In this way the cephalosporin is separated from many other impurities present in the fermentation broth.
- a small volume of organic solvent is used, giving a more concentrated solution of the cephalosporin, so achieving reduction of the volumetric flow rates.
- a second possibility is whole broth extraction at a pH of 4 or lower.
- the broth is extracted between 4 and 1 with an organic solvent immiscible with water.
- Any solvent that does not interfere with the cephalosporin molecule can be used.
- Suitable solvents are, for instance, butyl acetate, ethyl acetate, methyl isobutyl ketone, alcohols like butanol etc.
- Preferably 1-butanol or isobutanol are used.
- cephalosporin is back extracted with water at a pH between 4 and 10, preferably between 6 and 9. Again the final volume can be reduced.
- the recovery can be carried out at temperatures between 0 and 50° C., and preferably at ambient temperatures.
- the aqueous cephalosporin solution thus obtained is treated with a suitable enzyme in order to remove the adipoyl side chain and obtain the desired 7-ADCA.
- an immobilised enzyme is used, in order to be able to use the enzyme repeatedly.
- the methodology for the preparation of such particles and the immobilisation of the enzymes have been described extensively in EP-A-0222462.
- the pH of the aqueous solution has a value of, for example pH 4 to pH 9. at which the degradation reaction of cephalosporin is minimised and the desired conversion with the enzyme is optimised.
- the enzyme is added to the aqueous cephalosporin solution while maintaining the pH at the appropriate level by, for instance, adding an inorganic base, such as a potassium hydroxide solution, or applying a cation exchange resin.
- an inorganic base such as a potassium hydroxide solution
- a cation exchange resin When the reaction is completed the immobilised enzyme is removed by filtration.
- Another possibility is the application of the immobilised enzyme in a fixed or fluidised bed column, or using the enzyme in solution and removing the products by membrane filtration. Subsequently, the reaction mixture is acidified in the presence of an organic solvent immiscible with water.
- Suitable enzymes are, for instance, derived from a Pseudomonas SY77 micro-organism having a mutation in one or more of the positions 62, 177, 178 and 179. Also enzymes from other Pseudomonas micro-organisms, preferably Pseudomonas SE83, optionally having a mutation in one or more of the positions corresponding to the 62, 177, 178 and 179 positions in Pseudomonas SY77, may be used.
- the layers are separated and the pH of the aqueous layer is adjusted between 2 and 5, more preferably between 3 and 4.
- the crystalline 7-ADCA is then filtered off.
- the deacylation can also be carried out chemically as known in the art, for instance, via the formation of an iminochloride side chain, by adding phosphorus pentachloride at a temperature of lower than 10° C. and subsequently isobutanol at ambient temperatures or lower.
- the overall approach entails i) identification of residues of expandase involved in targeting specificity, ii) selection of expandase proteins or construction of mutant expandase proteins, iii) subcloning of mutant or selected expandase genes in P. chrysogenum expression vectors and expression of the expandase in P. chrysogenum, iv) determination of the adipoyl-7-ADCA production versus production of ⁇ -D-aminoadipoyl-7-ADCA and adipoyl-6-APA.
- a person skilled in the art may also use the modified expandase enzyme in processes disclosed in WO95/04148 and WO95/04149 which use 3′-carboxymethylthiopropionic acid and 3,3′-thiodipropionic acid as side chains, yielding 2-(carboxyethylthio)acetyl-7-ADCA and a mixture of 3-(carboxymethylthio)propionyl-7-ADCA and 2-(carboxyethylthio)acetyl-7-ADCA respectively.
- Sources that can be used as template in PCR reactions include chromosomal DNA preparations from publicly available Streptomyces clavuligerus strains (such as ATCC 27064), or expression cassettes such pZEx (described in PCT/EP97/03879) and pISEWA (described in EP02812P).
- the expandase expression cassette pISEWA FIG. 1 ) contains the wild type Streptomyces clavuligerus expandase gene including the IPNS promoter and AT terminator.
- the sequence of the C-terminus of CefE is mutated from SKA to SKD.
- PCR reaction is performed, using primers 1 and 2 (see table I). PCR is performed with a proof-reading polymerase. After a denaturation step (2 min 98° C.), part of the cefE gene is amplified in 25 cycli (1.15 min 94° C., 45 sec 55° C., 1 min 72° C.) followed by an extension step (8 min, 72° C.).
- chrysogenum Wisconsin 54-1255 (ATC 28089) by co-transformation with GBGLA28 (EP635574), which enables P. chrysogenum transformants to grow on selection medium containing acetamide as sole nitrogen source. More preferably, a strain is utilised that has a more pronounced capacity to produce penicillins. Examples are strains such as CBS 455.95.
- Transformants are purified by repeated cultivation on selective medium. Single stable colonies are used for further screening on the presence of the expandase gene by bioassay. Transformants are grown on agar medium. E. coli ESS2231 is used as indicator bacterium in an agar overlay, that also contains Bacto penase to be able to discriminate between penicillin and cephalosporin production according to methods well known in the art and described for example in Guttiérez et al., Mol. Gen. Genet. 225 (1991), 56-64. The presence of the cefE gene in the transformants is confirmed by PCR as described for example in WO 95/04149 on chromosomal DNA, using primers 1 and 2 (Table).
- Expandase-positive transformants are selected for further screening on the capacity to produce cephalosporins as described for example in WO 95/04149. Transformants are used to inoculate shake flasks with liquid medium as described for example in WO 95/04149.
- Transformants are inoculated at 2*10 6 conidia/ml into a seed medium consisting of for example (g/l): glucose, 30: (NH4) 2 SO 4 , 10: KH 2 PO 4 , 10, trace element solution I (MgSO 4 .7H 2 O, 25; FeSO 4 .7H 2 O, 10; CuSO 4 .5H 2 O, 0.5; ZnSO 4 .7H 2 O, 2; Na 2 SO 4 , 50; MnSO 4 .H 2 O, 2; CaCl 2 .2H 2 O, 5) 10 (ml/l) (pH before sterilisation 6.5).
- g/l glucose, 30: (NH4) 2 SO 4 , 10: KH 2 PO 4 , 10, trace element solution I (MgSO 4 .7H 2 O, 25; FeSO 4 .7H 2 O, 10; CuSO 4 .5H 2 O, 0.5; ZnSO 4 .7H 2 O, 2; Na 2 SO 4 , 50
- the seed medium is incubated for 48-72 hours at 25-30° C. and subsequently used to inoculate 10-20 volumes of a production medium containing (g/l) lactose, 80; CaSO 4 , 4; urea, 3; MgSO 4 .7H 2 O, 2; KH 2 PO 4 , 7, NaCl, 0.5; (NH 4 ) 2 SO 4 , 6; FeSO 4 .7H 2 O, 0.1; adipic acid, 2 to 5; trace element solution II (CuSO 4 .
- a production medium containing (g/l) lactose, 80; CaSO 4 , 4; urea, 3; MgSO 4 .7H 2 O, 2; KH 2 PO 4 , 7, NaCl, 0.5; (NH 4 ) 2 SO 4 , 6; FeSO 4 .7H 2 O, 0.1; adipic acid, 2 to 5; trace element solution II (CuSO 4 .
- FIG. 4 shows expandase accumulating predominantly in the cytosol or in the microbody.
- strains are selected for further analysis.
- a mutant expandase transformant is chosen that produces 10% more adipoyl-7-ADCA than the transformant that is selected from the transformation with the wild-type expandase gene.
- strains are grown in a 10 L fermenter the amount of adipoyl-7-ADCA in the culture with the expandase localised predominantly in the cytosol is higher than in the fermentation with expandase localised predominantly in the microbody.
- expandase predominantly localised in the cytosol is apparently stable enough to maintain stable productivity and improved yield in a long-term or large-scale fermentation.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Cephalosporin Compounds (AREA)
- Compounds Of Unknown Constitution (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides improved in vivo production of acylated cephalosporins with higher yield using expandase which is predominantly localised in the cytosol of the host cell.
Description
- This application is a divisional of U.S. Ser. No. 09/700,080 filed in the U.S. Dec. 1, 2000, which is a 371 of PCT/EP99/03455 filed internationally May 19, 1999, which claims priority to European application no. 98201655.2 filed May 19, 1998. The contents of these applications are incorporated herein by reference.
- The present invention lies in the field of recombinant DNA techniques. More in particular, the invention is in the field of the production of cephalosporins using genetically modified host organisms, host organisms so modified, as well as DNA for use therein. The invention further pertains to modified enzymes expressed from recombinant DNA in said host organisms.
- β-Lactam antibiotics constitute the most important group of antibiotic compounds, with a long history of clinical use. Among this group, the prominent ones are the penicillins and cephalosporins. These compounds are naturally produced by the filamentous fungi such as Penicillium chrysogenum and Acremonium chrysogenum, respectively.
- As a result of classical strain improvement techniques, the production levels of the antibiotics in P. chrysogenum and A. chrysogenum have increased dramatically over the past decades. With the increasing knowledge of the biosynthetic pathways leading to penicillins and cephalosporins, and the advent of recombinant DNA technology, new tools for the improvement of production strains and for the in vivo derivatisation of the compounds have become available.
- Most enzymes involved in β-lactam biosynthesis have been identified and their corresponding genes been cloned, as can be found in Ingolia and Queener, Med. Res. Rev. 9 (1989), 245-264 (biosynthesis route and enzymes), and Aharonowitz, Cohen, and Martin, Ann. Rev. Microbiol. 46 (1992), 461-495 (gene cloning).
- The first two steps in the biosynthesis of penicillin in P. chrysogenum are the condensation of the three amino acids L-5-amino-5-carboxypentanoic acid (L-α-aminoadipic acid) (A), L-cysteine (C) and L-valine (V) into the tripeptide LLD-ACV, followed by cyclisation of this tripeptide to form isopenicillin N. This compound contains the typical β-lactam structure.
- The third step involves the exchange of the hydrophilic side chain of L-5-amino-5-carboxypentanoic acid by a hydrophobic side chain by the action of the enzyme acyltransferase. The enzymatic exchange reaction mediated by acyltransferase takes place inside a cellular organelle, the microbody, as has been described in EP-A-0 448 180.
- Cephalosporins are much more expensive than penicillins. One reason is that some cephalosporins (e.g. cephalexin) are made from penicillins by a number of chemical conversions. Another reason is that, so far only cephalosporins with a D-5-amino-5-carboxypentanoyl side chain could be subjected to fermentative conversion. Cephalosporin C, by far the most important starting material in this respect, is very soluble in water at any pH, thus implying lengthy and costly isolation processes using cumbersome and expensive column technology. Cephalosporin C obtained in this way has to be converted into therapeutically used cephalosporins by a number of chemical and enzymatic conversions.
- The methods currently favoured in industry to prepare the intermediate 7-ADCA involve complex chemical steps leading to the expansion and derivatisation of penicillin G. One of the necessary chemical steps to produce 7-ADCA involves the expansion of the 5-membered penicillin ring structure to a 6-membered cephalosporin ring structure (see for instance U.S. Pat. No. 4,003,894). This complex chemical processing is both expensive and noxious to the environment.
- Consequently, there is a great desire to replace such chemical processes with enzymatic reactions such as enzymatic catalysis, preferably in an in vivo process. A key to the replacement of the chemical expansion process by enzymatic and in vivo processes is the central enzyme in the cephalosporin biosynthetic pathway, desacetoxycephalosporin C synthetase (DAOCS), also called “expandase”.
- The expandase enzyme from the bacterium Streptomyces clavuligerus was found to carry out, in some cases, penicillin ring expansions. When introduced into P. chtysogenum, it can convert the penicillin ring structure into the cephalosporin ring structure in vivo, as described in Cantwell et al., Proc. R. Soc. Lond. B. 248 (1992), 283-289. The expandase enzyme has been well characterised (EP-A-0 366 354) both biochemically and functionally, as has its corresponding gene, cefE. Both physical maps of the cefE gene (EP-A-0 341 892), DNA sequence and transformation studies in P. chrysogenum with cefE have been described.
- Another source for a ring expansion enzyme is for example the bacterium Nocardia lactamdurans (formerly Streptomyces lactamdurans) and the fungus Acremonium chrysogenum (formerly Cephalosporum acremonium). The expandase from Cephalosporium is a bifunctional enzyme having expandase (ring-expansion) as well as 3-hydroxylating activity. Both the biochemical properties of the enzyme and the DNA sequence of the gene have been described (Cortés et al., J. Gen. Microbiol. 133 (1987). 3165-3174; and Coque et al., Mol. Gen. Genet. 236 (1993), 453-458, respectively).
- Since the expandase catalyses the expansion of the 5-membered thiazolidine ring of penicillin N to the 6-membered dihydrothiazine ring of DAOC this enzyme would be a logical candidate to replace the ring expansion steps of the chemical process. Unfortunately, the enzyme works on the penicillin N intermediate of the cephalosporin biosynthetic pathway, but not, or relatively inefficiently, on the readily available inexpensive penicillins as produced by P. chrysogenum, like penicillin V or penicillin G. Penicillin N is commercially not available and even when expanded, its D-5-amino-5-carboxypentanoyl side chain cannot be easily removed by penicillin acylases.
- It has recently been found that the expandase enzyme is capable of expanding penicillins with non-naturally occurring side chains to the corresponding 7-ADCA derivatives. These side chains include adipate (5-carboxyl-pentanoic acid) and various other compounds. This feature of the expandase has been exploited in a process for the in vivo production of adipoyl-7-ADCA in Penicillium chrysogenum as disclosed in EP-A-0 532 341. Penicillium chrysogenum strains are transformed with the Streptomyces clavuligerus expandase to produce adipoyl-6-aminopenicillanic acid (adipoyl-6-APA) when these transformants are fed adipic acid. Subsequently, adipoyl-4-APA is “expanded” to adipoyl-7-ADCA Production of various other 7-acylated cephalosporins have been disclosed in WO 95/04148 and WO95/04149. In WO95/04148 and WO95/04149 it has been disclosed that addition of 3′-carboxymethyl thiopropionic acid and 3,3′-thiodipropionic acid to the medium yield penicillins that are substrates for the expandase, leading to the synthesis of 2-(carboxyethylthio)acetyl-7-ADCA and 3-(carboxymethylthio)propionyl-7-ADCA, respectively.
- Even though expandase displays an activity on penicillins with different side-chains, the expansion of these novel penicillins occurs less efficient as compared to the expansion of the natural substrate penicillin N. This notion has been the basis for modifying the expandase, aiming to alter the activity on adipoyl-penicillanic acid. Application of mutagenised expandase has been disclosed in WO98/02551.
- The final step in the synthesis of penicillins, the exchange of the α-amino adipoyl side chain of IPN by an alternative side-chain, occurs in the microbody, where the acyltransferase is localised. For optimal expansion of the penicillin, the preferred localisation of expandase is therefore believed to be in the microbody. This is based not only on the fact that the substrate for expandase is believed to be produced in the microbody, but also on the expectation that in the microbody, expandase should be better protected from degradation by proteases, which is a known drawback from the use of P. chrysogenum for the production of enzymes (see for example. Theilgaard et al., 1997; Purification and characterisation of δ-(L-α-aminoadipyl)-L-cysteinyl-D-valine synthetase from Penicillium chrysogenum; Biochem. J. 327, 185-191).
- Modification of cellular localisation of enzymes involved in beta-lactam antibiotic production has been suggested in
EP 0 448 180. For example on page 7, penultimate paragraph, it is suggested to localise epimerase and preferably subsequent cephalosporin biosynthetic enzymes like expandase/hydroxylase from Acremonium chrysogenum or expandase from Streptomyces spec. in the microbodies, to improve the efficiency of the production of cephalosporin or intermediates in Penicillium chrysogenum. It was also shown therein, that removal of the microbody targeting signal of acyltransferase, an enzyme involved in the removal of the side chain of acyl-6-APA destroys penicillin production altogether. This strongly suggests that enzymes involved in beta-lactam production should be localised in the microbodies, if not for reasons of substrate localisation then at least for reasons of stability. - The invention provides DNA, heterologous host cells capable of transcribing, translating or expressing said DNA and methods employing such host cells and cultures thereof for an improved in vivo production of acylated-cephalosporins with higher yield. According to the invention, a host cell is provided comprising an enzyme having expandase activity which is predominantly localised in the cytosol (as opposed to localised mainly in or with the peroxisomes or microbodies) of the host cell.
- In a preferred embodiment, the invention provides an isolated DNA fragment coding for a modified expandase, which expandase, after expression of said DNA fragment in a Penicillium chrysogenum host is found predominantly in the cytosol of said Penicillium host. Such a DNA fragment coding for a modified expandase can for example be obtained by modifying DNA encoding an expandase as found with Nocardia lactamdurans (formerly Streptomyces lactamdurans) and the fungus Acremonium chrysogenum, and other related (i.e. cephalosporin/cephamycin producing) micro-organisms.
- The invention provides an isolated DNA fragment encoding a modified expandase that preferably localises predominantly in the cytosol instead of in the microbody of the heterologous host. In a preferred embodiment of the invention such a DNA fragment is obtainable from Streptomyces clavuigerus DNA encoding an expandase, and modified to obtain an DNA fragment encoding an expandase that, when expressed in a Penicillium chrysogenum host, is found predominantly in the cytosol of said Penicillium host.
- Such a modification comprises cloning by recombinant techniques of a nucleotide sequence encoding said expandase, but preferably comprises modifying by recombinant techniques of a sequence coding for a microbody or peroxisome targeting signal in said expandase. Modification can comprise a single or multiple mutation (such as a deletion, insertion, or reversion) of a nucleic acid sequence encoding an expandase, preferably of a sequence encoding a carboxy-terminal amino acid sequence of said expandase.
- Amongst the eukaryotic organisms, targeting of proteins to peroxisomes or microbodies has been relatively well studied in non-filamentous yeast. In these organisms, proteins destined for the peroxisome or microbody generally contain a C-terminal targeting sequence, the amino acid sequence of which is generally S (serine) K (lysine) L (leucine), or more generally S/C/A/-K/H/R-L. Such a targeting sequence, at least in a homologous context, provides the necessary signal for a protein such as an enzyme to be routed to the microbody, where it finds its final localisation.
- For filamentous fungi, such as for Penicillium chrysogenum, targeting of proteins to peroxisomes or microbodies has been relatively little studied, and only very little is known about targeting of proteins in a heterologous context, when an organism such as a yeast or fungus is used as a host cell to translate or even express an heterologous protein. This is especially the case when a heterologous protein is derived from a prokarotic organism such as a bacterium, since bacteria do not have organelles like peroxisomes or microbodies, and thus do not utilise the perixosomal targeting signal in a homologous context. It is generally believed, that, in order for a heterologously expressed protein or enzyme to function well in its host, the respective targeting signals should at least resemble those used by the host in order to find comparative subcellular localisation.
- Expandase from the bacterium S. clavuligerus generally comprises a C-terminal sequence, SKA (Serine-Lysine-Alanine), that seemingly functions as a peroxisomal targeting sequence when said protein is expressed in a heterologous context in a eukaryotic host. For example, Penicillium chrysogenum strains transformed with the S. clavuligerus expandase (as for example discussed in EP 0532 341 A1) show localisation of the respective expandase within the peroxisome.
- It has been found, that the wild-type expandase from Streptomyces clavuligerus, when produced recombinantly in Penicillium chrysogenum, predominantly accumulates in the microbodies. Said sequence of three amino acids, Ser-Lys-Ala, apparently serves as a microbody targeting signal in Penicillium chrysogenum, although it is somewhat divergent from the consensus sequences for microbody targeting signals in yeast.
- When peroxisomal targeting signals, as well as signals that should prevent localisation within peroxisomes, were engineered onto the carboxy terminus of the S. clavuligenus expandase, or for that matter onto the carboxy terminus of Cephalosporium acremonium expandase/hydrolase, this tendency to localise within the peroxisome did not alter, regardless of the different carboxy terminal amino acid sequences that were added (Verburg et al., P. 35, page 108. In: 7th Int. Symp. Gen. Industr. Microorg. Jun. 26-Jul. 1, 1994, Montreal Canada).
- Apparently, the enzyme carries an effective targeting signal, causing it to localise, at least predominantly, within the microbody of the heterologous Penicillium chrysogenum host cell. However, in one embodiment of the invention, the invention now provides an effective modification of an expandase, altering the tendency to localise within the microbody and leading to a predominant localisation of said expandase in the cytosol of a host.
- The tendency to localise at the microbody or peroxisome is governed by N-terminal or C-terminal peroxisome targeting signals (PTSs), modification of said PTS (be it N-terminally or C-terminally) substantially preventing such localisation in the microbodies. An example of such a modification is a modification in a nucleotide sequence coding for a carboxy terminal tripeptide X1-X2-X3, for instance wherein X1 is one amino acid residue selected from the group consisting of Serine, Cysteine and Alanine, X2 is one amino acid residue selected from the group consisting of Lysine, Histidine and Arginine and X3 is Leucine or Alanine. Such tripeptide sequences are also called SKL-like peptides, and the essential sequence of the signal may be a small amino acid at the first, a basic residue at the penultimate and a large non-polar residue at the C-terminal position. The invention provides a DNA fragment encoding an expandase wherein said fragment encoding an SKL-like tripeptide has been modified or selected so as to substantially prevent the expandase to be localised in the microbodies and hence to cause the expandase to be localised predominantly in the cytosol of the host cell upon expression in said heterologous cell.
- In a preferred embodiment of the invention, said DNA fragment is obtained from DNA encoding S. clavuligerus expandase initially comprising a nucleotide sequence coding for a carboxy-terminal tripeptide Serine-Lysine-Alanine which is modified so as to cause the expandase to be localised predominantly in the cytosol of the host cell upon expression therein. Such a modification is particularly exemplified by a DNA fragment of the invention wherein a nucleotide sequence coding for Serine-Lysine-Alanine has been modified into a sequence coding for Serine-Lysine-Aspartic acid, or where the amino acid at the ultimate position has been deleted or replaced by for example another non-hydrophobic residue.
- Yet another modification comprises Serine-Serine-Aspartic acid, or where the amino acid at the penultimate position has been deleted or replaced by a non-positively charged residue.
- Yet other modifications comprise deletions of modifications in the first position of the tripeptide that alter the routing of a thus modified protein in a heterologous host and cause it to be predominantly localised in the cytosol of the host cell used.
- Yet other modifications comprise deletions or modifications of any of a combination of these three amino acids or codons encoding these carboxy-terminal amino acids.
- On the one hand, it has surprisingly been found that deliberate modification, using conventional recombinant DNA techniques, of the tripeptidic sequence SKA (or functional variants thereof as explained above) which apparently functions as a microbody targeting signal, causes the heterologously expressed enzyme to accumulate predominantly in the cytosol of the host cell, rather than in the microbodies.
- However, on the other hand, variations of proteins in nature are abound, and it is now possible to find micro-organisms that comprise an enzyme such as an expandase, that, when said enzyme would be expressed in a heterologous host, would be predominantly localised in the cytosol of said host. Especially proteins or enzymes that have a C-terminal sequence deviant from the above identified targeting sequence are likely candidates to be tested for cytosolic localisation and selected for further use in improving yields of cephalosporin production. In a particular embodiment, the invention provides a nucleotide sequence coding for an expandase which upon expression in a Penicillium chrysogenum host cell is localised predominantly in the cytosol, thereby improving cephalosporin yield over those of a host cell expressing a comparable enzyme within or at the microbodies.
- Quite contrary to expectation, an enzyme as provided by the invention appears to be stable outside the microbodies. An expandase, as provided by the invention, is still capable of expanding penicillins, even those with non-naturally occurring side chains (see for example EP 97201196.9 and EP 97201197.7) to the corresponding 7-ADCA derivatives.
- The invention also provides an isolated DNA fragment encoding a modified or selected enzyme as provided by the invention, said fragment further comprising regulatory regions for expression of said DNA in a eukaryotic host cell. It is for example within the skill of the artisan to provide a DNA fragment with regulatory regions functional in one or more host cells of various organisms, such as animal or plant or a yeast or fungus, origin. In a preferred embodiment, the invention provides a DNA fragment encoding a modified enzyme as provided by the invention comprising regulatory regions suitable for regulating expression in a host cell derived from a micro-organism such as a yeast or fungus.
- Surprisingly, it has been found that in a host cell (e.g. Penicillium chrysogenum) transformed with a expandase accumulating mainly in the cytosol as opposed to with in the microbodies the production of cephalosporin antibiotics (e.g. adipyl-7-ADCA), is increased, rather than decreased. This is even true when compared to a host cell which has been transformed with DNA coding for an in all other aspects comparable but microbody-localised expandase.
- The invention also provides a host cell or host organism (or progeny thereof) having been provided with a modified or selected recombinant DNA fragment encoding a cytosol-localised enzyme as provided by the invention. Such a host organism is for example incorporating, for example as result of transformation of said host organism or ancestor of said host organism, a DNA fragment, optionally comprising regulatory regions or sequences, comprising a nucleotide sequence encoding a modified enzyme as provided by the invention. Such a host is preferably selected from the group consisting of plants and micro-organisms, preferably being a fungus selected from the group consisting of Penicillium chrysogenum, Aspergillus nidulans or A. niger and Cephalosporium acremonium.
- The invention also provides cultures of hosts cells or host organisms as provided by the invention. Such a culture comprises cells wherein a functional expandase capable of expanding penicillins with (non-naturally occurring) side chains to the corresponding 7-ADCA derivatives is predominantly found in the cytosol. In a preferred embodiment, the invention provides a culture for large scale fermentation wherein a modified expandase localised in the cytosol contributes to higher production levels of adipoyl-7-ADCA than in a comparable scale fermentation culture utilising wild-type expandase of comparable origin.
- In yet another embodiment, the invention provides a host cell, and cultures thereof, having been provided by recombinant techniques with an expandase selected among others for its capacity or tendency to predominantly localise in the cytosol of a heterologous host, be it whether said expandase localises in a homologous context in a microbody or not. Such a host cell can be selected by providing a host cell with a DNA fragment encoding an expandase, and testing whether said expandase localises predominantly in the cytosol. In a preferred embodiment, testing for localisation of said enzyme is performed by electron microscopy, as explained in the experimental part of the description.
- The invention also provides a method for making a host cell or organism provided with a modified or selected DNA fragment encoding a modified or selected enzyme as provided by the invention comprising contacting cells under transforming conditions with a DNA fragment as provided by the invention and selecting for cells having obtained said DNA. Transformation of host cells, for example of P. chrysogenum or other fungi can, in general, be achieved by different means of DNA delivery, like PEG-Ca mediated protoplast uptake, electroporation or particle gun techniques, and selection of transformants. See for example Van den Hondel en Punt, Gene and Transfer and Vector Development for Filamentous Fungi, in: Applied Molecular Genetics of Fungi (Peberdy, Laten, Ogden, Bennett, eds.), Cambridge University Press (1991). The application of dominant and non-dominant selection markers has been described (Van den Hondel, supra). Selection markers of both homologous (P. chrysogenum derived) and heterologous (non-P. chrysogenum derived) origin have been described (Gouka et al., J. Biotechnol. 20 (1991) 189-200).
- The application of the different transformant selection markers, homologous or heterologous, in the presence or absence of vector sequences, physically linked or not to the non-selectable DNA, in the selection of transformants are well known in the art.
- The invention also provides a method for expressing a DNA fragment encoding an expandase in a host cell, wherein said DNA fragment codes for an expandase causing the expandase to be produced and localised predominantly in the cytosol. In a preferred embodiment of the invention such a method comprises providing said DNA fragment with a modification in a nucleotide sequence encoding a carboxy-terminal amino acid sequence, preferably a tripeptide sequence such as SKA found with the expandase of Streptomyces clavuligerus. Such a method provided by the invention is preferably used with as host a Penicillium chrysogenum cell.
- The invention also provides a method for expanding the 5-membered ring of a beta-lactam compound to form a six-membered cephem compound, comprising the steps of growing a host capable of producing said beta-lactam compound under conditions conducive thereto and allowing said host to express an heterologous expandase derived by recombinant means ands capable of expanding the 5-membered ring of said beta-lactam compound from a DNA fragment encoding it, so as to form the said 6-membered cephem compound, characterised in that the said expandase is expressed from a DNA fragment which has been modified or selected to code for an expandase that is produced or at least is localised predominantly in the cytosol of the host cell.
- In a preferred embodiment the invention provides a method for expanding the 5-membered ring of a beta-lactam compound by a modified expandase wherein said expandase is localised in the cytosol of a host cell due to a modification in the DNA fragment encoding it, whereby a microbody targeting signal has been modified, preferably wherein a targeting signal comprising a tripeptide amino acid sequence such as obtainable from expandase from Streptomyces clavuligerus has been modified.
- In the experimental part of this description an example of a method as provided by the invention is given wherein said host cell is Penicillium chrysogenum.
- In a preferred embodiment of the invention a method is provided wherein said beta-lactam compound is selected from the group consisting of phenylacetyl-6-APA, phenoxyacetyl-6-APA, alpha-aminoadipoyl-6-APA, adipoyl-6-APA, glutaryl-6-APA or from suberyl-6-APA, pimelyl-6-APA, trans-β-hydromuconyl-6-APA or comparable compounds. Furthermore, the invention provides a method of making a cephem compound comprising the steps of expanding the 5-membered (penam) ring of said beta-lactam compound in a process or method according to the invention and recovering the cephem compound so formed. In a preferred embodiment, the invention provides a method a making a cephem compound in a host cell culture for large scale fermentation wherein the expandase that is predominantly localised in the is cytosol of said host cell contributes to higher production levels of adipoyl-7-ADCA than in a method of making a cephem compound via comparable scale fermentation culture utilising an expandase (in wild-type or modified form) of comparable origin that is predominantly localised in a microbody.
- The invention is illustrated in more detail in the following 4 Figures.
-
FIG. 1 . Schematic representation of plasmid pISEWA. -
FIG. 2 . Schematic representation of plasmid ISEWA-SKD. -
FIG. 3 . Adipoyl-7-ADCA productivities of a large number (about 80) of transformants derived from transformations with plasmids pISEWA (open bars) and pISEWA-SKD (solid bars). X-axis: productivity class (arbitrary Units); Y-axis: % of transformants per class. -
FIG. 4 . EM photographs of a transformant expressing wild-type expandase (panel A) and a transformant expressing expandase with a non-targeting signal (SKA→SKD, panel B). The gold particles indicate the presence of expandase. N: nucleus, M: mitochondrion, P: peroxisome (microbody). - Transformation of host cells, for example of P. chrysogenum or other fungi can, in general, be achieved by different means of DNA delivery, like PEG-Ca mediated protoplast uptake, electroporation or particle gun techniques, and selection of transformants. See for example Van den Hondel en Punt, Gene and Transfer and Vector Development for Filamentous Fungi, in: Applied Molecular Genetics of Fungi (Peberdy, Laten, Ogden, Bennett, eds.), Cambridge University Press (1991). The application of dominant and non-dominant selection markers has been described (Van den Hondel, supra). Selection markers of both homologous (P. chrysogenum derived) and heterologous (non-P. chrysogenum derived) origin have been described (Gouka et al., J. Biotechnol. 20 (1991) 189-200).
- The application of the different transformant selection markers, homologous or heterologous, in the presence or absence of vector sequences, physically linked or not to the non-selectable DNA, in the selection of transformants are well known.
- The ring-expansion reaction, mediated by the modified or selected expandase enzyme is introduced into and expressed in this way in P. chrysogenum, for instance in strain Wisconsin 54-1255 (deposited at ATCC under accession number 28089). Other strains of P. chrysogenum, including mutants of strain Wisconsin 54-1255, having an improved beta-lactam yield, are also suitable.
- Furthermore, the modified cefE gene is placed under the transcriptional and translational control of fungal gene control elements. Those elements can be obtained from cloned fungal genes like the P. chrysogenum IPNS or pcbC gene, the b-tubulin gene, the Aspergillus nidulans gpdA gene, or the Aspergillus niger glcA gene.
- In accordance with the present invention the β-lactam intermediate adipoyl-7-ADCA is produced in P. chrysogenum transformants expressing expandase by adding adipic acid or a salt or an ester thereof to the medium. Suitable salts are for instance those of sodium or potassium. Adipoyl-7-ADCA is efficiently recovered from the medium through a simple solvent extraction, for instance, as follows:
- The broth is filtered and an organic solvent immiscible with water is added to the filtrate. The pH is adjusted in order to extract the cephalosporin from the aqueous layer. The pH range has to be lower than 4.5; preferably between 4 and 1, more preferably between 2 and 1. In this way the cephalosporin is separated from many other impurities present in the fermentation broth. Preferably a small volume of organic solvent is used, giving a more concentrated solution of the cephalosporin, so achieving reduction of the volumetric flow rates. A second possibility is whole broth extraction at a pH of 4 or lower. Preferably the broth is extracted between 4 and 1 with an organic solvent immiscible with water.
- Any solvent that does not interfere with the cephalosporin molecule can be used. Suitable solvents are, for instance, butyl acetate, ethyl acetate, methyl isobutyl ketone, alcohols like butanol etc. Preferably 1-butanol or isobutanol are used.
- Hereafter the cephalosporin is back extracted with water at a pH between 4 and 10, preferably between 6 and 9. Again the final volume can be reduced. The recovery can be carried out at temperatures between 0 and 50° C., and preferably at ambient temperatures.
- The aqueous cephalosporin solution thus obtained is treated with a suitable enzyme in order to remove the adipoyl side chain and obtain the desired 7-ADCA.
- Preferably, an immobilised enzyme is used, in order to be able to use the enzyme repeatedly. The methodology for the preparation of such particles and the immobilisation of the enzymes have been described extensively in EP-A-0222462. The pH of the aqueous solution has a value of, for example pH 4 to pH 9. at which the degradation reaction of cephalosporin is minimised and the desired conversion with the enzyme is optimised. Thus, the enzyme is added to the aqueous cephalosporin solution while maintaining the pH at the appropriate level by, for instance, adding an inorganic base, such as a potassium hydroxide solution, or applying a cation exchange resin. When the reaction is completed the immobilised enzyme is removed by filtration. Another possibility is the application of the immobilised enzyme in a fixed or fluidised bed column, or using the enzyme in solution and removing the products by membrane filtration. Subsequently, the reaction mixture is acidified in the presence of an organic solvent immiscible with water.
- Suitable enzymes are, for instance, derived from a Pseudomonas SY77 micro-organism having a mutation in one or more of the positions 62, 177, 178 and 179. Also enzymes from other Pseudomonas micro-organisms, preferably Pseudomonas SE83, optionally having a mutation in one or more of the positions corresponding to the 62, 177, 178 and 179 positions in Pseudomonas SY77, may be used.
- After adjusting the pH to about 0.1 to 1.5, the layers are separated and the pH of the aqueous layer is adjusted between 2 and 5, more preferably between 3 and 4. The crystalline 7-ADCA is then filtered off.
- The deacylation can also be carried out chemically as known in the art, for instance, via the formation of an iminochloride side chain, by adding phosphorus pentachloride at a temperature of lower than 10° C. and subsequently isobutanol at ambient temperatures or lower.
- The following examples are offered by way of illustration and not by way of limitation. The overall approach entails i) identification of residues of expandase involved in targeting specificity, ii) selection of expandase proteins or construction of mutant expandase proteins, iii) subcloning of mutant or selected expandase genes in P. chrysogenum expression vectors and expression of the expandase in P. chrysogenum, iv) determination of the adipoyl-7-ADCA production versus production of α-D-aminoadipoyl-7-ADCA and adipoyl-6-APA.
- In a similar way as has been described for the adipoyl side chain a person skilled in the art may also use the modified expandase enzyme in processes disclosed in WO95/04148 and WO95/04149 which use 3′-carboxymethylthiopropionic acid and 3,3′-thiodipropionic acid as side chains, yielding 2-(carboxyethylthio)acetyl-7-ADCA and a mixture of 3-(carboxymethylthio)propionyl-7-ADCA and 2-(carboxyethylthio)acetyl-7-ADCA respectively.
- Techniques involved in the genetic manipulation of the expandase gene are well described. Sources that can be used as template in PCR reactions include chromosomal DNA preparations from publicly available Streptomyces clavuligerus strains (such as ATCC 27064), or expression cassettes such pZEx (described in PCT/EP97/03879) and pISEWA (described in EP02812P). The expandase expression cassette pISEWA (
FIG. 1 ) contains the wild type Streptomyces clavuligerus expandase gene including the IPNS promoter and AT terminator. In order to disrupt the peroxisomal targeting of expandase, the sequence of the C-terminus of CefE is mutated from SKA to SKD. To that end, with pISEWA as a template, a PCR reaction is performed, using primers 1 and 2 (see table I). PCR is performed with a proof-reading polymerase. After a denaturation step (2 min 98° C.), part of the cefE gene is amplified in 25 cycli (1.15 min 94° C., 45 sec 55° C., 1 min 72° C.) followed by an extension step (8 min, 72° C.). The product of this reaction runs from the StuI site in cefE (about 450 bp from the start of translation; see Kovacevic et al.: Cloning, characterisation, and expression in Escherichia coli of the Streptomyces clavuligerus gene encoding desacetoxycephalosporin C synthetase, J. Bacteriol., 171, 754-760, 1989) to an NsiI site downstream from the stop codon. After verification of the sequence by nucleotide sequencing, the StuI-NsiI fragment is used to exchange the ‘wild-type’ cefE fragment in pISEWA. Thus, plasmid pISEWA-SKD is generated (FIG. 2 ).TABLE I Primers used in the construction of mutant expandase. The StuI site in primer 1, and the NsiI site in primer 2, are underlined. Primer Sequence (5′->3′) 1 GAGGCCTTCCTCGACTGCGAGCCG 2 CAAAGATGCATATGCTCGTCATGAAGAGCCT ACTAGTCCTTGGATGTGCGGCG - Techniques involved in the transfer of DNA to protoplasts of P. chrysogenum are well known in the art and described in many references, including Finkelstein and Ball (eds.), Biotechnology of filamentous fungi, technology and products, Butterworth-Heinemann (1992); Bennett and Lasure (eds.) More Gene Manipulations in fungi, Academic Press (1991); Turner, in: Pühler (ed), Biotechnology, second completely revised edition, VHC (1992). The Ca-PEG mediated protoplast transformation is used as described in EP635574. The constructs pISEWA and pISEWA-SKD are thus introduced into P. chrysogenum Wisconsin 54-1255 (ATC 28089) by co-transformation with GBGLA28 (EP635574), which enables P. chrysogenum transformants to grow on selection medium containing acetamide as sole nitrogen source. More preferably, a strain is utilised that has a more pronounced capacity to produce penicillins. Examples are strains such as CBS 455.95.
- Transformants are purified by repeated cultivation on selective medium. Single stable colonies are used for further screening on the presence of the expandase gene by bioassay. Transformants are grown on agar medium. E. coli ESS2231 is used as indicator bacterium in an agar overlay, that also contains Bacto penase to be able to discriminate between penicillin and cephalosporin production according to methods well known in the art and described for example in Guttiérez et al., Mol. Gen. Genet. 225 (1991), 56-64. The presence of the cefE gene in the transformants is confirmed by PCR as described for example in WO 95/04149 on chromosomal DNA, using primers 1 and 2 (Table). Expandase-positive transformants are selected for further screening on the capacity to produce cephalosporins as described for example in WO 95/04149. Transformants are used to inoculate shake flasks with liquid medium as described for example in WO 95/04149. Transformants are inoculated at 2*106 conidia/ml into a seed medium consisting of for example (g/l): glucose, 30: (NH4)2SO4, 10: KH2PO4, 10, trace element solution I (MgSO4.7H2O, 25; FeSO4.7H2O, 10; CuSO4.5H2O, 0.5; ZnSO4.7H2O, 2; Na2SO4, 50; MnSO4.H2O, 2; CaCl2.2H2O, 5) 10 (ml/l) (pH before sterilisation 6.5).
- The seed medium is incubated for 48-72 hours at 25-30° C. and subsequently used to inoculate 10-20 volumes of a production medium containing (g/l) lactose, 80; CaSO4, 4; urea, 3; MgSO4.7H2O, 2; KH2PO4, 7, NaCl, 0.5; (NH4)2SO4, 6; FeSO4.7H2O, 0.1; adipic acid, 2 to 5; trace element solution II (CuSO4. 5 H2O, 0.5; ZnSO4.7H2O, 2; MnSO4.H2O; 2; Na2SO4, 50), 10 (ml/l) (pH before sterilisation 5.5-6.0). The incubation is then continued for another 96-120 hours. Filtrates of well grown cultures are analysed by HPLC and NMR for production of adipoyl-7-ADCA. As
FIG. 3 shows, the transformants with the expandase predominantly localised in the cytosol perform significantly better than transformants with the expandase localised in the microbody. - In order to assess that the mutation of the C-terminus of expandase results in a block in the transport of expandase to the peroxisome, electron microscopy is used. Samples are fixed using glutaraldehyde, according to a procedure described by Waterham et al. J. Cell Biol. 127: 737-749 (1994). Localisation studies are performed using immuno-cytochemistry with an anti-expandase polyclonal antibody.
FIG. 4 shows expandase accumulating predominantly in the cytosol or in the microbody. - To determine the performance of transformants with the mutated expandase in larger scale fermentations, from both transformations strains are selected for further analysis. Thus, a mutant expandase transformant is chosen that produces 10% more adipoyl-7-ADCA than the transformant that is selected from the transformation with the wild-type expandase gene. When strains are grown in a 10 L fermenter the amount of adipoyl-7-ADCA in the culture with the expandase localised predominantly in the cytosol is higher than in the fermentation with expandase localised predominantly in the microbody. Thus, expandase predominantly localised in the cytosol is apparently stable enough to maintain stable productivity and improved yield in a long-term or large-scale fermentation.
Claims (9)
1. A method for expanding the 5-membered ring of a beta-lactam compound to form a six-membered cephem compound, comprising the steps of growing a host capable of producing said beta-lactam compound under conditions conducive thereto and allowing said host to express a heterologous expandase capable of expanding the 5-membered ring of said beta-lactam compound from a DNA fragment encoding it, so as to form the said 6-membered cephem compound, characterised in that said expandase is expressed from a DNA fragment which codes for an expandase that is localised predominantly in the cytosol of the host cell.
2. The method of claim 1 , wherein said expandase is predominantly localised in the cytosol due to a modification in the DNA fragment encoding it, whereby a microbody targeting signal has been modified.
3. The method of claim 2 , wherein the modification is of a DNA encoding an expandase endogenous to Streptomyces clavuligerus.
4. The method of claim 1 , wherein the host is Penicillium chrysogenum.
5. The method of clam 1 wherein said expandase is altered from an unaltered form of said expandase which is that of Streptomyces clavuligerus, wherein said altered expandase, when expressed in a Penicillium chrysogenum host is localized in the cytosol of said host, wherein the C-terminal sequence of said expandase is X1-X2-X3, wherein X1 is ser, cys or ala;
X2 is any amino acid; and
X3 is a non-hydrophobic amino acid.
6. The method of claim 5 where in said altered expandase X1 is ser, X2 is lys; and X3 is asp.
7. The method of claim 5 where in said altered expandase X1 is ser; X2 is ser; and X3 is asp.
8. The method of claim 1 , wherein the beta-lactam compound is selected from the group consisting of phenylacetyl-6-APA, phenoxyacetyl-6-APA, alpha-aminoadipoyl-6-APA, adipoyl-6-APA, glutaryl-6-APA, suberyl-6-APA, pimelyl-6-APA, or trans-b-hydromuconyl-6-APA.
9. A method for making a cephem compound comprising the steps of expanding the penam ring of said beta-lactam compound in a process according to claim 1 and recovering the cephem compound so formed.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11/349,381 US20060127972A1 (en) | 1998-05-19 | 2006-02-07 | In vivo production of cephalosporins |
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP98201655 | 1998-05-19 | ||
EP98201655.2 | 1998-05-19 | ||
US09/700,080 US6995003B1 (en) | 1998-05-19 | 1999-05-19 | Method to localize expandase in the cytosol |
PCT/EP1999/003455 WO1999060102A2 (en) | 1998-05-19 | 1999-05-19 | Improved in vivo production of cephalosporins |
US11/349,381 US20060127972A1 (en) | 1998-05-19 | 2006-02-07 | In vivo production of cephalosporins |
Related Parent Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/700,080 Division US6995003B1 (en) | 1998-05-19 | 1999-05-19 | Method to localize expandase in the cytosol |
PCT/EP1999/003455 Division WO1999060102A2 (en) | 1998-05-19 | 1999-05-19 | Improved in vivo production of cephalosporins |
Publications (1)
Publication Number | Publication Date |
---|---|
US20060127972A1 true US20060127972A1 (en) | 2006-06-15 |
Family
ID=8233737
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/700,080 Expired - Fee Related US6995003B1 (en) | 1998-05-19 | 1999-05-19 | Method to localize expandase in the cytosol |
US11/349,381 Abandoned US20060127972A1 (en) | 1998-05-19 | 2006-02-07 | In vivo production of cephalosporins |
Family Applications Before (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/700,080 Expired - Fee Related US6995003B1 (en) | 1998-05-19 | 1999-05-19 | Method to localize expandase in the cytosol |
Country Status (16)
Country | Link |
---|---|
US (2) | US6995003B1 (en) |
EP (2) | EP1953230A1 (en) |
JP (1) | JP2003527069A (en) |
KR (1) | KR100648480B1 (en) |
CN (2) | CN100390285C (en) |
AT (1) | ATE386123T1 (en) |
AU (1) | AU4144999A (en) |
BR (1) | BR9910532A (en) |
DE (1) | DE69938129D1 (en) |
ES (1) | ES2302379T3 (en) |
ID (1) | ID27054A (en) |
MX (1) | MXPA00011223A (en) |
PL (1) | PL344863A1 (en) |
RU (1) | RU2230790C2 (en) |
WO (1) | WO1999060102A2 (en) |
ZA (1) | ZA200006308B (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060217971A1 (en) * | 2005-03-28 | 2006-09-28 | Tellabs Operations, Inc. | Method and apparatus for modifying an encoded signal |
US10689670B2 (en) | 2016-06-14 | 2020-06-23 | Dsm Ip Assets B.V. | Recombinant yeast cell |
US10689681B2 (en) | 2013-05-31 | 2020-06-23 | Dsm Ip Assets B.V. | Microorganisms for diterpene production |
US10947515B2 (en) | 2015-03-16 | 2021-03-16 | Dsm Ip Assets B.V. | UDP-glycosyltransferases |
US11104886B2 (en) | 2016-12-08 | 2021-08-31 | Dsm Ip Assets B.V. | Kaurenoic acid hydroxylases |
US11225647B2 (en) | 2016-10-27 | 2022-01-18 | Dsm Ip Assets B.V. | Geranylgeranyl pyrophosphate synthases |
Families Citing this family (65)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB0011185D0 (en) * | 2000-05-09 | 2000-06-28 | Synpac Pharmaceuticals Limited | Protein |
CN1796537B (en) * | 2004-12-23 | 2010-09-08 | 华北制药集团有限责任公司 | New strain for producing penicillium chrysogenum and fermentation for preparing penicillin by using the strain |
CN101978063B (en) | 2007-11-20 | 2018-10-16 | 帝斯曼知识产权资产管理有限公司 | Succinic acid is produced in eukaryocyte |
CN101896606B (en) | 2007-11-20 | 2016-12-21 | 帝斯曼知识产权资产管理有限公司 | Dicarboxylic acids is produced in recombination yeast |
US20110318795A1 (en) | 2007-11-20 | 2011-12-29 | Verwaal Rene | Dicarboxylic acid production in a filamentous fungus |
EP2116136A1 (en) | 2008-05-08 | 2009-11-11 | Nederlandse Organisatie voor toegepast- natuurwetenschappelijk onderzoek TNO | Novel phytases |
WO2010107310A1 (en) | 2009-03-17 | 2010-09-23 | Nederlandse Organisatie Voor Toegepast- Natuurwetenschappelijk Onderzoek Tno | Novel cellulose and ligno-cellulose active proteins |
EP2419518A1 (en) | 2009-04-15 | 2012-02-22 | DSM IP Assets B.V. | Dicarboxylic acid production process |
UA108853C2 (en) | 2009-07-10 | 2015-06-25 | Galactose fermentation method | |
WO2011131674A1 (en) | 2010-04-21 | 2011-10-27 | Dsm Ip Assets B.V. | Process for the production of cells which are capable of converting arabinose |
EP2388331A1 (en) | 2010-05-21 | 2011-11-23 | Nederlandse Organisatie voor toegepast -natuurwetenschappelijk onderzoek TNO | Constitutive promoter |
BR112013008981A2 (en) | 2010-10-13 | 2017-10-03 | Dsm Ip Assets Bv | Yeast cell that ferments pentoses and glucose |
EA201301193A1 (en) | 2011-04-22 | 2014-02-28 | ДСМ АйПи АССЕТС Б.В. | Yeast cells capable of converting sugars containing arabinose and xylose |
AR087423A1 (en) | 2011-08-04 | 2014-03-19 | Dsm Ip Assets Bv | CAPABLE CELL TO FERMENT PENTOUS SUGARS |
EP2554668A1 (en) | 2011-08-04 | 2013-02-06 | DSM IP Assets B.V. | A pentose sugar fermenting cell |
US20150031868A1 (en) | 2012-01-23 | 2015-01-29 | Dsm Ip Assets B.V. | Diterpene production |
IN2015DN02650A (en) | 2012-10-16 | 2015-09-18 | Dsm Ip Assets Bv | |
EP2772545A1 (en) | 2013-03-01 | 2014-09-03 | Nederlandse Organisatie voor toegepast -natuurwetenschappelijk onderzoek TNO | Starch active proteins |
US20160060660A1 (en) | 2013-04-05 | 2016-03-03 | Université Du Luxembourg | Biotechnological production of itaconic acid |
WO2014178717A1 (en) | 2013-05-02 | 2014-11-06 | Nederlandse Organisatie Voor Toegepast-Natuurwetenschappelijk Onderzoek Tno | Novel organic acid pathway |
WO2015007748A1 (en) | 2013-07-15 | 2015-01-22 | Dsm Ip Assets B.V. | Diterpene production |
BR112016002092B1 (en) | 2013-07-31 | 2020-12-15 | Dsm Ip Assets B.V. | STEVIOL GLYCOSIDE RECOVERY |
EP3259361A1 (en) | 2015-02-16 | 2017-12-27 | DSM IP Assets B.V. | Process for producing itaconic acid under anaerobic conditions |
CA2979957A1 (en) | 2015-03-23 | 2016-09-29 | Dsm Ip Assets B.V. | Udp-glycosyltransferases from solanum lycopersicum |
EP3718417A1 (en) | 2015-04-03 | 2020-10-07 | DSM IP Assets B.V. | Steviol glycosides |
WO2016172282A1 (en) | 2015-04-21 | 2016-10-27 | Dsm Ip Assets B.V. | Microbial production of terpenoids |
PL3298133T3 (en) | 2015-05-22 | 2020-03-31 | Dsm Ip Assets B.V. | Acetate consuming yeast cell |
BR112018000550B1 (en) | 2015-07-10 | 2022-05-10 | Dsm Ip Assets B.V. | Method for preparing a steviol glycoside composition |
CN107922913B (en) | 2015-08-13 | 2022-04-05 | 帝斯曼知识产权资产管理有限公司 | Steviol glycoside transport |
WO2017050652A1 (en) | 2015-09-25 | 2017-03-30 | Dsm Ip Assets B.V. | Asparaginase |
EP4043558A3 (en) | 2015-10-05 | 2022-11-16 | DSM IP Assets B.V. | Kaurenoic acid hydroxylases |
WO2017060195A1 (en) | 2015-10-06 | 2017-04-13 | Dsm Ip Assets B.V. | Eukaryotic cell with increased production of fermentation product |
CN109153979A (en) | 2015-12-30 | 2019-01-04 | 帝斯曼知识产权资产管理有限公司 | The partial enzymatic hydrolysis of triacylglycerol |
CA3009871A1 (en) | 2015-12-30 | 2017-07-06 | Dsm Ip Assets B.V. | Partial enzymatic hydrolysis of triacylglycerols |
EP3435771A1 (en) | 2016-03-31 | 2019-02-06 | DSM IP Assets B.V. | Enzyme composition and preparation of a dairy product with improved properties |
EP3435772A1 (en) | 2016-03-31 | 2019-02-06 | DSM IP Assets B.V. | Enzyme composition and preparation of a dairy product with improved properties |
WO2017167847A1 (en) | 2016-03-31 | 2017-10-05 | Dsm Ip Assets B.V. | Production of milk with low lactose content |
EP3919615A1 (en) | 2016-07-13 | 2021-12-08 | DSM IP Assets B.V. | Malate dehyrogenases |
BR112019002417B1 (en) | 2016-08-09 | 2023-05-02 | Dsm Ip Assets B.V. | CRYSTALLIZATION OF STEVIOL GLYCOSIDES |
EP3497110A1 (en) | 2016-08-09 | 2019-06-19 | DSM IP Assets B.V. | Crystallization of steviol glycosides |
CN110036114B (en) | 2016-08-26 | 2023-09-29 | 勒萨弗尔公司 | Enhanced itaconic acid production |
WO2018073107A1 (en) | 2016-10-19 | 2018-04-26 | Dsm Ip Assets B.V. | Eukaryotic cell comprising xylose isomerase |
WO2018114938A1 (en) | 2016-12-21 | 2018-06-28 | Dsm Ip Assets B.V. | Lipolytic enzyme variants |
WO2018114941A1 (en) | 2016-12-21 | 2018-06-28 | Dsm Ip Assets B.V. | Lipolytic enzyme variants |
BR112019012559A2 (en) | 2016-12-21 | 2019-11-26 | Dsm Ip Assets Bv | lipolytic enzyme variants |
WO2018114912A1 (en) | 2016-12-21 | 2018-06-28 | Dsm Ip Assets B.V. | Lipolytic enzyme variants |
WO2018114995A1 (en) | 2016-12-22 | 2018-06-28 | Dsm Ip Assets B.V. | Fermentation process for producing steviol glycosides |
EP3638770B1 (en) | 2017-06-13 | 2023-01-18 | DSM IP Assets B.V. | Recombinant yeast cell |
US11639497B2 (en) | 2017-06-27 | 2023-05-02 | Dsm Ip Assets B.V. | UDP-glycosyltransferases |
CA3074001A1 (en) | 2017-09-26 | 2019-04-04 | Dsm Ip Assets B.V. | Acetic acid consuming strain |
EP3533878A1 (en) | 2018-02-28 | 2019-09-04 | Dutch DNA Biotech B.V. | Process for producing citramalic acid employing aspergillus |
EP3809852A1 (en) | 2018-06-19 | 2021-04-28 | DSM IP Assets B.V. | Lipolytic enzyme variants |
EP4232568A1 (en) | 2020-10-22 | 2023-08-30 | DSM IP Assets B.V. | Microorganisms for diterpene production |
EP4359426A2 (en) | 2021-06-24 | 2024-05-01 | Fonterra Co-Operative Group Limited | Recombinant beta-lactoglobulin |
EP4370692A1 (en) | 2021-07-12 | 2024-05-22 | Danisco Us Inc | Recombinant yeast cell |
WO2023285282A1 (en) | 2021-07-12 | 2023-01-19 | Dsm Ip Assets B.V. | Recombinant yeast cell |
WO2023285279A1 (en) | 2021-07-12 | 2023-01-19 | Dsm Ip Assets B.V. | Recombinant yeast cell |
EP4370690A1 (en) | 2021-07-12 | 2024-05-22 | Danisco Us Inc | Recombinant yeast cell |
WO2023285297A1 (en) | 2021-07-12 | 2023-01-19 | Dsm Ip Assets B.V. | Recombinant yeast cell |
EP4370689A1 (en) | 2021-07-12 | 2024-05-22 | Danisco Us Inc | Recombinant yeast cell |
WO2023079049A1 (en) | 2021-11-04 | 2023-05-11 | Dsm Ip Assets B.V. | Variant polypeptide and recombinant yeast cell |
WO2023079048A1 (en) | 2021-11-04 | 2023-05-11 | Dsm Ip Assets B.V. | Process for the production of ethanol and recombinant yeast cell |
WO2023079050A1 (en) | 2021-11-04 | 2023-05-11 | Dsm Ip Assets B.V. | Recombinant yeast cell |
CA3237662A1 (en) | 2021-11-09 | 2023-05-19 | Amgen Inc. | Production of therapeutic proteins |
WO2023222614A1 (en) | 2022-05-16 | 2023-11-23 | Dsm Ip Assets B.V. | Lipolytic enzyme variants |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4003894A (en) * | 1971-08-17 | 1977-01-18 | Gist-Brocades N.V. | Preparation of 7-substituted amino-desacetoxycephalosporanic acid compounds |
Family Cites Families (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
PT83746B (en) | 1985-11-15 | 1988-08-17 | Gist Brocades Nv | PROCESS FOR THE PREPARATION OF NEW IMMOBILIZED BIOCATALYZERS AND FOR THE PRODUCTION OF ETHANOL BY FERMENTATION |
US5070020A (en) | 1988-05-09 | 1991-12-03 | Eli Lilly And Company | Recombinant dna expression vectors and dna compounds that encode deacetoxycephalosporin c synthetase |
US5082772A (en) | 1988-10-24 | 1992-01-21 | Eli Lilly And Company | Process for preparing deacetylcephalosporin c |
PT97116B (en) * | 1990-03-23 | 1998-10-30 | Gist Brocades Nv | PROCESS FOR MODIFYING THE PRODUCTION OF SECONDARY METABOLITES, IN ADDITION TO BETA-LACTAMA DERIVATIVES |
US5318896A (en) | 1991-09-11 | 1994-06-07 | Merck & Co., Inc. | Recombinant expandase bioprocess for preparing 7-aminodesacetoxy cephalosporanic acid (7-ADCA) |
ATE238425T1 (en) | 1993-07-23 | 2003-05-15 | Dsm Nv | SELECTION MARKER GENE-FREE RECOMBINANT STRAINS: METHOD FOR THEIR PRODUCTION AND THE USE OF THESE STRAINS |
ES2194873T3 (en) * | 1993-07-30 | 2003-12-01 | Dsm Ip Assets Bv | PROCEDURE FOR THE EFFECTIVE PRODUCTION OF 7-ADCA THROUGH 3- (CARBOXIETIL) PROPIONIL-7-ADCA. |
CZ285604B6 (en) | 1993-07-30 | 1999-09-15 | Gist-Brocades B. V. | Process for preparing and isolation of 7-aminodesacetoxycephalosporanic acid |
WO1997020053A2 (en) * | 1995-11-27 | 1997-06-05 | Gist-Brocades B.V. | Improved process for the production of semi-synthetic cephalosporins via expandase activity on penicillin g |
WO1998002551A2 (en) | 1996-07-16 | 1998-01-22 | Gist-Brocades B.V. | Process for the production of adipoyl cephalosporins |
-
1999
- 1999-05-19 CN CNB998063142A patent/CN100390285C/en not_active Expired - Lifetime
- 1999-05-19 AT AT99925015T patent/ATE386123T1/en not_active IP Right Cessation
- 1999-05-19 EP EP08101461A patent/EP1953230A1/en not_active Withdrawn
- 1999-05-19 PL PL99344863A patent/PL344863A1/en not_active Application Discontinuation
- 1999-05-19 RU RU2000131687/13A patent/RU2230790C2/en not_active IP Right Cessation
- 1999-05-19 CN CNA2008100875582A patent/CN101353660A/en active Pending
- 1999-05-19 KR KR1020007012957A patent/KR100648480B1/en not_active IP Right Cessation
- 1999-05-19 ID IDW20002338A patent/ID27054A/en unknown
- 1999-05-19 WO PCT/EP1999/003455 patent/WO1999060102A2/en active IP Right Grant
- 1999-05-19 EP EP99925015A patent/EP1078069B1/en not_active Expired - Lifetime
- 1999-05-19 AU AU41449/99A patent/AU4144999A/en not_active Abandoned
- 1999-05-19 US US09/700,080 patent/US6995003B1/en not_active Expired - Fee Related
- 1999-05-19 DE DE69938129T patent/DE69938129D1/en not_active Expired - Lifetime
- 1999-05-19 ES ES99925015T patent/ES2302379T3/en not_active Expired - Lifetime
- 1999-05-19 BR BR9910532-2A patent/BR9910532A/en not_active Application Discontinuation
- 1999-05-19 MX MXPA00011223A patent/MXPA00011223A/en unknown
- 1999-05-19 JP JP2000549710A patent/JP2003527069A/en not_active Withdrawn
-
2000
- 2000-11-03 ZA ZA200006308A patent/ZA200006308B/en unknown
-
2006
- 2006-02-07 US US11/349,381 patent/US20060127972A1/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4003894A (en) * | 1971-08-17 | 1977-01-18 | Gist-Brocades N.V. | Preparation of 7-substituted amino-desacetoxycephalosporanic acid compounds |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060217971A1 (en) * | 2005-03-28 | 2006-09-28 | Tellabs Operations, Inc. | Method and apparatus for modifying an encoded signal |
US10689681B2 (en) | 2013-05-31 | 2020-06-23 | Dsm Ip Assets B.V. | Microorganisms for diterpene production |
US11725223B2 (en) | 2013-05-31 | 2023-08-15 | Dsm Ip Assets B.V. | Microorganisms for diterpene production |
US10947515B2 (en) | 2015-03-16 | 2021-03-16 | Dsm Ip Assets B.V. | UDP-glycosyltransferases |
US11459548B2 (en) | 2015-03-16 | 2022-10-04 | Dsm Ip Assets B.V. | UDP-glycosyltransferases |
US10689670B2 (en) | 2016-06-14 | 2020-06-23 | Dsm Ip Assets B.V. | Recombinant yeast cell |
US11186850B2 (en) | 2016-06-14 | 2021-11-30 | Dsm Ip Assets B.V. | Recombinant yeast cell |
US11225647B2 (en) | 2016-10-27 | 2022-01-18 | Dsm Ip Assets B.V. | Geranylgeranyl pyrophosphate synthases |
US11781121B2 (en) | 2016-10-27 | 2023-10-10 | Dsm Ip Assets B.V. | Geranylgeranyl pyrophosphate synthases |
US11104886B2 (en) | 2016-12-08 | 2021-08-31 | Dsm Ip Assets B.V. | Kaurenoic acid hydroxylases |
US11913034B2 (en) | 2016-12-08 | 2024-02-27 | Dsm Ip Assets B.V. | Kaurenoic acid hydroxylases |
Also Published As
Publication number | Publication date |
---|---|
ID27054A (en) | 2001-02-22 |
RU2230790C2 (en) | 2004-06-20 |
EP1078069B1 (en) | 2008-02-13 |
ATE386123T1 (en) | 2008-03-15 |
DE69938129D1 (en) | 2008-03-27 |
MXPA00011223A (en) | 2002-04-17 |
US6995003B1 (en) | 2006-02-07 |
AU4144999A (en) | 1999-12-06 |
CN1301303A (en) | 2001-06-27 |
PL344863A1 (en) | 2001-11-19 |
CN100390285C (en) | 2008-05-28 |
CN101353660A (en) | 2009-01-28 |
JP2003527069A (en) | 2003-09-16 |
ZA200006308B (en) | 2001-05-23 |
KR100648480B1 (en) | 2006-11-24 |
BR9910532A (en) | 2001-10-16 |
WO1999060102A2 (en) | 1999-11-25 |
EP1078069A2 (en) | 2001-02-28 |
EP1953230A1 (en) | 2008-08-06 |
ES2302379T3 (en) | 2008-07-01 |
KR20010025039A (en) | 2001-03-26 |
WO1999060102A3 (en) | 2000-02-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6995003B1 (en) | Method to localize expandase in the cytosol | |
AU657800B2 (en) | Novel bioprocesses for preparing 7-ACA and 7-ADAC | |
KR100336174B1 (en) | Efficient method for preparing 7-ADCA via 2- (carboxyethylthio) acetyl-7-ADCA and 3- (carboxymethylthio) propionyl-7-ADCA | |
Isogai et al. | Construction of a 7-aminocephalosporanic acid (7ACA) biosynthetic operon and direct production of 7ACA in Acremonium chrysogenum | |
SK28894A3 (en) | Bioprocess for preparing 7-adca | |
EP0711348B1 (en) | Process for the efficient production of 7-adca via 3-(carboxyethylthio)propionyl-7-adca | |
MX2007006780A (en) | Production of beta-lactam antibiotics by genetically modified non-naturally producing microorganisms. | |
EP0828850B1 (en) | Process for the production of 7-adca via expandase activity on penicillin g | |
EP0436355B1 (en) | Process for producing 7-aminocephem compound or salts thereof | |
JPH0787788B2 (en) | DNA compound encoding isopenicillin N synthase and recombinant DNA expression vector | |
US5919680A (en) | Process for the production of SSC's via expandase activity on penicillin G | |
WO1998002551A2 (en) | Process for the production of adipoyl cephalosporins | |
EP0444758A1 (en) | Method for modification of ACV synthetase and use of the modified enzyme for production of beta-lactam antibiotics | |
EP0716698B1 (en) | Process for the efficient production of 7-ADCA via 2-(carboxyethylthio)acetyl-7-ADCA and 3-(carboxymethylthio)propionyl-7-ADCA | |
WO1997038107A1 (en) | An enzyme with high adipoyl-coenzyme a synthetase activity and uses thereof | |
RU2139350C1 (en) | Method of effective production of 7-aminodeacetoxycephalosporanic acid through 3-(carboxyethylthio)-propionyl-7-amino- -deacetoxycephalosporanic acid | |
RU2139349C1 (en) | Method of effective production of 7-aminodeacetoxycephalosporanic acid through 2-(carboxyethylthio)-acetyl-7-amino- -deacetoxycephalosporanic acid and 3-(carboxymethylthio)- -propionyl-7-aminodeacetoxycephalosporanic acid | |
JPH09503907A (en) | Effective method for producing 7-ADCA via 2- (carboxyethylthio) acetyl-7-ADCA and 3- (carboxymethylthio) propionyl-7-ADCA |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |