US20050222068A1 - Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells - Google Patents

Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells Download PDF

Info

Publication number
US20050222068A1
US20050222068A1 US10/971,959 US97195904A US2005222068A1 US 20050222068 A1 US20050222068 A1 US 20050222068A1 US 97195904 A US97195904 A US 97195904A US 2005222068 A1 US2005222068 A1 US 2005222068A1
Authority
US
United States
Prior art keywords
antisense compound
seq
cells
hiv
conjugate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/971,959
Other languages
English (en)
Inventor
Dan Mourich
Patrick Iversen
Richad Bestwick
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sarepta Therapeutics Inc
Original Assignee
AVI Biopharma Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US10/971,959 priority Critical patent/US20050222068A1/en
Application filed by AVI Biopharma Inc filed Critical AVI Biopharma Inc
Priority to CA002542875A priority patent/CA2542875A1/en
Priority to PCT/US2004/035121 priority patent/WO2005041874A2/en
Priority to EP04796169A priority patent/EP1682073A2/de
Priority to AU2004285494A priority patent/AU2004285494A1/en
Assigned to AVI BIOPHARMA, INC. reassignment AVI BIOPHARMA, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BESTWICK, RICHARD K., IVERSEN, PATRICK L., MOURICH, DAN V.
Publication of US20050222068A1 publication Critical patent/US20050222068A1/en
Priority to US11/433,257 priority patent/US20070037764A1/en
Priority to US11/940,987 priority patent/US20080187993A1/en
Priority to US11/941,033 priority patent/US8008469B2/en
Priority to US13/187,338 priority patent/US20120027791A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/66—Phosphorus compounds
    • A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C12N2810/6045—RNA rev transcr viruses
    • C12N2810/6054—Retroviridae

Definitions

  • the present invention is drawn to novel antiviral conjugates and their use in inhibiting HIV infection and replication in hematopoietic cells, in particular, macrophage and T lymphocyte cells.
  • HIV envelope induces virus expression from resting CD4+ T cells isolated from HIV-infected individuals in the absence of markers of cellular activation or apoptosis.” J Immunol 170(5): 2449-55.
  • HIV Human immunodeficiency virus
  • AIDS acquired immune deficiency syndrome
  • Recent statistics indicate that as many as 42 million people worldwide are infected with the virus. In addition to the large number of individuals already infected, the virus continues to spread. Estimates from 2002 indicate 5 million new infections in that year alone. In the same year there were approximately 3.1 million deaths associated with HIV and AIDS.
  • HIV human immunodeficiency virus
  • squinavir, indinavir, ritonavir, nelfinavir and amprenavir are competitive inhibitors of the aspartyl protease expressed by HIV.
  • Zidovudine, didanosine, stavudine, lamivudine, zalcitabine and abacavir are nucleoside reverse transcriptase inhibitors that block viral cDNA synthesis.
  • the non-nucleoside reverse transcriptase inhibitors, nevaripine, delavamidine and efavirenz inhibit the synthesis of viral cDNA via a non-competitive mechanism.
  • HAART highly active antiretroviral therapy
  • the invention includes a method of achieving selective uptake of a substantially uncharged antisense compound into activated human hematopoietic cells, e.g., macrophage or T lymphocyte cells.
  • the method includes exposing a population of human macrophage or T lymphocyte cells that include activated human macrophage or T lymphocyte cells to an rTAT-antisense conjugate composed of (i) the antisense compound and (ii) covalently coupled thereto, a reverse TAT (rTAT) polypeptide having the sequence identified as SEQ ID NO:1.
  • This exposing is effective to achieve a greater level of intracellular uptake of the oligonucleotide analog into activated macrophage or T-lymphocyte cells than is achieved (i) by exposing non-activated macrophage or T-lymphocyte cells to the same antisense conjugate, or (ii) by exposing activated macrophage or T-lymphocyte cells to the oligonucleotide analog in the absence of the rTAT polypeptide.
  • the antisense compound is composed of morpholino subunits and phosphorus-containing intersubunit linkages joining a morpholino nitrogen of one subunit to a 5′ exocyclic carbon of an adjacent subunit.
  • the morpholino subunits in the conjugate to which the T cells are exposed may be joined by phosphorodiamidate linkages, in accordance with the structure:
  • the rTAT polypeptide may be covalently coupled at its C terminus to the 3′ end of the antisense compound.
  • the invention includes a method of selectively inhibiting HIV replication in activated, HIV-infected human hematopoietic cells, e.g., macrophage or T lymphocyte cells.
  • activated, HIV-infected cells are exposed to an rTAT-antisense conjugate composed of (i) a substantially uncharged antisense compound capable of hybridizing with an HIV sense-strand RNA sequence, to inhibit replication of HIV replication in HIV-infected cells, and (ii) covalently attached to the agent, an rTAT polypeptide having the polypeptide sequence identified as SEQ ID NO: 1.
  • This exposure is effective to achieve a greater level of intracellular uptake of the oligonucleotide analog into activated, HIV-infected macrophage or T-lymphocyte cells than is achieved (i) by exposing non-activated, non-HIV-infected macrophage or T-lymphocyte cells to the same conjugate compound, or (ii) by exposing activated, HIV-infected macrophage or T-lymphocyte cells to the oligonucleotide analog in the absence of the rTAT polypeptide, thereby selectively inhibiting HIV infection, e.g., replication, in the activated cells.
  • antisense compounds are identified above.
  • the antisense compound may be capable of hybridizing with a sequence selected from the group consisting of SEQ ID NOS: 26-48 to form a heteroduplex structure having a Tm of dissociation of at least 45° C.
  • the compound in this embodiment may have at least 12 contiguous bases from one of the sequences selected from the group consisting of SEQ ID NOS: 4-25.
  • the antisense compound is capable of hybridizing with a sequence selected from the group consisting of SEQ ID NOS: 26-31 (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to inhibit the synthesis of the HIV Vif protein in the infected cells.
  • the compound in this embodiment may have at least 12 contiguous bases from one of the sequences selected from the group consisting of SEQ ID NOS: 4-9.
  • the antisense compound is capable of hybridizing with SEQ ID NO:32 (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to inhibit the synthesis of HIV Gag-pol precursor polyprotein.
  • the compound in this embodiment may have at least 12 contiguous bases from the sequence identified as SEQ ID NO:10.
  • the antisense compound is capable of hybridizing with SEQ ID NOS:33, 45 and 46, (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to inhibit the synthesis of the HIV Rev phosphoprotein.
  • the compound in this embodiment may have at least 12 contiguous bases from the sequence identified as SEQ ID NOS:11, 23 and 24.
  • the antisense compound is capable of hybridizing with a sequence selected from the group consisting of SEQ ID NOS: 35-37 and 40-44, (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to block the cis-acting tRNA-primer binding site and Psi-packaging and dimerization elements, respectively.
  • the compound in this embodiment may have at least 12 contiguous bases from one of the sequences selected from the group consisting of SEQ ID NOS:13-15 and 18-22.
  • the antisense compound is capable of hybridizing with a sequence selected from the group consisting of SEQ ID NOS:38 and 39, (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to block the major splice donor site in viral RNA.
  • the compound in this embodiment may have at least 12 contiguous bases from one of the sequences selected from the group consisting of SEQ ID NOS:16 and 17.
  • the antisense compound is capable of hybridizing with SEQ ID NO:47, (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to inhibit reverse transcription of viral RNA by blocking the minus-strand transfer step.
  • the compound in this embodiment may have at least 12 contiguous bases from the sequence identified as SEQ ID NO:25.
  • an antisense conjugate for use in selectively inhibiting HIV replication in activated, HIV-infected human hematopoietic cells, e.g., macrophage or T lymphocyte cells.
  • the conjugate is composed of a substantially uncharged antisense compound containing 12-40 subunits and a base sequence effective to hybridize with an HIV sense-strand RNA sequence, to inhibit replication of HIV replication in HIV-infected cells, and a reverse TAT (rTAT) polypeptide having the sequence identified as SEQ ID NO: 1 and covalently coupled to the antisense compound.
  • FIG. 1A-1D show several preferred morpholino-type subunits having 5-atom (A), six-atom (B) and seven-atom (C-D) linking groups suitable for forming polymers.
  • FIGS. 2A-2D show the repeating subunit segment of exemplary morpholino oligonucleotides, designated A through D, constructed using subunits A-D, respectively, of FIG. 1 .
  • FIGS. 3A-3G show examples of uncharged linkage types in oligonucleotide analogs.
  • FIGS. 4A-4C show fluorescence activated cell sorting (FACS) analysis of uptake of rTAT-PMO conjugates into cultured splenocytes incubated with fluorescent conjugates and subjected to various lymphocyte activating substance in culture, as indicated. Separate lymphocytes populations were stained with antibodies to determine the extent of uptake by FACS analysis in CD8 positive T cells ( FIG. 4A ), CD4 positive T cells ( FIG. 4B ), and B cells (B220 positive cells) ( FIG. 4C ).
  • FACS fluorescence activated cell sorting
  • FIGS. 5A-5B shows FACS analysis of conjugated PMO uptake into na ⁇ ve and activated CD8 ( FIG. 5A ), and CD4 T-cells ( FIG. 5B ) using PMO-0003 (arginine-rich peptide-PMO) and PMO-0002 (rTAT-PMO).
  • hematopoietic cells refers specifically to T cells (T lymphocyte cells), B cells (B lymphocyte cells), monocytes, macrophages, dendritic cells and microglial cells among the other cell lineages derived from these hematopoietic precursors. All of these cells support HIV infection.
  • activated, HIV-infected T-lymphocyte cells refers to T cells that become activated, either as a result of HIV infection of the cells and/or after the T cell receptor (TCR) complex and a co-stimulatory receptor (e.g. CD28 on na ⁇ ve CD4 and CD8 T cells) are engaged to the extent that a signal transduction cascade is initiated, following HIV infection.
  • T cells will proliferate and then secrete cytokines or carry out cytolysis on cells expressing a specific foreign peptide with self MHC.
  • Cytokines are growth factors for other T cells, signals for B cells to produce antibody and signals for the transcriptional activation of HIV. The majority of HIV production in T cells is linked to T cell activation as determined by classical activation markers.
  • Macrophages refer to mononuclear phagocytes which are key components of innate immunity because they recognize, ingest, and destroy many pathogens without the aid of an adaptive immune response. They are also an important reservoir of HIV infection and are able to harbor replicating virus without being killed by it.
  • Activated, HIV-infected macrophage cells refers to HIV-infected macrophage cells that have become activated either as a result of HIV infection of the cells and/or effector T cells activate macrophages by direct interaction (e.g. CD40 ligand on T cells binds to CD40 on macrophages) and by secretion of gamma-interferon, a potent macrophage activating cytokine. Macrophage activation results in increased HIV replication as is the case with T cells.
  • antigen-activated B cells refer to either of two different types of B cell activation, T cell dependent and T cell independent.
  • T cell independent antigens contain repetitive identical epitopes and are capable of clustering membrane bound antibody on the surface of the B cell which can result in delivering activation signals.
  • T cell dependent activation is in response to protein antigens where the B cell acts as a professional antigen presenting cell. In either case of B cell activation the cell will proliferate and differentiate into plasma B cells capable of secreting antibodies against the antigen.
  • mature dendritic cells refer to professional antigen-presenting cells (APCs) that express both MHC class I and II and co-stimulatory molecules and are capable of initiating activation of na ⁇ ve T cells. Two different DC phenotypes are exhibited depending on maturation state and location in the body. Immature DCs reside in all tissues and organs as active phagocytic cells. Mature DCs traffic to secondary lymphoid organs (e.g. lymph node and spleen) and present peptides derived from processed protein antigens to T cells in the context of MHC molecules. Mature DCs also provide the necessary co-stimulatory signals to T cells by expressing the appropriate surface ligand (e.g. CD80 and CD86 on DCs bind to CD28 on T cells).
  • APCs professional antigen-presenting cells
  • antisense oligonucleotides refer to a compound having sequence of nucleotide bases and a subunit-to-subunit backbone that allows the antisense oligomer to hybridize to a target sequence in an RNA by Watson-Crick base pairing, to form an RNA:oligomer heterduplex within the target sequence.
  • the antisense oligonucleotide includes a sequence of purine and pyrimidine heterocyclic bases, supported by a backbone, which are effective to hydrogen-bond to corresponding, contiguous bases in a target nucleic acid sequence.
  • the backbone is composed of subunit backbone moieties supporting the purine and pyrimidine heterocyclic bases at positions that allow such hydrogen bonding. These backbone moieties may be cyclic moieties of 5 to 7 atoms in length, linked together by, for example, phosphorous-containing linkages one to three atoms long. Alternatively, the backbone may comprise a peptide structure, such as the backbone of a peptide nucleic acid (PNA)
  • PNA peptide nucleic acid
  • a “morpholino” oligonucleotide refers to a polymeric molecule having a backbone which supports bases capable of hydrogen bonding to typical polynucleotides, wherein the polymer lacks a pentose sugar backbone moiety, and more specifically a ribose backbone linked by phosphodiester bonds which is typical of nucleotides and nucleosides, but instead contains a ring nitrogen with coupling through the ring nitrogen.
  • a preferred “morpholino” oligonucleotide is composed of morpholino subunit structures of the form shown in FIGS.
  • FIGS. 1A-1D where (i) the structures are linked together by phosphorous-containing linkages, one to three atoms long, joining the morpholino nitrogen of one subunit to the 5′ exocyclic carbon of an adjacent subunit, and (ii) P i and P j are purine or pyrimidine base-pairing moieties effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide.
  • Exemplary structures for antisense oligonucleotides for use in the invention include the morpholino subunit types shown in FIGS. 1A-1D , with the uncharged, phosphorous-containing linkages shown in FIGS. 2A-2D , and more generally, the uncharged linkages 3 A- 3 G.
  • an oligonucleotide or antisense oligomer “specifically hybridizes” to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions, with a thermal melting point (Tm) substantially greater than 37° C., preferably at least 45° C., and typically 50° C.-80° C. or higher.
  • Tm thermal melting point
  • Such hybridization preferably corresponds to stringent hybridization conditions, selected to be about 10° C., and preferably about 50° C. lower than the T m for the specific sequence at a defined ionic strength and pH.
  • the T m is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide.
  • Polynucleotides are described as “complementary” to one another when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides.
  • a double-stranded polynucleotide can be “complementary” to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second.
  • Complementarity (the degree that one polynucleotide is complementary with another) is quantifiable in terms of the proportion of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules.
  • analog with reference to an oligomer means a substance possessing both structural and chemical properties similar to those of the reference oligomer.
  • a first sequence is an “antisense sequence” with respect to a second sequence if a polynucleotide whose sequence is the first sequence specifically binds to, or specifically hybridizes with, the second polynucleotide sequence under physiological conditions.
  • an antisense oligomer refers to the amount of antisense oligomer administered to a subject, either as a single dose or as part of a series of doses, that is effective to inhibit expression of a selected target nucleic acid sequence.
  • HIV is intended to include either or both of HIV-1 and HIV-2.
  • “Inhibition HIV replication in HIV-infected cells” means inhibiting viral replication within the cell, either by inhibiting or blocking the synthesis of a critical structural protein, inhibiting or blocking the synthesis of a viral protein necessary for viral-protein synthesis, replication, or assembly, or blocking a cis-acting element on the HIV genome or portion thereof.
  • “Selectively inhibiting HIV in activated, HIV-infected hematopoietic cells, e.g., macrophage or T-lymphocyte cells, cells” means inhibiting HIV infection selectively with respect to the extent of viral inhibition that would be observed in non-activated or non-HIV infected hematopoietic cells under the same inhibition conditions.
  • HIV human immunodeficiency virus
  • HAART highly active antiretroviral therapy
  • HIV infection of a cell is initiated by the interaction of viral envelope glycoproteins with specific cellular receptors. Following adsorption and uncoating, the viral RNA enters the target cell and is converted into cDNA by the action of reverse transcriptase (RT), an enzyme brought within the virion.
  • RT reverse transcriptase
  • the cDNA adopts a circular form, is converted to double-stranded cDNA and then becomes integrated into the host cell's genomic DNA by the action of integrase, a component of RT. Once integrated, HIV proviral cDNA is transcribed from the promoter within the 5′ LTR.
  • the transcribed RNA is spliced into one of several subgenomic mRNAs which act as mRNA and are translated to produce the viral proteins or is left as nascent, full-length viral RNA which is also translated or targeted for packaging into budding virions.
  • Full length genomic viral RNA contains a psi packaging sequence and a dimerization sequence near its 5′ end which are essential for packaging of two dimerized, full-length viral RNA molecules into virions. Once the virion is produced, it is released from the cell by budding from the plasma membrane.
  • the proviral cDNA remains stably integrated in the host genome and is replicated with the host DNA so that progeny cells also inherit the provirus.
  • HIV The entry of HIV into cells, including T lymphocytes, monocytes and macrophages, is, in general, effected by the interaction of the gp120 envelope protein of HIV with a CD4 receptor on the target cell surface.
  • the amino acid sequence of gp120 can be highly variable in different patients (or even the same patient). This variability plays an important role in disease progression.
  • the major peculiarities for HIV are that it has a latent phase in which the provirus may lie dormant following integration into the host cell's genome and it is cytopathic for T lymphocyte target cells. HIV commences the bulk of viral replication in activated and proliferating cells due to the binding of nuclear transcription and cellular enhancer factors to the HIV LTR which results in increased levels of viral transcription.
  • gag, pol and env gene products are translated into structural and enzymatic proteins.
  • HIV encodes several additional regulatory genes. Specifically, Tat and Rev are regulatory proteins and act to modulate transcriptional and posttranscriptional steps, respectively, and are essential for virus propagation.
  • Tat and Rev are regulatory proteins and act to modulate transcriptional and posttranscriptional steps, respectively, and are essential for virus propagation.
  • Nef is another regulatory gene which increases viral infectivity and is essential for efficient viral spread and disease progression in vivo.
  • Vif Another important regulatory protein is Vif or the viral infectivity factor (see below). Vif promotes the infectivity but not the production of viral particles. Viral particles produced in the absence of Vif (e.g. Vif deletion mutants) are defective while the cell to cell transmission of virus is not altered.
  • HIV infects primarily T cells and macrophages and HIV isolates that preferentially infect these cells are called T-tropic and M-tropic, respectively.
  • Virus isolates from early stages of an infection are consistently M-tropic while over the course of disease progression T-tropic viruses emerge and are associated with advanced disease stages.
  • HIV replication in both T cells and macrophages is highest in activated and proliferating cells due to the binding of nuclear transcription and cellular enhancer factors to the HIV long terminal repeat (LTR) resulting in increased transcription of HIV genes.
  • LTR long terminal repeat
  • HIV-1 infectious virus
  • SIV simian immunodeficiency virus
  • Vif acts to neutralize a cellular protein, APOBEC3G, that is part of a conserved antiretroviral pathway in mammalian cells.
  • APOBEC3G a cellular protein
  • APOBEC3G is incorporated into virions and in newly infected cells disables reverse transcription.
  • Vif specifically inactivates APOBEC3G and prevents its incorporation into progeny virions allowing productive infection of newly infected cells.
  • HIV-1 mutants with defective Vif genes have normal viral transcription, translation and virion production. These HIV-1 variants are able to bind and penetrate target cells but are not able to complete reverse transcription during the subsequent cycle of infection (Courcoul, Patience et al. 1995; Goncalves, Korin et al. 1996; Simon and Malim 1996; Dettenhofer, Cen et al. 2000). Vif is incorporated into HIV-1 virions and binds to RNA.
  • the APOBEC3G protein is a member of the cytidine deaminase family of nucleic acid editing enzymes and provides innate immunity to retroviral infection by effecting massive deamination of cytidine residues in nascent, first strand cDNA produced by reverse transcriptase (Harris, Bishop et al. 2003). HIV-1 utilizes the Vif protein to defeat the antiretroviral activity of APOBEC3G by Vif binding to APOBEC3G and targeting it for degradation by cellular proteasome-dependent pathways (Marin, Rose et al. 2003).
  • APOBEC3G is absent from HIV-1 virions produced in the presence of Vif and present in virions produced in the absence of Vif.
  • Current models suggest that virion incorporated APOBEC3G is responsible for the cytidine deamination of nascent cDNA in cells infected by virions containing APOBEC3G (Marin, Rose et al. 2003). Therefore, Vif acts to eliminate APOBEC3G from progeny virions and allows infection of otherwise nonpermisive cells.
  • Antisense oligomers directed to Vif mRNA reduce Vif protein levels and allow incorporation of APOBEC3G into nascent virions. This substantially reduces or eliminates the replicative potential of these virions and cause infected cells to produce a virus population with an increased defective to non-defective virion ratio.
  • the overall effect on an in vivo infection is to block the productive infection of lymphoid and myeloid cells and reduce the viral load in the individual.
  • Preferred target sequences are those in the region adjacent or including the AUG start site of the Vif gene, including the overlapping sequences identified by SEQ ID NOS: 26-31 in Table 2 below.
  • HIV target sites include the translational start sites of essential HIV structural and accessory genes, the tRNA primer binding site (PBS) and primer activation sequences (PAS), the Tat-Rev subgenomic mRNA splice donor and splice acceptor sites, the major 5′ splice donor (SD) site, the psi viral RNA packaging site, sequences required for dimerization of viral RNA prior to packaging, and the boundary between the U3 and R region of the viral long terminal repeat (LTR) which serves as the point of minus strand transfer during reverse transcription.
  • PBS tRNA primer binding site
  • PAS primer activation sequences
  • SD major 5′ splice donor
  • SD major 5′ splice donor
  • LTR viral long terminal repeat
  • the antisense compound has a base sequence that is complementary to a target region containing at least 12 contiguous bases in a HIV RNA transcript, and which includes at least 6 contiguous bases of one of the sequences identified by SEQ ID NOS:26-47 in Table 2 below.
  • Exemplary antisense oligomer sequences include those identified as SEQ ID NOS:4-25 in Table 1 below.
  • the target nucleotide sequence regions in Table 2 are referenced to NCBI GenBank Accession Number AF324493.
  • the target may encompass a sequence present in the mRNA for the Gag-pol polyprotein that includes the Gag capsid proteins and the viral enzymes protease, reverse transcriptase, and integrase.
  • An exemplary target sequence for the polyprotein mRNA is the region including or adjacent the AUG start site for the polyprotein mRNA, such as SEQ ID NO: 32 identified below.
  • the target may encompass a sequence present in the mRNA for the Rev protein.
  • This 19 kD phosphoprotein acts by binding to RRE (Rev responsive element), an RNA element encoded within the env region of HIV-1, and promoting the nuclear export, stabilization, and utilization of the viral mRNAs containing RRE.
  • RRE Rev responsive element
  • An exemplary target sequence for the Rev mRNA is the region including or adjacent to the AUG start site for the Rev mRNA, such as SEQ ID NO: 33 identified below.
  • Inhibition of viral replication or infectivity may also be inhibited by blocking cis-acting elements of HIV RNA transcripts.
  • preferred target sequences for this approach are the tRNA-PBS (primer binding site), primer activation sequences (PAS) and the Psi-packaging site and dimerization sequences (DIS) in full length HIV RNA transcripts.
  • exemplary target sequences include SEQ ID NOS: 35-37 and 40-44 given below.
  • Viral replication can also be inhibitied by interfering with the minus-strand transfer step during reverse transcription.
  • the preferred target region for this approach is found at the junction of the U3 and R regions of the viral long terminal repeat (LTR).
  • Exemplary target sequences include SEQ ID NO:47 given below.
  • Inhibition of viral RNA splicing can occur by targeting the major splice donor site located just upstream (5′) of the Gag-Pol start codon and Psi packaging region such as SEQ ID NOS:38 and 39.
  • Alternative targets for inhibiting viral RNA splicing are the Tat-Rev splice donor and splice acceptor sites, SEQ ID NOS:45 and 46, respectively.
  • the present invention is based, in part, on the discovery that the uptake of uncharged of substantially uncharged antisense compounds into activated human hematopoietic cells, such as activated, HIV-infected macrophages and T-lymphocyte cells, can be selectively enhanced, with respect to non-infected and/or non-activated cells, by conjugating the antisense compound with an rTAT polypeptide.
  • activated human hematopoietic cells such as activated, HIV-infected macrophages and T-lymphocyte cells
  • conjugating the antisense compound with an rTAT polypeptide.
  • This section describes various exemplary antisense compounds, the rTAT polypeptide, and methods of producing the rTAT-antisense conjugate.
  • Antisense oligomers for use in practicing the invention preferably have the properties: (1) a backbone that is substantially uncharged, (2) the ability to hybridize with the complementary sequence of a target RNA with high affinity, that is a Tm substantially greater than 37° C., preferably at least 45° C., and typically greater than 50° C., e.g., 60° C.-80° C. or higher, (3) a subunit length of at least 8 bases, generally about 8-40 bases, preferably 12-25 bases, and (4) nuclease resistance (Hudziak, Barofsky et al. 1996).
  • the antisense compound may have the capability for active or facilitated transport as evidenced by (i) competitive binding with a phosphorothioate antisense oligomer, and/or (ii) the ability to transport a detectable reporter into target cells.
  • the antisense compound displays selective uptake into activated immune cells when conjugated with rTAT polypeptide, according to cell-uptake criteria set out below.
  • Candidate antisense oligomers may be evaluated, according to well known methods, for acute and chronic cellular toxicity, such as the effect on protein and DNA synthesis as measured via incorporation of 3H-leucine and 3H-thymidine, respectively.
  • various control oligonucleotides e.g., control oligonucleotides such as sense, nonsense or scrambled antisense sequences, or sequences containing mismatched bases, in order to confirm the specificity of binding of candidate antisense oligomers.
  • control oligonucleotides e.g., control oligonucleotides such as sense, nonsense or scrambled antisense sequences, or sequences containing mismatched bases, in order to confirm the specificity of binding of candidate antisense oligomers.
  • sequences may be modified as needed to limit non-specific binding of antisense oligomers to non-target nucleic acid sequences.
  • the effectiveness of a given antisense oligomer molecule in forming a heteroduplex with the target mRNA may be determined by screening methods known in the art. For example, the oligomer is incubated in a cell culture containing an mRNA preferentially expressed in activated lymphocytes, and the effect on the target mRNA is evaluated by monitoring the presence or absence of (1) heteroduplex formation with the target sequence and non-target sequences using procedures known to those of skill in the art, (2) the amount of the target mRNA expressed by activated lymphocytes, as determined by standard techniques such as RT-PCR or Northern blot, (3) the amount of protein transcribed from the target mRNA, as determined by standard techniques such as ELISA or Western blotting. (See, for example,(Pari, Field et al. 1995; Anderson, Fox et al. 1996).
  • a second test measures cell transport, by examining the ability of the test compound to transport a labeled reporter, e.g., a fluorescence reporter, into cells.
  • the cells are incubated in the presence of labeled test compound, added at a final concentration between about 10-300 nM. After incubation for 30-120 minutes, the cells are examined, e.g., by microscopy or FACS analysis, for intracellular label. The presence of significant intracellular label is evidence that the test compound is transported by facilitated or active transport.
  • conjugation of the oligomer with the rTAT peptide selectively enhances uptake into activated immune cells, including activated, HIV-infected hematopoietic cells, in particular, activated, HIV-infected macrophage and T-lymphocyte cells.
  • RNAse resistance Two general mechanisms have been proposed to account for inhibition of expression by antisense oligonucleotides (Agrawal, Mayrand et al. 1990; Bonham, Brown et al. 1995; Boudvillain, Guerin et al. 1997).
  • a heteroduplex formed between the oligonucleotide and the viral RNA acts as a substrate for RNaseH, leading to cleavage of the viral RNA.
  • Oligonucleotides belonging, or proposed to belong, to this class include phosphorothioates, phosphotriesters, and phosphodiesters (unmodified “natural” oligonucleotides).
  • Such compounds expose the viral RNA in an oligomer:RNA duplex structure to hydrolysis by RNaseH, and therefore loss of function.
  • a second class of oligonucleotide analogs termed “steric blockers” or, alternatively, “RNaseH inactive” or “RNaseH resistant”, have not been observed to act as a substrate for RNaseH, and are believed to act by sterically blocking target RNA nucleocytoplasmic transport, splicing, translation, or replication.
  • This class includes methylphosphonates (Toulme, Tinevez et al. 1996), morpholino oligonucleotides, peptide nucleic acids (PNA's), certain 2′-O-allyl or 2′-O-alkyl modified oligonucleotides (Bonham, Brown et al. 1995), and N3′ ⁇ P5′ phosphoramidates (Ding, Grayaznov et al. 1996; Gee, Robbins et al. 1998).
  • a test oligomer can be assayed for its RNaseH resistance by forming an RNA:oligomer duplex with the test compound, then incubating the duplex with RNaseH under a standard assay conditions, as described (Stein, Foster et al. 1997). After exposure to RNaseH, the presence or absence of intact duplex can be monitored by gel electrophoresis or mass spectrometry.
  • a simple, rapid test for confirming that a given antisense oligomer type provides the required characteristics noted above, namely, high Tm, ability to be actively taken up by the host cells, and substantial resistance to RNaseH.
  • This method is based on the discovery that a properly designed antisense compound will form a stable heteroduplex with the complementary portion of the viral RNA target when administered to a mammalian subject, and the heteroduplex subsequently appears in the urine (or other body fluid). Details of this method are also given in co-owned U.S. Pat. No. 6,365,351 for “Non-Invasive Method for Detecting Target RNA,” the disclosure of which is incorporated herein by reference.
  • a test oligomer containing a backbone to be evaluated having a base sequence targeted against a known RNA, is injected into a mammalian subject.
  • the antisense oligomer may be directed against any intracellular RNA, including RNA encoded by a host gene.
  • the urine is assayed for the presence of the antisense-RNA heteroduplex. If heteroduplex is detected, the backbone is suitable for use in the antisense oligomers of the present invention.
  • the test oligomer may be labeled, e.g. by a fluorescent or a radioactive tag, to facilitate subsequent analyses, if it is appropriate for the mammalian subject.
  • the assay can be in any suitable solid-phase or fluid format.
  • a solid-phase assay involves first binding the heteroduplex analyte to a solid-phase support, e.g., particles or a polymer or test-strip substrate, and detecting the presence/amount of heteroduplex bound.
  • a solid-phase assay involves first binding the heteroduplex analyte to a solid-phase support, e.g., particles or a polymer or test-strip substrate, and detecting the presence/amount of heteroduplex bound.
  • the analyte sample is typically pretreated to remove interfering sample components.
  • the heteroduplex is confirmed by detecting the label tags.
  • the heteroduplex may be detected by immunoassay if in solid phase format or by mass spectroscopy or other known methods
  • the antisense oligomer has a base sequence directed to a targeted portion of the HIV genome, as discussed in Section II above.
  • the oligomer is able to effectively inhibit expression or action of the targeted genome region when administered to a host cell, e.g. in a mammalian subject. This requirement is met when the oligomer compound (a) has the ability to be selectively taken up by activated, HIV-infecte4d macrophage or T lymphocyte cells, (or other activated immune cells) and (b) once taken up, form a duplex with the target RNA with a Tm greater than about 45° C.
  • the ability to be taken up selectively by activated immune cells requires, in part, that the oligomer backbone be substantially uncharged.
  • the ability of the oligomer to form a stable duplex with the target RNA will depend on the oligomer backbone, the length and degree of complementarity of the antisense oligomer with respect to the target, the ratio of G:C to A:T base matches, and the positions of any mismatched bases.
  • the ability of the antisense oligomer to resist cellular nucleases promotes survival and ultimate delivery of the agent to the cell cytoplasm.
  • Antisense oligonucleotides of 15-20 bases are generally long enough to have one complementary sequence in the mammalian genome.
  • antisense compounds having a length of at least 17 nucleotides in length hybridize well with their target mRNA(Akhtar, Basu et al. 1991). Due to their hydrophobicity, antisense oligonucleotides interact well with phospholipid membranes (Akhtar, Basu et al. 1991), and it has been suggested that following the interaction with the cellular plasma membrane, oligonucleotides are actively transported into living cells (Loke, Stein et al. 1989; Yakubov, Deeva et al. 1989; Anderson, Xiong et al. 1999).
  • Morpholino oligonucleotides particularly phosphoramidate- or phosphorodiamidate-linked morpholino oligonucleotides have been shown to have high binding affinities for complementary or near-complementary nucleic acids. Morpholino oligomers also exhibit little or no non-specific antisense activity, afford good water solubility, are immune to nucleases, and are designed to have low production costs (Summerton and Weller 1997).
  • Morpholino oligonucleotides are detailed, for example, in co-owned U.S. Pat. Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,185,444, 5,521,063, and 5,506,337, all of which are expressly incorporated by reference herein
  • antisense oligomers for use in practicing the invention are composed of morpholino subunits of the form shown in the above cited patents, where (i) the morpholino groups are linked together by uncharged linkages, one to three atoms long, joining the morpholino nitrogen of one subunit to the 5′ exocyclic carbon of an adjacent subunit, and (ii) the base attached to the morpholino group is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide.
  • the purine or pyrimidine base-pairing moiety is typically adenine, cytosine, guanine, uracil or thymine. Preparation of such oligomers is described in detail in U.S. Pat. No. 5,185,444 (Summerton et al., 1993), which is hereby incorporated by reference in its entirety. As shown in this reference, several types of nonionic linkages may be used to construct a morpholino backbone.
  • Exemplary subunit structures for antisense oligonucleotides of the invention include the morpholino subunit types shown in FIGS. 1 A-D, each linked by an uncharged, phosphorous-containing subunit linkage, as shown in FIGS. 2A-2D , respectively.
  • the X moiety pendant from the phosphorous may be any of the following: fluorine; an alkyl or substituted alkyl; an alkoxy or substituted alkoxy; a thioalkoxy or substituted thioalkoxy; or, an unsubstituted, monosubstituted, or disubstituted nitrogen, including cyclic structures.
  • Alkyl, alkoxy and thioalkoxy preferably include 1-6 carbon atoms, and more preferably 1-4 carbon atoms.
  • Monosubstituted or disubstituted nitrogen preferably refers to lower alkyl substitution, and the cyclic structures are preferably 5- to 7-membered nitrogen heterocycles optionally containing 1-2 additional heteroatoms selected from oxygen, nitrogen, and sulfur.
  • Z is sulfur or oxygen, and is preferably oxygen.
  • FIG. 1A shows a phosphorous-containing linkage which forms the five atom repeating-unit backbone shown in FIG. 2A , where the morpholino rings are linked by a 1-atom phosphoamide linkage.
  • Subunit B in FIG. 1B is designed for 6-atom repeating-unit backbones, as shown in FIG. 2B .
  • the atom Y linking the 5′ morpholino carbon to the phosphorous group may be sulfur, nitrogen, carbon or, preferably, oxygen.
  • the X moiety pendant from the phosphorous may be any of the following: fluorine; an alkyl or substituted alkyl; an alkoxy or substituted alkoxy; a thioalkoxy or substituted thioalkoxy; or, an unsubstituted, monosubstituted, or disubstituted nitrogen, including cyclic structures.
  • Z is sulfur or oxygen, and is preferably oxygen.
  • Particularly preferred morpholino oligonucleotides include those composed of morpholino subunit structures of the form shown in FIG.
  • Subunits C-D in FIGS. 1 C-D are designed for 7-atom unit-length backbones as shown for structures in FIGS. 2C and D.
  • the X moiety is as in Structure B, and the moiety Y may be methylene, sulfur, or preferably oxygen.
  • the X and Y moieties are as in Structure B.
  • each Pi and Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and is preferably selected from adenine, cytosine, guanine and uracil.
  • the substantially uncharged oligomer may advantageously include a limited number of charged linkages, e.g. up to about 1 per every 5 uncharged linkages.
  • a charged linkage may be a linkage as represented by any of FIGS. 2 A-D, preferably FIG. 2B , where X is oxide (—O—) or sulfide (—S—).
  • morpholino oligomers with uncharged backbones are shown in FIGS. 3A-3G .
  • a substantially uncharged morpholino oligomer such as illustrated by the phosphorodiamidate morpholino oligomer (PMO) shown in FIG. 3G .
  • PMO phosphorodiamidate morpholino oligomer
  • a substantially uncharged backbone may include one or more, e.g., up to 10-20% of charged intersubunit linkages, typically negatively charged phosphorous linkages.
  • the antisense oligomer is designed to hybridize to a region of the target nucleic acid sequence, under physiological conditions with a Tm substantially greater than 37° C., e.g., at least 45° C. and preferably 60° C.-80° C., wherein the target nucleic acid sequence is preferentially expressed in activated lymphocytes.
  • the oligomer is designed to have high-binding affinity to the target nucleic acid sequence and may be 100% complementary thereto, or may include mismatches, e.g., to accommodate allelic variants, as long as the heteroduplex formed between the oligomer and the target nucleic acid sequence is sufficiently stable to withstand the action of cellular nucleases and other modes of degradation during its transit from cell to body fluid. Mismatches, if present, are less destabilizing toward the end regions of the hybrid duplex than in the middle. The number of mismatches allowed will depend on the length of the oligomer, the percentage of G:C base pair in the duplex and the position of the mismatch(es) in the duplex, according to well understood principles of duplex stability.
  • an antisense oligomer is not necessarily 100% complementary to a nucleic acid sequence that is preferentially expressed in activated lymphocytes, it is effective to stably and specifically bind to the target sequence such that expression of the target sequence is modulated.
  • the appropriate length of the oligomer to allow stable, effective binding combined with good specificity is about 8-40 nucleotide base units, and preferably about 12-25 nucleotides. Oligomer bases that allow degenerate base pairing with target bases are also contemplated, assuming base-pair specificity with the target is maintained.
  • mRNA transcribed from the relevant region of HIV is generally targeted by the antisense oligonucleotides for use in practicing the invention, however, in some cases double-stranded DNA may be targeted using a non-ionic probe designed for sequence-specific binding to major-groove sites in duplex DNA.
  • probe types are described in U.S. Pat. No. 5,166,315 (Summerton et al., 1992), which is hereby incorporated by reference, and are generally referred to herein as antisense oligomers, referring to their ability to block expression of target genes.
  • the method can be used to monitor the binding of the oligomer to the Vif RNA.
  • the antisense compounds for use in practicing the invention can be synthesized by stepwise solid-phase synthesis, employing methods detailed in the references cited above.
  • the sequence of subunit additions will be determined by the selected base sequence.
  • it may be desirable to add additional chemical moieties to the oligomer compounds e.g. to enhance the pharmacokinetics of the compound or to facilitate capture or detection of the compound.
  • Such a moiety may be covalently attached, typically to the 5′- or 3′-end of the oligomer, according to standard synthesis methods.
  • addition of a polyethyleneglycol moiety or other hydrophilic polymer e.g., one having 10-100 polymer subunits, may be useful in enhancing solubility.
  • One or more charged groups may enhance cell uptake.
  • a reporter moiety such as fluorescein or a radiolabeled group, may be attached for purposes of detection.
  • the reporter label attached to the oligomer may be a ligand, such as an antigen or biotin, capable of binding a labeled antibody or streptavidin.
  • Target SEQ. ID PMO Nucleotides Target Sequence (5′ to 3′) NO.
  • VIF-AUG1 5011-5035 CAAGAAGAAAAGCAAAGATC 26 ATCAG VIF-AUG2 5023-5043 CAAAGATCATCAGGGATTAT 27 G
  • VIF-AUG3 5030-5049 CATCAGGGATTATGGAAAAC 28
  • VIF-AUG4 5037 5059
  • GATTATGGAAAACAGATGGC 29 AGG
  • GAG-POL 789-806 GATGGGTGCGAGAGCGTC 32 REV-AUG 5959-5979 GGCATCTCCTATGGCAGGAA 33
  • G NEF-AUG 8786-8803 GATGGGTGGCAAGTGGTC 34
  • PMO conjugates exhibited differential uptake into lymphocytes dependent on cell activation status. PMO uptake was greatly increased in mature dendritic cells as well as activated B cells and CD4 and CD8 T cells when compared to immature or na ⁇ ve lymphocytes, as discussed below.
  • the rTAT peptide can be synthesized by a variety of known methods, including solid-phase synthesis.
  • the amino acid subunits used in construction of the polypeptide may be either l- or d-amino acids, preferably all l-amino acids or all d-amino acids. Minor (or neutral) amino acid substitutions are allowed, as long as these do not substantially degrade the ability of the polypeptide to enhance uptake of antisense compounds selectively into activated T cells.
  • One skilled in the art can readily determine the effect of amino acid substitutions by construction a series of substituted rTAT polypeptides, e.g., with a given amino acid substitution separately at each of the positions along the rTAT chain (see Example 1).
  • the rTAT polypeptide can be linked to the antisense to be delivered by a variety of methods available to one of skill in the art.
  • the linkage point can be at various locations along the transporter. In selected embodiments, it is at a terminus of the transporter, e.g., the C-terminal or N-terminal amino acid.
  • the polypeptide has, as its N terminal residue, a single cysteine residue whose side chain thiol is used for linking. Multiple transporters can be attached to a single compound if desired.
  • the transporter can be attached at the 5′ end of the PMO, e.g. via the 5′-hydroxyl group, or via an amine capping moiety, as described in Example 1C.
  • the transporter may be attached at the 3′ end, e.g. via a morpholino ring nitrogen, as described in Example 1D, either at a terminus or an internal linkage.
  • the linker may also comprise a direct bond between the carboxy terminus of a transporter peptide and an amine or hydroxy group of the PMO, formed by condensation promoted by e.g. carbodiimide.
  • Linkers can be selected from those which are non-cleavable under normal conditions of use, e.g., containing a thioether or carbamate bond. In some embodiments, it may be desirable to include a linkage between the transporter moiety and compound which is cleavable in vivo. Bonds which are cleavable in vivo are known in the art and include, for example, carboxylic acid esters, which are hydrolyzed enzymatically, and disulfides, which are cleaved in the presence of glutathione. It may also be feasible to cleave a photolytically cleavable linkage, such as an ortho-nitrophenyl ether, in vivo by application of radiation of the appropriate wavelength.
  • a conjugate having a disulfide linker using the reagent N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) or succinimidyloxycarbonyl ⁇ -methyl- ⁇ -(2-pyridyldithio) toluene (SMPT), is described in Example 1E.
  • exemplary heterobifunctional linking agents which further contain a cleavable disulfide group include N-hydroxysuccinimidyl 3-[(4-azidophenyl)dithio] propionate and others described in (Vanin).
  • the present invention provides a method and composition for delivering therapeutic compounds, e.g., uncharged antisense compounds to hematopoietic cells, and, specifically, to activated T cells, macrophages, monocytes, and mature dendritic cells.
  • therapeutic compounds e.g., uncharged antisense compounds to hematopoietic cells, and, specifically, to activated T cells, macrophages, monocytes, and mature dendritic cells.
  • the primary cellular reservoir for HIV production is from activated T cells, macrophages and dendritic cells.
  • the antiviral therapeutic effect of HIV antisense oligomers is augmented by precisely targeting the cells producing the majority of infectious virions. This is especially powerful when coupled to an antisense oligomer (e.g. antisense Vif oligomers) designed to create defective virions as the mechanism of its therapeutic effect, in part, because the crippled virus can serve as a vaccine in the infected host.
  • rTAT peptide to enhance uptake of a fluoresceinated PMO antisense compound selectively into activated mouse lymphocytes is demonstrated in the study described in Example 1, and with the results shown in FIGS. 4A-4C .
  • cultured mouse splenocytes were incubated with fluorescent rTAT-PMO conjugate and subjected to various lymphocyte activating substances, as indicated in the drawings.
  • Separate lymphocyte populations CD8 positive T cells, CD4 positive T cells, and B cells (B220 positive cells) were stained with antibody to determine the extent of uptake by FACS analysis of the cells.
  • the results show relatively low uptake of the antisense PMO into non-activated cells (dark heavy line) in all three cell types.
  • gamma-interferon gamma-IFN
  • PHA phytohemaglutinin
  • PMA+ION phorbol myristic acid+calcium ionophore
  • the rTAT peptide may be conjugated to a substantially uncharged antisense compound, to enhance its selective uptake into activated T cells, B cells, macrophages, monocytes or dendritic cells, including HIV-infected cells of these lineages.
  • the exposing step involves administering the antisense conjugate to the subject, in an amount effective to reduce the severity of the HIV infection.
  • the rTAT polypeptide is covalently coupled at its N-terminal cysteine residue to the 3′ or 5′ end of the antisense compound.
  • the antisense compound is composed of morpholino subunits and phosphorus-containing intersubunit linkages joining a morpholino nitrogen of one subunit to a 5′ exocyclic carbon of an adjacent subunit.
  • the invention further includes an antisense conjugate for use in selectively targeting activated, HIV-activated myeloid- or lymphoid-derived human cells, e.g., macrophage or T-lymphocyte cells, with an antisense conjugate.
  • the conjugate is composed of (i) a substantially uncharged antisense compound containing 12-40 subunits and a base sequence effective to hybridize to a region of HIV positive-strand RNA, e.g., the HIV Vif transcript identified by SEQ ID NOS:26-31, thereby to block expression or otherwise inhibit replication of the virus in the infected cells, and (ii) a reverse TAT (rTAT) polypeptide having the sequence identified as SEQ ID NO: 1 and covalently coupled to the antisense compound.
  • the compound may have various exemplary structural features, as described above.
  • the method includes administering to the subject, a substantially uncharged antisense conjugate of the type just described, thereby to block expression of an HIV protein or proteins or block a cis-acting genomic elements that plays a role in viral replication.
  • the PMOs were synthesized at AVI BioPharma (Corvallis, Oreg.) as previously described (Summerton and Weller, 1997). Purity of full length oligomers was >95% as determined by reverse-phase high-pressure liquid chromatography (HPLC) and MALDI TOF mass spectroscopy. Peptide conjugated forms of the PMO where produced by attaching the carboxy terminal cysteine of the peptide to the 5′ end of the PMO through a cross-linker N-[ ⁇ -maleimidobutyryloxy] succinimide ester (GMBS) (Moulton and Moulton, 2003), as detailed below in section C.
  • GMBS N-[ ⁇ -maleimidobutyryloxy] succinimide ester
  • P002 RRRQRRKKRC, SEQ ID NO:1 (Moulton and Moulton, 2003) and P003 (RRRRRRRRRFFC, SEQ ID NO:2).
  • the lyophilized PMO or peptide-conjugated PMO were dissolved in sterile H 2 O prior to use in cell cultures or dilution in PBS prior to injection in to mice.
  • a protected and activated carboxyfluorescein e.g. 6-carboxyfluorescein dipivalate N-hydroxysuccinimide ester, commercially available from Berry & Associates, Inc. (Dexter, Mich.)
  • NMP 0.05M
  • the mixture was incubated at 45° C. for 20 minutes, then the column was drained and a second similar portion of protected and activated carboxyfluorescein was added to the column and incubated at 45° C. for 60 minutes.
  • the column was drained and washed with NMP, and the oligomer was cleaved from the resin using 1 ml of cleavage solution (0.1M dithiothreitol in NMP containing 10% triethylamine).
  • the resin was washed with 300 ⁇ l of cleavage solution three times, immediately followed by addition of 4 ml of concentrated ammonia hydroxide and 16 hours incubation at 45° C. to remove base protecting groups.
  • the morpholino oligomer was precipitated by adding 8 volumes of acetone, the mixture was centrifuged, and the pellet was washed with 15 ml of CH 3 CN. The washed pellet was re-dissolved in 4 ml of H 2 O and lyophilized.
  • the product was analyzed by time-of-flight MALDI mass spectrometry (MALDI-TOF) and high pressure liquid chromatography (HPLC).
  • MALDI-TOF time-of-flight MALDI mass
  • the cross linker, N-( ⁇ -maleimidobutyryloxy)succinimide ester (GMBS), was dissolved in 50 ⁇ l of DMSO, and the solution was added to the oligomer (2-5 mM) in sodium phosphate buffer (50 mM, pH 7.2) at a 1:2 PMO/GMBS molar ratio. The mixture was stirred at room temperature in the dark for 30 minutes, and the product was precipitated using a 30-fold excess of acetone, then redissolved in water.
  • the PMO-GMBS adduct was lyophilized and analyzed by MALDI-TOF and HPLC.
  • the adduct was then dissolved in phosphate buffer (50 mM, pH 6.5, 5 mM EDTA) containing 20% CH 3 CN, and the transport peptide was added, at a 2:1 peptide to PMO molar ratio (based on a PMO concentration as determined by its absorbance at 260 nm).
  • the reaction was stirred at room temperature in the dark for 2 hours.
  • the conjugate was purified first through a CM-Sepharose (Sigma, St. Louis, Mo.) cationic exchange column, to remove unconjugated PMO, then through a reverse phase column (HLB column, Waters, Milford, Mass.).
  • the conjugate was lyophilized and analyzed by MALDI-TOF and capillary electrophoresis (CE).
  • the final product contained about 70% material corresponding to the full length PMO conjugated to the transport peptide, with the balance composed of shorter sequence conjugates, a small amount of unconjugated PMO, both full length and fragments, and a very small amount (about 2%) of unconjugated peptide.
  • the concentration determination used for all experiments was based on the total absorbance at 260 nm, including all shorter PMO sequences in the sample.
  • a PMO having a free secondary amine (ring nitrogen of morpholine) at the 5′-end was dissolved in 100 mM sodium phosphate buffer, pH 7.2, to make a 2-5 mM solution.
  • the linking reagent, GMBS was dissolved in 100 ⁇ l of DMSO and added to the PMO solution at a PMO/GMBS ratio of 1:2. The mixture was stirred at room temperature in the dark for 30 min, then passed through a P2 (Biorad) gel filtration column to remove the excess GMBS and reaction by-products.
  • the GMBS-PMO adduct was lyophilized and re-dissolved in 50 mM phosphate buffer, pH 6.5, to make a 2-5 mM solution.
  • a transport peptide having a terminal cysteine was added to the GMBS-PMO solution at a molar ratio of 2:1 peptide to PMO.
  • the reaction mixture was stirred at room temperature for 2 hours or at 4° C. overnight.
  • the conjugate was purified by passing through Excellulose gel filtration column (Pierce Chemical) to remove excess peptide, then through a cation exchange CM-Sepharose column (Sigma) to remove unconjugated PMO, and finally through an Amberchrom reverse phase column (Rohm and Haas) to remove salt.
  • the conjugate was lyophilized and characterized by MS and HPLC.
  • the DO11.10 transgenic mouse system (Murphy, Heimberger et al. 1990) was used as a source of splenocytes and T cells.
  • This transgenic mouse contains the gene for the T cell receptor (TCR) from the T cell hybridoma, DO11.10, that recognizes chicken ovalbumin (OVA).
  • TCR T cell receptor
  • OVA chicken ovalbumin
  • Lymphocyte activating substances derived from bacterial (LPS), murine cytokine (Gamma IFN), mitogenic plant lectin (PHA), chemical activator (PMA+ION) or culture media control (na ⁇ ve cell treatment) were added to individual cultures as follows; LPS [1 ⁇ g/ml] (lipopolysaccharide), murine gamma interferon [10 ng/ml], PHA (phytohemaglutanin) [2.5 ⁇ g/ml], PMA (phorbol myristic acid)+calcium ionophore [10 ng/ml+5 ng/ml] or RPMI+10% fetal calf serum.
  • LPS lipopolysaccharide
  • murine gamma interferon 10 ng/ml
  • PHA phytohemaglutanin
  • PMA phorbol myristic acid
  • RPMI+10% fetal calf serum RPMI+10% fetal calf serum.
  • Staining of lymphocyte populations was performed using anti-CD4 or anti CD8 PE-Texas Red [0.3 ⁇ g/million cells] (CalTag) or anti-CD45R (clone B220) APC (eBioscience) [0.4 mg/million cells] for 30 min on ice.
  • the cells were washed twice with cold FACS buffer and suspended in 50 ⁇ l of cold cyofix/cytoperm reagent (Pharmingen) for 30 min to lyse remaining red blood cells.
  • the cells were washed once with FACS buffer and suspended in 200 ⁇ l FACS buffer prior to analysis. Cell staining and PMO-fl uptake was measured using a FACSCalibur flow cytometer (Becton Dickinson). Flow data was analyzed using FCS Express 2 Pro software (Denovo software).
  • FIG. 4 demonstrates that separate lymphocytes populations all have enhanced uptake of P002-PMO conjugate when activated by a variety of lymphocyte activators. Different lymphocyte populations were stained with antibodies to determine the extent of uptake by FACS analysis in T cells A) CD8 positive T cells, B) CD4 positive T cells and C) B cells (B220 positive cells).
  • FIG. 5 is similar to FIG. 4 except that P003-PMO-fl was compared to P002-PMO-fl and unconjugated PMO-fl in A) CD8 positive T cells and B) CD4 positive T cells.
  • the P002-PMO-fl treated cells were activated with PHA as described above.
  • the figure indicates that the P003 peptide greatly enhances uptake in na ⁇ ve T-cells of both CD4 and CD8 lineages compared to PHA-activated T-cells treated with P002-PMO-fl. Uptake of the PMO-fl without a peptide conjugate is undetectable.
  • Sequence ID Listing SEQ ID Peptide Sequences NO.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • AIDS & HIV (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Transplantation (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
US10/971,959 2003-09-23 2004-10-21 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells Abandoned US20050222068A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US10/971,959 US20050222068A1 (en) 2003-10-23 2004-10-21 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells
CA002542875A CA2542875A1 (en) 2003-10-23 2004-10-22 Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells
PCT/US2004/035121 WO2005041874A2 (en) 2003-10-23 2004-10-22 Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells
EP04796169A EP1682073A2 (de) 2003-10-23 2004-10-22 Verfahren und antisense-zusammensetzung für die selektive hemmung von hiv-infektion in hämatopoetischen zellen
AU2004285494A AU2004285494A1 (en) 2003-10-23 2004-10-22 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells
US11/433,257 US20070037764A1 (en) 2003-10-23 2006-05-11 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells
US11/941,033 US8008469B2 (en) 2003-10-23 2007-11-15 Antisense compound for inducing immunological tolerance
US11/940,987 US20080187993A1 (en) 2003-10-23 2007-11-15 Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells
US13/187,338 US20120027791A1 (en) 2003-09-23 2011-07-20 Antisense compound for inducing immunological tolerance

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US51406403P 2003-10-23 2003-10-23
US10/971,959 US20050222068A1 (en) 2003-10-23 2004-10-21 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US11/433,257 Continuation-In-Part US20070037764A1 (en) 2003-10-23 2006-05-11 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells
US11/941,033 Continuation US8008469B2 (en) 2003-09-23 2007-11-15 Antisense compound for inducing immunological tolerance
US11/940,987 Continuation US20080187993A1 (en) 2003-10-23 2007-11-15 Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells

Publications (1)

Publication Number Publication Date
US20050222068A1 true US20050222068A1 (en) 2005-10-06

Family

ID=34555922

Family Applications (5)

Application Number Title Priority Date Filing Date
US10/971,959 Abandoned US20050222068A1 (en) 2003-09-23 2004-10-21 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells
US11/433,257 Abandoned US20070037764A1 (en) 2003-10-23 2006-05-11 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells
US11/941,033 Expired - Fee Related US8008469B2 (en) 2003-09-23 2007-11-15 Antisense compound for inducing immunological tolerance
US11/940,987 Abandoned US20080187993A1 (en) 2003-10-23 2007-11-15 Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells
US13/187,338 Abandoned US20120027791A1 (en) 2003-09-23 2011-07-20 Antisense compound for inducing immunological tolerance

Family Applications After (4)

Application Number Title Priority Date Filing Date
US11/433,257 Abandoned US20070037764A1 (en) 2003-10-23 2006-05-11 Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells
US11/941,033 Expired - Fee Related US8008469B2 (en) 2003-09-23 2007-11-15 Antisense compound for inducing immunological tolerance
US11/940,987 Abandoned US20080187993A1 (en) 2003-10-23 2007-11-15 Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells
US13/187,338 Abandoned US20120027791A1 (en) 2003-09-23 2011-07-20 Antisense compound for inducing immunological tolerance

Country Status (5)

Country Link
US (5) US20050222068A1 (de)
EP (1) EP1682073A2 (de)
AU (1) AU2004285494A1 (de)
CA (1) CA2542875A1 (de)
WO (1) WO2005041874A2 (de)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070082862A1 (en) * 2003-03-19 2007-04-12 Hiroshi Takaku Novel antisense oligonucleotide and anti-hiv agent
US20120276071A1 (en) * 2011-04-28 2012-11-01 University Of Notre Dame Anti-HIV Group I Introns and Uses Thereof in Treating HIV Infections
US11020417B2 (en) * 2015-06-04 2021-06-01 Sarepta Therapeutics, Inc Methods and compounds for treatment of lymphocyte-related diseases and conditions

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL211872B1 (pl) 2000-03-31 2012-07-31 Purdue Research Foundation Kompozycja farmaceutyczna
EP2168598A1 (de) * 2001-09-28 2010-03-31 Purdue Research Foundation Verfahren zur Behandlung mit Ligand-Immunogen-Konjugaten
DE602004028930D1 (de) 2003-04-29 2010-10-14 Avi Biopharma Inc Zusammensetzungen zur verbesserung der antisense-wirksamkeit und des transports von nukleinsäureanalog in zellen
US20050288246A1 (en) 2004-05-24 2005-12-29 Iversen Patrick L Peptide conjugated, inosine-substituted antisense oligomer compound and method
US8067571B2 (en) 2005-07-13 2011-11-29 Avi Biopharma, Inc. Antibacterial antisense oligonucleotide and method
US8168164B2 (en) * 2006-02-03 2012-05-01 Purdue Research Foundation Targeted conjugates and radiation
US20100016215A1 (en) 2007-06-29 2010-01-21 Avi Biopharma, Inc. Compound and method for treating myotonic dystrophy
ES2694726T3 (es) * 2007-06-29 2018-12-26 Sarepta Therapeutics, Inc. Conjugados peptídicos específicos de tejido y métodos
CA2705808A1 (en) * 2007-11-15 2009-05-22 Endocyte, Inc. Method of administering conjugates
AU2009335740B2 (en) * 2008-12-17 2016-04-21 Sarepta Therapeutics, Inc. Antisense compositions and methods for modulating contact hypersensitivity or contact dermatitis
US9161948B2 (en) 2011-05-05 2015-10-20 Sarepta Therapeutics, Inc. Peptide oligonucleotide conjugates
CN102352360B (zh) * 2011-11-11 2012-10-10 南开大学 抑制hiv-1的双长发卡结构rna表达原件的构建及功能检测
WO2015048395A1 (en) * 2013-09-26 2015-04-02 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Tolerogenic dendritic cells to treat inflammatory bowel disease
PL3554553T3 (pl) 2016-12-19 2022-11-07 Sarepta Therapeutics, Inc. Koniugaty oligomerów z pominięciem egzonu w dystrofii mięśniowej
WO2022098268A2 (en) * 2020-11-04 2022-05-12 Ibrahim Ahmed Ibrahim Mohamed Comb shaped antivirals ending with or without chain terminating bases

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050203041A1 (en) * 2003-09-23 2005-09-15 Mourich Dan V. Antisense compound and method for selectively killing activated T cells

Family Cites Families (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5185444A (en) * 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
EP0639582B1 (de) * 1985-03-15 1998-09-16 Antivirals Inc. Immunotestmittel für Polynukleotid und Verfahren
US5506337A (en) * 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5521063A (en) * 1985-03-15 1996-05-28 Antivirals Inc. Polynucleotide reagent containing chiral subunits and methods of use
US5217866A (en) * 1985-03-15 1993-06-08 Anti-Gene Development Group Polynucleotide assay reagent and method
US5166315A (en) * 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
WO1990007936A1 (en) 1989-01-23 1990-07-26 Chiron Corporation Recombinant therapies for infection and hyperproliferative disorders
CA2585164C (fr) 1989-06-02 2010-02-02 Institut Pasteur Sequences nucleotidiques issues du genome des retrovirus du type hiv-1, hiv-2 et siv, et leurs applications notamment pour l'amplification des genomes de ces retrovirus et pour lediagnostic in vitro des infections dues a ces virus
FR2647809B1 (fr) 1989-06-02 1991-09-20 Pasteur Institut Amorces oligonucleotidiques pour l'amplification du genome des retrovirus du type hiv-1, hiv-2 et siv, et leurs applications au diagnostic in vitro des infections dues a ces virus
GB8923123D0 (en) 1989-10-13 1989-11-29 Connaught Lab A vaccine for human immunodeficiency virus
US5852188A (en) * 1990-01-11 1998-12-22 Isis Pharmaceuticals, Inc. Oligonucleotides having chiral phosphorus linkages
EP0543938A4 (en) * 1990-08-14 1993-11-10 Isis Pharmaceuticals, Inc. Inhibition of influenza virus type a, ann arbor strain h2n2 by antisense oligonucleotides
US5576302A (en) * 1991-10-15 1996-11-19 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating hepatitis C virus having phosphorothioate linkages of high chiral purity
EP0672175A4 (de) * 1991-12-23 1997-08-06 Chiron Corp Hav-proben in sandwichhybridisierungsverfahren in lösungen.
US6174868B1 (en) * 1992-09-10 2001-01-16 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of hepatitis C virus-associated diseases
WO1995005851A1 (en) 1993-08-20 1995-03-02 St. Luke's-Roosevelt Hospital Center HIV vif-RELATED COMPOSITIONS, AND PROPHYLACTIC AND THERAPEUTIC USES THEREOF
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US6060456A (en) * 1993-11-16 2000-05-09 Genta Incorporated Chimeric oligonucleoside compounds
US5733781A (en) * 1994-07-19 1998-03-31 Gen-Probe Incorporated Oligonucleotides and methods for inhibiting propagation of human immunodeficiency virus
US5734039A (en) * 1994-09-15 1998-03-31 Thomas Jefferson University Antisense oligonucleotides targeting cooperating oncogenes
GB9510718D0 (en) * 1995-05-26 1995-07-19 Sod Conseils Rech Applic Antisense oligonucleotides
US5955318A (en) * 1995-08-14 1999-09-21 Abbott Laboratories Reagents and methods useful for controlling the translation of hepatitis GBV proteins
US5849727A (en) * 1996-06-28 1998-12-15 Board Of Regents Of The University Of Nebraska Compositions and methods for altering the biodistribution of biological agents
EP0975370B9 (de) * 1997-05-21 2004-11-03 The Board Of Trustees Of The Leland Stanford Junior University Zusammensetzung und verfahren zur verzögerung des transports durch biologische membranen
US6133246A (en) * 1997-08-13 2000-10-17 Isis Pharmaceuticals Inc. Antisense oligonucleotide compositions and methods for the modulation of JNK proteins
US6228579B1 (en) * 1997-11-14 2001-05-08 San Diego State University Foundation Method for identifying microbial proliferation genes
US6210892B1 (en) * 1998-10-07 2001-04-03 Isis Pharmaceuticals, Inc. Alteration of cellular behavior by antisense modulation of mRNA processing
US7094765B1 (en) * 1999-01-29 2006-08-22 Avi Biopharma, Inc. Antisense restenosis composition and method
WO2000045167A2 (en) * 1999-01-29 2000-08-03 Avi Biopharma, Inc. Non-invasive method for detecting target rna
US20020049173A1 (en) * 1999-03-26 2002-04-25 Bennett C. Frank Alteration of cellular behavior by antisense modulation of mRNA processing
AU781094B2 (en) * 1999-05-24 2005-05-05 Avi Biopharma, Inc. Antisense to c-myc for treatment of polycystic kidney disease
US6669951B2 (en) * 1999-08-24 2003-12-30 Cellgate, Inc. Compositions and methods for enhancing drug delivery across and into epithelial tissues
KR20020064915A (ko) * 1999-11-29 2002-08-10 에이브이아이 바이오파마 인코포레이티드 안티센스 항박테리아 방법 및 조성물
CA2396068A1 (en) * 2000-01-04 2001-07-12 Avi Biopharma, Inc. Antisense antibacterial cell division composition and method
US6228105B1 (en) * 2000-03-01 2001-05-08 Gerber Products Company Flexible pacifier
AU4036600A (en) 2000-03-28 2001-10-08 Isis Pharmaceuticals Inc Alteration of cellular behavior by antisense modulation of mrna processing
AU5752601A (en) * 2000-05-04 2001-11-12 Avi Biopharma Inc Splice-region antisense composition and method
WO2002004479A1 (en) * 2000-07-06 2002-01-17 Avi Biopharma, Inc. TRANSFORMING GROWTH FACTOR BETA (TGF-β) BLOCKING AGENT-TREATED STEM CELL COMPOSITION AND METHOD
AU2001289085A1 (en) * 2000-09-20 2002-04-02 Isis Pharmaceuticals, Inc. Antisense modulation of flip-c expression
AU2002342057B2 (en) * 2001-10-16 2009-01-22 Avi Biopharma, Inc. Antisense antiviral agent and method for treating ssRNA viral infection
US20030224353A1 (en) * 2001-10-16 2003-12-04 Stein David A. Antisense antiviral agent and method for treating ssRNA viral infection
CA2498777C (en) * 2002-09-13 2015-01-13 Replicor, Inc. Non-sequence complementary antiviral oligonucleotides
EP2977470B1 (de) * 2002-10-16 2018-01-03 Gen-Probe Incorporated Zusammensetzungen und verfahren zum nachweis des west-nil-virus
JP4791043B2 (ja) 2002-12-31 2011-10-12 プロリゴ・エルエルシー 同一固体支持体上で、２以上のオリゴヌクレオチドをタンデムに合成するための方法および組成物
DE602004028930D1 (de) * 2003-04-29 2010-10-14 Avi Biopharma Inc Zusammensetzungen zur verbesserung der antisense-wirksamkeit und des transports von nukleinsäureanalog in zellen
US20050234002A1 (en) * 2004-01-23 2005-10-20 Mourich Dan V Antisense oligomers and methods for inducing immune tolerance and immunosuppression
US8129352B2 (en) * 2004-09-16 2012-03-06 Avi Biopharma, Inc. Antisense antiviral compound and method for treating ssRNA viral infection
TW200622777A (en) * 2004-12-31 2006-07-01 Inventec Corp Manufacturing-order giving system and method thereof
CA2596506C (en) * 2005-02-09 2021-04-06 Avi Biopharma, Inc. Antisense composition and method for treating muscle atrophy
US8501704B2 (en) * 2005-11-08 2013-08-06 Sarepta Therapeutics, Inc. Immunosuppression compound and treatment method
DK2024499T3 (da) * 2006-05-10 2018-01-29 Sarepta Therapeutics Inc Oligonukleotidanaloger med kationiske intersubunit-koblinger
ES2694726T3 (es) * 2007-06-29 2018-12-26 Sarepta Therapeutics, Inc. Conjugados peptídicos específicos de tejido y métodos
WO2009086469A2 (en) 2007-12-28 2009-07-09 Avi Biopharma, Inc. Immunomodulatory agents and methods of use
AU2009335740B2 (en) 2008-12-17 2016-04-21 Sarepta Therapeutics, Inc. Antisense compositions and methods for modulating contact hypersensitivity or contact dermatitis

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050203041A1 (en) * 2003-09-23 2005-09-15 Mourich Dan V. Antisense compound and method for selectively killing activated T cells

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070082862A1 (en) * 2003-03-19 2007-04-12 Hiroshi Takaku Novel antisense oligonucleotide and anti-hiv agent
US20120276071A1 (en) * 2011-04-28 2012-11-01 University Of Notre Dame Anti-HIV Group I Introns and Uses Thereof in Treating HIV Infections
US9707257B2 (en) * 2011-04-28 2017-07-18 The University Of Notre Dame Anti-HIV group I introns and uses thereof in treating HIV infections
US11020417B2 (en) * 2015-06-04 2021-06-01 Sarepta Therapeutics, Inc Methods and compounds for treatment of lymphocyte-related diseases and conditions

Also Published As

Publication number Publication date
US20070037764A1 (en) 2007-02-15
WO2005041874A2 (en) 2005-05-12
AU2004285494A1 (en) 2005-05-12
US20080187993A1 (en) 2008-08-07
CA2542875A1 (en) 2005-05-12
WO2005041874A9 (en) 2010-01-14
US8008469B2 (en) 2011-08-30
US20120027791A1 (en) 2012-02-02
US20090111977A1 (en) 2009-04-30
EP1682073A2 (de) 2006-07-26

Similar Documents

Publication Publication Date Title
US20080187993A1 (en) Method and antisense composition for selective inhibition of hiv infection in hematopoietic cells
US8415313B2 (en) Antisense oligomers and methods for inducing immune tolerance and immunosuppression
US8030292B2 (en) Antisense antiviral compounds and methods for treating a filovirus infection
US6645501B2 (en) Anti-pathogen system and methods of use thereof
Kaushik et al. Anti-TAR polyamide nucleotide analog conjugated with a membrane-permeating peptide inhibits human immunodeficiency virus type 1 production
US7696179B2 (en) Inhibition of gene expression using RNA interfering agents
Trejo et al. The HTLV receptor is a widely expressed protein
US20070111962A1 (en) Immunosuppression compound and treatment method
CA2539972C (en) Antisense compound and method for selectively killing activated t cells
US20060293268A1 (en) Antisense antiviral compounds and methods for treating foot and mouth disease
Kitajima et al. Ribozyme‐based gene cleavage approach to chronic arthritis associated with human T cell leukemia virus type I. Induction of apoptosis in synoviocytes by ablation of HTLV‐I tax protein
Zehender et al. Resistance to Fas-mediated apoptosis of human T-cell lines expressing human T-lymphotropic virus type-2 (HTLV-2) Tax protein
CA2236036A1 (en) Signal-regulated, cleavage-mediated toxins
US20160310567A1 (en) Compositions for inhibiting viral replication and methods of use and production thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: AVI BIOPHARMA, INC., OREGON

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MOURICH, DAN V.;IVERSEN, PATRICK L.;BESTWICK, RICHARD K.;REEL/FRAME:016430/0258

Effective date: 20050329

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION