KR102008407B1 - Codon optimized il-21 and uses thereof - Google Patents

Abstract

The present invention relates to codon optimized IL-21 and its use. According to the present invention, when a signal peptide selected as a secretion leader sequence for enhancing secretion efficiency is enhanced to codon-optimized IL-21 such that IL-21 is highly expressed and highly secreted in CHO cells which are mammalian cells, The production of IL-21 was improved in CHO cell line as a production host, and it was confirmed that it overcomes the biological function problem that occurs when prokaryotes are used as host, which can be useful for mass production of high-quality IL-21. .

Description

Codon Optimized IL-21 and Its Uses {CODON OPTIMIZED IL-21 AND USES THEREOF}

The present invention relates to codon optimized IL-21 and its use.

Cytokines are essential proteins for bioregulation, which induce cell proliferation and differentiation, promote changes in function and activity, and are involved in immune system diseases, allergies, atopy, inflammation and various forms of tumors. With the recent development of various stem cell research including applied cell therapy and hematopoietic cell system, the demand for cytokine-like proteins for research and medical products used in the basic experiment of stem cell culture and development of cell therapy is increasing exponentially. .

IL-21 (Zalpha11 ligand) is also a member of the IL-2 family of cytokines, including IL-4, IL-7, IL-9, IL-13, and IL-15. Proteins in this family have been shown to have both anticancer and antiviral effects. IL-21 is produced by helper T-cells, which are important regulators of immunity. Based on expression patterns of its cognate receptors and administration of proteins, IL-21 activates CD8 + killer T-cells and natural cytotoxic (NK) cells, two lymphocyte classes that eradicate tumor and virus infected cells. Appeared to be. IL-21 also stimulates a selection class of B-cells (Parrish et al., Nature 408: 57-63, 2000).

Thus, IL-21 is essential for immune cell therapy as a cytokine that induces proliferation and activation of immune cells, especially NK cells.

On the other hand, the expression system for producing a specific protein is using bacteria, yeast, plants, insect cells, animal cells, among which the production of products by genetic modification has been used microorganisms due to the advantages of fast production speed and accurate reproducibility .

However, the production using microorganisms has a problem that the protein is not secreted out of the cell and is produced as a protein mass in the cell. In particular, there is no additional process such as post-translational modification for the sugar chain portion required for the secretion protein activity, and often has the inconvenience of methionine attached to the N-terminus of the protein to be removed separately. In order to produce a complete therapeutic protein, it is important that the folds, combinations, and post-translational formulas are properly formed and have a molecular form that is almost equivalent to that of the native protein. Currently, about 60 to 70% of all high value protein drugs Produced in cells.

However, protein expression in such animal cells has a problem of low productivity and high maintenance costs compared to microorganisms. As a result, all currently produced IL-21 is produced using microorganisms.

Therefore, it is possible to obtain a high yield, to produce an expression system for producing biologically active and purified recombinant IL-21 protein in animal cells, and to produce a variety of fusion protein synthesis to improve the efficacy of cytokines Development of the system is required.

Under these circumstances, the present inventors earnestly studied how to express and secrete IL-21 in animal cells in order to overcome the problems of the prior art. As a result, the inventors have (i) optimized IL-21 codons suitable for animal cells; And (ii) a vector system in which IL-21 is highly expressed and secreted in animal cells through selection and optimization of secretion leader sequences (signal peptides) to enhance secretion efficacy, and cultured animal cells into which the above-described recombinant expression vectors are introduced. The system and IL-21 high expression cell line were constructed, and the present invention was completed by confirming the proliferative and differentiating ability of natural killer cells by the recombinant IL-21.

Accordingly, one object of the present invention is to provide a polynucleotide of codon optimized IL-21 (Interleukin-21).

Another object of the present invention is to provide a vector comprising the polynucleotide.

In addition, another object of the present invention to provide a host cell transformed with the vector.

In addition, another object of the present invention to provide a method for producing IL-21 (Interleukin-21) protein.

In addition, another object of the present invention to provide an immunological disease treatment agent comprising IL-21 (Interleukin-21) protein as an active ingredient.

Hereinafter, the present invention will be described in more detail.

At this time, if there is no other definitions in the technical terms and scientific terms used herein, those having ordinary skill in the art to which this invention belongs have the meaning that is commonly understood.

In addition, repeated description of the same technical configuration and operation as in the prior art will be omitted.

As used herein, the term “codon-optimization” refers to the coding region or gene of a nucleic acid molecule for the transformation of various hosts, so as to reflect the typical codon utilization of the host organism without changing the polypeptide encoded by the DNA. Refers to changing the codon in the coding region or gene of the nucleic acid molecule. In the context of the present invention, gene and DNA coding regions are codon-optimized for optimal expression in mammalian cells.

Codon-optimization may synthesize all (or a portion) of DNA to remove all destabilizing sequences or regions of the secondary structure that may be present in the transcribed mRNA, or synthesize all of the DNA (or a portion) to modify the base composition. It may also be varied to be more preferred in the host cell of interest.

As used herein, the terms “nucleic acid”, “nucleic acid molecule”, “oligonucleotide”, “nucleotide” and “polynucleotide” may be used interchangeably and may be in the form of either a single stranded form or a double stranded helix, Ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecule") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine or deoxycytidine; "DNA Molecule ”), or any phosphoester analogue thereof, such as phosphorothioate and thioester. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, especially DNA or RNA molecule, refers only to the primary and secondary structures of this molecule and is not limited to any particular tertiary form. Thus, the term particularly includes linear or circular DNA molecules (eg, restriction enzyme fragments), plasmids, supercoiled DNA and double stranded DNA found in chromosomes. In discussing the structure of certain double-stranded DNA molecules, the sequence is defined in the conventional convention of providing only sequences in the 5 'to 3' direction along non-transcriptional strands of DNA (ie, strands having sequences homologous to mRNA). As described herein. A "recombinant DNA molecule" is a DNA molecule that has undergone molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semisynthetic DNA.

The term “fragment” when applied to a polynucleotide sequence refers to a nucleotide sequence of reduced length compared to a reference nucleic acid, which includes the same nucleotide sequence as the reference nucleic acid over a common portion. Such nucleic acid fragments according to the invention may be included in larger polynucleotides, where appropriate, as components. Such fragments are at least six, eight, nine, ten, twelve, fifteen, eighteen, twenty, twenty-one, twenty-four, twenty-five, twenty-five of the nucleic acids according to the invention. , 30, 39, 40, 42, 45, 48, 50, 51, 54, 57, 60, 63, 66, 70, 75, 78, 80 , 90, 100, 105, 120, 135, 150, 200, 300, 500, 720, 900, 1000, 1500, 2000, 3000, 4000, Oligonucleotides from, or alternatively consist of, oligonucleotides ranging from 5000 or more.

As used herein, the term “expression vector” is a nucleic acid molecule coding gene expressed in a host cell. Typically, expression vectors include transcriptional promoters, genes, origins of replication, selectable markers, and transcription terminators. Gene expression usually occurs under the control of a promoter and such genes are said to be "operably linked" to the promoter. Similarly, regulatory elements and key promoters are operably linked when the regulatory element modulates the activity of the core promoter. Expression vectors can also be known as expression constructs.

As used herein, the term "host cell" is a cell containing a heterologous nucleic acid molecule such as, for example, a cloning vector or an expression vector.

The term "expression" as used herein refers to the biosynthesis of gene production. For example, in the case of a gene, expression includes transcription of the gene into mRNA and translation of the mRNA into one or a polypeptide.

As used herein, the term "polypeptide" is a polymer of amino acid residues linked by peptide bonds produced naturally or synthetically. Polypeptides up to about 10 amino acid residues are usually referred to as "peptides".

The term "protein" as used herein is a polymer comprising one or more polypeptide chains. The protein may also include non-peptide components such as carbohydrate groups. Carbohydrates and other non-peptide substituents may be added to the protein. Proteins are defined herein in terms of their amino acid main structure; Substituents such as hydrocarbon groups and non-peptide groups are generally specified, but may nevertheless be present.

As used herein, the terms "5'-terminus" or "3'-terminus" are used herein to indicate a position in a polynucleotide. This specification allows these terms to be used with respect to a particular sequence or portion of a polynucleotide to a proximal or relative position.

As used herein, the term "N-terminus" or "C-terminus" is used herein to indicate a position in a polypeptide. This term allows these terms to be used with respect to a particular sequence or portion of a polypeptide relative to a proximal or relative position.

For example, a particular sequence located C-terminally relative to a reference sequence in the polypeptide is located near the C-terminus of the reference sequence, but may not be essential at the carboxy terminus of the complete polypeptide.

According to an aspect of the present invention, the present invention provides a nucleic acid sequence of SEQ ID NO: 5; Or codon optimized IL-21 (Interleukin-21) polynucleotide (Optimized IL-21) comprising a fragment thereof, a vector comprising the polynucleotide and a host cell transformed with the vector.

Codon-optimized IL-21 (Interleukin-21) according to the present invention is characterized by having a nucleic acid sequence of SEQ ID NO: 5.

According to a preferred embodiment of the invention, the host cell of the invention is a mammalian cell, said mammalian cell is a CHO cell.

According to another aspect of the present invention, the present invention provides a production of IL-21 (Interleukin-21) protein comprising culturing the host cell to produce a recombinant IL-21 protein from mammalian cells as a host cell Provide a method.

That is, native sequences encoding IL-21 can be modified to improve expression efficiency in host cells.

According to a preferred embodiment of the invention, the modification is codon optimized IL-21 (Interleukin-21) polynucleotide of the present invention, that is, the nucleic acid sequence of SEQ ID NO: 5; Or a fragment thereof, wherein the nucleic acid sequence of SEQ ID NO: 5; Or at the 5'-end or 3'-end, most preferably the 5'-end of the fragment thereof, adding a nucleotide encoding a signal peptide.

The present invention provides a codon-optimized IL-21 polynucleotide to which a nucleotide encoding a signal peptide is linked. The signal peptide referred to herein refers to a peptide that serves to move IL-21 protein made from ribosomes out of cells. do.

For example, in one embodiment of the present invention, in the IL-21 nucleic acid molecule for large-scale and high efficiency production of IL-21, instead of the coding sequence for IL-21 signal peptide, the coding sequence for another signal peptide is preferably in place. Is provided. In addition, codon-optimized IL-21 coding sequences with specific changes in nucleotides are used to optimize production in mammalian cells.

In addition, in the present invention, the signal peptide may be codon-optimized according to the purpose.

According to a preferred embodiment of the present invention, the signal peptide is human serum albumin (human serum albumin, Accession number P02768, SEQ ID NO: 8), rat serum albumin (rat serum albumin, Accession number P02770, SEQ ID NO: 10), azolosi Dean (Azurocidin preproprotein, Accession number, SEQ ID NO: 12), tPA (Tissue-type plasminogen activator, Accession number NP_001691, SEQ ID NO: 14) and H7 (Ig heavy chain signal peptide 7, SEQ ID NO: 16), More preferably, it is Azurocidin preproprotein, Accession number (SEQ ID NO: 12) or tPA (Tissue-type plasminogen activator, Accession number NP_001691, SEQ ID NO: 14), and most preferably Azurocidin preproprotein, Accession number, SEQ ID NO: 12).

More specifically, the nucleotide sequence encoding the human serum albumin signal peptide (SEQ ID NO: 8) is preferably a codon-optimized polynucleotide represented by SEQ ID NO: 7. The nucleotide sequence encoding the rat serum albumin (SEQ ID NO: 10) is preferably a codon-optimized polynucleotide represented by SEQ ID NO: 9. Preferably, the nucleotide sequence encoding the azurosisid signal peptide (SEQ ID NO: 12) is a codon-optimized polynucleotide represented by SEQ ID NO: 11. The nucleotide sequence encoding the tPA signal peptide (SEQ ID NO: 14) is preferably a codon-optimized polynucleotide represented by SEQ ID NO: 13. The nucleotide sequence encoding the H7 signal peptide (SEQ ID NO: 16) is preferably a codon-optimized polynucleotide represented by SEQ ID NO: 15.

In other words, the signal peptide may be codon-optimized for expression in an animal cell CHO cell line. For example, nucleotides encoding azurosidine can be codon-optimized and represented by the nucleotide sequence of SEQ ID NO.

In the present invention, the nucleotide encoding the azolosidine signal peptide (SEQ ID NO: 11) is linked to the 5'-terminal portion of the codon-optimized IL-21 polynucleotide of SEQ ID NO: 5 of the present invention, thereby adjudicating the signal peptide. IL-21 protein linked to the expression was normally expressed and induced to move out of the cell. As a result, it was confirmed in the cell culture that the signal peptide-linked IL-21 protein was expressed in the cells and successfully secreted out of the cells.

Codon-optimized IL-21 polynucleotide of SEQ ID NO: 5 according to the present invention is codon-optimized to be highly expressed in animal cells, and may be secreted out of the cell.

In another embodiment of the present invention, a vector for expressing IL-21 protein is provided.

The IL-21 protein expression vector according to the present invention includes a nucleotide encoding a signal peptide and a codon-optimized IL-21 polynucleotide of SEQ ID NO. That is, preferably, the vector of the present invention is a codon-optimized mature IL-21 protein in which a codon is replaced with a nucleotide encoding a codon-optimized azurosidine signal peptide at a non-optimized wild type IL-21 signal peptide position. It may comprise an IL-21 sequence encoding the amino acid sequence of.

In using the expression vectors and methods of the present invention, codon optimized and signal peptide optimized IL-21 was produced in animal cells at significant levels than wild type or conventionally known IL-21.

In another embodiment of the invention, the expression vector may further comprise a selectable marker. Selectable markers used in the present invention are zeocin resistant, but are not limited thereto.

In addition, the expression vector may comprise a nucleotide sequence that encodes a peptide tag to aid in the purification of the desired protein.

As used herein, the term “tag” is used to denote a polypeptide fraction that can attach to a secondary polypeptide to provide purification or detection of the secondary polypeptide or to provide a site for attachment of the secondary polypeptide to a substrate. In principle, any peptide or protein for which antibodies or other specific binding agents are available may be used as a tag.

The tag used in the present invention is not limited to the type of tag so as to achieve the purpose of purifying the IL-21 protein of the present invention, any tag known in the art, the nucleic acid sequence of SEQ ID NO: 5; Or by attaching to the 5'-end or 3'-end of the fragment thereof.

In another embodiment of the present invention, a cell transformed with the IL-21 protein expression vector of the present invention is provided.

The transformed cell according to the present invention can be obtained by inserting the expression vector of the present invention as described above into an animal cell and transforming the animal cell, wherein the animal cell is preferably a CHO cell.

In another embodiment of the present invention, a method for preparing IL-21 protein is provided, which comprises culturing the transformed cells of the present invention.

In one embodiment the IL-21 (Interleukin-21) polynucleotide (Optimized AzSP / Optimized IL-21) of the present invention comprises:

The nucleic acid sequence of SEQ ID NO: 11; Or polynucleotides of codon optimized Azurocidin preproprotein, including fragments thereof (Optimized AzSP); And

The nucleic acid sequence of SEQ ID NO: 5; Or polynucleotides of codon optimized IL-21 (Interleukin-21) comprising fragments thereof.

That is, it is an IL-21 coding sequence (SEQ ID NO: 17) comprising a sequence encoding SEQ ID NO: 11 (SEQ ID NO: 11) as a signal peptide at the 5'-end of the nucleic acid sequence of SEQ ID NO: 5 (polynucleotide sequence). Its amino acid sequence is shown in SEQ ID NO: 18. The sequence may additionally include a tag for purification, such as Twin-strep-tag, but is not limited thereto.

Thus, when using the expression vectors described herein, the yield of recombinant IL-21 protein recovered from CHO cells was significantly improved.

Further, according to another aspect of the present invention, the present invention provides an immunological disease treatment agent comprising IL-21 (Interleukin-21) protein produced according to the method of the present invention as an active ingredient.

As used herein, the term "immunotherapy" refers to modulating a human immune response to impart a desired therapeutic effect. An immunotherapeutic agent refers to an immunotherapeutic composition that sufficiently modulates an individual's immune system to ultimately reduce symptoms associated with an unwanted immune response or to increase the desired immune response and ultimately alleviate the symptoms.

According to the present invention, when the selected signal peptide is linked to the codon-optimized IL-21 as a secretion leader to enhance secretion efficiency, the IL-21 is highly expressed and secreted in CHO cells which are mammalian cells. The production of IL-21 in the CHO cell line as a production host was improved, and it was confirmed that the biological function problem caused by using prokaryotes as a host was overcome, which can be useful for mass production of high quality IL-21. have.

1A shows codon-non-optimized wild type IL-21 (WT IL-21; BC066259) polynucleotide (SEQ ID NO: 1; including codon-non-optimized IL-21 signal peptide) and codon-optimized IL-21 (opti IL). -21) shows the results of optimized sequence alignment between polynucleotides (SEQ ID NO: 2; including codon-optimized IL-21 signal peptide). FIG. 1B shows a schematic of codon-optimized IL-21 (IL-21) and codon-optimized IL-21 (opti IL-21) of the present invention in which IL-21 signal peptide (IL21SP) is conserved. 1C shows a vector map of the present invention.
2 shows cell lines transformed with codon-optimized IL-21 (opti IL-21), negative control (Mock) and non-optimized IL-21 transformed cell lines (IL-21) of the present invention. Comparison of IL-21 expression levels is shown.
3A shows the wild-type sequence (non-optimized) and optimized sequence sites encoding each of the five signal peptides (secretory leader sequence). Figure 3b shows a cell line (AzSP / mIL21), negative control (Mock), wild type IL-21 signal peptide (IL21SP / mIL21) or other transformed with IL-21 optimized by the azurosisid secretion leader sequence of the present invention. Comparison of IL-21 expression levels in cell lines (HSASP / mIL21, RSASP / mIL21, tPASP / mIL21 and H7SP / mIL21) transformed with IL-21 optimized by four secretory leader sequences is shown.
FIG. 4 shows selected two cell lines (AzSP / IL21-5, AzSP / IL21-12), vector control cell line (Mock) and opti IL-21 cell line (cell line not optimized for azolosidine). Comparison of IL-21 expression levels is shown.
Figure 5 shows the results of comparing the biological activity when treated with CD3-cord blood cells of the present invention IL-21 and commercially available rhIL-21.

Hereinafter, the examples are only for illustrating the present invention in more detail, and the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, those skilled in the art. Will be self-evident.

Example 1. Codon Optimization of IL-21

The present inventors attempted to enhance the secretion of IL-21 protein by increasing the expression of IL-21 using codon optimization suitable for animal cells.

First, PCR was performed using the following primer sequences to obtain a non-optimized wild type IL-21 (WT IL-21) DNA sequence:

Forward primer sequences; GATCCTTAAGGCCACCATGAGATCCAGTCCTGGCA (SEQ ID NO: 19) and reverse primer sequences; GATCGGATCCTCAGGAATCTTCACTTCCGTGTG (SEQ ID NO: 20).

The non-optimized wild type IL-21 total sequence is AflII (CTTAAG) and BamH1 (GGATCC) at both ends of the non-optimized wild type IL-21 sequence (SEQ ID NO: 1). There is a restriction enzyme site, in which the kozak sequence (GCCACC), generally known to enhance the transcription of a protein, is inserted, which is shown in SEQ ID NO: 21.

Codon optimization was performed for the base sequence region of the IL-21 gene using a codon optimization program.

As a result, as shown in FIG. 1A, the codon-optimized IL-21 polynucleotide (SEQ ID NO: 2) showed 82% homology with the wild type IL-21 polynucleotide (SEQ ID NO: 1).

In addition, to implement an expression system suitable for animal cells, the CHO cell line was used as the host cell in the present invention.

The CHO (Chinese hamster ovary) cell line has several strains. The CHO-DG44 and GS (glutamine tynthetase) / MSX (methionine sulphoximine) gene amplification systems using a dihydrofolate reductase (DHFR) / methotrexate (MTX) gene amplification system are typical. There is CHO-K1 to use.

In this example, CHO-K1 cells were used as host cells for producing recombinant IL-21 protein.

To construct a suitable expression system for CHO-K1 cells, as shown in FIGS. 1B and 1C, the non-optimized IL-21 and optimized IL-21 DNA were AflII of the pcDNA3.1 / Zeo (+)-GS plasmid. Was inserted into the BamH1 restriction enzyme site and cloned into the expression vector (pcDNA3.1 / Zeo (+)-GS) for CHO-K1 cells (pcDNA3.1 / Zeo (+)-GS plasmid was the GS of CHO-K1 cells. As a vector modified for the expression system, it was provided by Professor Lee Kyun-min of Daejeon Institute of Science and Technology).

When 60-70% of CHO-K1 cells were grown in 6-well plates, 1 ug of DNA and 3 ul of X-tremegene 9 transfection reagent (Roche) were diluted in 200 ul of opti-MEM (Gibco) and allowed to stand for 15 minutes. And transformed into CHO-K1 cells.

CHO-K1 cells were cultured in DMEM Gln (-) (Gibco), 10% dialized FBS (Gibco), and GSEM supplement (sigma).

After 24 hours of transformation, change to selection media (selection media: DMEM Gln (-), 10% dFBS, GSEM, 300ug / ml zeocin (Invitrogen), 25uM MSX (Sigma)) and change medium once every 3 days. Screened for weeks.

It was then seeded at 100,000 cells / 6 wells. After culturing for 3 days, the culture was harvested and the amount of IL-21 was measured in the culture using a human IL-21 ELISA kit (Komabiotech).

At this time, Mock cell line transformed with pcDNA3.1-GS vector was used as a negative control (vector control).

As a result, as shown in Figure 2, in the cell line (opti IL-21) transformed with IL-21 optimized by the codon optimization of the present invention, negative control (Mock) and non-optimized IL Compared to the cell line transformed with -21 (IL-21), it was confirmed that the production of IL-21 more than seven times increased.

Example 2 Secretion Sequence Optimization

2-1. Screening of Signal Peptides

In order to improve the secretion of IL-21 protein, the present inventors selected five types of signal peptides estimated to enhance the secretion of recombinant protein in CHO cells, and the codon-optimized IL-21 identified in Example 1 above. By combining the selected high efficiency signal peptides with the sequence, the correlation between the secretion of these signal peptides and IL-21 was first confirmed.

More specifically, the original IL-21 signal peptide was removed from the codon-optimized IL-21 in Example 1, and a gene into which azolosidine and other signal peptides were inserted as shown in Table 1 was synthesized. In addition, restriction enzymes, kozak sequence and mature IL-21 sequence are identical to optimized IL-21 (opti IL-21; opti IL21SP / IL-21).

The codon-optimized mature IL-21 nucleotide sequence from which the original IL-21 signal peptide was removed is shown in SEQ ID NO: 5, and the amino acid sequence encoded thereby is shown in SEQ ID NO: 6. In addition, codon-non-optimized mature IL-21 nucleotide sequences are shown in SEQ ID NO: 3, and the amino acid sequences encoded thereby are shown in SEQ ID NO: 4.

At this time, in order to express the known signal peptides in CHO cells, the inventors further codon optimized their sequences.

Thus, the sequence of each signal peptide is identical to the known sequence, but the DNA sequences are different.

The wild type sequence (non-optimized) and the optimized sequence region encoding each of the five signal peptides are shown in FIG. 3A, and the optimized nucleotide sequences encoding the signal peptides and thus the encoded signal peptides are shown in Table 1 below. Shown in

protein Signal peptide sequence Human serum albumin ATGAAGTGGGTGACCTTTATTTCCCTTCTGTTCCTCTTTTCTAGTGCCTATTCC (SEQ ID NO: 7)

MKWVTFISLLFLFSSAYS (SEQ ID NO: 8) Rat serum albumin ATGAAGTGGGTCACCTTTCTGTTGCTCCTCTTCATTTCAGGTTCAGCCTTTTCT (SEQ ID NO: 9)

MKWVTFLLLLFISGSAFS (SEQ ID NO: 10) Azurocidin preproprotein ATGACTCGGCTGACAGTCCTGGCACTGCTGGCTGGTCTGCTGGCTTCCAGCAGAGCC (SEQ ID NO: 11)

MTRLTVLALLAGLLASSRA (SEQ ID NO: 12) Tissue-type plasminogen activator (tPA) ATGGACGCCATGAAGCGGGGGCTCTGCTGTGTCCTGCTGCTTTGTGGAGCAGTGTTCGTGAGCCCC (SEQ ID NO: 13)

MDAMKRGLCCVLLLCGAVFVSP (SEQ ID NO: 14) H7 (Ig heavy chain signal peptide 7) ATGGAGTTTGGCCTGAGCTGGGTTTTCCTCGTGGCCCTGTTCCGCGGTGTCCAGTGT (SEQ ID NO: 15)

MEFGLSWVFLVALFRGVQC (SEQ ID NO: 16)

Subsequently, an IL-21 recombinant gene, a control group (IL21SP / IL-21), a mock vector linked to five different secretory sequences (signal peptides) were introduced into CHO-K1 cells, and transformed through two weeks of selection ( pool transfectant) cell lines were constructed.

It was then seeded at 100,000 cells / 6 wells. After culturing for 3 days, the culture was harvested and the amount of IL-21 was measured in the culture using a human IL-21 ELISA kit (Komabiotech).

At this time, Mock cell line transformed with pcDNA3.1-GS vector was used as a negative control (vector control).

As a result, as shown in FIG. 3B, in the cell line (AzSP / mIL21) transformed with the azurosisid secretion leader sequence and optimized IL-21 of the present invention, a negative control (Mock), wild-type IL-21 signal peptide Of IL-21 compared to cell lines transformed with IL-21 optimized by (IL21SP / mIL21) or other four secretory leader sequences (HSASP / mIL21, RSASP / mIL21, tPASP / mIL21 and H7SP / mIL21). It was confirmed that the yield increased significantly.

The codon-optimized azurosidine secretion leader sequence is shown in SEQ ID NO: 11 and its amino acid sequence in SEQ ID NO: 12.

In addition, Azsp / mIL21 containing azolosidine optimized as a selected signal peptide was introduced into CHO-K1 cells to produce stabilized clones, among which the two cell lines producing the most IL-21 (AzSP). / IL21-5, AzSP / IL21-12) were selected to compare IL-21 expression levels.

As a result, as shown in Fig. 4, in the production amount of IL-21, the two selected cell lines (AzSP / IL21-5, AzSP / IL21-12) were cell lines (Mock) and opti IL as vector control groups. It was confirmed that the production increased 2-3 times as compared to the -21 cell line (cell line that did not optimize the azolosidine secretion sequence).

Example 3. Effect of Cellular Activity by IL-21 Protein of the Present Invention

The inventors of the present invention prepared the codon-optimized IL-21 (opti IL-21) of the present invention prepared in Example 2 and the azurosisid optimized-codon optimized IL-21 (opti AzSP / IL-21) of the present invention. In order to confirm the cellular activity effect of IL-15 and IL-21 activating NK cells were co-treated with CD3-cord blood cells as follows:

end. rhIL-15 (com; 10 ng / ml) + rhIL-21 (com; 10 ng / ml); Groups treated with recombinant human IL-15 (rhIL-15) and commercially available IL-21 (rhIL-21) (Peprotech), which are currently used for activation of NK cells,

I. rhIL-15 (com; 10 ng / ml) + mock; group treated with culture medium of rhIL-15 and mock cells,

All. rhIL-15 (com; 10 ng / ml) + opti IL-21 (WT; 10 ng / ml); group treated with rhIL-15 and the culture medium of the opti IL-21 cell line of the present invention,

la. rhIL-15 (com; 10 ng / ml) + opti AzSP / IL-21 (10 ng / ml); Groups treated with rhIL-15 and the culture medium of the AzSP / IL-21 cell line of the present invention.

It is known in the art that IL-15 induces differentiation of NK cells and IL-21 induces proliferation of NK cells.

In other words, in the present embodiment, the same treatment of rhIL-15 and the activity of IL-21 (C and D) of the present invention and IL-21 (A) produced in the commercially available bacteria commonly used in the art are shown. Comparison was made in terms of cell proliferation and purity.

As a result, as shown in Fig. 5, IL-21 of the present invention, when treated with CD3-cord blood cells, showed not only high NK cell proliferation ability but also a similar degree of purity compared to commercially available rhIL-21. .

That is, the codon-optimized IL-21 of the present invention, which is produced by itself in animal cells, exhibits high biological activity compared to conventional products produced by bacteria.

Thus, IL-21 codon optimization suitable for animal cells of the present invention; And secretion leader sequence (signal peptide) selection and optimization to enhance secretion efficacy, as well as high expression and high secretion of IL-21 in mammalian CHO cells, Overcome the problem of biological function.

<110> Korea Research Institute of Bioscience and Biotechnology <120> CODON OPTIMIZED IL-21 AND USES THEREOF <130> KRIBB1-31 <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 489 <212> DNA <213> Homo sapiens <400> 1 atgagatcca gtcctggcaa catggagagg attgtcatct gtctgatggt catcttcttg 60 gggacactgg tccacaaatc aagctcccaa ggtcaagatc gccacatgat tagaatgcgt 120 caacttatag atattgttga tcagctgaaa aattatgtga atgacttggt ccctgaattt 180 ctgccagctc cagaagatgt agagacaaac tgtgagtggt cagctttttc ctgctttcag 240 aaggcccaac taaagtcagc aaatacagga aacaatgaaa ggataatcaa tgtatcaatt 300 aaaaagctga agaggaaacc accttccaca aatgcaggga gaagacagaa acacagacta 360 acatgccctt catgtgattc ttatgagaaa aaaccaccca aagaattcct agaaagattc 420 aaatcacttc tccaaaagat gattcatcag catctgtcct ctagaacaca cggaagtgaa 480 gattcctga 489 <210> 2 <211> 489 <212> DNA <213> Artificial Sequence <220> <223> opti IL-21 <400> 2 atgagatcca gtcccgggaa tatggagcgg attgtgatct gtctgatggt tatcttcttg 60 ggaactctgg tccacaagtc atcgtcccag ggtcaggacc gccacatgat tcggatgcgt 120 cagctgatag acattgtgga ccagctgaag aattatgtga acgatcttgt gcctgaattt 180 ctgcccgcac ccgaagatgt cgagaccaac tgcgagtgga gcgctttttc ctgcttccag 240 aaggcccagc tcaagtctgc taacaccggc aacaatgaga ggatcatcaa cgtaagcatc 300 aagaagctga agaggaagcc tccaagcaca aacgccggcc ggcggcaaaa gcacagactc 360 acatgccctt catgtgactc ttacgagaaa aagccaccca aagagttcct agaacgcttt 420 aagagccttc tccaaaagat gatccatcag cacctgtctt cccgaaccca tggaagtgaa 480 gattcctga 489 <210> 3 <211> 402 <212> DNA <213> Homo sapiens <400> 3 caaggtcaag atcgccacat gattagaatg cgtcaactta tagatattgt tgatcagctg 60 aaaaattatg tgaatgactt ggtccctgaa tttctgccag ctccagaaga tgtagagaca 120 aactgtgagt ggtcagcttt ttcctgcttt cagaaggccc aactaaagtc agcaaataca 180 ggaaacaatg aaaggataat caatgtatca attaaaaagc tgaagaggaa accaccttcc 240 acaaatgcag ggagaagaca gaaacacaga ctaacatgcc cttcatgtga ttcttatgag 300 aaaaaaccac ccaaagaatt cctagaaaga ttcaaatcac ttctccaaaa gatgattcat 360 cagcatctgt cctctagaac acacggaagt gaagattcct ga 402 <210> 4 <211> 162 <212> PRT <213> Homo sapiens <400> 4 Met Arg Ser Ser Pro Gly Asn Met Glu Arg Ile Val Ile Cys Leu Met   1 5 10 15 Val Ile Phe Leu Gly Thr Leu Val His Lys Ser Ser Ser Gln Gly Gln              20 25 30 Asp Arg His Met Ile Arg Met Arg Gln Leu Ile Asp Ile Val Asp Gln          35 40 45 Leu Lys Asn Tyr Val Asn Asp Leu Val Pro Glu Phe Leu Pro Ala Pro      50 55 60 Glu Asp Val Glu Thr Asn Cys Glu Trp Ser Ala Phe Ser Cys Phe Gln  65 70 75 80 Lys Ala Gln Leu Lys Ser Ala Asn Thr Gly Asn Asn Glu Arg Ile Ile                  85 90 95 Asn Val Ser Ile Lys Lys Leu Lys Arg Lys Pro Pro Ser Thr Asn Ala             100 105 110 Gly Arg Arg Gln Lys His Arg Leu Thr Cys Pro Ser Cys Asp Ser Tyr         115 120 125 Glu Lys Lys Pro Pro Lys Glu Phe Leu Glu Arg Phe Lys Ser Leu Leu     130 135 140 Gln Lys Met Ile His Gln His Leu Ser Ser Arg Thr His Gly Ser Glu 145 150 155 160 Asp ser         <210> 5 <211> 402 <212> DNA <213> Artificial Sequence <220> <223> codon-optimized mature IL-21 <400> 5 cagggtcagg accgccacat gattcggatg cgtcagctga tagacattgt ggaccagctg 60 aagaattatg tgaacgatct tgtgcctgaa tttctgcccg cacccgaaga tgtcgagacc 120 aactgcgagt ggagcgcttt ttcctgcttc cagaaggccc agctcaagtc tgctaacacc 180 ggcaacaatg agaggatcat caacgtaagc atcaagaagc tgaagaggaa gcctccaagc 240 acaaacgccg gccggcggca aaagcacaga ctcacatgcc cttcatgtga ctcttacgag 300 aaaaagccac ccaaagagtt cctagaacgc tttaagagcc ttctccaaaa gatgatccat 360 cagcacctgt cttcccgaac ccatggaagt gaagattcct ga 402 <210> 6 <211> 162 <212> PRT <213> Artificial Sequence <220> <223> codon-optimized mature IL-21 <400> 6 Met Arg Ser Ser Pro Gly Asn Met Glu Arg Ile Val Ile Cys Leu Met   1 5 10 15 Val Ile Phe Leu Gly Thr Leu Val His Lys Ser Ser Ser Gln Gly Gln              20 25 30 Asp Arg His Met Ile Arg Met Arg Gln Leu Ile Asp Ile Val Asp Gln          35 40 45 Leu Lys Asn Tyr Val Asn Asp Leu Val Pro Glu Phe Leu Pro Ala Pro      50 55 60 Glu Asp Val Glu Thr Asn Cys Glu Trp Ser Ala Phe Ser Cys Phe Gln  65 70 75 80 Lys Ala Gln Leu Lys Ser Ala Asn Thr Gly Asn Asn Glu Arg Ile Ile                  85 90 95 Asn Val Ser Ile Lys Lys Leu Lys Arg Lys Pro Pro Ser Thr Asn Ala             100 105 110 Gly Arg Arg Gln Lys His Arg Leu Thr Cys Pro Ser Cys Asp Ser Tyr         115 120 125 Glu Lys Lys Pro Pro Lys Glu Phe Leu Glu Arg Phe Lys Ser Leu Leu     130 135 140 Gln Lys Met Ile His Gln His Leu Ser Ser Arg Thr His Gly Ser Glu 145 150 155 160 Asp ser         <210> 7 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> human serum albumin signal peptide <400> 7 atgaagtggg tgacctttat ttcccttctg ttcctctttt ctagtgccta ttcc 54 <210> 8 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> human serum albumin signal peptide <400> 8 Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Leu Phe Ser Ser Ala   1 5 10 15 Tyr ser         <210> 9 <211> 54 <212> DNA <213> Artificial Sequence <220> Rat serum albumin signal peptide <400> 9 atgaagtggg tcacctttct gttgctcctc ttcatttcag gttcagcctt ttct 54 <210> 10 <211> 18 <212> PRT <213> Artificial Sequence <220> Rat serum albumin signal peptide <400> 10 Met Lys Trp Val Thr Phe Leu Leu Leu Leu Phe Ile Ser Gly Ser Ala   1 5 10 15 Phe ser         <210> 11 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Azurocidin preproprotein signal peptide <400> 11 atgactcggc tgacagtcct ggcactgctg gctggtctgc tggcttccag cagagc 56 <210> 12 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> Azurocidin preproprotein signal peptide <400> 12 Met Thr Arg Leu Thr Val Leu Ala Leu Leu Ala Gly Leu Leu Ala Ser   1 5 10 15 Ser Arg Ala             <210> 13 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> tPA signal peptide <400> 13 atggacgcca tgaagcgggg gctctgctgt gtcctgctgc tttgtggagc agtgttcgtg 60 agcccc 66 <210> 14 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> tPA signal peptide <400> 14 Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly   1 5 10 15 Ala Val Phe Val Ser Pro              20 <210> 15 <211> 57 <212> DNA <213> Artificial Sequence <220> H223 signal peptide <400> 15 atggagtttg gcctgagctg ggttttcctc gtggccctgt tccgcggtgt ccagtgt 57 <210> 16 <211> 19 <212> PRT <213> Artificial Sequence <220> H223 signal peptide <400> 16 Met Glu Phe Gly Leu Ser Trp Val Phe Leu Val Ala Leu Phe Arg Gly   1 5 10 15 Val Gln Cys             <210> 17 <211> 458 <212> DNA <213> Artificial Sequence <220> <223> Opti AzSP / IL-21 <400> 17 atgactcggc tgacagtcct ggcactgctg gctggtctgc tggcttccag cagagccagg 60 gtcaggaccg ccacatgatt cggatgcgtc agctgataga cattgtggac cagctgaaga 120 attatgtgaa cgatcttgtg cctgaatttc tgcccgcacc cgaagatgtc gagaccaact 180 gcgagtggag cgctttttcc tgcttccaga aggcccagct caagtctgct aacaccggca 240 acaatgagag gatcatcaac gtaagcatca agaagctgaa gaggaagcct ccaagcacaa 300 acgccggccg gcggcaaaag cacagactca catgcccttc atgtgactct tacgagaaaa 360 agccacccaa agagttccta gaacgcttta agagccttct ccaaaagatg atccatcagc 420 acctgtcttc ccgaacccat ggaagtgaag attcctga 458 <210> 18 <211> 152 <212> PRT <213> Artificial Sequence <220> <223> Opti AzSP / IL-21 <400> 18 Met Thr Arg Leu Thr Val Leu Ala Leu Leu Ala Gly Leu Leu Ala Ser   1 5 10 15 Ser Arg Ala Gln Gly Gln Asp Arg His Met Ile Arg Met Arg Gln Leu              20 25 30 Ile Asp Ile Val Asp Gln Leu Lys Asn Tyr Val Asn Asp Leu Val Pro          35 40 45 Glu Phe Leu Pro Ala Pro Glu Asp Val Glu Thr Asn Cys Glu Trp Ser      50 55 60 Ala Phe Ser Cys Phe Gln Lys Ala Gln Leu Lys Ser Ala Asn Thr Gly  65 70 75 80 Asn Asn Glu Arg Ile Ile Asn Val Ser Ile Lys Lys Leu Lys Arg Lys                  85 90 95 Pro Pro Ser Thr Asn Ala Gly Arg Arg Gln Lys His Arg Leu Thr Cys             100 105 110 Pro Ser Cys Asp Ser Tyr Glu Lys Lys Pro Pro Lys Glu Phe Leu Glu         115 120 125 Arg Phe Lys Ser Leu Leu Gln Lys Met Ile His Gln His Leu Ser Ser     130 135 140 Arg Thr His Gly Ser Glu Asp Ser 145 150 <210> 19 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer F <400> 19 gatccttaag gccaccatga gatccagtcc tggca 35 <210> 20 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer R <400> 20 gatcggatcc tcaggaatct tcacttccgt gtg 33 <210> 21 <211> 507 <212> DNA <213> Artificial Sequence <220> Non-opti IL-21 sequence (AflII BamH1) <400> 21 cttaaggcca ccatgagatc cagtcctggc aacatggaga ggattgtcat ctgtctgatg 60 gtcatcttct tggggacact ggtccacaaa tcaagctccc aaggtcaaga tcgccacatg 120 attagaatgc gtcaacttat agatattgtt gatcagctga aaaattatgt gaatgacttg 180 gtccctgaat ttctgccagc tccagaagat gtagagacaa actgtgagtg gtcagctttt 240 tcctgctttc agaaggccca actaaagtca gcaaatacag gaaacaatga aaggataatc 300 aatgtatcaa ttaaaaagct gaagaggaaa ccaccttcca caaatgcagg gagaagacag 360 aaacacagac taacatgccc ttcatgtgat tcttatgaga aaaaaccacc caaagaattc 420 ctagaaagat tcaaatcact tctccaaaag atgattcatc agcatctgtc ctctagaaca 480 cacggaagtg aagattcctg aggatcc 507

Claims (10)

The nucleic acid sequence of SEQ ID NO: 5; Or polynucleotides of codon optimized IL-21 (Interleukin-21), including fragments thereof.
The method of claim 1,
The nucleic acid sequence of SEQ ID NO: 5; Or a nucleotide encoding a signal peptide at the 5'-end or 3'-end of the fragment thereof.
The method of claim 2,
The signal peptide is human serum albumin (Accession number P02768, SEQ ID NO: 8), rat serum albumin (rat serum albumin, Accession number P02770, SEQ ID NO: 10), azurocidin preproprotein, Accession number, sequence No. 12), tPA (Tissue-type plasminogen activator, Accession number NP_001691, SEQ ID NO: 14) and H7 (Ig heavy chain signal peptide 7, SEQ ID NO: 16).
The method of claim 3,
The polynucleotide is
The nucleic acid sequence of SEQ ID NO: 11; Or polynucleotides of codon optimized Azurocidin preproprotein, including fragments thereof (Optimized AzSP); And
The nucleic acid sequence of SEQ ID NO: 5; Or a polynucleotide of codon-optimized IL-21 (Interleukin-21) including a fragment thereof in a linked form.
The method of claim 4, wherein
The polynucleotide is a nucleic acid sequence of SEQ ID NO: 5; Or a nucleotide encoding a tag sequence at the 5'-end or 3'-end of the fragment thereof.
A vector comprising the polynucleotide of any one of claims 1 to 5.
Chinese hamster ovary (CHO) cells transformed with the vector of claim 6.
delete A method for producing IL-21 (Interleukin-21) protein comprising culturing the CHO cells of claim 7.
An immunological disease therapeutic agent comprising a recombinant IL-21 (Interleukin-21) protein as an active ingredient,
The recombinant IL-21 (Interleukin-21) protein is
The nucleic acid sequence of SEQ ID NO: 11; Or polynucleotides of codon optimized Azurocidin preproprotein, including fragments thereof (Optimized AzSP); And a nucleic acid sequence of SEQ ID NO: 5; Or an immunological disease, characterized in that it is produced from a CHO (Chinese hamster ovary) cell transformed with a vector comprising a codon-optimized IL-21 (Interleukin-21) polynucleotide (Optimized IL-21) comprising a fragment thereof. remedy.

Images