US20040115775A1 - Homogeneity and secretion of recombinant proteins in mammalian systems - Google Patents
Homogeneity and secretion of recombinant proteins in mammalian systems Download PDFInfo
- Publication number
- US20040115775A1 US20040115775A1 US10/432,196 US43219603A US2004115775A1 US 20040115775 A1 US20040115775 A1 US 20040115775A1 US 43219603 A US43219603 A US 43219603A US 2004115775 A1 US2004115775 A1 US 2004115775A1
- Authority
- US
- United States
- Prior art keywords
- protein
- cell
- interest
- expression vector
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
- C12N15/625—DNA sequences coding for fusion proteins containing a sequence coding for a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
- C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
Definitions
- the present invention relates to a method for improving homogeneity and/or secretion of a recombinant protein of interest expressed in mammalian cells by replacing the endogenous signal peptide sequence of the DNA encoding the protein of interest with that of human hGH.
- the invention also relates to DNA expression vectors containing the sequence encoding such proteins fused to the signal peptide sequence of the hGH and to cells harboring such vectors.
- Protein secretion is one of the most important issues of protein production in the field of biotechnology. This process is composed of the following steps: first, translocation across the endoplasmic reticulum (ER) membrane; second N-glycosylation and folding in the ER lumen; third, exit from the ER; fourth, modifications in the Golgi apparatus; and finally release from the secretory granules to the extracellular space (Sakaguchi 1997). Whether or not a protein is secreted from the cells mainly depends on whether it can be translocated across the membrane and whether it can be correctly folded in the ER lumen. Membrane translocation is obligatorily coupled in mammalian cells.
- nascent peptides After membrane translocation, the nascent peptides are released into the lumenal space and folded with the assistance of various chaperones and folding enzymes. Wrongly folded proteins are trapped within the ER and thus cannot proceed towards the secretory compartments. In biotechnological processes in which massive protein expression occurs, secretion can represent a bottleneck and limit the rate of expression.
- Signal peptides or leader sequences are located at the amino terminus of nascent polypeptides. They target proteins to the secretory pathway and are cleaved from the nascent chain once translocated in the reticulum endoplasmatic membrane.
- SUBSTITUTE SHEET (RULE 26)
- the signal peptide consists of three regions: an amino-terminal polar region (N region), where positive charged aminoacid residues are frequently observed; a central hydrophobic region (H region) of more than 7-8 hydrophobic amino acid residues; and a carboxy-terminal region (C region) that includes the signal peptide cleavage site (Sakaguchi 1997).
- N region amino-terminal polar region
- H region central hydrophobic region
- C region carboxy-terminal region
- the eukaryotic H regions are dominated by Leu with some occurrence of Val, Ala, Phe and Ile.
- the cleavage of the signal peptide from the mature protein occurs at a specific site and the cleavage specificity resides in the last residue of the signal sequence (Nielsen et al. 1997).
- the signal peptide of the human growth hormone (hGH) has been described to be effective in targeting the secretion of intracellular, membrane bound proteins and proteins secreted by different mechanisms than those governed by signal peptides.
- WO26562 describes the secretion of the intracellular protein icIL-Ira-Il by fusion of the signal peptide of hGH to the sequence of the icIL-Ira-II.
- the invention relates to a process for the recombinant expression of a protein having the amino acid sequence of natural icIL-Ira-II in a recombinant cell expression system through use of a vector which is a fusion of the signal peptide of a human secretory protein, preferably the 26 amino acid signal peptide of hGH, fused in proper reading frame with the DNA encoding icIL-Ira-Il.
- the process comprises producing an expression vector containing DNA encoding icIL-Ira-11, either in the form of cDNA or genomic DNA, fused in proper reading frame with DNA encoding the selected signal peptide, preferably the 26 amino acid hGH signal peptide (FIG. 1 SEQ ID NO:2).
- the expression vector is then inserted into an appropriate expression host, such as CHO cells.
- the transformed host cells are then cultured in a manner, which causes the expression vector to express its encoded protein, and the expressed and secreted icIL-Ira-II protein is then collected and purified from the culture medium.
- the soluble forms of CD40L have been prepared by fusion of the entire extracellular domain of human CD40L or the CD40L region homologous to TNF sequence to the signal peptide sequence of hGH.
- the multimerized form of the CD40L has been prepared by fusion to an isoleucine zipper (IZ). The results showed that multimerization increases the activity of soluble CD40L.
- Pecceu et al (1991) describes the use of the hGH signal peptide to express and secrete the mature form of IL-1 ⁇ .
- proIL-1 ⁇ remains primarily cytosolic until it is cleaved and transported out of the cells. Examination of the sequence reveals the absence of a classical N-terminal or internal hydrophobic signal peptide. Release of mature IL-1 ⁇ appears to be linked to processing at the aspartic acid-alanine peptide cleavage by the converting enzyme (ICE) (Dinarello 1996).
- ICE is constitutively expressed in most cells, not all cells process proIL-1 ⁇ and secrete mature IL-1 ⁇ . Therefore secretion of mature IL-1 ⁇ is cell dependent.
- Pecceu discloses the use a recombinant vector containing only the DNA encoding the mature form of IL-18 ⁇ , without any signal peptide and a vector containing the DNA encoding the mature form of IL-18 ⁇ joined to hGH signal peptide.
- the results show that only 52% of the protein are secreted using the first construct, while using the construct with hGH signal peptide results in 97% secretion.
- the first ATG codon for initiation of translation has to be identified by the transcriptional machinery.
- An ATG codon in a very weak context is not likely to be the start site for translation.
- the optimal context for initiation of translation in vertebral mRNAs is a G residue following the ATG codon (position +4 in the coding region) and a purine, preferable A, three nucleotides upstream ( ⁇ 3 in the noncoding region) this consensus sequence has been designated Kozak sequence (Kozak 1996, 1999).
- Messenger RNA in which the first ATG codon lacks the preferred nucleotides in both of these key flanking positions have the special property of initiating translation at the first and second ATG codons, thereby producing two proteins from one RNA.
- the ATG in the initiation site of hGH signal peptide is followed by G (in position +3) required for obtaining an optimal Kozak sequence (FIGS. 1 and 2 SEQ ID NO:3), which ensures the start of translation at the first ATG site only and homogeneity of the product.
- IL- 18 binding protein (IL18-BP) was affinity purified from human urine using IL-18, sequenced and cloned. IL-18BP was found to abolish in vitro the activity of the pro-inflammatory cytokine IL-18. (Novick et al. 1999). The DNA encodes a signal peptide at its N-terminal portion. Part of the Kozak sequence encoded inside the signal peptide is not of the appropriate context. IL-18BP leader ATG A +1 +4 Kozak Concensus ATG G +1 +4 Human growth ATG G hormone leader +1 +4
- the invention provides an improved method for production of homogeneous recombinant protein of interest expressed in different mammalian systems and or effective secretion thereof comprising replacing the endogenous signal peptide sequence of the DNA encoding the protein of interest with that of hGH.
- the invention also provides an expression vector for improving homogeneity and/or secretion of a recombinant protein of interest expressed in a mammalian system comprising the signal peptide sequence of the hGH joined to the DNA encoding the protein of interest.
- the present invention provides said vector, which encodes the optimal Kozak sequence ensuring translation from one initiation codon only. Part of such a sequence is included in the coding for the hGH signal peptide, ensuring accurate cleavage of the signal peptide from the mature protein.
- the vector includes the gene encoding IL-18BP.
- IL-18BP the gene encoding IL-18BP.
- Such a vector allows the production of homogeneous IL-18BP (starting with Thr-Pro-Val).
- the invention also provides a protein of interest produced with the said vector and by the said method, such as IL-18BP.
- the invention provides cells capable of growing in serum free medium and able to produce at least 4 picogram IL-18B/cell/24 hours, preferably at least 11.8 picogram/cell/24 hours and most preferably about 12 picograms/cell/24 hours.
- FIG. 1 shows the genomic sequence encoding the hGH signal peptide and translated amino acid sequence.
- FIG. 2 shows the Kozak sequence present in the consensus and in the hGH signal peptide.
- FIG. 3 describes the primers used for the fusion of hGH signal peptide (without its intron) sequence with the IL-18BP sequence.
- the present invention relates to the production and secretion of recombinant proteins using the signal peptide sequence of the hGH instead of their natural signal peptide sequence.
- the invention also provides an expression vector containing the DNA encoding the protein of interest, either in the form of cDNA or genomic DNA, fused in proper reading frame with the DNA encoding the hGH signal peptide.
- the expression vector is then inserted into an appropriate expression host, i.e. mammalian cells.
- the transformed host cells are then cultured in a manner, which causes the expression vector to express its encoded protein, and the expressed and secreted protein is then isolated and purified.
- the expression of the protein of interest may be stable or transient.
- CHO cells are the preferred host cells, other mammalian cells may be used, such as COS cells, HEK293 cells etc.
- COS cells HEK293 cells
- Those of ordinary skill in the art are well aware of the techniques of creating expression vectors, inserting them into expression systems and selecting clones, which express the desired protein, including amplification techniques.
- promoters used to control transcription of the recombinant proteins may be any of those, which are functional in the host cells.
- Examples of promoters functional in mammalian cells include the SV40 early promoter, adenovirus major late promoter, herpes simplex (HSV) thymidine kinase promoter, rous sarcoma (RSV) LTR promoter, human cytomegalovirus (CMV) immediate early promoter, mouse mammary tumor virus (MMTV) LTR promoter, interferon- ⁇ promoter, heat shock protein 70 (hsp 70) promoter, as well as many others well known in the art. These promoters may be either constitutive or regulatable.
- Constitutive promoters are preferred because an extra treatment step, such as temperature shift, addition of chemical agents or inducers, etc., is not required for expression from constitutive promoters. It has been shown in one embodiment that higher productivity can be obtained by controlling IL-18BP expression with the CMV promoter as compared to the SV40 promoter.
- the core polyadenylation signal i.e. the highly conserved hexanucleotide AAUAAA found 10 to 30 nucleotides upstream of the cleavage site, a less highly conserved U-rich or GU-rich element located downstream of the cleavage site, and the cleavage site itself, which becomes the point of poly(A) addition and is thus generally referred to as the poly(A) site (Zhao et al. 1999). Additional sequences outside of this core recruit regulatory factors or maintain the core signal in an open and accessible structure.
- Different expression vectors for heterologous expression have been designed to contain efficient polyadenylation signals such as SV40 and hGH polyadenylation signals.
- IL-18BP is produced using the human growth hormone polyadenylation signal.
- the present invention relates to an expression vector which contains the IL-18BP DNA fused to the DNA encoding the signal peptide of hGH, and to host cells transfected with such an expression vector.
- the DNA sequence of the hGH signal peptide used may be either the genomic sequence including the intron (FIG. 1 SEQ ID NO: 1) or the cDNA sequence of the signal peptide excluding the intron.
- the invention relates to mammalian cells which express and efficiently secrete homogenous recombinant proteins using the hGH signal peptide.
- the invention relates to cells which efficiently secrete homologous recombinant proteins, according to the invention, that are capable of being grown and produced in serum free medium (SFM). More specifically, in a preferred embodiment cells, according to the invention, were shown to produce between 4 and 11.8, and also about 12 picogram IL-18BP/cell/24 hours in both serum and serum free conditions.
- SFM serum free medium
- the invention also relates to proteins of interest prepared according to the method herein described.
- the invention relates to pharmaceutical compositions comprising proteins of interest, such as IL-18BP produced in such an expression system, optionally together with a pharmaceutically acceptable excipient.
- the DNA of the natural signal peptide of the IL-18BP protein encodes for a non-optimal Kozak sequence because the +4 is A and not G therefore it was replaced by hGH signal peptide which exhibits an optimal Kozak sequence (FIG. 2 SEQ ID NO:3).
- the DNA fragment encoding the hGH signal peptide fused to the IL-18BP protein was introduced in a mammalian expression vector under the control of the SV-40 promoter and polyadenylation signal.
- hGH signal peptide (without its intron, see FIG. 1) was fused directly to the cDNA coding for the mature hIL-18SBP protein (variant A, accession number AF110799 in the NCBI public databases) by PCR (FIG. 3 describes the primers used).
- the hGH signal peptide (without its intron) was amplified by PCR using pXGH5 (Selden et al. 1986) as a template and two primers, a) a primer containing sequences from the beginning of the hGHsp (5′hGH-IL-18BP fusion out primer SEQ ID NO:4) and b) a primer encoding sequences from the end of the hGHsp and sequences coding the first 19 nucleotides of the mature IL-18BP cDNA (3′ hGH-IL-18BP fusion-in primer SEQ ID NO:5).
- the cDNA coding for the mature IL-18BP was amplified by PCR using a plasmid encoding the IL-18BP cDNA, as a template and two primers, a) a primer coding overlapping sequences to the hGH signal peptide end and the beginning of the mature IL-18BP cDNA (the 5′hGH-IL-18BP fusion-in primer SEQ ID NO:6) and b) a primer containing the end of the IL-18BP cDNA sequence (the 3 ′hGH-IL-18BP fusion-out primer SEQ ID NO:7).
- the fragments resulting from the above PCR amplification were fused in a third PCR, by annealing of the overlapping sequences present in both fragments and using two primers a) the primer 5′hGH-IL-18BP fusion out, and b) the primer 3′hGH-IL-18BP fusion-out primers.
- the resulting PCR DNA fragment was cloned into the mammalian expression vector pSVE3 (Hartman et al. 1982) encoding the commonly used regulatory signals, the SV40 promoter and SV40 polyA signal (the 5′ and 3′ fusion out primers contained also specific restriction sites sequences needed for cloning).
- the constructed plasmid (PSILl18BP) was used for transfecting CHO (DHFR—) cells together with a plasmid containing the mouse DHFR gene as a selective marker.
- the DNA of the natural signal peptide of the IL-18BP protein encodes for a non-optimal Kozal sequence because the +4 is A and not G therefore it was replaced by hGH signal peptide which exhibits an optimal Kozak sequence (FIG. 2 SEQ ID NO:3).).
- the DNA fragment encoding the hGH signal peptide fused to the IL-18BP protein was introduced in a mammalian expression vector under the control of the CMV promoter and the human growth hormone polyadenylation signal.
- the DNA encoding the hGH signal peptide (without its intron see FIG. 1) was fused directly to the cDNA coding for the mature hIL-18BP protein (variant A accession number AF 110799) by PCR using the expression vector generated in example 1 (PSIL 18BP) as a template and two primers, a) the forward primer ACGCGTTCGACGCCACCATGGCTCCCGGACG (SEQ ID NO:8) comprising a SaII restriction site, and the first 21 bases encoding the cDNA hGH signal peptide and b) the reverse primer CGGGATCCTCATTAACCCTGCTGCTGTGG (SEQ ID NO:9) comprising the last 18 bases of IL-18BP, two stop codons and a Bam HI restriction site.
- the resulting PCR DNA fragment was inserted into a mammalian expression vector, using known molecular genetic manipulations, wherein the, mammalian vector comprise the commonly used regulatory signals to be used to express IL-18BP: the CMV promoter and hGH polyA signal (Ausubel et al., Current Protocols in Molecular Biology, Greene Publications and Wiley Interscience, New York, N.Y., 1987-1995; Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989).
- the constructed plasmid (pCMV-IL18 bp2) was used for transfecting CHO (DHFR—) cells together with a plasmid containing the mouse DHFR gene as a selective marker.
- the IL-18BP in the supernatant of all the producing cells was purified by immunoaffinity chromatography.
- N-terminal analysis of the IL18 -BP expressed with the signal peptide of hGH revealed only the correct species of IL-18B with the following N-terminal amino acid sequence T P V S Q T T T A A T A S V R (SEQ ID NO:10).
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to a method for improving homogeneity and/or secretion of a recombinant protein of interest expressed in mammalian cells by replacing the endogenous signal peptide sequence of the DNA encoding the protein of interest with that of human hGH. The invention also relates to DNA expression vectors containing the sequence encoding such proteins fused to the signal peptide sequence of the hGH and to cells harboring such vectors.
Description
- The present invention relates to a method for improving homogeneity and/or secretion of a recombinant protein of interest expressed in mammalian cells by replacing the endogenous signal peptide sequence of the DNA encoding the protein of interest with that of human hGH. The invention also relates to DNA expression vectors containing the sequence encoding such proteins fused to the signal peptide sequence of the hGH and to cells harboring such vectors.
- Protein secretion is one of the most important issues of protein production in the field of biotechnology. This process is composed of the following steps: first, translocation across the endoplasmic reticulum (ER) membrane; second N-glycosylation and folding in the ER lumen; third, exit from the ER; fourth, modifications in the Golgi apparatus; and finally release from the secretory granules to the extracellular space (Sakaguchi 1997). Whether or not a protein is secreted from the cells mainly depends on whether it can be translocated across the membrane and whether it can be correctly folded in the ER lumen. Membrane translocation is obligatorily coupled in mammalian cells. After membrane translocation, the nascent peptides are released into the lumenal space and folded with the assistance of various chaperones and folding enzymes. Wrongly folded proteins are trapped within the ER and thus cannot proceed towards the secretory compartments. In biotechnological processes in which massive protein expression occurs, secretion can represent a bottleneck and limit the rate of expression.
- Signal peptides or leader sequences, are located at the amino terminus of nascent polypeptides. They target proteins to the secretory pathway and are cleaved from the nascent chain once translocated in the reticulum endoplasmatic membrane. SUBSTITUTE SHEET (RULE 26)
- The signal peptide consists of three regions: an amino-terminal polar region (N region), where positive charged aminoacid residues are frequently observed; a central hydrophobic region (H region) of more than 7-8 hydrophobic amino acid residues; and a carboxy-terminal region (C region) that includes the signal peptide cleavage site (Sakaguchi 1997). The eukaryotic H regions are dominated by Leu with some occurrence of Val, Ala, Phe and Ile. The cleavage of the signal peptide from the mature protein occurs at a specific site and the cleavage specificity resides in the last residue of the signal sequence (Nielsen et al. 1997). Close to the cleavage site −3 and −1 alanine is more predominant. This site confers processing specificity. No further specific patterns in the first few positions of the mature protein can be seen in eukaryotic organisms (Nielsen et al 1997). Therefore a “bad” signal peptide can promote more than one specific cleavage resulting in non-homogenous expression of the protein; i.e. the protein will be expressed with different N-terminal aminoacids.
- Since many proteins are regulated under physiological conditions the use of natural regulatory signals for overexpression in manmmalian systems is not desirable. For example, in such systems efficient promoters such as CMV and SV40 are used to control expression of recombinant proteins of interest. Similarly, the use of effective signal peptides such as SV40 and hGH poly A to overexpress recombinant secreted proteins instead of their endogenous counterparts would be advantageous.
- The signal peptide of the human growth hormone (hGH) has been described to be effective in targeting the secretion of intracellular, membrane bound proteins and proteins secreted by different mechanisms than those governed by signal peptides.
- For example, WO26562 describes the secretion of the intracellular protein icIL-Ira-Il by fusion of the signal peptide of hGH to the sequence of the icIL-Ira-II. The invention relates to a process for the recombinant expression of a protein having the amino acid sequence of natural icIL-Ira-II in a recombinant cell expression system through use of a vector which is a fusion of the signal peptide of a human secretory protein, preferably the 26 amino acid signal peptide of hGH, fused in proper reading frame with the DNA encoding icIL-Ira-Il. The process comprises producing an expression vector containing DNA encoding icIL-Ira-11, either in the form of cDNA or genomic DNA, fused in proper reading frame with DNA encoding the selected signal peptide, preferably the 26 amino acid hGH signal peptide (FIG. 1 SEQ ID NO:2). The expression vector is then inserted into an appropriate expression host, such as CHO cells. The transformed host cells are then cultured in a manner, which causes the expression vector to express its encoded protein, and the expressed and secreted icIL-Ira-II protein is then collected and purified from the culture medium.
- Morris at al. (1999) describes the use of hGH signal peptide for the secretion of the protein CDL40L, which exists in nature predominantly as a membrane-anchored molecule. Several reports have shown that the soluble form of CD40L is biologically active (Fanslow et al. 1994, Hollenbaugh et al. 1992 and Mazzei et al. 1995). To use CD40L as a potential therapeutic, optimisation of soluble forms of this molecule have been developed. In this work, the activity of soluble forms of CD40L, and the activity of the soluble multimeuized CD40L TNF homologous region, have been compared. The soluble forms of CD40L have been prepared by fusion of the entire extracellular domain of human CD40L or the CD40L region homologous to TNF sequence to the signal peptide sequence of hGH. The multimerized form of the CD40L has been prepared by fusion to an isoleucine zipper (IZ). The results showed that multimerization increases the activity of soluble CD40L.
- Pecceu et al (1991) describes the use of the hGH signal peptide to express and secrete the mature form of IL-1β. In the body, after synthesis, proIL-1β remains primarily cytosolic until it is cleaved and transported out of the cells. Examination of the sequence reveals the absence of a classical N-terminal or internal hydrophobic signal peptide. Release of mature IL-1β appears to be linked to processing at the aspartic acid-alanine peptide cleavage by the converting enzyme (ICE) (Dinarello 1996). Although ICE is constitutively expressed in most cells, not all cells process proIL-1 β and secrete mature IL-1β. Therefore secretion of mature IL-1β is cell dependent. Pecceu discloses the use a recombinant vector containing only the DNA encoding the mature form of IL-18β, without any signal peptide and a vector containing the DNA encoding the mature form of IL-18β joined to hGH signal peptide. The results show that only 52% of the protein are secreted using the first construct, while using the construct with hGH signal peptide results in 97% secretion.
- The first ATG codon for initiation of translation has to be identified by the transcriptional machinery. An ATG codon in a very weak context is not likely to be the start site for translation. The optimal context for initiation of translation in vertebral mRNAs is a G residue following the ATG codon (position +4 in the coding region) and a purine, preferable A, three nucleotides upstream (−3 in the noncoding region) this consensus sequence has been designated Kozak sequence (Kozak 1996, 1999). Messenger RNA in which the first ATG codon lacks the preferred nucleotides in both of these key flanking positions (a “bad ” or non optimal Kozak sequence) have the special property of initiating translation at the first and second ATG codons, thereby producing two proteins from one RNA. The ATG in the initiation site of hGH signal peptide is followed by G (in position +3) required for obtaining an optimal Kozak sequence (FIGS. 1 and 2 SEQ ID NO:3), which ensures the start of translation at the first ATG site only and homogeneity of the product.
- IL-18 binding protein (IL18-BP) was affinity purified from human urine using IL-18, sequenced and cloned. IL-18BP was found to abolish in vitro the activity of the pro-inflammatory cytokine IL-18. (Novick et al. 1999). The DNA encodes a signal peptide at its N-terminal portion. Part of the Kozak sequence encoded inside the signal peptide is not of the appropriate context.
IL-18BP leader ATG A +1 +4 Kozak Concensus ATG G +1 +4 Human growth ATG G hormone leader +1 +4 - Therefore exists a need to provide a method or system allowing secretion of a protein of interest in general and allowing secretion of IL-18BP in particular as homogenous proteins and/or in large amounts in mammalian cells.
- The invention provides an improved method for production of homogeneous recombinant protein of interest expressed in different mammalian systems and or effective secretion thereof comprising replacing the endogenous signal peptide sequence of the DNA encoding the protein of interest with that of hGH. The invention also provides an expression vector for improving homogeneity and/or secretion of a recombinant protein of interest expressed in a mammalian system comprising the signal peptide sequence of the hGH joined to the DNA encoding the protein of interest.
- In one aspect, the present invention provides said vector, which encodes the optimal Kozak sequence ensuring translation from one initiation codon only. Part of such a sequence is included in the coding for the hGH signal peptide, ensuring accurate cleavage of the signal peptide from the mature protein.
- In one embodiment of the present invention the vector includes the gene encoding IL-18BP. Such a vector allows the production of homogeneous IL-18BP (starting with Thr-Pro-Val).
- The invention also provides a protein of interest produced with the said vector and by the said method, such as IL-18BP.
- In onother aspect, the invention provides cells capable of growing in serum free medium and able to produce at least 4 picogram IL-18B/cell/24 hours, preferably at least 11.8 picogram/cell/24 hours and most preferably about 12 picograms/cell/24 hours.
- FIG. 1 shows the genomic sequence encoding the hGH signal peptide and translated amino acid sequence.
- FIG. 2 shows the Kozak sequence present in the consensus and in the hGH signal peptide.
- FIG. 3 describes the primers used for the fusion of hGH signal peptide (without its intron) sequence with the IL-18BP sequence.
- The present invention relates to the production and secretion of recombinant proteins using the signal peptide sequence of the hGH instead of their natural signal peptide sequence. The invention also provides an expression vector containing the DNA encoding the protein of interest, either in the form of cDNA or genomic DNA, fused in proper reading frame with the DNA encoding the hGH signal peptide. The expression vector is then inserted into an appropriate expression host, i.e. mammalian cells. The transformed host cells are then cultured in a manner, which causes the expression vector to express its encoded protein, and the expressed and secreted protein is then isolated and purified. The expression of the protein of interest may be stable or transient.
- While CHO cells are the preferred host cells, other mammalian cells may be used, such as COS cells, HEK293 cells etc. Those of ordinary skill in the art are well aware of the techniques of creating expression vectors, inserting them into expression systems and selecting clones, which express the desired protein, including amplification techniques.
- As will be appreciated by those skilled in the art, the types of promoters used to control transcription of the recombinant proteins may be any of those, which are functional in the host cells. Examples of promoters functional in mammalian cells include the SV40 early promoter, adenovirus major late promoter, herpes simplex (HSV) thymidine kinase promoter, rous sarcoma (RSV) LTR promoter, human cytomegalovirus (CMV) immediate early promoter, mouse mammary tumor virus (MMTV) LTR promoter, interferon-β promoter, heat shock protein 70 (hsp 70) promoter, as well as many others well known in the art. These promoters may be either constitutive or regulatable. Constitutive promoters are preferred because an extra treatment step, such as temperature shift, addition of chemical agents or inducers, etc., is not required for expression from constitutive promoters. It has been shown in one embodiment that higher productivity can be obtained by controlling IL-18BP expression with the CMV promoter as compared to the SV40 promoter.
- In mammalian cells, three elements define the core polyadenylation signal i.e. the highly conserved hexanucleotide AAUAAA found 10 to 30 nucleotides upstream of the cleavage site, a less highly conserved U-rich or GU-rich element located downstream of the cleavage site, and the cleavage site itself, which becomes the point of poly(A) addition and is thus generally referred to as the poly(A) site (Zhao et al. 1999). Additional sequences outside of this core recruit regulatory factors or maintain the core signal in an open and accessible structure. Different expression vectors for heterologous expression have been designed to contain efficient polyadenylation signals such as SV40 and hGH polyadenylation signals. In a preferred embodiment IL-18BP is produced using the human growth hormone polyadenylation signal.
- In particular, the present invention relates to an expression vector which contains the IL-18BP DNA fused to the DNA encoding the signal peptide of hGH, and to host cells transfected with such an expression vector.
- The DNA sequence of the hGH signal peptide used, may be either the genomic sequence including the intron (FIG. 1 SEQ ID NO: 1) or the cDNA sequence of the signal peptide excluding the intron.
- In accordance with the present invention it is possible to express, IL-18BP and other secreted proteins homogeneously and effectively in a mammalian expression system using the signal peptide of hGH.
- In addition, the invention relates to mammalian cells which express and efficiently secrete homogenous recombinant proteins using the hGH signal peptide.
- In another aspect, the invention relates to cells which efficiently secrete homologous recombinant proteins, according to the invention, that are capable of being grown and produced in serum free medium (SFM). More specifically, in a preferred embodiment cells, according to the invention, were shown to produce between 4 and 11.8, and also about 12 picogram IL-18BP/cell/24 hours in both serum and serum free conditions.
- The invention also relates to proteins of interest prepared according to the method herein described. In another aspect, the invention relates to pharmaceutical compositions comprising proteins of interest, such as IL-18BP produced in such an expression system, optionally together with a pharmaceutically acceptable excipient.
- The invention will be now illustrated by the following non-limiting examples.
- The DNA of the natural signal peptide of the IL-18BP protein encodes for a non-optimal Kozak sequence because the +4 is A and not G therefore it was replaced by hGH signal peptide which exhibits an optimal Kozak sequence (FIG. 2 SEQ ID NO:3). The DNA fragment encoding the hGH signal peptide fused to the IL-18BP protein was introduced in a mammalian expression vector under the control of the SV-40 promoter and polyadenylation signal.
- For the preparation of the expression vector, hGH signal peptide (without its intron, see FIG. 1) was fused directly to the cDNA coding for the mature hIL-18SBP protein (variant A, accession number AF110799 in the NCBI public databases) by PCR (FIG. 3 describes the primers used).
- The hGH signal peptide (without its intron) was amplified by PCR using pXGH5 (Selden et al. 1986) as a template and two primers, a) a primer containing sequences from the beginning of the hGHsp (5′hGH-IL-18BP fusion out primer SEQ ID NO:4) and b) a primer encoding sequences from the end of the hGHsp and sequences coding the first 19 nucleotides of the mature IL-18BP cDNA (3′ hGH-IL-18BP fusion-in primer SEQ ID NO:5).
- The cDNA coding for the mature IL-18BP was amplified by PCR using a plasmid encoding the IL-18BP cDNA, as a template and two primers, a) a primer coding overlapping sequences to the hGH signal peptide end and the beginning of the mature IL-18BP cDNA (the 5′hGH-IL-18BP fusion-in primer SEQ ID NO:6) and b) a primer containing the end of the IL-18BP cDNA sequence (the 3 ′hGH-IL-18BP fusion-out primer SEQ ID NO:7).
- The fragments resulting from the above PCR amplification were fused in a third PCR, by annealing of the overlapping sequences present in both fragments and using two primers a) the primer 5′hGH-IL-18BP fusion out, and b) the primer 3′hGH-IL-18BP fusion-out primers.
- The resulting PCR DNA fragment was cloned into the mammalian expression vector pSVE3 (Hartman et al. 1982) encoding the commonly used regulatory signals, the SV40 promoter and SV40 polyA signal (the 5′ and 3′ fusion out primers contained also specific restriction sites sequences needed for cloning).
- The constructed plasmid (PSILl18BP) was used for transfecting CHO (DHFR—) cells together with a plasmid containing the mouse DHFR gene as a selective marker.
- Individual isolates were isolated in selective medium and assayed for IL-18BP production by an ELISA assay.
- Several rounds of gene amplification with increasing MTX concentrations were carried out. After amplification, clones were isolated by limiting dilution. After subcloning the selected clone S10-21 showed a specific and stable productivity of 1 picogram/cell/24 hours.
- The DNA of the natural signal peptide of the IL-18BP protein encodes for a non-optimal Kozal sequence because the +4 is A and not G therefore it was replaced by hGH signal peptide which exhibits an optimal Kozak sequence (FIG. 2 SEQ ID NO:3).). The DNA fragment encoding the hGH signal peptide fused to the IL-18BP protein was introduced in a mammalian expression vector under the control of the CMV promoter and the human growth hormone polyadenylation signal.
- For the preparation of the expression vector, the DNA encoding the hGH signal peptide (without its intron see FIG. 1) was fused directly to the cDNA coding for the mature hIL-18BP protein (variant A accession number AF 110799) by PCR using the expression vector generated in example 1 (PSIL 18BP) as a template and two primers, a) the forward primer ACGCGTTCGACGCCACCATGGCTCCCGGACG (SEQ ID NO:8) comprising a SaII restriction site, and the first 21 bases encoding the cDNA hGH signal peptide and b) the reverse primer CGGGATCCTCATTAACCCTGCTGCTGTGG (SEQ ID NO:9) comprising the last 18 bases of IL-18BP, two stop codons and a Bam HI restriction site.
- The resulting PCR DNA fragment was inserted into a mammalian expression vector, using known molecular genetic manipulations, wherein the, mammalian vector comprise the commonly used regulatory signals to be used to express IL-18BP: the CMV promoter and hGH polyA signal (Ausubel et al., Current Protocols in Molecular Biology, Greene Publications and Wiley Interscience, New York, N.Y., 1987-1995; Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989).
- The constructed plasmid (pCMV-IL18 bp2) was used for transfecting CHO (DHFR—) cells together with a plasmid containing the mouse DHFR gene as a selective marker.
- Individual isolates were isolated in selective medium and assayed for IL-18BP production by an ELISA assay.
- Several rounds of gene amplification with increasing MTX concentrations were carried out (up to 1000 nM) on selected high producer isolates. Following amplification the MTX was removed and high producer clones were isolated by limiting dilution and screening the activity. After cloning the selected clone 22C2-11 showed high specific productivity of 4 picogram/cell/24 hours and stability in serum at 37° C. The 22C2-11 clone was found to grow and produce IL-18BP also under serum free conditions. The productivity of the clone 22C2-11 was tested at lower temperatures. At 32-33° C., both in serum and serum free conditions, the productivity was found to increase to 11.8 picogram IL-18BP/cell/24 hours.
- These results indicate that using a construct controlling expression from the CMV promoter and hGH ployA signal allowed increased IL-18BP expression as compared to the expression levels controlled from the SV40 promoter and SV40 poly A signal (example 1).
- The IL-18BP in the supernatant of all the producing cells (S 10-21 and 22C2-11 examples 1 and 2 respectively) was purified by immunoaffinity chromatography. N-terminal analysis of the IL18 -BP expressed with the signal peptide of hGH, revealed only the correct species of IL-18B with the following N-terminal amino acid sequence T P V S Q T T T A A T A S V R (SEQ ID NO:10). These results show that IL-18BP is homogeneously produced, from different expression vectors, by using the hGH signal peptide in which, in contrast to the IL-18BP natural signal peptide, the Kozak signal is of optimal context.
- Dinarello, C.A. (1996) “Biologic Basis for Interleukin-1 in Disease. ” Blood, 87, 2095-147.
- Fanslow, W. C., Srinivasan, S., Paxton, R., Gibson, M. G., Spriggs, M. K., Armitage, R. J. (1994) “Structural characteristics of CD40 ligand that determine biological function.” Semin Immunology, 5, 267-78.
- Hartman, J. R., Nayak, D. P. and Fareed, G. C. (1982) “Human Influenza virus hemagglutinin is expressed in monkey cells using simian virus 40 vectors. ” Proc.Natl.Acad.Sci.USA, 79, 233-7.
- Hollenbaugh, D., Grosmaire, L. S., Kullas, C. D., Chalupny, N. J., Braesch-Andersen, S., Noelle, R. J., Stamenkovic, I., Ledbetter, J. A., and Aruffo, A. (1992) “The human T cell antigen gp39, a member of the TNF gene family, is a ligand for the CD40 receptor: expression of a soluble form of gp39 with B cell co-stimulatory activity.” EMBO J. 11, 4313-21.
- Kozak, M. (1996)“Interpreting cDNA sequences: some insights from studies on translation.” Mammalian Genome, 7, 563-74.
- Kozak, M. (1999) “Initiation of translation in prokaryotes and eukaryotes.” Gene, 234, 187-208.
- Mazzei, G. J., Edgerton, M. D., Losberger, C., Lecoanet-Henchoz, S., Graber, P., Durandy, A., Gauchat, J. F., Bernard, A., Allet, B. and Bonnefoy, J. Y. (1995) “Recombinant Soluble Trimeric CD40 Ligand Is Biologically Active.” J. Biol. Chenm. 270, 7025-8.
- Morris, A., Remmele, Jr., Klinke, R., Macduff, B. M., Fanslow, W. C. and Armitage, R. J. (1999) “Incorporation of an Isoleucine Zipper Motif Enhances the Biological Avtivity of Soluble CD40L (CD154).” The journal of Biological Chemistry, 474, 418-23.
- Nielsen, H., Engelbrecht, J., Brunak, S. and von Heijne, G. (1997) “Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.” Protein Engineering, 10, 1-6.
- Novick, D., Kim, S. H., Fantuzzi, G., Reznikov, L. L, Dinarello, C. A. and Rubinstein, M.(1999) “Interleukin-18 Binding Protein: A Novel Modulator of the ThI Cytokine Response.” Immunity 10, 127-136.
- Pecceu, F., Dousset, P., Shire, D., Cavrois, E., Marchese, E., Ferrara, P., Kaghad, M., Dumont, X. and Lupker, J.(1991) “human interleukin 1b fused to the human growth hormone signal peptide is N-glycosilated and secretede by chinese hamster ovary cells.” Gene, 97, 253-8.
- Sakaguchi, M. (1997) “Eukaryotic protein secretion.” Current Opinion in Biotechnology, 8, 595-601.
- Selden, R. F., Howie, K. B., Rowe, M. E., Goodman, H. M. and Moore, D. D. (1986) “Human growth hormone as a reporter gene in regulation studies employing transient gene expression.” Mol Cell Biol 6, 3173-9.
- Zhao, J., Hyman, L., and Moore, C. (1999) “Formation of mRNA 3′ ends in eukaryotes: mechanism, regulation and interrelationships with other steps in mRNA synthesis.”Microbiology and Molecular Biology Reviews 63, 405-445.
-
1 10 1 338 DNA Homo sapiens 1 atggctacag gtaagcgccc ctaaaatccc tttgggcaca atgtgtcctg aggggagagg 60 cagcgacctg tagatgggac gggggcacta accctcaggt ttggggcttc tgaatgtgag 120 tatcgccatg taagcccagt atttggccaa tctcagaaag ctcctggtcc ctggagggat 180 ggagagagaa aaacaaacag ctcctggagc agggagagtg ctggcctctt gctctccggc 240 tccctctgtt gccctctggt ttctccccag gctcccggac gtccctgctc ctggcttttg 300 gcctgctctg cctgccctgg cttcaagagg gcagtgcc 338 2 26 PRT Homo sapiens 2 Met Ala Thr Gly Ser Arg Thr Ser Leu Leu Leu Ala Phe Gly Leu Leu 1 5 10 15 Cys Leu Pro Trp Leu Gln Glu Gly Ser Ala 20 253 4 DNA Homo sapiens 3 atgg 44 34 DNA Homo sapiens 4 tataagctta ccatggctac aggctcccgg acgt 34 5 34 DNA Homo sapiens 5 tggtctgcga gacaggtgtg gcactgccct cttg 34 6 34 DNA Homo sapiens 6 caagagggca gtgccacacc tgtctcgcag acca 34 7 31 DNA Homo sapiens 7 cgggatccct attaaccctg ctgctgtgga c 31 8 31 DNA Homo sapiens 8 acgcgttcga cgccaccatg gctcccggac g 31 9 29 DNA Homo sapiens 9 cgggatcctc attaaccctg ctgctgtgg 29 10 15 PRT Homo sapiens 10 Thr Pro Val Ser Gln Thr Thr Thr Ala Ala Thr Ala Ser Val Arg 1 5 10 15
Claims (28)
1. A method for improving homogeneity and/or secretion of a recombinant protein of interest expressed in a mammalian system comprising replacing the endogenous signal peptide sequence of the DNA encoding the protein of interest with that of hGH.
2. A method according to claim 1 , wherein the protein of interst IL-18BP.
3. A method according to claim 2 , wherein the mammalian system comprises CHO cells.
4. A method according to claim 3 , wherein the CHO cells are cultured in medium supplemented with serum.
5. A method according to claim 3 , wherein the CHO cells are cultured under serum free conditions.
6. An expression vector for improving homogeneity and/or secretion of a recombinant protein of interest expressed in a mammalian system comprising the signal peptide sequence of hGH and the DNA encoding the protein of interest.
7. An expression vector according to claim 6 , which directs expression of a homogenous protein.
8. An expression vector according to claim 6 , which directs efficient expression of the protein of interest.
9. An expression vector according to claim 6 , which directs efficient translation of the protein of interest.
10. An expression vector according to claim 6 , in which the signal peptide encodes an optimal Kozalk sequence.
11. An expression vector according to claim 6 , which directs efficient secretion of the protein of interest.
12. An expression vector according to claim 6 , which allows constitutive expression of the protein of interest.
13. An expression vector according to claim 6 , wherein the expression of the gene encoding the protein of interest is regulated by the CMV promoter.
14. An expression vector according to claim 6 , wherein the expression of the gene encoding the protein of interest is regulated by the polyadenylation signal of the human growth hormone.
15. An expression vector in accordance with anyone of claims 6 to 14 , wherein the protein of interest is IL-18BP.
16. A cell harbouring a vector according to anyone of claims 6 to 15 .
17. A cell according to claim 16 , producing about 12 picogram IL-18BP/cell/24 hours.
18. A cell according to claim 16 , producing 11.8 picogram IL-18BP/cell/24 hours.
19. A cell according to claim 16 , producing at least 4 picogram IL-18BP/cell/24 hours.
20. A cell according to claim 16 , producing at least 11.8 picogram IL-18BP/cell/24 hours.
21. A cell according to claim 16 , capable of growing in serum free medium.
22. A cell according to claim 21 , producing at least 4 picogram IL-18 BP/cell/24 hours.
23. A cell according to claim 21 , producing about 12 picogram IL-18 BP/cell/24 hours.
24. A cell according to claim 21 , producing 11.8 picogram IL-18BP/cell/24 hours.
25. A cell according to claim 21 , producing at least 11.8 picogram IL-18BP/cell/24 hours.
26. A protein obtainable by the method of claim 1 .
27. A protein according to claim 26 , being IL-18BP.
28. A pharmaceutical composition comprising a protein according to claims 26 or 27.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/858,928 US7282352B2 (en) | 2000-12-05 | 2004-06-02 | Homogeneity and secretion of recombinant proteins in mammalian systems |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
IL14011000A IL140110A0 (en) | 2000-12-05 | 2000-12-05 | Improvement of homogeneity and secretion of recombinant proteins in mammalian systems |
IL140110 | 2000-12-05 | ||
PCT/IL2001/001125 WO2002046430A2 (en) | 2000-12-05 | 2001-12-05 | Improvement of homogeneity and secretion of recombinant proteins in mammalian systems |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/858,928 Continuation-In-Part US7282352B2 (en) | 2000-12-05 | 2004-06-02 | Homogeneity and secretion of recombinant proteins in mammalian systems |
Publications (1)
Publication Number | Publication Date |
---|---|
US20040115775A1 true US20040115775A1 (en) | 2004-06-17 |
Family
ID=11074884
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/432,196 Abandoned US20040115775A1 (en) | 2000-12-05 | 2001-12-05 | Homogeneity and secretion of recombinant proteins in mammalian systems |
US10/858,928 Expired - Fee Related US7282352B2 (en) | 2000-12-05 | 2004-06-02 | Homogeneity and secretion of recombinant proteins in mammalian systems |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/858,928 Expired - Fee Related US7282352B2 (en) | 2000-12-05 | 2004-06-02 | Homogeneity and secretion of recombinant proteins in mammalian systems |
Country Status (14)
Country | Link |
---|---|
US (2) | US20040115775A1 (en) |
EP (1) | EP1339855B1 (en) |
JP (1) | JP2004516830A (en) |
AT (1) | ATE471986T1 (en) |
AU (2) | AU2002222454B2 (en) |
CA (1) | CA2429094A1 (en) |
CY (1) | CY1110670T1 (en) |
DE (1) | DE60142446D1 (en) |
DK (1) | DK1339855T3 (en) |
ES (1) | ES2346956T3 (en) |
IL (1) | IL140110A0 (en) |
PT (1) | PT1339855E (en) |
SI (1) | SI1339855T1 (en) |
WO (1) | WO2002046430A2 (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070048793A1 (en) * | 2005-07-12 | 2007-03-01 | Baynes Brian M | Compositions and methods for biocatalytic engineering |
WO2016154344A1 (en) | 2015-03-24 | 2016-09-29 | The Regents Of The University Of California | Adeno-associated virus variants and methods of use thereof |
CN111304243A (en) * | 2018-12-12 | 2020-06-19 | 普莱柯生物工程股份有限公司 | Construction method of CHO cell strain for efficiently expressing foreign protein, constructed CHO cell strain and application thereof |
WO2022042673A1 (en) * | 2020-08-28 | 2022-03-03 | 江苏恒瑞医药股份有限公司 | Signal peptide for reducing end heterogeneity of heterologous polypeptide |
Families Citing this family (16)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2864810A1 (en) * | 2003-04-18 | 2004-11-04 | Biogen Idec Ma, Inc. | Polymer-conjugated glycosylated neublastin |
GB0314856D0 (en) | 2003-06-25 | 2003-07-30 | Unitargeting Res As | Protein expression system |
ES2333724T3 (en) | 2003-09-26 | 2010-02-26 | Merck Serono Sa | LEADING SEQUENCES FOR USE IN THE PRODUCTION OF PROTEINS. |
US7598059B2 (en) | 2003-10-02 | 2009-10-06 | Biogen Idec Ma Inc. | Neublastin expression constructs |
NZ553420A (en) | 2004-08-19 | 2010-02-26 | Biogen Idec Inc | Refolding transforming growth factor beta family proteins |
ATE557038T1 (en) * | 2005-06-03 | 2012-05-15 | Ares Trading Sa | PREPARATION OF RECOMBINANT IL-18 BINDING PROTEIN |
TWI501774B (en) | 2006-02-27 | 2015-10-01 | Biogen Idec Inc | Treatments for neurological disorders |
WO2008108344A1 (en) * | 2007-03-02 | 2008-09-12 | Cellgentech, Inc. | Cell for gene therapy of lcat deficiency, and replication-deficient retrovirus vector and plasmid for use in the production of the cell |
US8329655B2 (en) | 2007-05-01 | 2012-12-11 | Biogen Idec Ma Inc. | Methods for increasing vascularization |
TWI488640B (en) * | 2008-04-16 | 2015-06-21 | Ferring Int Ct Sa | Pharmaceutical preparation |
WO2010036976A2 (en) | 2008-09-25 | 2010-04-01 | Transgenrx, Inc. | Novel vectors for production of antibodies |
WO2010036978A2 (en) | 2008-09-25 | 2010-04-01 | Transgenrx, Inc. | Novel vectors for production of growth hormone |
US9150881B2 (en) | 2009-04-09 | 2015-10-06 | Proteovec Holding, L.L.C. | Production of proteins using transposon-based vectors |
AU2014225272B2 (en) * | 2013-03-08 | 2015-10-22 | Neuclone Biologics Pty Ltd | A cell expression system |
EP3932947A1 (en) * | 2013-03-14 | 2022-01-05 | Translate Bio MA, Inc. | Methods and compositions for delivering mrna coded antibodies |
EP3999647A1 (en) * | 2019-07-18 | 2022-05-25 | Lysogene | Compositions and methods for the treatment of sanfilippo disease and other disorders |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5417970A (en) * | 1988-10-21 | 1995-05-23 | Sanofi | Drugs containing a glycosylated interleukin-2 |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4923805A (en) * | 1983-11-02 | 1990-05-08 | Integrated Genetics, Inc. | Fsh |
FR2619719B1 (en) * | 1987-09-01 | 1991-05-10 | Sanofi Sa | PROCESS FOR OBTAINING INTERLEUKIN-2 FROM EUKARYOTIC CELLS, VECTORS NECESSARY FOR ITS IMPLEMENTATION AND HIGHLY PRODUCING CELL LINES |
EP0935651B1 (en) * | 1996-09-13 | 2004-12-29 | Transkaryotic Therapies, Inc. | THERAPY FOR alpha-GALACTOSIDASE A DEFICIENCY |
IL126562A0 (en) * | 1998-10-14 | 1999-08-17 | Interpharm Lab Ltd | Expression and secretion of icil-1 receptor antagonist type ii |
-
2000
- 2000-12-05 IL IL14011000A patent/IL140110A0/en unknown
-
2001
- 2001-12-05 AU AU2002222454A patent/AU2002222454B2/en not_active Ceased
- 2001-12-05 AT AT01999652T patent/ATE471986T1/en active
- 2001-12-05 DK DK01999652.9T patent/DK1339855T3/en active
- 2001-12-05 JP JP2002548147A patent/JP2004516830A/en active Pending
- 2001-12-05 AU AU2245402A patent/AU2245402A/en active Pending
- 2001-12-05 ES ES01999652T patent/ES2346956T3/en not_active Expired - Lifetime
- 2001-12-05 CA CA002429094A patent/CA2429094A1/en not_active Abandoned
- 2001-12-05 US US10/432,196 patent/US20040115775A1/en not_active Abandoned
- 2001-12-05 SI SI200130972T patent/SI1339855T1/en unknown
- 2001-12-05 EP EP01999652A patent/EP1339855B1/en not_active Expired - Lifetime
- 2001-12-05 WO PCT/IL2001/001125 patent/WO2002046430A2/en active IP Right Grant
- 2001-12-05 PT PT01999652T patent/PT1339855E/en unknown
- 2001-12-05 DE DE60142446T patent/DE60142446D1/en not_active Expired - Lifetime
-
2004
- 2004-06-02 US US10/858,928 patent/US7282352B2/en not_active Expired - Fee Related
-
2010
- 2010-07-20 CY CY20101100677T patent/CY1110670T1/en unknown
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5417970A (en) * | 1988-10-21 | 1995-05-23 | Sanofi | Drugs containing a glycosylated interleukin-2 |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070048793A1 (en) * | 2005-07-12 | 2007-03-01 | Baynes Brian M | Compositions and methods for biocatalytic engineering |
WO2016154344A1 (en) | 2015-03-24 | 2016-09-29 | The Regents Of The University Of California | Adeno-associated virus variants and methods of use thereof |
CN111304243A (en) * | 2018-12-12 | 2020-06-19 | 普莱柯生物工程股份有限公司 | Construction method of CHO cell strain for efficiently expressing foreign protein, constructed CHO cell strain and application thereof |
WO2022042673A1 (en) * | 2020-08-28 | 2022-03-03 | 江苏恒瑞医药股份有限公司 | Signal peptide for reducing end heterogeneity of heterologous polypeptide |
Also Published As
Publication number | Publication date |
---|---|
ES2346956T3 (en) | 2010-10-22 |
EP1339855A2 (en) | 2003-09-03 |
US7282352B2 (en) | 2007-10-16 |
AU2002222454B2 (en) | 2007-04-05 |
IL140110A0 (en) | 2002-02-10 |
PT1339855E (en) | 2010-07-07 |
CA2429094A1 (en) | 2002-06-13 |
DK1339855T3 (en) | 2010-08-30 |
US20060234352A1 (en) | 2006-10-19 |
EP1339855B1 (en) | 2010-06-23 |
JP2004516830A (en) | 2004-06-10 |
SI1339855T1 (en) | 2010-08-31 |
ATE471986T1 (en) | 2010-07-15 |
WO2002046430A3 (en) | 2003-01-03 |
AU2245402A (en) | 2002-06-18 |
WO2002046430A2 (en) | 2002-06-13 |
DE60142446D1 (en) | 2010-08-05 |
CY1110670T1 (en) | 2015-06-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1339855B1 (en) | Improvement of homogeneity and secretion of recombinant proteins in mammalian systems | |
AU2002222454A1 (en) | Improvement of homogeneity and secretion of recombinant proteins in mammalian systems | |
JP4908723B2 (en) | Methods for treating inflammation | |
Leahy et al. | A mammalian expression vector for expression and purification of secreted proteins for structural studies | |
JP3121611B2 (en) | Gene vector for expressing nerve growth factor in eukaryotic cells | |
AU7519494A (en) | Expression of fusion polypeptides transported out of the cytoplasm without leader sequences | |
JPH05268967A (en) | Chimeric interleukin-5 receptor/immunoglobulin polypeptide | |
JPH11504819A (en) | Novel mutant CD40L | |
EP3138917A1 (en) | Method for the expression of polypeptides using modified nucleic acids | |
KR870000501B1 (en) | Manufacturing method of human-proinsulin amino acid sequences containing proteins | |
WO1997023639A1 (en) | Process for producing biologically active fused proteins | |
JP3570558B2 (en) | DNA fragment, vector containing the same, transformant transformed with the vector, and method for producing protein using the vector | |
US7214532B2 (en) | Methods for identifying human cell lines useful for endogenous gene activation, isolated human cell lines identified thereby, and uses thereof | |
US20040053249A1 (en) | Fas ligand-fused proteins | |
EP1121448B1 (en) | EXPRESSION AND SECRETION OF icIL-1 RECEPTOR ANTAGONIST TYPE II | |
KR102008407B1 (en) | Codon optimized il-21 and uses thereof | |
JP3499528B2 (en) | Signal sequence trap method | |
US20040209323A1 (en) | Protein expression by codon harmonization and translational attenuation | |
KR100512018B1 (en) | Production of human mutant proteins in human cells by homologous recombination | |
WO1997042306A1 (en) | Bovine dipeptidylaminopeptidase 1 | |
JPH11196867A (en) | New il-6 receptor-il-6 fused protein | |
MXPA00000677A (en) | Identification of human cell lines for the production of human proteins by endogenous gene activation | |
KR20170033609A (en) | Recombinant Vector Including Gene of Autopahgy Activation Proetin and Crystallizing Method for Recombinant Protein Using Thereof | |
MXPA00000645A (en) | Production of human mutant proteins in human cells by homologous recombination | |
JPH0723788A (en) | Production of neurotrophic factor and vector therefor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
XAS | Not any more in us assignment database |
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:APPLIED RESEARCH SYSTEMS ARS HOLDING N.V.;REEL/FRAME:019808/0379 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |