JPH0723788A - Production of neurotrophic factor and vector therefor - Google Patents

Abstract

PURPOSE:To obtain a new vector having a bioactivity useful for production of a brain-derived neurotrophic factor maturation protein. CONSTITUTION:This is a vector having a DNA capable of coding a polypeptide chain of a brain-derived neurotrophic factor and another DNA capable of coding the signal sequence of a colibacillus is bonded to the DNA on the upper stream side of 5' terminal. A regulator gene for a colibacillus is contained in the upper stream of the DNA capable of coding the signal sequence. As this vector, a BDNF manifestation vector pTRSBDNF is exemplified. This exemplified vector can be obtained by the scheme shown in the figure.

Description

Detailed Description of the Invention

[0001]

The present invention relates to a vector having a DNA encoding a brain-derived neurotrophic factor gene, an Escherichia coli regulatory gene and an E. coli signal sequence, a transformant transformed with the vector, and the trait. The present invention relates to a method for producing a brain-derived neurotrophic factor using a transformant.

[0002]

BACKGROUND OF THE INVENTION Vertebrate nerve cells require a group of polypeptides called neurotrophic factors for their survival. These polypeptides are useful for elucidating the functions of the nervous system and the mechanisms of development and aging, and are expected as medicines.

Brain-derived neurotrophic factor (hereinafter abbreviated as BDNF) is one of them, but it is considered to play an important role in the central nervous system, and has been particularly attracting attention. BDNF isolation from nature is described in Barde, Y. et al. -A.
First reported by et al., 2 μg from 3 kg pig brain
BDNF has been obtained (The Emboss Journal (EMB
O J.) 1 , 549 (1982)). Since the abundance of BDNF in the living body is extremely small in this manner, it was considered that it is extremely difficult to use it for research on the nervous system and medical treatment.

Thereafter, Leibrock, J. et al. Pig B
The DNF gene was cloned (Nature)
341 , 149 (1989)), after the complete elucidation of the amino acid sequence, genetic engineering production of BDNF in animal cells as a host has been actively attempted. For example, Knusel, B.
Et al. Performed purification from 3 liters of recombinant animal cell culture,
Fractions containing 1 μg of BDNF as a main component have been obtained (Proc. Natl. Acad. Sci. USA 88 , 961 (19
91)). Meanwhile, Negro, A .; Used E. coli as a host,
We have reported the production of BDNF with methionine added to the N-terminus (Biochemical Biophysical Research
Communications (Biochem. Biophys. Res. Commu
n.) 186 , 1553 (1992)). A large amount of BDNF corresponding to 25% of the total cell protein accumulated in the cytoplasm, but no biological activity was observed. Therefore, the biological activity was recovered by treating it with a denaturing agent and a redox agent, and the culture solution. About 100 μg BDNF is obtained per liter.

[0005]

The genetically engineered production of BDNF has been vigorously attempted until now, but when the method using an animal cell as the host produces a small amount, and considering the time and cost required for culturing, There is a problem with productivity. On the other hand, in the method using Escherichia coli as a host, which is easy to culture,
DNF does not exhibit biological activity, and complicated procedures are required to recover it. In addition, the addition of an extra amino acid at the N-terminal is also a problem of Escherichia coli, which may be an obstacle in considering BDNF for medical use. Considering mass production of BDNF by these conventional techniques, including isolation from nature, there are many problems.

An object of the present invention is to provide a vector having high expression efficiency using Escherichia coli as a host and a transformant transformed with the vector, in order to improve BDNF productivity. It is intended to provide a method for efficiently producing a BDNF matured protein having biological activity by culturing a transformant.

[0007]

The present inventors have found that BDNF produced in the cytoplasm of Escherichia coli cannot take the correct three-dimensional structure under the reducing atmosphere in the cytoplasm.
BD to periplasm, which is considered to show no biological activity
An attempt was made on secretory production of NF. BDNF is a secretory protein, and it was expected that it would not hinder the permeation of Escherichia coli cytoplasmic membrane, but it was considered to be problematic to utilize the natural prepro sequence as it is for membrane permeation. Therefore, an expression vector having a gene encoding BDNF as a mature protein containing no prepro sequence and an E. coli signal sequence was prepared, and E. coli transformed with the vector was cultured. As a result, a large amount of BDNF was found to be a mature protein. It was found to be produced. Furthermore, it was found that BDNF produced by utilizing the secretory mechanism of E. coli has biological activity, and as a result of repeated studies based on this, the present invention was completed.

[0008]

In the present invention, since BDNF is produced in the periplasm of E. coli by utilizing the E. coli signal sequence, the polypeptide chain of BDNF is appropriately folded, and cross-linking by SS bond is appropriate. BD, which is carried out and as a result retains its original three-dimensional structure and has biological activity
NF can be produced. In addition, BDNF can be produced as a complete mature protein without adding an extra amino acid at the N-terminus.

In the present invention, since the Escherichia coli regulatory gene can be used to control the growth of E. coli and the production of BDNF,
BDNF productivity is improved.

In the present invention, since E. coli, which is fast growing and easy to handle, is used as a host, higher productivity can be realized as compared with the method using an animal cell as a host.

[0011]

The present invention will be described in detail below.

The amino acid sequence of the polypeptide chain of BDNF has been determined by translating the base sequence of the BDNF gene. Leibrock, J., supra. Pig BD by et al.
Following cloning of the NF gene, Jones, K. et al. Et al. Described the human BDNF gene (Proc. Natl. Acad. Sci. USA 8
7 , 8060 (1990), Hofer, M. et al. Et al. Identified the mouse BDNF gene (EMBO J. 9 , 2459 (1990)), Maisonpierre,
P. C. And the rat BDNF gene (Genomics (Gen
omics) 10 , 558 (1991)), respectively, and translated the nucleotide sequence to report the amino acid sequence of BDNF. BD of these mammals, including swine BDNF
The amino acid sequences of NF are perfectly consistent across species. For BDNF of other animals, for example, Ha
llbook, F. Have reported the amino acid sequence of BDNF in chickens and salmon (Neuron 6 , 84).
5 (1991)), and only a few amino acid substitutions are recognized, and it is very similar to human BDNF as a whole. High homology of amino acid sequences across biological species is due to BDN
One of the features of F. Therefore, the present invention is
Not limited to F, it can be applied to BDNF of various organisms.

The vector of the present invention has a DNA encoding the polypeptide chain of BDNF, and the DNA is a BDN cloned from nature as described above.
Examples include F gene and DNA having the same nucleotide sequence as the F gene. Genes cloned from nature include B-encoding DNA that encodes BDNF as a mature protein.
In many cases, it contains DNA that encodes the DNF prepro sequence or DNA that does not encode a polypeptide.
In the present invention, D encoding the polypeptide chain of BDNF is used.
As NA, DNA encoding BDNF as a mature protein is used, and such DNA can be obtained by the following method, for example. From the gene cloned from nature using the restriction enzyme, the desired D
How to separate NA. Using a gene cloned from nature as a template, the desired DN was obtained by PCR (Saiki, RK, et al., Science (Science) 239 , 487 (1988)).
A method of amplifying A. A method for chemically synthesizing a target DNA.

The DNA encoding the polypeptide chain of BDNF contained in the vector of the present invention further includes BD
A nucleotide sequence designed by reverse-translating the amino acid sequence of NF D
NA is mentioned. When the amino acid sequence of BDNF is reversely translated, a plurality of base sequences can be obtained due to the degeneracy of gene codons, and an appropriate base sequence is selected and designed from these. DNA having the designed base sequence can be obtained by chemical synthesis. As a design criterion, whether or not the gene codon to be used has a high frequency of occurrence in Escherichia coli used for BDNF production, and whether the DNA fragment is wrong when constructing the whole DNA from the synthesized single-stranded DNA Examples include whether or not ligation is likely to occur, and whether or not mRNA transcribed from a DNA has a secondary structure such as a hairpin structure, resulting in a reduction in translation efficiency in the ribosome.

The vector of the present invention has a DNA encoding the above-mentioned BDNF polypeptide chain, and a DNA encoding an E. coli signal sequence is provided upstream of the 5'end of the DNA.
Are combined. These two types of DNA have a signal sequence part and a B sequence without an extra base between them.
The coupling is performed so that no frame shift occurs between the DNF parts. Such a binding is due to two types of DNA
The method of ligating both DNAs using DNA ligase after processing the ends on the side involved in the ligation with a restriction enzyme, DNA polymerase, S1 nuclease, etc. so that the desired sequence is produced after ligation, It is realized by using a method of chemically synthesizing a part or all of the sequences of two kinds of DNA, including a binding part in a bound state.

As the signal sequence, the signal sequence of Escherichia coli β-lactamase is preferably used, and as long as it functions in E. coli cells, it can be used, for example, the signal sequence of Escherichia coli alkaline phosphatase,
Examples include signal sequences of various outer membrane proteins of Escherichia coli.

When Escherichia coli containing the vector of the present invention is cultivated by binding a signal sequence to express the BDNF gene, BDNF is synthesized as a fusion protein having a signal sequence added to the N-terminus. The fusion protein is transported to the periplasm of Escherichia coli by the action of the signal sequence, the signal sequence is dissociated, and BDNF is changed to a mature protein having the correct N-terminus. The periplasmic environment depends on the folding of the polypeptide chain of BDNF, in particular S
Suitable for cross-linking reaction by -S bond, resulting in BD
NF can retain its original three-dimensional structure and exhibit biological activity.

The vector of the present invention also has a regulatory gene upstream of the DNA encoding the E. coli signal sequence. The regulatory gene is not particularly limited as long as it functions in E. coli cells, but a tryptophan regulatory gene that is a regulatory gene that has a strong action as a promoter and is easy to induce and suppress gene expression is preferably used. . The tryptophan-regulated gene is composed of a promoter region which is a binding site of RNA synthase and an operator region which is a binding site of repressor protein. The synthesis of messenger RNA (mRNA) using DNA as a template is initiated by the binding of RNA synthase to the promoter region, and the synthesized mRNA binds to the ribosome to synthesize a polypeptide chain. When the intracellular L-tryptophan (Trp) concentration is increased, the repressor protein is activated by binding to Trp and binds to the operator region. As a result, RNA synthase cannot bind to the promoter region, and mRNA synthesis and subsequent polypeptide chain synthesis are stopped. On the other hand, Trp
When the repressor protein cannot bind to Trp due to a decrease in concentration, or when the repressor protein binds to 3-indole acrylic acid which is a substance similar to Trp and is inactivated, mRNA is synthesized and the polypeptide chain Begins to synthesize. Therefore, when culturing Escherichia coli having the vector of the present invention using a tryptophan-regulated gene, the expression can be suppressed by adding Trp to the medium, and conversely, Trp in the medium can be removed, or ,
Expression can be induced by adding 3-indole acrylic acid to the medium.

Other than the tryptophan regulatory gene, the regulatory gene that can be used in the vector of the present invention is:
For example, a lactose regulatory gene, a tac regulatory gene, an alkaline phosphatase regulatory gene and the like can be mentioned. Further, when Escherichia coli into which the RNA polymerase gene of T7 phage has been incorporated is used as a host, the T7 promoter can be used.

The vector of the present invention can be produced by a known method, for example, Maniatis, T. et al. Molecular Cloning, Laboratory Manual (Molecular Clon
ing, A Laboratory Manual), Cold Spring Harbor Laborator
y) The method described in (1982) can be used.

The transformant of the present invention can be obtained by transforming Escherichia coli with the vector prepared as described above.

Examples of Escherichia coli include HB101 strain,
Examples include JM105 strain and JM109 strain.

As a method for transforming Escherichia coli, for example, Maniatis, T. et al. Et al. Molecular Cloning, A Laboratory Manual (Molecular Cloning, A Lab
o-ratory Manual), Cold Spring Harbor Laboratory (1982)
The method described in 1. Calcium chloride method or calcium chloride /
The rubidium chloride method can be applied, and when the phage vector is used, the in vitro packaging method can be applied.

The method for producing a neurotrophic factor of the present invention comprises culturing the transformant obtained as described above to produce BDNF in the culture.

The medium used for culture varies depending on the type of E. coli and the type of vector, and examples thereof include M9 medium, NZCYM medium and LB medium. pH
Is preferably about 6-8. Also, as mentioned above,
When the gene expression is suppressed or induced depending on the medium condition, the growth of the transformant and the production of BDNF can be controlled,
As a result, BDNF can be efficiently produced.

Culturing is usually carried out at about 37 ° C. for about 4 to 24 hours, and aeration and agitation are added if necessary.

Hereinafter, the present invention will be described in more detail with reference to specific examples, but the present invention is not limited thereto.

Example 1 Construction of BDNF Expression Vector (1) Synthesis of Primer DNA (FIG. 1) Arginine (Ar) at the 6th position from histidine (His), which is the N-terminal of the BDNF mature protein, of rat BDNF gene.
g) and single-stranded DNA (5'-CACTCCGA) corresponding to the sense sequence of the part encoding the part of Arg at position 7.
CCCCGCCCGCCG) and a part of threonine (Thr) at position 114 and isoleucine (Ile) at position 115
Single-stranded DNA (5'-GATCCCTA) with a sequence that matches the antisense sequence of the portion from the Arg to the 119th Arg and that additionally encodes a translation stop codon.
TTATCTTCCCCTTTTAATGG) automatically D
Solid phase synthesis was performed using NA synthesizer 380B (Applied Biosystems).

After separating the synthesized single-stranded DNA from the resin, it was purified using an OPC cartridge (Applied Biosystems) to obtain 85-150 μg of single-stranded DNA.
NA (primer DNA) was obtained.

(2) Synthesis of BDNF gene (FIGS. 1 and 2) Plasmid pcBDN containing rat BDNF cDNA
F / CDM8 0.1 μg to each 1 μM primer DN
A, 200 μM each of dATP, dCTP, dGTP, d
PCR was carried out by adding TTP, 2.5 U of Taq DNA polymerase and a buffer to make 100 μl. A reaction cycle of 94 ° C. for 1.5 minutes, 55 ° C. for 2.5 minutes and 72 ° C. for 3.4 minutes was repeated 25 times, and finally the reaction was carried out at 72 ° C. for 7 minutes. After concentrating the reaction mixture by ethanol precipitation,
5% polyacrylamide gel electrophoresis was performed, the gel piece containing the desired DNA of 367 base pairs was cut out, and the DNA was recovered by the electroelution method. The recovered DNA was purified by phenol treatment and ethanol precipitation to obtain 4U of T4D.
The ends were blunted by reacting with NA polymerase at 37 ° C. for 5 minutes. After purification by phenol treatment and ethanol precipitation again, 10 U of T4 polynucleotide kinase was reacted at 37 ° C. for 1 hour to phosphorylate the ends, and 10 μl of BDNF gene was obtained.

As a result of DNA sequencing using 0.5 μl of the obtained BDNF gene, the base sequence shown in FIG. 1 was obtained, and the base sequence of the protein-coding portion was completely identical to the base sequence of BDNF cDNA. did.

(3) Preparation of BDNF expression vector (FIG. 2) 0.6 μg of the plasmid vector pTRSNGF was digested with the restriction enzymes SacI (20 U) and BamHI (18 U) at 37 ° C. for 1 hour for cleavage. After reacting with 13 U of calf intestinal alkaline phosphatase at 37 ° C. for 15 minutes and then at 55 ° C. for 15 minutes to dephosphorylate the ends, 0.8% agarose gel electrophoresis was performed to analyze tryptophan-regulated gene and Escherichia coli β-lactamase. A DNA fragment having a DNA encoding the signal sequence was recovered. Then, it was reacted with 4 U of T4 DNA polymerase at 37 ° C. for 5 minutes to blunt the ends.

1/10 amount of the obtained DNA fragment and BDN
The F gene (0.5 μl) was mixed, and a ligation reaction was performed overnight at 4 ° C. using a DNA ligation kit (Takara Shuzo). Escherichia coli C600 strain was transformed with the reaction mixture, and plasmid DNA was prepared from 52 colonies formed. As a result of cleavage with various restriction enzymes and analysis of the nucleotide sequence, 10 clones carrying the target vector were found.
I got one. One clone among these was cultivated, and the BDNF expression vector isolated from the culture was named pTRSBNDF.

Example 2 Expression of BDNF gene (1) Preparation of transformant Escherichia coli HB101 strain was transformed with 0.1 μg of the expression vector pTRSBBDNF to obtain 103 colonies. One of the clones was placed in LB medium at 37 ° C for 16
After culturing for a time, it was used as a preserved strain.

This strain was transformed into Escherichia coli HB101 [pTRSB
DNF], and was assigned to the Institute of Biotechnology, Institute of Biotechnology, National Institute of Advanced Industrial Science and Technology No. 13703 (FERM P-1370).
Deposited with the deposit number of 3).

(2) Cultivation of transformant 10 μl of the preserved strain was added to 10 ml of a medium (1 g of NH ₄ Cl,
Na ₂ HPO ₄ 6g, KH ₂ PO ₄ 3g, NaCl 0.5
g, CaCl ₂ .2H ₂ O 15 mg, MgSO ₄ .7H ₂ O 0.
5 g, casamino acid 2.5 g, glucose 5 g, yeast extract 1.5 g, L-tryptophan 40 mg, L-proline 0.1 g, thiamine hydrochloride 0.1 g, ampicillin 5
0 mg, 1 liter of water, pH 7) was inoculated and the mixture was cultured at 37 ° C overnight. 90 ml of medium (NH ₄ Cl 1
g, Na ₂ HPO ₄ 6 g, KH ₂ PO ₄ 3 g, NaCl 0.1.
5 g, CaCl ₂ .2H ₂ O 15 mg, MgSO ₄ .7H ₂ O
0.5 g, casamino acid 2.5 g, glucose 5 g, L-proline 0.1 g, thiamine hydrochloride 0.1 g, ampicillin
50mg, water 0.9l, pH7), add at 37 ° C for 24
Incubated for hours.

(3) Detection of BDNF in the culture (FIG. 3) The cells at 24 hours of culture were collected by centrifugation to obtain 0.15 M.
Saline, then 10 mM Tris-HCl buffer (pH 8,
After washing at 4 ° C.), the cells were suspended in 10 mM Tris-HCl buffer (pH 8, 4 ° C.) so that the absorbance at 550 nm was about 28. 0.5 M EDTA (pH 8) 40 in 4 ml of suspension
μl was added, and the cells were crushed by irradiating with ultrasonic waves under ice cooling at 20 kHz, 70 W for a total of 5.4 minutes. 4,000 × g, 4
BDNF in the bacterial cell extract obtained by removing unbroken bacterial cells by centrifugation at 10 ° C for 10 minutes was detected by the following procedure.

A buffer (40% glycerol, 2% SDS, 0.04% Coomassie Brilliant Blue R-250, 20 mM Tris-HCl buffer, pH was added to 10 μl of the cell extract.
6.8) 10 μl was added and heated at 100 ° C. for 5 minutes.
After performing 0.1% SDS-15% polyacrylamide gel electrophoresis using this solution as a sample, the protein in the gel was transferred to a nitrocellulose membrane, and mouse NGF (2.5
When reacted with a polyclonal antibody against S) (Collaborative), binding of the antibody was observed at a molecular weight of around 14,000.

On the other hand, when L-tryptophan was added to the medium and the cells cultured in the state where the BDNF gene expression was suppressed were treated in the same manner, the molecular weight was 14,000.
No antibody binding was observed in the vicinity.

It was confirmed that the production of BDNF by Escherichia coli was confirmed by binding with an antibody against NGF, which has a high structural similarity to BDNF, and the molecular weight thereof was in agreement with the molecular weight of rat BDNF of about 13,500. Based on the amount of antibody bound, BD
The amount of NF produced was calculated to be 1 mg or more per liter of the culture solution. The antibody binding observed on the high molecular weight side is
It is irrelevant to the expression of the F gene and is a protein of Escherichia coli as a host that reacts with an antibody.

Further, the produced BDNF was purified, and the N-terminal amino acid sequence was analyzed using a protein sequencer 477A (Applied Biosystems).
The amino acid sequence from the end to the 10th amino acid was completely in agreement with the amino acid sequence of BDNF obtained by translating the BDNF gene. As a result, it was confirmed that BDNF was produced as a mature protein.

Example 3 BDNF biological activity evaluation (FIG. 4) Serum-free P was applied to a 24-well plate coated with collagen.
200 μl of IT medium and dorsal root ganglia (DRG) of 8-day-old chicken embryo were put therein, and incubated at 37 ° C. in a CO ₂ incubator to attach DRG to the bottom surface of the plate. When 10 μl of a sterile filtered solution of the bacterial cell extract prepared in Example 2 and 300 μl of PIT medium were added to the plate and cultured in a CO ₂ incubator at 37 ° C. for 39 hours, the elongation of nerve fibers was promoted. On the other hand, in the extract obtained from the cells cultured in the state where the BDNF gene expression was suppressed, almost no nerve fiber elongation was observed.

[0043]

INDUSTRIAL APPLICABILITY The BDNF obtained in the present invention has biological activity and can be effectively used as a reagent for studying nervous system. Moreover, since an extra amino acid is not added to the N-terminal, it is considered that the highly purified amino acid can be used as a drug for neurosis.

The vector of the present invention contains B having biological activity.
It is excellent as an expression vector for DNF and can be effectively used for protein engineering research of BDNF.

The transformant of the present invention has been cloned and is capable of stably expressing the BDNF gene,
It can be effectively used as a production system of BDNF having biological activity.

[0046]

[Sequence list]

SEQ ID NO: 1 Sequence Length: 20 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence Features Characteristic Characteristic Symbol: CDS Location: 1. .18 Characterization Method: S Sequence CAC TCC GAC CCC GCC CGC CG 20 His Ser Asp Pro Ala Arg 1 5 SEQ ID NO: 2 Sequence Length: 6 Sequence Type: Amino Acid Topology: Linear Sequence Type: peptide SEQ ID NO: 3 Sequence Length: 27 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Synthetic DNA Antisense: yes Sequence GATCCTATTATCTTCCCCTTTTAATGG 27 SEQ ID NO: 4 Sequence Length: 476 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence features Characteristic symbols: -10 signal Location: 2..7 Method of determining features: S Characteristic symbol: CDS Location: 41..466 Method of determining characteristic: S sequence GTTAACTAGT ACGCAAGTTC ACGTAAAAAG GGTATCGACA ATG AGT ATT CAA CAT 55 Met Ser Ile Gln His -20 TTC CGT GTC GCC CTT ATT CCC TTT TTT GCG GCA TTT TGC CTT CCT GTT 103 Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Ala Phe Cys Leu Pro Val -15 -10 -5 TTT GCG CAC TCC GAC CCC GCC CGC CGT GGG GAG CTG AGC GTG TGT GAC 151 Phe Ala His Ser Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cys Asp 1 5 10 AGT ATT AGC GAG TGG GTC ACA GCG GCA GAT AAA AAG ACT GCA GTG GAC 199 Ser Ile Ser G lu Trp Val Thr Ala Ala Asp Lys Lys Thr Ala Val Asp 15 20 25 30 ATG TCC GGT GGG ACG GTC ACA GTC CTG GAG AAA GTC CCG GTA TCA AAA 247 Met Ser Gly Gly Thr Val Thr Val Leu Glu Lys Val Pro Val Ser Lys 35 40 45 GGC CAA CTG AAG CAA TAT TTC TAC GAG ACC AAG TGT AAT CCC ATG GGT 295 Gly Gln Leu Lys Gln Tyr Phe Tyr Glu Thr Lys Cys Asn Pro Met Gly 50 55 60 TAC ACG AAG GAA GGC TGC AGG GGC ATA GAC AAA AGG CAC TGG AAC TCG 343 Tyr Thr Lys Glu Gly Cys Arg Gly Ile Asp Lys Arg His Trp Asn Ser 65 70 75 CAA TGC CGA ACT ACC CAA TCG TAT GTT CGG GCC CTT ACT ATG GAT AGC 391 Gln Cys Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met Asp Ser 80 85 90 AAA AAG AGA ATT GGC TGG CGG TTC ATA AGG ATA GAC ACT TCC TGT GTA 439 Lys Lys Arg Ile Gly Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val 95 100 105 110 TGT ACA CTG ACC ATT AAA AGG GGA AGA TAATAGGATC 476 Cys Thr Leu Thr Ile Lys Arg Gly Arg 115 SEQ ID NO: 5 Sequence Length: 142 Sequence Type: Amino Acid Topology: Linear Sequence Type: Peptide Sequence Characteristic symbol: sig peptide Location: -23 ..- 1 Characteristic determination method: S Characteristic symbol: mat peptide Location: 1..119 Characteristic determination method: S Sequence Met Ser Ile Gln His Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Ala -20 -15 -10 Phe Cys Leu Pro Val Phe Ala His Ser Asp Pro Ala Arg Arg Gly Glu -5 1 5 Leu Ser Val Cys Asp Ser Ile Ser Glu Trp Val Thr Ala Ala Asp Lys 10 15 20 25 Lys Thr Ala Val Asp Met Ser Gly Gly Thr Val Thr Val Leu Glu Lys 30 35 40 Val Pro Val Ser Lys Gly Gln Leu Lys Gln Tyr Phe Tyr Glu Thr Lys 45 50 55 Cys Asn Pro Met Gly Tyr Thr Lys Glu Gly Cys Arg Gly Ile Asp Lys 60 65 70 Arg His Trp Asn Ser Gln Cys Arg Thr Thr Gln Ser Tyr Val Arg Ala 75 80 85 Leu Thr Met Asp Ser Lys Lys Arg Ile Gly Trp Arg Phe Ile Arg Ile 90 95 100 105 Asp Thr Ser Cys Val Cys Thr Leu Thr Ile Lys Arg Gly Arg 110 115

[Brief description of drawings]

FIG. 1 is a BDNF expression vector pT prepared in Example 1.
The partial base sequence of RSBDNF and the amino acid sequences of the signal peptide and BDNF obtained by translating the same are shown.

FIG. 2 is a BDNF expression vector pT prepared in Example 1.
A method for producing RSBDNF is shown.

FIG. 3 shows the protein content of the bacterial cell extract obtained in Example 2 as S
The results of separation by DS-polyacrylamide gel electrophoresis, transfer to a nitrocellulose membrane, and binding reaction with an antibody are shown. (A) shows a bacterial cell extract when the BDNF gene expression is suppressed, and (b) shows a bacterial cell extract when the BDNF gene is expressed.

FIG. 4 shows BDNF in the bacterial cell extract described in Example 3,
The nerve fiber elongation promotion activity with respect to the chicken 8-day embryo DRG is shown. (A) shows a bacterial cell extract when the BDNF gene expression is suppressed, and (B) shows a bacterial cell extract when the BDNF gene is expressed.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical indication location C12R 1:19) (C12P 21/02 C12R 1:19) (72) Inventor Kenichi Takahashi Saitama prefecture Hiki Hatoyama-cho, Gunma 2520, Hitachi, Ltd. Basic Research Laboratories (72) Inventor Norio Shimizu, Hayama, Hiki-gun, Saitama Prefecture 2520, Akanuma, Hitachi, Ltd. Basic Research Laboratories

Claims (7)

[Claims] 1. A method comprising a DNA encoding a polypeptide chain of brain-derived neurotrophic factor, wherein the 5'-terminal upstream side of the DNA is bound with a DNA encoding an Escherichia coli signal sequence.
A vector having an Escherichia coli regulatory gene upstream of the DNA encoding the signal sequence. 2. The vector according to claim 1, wherein the E. coli signal sequence is a β-lactamase signal sequence. 3. The vector according to claim 1, wherein the Escherichia coli regulatory gene is a tryptophan regulatory gene. 4. The vector according to claim 2, wherein the Escherichia coli regulatory gene is a tryptophan regulatory gene. 5. A transformant obtained by transforming Escherichia coli with the vector according to claim 1, 2 or 3. 6. A method for producing a neurotrophic factor, which comprises culturing the transformant according to claim 5 and producing a brain-derived neurotrophic factor in the culture. 7. A vector having the following formula: GTTAACTAGT ACGCAAGTTC ACGTAAAAAG GGTATCGACA ATG AGT ATT CAA CAT 55 Met Ser Ile Gln His -20 TTC CGT GTC GCC CTT ATT CCC TTT TTT GCG GCA TTT TGC CTT CCT GTT 103 Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Prola Cy -15 -10 -5 TTT GCG CAC TCC GAC CCC GCC CGC CGT GGG GAG CTG AGC GTG TGT GAC 151 Phe Ala His Ser Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cys Asp 1 5 10 AGT ATT AGC GAG TGG GTC ACA GCG GCA GAT AAA AAG ACT GCA GTG GAC 199 Ser Ile Ser Glu Trp Val Thr Ala Ala Asp Lys Lys Thr Ala Val Asp 15 20 25 30 ATG TCC GGT GGG ACG GTC ACA GTC CTG GAG AAA GTC CCG GTA TCA AAA 247 Met Ser Gly Gly Thr Val Thr Val Leu Glu Lys Val Pro Val Ser Lys 35 40 45 GGC CAA CTG AAG CAA TAT TTC TAC GAG ACC AAG TGT AAT CCC ATG GGT 295 Gly Gln Leu Lys Gln Tyr Phe Tyr Glu Thr Lys Cys Asn Pro Met Gly 50 55 60 TAC ACG AAG GAA GGC TGC AGG GGC ATA GAC AAA AGG CAC TGG AAC TCG 343 Tyr Thr Lys Glu Gly Cys Arg Gly Ile Asp Lys Arg His Trp Asn Ser 65 70 75 CAA TGC CGA ACT ACC CAA TCG TAT GTT CGG GCC CTT ACT ATG GAT AGC 391 Gln Cys Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met Asp Ser 80 85 90 AAA AAG AGA ATT GGC TGG CGG TTC ATA AGG ATA GAC ACT TCC TGT GTA 439 Lys Lys Arg Ile Gly Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val 95 100 105 110 TGT ACA CTG ACC ATT AAA AGG GGA AGA TAATAGGATC 476 Cys Thr Leu Thr Ile Lys Arg Gly Arg 115