US20040137473A1 - Use of representations of DNA for genetic analysis - Google Patents

Use of representations of DNA for genetic analysis Download PDF

Info

Publication number
US20040137473A1
US20040137473A1 US10/677,396 US67739603A US2004137473A1 US 20040137473 A1 US20040137473 A1 US 20040137473A1 US 67739603 A US67739603 A US 67739603A US 2004137473 A1 US2004137473 A1 US 2004137473A1
Authority
US
United States
Prior art keywords
dna
representation
representations
array
probes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/677,396
Other languages
English (en)
Inventor
Michael Wigler
Robert Lucito
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cold Spring Harbor Laboratory
Original Assignee
Cold Spring Harbor Laboratory
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cold Spring Harbor Laboratory filed Critical Cold Spring Harbor Laboratory
Priority to US10/677,396 priority Critical patent/US20040137473A1/en
Publication of US20040137473A1 publication Critical patent/US20040137473A1/en
Priority to US11/094,388 priority patent/US7531307B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C12Q1/6855—Ligating adaptors

Definitions

  • the field of the invention is genetic analysis.
  • the second approach is to examine changes in the cancer genome itself.
  • DNA is more stable than RNA, and can be obtained from poorly handled tissues, and even from fixed and archived biopsies.
  • the genetic changes that occur in the cancer cell if their cytogenetic location can be sufficiently resolved, can be correlated with known genes as the data bases of positionally mapped cDNAs mature. Thus, the information derived from such an analysis is not likely to become obsolete.
  • the nature and number of genetic changes can provide clues to the history of the cancer cell.
  • a high resolution genomic analysis may lead to the discovery of new genes involved in the etiology of the disease or disorder of interest.
  • Microarrays typically have many different DNA molecules, often referred to as probes, fixed at defined coordinates, or addresses, on a flat, usually glass, support. Each address contains either many copies of a single DNA probe, or a mixture of different DNA probes, and each DNA molecule is usually 2000 nucleotides or less in length.
  • the DNAs can be from many sources, including genomic DNA or cDNA, or can be synthesized oligonucleotides. For clarity and brevity, we refer to those chips with genomic or cDNA derived probes as DNA chips and those chips with synthesized oligonucleotide probes as oligo chips, respectively. Chips are typically hybridized to samples, applied as single stranded nucleic acids in solution.
  • the extent of hybridization with samples at a given address is determined by many factors including the concentration of complementary sequences in the sample, the probe concentration, and the volume of sample from which each address is able to capture complementary sequences by hybridization. We refer to this volume as the diffusion volume. Because the diffusion volume, and hence, the potential hybridization signal, may vary from address to address in the hybridization chamber, the probe array is most accurate as a comparator, measuring the ratio of hybridization between two differently labeled specimens (the sample) that are thoroughly mixed and therefore share the same hybridization conditions, including the same diffusion volume. Typically the two specimens will be from diseased and disease free cells.
  • the compound chip partially addresses this problem by increasing the nucleotide complexity of different probes at a given address, allowing for the capture of several species of DNA fragments at a single address.
  • the signals of the different captured species combine to yield a detectable level of hybridization from genomic DNA.
  • Present forms of compound probe arrays place the insert found in a single clone of a megacloning vector, such as a BAC, at each address. Because each address contains fragments derived from the entire BAC clone, several problems are created. The presence of repeat elements in the genomic inserts requires quenching with cold unlabeled DNA. Also, the great size of the megacloning vector inserts limits the positional resolution.
  • hybridization to a particular address reveals only to which BAC the hybridizing sequence is complementary, and does not reveal the specific complementary gene or sequence within that BAC.
  • Another drawback is the presence of DNA derived from the megacloning vector and host sequences. The steps of excising and purifying the genomic DNA inserts from the vector and host sequences complicate and hinder rapid fabrication of microarrays.
  • RDA representational difference analysis
  • amplicon representation is a set of restriction endonuclease fragments of a limited size range generated by PCR (polymerase chain reaction). PCR generates sufficient amounts of DNA for subsequent processing, on the order of 100 ug, starting from as little as 3 ng of DNA (the amount of DNA isolatable from about 1000 cells).
  • amplicon useful in RDA is that an amplicon representation with much lower complexity than that of the genome from which the amplicon is derived is needed to enable the subtractive hybridization to proceed effectively.
  • Such low complexity representations do not “capture” enough (typically, 7% or less) of the genome to be generally useful for other applications.
  • the complexity of the representation is related to the frequency of cutting of the restriction enzyme used to generate the genomic fragments, combined with the amplification reaction steps, e.g., PCR, which tend to favor the smaller fragments.
  • WGA Whole genome amplification
  • the amplified DNA can not be used for Southern analysis.
  • a representation of DNA is a sampling of DNA produced by a restriction endonuclease digestion of genomic or other DNA, followed by linkage of adaptors and then amplification with primers complementary to the adaptors.
  • the DNA may be from any source.
  • Sources from which representations can be made include, but are not limited to, genomic or cDNA from tumor biopsy samples, including breast cancer and prostate cancer biopsies, normal tissue samples, tumor cell lines, normal cell lines, cells stored as fixed specimens, autopsy samples, forensic samples, paleo-DNA samples, microdissected tissue samples, isolated nuclei, and fractionated cell or tissue samples.
  • genomic complexity of a representation can range from below 1% to as high as 95% of the total genome. This simplification allows for desirable hybridization kinetics.
  • Probes from representations of genomic DNA can be used as the probe of the microarray, and as the labeled sample hybridized to any microarray, however derived. Because formation of a representation involves the step of amplifying the DNA via an amplification reaction, such as the polymerase chain reaction, ligase chain reaction, etc., very small amounts of DNA can be used as starting material.
  • an amplification reaction such as the polymerase chain reaction, ligase chain reaction, etc.
  • compound representations defined as a representation of a representation, is also provided by the present invention. As is fully described below, compound representations can be used, for example, to screen for polymorphisms.
  • representational difference analysis can be used for the efficient removal of vector and host sequences when constructing microarrays from megacloning vectors.
  • RDA may also be used to remove any known, unwanted sequences from the representation, including repetitive sequences.
  • concise representation refers to a sampling of DNA produced by a restriction endonuclease digestion of genomic or other DNA, followed by linkage of adaptors and then amplification with primers complementary to the adaptors.
  • compound representation refers to a representation of a representation.
  • the present invention is also directed to methods for the production of High Complexity Representations (HCRs) of the DNA from cells.
  • HCR High Complexity Representations
  • the HCR is made by completely digesting a small amount of DNA from any source with a relatively frequent cutting restriction endonuclease, ligating adaptor oligonucleotides to the ends of the resulting fragments, and amplifying the fragments, for example by PCR, using primers to said adaptor oligonucleotides.
  • the HCR is made by completely digesting a small amount of DNA from any source with at least two restriction endonucleases, ligating adaptor oligonucleotides to the ends of the resulting fragments, and amplifying the fragments, for example by PCR, using primers to said adaptor oligonucleotides.
  • HCRs can represent from 20% to 95% of the genome, depending on the restriction enzyme or enzymes used, and the conditions of the PCR amplification.
  • Sources from which HCR's can be made include, but are not limited to, tumor biopsy samples, including breast cancer and prostate cancer biopsies, normal tissue samples, tumor cell lines, normal cell lines, cells stored as fixed specimens, autopsy samples, forensic samples, paleo-DNA samples, microdissected tissue samples, isolated nuclei, and fractionated cell or tissue samples.
  • HCRs are useful for, but not limited to, determining gene copy number, deletion mapping, determining loss of heterozygosity, comparative genomic hybridization, and archiving of DNA.
  • FIGS. 1 illustrates the results of PCR reactions designed to quantitate the complexity of HCRs.
  • Panel A shows a gel on which the products of PCR reactions have been separated and visualized. The PCR reactions were performed using probes chosen randomly from an assortment of sequence tags, representing sequences known to be present in the human genome. This sequence tag is present in all of the HCRs produced from 14 tumor biopsy normals obtained by sorting (numbered 1-14). M represents the marker ⁇ x174 HaeIII digested. G denotes two different genomic DNAs used as positive controls, and—denotes a reaction which contained no DNA.
  • Panel B shows the products of reactions performed on HCRs with 6 probes chosen randomly from an assortment of sequence tags, representing sequences known to be present in the human genome.
  • FIGS. 2 illustrates an analysis of copy number using low (LCR) and high (HCR) complexity representations and genomic DNA (Genomic) for several amplified loci (cycD1, c-erB2, and c-myc each denoting the respective locus).
  • Panel a is a Southern blot comparing tumor cell lines (T) to normal (N).
  • DpnII represents the HCRs and BglII represents the LCRs.
  • the lane marked probe denotes the free probe used as a marker.
  • the probes used for hybridization were derived from small BglII fragments isolated from P1 clones specific for each locus respectively.
  • FIG. 2B represents the quantitation of the above described Southern blots comparing the amount of amplification of high and low complexity representations with genomic DNA cut with the same restriction enzyme used to generate each representation.
  • FIG. 3 illustrates the use of HCRs for deletion mapping. Shown is the deletion mapping of 7 tumor cell lines (designated 1-7) which already display a known deletion pattern for several probes from the human genomic region 20p11. The deletion pattern of the DpnII HCRs (denoted HCR) is compared to the DpnII digest of the genomic DNA (denoted Genomic).
  • FIG. 4 illustrates a comparison of primary tumor biopsies by HCR Southern blotting analysis.
  • Primary tumor biopsy HCRs (denoted by a number preceded by BBR, CHTN, or NSBR) from matched diploid (Dpl) and aneuploid (Anu) were compared by Southern blot analysis.
  • the c-myc probe which was hybridized was the same as that used in FIG. 2.
  • FIG. 5 illustrates the results of a quantitative PCR analysis of HCRs. Diploid (Dpl) and aneuploid (Anu) HCRs derived from sorted primary tumor biopsies were used as template for QPCR analysis. Probes from several genomic regions (FHIT, p16, and c-erB2) were used to determine copy number in several HCRs. The data from the ABI 7700 Sequence Detector was analyzed with MS Excel to produce the graphs shown. The X axis represents the cycle number during the reaction and the Y axis denotes the fluorescence produced.
  • FIG. 6 illustrates the use of HCRs for LOH analysis. Shown is LOH analysis carried out on HCRs derived from sorted primary tumor biopsies, where Dpl denotes diploid and Anu denotes aneuploid.
  • the primers used in the reaction amplify a fragment from the p53 locus which contains a tetranucleotide repeat.
  • +Gen denotes a mixed population normal genomic DNA which was used as positive control and +HCR denotes the HCR produced from this mixed normal genomic DNA.
  • ⁇ lane represents a reaction which no template was added.
  • FIG. 7 illustrates the use of HCRs for comparative genomic hybridization. Shown are two representative chromosome spreads (Ch 1, and Ch 17) comparing the genomic (Gen) to the HCR, for two different cell lines, BT474, and MCF7. Lines below the spreads denote differences which exceed the standard deviation, suggesting an abnormal copy number.
  • FIGS. 8 A-C graphically depict the results of microarray experiments graphed such that the intensity of one channel (usually the Cy3 channel)is the abscissa and the ratio of CyS to Cy3 is the ordinate.
  • FIG. 9 graphically depicts the comparison of two microarray experiments performed with parallel representations produced from the two cell lines MDA-MB-415 and SKBR-3.
  • FIGS. 10 A-D illustrate the analysis of 36 probes that displayed copy number differences from the previous experiment shown in FIG. 2 by Southern blotting representations and genomic DNA from the two cell lines MDA-MB-415 and SKBR-3.
  • FIG. 11 shows the ratios of gene copy number obtained by microarray measurement on the x-axis with ratios obtained by quantitative blotting of representations on the y-axis.
  • FIGS. 12 A-C show the comparison of hybridizations of BglII representations to that of DpnII representations.
  • the present invention provides for the use of simple and compound representations of DNA in microarray technology. Representations are used to obtain a reproducible sampling of the genome that has reduced complexity.
  • a representational protocol initiates with restriction endonuclease cleavages followed by ligation of oligonucleotides to the cleaved DNA. Ultimately, these oligonucleotides are used for a gene amplification protocol such as PCR.
  • the resulting representation can be advantageously applied to microarray technology as both the arrayed probe and hybridized sample.
  • Inter ALU PCR utilizes alu consensus primers to amplify the unique sequences between alu sequences. Only those fragments between alu sequences and small enough to be amplified by PCR are present in the Inter ALU samplings. Like the previously described method, the disadvantage of this method is that the sampling is highly dependent on PCR conditions, especially temperature. Due to the fact that the primers for amplification are hybridizing to endogenous sequences, any mismatch between the primer and the recognition site in the alu sequence would cause a change in the representation. Any temperature fluctuation during amplification could create markedly different representations from the same sample if produced at different times. If this type of representation were used for microarray experiments, comparison from experiment to experiment would be difficult. These variations caused by inefficient amplification due to mismatch would make the production of a microarray based on this technique difficult if not impossible.
  • a representation of DNA is a sampling of DNA, for example, the genome, produced by a restriction endonuclease digestion of genomic or other DNA, followed by linkage of adaptors and then amplification with primers complementary to the adaptors (Lucito et al., 1998, Proc. Natl. Acad. Sci. USA 95:4487-4492, incorporated herein by reference). Generally, only fragments in the size range of 200-1200 bp amplify well, so the representation is a subset of the genome.
  • any use of a simple or compound representation as a source for the probe attached to a chip, or as the sample hybridized to the chip, or as DNA from which a probe to be hybridized to an array is derived, is within the scope of the invention.
  • Arrays comprising probes derived from a representation by any method, for example by using the representation as a template for nucleic acid synthesis (e.g., nick translation, random primer reaction, transcription of RNA from represented DNA, oligonucleotide synthesis), or by manipulating the representation (e.g., size fractionation of the representation, gel purified fragments from the representation to the array) are also within the scope of the invention.
  • a template for nucleic acid synthesis e.g., nick translation, random primer reaction, transcription of RNA from represented DNA, oligonucleotide synthesis
  • manipulating the representation e.g., size fractionation of the representation, gel purified fragments from the representation to the array
  • the one or more represented biological samples, and at least a fraction of the DNA comprising the microarray be from the same species.
  • the one or more samples are from a human, and at least a portion of the DNA on the microarray is human in origin.
  • DNA from any species may be utilized according to the invention, including mammalian species (including but not limited to pig, mouse, rat, primate (e.g., human), dog and cat), species of fish, species of reptiles, species of plants and species of microorganisms.
  • a representation of the DNA from one or more biological samples is hybridized to a microarray that is comprised of elements not from a representation.
  • the microarray can be a simple or a compound array.
  • a representation of the DNA from one or more biological samples is hybridized to a compound probe array comprised of, for example, DNA from a megacloning vector such as a BAC, YAC, PAC, P1, or cosmid.
  • the DNA in the array derives from expressed sequences such as may be obtained from cDNAs or expression sequence tags (ESTs). The DNA in the array, in these embodiments, is not from a representation.
  • the one or more samples hybridized to the microarray are from a human, and the microarray is comprised of DNA from one or more megacloning vectors that contain human DNA inserts.
  • the represented samples may derive from any DNA, e.g., cDNAs or genomic DNAs, and may be high or low complexity representations.
  • two represented samples are used, and the samples are differentially labeled so that hybridization of each sample can be individually quantitated and compared to the other sample. Differential labeling can be done with two different fluorescent indicators, e.g., Cy5-dCTP, fluorescein-dCTP, or lissamine-5-dCTP.
  • This embodiment is useful for detecting variations in gene copy number.
  • representations of genomic DNA taken from a normal sample and genomic DNA taken from a sample of a tumor biopsy from a human can be differentially labeled and hybridized to a microarray fabricated with a BAC library spanning a significant portion of the human genome. Fixed at each address of the microarray is DNA from a single, different member of the BAC library. The hybridization signal from the tumor sample can be detected and compared to that of the normal sample. The signals at most of the addresses should be similar, but an address where, for example, the tumor sample has greater fluorescence, indicates that there has been an amplification in the tumor cell genome of the sequences corresponding to the BAC insert DNA at that address.
  • This embodiment can also be useful for detecting variations in levels of gene expression when the represented sample derives from cDNA. This embodiment can also be used to assess the reproducibility of representations by comparing hybridization patterns of different representations from the same sample. Similar or identical patterns of hybridization indicate that the representations are reproducible.
  • both the compound probe array DNA and the hybridized sample DNA are from representations.
  • the microarray is fabricated with compound probes derived from a representation.
  • a represented compound array has DNA sequences from more than one fragment of the representation at each address.
  • the decreased complexity of both the array and sample DNAs allows for favorable hybridization kinetics and improved detection.
  • the sample and microarray DNA are identically represented, i.e., cut with the same restriction enzyme, ligated to the same adaptors, and amplified via, for example, the polymerase chain reaction.
  • This embodiment can also be used to assess the reproducibility of representations by comparing hybridization patterns of different representations from the same sample. Similar or identical patterns of hybridization indicate that the representations are reproducible.
  • RDA representational difference analysis
  • the compound probe array DNA is from a representation
  • the hybridized sample DNA is any DNA, whether from a representation or not.
  • a simple probe array made from a representation is hybridized to a sample comprising DNA, whether from a representation or not.
  • the sample DNA hybridized to the microarray is a representation of DNA, e.g., genomic DNA
  • the microarray is a simple probe array fabricated with a representation of DNA.
  • a represented simple probe array has DNA from only one fragment of a representation at each address.
  • each element of the array comprises many copies of a single DNA molecule derived from a representation of genomic DNA.
  • the arrayed probes of any array may, if so desired, be mapped to any known library of genomic DNA.
  • the method of orthogonal partition hybridization can be used to map DNA libraries derived from genomic DNA or representations of genomic DNA to inserts of megacloning vector libraries. Libraries of probes from representations of the total genome, which can be used later for arraying, can be mapped.
  • the probe library could be converted into 96 well dishes, and the collection maintained by PCR and manipulated robotically. The map positions of most of the probes can be determined after arraying, and records kept electronically. Those probes that cannot be mapped to the library of genomic DNA can later be mapped either as needed or as new mapping tools become available.
  • Arrays of simple DNA probes can be mapped, for example, by hybridization to orthogonal partitions of libraries of megacloning vectors. This can be illustrated by the following, non-limiting example: the assignment of arrayed probes to a positionally mapped megaYAC library of about 10,000 elements. Although this example is oriented towards YACs, because an ordered collection exists, the same principles can be applied to mapping arrays of simple probes to other ordered collections of vectors.
  • a partition is the division of a set into subsets, such that every element of the set is in one and only one subset.
  • Two partitions are called orthogonal if the intersection (i.e., the common elements) of any two subsets, one from each partition, contains no more than one element of the original set. If the members of the original set are arbitrarily laid out as a square, it is easy to see that there are always at least two mutually orthogonal, and in this case, equal partitions. These can be thought of as the partition of rows, and the partition of columns.
  • There is a third mutually orthogonal and equal partition the partition of “wrapped” diagonals, which will not be utilized in this example.
  • each subset from one intersects each subset from the other in exactly one element.
  • Each subset of one partition intersects a subset from another partition at a single element, and every element is the intersection of two subsets.
  • Hybridization with representations of subsets from two orthogonal partitions could then be performed. If a probe hybridized to two subsets, one from each partition, that probe should have sequences in common with their intersection, which would be a unique YAC, if no YACs overlapped.
  • probes in a large library will overlap, and a given probe may be in two or more members of the library, probes may hybridize to more than one subset of a partition. For example, if a probe is contained in two overlapping YACs, and hence hybridized to two subsets in each partition, there will be two possible solutions, with four candidate YACs, to the hybridization pattern with two orthogonal partitions. Knowledge of the mapping assignments of the YACs should be sufficient to resolve this ambiguity. Only one pair of YACs will be neighbors.
  • This embodiment is useful for detection of changes in gene copy number between normal and, for example, cancer biopsy samples, as is described in section 5.2. If the elements have been mapped, as described above, positional information of the alteration of gene copy number can be gathered.
  • This embodiment is also useful for extension reactions performed on an array that could be used to identify single nucleotide polymorphisms as done in the minisequencing reaction (Pastinen et al., 1997, Genome Research. 7:606-614).
  • the elements of the microarray in this case are oligonucleotides, preferably single stranded oligonucleotides, derived from and complementary to fragments present in a representation, which oligonucleotides are fixed to the surface of the solid support of the array at their 5′ends. A representation produced from a sample is then hybridized to the array.
  • oligonucleotides are extended by incubation in the presence of polymerase, nucleotide and necessary buffer.
  • the nucleotide that follows the oligonucleotide sequence is detected by the addition of a fluorescently tagged dideoxynucleotide (Pastinen et al., 1997, Genome Research. 7:606-614; Syvanen et al., 1990, Genomics. 8:684-692).
  • the sample DNA hybridized to the microarray is or is derived from a compound representation of DNA, and the microarray, like that described in section 5.4, is a represented simple probe array.
  • a compound representation is the result of two or more consecutive representations.
  • a compound representation is made by making a first representation of, for example, genomic DNA, followed by the making of a second representation of the first representation.
  • different restriction enzymes are used for each sample representation, and the enzyme used to prepare the first sample representation and the representation immobilized on the microarray are the same.
  • a and B are any two restriction endonucleases. They derive from a first representation made by using the A restriction endonuclease.
  • This first representation will consist of fragments that have an A restriction endonuclease site at each end, such fragments are termed AA fragments.
  • a fragment with a B restriction endonuclease site at each end is termed a BB fragment, while fragments with an A restriction endonuclease site at one end and a B restriction endonuclease site at the other is termed an AB fragment.
  • AcB representations consist of AB and BB fragments that derive from those AA fragments of the simple A representation that contain a B restriction endonuclease site.
  • AsB representations consist of those AA fragments of the simple A representation that do not contain a B restriction endonuclease site.
  • AsB is made by making a first representation with the restriction endonuclease A, then making a second representation by cleaving the resulting AA fragments with the restriction endonuclease B and amplifying with the same primers used in the first representation.
  • AA fragments from the first representation that have an internal B site are cut by the B restriction endonuclease and will not amplify, while those AA fragments lacking an internal B site will amplify.
  • the final representation then consists only of those AA fragments with no internal B site.
  • the second representation is also made from a first simple A representation, i.e., a representation made with restriction endonuclease A.
  • AcB is made, like AsB, by making a first representation with the restriction endonuclease A, then making a second representation by cleaving the resulting AA fragments with the restriction endonuclease B.
  • This cleavage results in three types of fragments: 1) AA fragments, i.e., those AA fragments without internal B sites, 2) AB fragments, i.e., fragments with an A site at one end and B site at the other, derived from those AA fragments with one or more internal B sites, and 3) BB fragments, derived from those AA fragments with more than one internal B site.
  • AA fragments i.e., those AA fragments without internal B sites
  • AB fragments i.e., fragments with an A site at one end and B site at the other, derived from those AA fragments with one or more internal B sites
  • BB fragments derived from those AA fragments with more than one internal B site.
  • This adaptor has a different sequence than the adaptor used for the first, simple representation, and is much longer, on the order of 40 nucleotides. After ligation, and removal of unligated adaptors, the ability of these molecules to extend from the 3′ end is removed by dideoxy extension. Finally, primers to the A and B adaptors are added and the product is exponentially amplified by PCR using a polymerase without 3′ exonuclease activity. Only AB and BB fragments are strongly favored to amplify.
  • the protocol for AcB may seem more complex than needed.
  • the reason for adding the A adaptor to the 5′ end only is to disable exponential amplification from strands that have A at both ends. Even with this step, there will be some AA fragments that reanneal during the polymerase chain reaction step, fill-in at their 3′ ends during the chain elongation step, and subsequently amplify from the A oligonucleotide primer, thereby poisoning the representation. Hence, two more features are added.
  • the new A adaptor is long (40 nucleotides or longer).
  • AcB and AsB representations are useful for detecting internal polymorphic restriction endonuclease sites and for detecting heterozygous and homozygous states with respect to those polymorphic sites.
  • a simple DNA probe chip made with a simple A representation i.e., the first representation of the AcB or AsB compound representations
  • differentially labeled AcB for this example, a red label
  • AsB for this example, a green label
  • both homozygous and heterozygous states are readily detected: high red ratios indicate both alleles have B sites; high green ratios indicate both alleles do not have B sites; and ratios near equality (yellow) indicate the heterozygous state.
  • the second restriction endonuclease i.e., the B restriction endonuclease is one that recognizes CpG, such as TaqI.
  • CpG such as TaqI.
  • Such restriction endonucleases are especially useful since the sequence CpG is especially polymorphic.
  • representations are generated by restriction endonuclease digestion of DNA, followed by linkage of adaptors and then amplification with primers complementary to the adaptors.
  • the DNA may be from any source.
  • the method is adaptable to any genome. It is often advantageous to isolate DNA contemporaneously from both normal and diseased cells, for example, from normal and cancerous tissue, preferably from the same individual. Parallel processing of the samples allows for more accurate comparisons of the representations generated from the two different sources of cells.
  • the DNA is isolated by any convenient means, and then substantially completely digested by any means, such as the use of a restriction enzyme endonuclease, which results in cutting at predetermined sequences.
  • HCRs High complexity representations
  • DpnII cutting restriction enzyme
  • LCRs Low complexity representations
  • BamHI or BglII cutting restriction enzyme
  • a restriction enzyme which is inhibited by methylation of the DNA can be selected for the digestion step.
  • the use of such an enzyme can reveal differences in methylation between compared samples. This can be useful because, for example, it has been suggested that there are differences in methylation between normal cells and some cancerous cells.
  • Complexity of the representation can also be shaped by the adaptors used for amplification. Because the same adaptors are used at both ends of the cleaved fragments, the single strands form panhandles (Lukyanov et al., 1995, Anal. Biochem. 229:198-202, incorporated herein by reference). This inhibits amplification by PCR, because panhandle formation competes with PCR primer annealing, a necessary step for amplification. Shorter fragments are preferentially inhibited due to the close proximity of the adaptors resulting effectively in a higher local concentration of the 5′ and 3′ adaptors linked to the ends of such fragments, as compared with longer fragments.
  • Adaptors that form panhandles of 29 nucleotides allow for amplification of fragments in the size range of 200-1200 bp. Shorter adaptors that form panhandles of 24 nucleotides release some of the inhibition of the smaller fragments, resulting in the favoring of smaller PCR amplification products, and therefore, a representation of altered complexity.
  • the DNA may be from any source.
  • Sources from which representations can be made include, but are not limited to, tumor biopsy samples, including breast cancer and prostate cancer biopsies, normal tissue samples, tumor cell lines, normal cell lines, cells stored as fixed specimens, autopsy samples, forensic samples, paleo-DNA samples, microdissected tissue samples, isolated nuclei, and fractionated cell or tissue samples.
  • the degree of complexity of the representation generated is related to the frequency of cutting, specifically, more frequent cutting enzymes will result in higher complexity representations.
  • representations of the desired complexity can be produced by the selection of the appropriate enzyme. The selection can be made with the guidance of the art, including readily available information on the frequency of cutting of various enzymes and the average fragment lengths generated by said enzymes (Bishop et al., 1983, A Model For Restriction Fragment Length Distributions, Am. J. Hum. Genet. 35:795-815).
  • restriction endonucleases that cleave with relatively greater frequency than, for example, a restriction enzyme such as DpnII.
  • the oligonucleotide adaptors are ligated to the ends of each of the strands of the DNA.
  • the adaptor will usually be staggered at both ends, with one strand being longer than the other and therefore being single stranded over a small region at the end not ligated to the digested fragments.
  • the adaptor will have an end complementary to the fragments' staggered ends.
  • the DNA is then amplified by an amplification reaction, for example, by adding primer and using the polymerase chain reaction for usually at least 15 cycles and generally not more than about 35 cycles.
  • the primer will be complementary to the adaptor.
  • the adaptors are then removed by restriction endonuclease digestion and separation, using any convenient means.
  • HCRs are prepared from the same amount of starting material, that the genomic DNAs are extracted in the same manner, and that PCR is performed at the same time under the same conditions in the same thermal cycler.
  • Microarrays for use in the present invention are known in the art and consist of a surface to which probes can be specifically hybridized or bound, preferably at a known position. Each probe preferably has a different nucleic acid sequence. The position of each probe on the solid surface is preferably known.
  • the microarray is a high density array, preferably having a density of greater than about 60 different probes per 1 cm 2 .
  • a microarray DNA probes are attached to a solid support, which may be made from glass, plastic (e.g., polypropylene, nylon), polyacrylamide, nitrocellulose, or other materials, and may be porous or nonporous.
  • a preferred method for attaching the nucleic acids to a surface is by printing on glass plates, as is described generally by Schena et al., 1995, Science 270:467-470. See also DeRisi et al., 1996, Nature Genetics 14:457-460; Shalon et al., 1996, Genome Res. 6:639-645; and Schena et al., 1995, Proc. Natl. Acad. Sci. USA 93:10539-11286.
  • a second preferred method for making microarrays is by making high-density oligonucleotide arrays.
  • Techniques are known for producing arrays containing thousands of oligonucleotides complementary to defined sequences, at defined locations on a surface using photolithographic techniques for synthesis in situ (see, Fodor et al., 1991, Light-directed spatially addressable parallel chemical synthesis, Science 251:767-773; Pease et al., 1994, Light-directed oligonucleotide arrays for rapid DNA sequence analysis, Proc. Natl. Acad. Sci.
  • microarrays Other methods for making microarrays, e.g., by masking (Maskos and Southern, 1992, Nuc. Acids Res. 20:1679-1684), may also be used.
  • any type of array for example, dot blots on a nylon hybridization membrane (see Sambrook et al., Molecular Cloning—A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989, which is incorporated in its entirety for all purposes), could be used, although, as will be recognized by those of skill in the art, very small arrays will be preferred because hybridization volumes will be smaller.
  • Presynthesized probes can be attached to solid phases by methods known in the art.
  • Sample to be hybridized to microarrays can be labeled by any means known to one of skill in the art.
  • the sample may be from any source, including a representation, cDNA, RNA or genomic DNA.
  • the sample is labeled with a fluorescent probe, by, for example, random primer labeling or nick translation.
  • a fluorescent probe by, for example, random primer labeling or nick translation.
  • the fluorescent label may be, for example, a lissamine-conjugated nucleotide or a fluorescein-conjugated nucleotide analog.
  • Sample nucleotides are preferably concentrated after labeling by ultrafiltration.
  • two differentially labeled samples e.g., one labeled with lissamine, the other fluorescein are used.
  • Hybridization of a representation of a sample to an array encompasses hybridization of the representation, or nucleotides derived from the representation by any method, for example by using the representation as a template for nucleic acid synthesis (e.g., nick translation, random primer reaction, transcription of RNA from represented DNA), or by manipulating the representation (e.g., size fractionation of the representation, gel purified fragments from the representation to the array).
  • a template for nucleic acid synthesis e.g., nick translation, random primer reaction, transcription of RNA from represented DNA
  • manipulating the representation e.g., size fractionation of the representation, gel purified fragments from the representation to the array.
  • Nucleic acid hybridization and wash conditions are chosen such that the sample DNA specifically binds or specifically hybridizes to its complementary DNA of the array, preferably to a specific array site, wherein its complementary DNA is located, i.e., the sample DNA hybridizes, duplexes or binds to a sequence array site with a complementary DNA probe sequence but does not substantially hybridize to a site with a non-complementary DNA sequence.
  • one polynucleotide sequence is considered complementary to another when, if the shorter of the polynucleotides is less than or equal to 25 bases, there are no mismatches using standard base-pairing rules or, if the shorter of the polynucleotides is longer than 25 bases, there is no more than a 5% mismatch.
  • the polynucleotides are perfectly complementary (no mismatches). It can easily be demonstrated that specific hybridization conditions result in specific hybridization by carrying out a hybridization assay including negative controls (see, e.g., Shalon et al., supra, and Chee et al., 1996, Science 274:610-614).
  • Arrays containing double-stranded probe DNA situated thereon are preferably subjected to denaturing conditions to render the DNA single-stranded prior to contacting with the sample DNA.
  • Arrays containing single-stranded probe DNA e.g., synthetic oligodeoxyribonucleic acids
  • Optimal hybridization conditions will depend on the length (e.g., oligomer versus polynucleotide greater than 200 bases) and type (e.g., RNA, DNA) of probe and sample nucleic acids.
  • length e.g., oligomer versus polynucleotide greater than 200 bases
  • type e.g., RNA, DNA
  • General parameters for specific (i.e., stringent) hybridization conditions for nucleic acids are described in Sambrook et al., supra, and in Ausubel et al., 1987, Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, New York.
  • typical hybridization conditions are hybridization in 5 ⁇ SSC plus 0.2% SDS at 65° C. for 4 hours followed by washes at 25° C.
  • Hybridization to the array may be detected by any method known to those of skill in the art.
  • the hybridization of flourescently labeled sample nucleotides is detected by laser scanner.
  • the scanner is preferably one that is able to detect fluorescence of more than one wavelength, the wavelengths corresponding to that of each fluorescent label, preferably simultaneously or nearly simultaneously.
  • High Complexity Representations are generated by restriction endonuclease digestion of DNA, followed by linkage of adaptors and then amplification with primers complementary to the adaptors.
  • the DNA may be from any source.
  • the method is adaptable to any genome. It is often advantageous to isolate DNA contemporaneously from both normal and diseased cells, for example, from normal and cancerous tissue, preferably from the same individual. Parallel processing of the samples allows for more accurate comparisons of the two HCRs generated from the two different sources of cells.
  • the DNA is isolated by any convenient means, and then substantially completely digested by any means, such as the use of a restriction enzyme endonuclease, which results in frequent cutting at predetermined sequences.
  • a “relatively frequent cutting restriction endonuclease” is used.
  • the term “relatively frequent cutting restriction endonuclease” is intended to mean a restriction endonuclease which has a consensus sequence of four or fewer nucleotides, and may provide for blunt ends or staggered ends.
  • Exemplary “relatively frequent cutting restriction endonucleases” include, but are not limited to DpnII, Tsp509I, MboI, Sau3Al, MaeII, MspI, HpaII, BfaI, HinPI, Csp6l, TaqI, MseI, AluI, BstUI, DpnI, HaeIII, RsaI, HnaI, and NlaIII.
  • At least two restriction enzymes are used simultaneously or sequentially to cut DNA with the desired frequency.
  • the enzyme combination used should be chosen such that at least about 50% of the fragments produced by the digestion will be between 100 and 1000 nucleotides in length. It is within the skill in the art to select such combinations. Bishop et al., 1983, Am. J. Hum. Genet. 35:795-815, incorporated by reference herein).
  • a restriction enzyme which is inhibited by methylation of the DNA can be selected for the digestion step.
  • the use of such an enzyme can reveal differences in methylation between compared samples. This can be useful because, for example, it has been suggested that there are differences in methylation between normal cells and some cancerous cells.
  • the degree of complexity of a representation is related to the frequency of cutting, specifically, more frequent cutting enzymes will result in higher complexity representations.
  • representations of the desired complexity can be produced by the selection of the appropriate enzyme.
  • restriction endonucleases that cleave with relatively greater frequency than, for example, a restriction enzyme such as DpnII.
  • the oligonucleotide adaptors are ligated to the ends of each of the strands of the DNA.
  • the adaptor will usually be staggered at both ends, with one strand being longer than the other and therefore being single stranded over a small region at the end not ligated to the digested fragments.
  • the adaptor will have an end complementary to the fragments' staggered ends.
  • the DNA is then amplified by an amplification reaction, for example, by adding primer and using the polymerase chain reaction for usually at least 15 cycles and generally not more than about 35 cycles.
  • the primer will be complementary to the adaptor.
  • the adaptors are then removed by restriction endonuclease digestion and separation, using any convenient means.
  • HCRs are prepared from the same amount of starting material, that the genomic DNAs are extracted in the same manner, and that PCR is performed at the same time under the same conditions in the same thermal cycler.
  • HCR's are useful for, among other things, determining gene copy number, deletion mapping, loss-of-heterozygosity (LOH) and comparative genomic hybridization (CGH). HCR's are also useful for microarrays, as described above. HCRs also are a generally useful means of “immortalizing” and archiving DNA for later analysis.
  • HCRs of from the DNA of nonrenewable sources can be produced and stored, creating an archivable representation of the DNA from the original source. Further analysis can then be performed on the HCR instead of on the limited amount of original material.
  • HCRs can be prepared from normal and tumor tissue stored as fixed, paraffin embedded, archived biopsies, and this would greatly extend the utility of such samples. As compared with fresh samples, more rounds of PCR are usually required to obtain workable amounts of DNA. The amplified DNA from stored samples usually has a lower size distribution than HCRs prepared from DNA extracted from fresh sources. HCRs prepared from paired stored samples are similar to each other, which suggest that the method has utility.
  • Genomes often contain either extra copies of sequences due to gene amplification, or missing sequence when genes are deleted, which is known as loss of heterozygosity when one allele of a gene is lost, or loss of homozygosity when both alleles are lost.
  • Comparison of Southern blots of HCRs from diseased cells and normal cells can reveal whether the gene corresponding to the probe (for example a probe for a tumor suppressor of oncogene) is amplified or missing in the diseased cells relative to normal cells.
  • HCRs Some variability in the content of HCRs will arise due to polymorphism. For example, if a given sequence in an individual is contained on a bi-allelic DpnII fragment, occurring on a large and small fragment, and the small fragment is lost in the tumor due to loss of heterozygosity, the HCR from tumor may appear to be missing the sequence in question because: 1) the large fragment will not be efficiently amplified by PCR, and will not be represented in the library, and 2) the small fragment is not present in the starting material, due to LOH. This can be used in a rapid method for loss of heterozygosity analysis if a sufficient number of such polymorphic sequences were known.
  • Comparative genome hybridization is a powerful tool for analyzing the global genomic changes in tumors.
  • CGH Comparative genome hybridization
  • DNA from a test sample is labeled and mixed with normal DNA that is labeled with a different fluorophore. This probe mixture is hybridized to a normal metaphase spread or other reference standard.
  • the intensity of the fluorescence at each location along the normal chromosomes is proportional to the copy number of gene sequences that bind there.
  • the resulting fluorescence ratios of hybridized test DNA to normal DNA is measured. One can observe the gains and losses of whole chromosomes or insertions and deletions on a specific chromosome.
  • CGH can be performed with HCRs by flourescently labeling the HCR and using it in a CGH protocol.
  • genomic DNA was digested by the desired restriction endonuclease (DpnII to produce the High Complexity Representation and BglII to produce the Low Complexity Representation) as suggested by the supplier.
  • the digest was purified by phenol extracting and precipitation.
  • the digested DNA was ligated to adaptors RBgl24 and RBgl12.
  • the ligating mixture contained the digested genomic DNA, 1 ⁇ reaction buffer (from the supplier), 444 pmoles of each adaptor and water to bring the volume to 30 ul.
  • the reaction was placed at 55° C. and the temperature slowly decreased to 15° C.
  • the reaction mixture reached 15° C., 400 units of T4 DNA ligase was added, and the reaction mixture was incubated at 15° C. for 12-18 hrs.
  • the ligated material was split into two PCR tubes and amplified by PCR.
  • the PCR reaction contained the ligated material, 1 ⁇ PCR buffer (335 MM Tris-HCL, pH8.8, 20 mM MgCl 2 , 80 mM(NH4) 2 SO 4 , 50 mM beta-mercaptoethanol, 0.5 mg/ml of bovine serum albumin), 0.32 mM dNTP's, 0.6 mM RBgl24 adaptor, which was then overlaid with mineral oil.
  • the reaction was placed in a thermal cycler preheated to 72° C.
  • the thermal cycler was set to continue 72° C. for 5 minutes, and then repeat 20 cycles of 1 minute at 95° C., and 3 minutes at 72° C. This was followed by an additional 10 minutes at 72° C.
  • the reaction was purified by phenol-chloroform, and then precipitation.
  • Tumor genomes often contain either extra copies of sequences due to gene amplification, or missing sequence when genes are deleted.
  • genomic DNA was prepared from tumor cell lines amplified at cyclin D1 (MDA-MB-415), or c-erB2 (BT474), or c-myc (SKBr3), or human placenta.
  • HCRs and LCRs were made from cell line or placenta DNAs using DpnII or BglII, respectively.
  • FIG. 3 illustrates that the probe hybridized to sequences in the HCRs when and only when it hybridized to sequences in the respective genomic DNA.
  • HCRs made from limiting amounts of DNA.
  • HCRs were prepared from aneuploid and diploid nuclei sorted from several breast cancer biopsies, and blotted for c-myc.
  • FIG. 4 illustrates that c-myc is amplified in the HCRs made from the aneuploid nuclei of some biopsy samples.
  • We obtained confirmation of the validity of the c-myc amplifications by demonstrating that probes adjacent to but distinct from the c-myc probes were also amplified in the same samples.
  • the curve for the aneuploid HCR deleted for p16 arises 4 cycles later than the paired diploid HCR, again a 16 fold difference, probably reflecting about 6% contamination of the aneuploid nuclei with diploid nuclei.
  • One tumor/normal pair showed a shift of a single cycle for primer pairs detecting the p16 gene. This might reflect loss of a single allele in the tumor.
  • LOH Loss of heterozygosity
  • Comparative genome hybridization is a powerful tool for analyzing the global genomic changes in tumors.
  • CGH Comparative genome hybridization
  • the applicability of HCRs to CGH was examined.
  • tumor cell lines were chosen so that direct comparison of CGH performed with genomic and HCR DNA was possible. Little difference in patterns could be discerned with the two cell lines examined, BT474 and MCF7.
  • FIG. 7 shows the chromosomal scanning profiles obtained for two representatives chromosomes with each DNA source.
  • preparation of a microarray involves the steps of preparing the glass surface, preparing probes, and depositing the probes on the surface. Exemplary protocols for these steps are presented in this subsection.
  • each of two samples to be hybridized to a microarray are random primer labeled using Klenow polymerase (Amersham), one with a lissamine-conjugated nucleotide analog (DuPone NEN) and the other with a fluorescein-conjugated nucleotide analog (BMB).
  • Klenow polymerase Amersham
  • DuPone NEN lissamine-conjugated nucleotide analog
  • BMB fluorescein-conjugated nucleotide analog
  • the 5 ⁇ g of combined sample DNA is concentrated to 7.5 ⁇ l of TE buffer, denatured in boiling water and snap-cooled on ice. Concentrated hybridization solution is added to a final concentration of 5 ⁇ SSC/0.01% SDS.
  • the entire 10 ⁇ l of labeled sample DNA is transferred to the microarray surface, covered with a coverslip, placed in a humidity chamber and incubated in a 60 C water bath for 12 hours. The humidity is kept at 100% by the addition of 2 ⁇ l of water in a corner of the chamber.
  • the slide is then rinsed in 5 ⁇ SSC/0.1% SDS for 5 minutes and then in 0.2 ⁇ SSC/0.1% SDS for 5 minutes. All rinses are at room temperature.
  • the array is dried, and a drop of antifade (Molecular Probes) applied to the array under a coverslip.
  • a laser scanner is used to detect the two-color fluorescence hybridization signals from 1.8-cm ⁇ 1.8-cm arrays at 20- ⁇ m resolution.
  • the glass substrate slide is mounted on a computer-controlled, two-axis translation stage (PM-500, Newport, Irvine, Calif.) that scans the array over an upward-facing microscope objective (20 ⁇ , 0.75 NA Fluor, Nikon, Melville, N.Y.) in a bi-directional raster pattern.
  • PM-500 Newport, Irvine, Calif.
  • a water-cooled Argon/Krypton laser Innova 70 Spectrum, Coherent, Palo Alto, Calif.
  • multiline mode allows for simultaneous specimen illumination at 488.0 nm and 568.2 nm.
  • Preamplified PMT signals are read into a personal computer using a 12-bit analog-to-digital conversion board (RTI-834, Analog Devices, Norwood, Mass.), displayed in a graphics window, and stored to disk for further rendering and analysis.
  • the back aperture of the 20 ⁇ objective is deliberately underfilled by the illuminating laser beam to produce a large-diameter illuminating spot at the specimen (5- ⁇ m to 10- ⁇ m half-width).
  • Stage scanning velocity is 100 mm/sec
  • PMT signals are digitized at 100 ⁇ sec intervals. Two successive readings are summed for each pixel, such that pixel spacing in the final image is 20 ⁇ m. Beam power at the specimen is ⁇ 5 mW for each of the two lines.
  • the scanned image is despeckled using a graphics program (Hijaak Graphics Suite) and then analyzed using a custom image gridding program that creates a spreadsheet of the average red and green hybridization intensities for each spot.
  • the red and green hybridization intensities are corrected for optical cross talk between the fluorescein and lissamine channels, using experimentally determined coefficients.
  • arrays are made with random probes (with an average length of 1 kbp) taken from the human genome. For this example we assume that a chip of 100,000 elements can be made. We choose this number for illustrative purposes.
  • the arrays are hybridized under the conditions described in the literature (Schena et al., 1995, Science 270:467-70; Schena et al., 1996, Proc Natl Acad Sci USA 93:10614-9; Schena, 1996, Bioessays 18:427-31; Shalon et al., 1996, Genome Res 6:639-45). Variations in these conditions can be tested to optimize the ratio of signal to noise in the hybridization, as will be discussed in detail below.
  • Bgl II representations of the genomic DNA are used, and prepared as previously described (Lisitsyn et al., 1993, Science 259:946-51). Bgl II representations have a complexity of about 2% the complexity of the entire human genome. The representations are labeled as before with distinguishable fluorescent dyes, “green” for tumor DNA from the biopsy and “red” with normal DNA from the same patient. The same arrays are hybridized with the two labeled representations.
  • the hybridized chips are then analysed by scanning in the red and green channels to derive information about the relative gene copy concentrations in tumor and normal DNAs. Most probes of the chip (about two thirds) do not display significant hybridization signal in either the red or green channels. We call these class A probes. Most probes are in this category because most probes are not repetitive nor share sequences with the BglII representations. Therefore, only background flourescence is observed.
  • the first point is that it is advantageous to reduce the nucleotide complexity of the sample to observe hybridization signal from single copy genomic sequences. According to the present invention in this example, we achieve this by making representations of the sample. The degree to which this complexity may be reduced is in part a function of the hybridization conditions and background noise, but reductions on the order of minimally ten fold and optimally about fifty fold are advantageous.
  • the second point is that when using a represented sample, most randomly chosen probes are not very informative. Only those that share sequences with the represented sample are informative, and these are in a great minority. This can be remedied as is illustrated in the next examples.
  • probes of class C or D from those of A or B, and to “cull” these probes to assemble a new array that is more efficient at detecting genetic differences between represented samples.
  • a more efficient way to assemble a collection of probes useful for assaying represented samples is to select probes from similarly represented DNA.
  • This DNA can be total genomic DNA from tissues or cultured cells, or genomic DNA that has been cloned as an insert into a cloning vector, such as a BAC or YAC, or cDNAs.
  • a cloning vector such as a BAC or YAC, or cDNAs.
  • the DNA from these normal cells could obscure genetic loss within the tumor by common means of analysis, such as southern blotting and PCR analysis of loss-of-heterozygosity (Kerangueven et al., 1995, Genes Chromosomes Cancer 13(4):291-4; Habuchi et al., 1995, Oncogene 19:11(8):1671-4). It is therefore necessary to separate the tumor and normal nuclei.
  • tumors can be distinguished from normal cells, most commonly by aneuploidy (a different amount of DNA per nucleus) or surface markers.
  • tumor nuclei of tumor cells from a biopsy can be separated from normal stroma by fluorescence activated sorting (Del Bino et al., 1989, Anal Cell Pathol 1(4) :215-23; Maesawa et al., 1992, Jpn J Cancer Res 83(12) :1253-6) into populations that are 90% free of normal nuclei.
  • the normal stroma of tumor biopsy specimens can be microdissected and relatively pure populations of tumor cells obtained.
  • DNA can be prepared from as few as 5000 tumor cells or nuclei obtained by these means, and representations prepared. By comparing the tumor with normal representations in array format, as in the above example, genetic losses in the tumor can be detected.
  • This genetic loss can occur in two fundamental varieties.
  • homozygous loss where both copies of a gene have been lost in the tumor, will result in the absolute loss of those sequences.
  • those sequences encompass an element that both is present in the representation of the normal DNA and shares sequences with a probe of the array, the absence of those sequences will be detected by a high red-to-green ratio for that probe. That is, the array will detect the sequences present in the normal sample but absent in the tumor sample.
  • a tumor loses about 3 megabases of sequence through homozygous loss, or about 0.1% of the genome. Thus we expect that about 10 probes from a 10,000 member array would detect loss.
  • heterozygous loss can frequently be detected by an array based on representational analysis.
  • LOH only one of two alleles of a tumor is lost, and the explanation for the detection differs from that of homozygous loss.
  • Individuals have genetic polymorphisms that are frequently manifest as restriction fragment length polymorphisms.
  • sequences from one allele may be in a representation, due to being on a low molecular weight restriction endonuclease fragment, while sequences from the other allele are not.
  • the allele that is in a representation is the allele that is lost in the tumor, then that loss can be detected by the array, provided that sequence is shared with one of the arrayed probes.
  • Previous estimates are that cancers lose about 15% of their genome through this mechanism. Depending on the density estimates of restriction endonuclease polymorphisms, upwards of 0.6% of the representation will be lost in the tumor, or about 60 probes per 10,000 member array.
  • Hybridization of nucleic acid, whether it be RNA or DNA, to the DNA fragments on the array is affected by several factors including complexity, concentration, ionic strength, time, temperature, and viscosity (Wetmur et al., 1968, Mol Biol 31(3) :349-70; Wetmur, 1976, Annu Rev Biophys Bioeng 5:337-61). By varying these factors we are able to optimize the hybridization conditions to allow for the highest signal with the lowest possible background.
  • the concentration of the sample also is an important factor that effects the rate of hybridization.
  • the fact that we are producing representations for the hybridization puts us at an advantage as compared to many other chip techniques. We can make virtually unlimited amounts of representation for hybridization. In this way we can approach if necessary the maximum DNA concentration in solution. For example, sample concentrations of 1 ug/ul up to 8 ug/ul can be used, if necessary.
  • Hybridization rates have been determined to be strongly dependent on the Na ion concentration ranging up to 3.2 M.
  • Time of incubation also affects the completion of the hybridization reaction. One can vary this factor up until we reach 24 hours, or more if necessary. Preferably, we use the shortest time that will give us the best signal to noise ratio.
  • the temperature of hybridization may also be varied.
  • the optimum temperature for hybridization of a fragment would be 25 C below its melting temperature. We are asking for many fragments of different size and content from a representation to hybridize to their complementary probes in the microarray during the same incubation.
  • Current protocols for hybridization use a temperature of 65 C. One can vary this temperature from, for example, 55 C to 75 C to determine the optimum temperature of hybridization for our purposes.
  • the rate of hybridization can be increased by the addition of neutral polymers to the solution. It is believed that the polymer excludes water from solution increasing the local concentration of nucleic acid.
  • a neutral polymer such as ficoll.
  • organisms are genetically polymorphic. That means that arrays based on representations can be used to provide a signature for individuals, which might be useful in forensic identification, or be used to follow genetic crosses between individuals, for example to determine paternity.
  • the application of this method can be applied to a child, and the child's assumed biological parents, to determine if the parentage is correct. Due to the laws of Mendelian inheritance, if parentage is correct, all “green” digits in the child's digit signature should have a green value in at least one parent. In more classical terms, the child possessing a “green allele” at an address (that is, the presence of the small fragment allele) must have inherited the same from either mother or father or both. Similarly, if the child displays a “yellow” digit for an address, then either mother or father must have a yellow digit at that address.
  • the simplest compound representation can be made by cleavage with a first restriction endonuclease, addition of linkers to those cleavage sites, cleavage with a second restriction endonuclease and then PCR amplification.
  • This representation will consist of all the small fragments in the genome made by the first cleavage that do not contain restriction endonuclease sites for the second enzyme.
  • the use of compound representations makes possible a new use of representational arrays in cancer diagnosis. Cancers accumulate point mutations. Occasionally these point mutations destroy a restriction endonuclease site. If the site destroyed is the site of the second enzyme, the compound representation of the tumor will contain a sequence that is not present in the same compound representation from the normal DNA of that patient. If the tumor representation is labeled in green and the normal in red, “green” addresses most likely will reflect point mutation in the tumor (after correcting for gene amplification, which can be determined by comparing the simple representations). This gives the tumor a digit signature of greens. The number of green digits reflect the point mutation load in the tumor, which may have predictive and prognostic value. Moreover, the signature of a biopsied tumor can provide a marker that can be used to determine if a second tumor arising in the same patient is an independent primary tumor or a metastasis of the first.
  • each probe in the above examples comprises a single cloned sequence of DNA with a length roughly between 100 to 1000 bp (This range is not intended to define the term “simple DNA probes”, it is merely an example thereof).
  • the applications of arrays of compound probes, such as probes derived by representing YAC or BAC inserts, would not be much different.
  • the major difference between arrays of simple probes and compound probes is that that LOH and polymorphic analysis could not be readily performed upon the latter. With arrays of compound probes gene amplification and homozygous loss could still be detected, essentially as described in Examples 6.13 and 6.14.
  • Another type of array can be made with oligonucleotide probes (Cho et al., 1998, Proc Natl Acad Sci USA 31:95(7):3752-7; Pease et al., 1994, Proc Natl Acad Sci USA 91 (11):5022-6; Lipshutz et al., 1995, Biotechniques 19(3):442-7).
  • oligonucleotide probes Cho et al., 1998, Proc Natl Acad Sci USA 31:95(7):3752-7; Pease et al., 1994, Proc Natl Acad Sci USA 91 (11):5022-6; Lipshutz et al., 1995, Biotechniques 19(3):442-7).
  • any measuring tool must satisfy the criterion of reproducibility.
  • Microarray hybridization has been extensively tested, and because we use it to measure gene ratios between two samples, it is particularly robust. However, we have introduced the added element of representation during the preparation of samples. We have therefore tested the reproducibility of our measurements when independent representations are made from the same DNA source and hybridized to microarrays.
  • FIG. 8 A-C depict the results of microarray experiments graphed such that the intensity of one channel (usually the Cy3 channel)is the abscissa and the ratio of Cy5 to Cy3 is the ordinate.
  • BglII representations were produced separately from the same source of genomic DNA, differentially labeled and then hybridized to an array of 3316 features (1658 printed in duplicate).
  • B One BglII representation was differentially labeled and then hybridized to the microarray described in panel A.
  • C A breast primary tumor was separated into normal and tumor nuclei by sorting, and genomic DNA prepared. BglII representations prepared from the genomic DNA were differentially labeled and then hybridized to the microarray described in panel A. The crosshairs represent the limit of measurement for the scanner.
  • FIG. 8A shows a plot of the normalized ratio of the channel intensities as a function of the intensity in one channel (Cy3) for each feature.
  • Cy3 the ratio of Cy5 to Cy3 channels above the median if greater than one, otherwise we plotted the inverse ratio below the median.
  • the ratios of channel intensity are approximately constant through-out the entire range. Only six ratios were outside of the range of 1.5, and none were outside 2.0. Essentially the same results were obtained in three separate experiments.
  • FIG. 8B is plotted in the same manner as FIG. 8A. Note that there is no greater variation from the mean in the comparison of parallel representations than when we compare the identical sample.
  • FIG. 9 shows the comparison of two microarray experiments. Parallel representations were produced for the two cell lines MDA-MB-415 and SKBR-3. These representations were differentially labeled and hybridized to an array of 938 features printed in duplicate. The ratios of duplicates were averaged and then graphed, the abscissa being the ratios from experiment 1 in ascending order (as an index) and the ordinate being the ratios from experiment 2 indexed in the same order as the abscissa.
  • any measuring tool must also satisfy the criterion that it can be independently verified. We therefore sought confirmation of microarray measurements by quantitative Southern blotting of representations and genomic DNAs.
  • the blots were controlled for loading accuracy by stripping and rehybridization with control probes, and quantitated by scanning with a FUJIX BAS -2000 Bio-imaging Analyser.
  • FIGS. 10 A-D illustrate the analysis of 36 probes that displayed copy number differences from the previous experiment shown in FIG. 9 by Southern blotting representations and genomic DNA from the two cell lines MDA-MB-415 and SKBR-3. Some of the blots are shown. “M” designates MDA-MB-415 and “S” designates SKBR-3. Southern blots of representations (A,C, and D) or genomic DNA (B) are shown for probes with the designation “CHP” names. CHP0187 was a probe that detected no difference in copy number by array hybridization.
  • array probes that detect differences between the cell lines detect either of two types of events by Southern blotting: increased copy number in one of the cell lines, where there is appreciable signal from both (FIG. 10A and FIG. 10D); or the absence of signal from one cell line (FIG. 10C).
  • the first type of event is likely to be gene amplification.
  • the second type of event is likely to reflect gene deletion, either due to homozygous deletion or allelic loss of a polymorphic BglII site, with a small BglII fragment present in only one of the two cell lines. In fact, for five out of five cases of reported deletions, we concluded by PCR analysis that the difference between the cell lines was due to BglII polymorphism.
  • FIG. 11 shows the ratios of gene copy number obtained by microarray measurement on the x-axis with ratios obtained by quantitative blotting of representations on the y-axis. Therefore, all deletions are plotted below 1, and amplifications plotted above 1.
  • microarray hybridization underestimates the change in copy number for gene deletion. This most likely results from non-specific background hybridization in the absence of specific hybridization.
  • FIGS. 12 A-C show the comparison of hybridizations of BglII representations to that of DpnII representations.
  • Microarrays of 1658 features were hybridized, scanned, and threshed for intensity and the data was graphed in the same format as the data in FIGS. 8A, 8B, and 8 C, with ratios (or inverse ratios)plotted as a function of single channel intensity.
  • BglII representations of the two cell lines MDA-MB-415 and SKBR-3 were differentially labeled and hybridized to arrays and graphed as described.
  • DpnII representations of the above cell lines were differentially labeled and hybridized to arrays analyzed and graphed as described.
  • C The data from FIG. 12B was graphed at a smaller range to show scatter.
  • This YAC derives from one of two regions residing near to but distinct from c-myc that we find commonly amplified in breast cancers (M Nakamura, unpublished).
  • BglII low complexity
  • probes from this region which are highly amplified in SKBR-3 and probes which are not.
  • DpnII high complexity representation that this region has undergone amplification, because the great majority of probes register ratios above the median.
  • HCR data we do not have an appreciation of the degree of amplification that has occurred, and would be unable to delimit the epicenter of amplification.
  • Our method has advantages in simplicity, flexibility, resolution and sample preparation.
  • the simplicity is inherent in its design and the method for generating libraries of probes.
  • the flexibility derives from having a virtually inexhaustible set of probes to use, so that probes with desirable characteristics can be selected.
  • the resolution results from generally high specific to nonspecific hybridization signals for probes and is therefore limited only by the density of probes that can be printed. Additionally, because representations are used to prepare samples, only very minute amounts of starting material are needed.
  • representations are sensitive to nucleotide polymorphisms at the restriction endonuclease sites used in their preparation. For example, if normal DNA is heterozygous for a BglII site that creates a small BglII fragment, the loss of this site in the tumor is readily seen as a gene deletion. Since representations can also be made to be sensitive to polymorphisms at internal restriction endonuclease sites, it should be possible to intensively survey the cancer genome for allelic losses, or even mutational load. The same principles could be applied for whole genome genotyping of individuals by array hybridization. In fact, we showed that some of the gene copy number differences we detected between representations of two cell lines arise because of BglII polymorphisms.
  • genomic array hybridization emerges from linking data about the arrayed probes to the physical, genetic, and ultimately, the transcription map of the genome. Random representational probes do not have associated physical or genetic or transcriptional mapping information. However, this condition is very readily remedied. Representational probes can be mapped efficiently and placed into association in a variety of ways by hybridizing arrays of these probes to collections of YACs, BACs or radiation hybrids. Array hybridization to even unordered and unmapped pools of BACs, given sufficient numbers of probes and BACs, results in the assemblage of contigs of BACs and neighborhoods of probes with associated inferred physical distances.
  • 96-well sterile and non-sterile plates were obtained from Corning-Costar, 96-well PCR plates were obtained from Marsh, E. coli strain XL1 Blue was obtained from Stratagene, BglII, DpnII and Ligase were supplied by New England Biolabs, Silanated glass slides were obtained from CEL Associates, Houston, Tex.
  • Taq polymerase was 14 purchased from Perkin Elmer, and oligonucleotides were obtained from Operon Technologies. Pins (Chipmaker 2) used for the arrayer, and the hybridization chamber were purchased from Telechem International. Klenow fragment, Cy3 and Cy5, and dNTPs were obtained from Amersham Pharmacia Biotech.
  • BglII probes were obtained by several procedures. Initially, we obtained BglII probes that were the products of RDA experiments. Subsequently, we cloned small( ⁇ 1.0 kbp) BglII fragments from BACs, Pls, and YACs obtained from various library resources (Research Genetics). Finally, we added to our collection by random cloning of small BglII fragments from the human genome. Probe fragments were maintained as pUC19 inserts in the E. coli strain XL1 Blue.
  • Arrays were made from two sets of probes, an early set with about 800 members, and a later set of about 2000.
  • Glycerol stocks of the E. coli hosts were arrayed in 96 well plates.
  • Probe preparation was started by PCR amplification of the insert directly from the lysed E. coli host, using primers set 1: pUC(for) aaggcgattaagttgggtaac and pUC(rev) caatttcacacaggaaacagc. 20 cycles of PCR (95° C. for 1 seconds, 55° C. for 30 seconds, and 72° C. for 1 minute) were followed by an extension of 10 minutes at 72° C. This created a stock for further amplifications. 1 ⁇ l of this reaction was then used for a second PCR amplification to produce the probe fragments for arraying.
  • PCR amplification was carried out with primer set 2: M13 ttgtaaaacgacggccagtg and M13Rev ggaaacagctatgaccatga. These are internal to primer set 1, decreasing the possibility of E. coli contamination.
  • primer set 2 M13 ttgtaaaacgacggccagtg and M13Rev ggaaacagctatgaccatga. These are internal to primer set 1, decreasing the possibility of E. coli contamination.
  • the same PCR conditions were followed. PCR reactions were precipitated by addition of ⁇ fraction (1/10) ⁇ th volume of 3M NaAcetate (pH 5.3) and 1 volume of isopropanol. After 30 minutes at ⁇ 20° C., the plates were centrifuges at 1500 rpm in a table top centrifuge.
  • the supernatant was removed and the pellet was washed with 70% ethanol, centrifuged at 1500 rpm in a table top centrifuge for 5 minutes, and again the supernatant removed.
  • the plates were dried in a vacuum oven, and then resuspended in 15 ⁇ l of 3 ⁇ SSC for arraying.
  • the labeled sample was then brought up to 15 ⁇ l and a concentration of 3 ⁇ SSC and 0.2% SDS, denatured and then hybridized to the array. Processing of the array.
  • the array was placed in a humidified chamber for 3-5 minutes, until spots became hydrated.
  • the slide was cross-linked by UV irradiation of 60 mJoules in a Stragene Stratlinker.
  • the slide was then hydrated again in the humidified chamber and then snap dried by heating on the surface of a hot plate for several seconds.
  • the array is then washed in 0.1% SDS for approximately 10 seconds, in deionized water for approximately 10 seconds, and then denatured in boiling deionized water for approximately 1-2 minutes.
  • the array After denaturation the array is quickly immersed in ice cold benzene free ethanol for several seconds, taken out and allowed to dry. Cover slips for the arrays are put through the same wash procedure from the SDS to the ice cold ethanol. The 15 ⁇ l of sample is then placed on the array and a cover slip is slowly placed on the array.
  • Arrays were scanned by either GSI Lumonics ScanArray3000 or AxonGenePix4000. Feature definition and quantitative analysis of the resulting tiff files were performed with either ScanAlyze (Stanford University) or Axon GenePix2.0. The resulting tab-delimitated text files were then imported into S-plus 2000, a mathematics and statistical software package (MathSoft, www.mathsoft.com), with which we normalized the data and threshed by minimum intensity value of 300 to 500 depending on the average background pixel intensity. We implemented databases in Microsoft Access and used Per1 for data extraction and reformatting.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
US10/677,396 1997-10-30 2003-10-01 Use of representations of DNA for genetic analysis Abandoned US20040137473A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/677,396 US20040137473A1 (en) 1997-10-30 2003-10-01 Use of representations of DNA for genetic analysis
US11/094,388 US7531307B2 (en) 1997-10-30 2005-03-30 Use of representations of DNA for genetic analysis

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US6435897P 1997-10-30 1997-10-30
PCT/US1998/023168 WO1999023256A1 (en) 1997-10-30 1998-10-30 Probe arrays and methods of using probe arrays for distinguishing dna
US56188100A 2000-05-01 2000-05-01
US10/677,396 US20040137473A1 (en) 1997-10-30 2003-10-01 Use of representations of DNA for genetic analysis

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US56188100A Division 1997-10-30 2000-05-01

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/094,388 Division US7531307B2 (en) 1997-10-30 2005-03-30 Use of representations of DNA for genetic analysis

Publications (1)

Publication Number Publication Date
US20040137473A1 true US20040137473A1 (en) 2004-07-15

Family

ID=22055393

Family Applications (3)

Application Number Title Priority Date Filing Date
US10/677,396 Abandoned US20040137473A1 (en) 1997-10-30 2003-10-01 Use of representations of DNA for genetic analysis
US11/094,388 Expired - Fee Related US7531307B2 (en) 1997-10-30 2005-03-30 Use of representations of DNA for genetic analysis
US11/094,565 Expired - Fee Related US8663917B2 (en) 1997-10-30 2005-03-30 Use of representations of DNA for genetic analysis

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/094,388 Expired - Fee Related US7531307B2 (en) 1997-10-30 2005-03-30 Use of representations of DNA for genetic analysis
US11/094,565 Expired - Fee Related US8663917B2 (en) 1997-10-30 2005-03-30 Use of representations of DNA for genetic analysis

Country Status (8)

Country Link
US (3) US20040137473A1 (da)
EP (1) EP1032705B1 (da)
JP (2) JP2001521754A (da)
AT (1) ATE537270T1 (da)
AU (1) AU753505B2 (da)
CA (1) CA2307674C (da)
DK (1) DK1032705T3 (da)
WO (1) WO1999023256A1 (da)

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040096853A1 (en) * 2000-12-08 2004-05-20 Pascal Mayer Isothermal amplification of nucleic acids on a solid support
US20040191813A1 (en) * 2002-12-23 2004-09-30 Laurakay Bruhn Comparative genomic hybridization assays using immobilized oligonucleotide features and compositions for practicing the same
US20040259106A1 (en) * 2003-06-20 2004-12-23 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20050026183A1 (en) * 2003-05-15 2005-02-03 Jian-Bing Fan Methods and compositions for diagnosing conditions associated with specific DNA methylation patterns
US20050032095A1 (en) * 2003-05-23 2005-02-10 Wigler Michael H. Virtual representations of nucleotide sequences
US20050037393A1 (en) * 2003-06-20 2005-02-17 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20050100893A1 (en) * 1999-04-20 2005-05-12 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
US20050164246A1 (en) * 2003-05-15 2005-07-28 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US20050181394A1 (en) * 2003-06-20 2005-08-18 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
US20070031883A1 (en) * 2004-03-04 2007-02-08 Kincaid Robert H Analyzing CGH data to identify aberrations
US20070082338A1 (en) * 2005-07-29 2007-04-12 Curry Bo U CGH array quality assessment
US20070128624A1 (en) * 2005-11-01 2007-06-07 Gormley Niall A Method of preparing libraries of template polynucleotides
US20070207481A1 (en) * 2005-12-14 2007-09-06 Michael Wigler Use of roma for characterizing genomic rearrangements
US20070259351A1 (en) * 2006-05-03 2007-11-08 James Chinitz Evaluating Genetic Disorders
US20070269817A1 (en) * 2002-06-17 2007-11-22 Affymetrix, Inc. Methods for Genotyping
US20080009420A1 (en) * 2006-03-17 2008-01-10 Schroth Gary P Isothermal methods for creating clonal single molecule arrays
US20080102453A1 (en) * 2006-10-31 2008-05-01 Jayati Ghosh Methods and systems and analysis of CGH data
WO2008119765A1 (en) * 2007-03-30 2008-10-09 Oryzon Genomics, S.A. Method of nucleic acid analysis to analyze the methylation pattern of cpg islands in different samples
US20080287308A1 (en) * 2007-05-18 2008-11-20 Affymetrix, Inc. System, method, and computer software product for genotype determination using probe array data
US20080293589A1 (en) * 2007-05-24 2008-11-27 Affymetrix, Inc. Multiplex locus specific amplification
US20090233802A1 (en) * 2007-02-02 2009-09-17 Helen Bignell Methods for indexing samples and sequencing multiple polynucleotide templates
US20100041561A1 (en) * 2005-11-25 2010-02-18 Niall Anthony Gormley Preparation of Nucleic Acid Templates for Solid Phase Amplification
US20100227768A1 (en) * 2005-12-14 2010-09-09 Wigler Michael H Method for designing a therapeutic regimen based on probabilistic diagnosis for genetic diseases by analysis of copy number variations
US7822555B2 (en) 2002-11-11 2010-10-26 Affymetrix, Inc. Methods for identifying DNA copy number changes
US8003354B2 (en) 2000-02-07 2011-08-23 Illumina, Inc. Multiplex nucleic acid reactions
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US8150627B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US8288103B2 (en) 2000-02-07 2012-10-16 Illumina, Inc. Multiplex nucleic acid reactions
US8486625B2 (en) 1999-04-20 2013-07-16 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
US8663917B2 (en) 1997-10-30 2014-03-04 Cold Spring Harbor Laboratory Use of representations of DNA for genetic analysis
US8862410B2 (en) 2010-08-02 2014-10-14 Population Diagnostics, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US9976180B2 (en) 2012-09-14 2018-05-22 Population Bio, Inc. Methods for detecting a genetic variation in subjects with parkinsonism
US10233495B2 (en) 2012-09-27 2019-03-19 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10522240B2 (en) 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
US10724096B2 (en) 2014-09-05 2020-07-28 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
US10961585B2 (en) 2018-08-08 2021-03-30 Pml Screening, Llc Methods for assessing risk of developing a viral of disease using a genetic test
US11180807B2 (en) 2011-11-04 2021-11-23 Population Bio, Inc. Methods for detecting a genetic variation in attractin-like 1 (ATRNL1) gene in subject with Parkinson's disease
US11306351B2 (en) 2005-12-21 2022-04-19 Affymetrix, Inc. Methods for genotyping
US11339439B2 (en) 2011-10-10 2022-05-24 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders

Families Citing this family (67)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020090639A1 (en) * 1998-02-26 2002-07-11 Mcginnis Ralph Evan Two dimensional linkage study methods and related inventions
JP2002528096A (ja) * 1998-10-27 2002-09-03 アフィメトリックス インコーポレイテッド ゲノムｄｎａの複雑性制御および分析
WO2000034518A1 (en) * 1998-12-04 2000-06-15 Keygene N.V. Array and method for analysing nucleic acid sequences
US8367322B2 (en) 1999-01-06 2013-02-05 Cornell Research Foundation, Inc. Accelerating identification of single nucleotide polymorphisms and alignment of clones in genomic sequencing
WO2000040755A2 (en) 1999-01-06 2000-07-13 Cornell Research Foundation, Inc. Method for accelerating identification of single nucleotide polymorphisms and alignment of clones in genomic sequencing
AU779231B2 (en) * 1999-02-22 2005-01-13 Lynx Therapeutics, Inc. Polymorphic DNA fragments and uses thereof
ATE225940T1 (de) * 1999-05-19 2002-10-15 Advanced Array Technologies S Verfahren zur identifizierung und/oder quantifizierung einer zielverbindung
US6638717B2 (en) 1999-05-19 2003-10-28 Aventis Pharmaceuticals, Inc. Microarray-based subtractive hybridzation
WO2001009384A2 (en) * 1999-07-29 2001-02-08 Genzyme Corporation Serial analysis of genetic alterations
BR0109679A (pt) * 2000-03-29 2003-02-04 Cambia Métodos de genotipagem, de identificação de uma molécula de ácido nucleico contendo um polimorfismo, kit para genotipagem, e, matriz ordenada de moléculas de dna
US6571005B1 (en) * 2000-04-21 2003-05-27 The Regents Of The University Of California Feature extraction and normalization algorithms for high-density oligonucleotide gene expression array data
AU2001257448A1 (en) * 2000-05-01 2001-11-12 Cold Spring Harbor Laboratory Use of representations of dna for genetic analysis
US20030087231A1 (en) * 2000-05-19 2003-05-08 Albertson Donna G. Methods and compositions for preparation of a polynucleotide array
US7846733B2 (en) 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
US6455255B1 (en) * 2000-08-02 2002-09-24 Abbott Laboratories Method of performing subtractive hybridization using RDA
WO2002016645A2 (en) * 2000-08-21 2002-02-28 Lynx Therapeutics, Inc. Polymorphic dna fragments and uses thereof
US6713257B2 (en) * 2000-08-25 2004-03-30 Rosetta Inpharmatics Llc Gene discovery using microarrays
US7807447B1 (en) 2000-08-25 2010-10-05 Merck Sharp & Dohme Corp. Compositions and methods for exon profiling
US20030148273A1 (en) * 2000-08-26 2003-08-07 Shoulian Dong Target enrichment and amplification
JP2005503755A (ja) 2000-12-13 2005-02-10 ニューゲン テクノロジーズ， インコーポレイテッド 核酸配列の複数コピーを作製するための方法および組成物、ならびにそれらを検出する方法
AU2002252279B2 (en) 2001-03-09 2005-05-12 Nugen Technologies, Inc. Methods and compositions for amplification of RNA sequences
WO2002086163A1 (en) * 2001-04-20 2002-10-31 Karolinska Innovations Ab Methods for high throughput genome analysis using restriction site tagged microarrays
US10229244B2 (en) 2002-11-11 2019-03-12 Affymetrix, Inc. Methods for identifying DNA copy number changes using hidden markov model based estimations
US7424368B2 (en) 2002-11-11 2008-09-09 Affymetix, Inc. Methods for identifying DNA copy number changes
WO2004061125A2 (en) 2002-12-31 2004-07-22 Mmi Genomics, Inc. Compositions, methods and systems for inferring bovine traits
US20060183132A1 (en) * 2005-02-14 2006-08-17 Perlegen Sciences, Inc. Selection probe amplification
US20090124514A1 (en) * 2003-02-26 2009-05-14 Perlegen Sciences, Inc. Selection probe amplification
JP2006523465A (ja) 2003-04-14 2006-10-19 ニューゲン テクノロジーズ， インコーポレイテッド ランダムにプライミングされる複合プライマーを用いる大規模増幅
US7211384B2 (en) 2003-05-28 2007-05-01 Agilent Technologies, Inc. Comparative genomic hybridization assays using immobilized oligonucleotide targets with initially small sample sizes and compositions for practicing the same
EP2471922A1 (en) 2004-05-28 2012-07-04 Asuragen, Inc. Methods and compositions involving microRNA
US8173611B2 (en) 2004-11-12 2012-05-08 Asuragen Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
US20060110744A1 (en) 2004-11-23 2006-05-25 Sampas Nicolas M Probe design methods and microarrays for comparative genomic hybridization and location analysis
WO2006122215A2 (en) 2005-05-10 2006-11-16 State Of Oregon Acting By & Through The State Board Of Higher Education On Behalf Of The University Of Oregon Methods of mapping polymorphisms and polymorphism microarrays
CA2621267A1 (en) 2005-09-07 2007-03-15 Nugen Technologies, Inc. Improved nucleic acid amplification procedure
EP1857559A1 (en) * 2006-05-16 2007-11-21 INSERM (Institut National de la Santé et de la Recherche Médicale) A method for predicting responsiveness to TNF alpha blocking agents
CA2663962A1 (en) 2006-09-19 2008-03-27 Asuragen, Inc. Mir-15, mir-26, mir-31,mir-145, mir-147, mir-188, mir-215, mir-216, mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention
EP2115138A2 (en) 2006-09-19 2009-11-11 Asuragen, Inc. Micrornas differentially expressed in pancreatic diseases and uses thereof
US8568979B2 (en) 2006-10-10 2013-10-29 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US9388457B2 (en) 2007-09-14 2016-07-12 Affymetrix, Inc. Locus specific amplification using array probes
US8361714B2 (en) 2007-09-14 2013-01-29 Asuragen, Inc. Micrornas differentially expressed in cervical cancer and uses thereof
EP2053132A1 (en) 2007-10-23 2009-04-29 Roche Diagnostics GmbH Enrichment and sequence analysis of geomic regions
WO2009055708A1 (en) * 2007-10-26 2009-04-30 Perlegen Sciences, Inc. Selection probe amplification
WO2009070805A2 (en) * 2007-12-01 2009-06-04 Asuragen, Inc. Mir-124 regulated genes and pathways as targets for therapeutic intervention
US8034568B2 (en) 2008-02-12 2011-10-11 Nugen Technologies, Inc. Isothermal nucleic acid amplification methods and compositions
US9074244B2 (en) 2008-03-11 2015-07-07 Affymetrix, Inc. Array-based translocation and rearrangement assays
GB2470672B (en) 2008-03-21 2012-09-12 Nugen Technologies Inc Methods of RNA amplification in the presence of DNA
WO2009137807A2 (en) 2008-05-08 2009-11-12 Asuragen, Inc. Compositions and methods related to mirna modulation of neovascularization or angiogenesis
CA2768391C (en) 2009-07-21 2016-09-06 Gen-Probe Incorporated Methods and compositions for quantitative detection of nucleic acid sequences over an extended dynamic range
US20120302450A1 (en) * 2009-10-30 2012-11-29 Bernhard Palsson Bacterial Metastructure and Methods of Use
US9677139B2 (en) 2009-12-11 2017-06-13 Cold Spring Harbor Laboratory Genetic markers indicative of a cancer patient response to trastuzumab (herceptin)
WO2011108930A1 (en) 2010-03-04 2011-09-09 Interna Technologies Bv A MiRNA MOLECULE DEFINED BY ITS SOURCE AND ITS DIAGNOSTIC AND THERAPEUTIC USES IN DISEASES OR CONDITIONS ASSOCIATED WITH EMT
LT2561078T (lt) 2010-04-23 2019-01-10 Cold Spring Harbor Laboratory Naujos struktūriškai sukonstruotos shrnr
NZ605420A (en) 2010-07-06 2015-02-27 Interna Technologies Bv Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated braf pathway
AU2011316807C1 (en) 2010-10-22 2018-01-25 Cold Spring Harbor Laboratory Varietal counting of nucleic acids for obtaining genomic copy number information
US10150999B2 (en) 2010-11-17 2018-12-11 Interpace Diagnostics, Llc miRNAs as biomarkers for distinguishing benign from malignant thyroid neoplasms
EP2474617A1 (en) 2011-01-11 2012-07-11 InteRNA Technologies BV Mir for treating neo-angiogenesis
CA2826043A1 (en) 2011-02-03 2012-08-09 Mirna Therapeutics, Inc. Synthetic mimics of mir-124
US20140057295A1 (en) 2011-02-28 2014-02-27 Barbara J. Stegmann Anti-mullerian hormone changes in pregnancy and prediction of adverse pregnancy outcomes and gender
WO2013040251A2 (en) 2011-09-13 2013-03-21 Asurgen, Inc. Methods and compositions involving mir-135b for distinguishing pancreatic cancer from benign pancreatic disease
US20130157884A1 (en) 2011-10-26 2013-06-20 Asuragen, Inc. Methods and compositions involving mirna expression levels for distinguishing pancreatic cysts
EP2771487A1 (en) 2011-10-27 2014-09-03 Asuragen, INC. Mirnas as diagnostic biomarkers to distinguish benign from malignant thyroid tumors
WO2014007623A1 (en) 2012-07-03 2014-01-09 Interna Technologies B.V. Diagnostic portfolio and its uses
US20140100124A1 (en) 2012-10-04 2014-04-10 Asuragen, Inc. Diagnostic mirnas for differential diagnosis of incidental pancreatic cystic lesions
EP3366785A3 (en) 2013-03-15 2018-09-19 Baylor Research Institute Ulcerative colitis (uc)-associated colorectal neoplasia markers
CA2907377A1 (en) 2013-03-15 2014-09-18 Baylor Research Institute Tissue and blood-based mirna biomarkers for the diagnosis, prognosis and metastasis-predictive potential in colorectal cancer
WO2017062434A1 (en) * 2015-10-07 2017-04-13 Mayo Foundation For Medical Education And Research Homologous recombination deficiency-interstitial aberration (hrd-ia) assay
WO2019086603A1 (en) 2017-11-03 2019-05-09 Interna Technologies B.V. Mirna molecule, equivalent, antagomir, or source thereof for treating and/or diagnosing a condition and/or a disease associated with neuronal deficiency or for neuronal (re)generation

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5436142A (en) * 1992-11-12 1995-07-25 Cold Spring Harbor Laboratory Methods for producing probes capable of distingushing variant genomic sequences
US5445934A (en) * 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5569753A (en) * 1994-12-20 1996-10-29 Cold Spring Harbor Laboratory Cancer detection probes
US5665549A (en) * 1992-03-04 1997-09-09 The Regents Of The University Of California Comparative genomic hybridization (CGH)
US5710000A (en) * 1994-09-16 1998-01-20 Affymetrix, Inc. Capturing sequences adjacent to Type-IIs restriction sites for genomic library mapping
US5721098A (en) * 1986-01-16 1998-02-24 The Regents Of The University Of California Comparative genomic hybridization
US5830645A (en) * 1994-12-09 1998-11-03 The Regents Of The University Of California Comparative fluorescence hybridization to nucleic acid arrays
US5858671A (en) * 1996-11-01 1999-01-12 The University Of Iowa Research Foundation Iterative and regenerative DNA sequencing method
US6013431A (en) * 1990-02-16 2000-01-11 Molecular Tool, Inc. Method for determining specific nucleotide variations by primer extension in the presence of mixture of labeled nucleotides and terminators
US6040138A (en) * 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US6100030A (en) * 1997-01-10 2000-08-08 Pioneer Hi-Bred International, Inc. Use of selective DNA fragment amplification products for hybridization-based genetic fingerprinting, marker assisted selection, and high-throughput screening
US6153379A (en) * 1993-06-22 2000-11-28 Baylor College Of Medicine Parallel primer extension approach to nucleic acid sequence analysis
US6287825B1 (en) * 1998-09-18 2001-09-11 Molecular Staging Inc. Methods for reducing the complexity of DNA sequences
US6465182B1 (en) * 1999-04-29 2002-10-15 The Regents Of The University Of California Comparative fluorescence hybridization to oligonucleotide microarrays
US6556549B1 (en) * 1999-07-02 2003-04-29 Qualcomm Incorporated Method and apparatus for signal combining in a high data rate communication system

Family Cites Families (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5573933A (en) 1987-04-14 1996-11-12 Luminis Pty, Ltd. Transgenic pigs
GB8810400D0 (en) * 1988-05-03 1988-06-08 Southern E Analysing polynucleotide sequences
JP2802125B2 (ja) 1989-06-23 1998-09-24 キヤノン株式会社 核酸の検出方法
US5474796A (en) 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
CZ291877B6 (cs) * 1991-09-24 2003-06-18 Keygene N.V. Způsob amplifikace přinejmenším jednoho restrikčního fragmentu z výchozí DNA a způsob přípravy sestavy amplifikovaných restrikčních fragmentů
US5632957A (en) * 1993-11-01 1997-05-27 Nanogen Molecular biological diagnostic systems including electrodes
US20040197774A1 (en) 1992-11-12 2004-10-07 Michael Wigler Representational approach to DNA analysis
US6277606B1 (en) 1993-11-09 2001-08-21 Cold Spring Harbor Laboratory Representational approach to DNA analysis
US6350576B1 (en) 1994-12-20 2002-02-26 Cold Spring Harbor Laboratory Cancer detection probes
EP0721987A1 (en) * 1995-01-16 1996-07-17 Keygene N.V. Amplification of simple sequence repeats
US5871917A (en) * 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids
US6119120A (en) 1996-06-28 2000-09-12 Microsoft Corporation Computer implemented methods for constructing a compressed data structure from a data string and for using the data structure to find data patterns in the data string
WO1998008981A1 (en) * 1996-08-30 1998-03-05 Life Technologies, Inc. METHODS FOR IDENTIFICATION AND ISOLATION OF SPECIFIC NUCLEOTIDE SEQUENCES IN cDNA AND GENOMIC DNA
AUPO427996A0 (en) 1996-12-20 1997-01-23 Co-Operative Research Centre For Diagnostic Technologies Method for detecting a nucleotide at a specific location within a polynucleotide sequence and apparatus therefor
CN1265156A (zh) 1997-07-22 2000-08-30 拉普吉恩公司 核酸阵列上进行的扩增及其它酶反应
CA2307674C (en) 1997-10-30 2013-02-05 Cold Spring Harbor Laboratory Probe arrays and methods of using probe arrays for distinguishing dna
WO1999028505A1 (en) 1997-12-03 1999-06-10 Curagen Corporation Methods and devices for measuring differential gene expression
EP1051523A2 (en) 1998-02-02 2000-11-15 Amersham Pharmacia Biotech AB Nucleic acid analysis method
JP2002528096A (ja) * 1998-10-27 2002-09-03 アフィメトリックス インコーポレイテッド ゲノムｄｎａの複雑性制御および分析
AU2001257448A1 (en) 2000-05-01 2001-11-12 Cold Spring Harbor Laboratory Use of representations of dna for genetic analysis
US6455182B1 (en) * 2001-05-09 2002-09-24 Utc Fuel Cells, Llc Shift converter having an improved catalyst composition, and method for its use
US8694263B2 (en) 2003-05-23 2014-04-08 Cold Spring Harbor Laboratory Method of identifying virtual representations of nucleotide sequences
EP1969514A2 (en) 2005-12-14 2008-09-17 Cold Spring Harbor Laboratory Methods for assessing probabilistic measures of clinical outcome using genomic profiling
CA2633203A1 (en) 2005-12-14 2007-06-21 Michael H. Wigler Use of roma for characterizing genomic rearrangements

Patent Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5721098A (en) * 1986-01-16 1998-02-24 The Regents Of The University Of California Comparative genomic hybridization
US6159685A (en) * 1986-01-16 2000-12-12 The Regents Of The University Of California Comparative genomic hybridization
US5445934A (en) * 1989-06-07 1995-08-29 Affymax Technologies N.V. Array of oligonucleotides on a solid substrate
US5510270A (en) * 1989-06-07 1996-04-23 Affymax Technologies N.V. Synthesis and screening of immobilized oligonucleotide arrays
US6013431A (en) * 1990-02-16 2000-01-11 Molecular Tool, Inc. Method for determining specific nucleotide variations by primer extension in the presence of mixture of labeled nucleotides and terminators
US5665549A (en) * 1992-03-04 1997-09-09 The Regents Of The University Of California Comparative genomic hybridization (CGH)
US5501964A (en) * 1992-11-12 1996-03-26 Cold Spring Harbor Laboratory Methods for producing probes capable of distinguishing DNA from related sources
US5436142A (en) * 1992-11-12 1995-07-25 Cold Spring Harbor Laboratory Methods for producing probes capable of distingushing variant genomic sequences
US6153379A (en) * 1993-06-22 2000-11-28 Baylor College Of Medicine Parallel primer extension approach to nucleic acid sequence analysis
US5710000A (en) * 1994-09-16 1998-01-20 Affymetrix, Inc. Capturing sequences adjacent to Type-IIs restriction sites for genomic library mapping
US5830645A (en) * 1994-12-09 1998-11-03 The Regents Of The University Of California Comparative fluorescence hybridization to nucleic acid arrays
US6562565B1 (en) * 1994-12-09 2003-05-13 The Regents Of The University Of California Comparative fluorescence hybridization to nucleic acid arrays
US5569753A (en) * 1994-12-20 1996-10-29 Cold Spring Harbor Laboratory Cancer detection probes
US6040138A (en) * 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US5858671A (en) * 1996-11-01 1999-01-12 The University Of Iowa Research Foundation Iterative and regenerative DNA sequencing method
US6100030A (en) * 1997-01-10 2000-08-08 Pioneer Hi-Bred International, Inc. Use of selective DNA fragment amplification products for hybridization-based genetic fingerprinting, marker assisted selection, and high-throughput screening
US6287825B1 (en) * 1998-09-18 2001-09-11 Molecular Staging Inc. Methods for reducing the complexity of DNA sequences
US6465182B1 (en) * 1999-04-29 2002-10-15 The Regents Of The University Of California Comparative fluorescence hybridization to oligonucleotide microarrays
US6556549B1 (en) * 1999-07-02 2003-04-29 Qualcomm Incorporated Method and apparatus for signal combining in a high data rate communication system

Cited By (106)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8663917B2 (en) 1997-10-30 2014-03-04 Cold Spring Harbor Laboratory Use of representations of DNA for genetic analysis
US8486625B2 (en) 1999-04-20 2013-07-16 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
US9279148B2 (en) 1999-04-20 2016-03-08 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
US9441267B2 (en) 1999-04-20 2016-09-13 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
US20050100893A1 (en) * 1999-04-20 2005-05-12 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
US10837059B2 (en) 2000-02-07 2020-11-17 Illumina, Inc. Multiplex nucleic acid reactions
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US8003354B2 (en) 2000-02-07 2011-08-23 Illumina, Inc. Multiplex nucleic acid reactions
US8906626B2 (en) 2000-02-07 2014-12-09 Illumina, Inc. Multiplex nucleic acid reactions
US8288103B2 (en) 2000-02-07 2012-10-16 Illumina, Inc. Multiplex nucleic acid reactions
US9850536B2 (en) 2000-02-07 2017-12-26 Illumina, Inc. Multiplex nucleic acid reactions
US20110008781A1 (en) * 2000-12-08 2011-01-13 Illumina Cambridge, Ltd. Isothermal amplification of nucleic acids on a solid support
US7972820B2 (en) 2000-12-08 2011-07-05 Illumina Cambridge Limited Isothermal amplification of nucleic acids on a solid support
US7790418B2 (en) 2000-12-08 2010-09-07 Illumina Cambridge Limited Isothermal amplification of nucleic acids on a solid support
US20040096853A1 (en) * 2000-12-08 2004-05-20 Pascal Mayer Isothermal amplification of nucleic acids on a solid support
US20110217710A9 (en) * 2002-06-17 2011-09-08 Affymetrix, Inc. Methods for Genotyping
US20070269817A1 (en) * 2002-06-17 2007-11-22 Affymetrix, Inc. Methods for Genotyping
US9388459B2 (en) 2002-06-17 2016-07-12 Affymetrix, Inc. Methods for genotyping
US7822555B2 (en) 2002-11-11 2010-10-26 Affymetrix, Inc. Methods for identifying DNA copy number changes
US8190373B2 (en) 2002-11-11 2012-05-29 Affymetrix, Inc. Methods for identifying DNA copy number changes
US10108777B2 (en) 2002-11-11 2018-10-23 Affymetrix, Inc. Methods for identifying DNA copy number changes
US20110029251A1 (en) * 2002-11-11 2011-02-03 Affymetrix, Inc. Methods for Identifying DNA Copy Number Changes
US20040191813A1 (en) * 2002-12-23 2004-09-30 Laurakay Bruhn Comparative genomic hybridization assays using immobilized oligonucleotide features and compositions for practicing the same
US8232055B2 (en) 2002-12-23 2012-07-31 Agilent Technologies, Inc. Comparative genomic hybridization assays using immobilized oligonucleotide features and compositions for practicing the same
US8150627B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US20050164246A1 (en) * 2003-05-15 2005-07-28 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US20050026183A1 (en) * 2003-05-15 2005-02-03 Jian-Bing Fan Methods and compositions for diagnosing conditions associated with specific DNA methylation patterns
US8150626B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US8694263B2 (en) 2003-05-23 2014-04-08 Cold Spring Harbor Laboratory Method of identifying virtual representations of nucleotide sequences
US20050032095A1 (en) * 2003-05-23 2005-02-10 Wigler Michael H. Virtual representations of nucleotide sequences
US20050059048A1 (en) * 2003-06-20 2005-03-17 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20050181394A1 (en) * 2003-06-20 2005-08-18 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US9045796B2 (en) 2003-06-20 2015-06-02 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20040259106A1 (en) * 2003-06-20 2004-12-23 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US11591641B2 (en) 2003-06-20 2023-02-28 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20050037393A1 (en) * 2003-06-20 2005-02-17 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20040259100A1 (en) * 2003-06-20 2004-12-23 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US10738350B2 (en) 2003-06-20 2020-08-11 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US7670810B2 (en) 2003-06-20 2010-03-02 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20050053980A1 (en) * 2003-06-20 2005-03-10 Illumina, Inc. Methods and compositions for whole genome amplification and genotyping
US20070031883A1 (en) * 2004-03-04 2007-02-08 Kincaid Robert H Analyzing CGH data to identify aberrations
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
US20070082338A1 (en) * 2005-07-29 2007-04-12 Curry Bo U CGH array quality assessment
US8321138B2 (en) 2005-07-29 2012-11-27 Agilent Technologies, Inc. Method of characterizing quality of hybridized CGH arrays
US20070128624A1 (en) * 2005-11-01 2007-06-07 Gormley Niall A Method of preparing libraries of template polynucleotides
US10253359B2 (en) 2005-11-01 2019-04-09 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US8563478B2 (en) 2005-11-01 2013-10-22 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US9376678B2 (en) 2005-11-01 2016-06-28 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US11142789B2 (en) 2005-11-01 2021-10-12 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US7741463B2 (en) 2005-11-01 2010-06-22 Illumina Cambridge Limited Method of preparing libraries of template polynucleotides
US20100273662A1 (en) * 2005-11-01 2010-10-28 Illumina Cambridge Ltd Method of preparing libraries of template polynucleotides
US20100041561A1 (en) * 2005-11-25 2010-02-18 Niall Anthony Gormley Preparation of Nucleic Acid Templates for Solid Phase Amplification
US8168388B2 (en) 2005-11-25 2012-05-01 Illumina Cambridge Ltd Preparation of nucleic acid templates for solid phase amplification
US20100227768A1 (en) * 2005-12-14 2010-09-09 Wigler Michael H Method for designing a therapeutic regimen based on probabilistic diagnosis for genetic diseases by analysis of copy number variations
US8554488B2 (en) 2005-12-14 2013-10-08 Cold Spring Harbor Laboratory Determining a probabilistic diagnosis of autism by analysis of genomic copy number variations
EP3091462A1 (en) 2005-12-14 2016-11-09 Cold Spring Harbor Laboratory Methods for assessing probabilistic measures of clinical outcome using genomic profiling
US20070207481A1 (en) * 2005-12-14 2007-09-06 Michael Wigler Use of roma for characterizing genomic rearrangements
US11306351B2 (en) 2005-12-21 2022-04-19 Affymetrix, Inc. Methods for genotyping
US20080009420A1 (en) * 2006-03-17 2008-01-10 Schroth Gary P Isothermal methods for creating clonal single molecule arrays
US7702468B2 (en) 2006-05-03 2010-04-20 Population Diagnostics, Inc. Evaluating genetic disorders
US8655599B2 (en) 2006-05-03 2014-02-18 Population Diagnostics, Inc. Evaluating genetic disorders
US20110021366A1 (en) * 2006-05-03 2011-01-27 James Chinitz Evaluating genetic disorders
US20100248236A1 (en) * 2006-05-03 2010-09-30 James Chinitz Evaluating Genetic Disorders
US10522240B2 (en) 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
US10529441B2 (en) 2006-05-03 2020-01-07 Population Bio, Inc. Evaluating genetic disorders
US7957913B2 (en) 2006-05-03 2011-06-07 Population Diagnostics, Inc. Evaluating genetic disorders
US10210306B2 (en) 2006-05-03 2019-02-19 Population Bio, Inc. Evaluating genetic disorders
US20070259351A1 (en) * 2006-05-03 2007-11-08 James Chinitz Evaluating Genetic Disorders
US20080102453A1 (en) * 2006-10-31 2008-05-01 Jayati Ghosh Methods and systems and analysis of CGH data
US9512478B2 (en) 2007-02-02 2016-12-06 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US11634768B2 (en) 2007-02-02 2023-04-25 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US10988806B2 (en) 2007-02-02 2021-04-27 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US8182989B2 (en) 2007-02-02 2012-05-22 Illumina Cambridge Ltd. Methods for indexing samples and sequencing multiple polynucleotide templates
US8053192B2 (en) 2007-02-02 2011-11-08 Illumina Cambridge Ltd. Methods for indexing samples and sequencing multiple polynucleotide templates
US20090233802A1 (en) * 2007-02-02 2009-09-17 Helen Bignell Methods for indexing samples and sequencing multiple polynucleotide templates
US10457985B2 (en) 2007-02-02 2019-10-29 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
US8822150B2 (en) 2007-02-02 2014-09-02 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple polynucleotide templates
WO2008119765A1 (en) * 2007-03-30 2008-10-09 Oryzon Genomics, S.A. Method of nucleic acid analysis to analyze the methylation pattern of cpg islands in different samples
US20100022409A1 (en) * 2007-03-30 2010-01-28 Oryzon Genomics, S.A. Method of nucleic acid analysis to analyze the methylation pattern
US10832796B2 (en) 2007-05-18 2020-11-10 Affymetrix, Inc. System, method, and computer software product for genotype determination using probe array data
US8200440B2 (en) 2007-05-18 2012-06-12 Affymetrix, Inc. System, method, and computer software product for genotype determination using probe array data
US9760675B2 (en) 2007-05-18 2017-09-12 Affymetrix, Inc. System, method, and computer software product for genotype determination using probe array data
US20080287308A1 (en) * 2007-05-18 2008-11-20 Affymetrix, Inc. System, method, and computer software product for genotype determination using probe array data
US20080293589A1 (en) * 2007-05-24 2008-11-27 Affymetrix, Inc. Multiplex locus specific amplification
US11788142B2 (en) 2010-08-02 2023-10-17 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US8862410B2 (en) 2010-08-02 2014-10-14 Population Diagnostics, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US10059997B2 (en) 2010-08-02 2018-08-28 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US11339439B2 (en) 2011-10-10 2022-05-24 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US11180807B2 (en) 2011-11-04 2021-11-23 Population Bio, Inc. Methods for detecting a genetic variation in attractin-like 1 (ATRNL1) gene in subject with Parkinson's disease
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US11174516B2 (en) 2012-02-09 2021-11-16 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US11008614B2 (en) 2012-09-14 2021-05-18 Population Bio, Inc. Methods for diagnosing, prognosing, and treating parkinsonism
US12012634B2 (en) 2012-09-14 2024-06-18 Population Bio, Inc. Methods for diagnosing, prognosing, and treating parkinson's disease or parkinsonism
US9976180B2 (en) 2012-09-14 2018-05-22 Population Bio, Inc. Methods for detecting a genetic variation in subjects with parkinsonism
US11618925B2 (en) 2012-09-27 2023-04-04 Population Bio, Inc. Methods and compositions for screening and treating developmental disorders
US10233495B2 (en) 2012-09-27 2019-03-19 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10597721B2 (en) 2012-09-27 2020-03-24 Population Bio, Inc. Methods and compositions for screening and treating developmental disorders
US10724096B2 (en) 2014-09-05 2020-07-28 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
US11549145B2 (en) 2014-09-05 2023-01-10 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
US10544463B2 (en) 2017-02-03 2020-01-28 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10563264B2 (en) 2017-02-03 2020-02-18 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10941448B1 (en) 2017-02-03 2021-03-09 The Universite Paris-Saclay Methods for assessing risk of developing a viral disease using a genetic test
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
US11913073B2 (en) 2017-02-03 2024-02-27 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US11913074B2 (en) 2018-08-08 2024-02-27 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10961585B2 (en) 2018-08-08 2021-03-30 Pml Screening, Llc Methods for assessing risk of developing a viral of disease using a genetic test

Also Published As

Publication number Publication date
AU753505B2 (en) 2002-10-17
WO1999023256A1 (en) 1999-05-14
CA2307674C (en) 2013-02-05
US20050266444A1 (en) 2005-12-01
ATE537270T1 (de) 2011-12-15
CA2307674A1 (en) 1999-05-14
JP2001521754A (ja) 2001-11-13
AU1449799A (en) 1999-05-24
DK1032705T3 (da) 2012-03-26
US8663917B2 (en) 2014-03-04
US20050196799A1 (en) 2005-09-08
US7531307B2 (en) 2009-05-12
EP1032705B1 (en) 2011-12-14
EP1032705A1 (en) 2000-09-06
EP1032705A4 (en) 2004-09-15
JP2009232865A (ja) 2009-10-15

Similar Documents

Publication Publication Date Title
US7531307B2 (en) Use of representations of DNA for genetic analysis
US20230183788A1 (en) Oligonucleotide Paints
US7776536B2 (en) Comparative fluorescence hybridization to nucleic acid arrays
AU780119B2 (en) Accelerating identification of single nucleotide polymorphisms and alignment of clones in genomic sequencing
US6403319B1 (en) Analysis of sequence tags with hairpin primers
US7247428B2 (en) Methods for rapid screening of polymorphisms, mutations and methylation
EP1040202B1 (en) Dna polymorphism identity determination using flow cytometry
US6156502A (en) Arbitrary sequence oligonucleotide fingerprinting
US20050233340A1 (en) Methods and compositions for assessing CpG methylation
JP2006525814A (ja) ヌクレオチド配列の実質的表示
EP1647602A1 (en) Array-based comparative genome hybridization assays
WO2001073134A2 (en) Gene profiling arrays
US20030049663A1 (en) Use of reflections of DNA for genetic analysis
US20040014086A1 (en) Regulome arrays
Knight et al. The use of subtelomeric probes to study mental retardation
WO2001083822A2 (en) Use of representations of dna for genetic analysis
US20070148636A1 (en) Method, compositions and kits for preparation of nucleic acids
JP2002532070A (ja) 核酸配列を解析するためのアレイおよび方法
JP2003038183A (ja) ゲノムｄｎａ中のメチレーションサイトのメチル化検出用バイオチップ及びメチル化検出方法
Class et al. Inventors: Chao-Ting Wu (Brookline, MA, US) Chao-Ting Wu (Brookline, MA, US) George M. Church (Brookline, MA, US) Benjamin Richard Williams (Seattle, WA, US) Assignees: President and Fellows of Havard College

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION