US20040043464A1 - Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them - Google Patents

Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them Download PDF

Info

Publication number
US20040043464A1
US20040043464A1 US10/654,528 US65452803A US2004043464A1 US 20040043464 A1 US20040043464 A1 US 20040043464A1 US 65452803 A US65452803 A US 65452803A US 2004043464 A1 US2004043464 A1 US 2004043464A1
Authority
US
United States
Prior art keywords
glycosyltransferase
ala
leu
arg
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/654,528
Inventor
Emil Gotschlich
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US10/654,528 priority Critical patent/US20040043464A1/en
Publication of US20040043464A1 publication Critical patent/US20040043464A1/en
Priority to US11/102,497 priority patent/US20050271690A1/en
Priority to US12/815,272 priority patent/US8268596B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/22—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Neisseriaceae (F)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins

Definitions

  • the present invention relates to glycosyltransferases useful for biosynthesis of oligosaccharides, genes encoding such glycosyltransferases and recombinant methods of producing the enzymes, and the oligosaccharides produced thereby.
  • Neisseria species commonly colonize many mammalian hosts, human beings are the only species subject to invasive disease by members of this species.
  • Neisseria meningitidis is the etiologic agent for septicemia and meningitis that may occur in epidemic form.
  • Neisseria gonorrhoeae is the causative agent of gonorrhea and its manifold complications. These organisms, particularly the gonococcus, have proved remarkably adept at varying the antigenic array of their surface-exposed molecules, notably their adhesive pili and opacity-related (opa) proteins.
  • LPS LPS in the external leaflet of their outer membranes
  • the LPS of Neisseria ssp. is of modest size and therefore is often referred to as lipooligosaccharide or LOS.
  • LOS lipooligosaccharide
  • the molecular size of the LOS is similar to that seen in rough LPS mutants of Salmonella ssp., this substance has considerable antigenic diversity.
  • a serological typing scheme has been developed that separates strains into 12 immunotypes (Zollinger and Mandrell, 1977, Infect. Immun.
  • the LOS molecules have a number of biological activities. They are potent endotoxic molecules believed to be the toxin responsible for adrenal cortical necrosis seen in severe meningococcal disease. They serve as the target antigen for much of the bactericidal activity present in normal or convalescent human sera (Rice et al., 1980, J. Immunol. 124:2105). Gonococci possess a very unusual sialyl transferase activity which is able to use externally supplied CMP-NANA and add N-acetyl neuraminic acid to the LOS on the surface of the organism (Nairn et al., 1988, J. Gen. Microbiol.
  • Group B and C meningococci have the capacity to synthesize CMP-NANA, and frequently sialylate their LOS without requiring exogenous CMP-NANA (Mandrell et al., 1991, J. Bacteriol. 173:2823).
  • the sialic acid unit is linked ⁇ 2 ⁇ 3 to the terminal Gal residue of the lacto-N-neotetraose (Yamasaki et al., 1993, J. Bacteriol.
  • inoculated variant A produced a truncated LOS containing only the ⁇ -lactosyl group linked to Hep1, while one of the new variants (variant C) produced a complete LOS (Kerwood et al., 1992, Biochemistry 31:12760). This suggests that the addition of the additional sugars GalNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3 is likely to be under control of a phase variation mechanism.
  • Mutant 1291b synthesizes the alternative LOS structure Gal ⁇ 1 ⁇ 4Gal ⁇ 1 ⁇ 4Glc (see FIG. 1). Only the genetic basis of the 1291e mutant is now defined. It is a mutation of phosphoglucomutase (pgm), which precludes the synthesis of UDP-glucose, and hence the addition of the first residue of the lacto-N-neotetraose unit (Zhou et al., 1994, J. Biol. Chem. 269:11162; Sandlin and Stein, 1994, J. Bacteriol. 176:2930).
  • pgm phosphoglucomutase
  • Oligosaccharides are polymers of varying number of residues, linkages, and subunits.
  • the basic subunit is a carbohydrate monosaccharide or sugar, such as mannose, glucose, galactose, N-acetylglucosamine, N-acetylgalactosamine, and the like.
  • the number of different possible stereoisomeric oligosaccharide chains is enormous.
  • Oligosaccharides and polysaccharides play an important role in protein function and activity, by serving as half-life modulators, and, in some instances, by providing structure. As pointed out above, oligosaccharides are critical to the antigenic variability, and hence immune evasion, of Neisseria, especially gonococcus.
  • glycosyltransferases Recent advances in oligosaccharide synthesis have occurred with the isolation of glycosyltransferases. These enzymes can be used in vitro to prepare oligosaccharides and polysaccharides (see, e.g., Roth, U.S. Pat. No. 5,180,674, issued Jan. 19, 1993).
  • the advantage of biosynthesis with glycosyltransferases is that the glycosidic linkages formed by enzymes are highly stereo and regio-specific. However, each enzyme catalyzes linkage of specific sugar residues to other specific acceptor molecules, e.g., an oligosaccharide or lipid. Thus, synthesis of a desired oligosaccharide may be limited by the availability of glycosyltransferases (see, Roth, International Patent Publication No. WO 93/13198, published Jul. 8, 1993).
  • glycosyltransferases themselves are usually present in fairly low quantities in cells. It is difficult to obtain enough of the enzyme to be commercially practicable.
  • glycosyltransferases there is a great need in the art for glycosyltransferases. There is a further need for genes encoding such glycosyltransferases, to provide an unlimited source of glycosyltransferases through recombinant technology.
  • the present invention is directed to nucleic acids encoding glycosyltransferases, the proteins encoded thereby, and to methods for synthesizing oligosaccharides using the glycosyltransferases of the invention. Accordingly, in one aspect, the invention is directed to a purified nucleic acid that is hybridizable under moderately stringent conditions to a nucleic acid corresponding to the LOS locus of Neisseria, e.g., a nucleic acid having a nucleotide sequence corresponding to or complementary to the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1).
  • the nucleic acid of the invention is hybridizable to a portion of the coding sequence for a gene of the LOS locus, i.e., a portion of the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1) that encodes a functionally active glycosyltransferase.
  • the invention relates to a nucleic acid that has a nucleotide sequence corresponding to or complementary to a portion of the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1) that encodes a functionally active glycosyltransferase.
  • the nucleic acid encodes a functionally active glycosyltransferase.
  • the invention is directed to a nucleic acid that has a nucleotide sequence corresponding to or complementary to the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1).
  • the functionally active glycosyltransferases of the invention are characterized by catalyzing a reaction selected from the group consisting of:
  • nucleic acid encodes a functionally active glycosyltransferase.
  • nucleic acids of the invention include oligonucleotides useful as primers for polymerase chain reaction (PCR) or for probes for the presence and level of transcription of a glycosyltransferase gene.
  • the nucleic acid encodes a glycosyltransferase having an amino acid sequence of SEQ ID NO:2; SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.
  • the invention further relates to an expression vector comprising the nucleic acid encoding a glycosyltransferase of the invention operatively associated with an expression control sequence. Accordingly, the invention extends to recombinant host cell transformed with such an expression vector.
  • the invention is directed to a method for producing a glycosyltransferase comprising culturing the recombinant host cell under conditions that allow expression of the glycosyltransferase; and recovering the expressed glycosyltransferase.
  • the invention is directed to glycosyltransferase having an amino acid sequence of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, or a functionally active fragment thereof.
  • the invention further contemplates a composition comprising a glycosyltransferase conjugated to a solid phase support, wherein the glycosyltransferase is selected from the group consisting of a glycosyltransferase having an amino acid sequence of SEQ ID NO:2, or a functionally active fragment thereof; a glycosyltransferase having an amino acid sequence of SEQ ID NO:3, or a functionally active fragment thereof; a glycosyltransferase having an amino acid sequence of.
  • SEQ ID NO:4 or a functionally active fragment thereof; and a glycosyltransferase having an amino acid sequence of SEQ ID NO:5, or a functionally active fragment thereof; and a glycosyltransferase having an amino acid sequence of SEQ ID NO:6, or a functionally active fragment thereof.
  • the invention accordingly further provides methods for preparing oligosaccharides, e.g., two or more saccharides.
  • the invention relates to a method for adding GalNAc or GlcNAc ⁇ 1 ⁇ 3 to Gal, comprising contacting a reaction mixture comprising an activated GalNAc or GlcNAc to an acceptor moiety comprising a Gal residue in the presence of the glycosyltransferase having an amino acid sequence of SEQ ID NO:2; a method for adding Gal ⁇ 1 ⁇ 4 to GlcNAc or Glc, comprising contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a GlcNAc or Glc residue in the presence of the glycosyltransferase having an amino acid sequence of SEQ ID NO:3; a method for adding Gal ⁇ 1 ⁇ 4 to Gal, comprising contacting a reaction mixture comprising
  • the oligosaccharides are prepared on a carrier that is non-toxic to a mammal, in particular a human, such as a lipid isoprenoid or polyisoprenoid alcohol.
  • a carrier such as dolichol phosphate.
  • the oligosaccharide is attached to the carrier via a labile bond, thus allowing for chemically removing the oligosaccharide from the lipid carrier.
  • an oligosaccharide transferase can be used, e.g., to transfer the oligosaccharide from a lipid carrier to a protein.
  • the glycosyltransferases can be expressed in a eukaryotic expression system, to provide for glycosylation of a protein expressed in such a system.
  • An important advantage of the present invention is that it provides for the synthesis of oligosaccharide antigens of Neisseria independently of lipid A, which is highly toxic.
  • the lipid A portion of LOS is a potent endotoxin, and highly toxic.
  • Chemical treatment of the LOS e.g., by hydrolysis, destroys the antigenicity of the oligosaccharide, leaving a useless product.
  • the invention provides glycosyltransferases and strategies for preparing a number of oligosaccharides, such as but not limited to, Gal ⁇ 1 ⁇ 4Gal ⁇ 1 ⁇ 4Glc, Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4Glc, and GalNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4Glc.
  • glycosyltransferases useful for the synthesis of oligosaccharides.
  • Still a further object of the invention is to provide for synthesis of therapeutically useful oligosaccharides.
  • FIG. 1 Alternative structures found in gonococcal LOS.
  • R1 refers to the inner core region of LOS consisting of two keto-deoxy-octulosonic acid (KDO) residues. These in turn are attached to a lipid A structure.
  • R2 in gonococci is typically GlcNAc ⁇ 1 ⁇ 2Hep ⁇ 1 ⁇ 3.
  • the structure in the top panel contains a tetrasaccharide identical to lacto-N-neotetraose found in paragloboside glycolipids. In many strains this tetrasaccharide bears a terminal GalNAc ⁇ 1 ⁇ 3.
  • the lower panel shows an alternative trisaccharide structure with the terminal Gal ⁇ 1 ⁇ 4 linked.
  • FIG. 2 (A) Genetic map of the LOS locus based on the DNA sequence. Sequence information bp 1-2725 was obtained from plasmid pPstCla, bp 2725-5859 from plasmid p3400 (see materials and methods). IS refers to an area of the sequence that has homology to a previously reported neisserial insertion sequence IS1106 (Knight et al., 1992, Molec. Microbiol. 6:1565). The positions of the reading frames of lgtA-E are indicated.
  • FIG. 3 Homology of the protein products of lgtA and lgtD.
  • the primary structure of two proteins is very similar, particularly in the first half of the sequences.
  • the glycine residues starting at position 86 reflect the coding of the poly-G regions in the respective genes.
  • the Bestfit program of the GCG package was used and the symbols
  • FIG. 4 Homology of the protein products of lgtB and lgtE.
  • the primary structure of two proteins is very similar, particularly in the first half of the sequences.
  • These sequences also have significant homology to lex-1 (Cope et al., 1991, Molec. Microbiol. 5:1113) or lic2A (High et al., 1993, Molec. Microbiol. 9:1275) genes of Haemophilus influenzae .
  • lex-1 Cope et al., 1991, Molec. Microbiol. 5:1113
  • lic2A High et al., 1993, Molec. Microbiol. 9:1275
  • FIG. 5 Homology of the protein products of rfaI and lgtC.
  • the E. coli rfaI and rfaJ genes are very closely related. They serve as glucosyl transferases of two glucose residues in the LPS core region (Pradel et al., 1992, J. Bacteriol. 174:4736).
  • the glycines at position 54-56 in lgtC are encoded by the poly-G tract. For meaning of symbols see FIG. 3.
  • FIG. 6 Deletions in the LOS locus. Three insertion and five deletions of the LOS locus were constructed as detailed in the methods section. The restriction sites that were used are indicated. The insertions are marked by triangles and the extent of the deletions by stippled boxes. The open arrows indicate the open reading frames disrupted by the construction. In each of the constructs the erythromycin marker ermC′ was inserted at the site of the insertion or the deletion.
  • FIG. 7 Silver-stained SDS-PAGE of LOS preparations. Gel electrophoresis of purified LOS samples of 375 ng was performed and stained as described in materials and methods. Above the gel are indicated the structure of the LOS of the major bands inferred to be present in each of the preparations. These structures are based on the reactivity with monoclonal antibodies shown in FIG. 8, but are presented in this Figure to facilitate interpretation of the patterns observed. R stands for the inner core region and lipid A. 1291e is a pyocin resistant mutant (Dudas and Apicella, 1988, Infect. Immun. 56:499)
  • FIG. 8 Reactivity of LOS from strain F62 wt and mutants with monoclonal antibodies.
  • the names of the following monoclonal antibodies were abbreviated: 17-1-L1 (L1), 9-2-L378 (L3), 2-1-L8 (L8).
  • Purified LOS was applied to Immobilon-P membranes, allowed to react with the antibodies and developed as described in materials and methods. The specificity of the monoclonal antibodies is summarized in FIG. 1.
  • the present invention provides five novel glycosyltransferases, genes encoding the glycosyltransferases, and methods for biosynthesis of oligosaccharides using such glycosyltransferases.
  • the glycosyl transferases of the invention can be used for in vitro biosynthesis of various oligosaccharides, such as the core oligosaccharide of the human blood group antigens, i.e., lacto-N-neotetraose.
  • glycosyltransferases of the invention can be accomplished using standard techniques, as disclosed herein. Such glycosyl transferases are useful for biosynthesis of oligosaccharides in vitro, or alternatively genes encoding such glycosyltransferases can be transfected into cells, e.g., yeast cells or eukaryotic cells, to provide for alternative glycosylation of proteins and lipids.
  • cells e.g., yeast cells or eukaryotic cells
  • the instant invention is based, in part, on the discovery and cloning of a locus involved in the biosynthesis of gonococcal LOS has from gonococcal strain F62.
  • the locus contains five open reading frames.
  • the first and the second reading frames are homologous, but not identical to the fourth and the fifth reading frames respectively.
  • Interposed is an additional reading frame which has distant homology to the E. coli rfaI and rfaJ genes, both glucosyl transferases involved in LPS core biosynthesis.
  • the second-and the fifth reading frames show strong homology to the lex-1 or lic2A gene of Haemophilus influenzae , but do not contain the CAAT repeats found in this gene.
  • Deletions of each of these five genes, of combinations of genes, and of the entire locus were constructed and introduced into parental gonococcal strain F62 by transformation.
  • the LOS phenotypes were then analyzed by SDS-PAGE and reactivity with monoclonal antibodies. Analysis of the gonococcal mutants indicates that four of these genes are the glycosyl transferases that add GalNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4 to the substrate Glc ⁇ 1 ⁇ 4Hep ⁇ R of the inner core region.
  • the gene with homology to E. coli rfaI/rfaJ is involved with the addition of the ⁇ -linked galactose residue in the biosynthesis of the alternative LOS structure Gal ⁇ 1 ⁇ 4Gal ⁇ 1 ⁇ 4Glc ⁇ 1 ⁇ 4Hep ⁇ R.
  • Abbreviations used throughout this specification include: Lipopolysaccharide, LPS; Lipooligosaccharide, LOS; N-Acetyl-neuraminic acid cytidine mono phosphate, CMP-NANA; wild type, wt; Gal, galactose; Glc, glucose; NAc, N-acetyl (e.g., GalNAc or GlcNAc).
  • a cell has been “transformed” by exogenous or heterologous DNA when such DNA has been introduced inside the cell; the cell may express a gene or genes encoded by such DNA.
  • the transforming DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell, or may be contained on an autonomous replicon. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a “clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a “nucleic acid molecule” refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; “RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecules”) in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
  • this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes.
  • sequences may be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
  • a “recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • a nucleic acid molecule is “hybridizable” to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al., 1989, supra). The conditions of temperature and ionic strength determine the “stringency” of the hybridization. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible.
  • the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T m for hybrids of nucleic acids having those sequences.
  • the relative stability (corresponding to higher T m ) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating T m have been derived (see Sambrook et al., supra, 9.50-9.51).
  • a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; more preferably at least about 15 nucleotides; most preferably the length is at least about 20 nucleotides.
  • a DNA “coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus.
  • a coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3′ to the coding sequence.
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding sequence in a host cell.
  • the individual genes encoding glycosyltransferases of the invention are found in a single locus with very short non-coding sequences between them, phase variation resulting in deletion of any of lgtA, lgtB, or lgtC does not preclude reinitiation of transcription at the downstream genes.
  • the locus provided herein includes transcription initiation sequences for transcription in Neisseria.
  • the coding sequences of the invention can be engineered for expression under control of heterologous control sequences.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3′ direction) coding sequence.
  • the promoter sequence is bounded at its 3′ terminus by the transcription initiation site and extends upstream (5′ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eukaryotic promoters will often, but not always, contain “TATA” boxes and “CAT” boxes.
  • a coding sequence is “under the control” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
  • a “signal sequence” can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that directs the host cell to translocate the polypeptide to the cell surface or to organelles within the cell, or secrete the polypeptide into the media, and this signal peptide is usually selectively cleaved by the protein transport machinery. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.
  • Incorporation of a signal sequence may be desirable for high level expression of a glycosyltransferase of the invention by bacteria, yeast, insect cells (baculovirus), or eukaryotic cells, to avoid affecting endogenous glycosyltransfer in the host cell.
  • a molecule is “antigenic” when it is capable of specifically interacting with an antigen recognition molecule of the immune system, such as an immunoglobulin (antibody) or T cell antigen receptor.
  • an antigen recognition molecule of the immune system such as an immunoglobulin (antibody) or T cell antigen receptor.
  • an antigen recognition molecule of the immune system such as an immunoglobulin (antibody) or T cell antigen receptor.
  • an antigen recognition molecule of the immune system such as an immunoglobulin (antibody) or T cell antigen receptor.
  • an antigen recognition molecule of the immune system such as an immunoglobulin (antibody) or T cell antigen receptor.
  • the carbohydrate (oligosaccharide) moiety of the LOS of Neisseria is an important antigenic determinant, which determines serotype of meningococcus (Zollinger and Mandrell, 1977, Infect. Immun. 18:424; Zollinger and Mandrell, 1980, Infect. Immun. 28:
  • An antigenic portion of a molecule can be that portion that is immunodominant for antibody, or it can be a portion used to generate an antibody to the molecule by conjugating the antigenic portion to a carrier molecule for immunization.
  • a molecule that is antigenic need not be itself immunogenic, i.e., capable of eliciting an immune response without a carrier.
  • a composition comprising “A” (where “A” is a single protein, DNA molecule, vector, etc.) is substantially free of “B” (where “B” comprises one or more contaminating proteins, DNA molecules, vectors, etc.) when at least about 75% by weight of the proteins, DNA, vectors (depending on the category of species to which A and B belong) in the composition is “A”.
  • “A” comprises at least about 90% by weight of the A+B species in the composition, most preferably at least about 99% by weight. It is also preferred that a composition, which is substantially free of contamination, contain only a single molecular weight species having the activity or characteristic of the species of interest.
  • phrases “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions.
  • Pharmaceutically acceptable compositions of the invention are free of amounts of lipid A effective to cause a response in a mammalian subject, in particular a human subject.
  • adjuvant refers to a compound or mixture that enhances the immune response to an antigen.
  • An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifically enhances the immune response (Hood et al., Immunology, Second Ed., 1984, Benjamin/Cummings: Menlo Park, Calif., p. 384).
  • a primary challenge with an antigen alone, in the absence of an adjuvant will fail to elicit a humoral or cellular immune response.
  • Adjuvants include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG ( bacille Calmette - Guerin ) and Corynebacterium parvum.
  • the adjuvant is pharmaceutically acceptable.
  • the present invention provides the full length coding sequence of the LOS locus of Neisseria, and thus, allows for obtaining any one or all five genes, termed herein lgt genes, encoding glycosyltransferases characteristic of that locus.
  • lgt genes Any Neisseria bacterial cell can potentially serve as the nucleic acid source for the molecular cloning of an lgt gene.
  • the genes are isolated from Neisseria gonorrhoeae.
  • the DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA “library”), by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell (See, for example, Sambrook et al., 1989, supra; Glover, D. M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II). For example, a N.
  • gonorrhoeae genomic DNA can be digested with a restriction endonuclease or endonucleases, e.g., Sau3A, into a phage vector digested with a restriction endonuclease or endonucleases, e.g., BamHI/EcoRI, for creation of a phage genomic library.
  • a restriction endonuclease or endonucleases e.g., Sau3A
  • a phage vector digested with a restriction endonuclease or endonucleases e.g., BamHI/EcoRI
  • DNA fragments are generated, some of which will encode the desired gene.
  • the DNA may be cleaved at specific sites using various restriction enzymes.
  • DNAse in the presence of manganese to fragment the DNA, or the DNA can be physically sheared, as for example, by sonication.
  • the linear DNA fragments can then be separated according to size by standard techniques, including but not limited to, agarose and polyacrylamide gel electrophoresis and column chromatography.
  • the generated DNA fragments may be screened by nucleic acid hybridization to the labeled probe synthesized with a sequence as disclosed herein (Benton and Davis, 1977, Science 196:180; Grunstein and Hogness, 1975, Proc. Natl. Acad. Sci. U.S.A. 72:3961). Those DNA fragments with substantial homology to the probe will hybridize.
  • the present invention provides specific examples of DNA fragments that can be used as hybridization probes for glycosyltransferases, e.g., SEQ ID NO:1.
  • the presence of the gene may be detected by assays based on the physical, chemical, or immunological properties of its expressed product.
  • the putative lgt gene can be mutated, and its role as a glycosyltransferase established by detecting a variation in the structure of the oligosaccharide of LOS.
  • Alternatives to isolating the lgt genomic DNA include, but are not limited to, chemically synthesizing the gene sequence itself from a known sequence that encodes an Lgt, e.g., as shown in SEQ ID NO:1.
  • DNA for an lgt gene can be isolated PCR using oligonucleotide primers designed from the nucleotide sequences disclosed herein. Other methods are possible and within the scope of the invention.
  • the identified and isolated gene can then be inserted into an appropriate cloning vector.
  • vector-host systems known in the art may be used. Possible vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used. In a specific aspect of the invention, the lgt coding sequence is inserted in an E. coli cloning vector.
  • vectors include, but are not limited to, bacteriophages such as lambda derivatives, or plasmids such as pBR322 derivatives or pUC plasmid derivatives, e.g., pGEX vectors, pmal-c, pFLAG, etc.
  • the insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini.
  • the ends of the DNA molecules may be enzymatically modified.
  • any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences.
  • PCR primers containing such linker sites can be used to amplify the DNA for cloning.
  • Recombinant molecules can be introduced into host cells via transformation, transfection, infection, electroporation, etc., so that many copies of the gene sequence are generated.
  • Transformation of host cells with recombinant DNA molecules that incorporate the isolated lgt gene or synthesized DNA sequence enables generation of multiple copies of the gene.
  • the gene may be obtained in large quantities by growing transformants, isolating the recombinant DNA molecules from the transformants and, when necessary, retrieving the inserted gene from the isolated recombinant DNA.
  • the present invention also relates to vectors containing genes encoding truncated forms of the enzyme (fragments) and derivatives of Lgt's that have the same functional activity as an Lgt.
  • fragments and derivatives related to an Lgt are within the scope of the present invention.
  • the fragment or derivative is functionally active, i.e., capable of mediating transfer of a sugar to an acceptor molecule.
  • Truncated fragments of the glycosyltransferases can be prepared by eliminating N-terminal, C-terminal, or internal regions of the protein that are not required for functional activity. Usually, such portions that are eliminated will include only a few, e.g., between 1 and 5, amino acid residues, but larger segments may be removed.
  • a glycosyltransferase fusion protein comprises at least a functionally active portion of a non-glycosyltransferase protein joined via a peptide bond to at least a functionally active portion of a glycosyltransferase polypeptide.
  • the non-glycosyltransferase sequences can be amino- or carboxy-terminal to the glycosyltransferase sequences. Expression of a fusion protein can result in an enzymatically inactive glycosyltransferase fusion protein.
  • a recombinant DNA molecule encoding such a fusion protein comprises a sequence encoding at least a functionally active portion of a non-glycosyltransferase protein joined in-frame to the glycosyltransferase coding sequence, and preferably encodes a cleavage site for a specific protease, e.g., thrombin or Factor Xa, preferably at the glycosyltransferase-non-glycosyltransferase juncture.
  • the fusion protein may be expressed in Escherichia coli.
  • Lgt derivatives can be made by altering encoding nucleic acid sequences by substitutions, additions or deletions that provide for functionally equivalent molecules. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as an lgt gene may be used in the practice of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of lgt genes that are altered by the substitution of different codons that encode the same amino acid residue within the sequence, thus producing a silent change.
  • the Lgt derivatives of the invention include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of an Lgt including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a conservative amino acid substitution.
  • one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration.
  • Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • Lgt derivatives and analogs of the invention can be produced by various methods known in the art (e.g., Sambrook et al., 1989, supra). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. In the production of the gene encoding a derivative or analog of Lgt, care should be taken to ensure that the modified gene remains within the same translational reading frame as the lgt gene, uninterrupted by translational stop signals, in the gene region where the desired activity is encoded.
  • the lgt nucleic acid sequence can be mutated un vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification.
  • Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site directed mutagenesis (Hutchinson, C., et al., 1978, J. Biol. Chem.
  • PCR techniques are preferred for site directed mutagenesis (see Higuchi, 1989, “Using PCR to Engineer DNA”, in PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70). It is notable in this regard that the lgtA, lgtB, and lgtC genes contain long poly-G stretches that are particularly susceptible to phase variation mutation.
  • the gene coding for an Lgt, or a functionally active fragment or other derivative thereof can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
  • An expression vector also preferably includes a replication origin.
  • the necessary transcriptional and translational signals can also be supplied by the native lgt gene and/or its flanking regions.
  • host-vector systems may be utilized to express the protein-coding sequence.
  • a bacterial expression system is used to provide for high level expression of the protein with a higher probability of the native conformation.
  • Potential host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.
  • virus e.g., vaccinia virus, adenovirus, etc.
  • insect cell systems infected with virus e.g., baculovirus
  • microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.
  • the expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used.
  • the periplasmic form of the Lgt (containing a signal sequence) is produced for export of the protein to the Escherichia coli periplasm or in an expression system based on Bacillus subtillis.
  • any of the methods previously described for the insertion of DNA fragments into a vector may be used to construct expression vectors containing a chimeric gene consisting of appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination).
  • expression of nucleic acid sequence encoding an glycosyltransferase or peptide fragment may be regulated by a second nucleic acid sequence so that the glycosyltransferase or peptide is expressed in a host transformed with the recombinant DNA molecule.
  • expression of an glycosyltransferase may be controlled by any promoter/enhancer element known in the art, but these regulatory elements must be functional in the host selected for expression.
  • bacterial promoters are required for expression in bacteria.
  • Eukaryotic viral or eukaryotic promoters are preferred when a vector containing an lgt gene is injected directly into a subject for transient expression, resulting in heterologous protection against bacterial infection, as described in detail below.
  • Promoters which may be used to control lgt gene expression include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl.
  • Expression vectors containing lgt gene inserts can be identified by four general approaches: (a) PCR amplification of the desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of “marker” gene functions, and (d) expression of inserted sequences.
  • the nucleic acids can be amplified by PCR with incorporation of radionucleotides or stained with ethidium bromide to provide for detection of the amplified product.
  • the presence of a foreign gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted lgt gene.
  • the recombinant vector/host system can be identified and selected based upon the presence or absence of certain “marker” gene functions (e.g., ⁇ -galactosidase activity, PhoA activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector. If the lgt gene is inserted within the marker gene sequence of the vector, recombinants containing the lgt insert can be identified by the absence of the marker gene function.
  • marker gene functions e.g., ⁇ -galactosidase activity, PhoA activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.
  • recombinant expression vectors can be identified by assaying for the activity of the lgt gene product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of the lgt gene product in in vitro assay systems, e.g., glycosyltransferase activity. Once a suitable host system and growth conditions are established, recombinant expression vectors can be propagated and prepared in quantity.
  • the glycosyltransferases of the present invention can be used in the biosynthesis of oligosaccharides.
  • the glycosyltransferases of the invention are capable of stereospecific conjugation of a specific activated saccharide unit to a specific acceptor molecule.
  • Such activated saccharides generally consist of uridine, guanosine, and cytidine diphosphate derivatives of the saccharides, in which the nucleoside diphosphate serves as a leaving group.
  • the activated saccharide may be a saccharide-UDP, a saccharide-GDP, or a saccharide-CDP.
  • the activated saccharide is UDP-GlcNAC, UDP-GalNAc, or UDP-Gal.
  • acceptor molecule refers to the molecule to which the glycosyltransferase transfers an activated sugar.
  • synthesis of carbohydrates proceeds by sequential coupling of sugar residues to a lipid, e.g., dolichol phosphate.
  • a lipid e.g., dolichol phosphate.
  • the oligosaccharide or polysaccharide is transferred from the activated lipid carrier to the polypeptide on the luminal side of the endoplasmic reticulum.
  • the carbohydrate can be synthesized directly on a lipid A molecule.
  • the acceptor molecule, or carrier contains a lipid, preferably a polyisoprenoid alcohol lipid such as dolichol phosphate.
  • lipid A is not useful as a carrier for direct administration of the resulting oligosaccharide to a subject, e.g., as a vaccine preparation, it may be appropriate for use with a labile linkage for subsequent cleavage (under mild conditions) and separation of the oligosaccharide from the lipid carrier.
  • glycosyltransferases will only work efficiently to add a specific activated saccharide to a saccharide residue on the acceptor molecule that corresponds to the natural acceptor molecule.
  • LgtE catalyzes transfer of Gal to Glc ⁇ 1 ⁇ 4Hep.
  • the nature of the Glc residue (whether it is attached directly or indirectly to the carrier, for example) will affect the reaction efficiency. It is unlikely that efficient synthesis can occur in the absence of a carrier, or using other than a lipid carrier. However, even inefficient synthesis may be desirable, and practice of the present invention is not limited to use of acceptor molecules containing lipids, but extends to saccharides, polysaccharides, polypeptides, glycoproteins, and the like.
  • a glycosyltransferase is contacted with an appropriate activated saccharide and an appropriate acceptor molecule under conditions effective to transfer and covalently bond the saccharide to the acceptor molecule.
  • Conditions of time, temperature, and pH appropriate and optimal for a particular saccharide unit transfer can be determined through routine testing; generally, physiological conditions will be acceptable.
  • Certain co-reagents may also be desirable; for example, it may be more effective to contact the glycosyltransferase with the activated saccharide and the acceptor molecule in the presence of a divalent cation.
  • the glycosyltransferase enzymes can be covalently or non-covalently immobilized on a solid phase support such as SEPHADEX, SEPHAROSE, or poly(acrylamide-co-N-acryloxysucciimide) (PAN) resin.
  • a specific reaction can be performed in an isolated reaction solution, with facile separation of the solid phase enzyme from the reaction products. Immobilization of the enzyme also allows for a continuous biosynthetic stream, with the specific glycosyltransferases attached to a solid support, with the supports arranged randomly or in distinct zones in the specified order in a column, with passage of the reaction solution through the column and elution of the desired oligosaccharide at the end.
  • An oligosaccharide e.g., a disaccharide, prepared using a glycosyltransferase of the present invention can serve as an acceptor molecule for further synthesis, either using other glycosyltransferases of the invention, or glycosyltransferases known in the art (see, e.g., Roth, U.S. Pat. No. 5,180,674, and Roth, International Patent Publication No. WO 93/13198, published Jul. 8, 1993, each of which is incorporated herein by reference in its entirety).
  • the oligosaccharide compositions of the invention are useful in a wide variety of therapeutic and diagnostic applications.
  • the saccharide compositions can be used as blocking agents for cell surface receptors in the treatment of numerous diseases involving cellular adhesion.
  • saccharide compositions useful as nutritional supplements, antibacterials, anti-metastases agents, anti-inflammatory agents (e.g., for binding to inflammatory-associated lectins or cell surface receptors), to mention but a few, are contemplated by the instant invention.
  • the glycosyltransferases of the invention can be used in conjunction with other glycosyltransferases known in the art or to be discovered to synthesize complex oligosaccharides or polysaccharides.
  • the glycosyltransferases of the invention can be used to synthesize oligosaccharides representative of the oligosaccharides found on various strains of Neisseria. For example, by deleting open reading frames from the locus, or by selecting only a few of the glycosyltransferases of the invention for synthesis, alternative oligosaccharide structures can be prepared. These can be used in vaccine preparations effective against Neisseria variants, in particular, subunit vaccines against gonococcus and meningococcus.
  • the glycosyltransferases of the present invention can be used to prepare oligosaccharides corresponding to oligosaccharides associated with human glycolipids.
  • the present invention provides for synthesis of an oligosaccharide corresponding to lacto-N-neotetraose of the sphingolipid paragloboside; an oligosaccharide that mimics gangliosides; and a mimic of the saccharide portion of globoglycolipids, which is the structure characteristically found in Neisseria meningitidis immunotype L1.
  • the oligosaccharides of the present invention correspond to the core oligosaccharides of the blood group antigens, and therefore have great utility in the preparation of such blood group antigens for diagnostic or therapeutic purposes.
  • a method for preparing an oligosaccharide having the structure GalNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4Glc comprises sequentially performing the steps of:
  • d contacting a reaction mixture comprising an activated GalNAc to the acceptor moiety comprising a Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:5, or a functionally active fragment thereof.
  • a method for preparing an oligosaccharide having the structure Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4Glc comprises sequentially performing the steps of:
  • a method for preparing an oligosaccharide having the structure Gal ⁇ 1 ⁇ 4Gal ⁇ 1 ⁇ 4Glc comprises sequentially performing the steps of:
  • Such oligosaccharides can be prepared using lipid A as a carrier.
  • lipid A a carrier for oligosaccharides.
  • a non-toxic lipid such as dolichol phosphate, is used as the carrier.
  • Active immunity against Neisseria strains can be induced by immunization (vaccination) with an immunogenic amount of an oligosaccharide prepared according to the present invention in admixture with an adjuvant, wherein the oligosaccharide is the antigenic component of the vaccine.
  • the oligosaccharide is conjugated to a carrier protein.
  • the antigen is a glycolipid, it can be incorporated in a liposome.
  • oligosaccharide alone cannot cause bacterial infection, although the oligosaccharide on lipid A is toxic, and the active immunity elicited by vaccination according to the present invention can result in immediate immune response.
  • an adjuvant depends on the subject to be vaccinated.
  • a pharmaceutically acceptable adjuvant is used.
  • a vaccine for a human should avoid oil or hydrocarbon emulsion adjuvants, including complete and incomplete Freund's adjuvant.
  • an adjuvant suitable for use with humans is alum (alumina gel).
  • a vaccine of the invention i.e., a vaccine comprising an oligosaccharide corresponding to an antigenic determinant on a strain of Neisseria
  • Administration of an amount of a Neisseria oligosaccharide sufficient to inhibit adhesion of the bacterium to its target cell may also be effective for treating meningococcal or gonococcal infection.
  • the required amount can be determined by one of ordinary skill using standard techniques.
  • the present invention further contemplates transforming a host cell with a glycosyltransferase or glycosyltransferases of the invention. It is expected that expression of the glycosyltransferase, possibly in a cell lacking one or more endogenous glycosyltransferases, may result in novel glycosylation of lipids and proteins in such eukaryotic cells, and novel glycosylation of lipids in procaryotic cells.
  • transformation of a bacterium with non-toxic lipid molecules may provide for expression of Neisseria oligosaccharides on such a bacterium, which can then be used directly in a whole cell vaccine.
  • glycosyl transferase in yeast, insect, or mammalian cell lines may result in novel glycosylation of lipids and proteins expressed by these cells.
  • oligosaccharides can be used in vaccines, so to they can be used to generate antibodies to themselves, which antibodies, in turn, can be used to detect that particular strain of bacteria or for passive immunity.
  • Antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library.
  • Various procedures known in the art may be used for the production of polyclonal antibodies to oligosaccharide.
  • various host animals can be immunized by injection with the oligosaccharide, including but not limited to rabbits, mice, rats, sheep, goats, etc.
  • the oligosaccharide can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH).
  • an immunogenic carrier e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH).
  • BSA bovine serum albumin
  • KLH keyhole limpet hemocyanin
  • Various adjuvants may be used to increase the immunological response, depending on the host species.
  • any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used.
  • monoclonal antibodies can be produced in germ-free animals utilizing recent technology (PCT/US90/02545).
  • human antibodies may be used and can be obtained by using human hybridomas (Cote et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pp. 77-96).
  • human hybridomas Cote et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030
  • EBV virus Cold-d Antibodies
  • chimeric antibodies Manton et al., 1984, J. Bacteriol.
  • 4,946,778 can be adapted to produce oligosaccharide-specific single chain antibodies.
  • An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al., 1989, Science 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for an oligosaccharide, or its derivatives, or analogs.
  • Antibody fragments which contain the idiotype of the antibody molecule can be generated by known techniques.
  • such fragments include but are not limited to: the F(ab′) 2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab′ fragments which can be generated by reducing the disulfide bridges of the F(ab′) 2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
  • screening for the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), “sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.
  • radioimmunoassay e.g., ELISA (enzyme-linked immunosorbant assay), “sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoa
  • antibody binding is detected by detecting a label on the primary antibody.
  • the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
  • the secondary antibody is labeled.
  • Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. For example, to select antibodies which recognize a specific oligosaccharide, one may assay generated hybridomas for a product which binds to an oligosaccharide containing such epitope. For selection of an antibody specific to an oligosaccharide from a particular species or strain of Neisseria, one can select on the basis of positive binding with oligosaccharide expressed by or isolated from cells of that species or strain.
  • the foregoing antibodies can be used in methods known in the art relating to the localization and activity of the oligosaccharide, e.g., for Western blotting, imaging oligosaccharide in situ, measuring levels thereof in appropriate physiological samples, etc.
  • Diagnosis of infection with a Gram positive bacterium can use any immunoassay formal known in the art, as desired.
  • the antibodies can be labeled for detection in vitro, e.g., with labels such as enzymes, fluorophores, chromophores, radioisotopes, dyes, colloidal gold, latex particles, and chemiluminescent agents.
  • the antibodies can be labeled for detection in vivo, e.g., with radioisotopes (preferably technetium or iodine); magnetic resonance shift reagents (such as gadolinium and manganese); or radio-opaque reagents.
  • the nucleic acids and sequences thereof of the invention can be used in the diagnosis of infection with Neisseria, in particular, to identify a particular strain, or to determine which, if any, of the glycosyltransferase genes are mutated.
  • the lgt genes or hybridizable fragments thereof can be used for in situ hybridization with a sample from a subject suspected of harboring an infection of Neisseria bacteria.
  • specific gene segments of a Neisseria can be identified using PCR amplification with probes based on the lgt genes of the invention.
  • the hybridization with a probe or with the PCR primers can be performed under stringent conditions, or with a sequence specific for a unique strain or a limited number of strains of the bacterium, or both, thus allowing for diagnosis of infection with that particular strain (or strains).
  • the hybridization can be under less stringent conditions, or the sequence may be homologous in any or all strains of a bacterium, thus allowing for diagnosis of infection with that species.
  • This Example describes a locus in Neisseria gonorrhoeae strain F62 containing five genes.
  • Four of the genes are responsible for the sequential addition of the GalNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4 to the substrate Glc ⁇ 1 ⁇ 4Hep ⁇ R of the inner core region (Yamasaki et al., 1991, Biochemistry 30:10566).
  • the fifth gene is involved with the addition of the ⁇ -linked galactose residue in the biosynthesis of the alternative LOS structure Gal ⁇ 1 ⁇ 4Gal ⁇ 1 ⁇ 4Hep ⁇ R (John et al., 1991, J. Biol. Chem. 266:19303).
  • three of the LOS biosynthetic enzymes are potentially susceptible to premature termination by reading-frame changes, as has been reported for the gonococcal pilC genes (Jonsson et al., 1991, EMBO J. 10:477; Rudel et al., 1992, Molec. Microbiol. 6:3439). It is likely that these structural features are responsible for the high-frequency genetic variation of gonococcal LOS (Schneider et al., 1988, Infect. Immun. 56:942).
  • E. coli strains were grown in solid or liquid LB medium (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor); antibiotics were added as applicable. Carbenicillin was used at 50 ⁇ g/ml and erythromycin at 200 ⁇ g/ml.
  • Neisseria gonorrhoeae strain F62 was grown on GC agar (Swanson, 1978, Infect. Immun. 19:320) or GC agar containing 2 ⁇ g/ml erythromycin.
  • gonococci were grown in 1.5% proteose peptone broth (Difco Laboratories, Detroit Mich.), 30 mM phosphate, 8.5 mM NaCl supplemented with 1% isovitalex (Becton Dickinson Microbiology Systems, Cockeysville, Md.).
  • Plasmids were purified using either Qiagen columns or the QIAprep spin columns obtained from Qiagen Inc. (Chatsworth, Calif.). Digestion with restriction enzymes, gel electrophoresis, ligations with T4 DNA polymerase and transformation of E. coli were done according to Sambrook et al. (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor). Southern hybridization was performed on Hybond N+ membranes Amersham Co. (Arlington Heights, Ill.) with DNA labeled using the ECL kit from Amersham Co. Genomic DNA was isolated as described by Moxon et al. (Moxon et al., 1984, J. Clin. Invest. 73:298).
  • a gene bank of Neisseria gonorrhoeae strain F62 genomic DNA was constructed by ligating ca 20 kb fragments obtained by incomplete digestion with Sau3A into BamHI/EcoRI digested ⁇ 2001 (Karn et al., 1984, Gene 32:217).
  • the phage library was screened by hybridization with random-prime-labeled plasmid pR10PI, and 5 clones were isolated by plaque purification. The phage from these clones were purified by sedimentation followed by flotation on CsCl (Davis et al., 1980, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), and the DNA was isolated.
  • the insertion and deletions shown in FIG. 6 were constructed as follows. I1, I3, ⁇ 1 and ⁇ 2 used plasmid pPstCla cut respectively with BsaBI, AscI, StyI and double cut with StyI and BsaBI. I2 and ⁇ 3 used plasmid p3400 cut with AgeI or StyI. The complete locus was assembled by cloning the ClaI-ApaI fragment from p3400 into pPstCla cut with ClaI and ApaI, and the plasmid was called pLOS5. Deletions ⁇ 4 and ⁇ 5 were constructed using pLOS5 and digestion with StyI and BbsI or with StyI alone.
  • the cut plasmids were treated with the Klenow fragment of E. coli DNA polymerase to blunt the ends, and ermC′ (erythromycin resistance marker) was inserted.
  • the ermC′ gene was isolated from plasmid pIM13 (Projan et al., 1987, J. Bacteriol. 169:5131) as a ClaI-HindIII fragment and cloned into the same sites in plasmid pHSS6 (Seifert et al., 1986, Proc. Natl. Acad. Sci. USA 83:735). From this plasmid it was excised as a NotI fragment, the ends blunted by treatment with Klenow fragment of DNA polymerase, purified by gel electrophoresis and recovery with Geneclean II.
  • Transformation of piliated Neisseria gonorrhoeae strain F62 was performed with plasmids isolated from E. coli (Klugman et al., 1989, Infect. Immun. 57:2066) and the transformants selected on GC agar (Swanson, 1978, Infect. Immun. 19:320) containing 2 ⁇ g/ml erythromycin.
  • the fidelity of the genomic alteration of each of the gonococcal transformants was verified by sequencing the upstream and downstream junctions of the ermC′ gene in their genomic DNA using a PCR technique.
  • Two 5′ biotinylated primers, GCCGAGAAAACTATTGGTGGA SEQ. ID.
  • AAAACATGCAGGAATTGACGAT (SEQ. ID. NO:8), were synthesized; these were based on the ermC′ sequence near its upstream and its downstream end respectively.
  • the primers were designed such that their 3′ ends pointed outward from the ermC′ gene. Each of these primers was used together with a suitable primer matching the sequence of the LOS locus near the putative insertion.
  • PCR was performed according the instructions supplied with the GeneAmp PCR Reagent Kit from Perkin Elmer (Branchburg, N.J.) using 25 cycles. In all instances the expected size product was obtained. The DNA sequence of these products was determined by purifying the PCR product on magnetic streptavidin beads from Dynal, Inc.
  • the strips were washed thrice in the same buffer containing 1% gelatin.
  • the strips were treated for 2 h with monoclonal antibodies diluted in blocking buffer.
  • the antibodies available as ascites fluids were diluted ⁇ fraction (1/1000) ⁇ , antibodies available as tissue culture supernatants ⁇ fraction (1/10) ⁇ .
  • the strips were washed, incubated for 60 min with a ⁇ fraction (1/1000) ⁇ dilution of phosphatase-conjugated anti-IgG,IgA,IgM from Cappel (Organon Teknika Co., West Chester, Pa.), washed and stained as described previously (Blake et al., 1984, Analyt. Biochem. 136:175).
  • a ⁇ 2001 bank of Neisseria gonorrhoeae strain F62 DNA was screened by hybridization with pR10PI and 5 clones were isolated.
  • One of these clones when digested with either Cal or BfaI and examined by Southern hybridization using pR10PI as the probe, gave rise to a pattern identical to that seen with genomic DNA.
  • the appropriate ClaI fragments of this ⁇ 2001 clone were isolated and cloned into the ClaI site of pBluescript II SK ⁇ . The entire sequence of the 3400 ClaI fragment was determined.
  • 16 bp following the stop codon of the tRNA synthetase is the beginning of a stem loop structure followed closely by a consensus ribosome binding site (rbs), and within 6 bp is a TTG believed to be the initiation codon of lgtA.
  • 2871 bp downstream from the beginning of the stem loop (closely following the stop codon of lgtC) there is an almost perfect repeat of the stem loop structure, the rbs and the TTG initiation codon of lgtD with the downstream sequence strongly homologous for about 500 bp. The sequences then diverge to some extent.
  • the lgtC sequence interposed between the repeated portions of the locus is not repeated within the locus or in the Neisseria gonorrhoeae genome (data not shown). It appears to be homologous to E. coli rfaI or rfaJ genes, which are very closely related genes that serve as glucosyl transferases in core LPS biosynthesis (Pradel et al., 1992, J. Bacteriol. 174:4736). The similarity of rfaI with lgtC is illustrated in FIG. 5.
  • LOS phenotype of Neisseria gonorrhoea F62 with deletions of the LOS locus In order to define the function of the lgt genes, insertions or deletions of the LOS locus were constructed in plasmids propagated in E. coli . The insertions or deletions in each case were marked with the ermC′ gene, which is an excellent selective marker in Neisseria gonorrhoeae (Klugman et al., 1989, Infect. Immun. 57:2066). The constructions are summarized in FIG. 6. I1, I2 and I3 refer to insertions of the ermC′ marker into, respectively, a BsaBI, AgeI and AscI site.
  • the deletions were constructed by excising portions of the plasmids and substituting the erythromycin marker.
  • the open arrows indicate the gene or genes disrupted.
  • Each of these plasmids was used to transform Neisseria gonorrhoeae strain F62 and transformants were selected on erythromycin-containing plates.
  • the fidelity of the genomic alteration of a prototype of each of the gonococcal transformants was verified by sequencing the upstream and downstream junction of the ermC′ gene. To simplify the nomenclature in this report the gonococcal mutants have been given the same names used to identify the plasmid constructs in FIG. 6.
  • the LOS of the mutants were examined by SDS-PAGE and compared to the LOS of strain 1291e.
  • This strain was originally isolated by Dudas and Apicella (Dudas and Apicella, 1988, Infect. Immun. 56:499) as a pyocin-resistant mutant of strain 1291 wild type and has been extensively characterized both chemically and genetically. Chemical analysis has shown that this mutant lacks completely the lacto-N-neotetraose substitution on heptose 1 (John et al., 1991, J. Biol. Chem. 266:19303). The genetic basis of this mutant has been defined (Zhou et al., 1994, J. Biol. Chem.
  • the LOS preparations were also studied using a dot blot technique for their reactivity with monoclonal antibodies.
  • the monoclonal antibodies employed and their reported specificities are shown in FIG. 1.
  • the reactions observed with the LOS obtained from the parental strain and the mutants are summarize in FIG. 8.
  • the reactivity of the parental F62 with 1-1-M, 3F11 and L8 was as reported previously by Mandrell et al (Mandrell et al., 1985, Amer. Soc. Microbiology, Washington 379-384) and by Yamasaki et al (Yamasaki et al., 1991, Mol. Immunol. 28:1233). Mutants ⁇ 4 and I2 fail to react with any of the antibodies.
  • ⁇ 5 gives a strong reaction with antibodies 4C4 and L8, indicating that the first galactose residue is present. This is in keeping with the SDS-PAGE results (see FIG. 6) and supports the role of lgtE as the galactosyl transferase. It also indicates that deletions upstream of lgtE do not significantly inactivate its function by polar effects.
  • the LOS of F62 wt parent has strong reactivity with L3 and weak reactivity with 3F11. It is known that reactivity 3F11 is occluded by the addition of the GalNAc residue (Schneider et al., J. Exp. Med. 174:1601); this is not the case with the L3 antibody.
  • the wt LOS reacts with 1-1-M, the antibody reactive when the terminal GalNAc residue is present.
  • the reactivity with 1-1-M is lost in ⁇ 3 which has a deletion only in lgtD. This suggest that this gene encodes the GalNAc transferase.
  • mutant ⁇ 3 encodes the ⁇ -Gal transferase. This is further supported by the weak reactivity of mutant ⁇ 3 with antibody L1.
  • Mutant ⁇ 3 has a deletion of lgtD and fails to add the terminal GalNAc, allowing the ⁇ -Gal transferase to modify the lacto-N-neotetraose group to produce a P i -like globoside (Mandrell, 1992, Infect. Immun. 60:3017).
  • Mutant I3 (with inactive lgtB) has lost reactivity with 1-1-M, 3F11 and L1, and remains only weakly reactive with L3.
  • a locus containing 5 open reading frames has been cloned.
  • the effect of eight defined mutations within this locus on the size and serological reactivity of the LOS produced by gonococcal transformants suggests that these genes are the glycosyl transferases responsible for the biosynthesis of most of the lacto-N-neotetraose chain.
  • the data obtained allow an identification of the function of each of these genes.
  • lgtB and lgtE which are structurally very closely related, also perform an apparently very similar biosynthetic task, i.e. the addition of Gal ⁇ 1 ⁇ 4 to GlcNAc or Glc, respectively.
  • lgtA and lgtD add, GalNAc or GlcNAc ⁇ 1 ⁇ 3, respectively, to a Gal residue.
  • lgtC which is unrelated to the other genes in the locus, is responsible for the addition of a Gal ⁇ 1 ⁇ 4.
  • LOS biosynthesis Three aspects of LOS biosynthesis appear potentially to be subject to high frequency variation. The first is the addition of the terminal GalNAc (lgtD). This would cause an alteration of reactivity with monoclonal antibody 1-1-M, and this phase variation has been reported by van Putten (Van Putten, 1993, EMBO J. 12:4043). Similarly, a change in lgtA would cause the failure of the addition of GlcNAc to the growing chain and truncate the LOS at the ⁇ -lactosyl level.
  • lgtD terminal GalNAc
  • variable addition of ⁇ 1 ⁇ 4Gal to either the ⁇ -lactosyl (p k -like globo-triose) or the lacto-N-neotetraose group (P i -like globoside) would be under the control of the expression of lgtC.
  • the activity of the lgtC transferase appears to compete poorly with the other transferases for precursor and its activity is evident only if either lgtA or lgtD are silent.
  • the GlcNAc transferase lgtA must be inactive and for expression of the P i -like globoside Gal ⁇ 1 ⁇ 4Gal ⁇ 1 ⁇ 4GlcNAc ⁇ 1 ⁇ 3Gal ⁇ 1 ⁇ 4Glc the GalNAc transferase lgtD must be silent.
  • the lic2 gene is homologous to lgtB and lgtE the galactosyl transferases which link Gal ⁇ 1 ⁇ 4 to respectively Glc or GlcNAc, it is likely that this is its function in Haemophilus influenzae LOS synthesis. It is remarkable that while both these mucosal pathogens have evolved frame shift mechanisms to cause antigenic variation of the LOS, that the gonococcal homologs of lic2, (lgtB and lgtE) are not the ones that contain poly-G tracts.
  • van Putten has shown that sialylation of LOS has a marked inhibitory effect on epithelial cell invasion, without apparently greatly altering adhesion (Van Putten, 1993, EMBO J. 12:4043). His studies suggest that in the mucosal infection, LOS structures that cannot be sialylated may be important for efficient cell invasion. In the context of this report, such structures could be achieved either by the efficient addition of the terminal GalNAc or by shortening the LOS chain by silencing the GlcNAc transferase. The correlation of LOS chemistry with biological reaction has been complicated by the leakiness of the existing LOS mutants isolated by pyocin selection (Dudas and Apicella, 1988, Infect. Immun.
  • mutant 1291e which shows in addition to the major low molecular weight band, an additional higher band (see FIG. 7).
  • the new insight provided into the genetics of the biosynthesis of gonococcal LOS will allow construction of mutants that are not leaky. For instance, ⁇ 4 and ⁇ 5 should be stable mutants since they no longer contain genes with poly-G tracts. The expression of the genes containing the poly-G tracts could be stabilized by engineering the areas so that glycines are encoded by other codons.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Saccharide Compounds (AREA)

Abstract

The present invention is directed to nucleic acids encoding glycosyltransferases, the proteins encoded thereby, and to methods for synthesizing oligosaccharides using the glycosyltransferases of the invention. In particular, the present application is directed to identification a glycosyltransferase locus of Neisseria gonorrhoeae containing five open reading frames for five different glycosyltransferases. The functionally active glycosyltransferases of the invention are characterized by catalyzing reactions such as adding Gal β1→4 to GlcNAc or Glc; adding GalNAc or GlcNAc β1→3 to Gal; and adding Gal α1→4 to Gal. The glycosyltransferases of the invention are particularly suited to the synthesis of the oligosaccharides Galβ1→4GlcNAcβ1→3Galβ1→4Glc (a mimic of lacto-N-neotetraose), GalNAcβ1→3Galβ1→4GlcNAcβ1→3Galβ1→4Glcβ1→4 (a mimic ganglioside), and Galβ1→4Galβ1→4Glcβ1→4Hep→R (a mimic of the saccharide portion of globo-glycolipids).

Description

  • [0001] The research leading to the present invention was supported in part with funds from grant number AI-10615 from the Public Health Service. Accordingly, the Government may have certain rights in the invention.
    • FIELD OF THE INVENTION
  • The present invention relates to glycosyltransferases useful for biosynthesis of oligosaccharides, genes encoding such glycosyltransferases and recombinant methods of producing the enzymes, and the oligosaccharides produced thereby. [0002]
    • BACKGROUND OF THE INVENTION Neisseria and Lipo-Oligosaccharide (LOS)
  • While Neisseria species commonly colonize many mammalian hosts, human beings are the only species subject to invasive disease by members of this species. [0003] Neisseria meningitidis is the etiologic agent for septicemia and meningitis that may occur in epidemic form. Neisseria gonorrhoeae is the causative agent of gonorrhea and its manifold complications. These organisms, particularly the gonococcus, have proved remarkably adept at varying the antigenic array of their surface-exposed molecules, notably their adhesive pili and opacity-related (opa) proteins. The genetic mechanisms for the variation of pilus (Meyer et al., 1982, Cell 30:45; Haas and Meyer, 1986, Cell 44:107; Koomey et al., 1987, Genetics 117:391; Swanson and Koomey, 1989, American Society for Microbiology, Washington, 743-761) and opa protein (Stern et al., 1986, Cell 47:61; Meyer et al., 1990, Ann. Rev. Microbiol. 44:451; Bhat et al., 1991, Molec. Microbiol. 5:1889) expression are in the main well understood. Like other Gram-negative bacteria the Neisseria ssp. carry LPS in the external leaflet of their outer membranes (Johnston and Gotschlich, 1974, J. Bacteriol. 119;250). In contrast to the high molecular weight LPS molecules with repeating O-chains seen in many enteric bacteria, the LPS of Neisseria ssp. is of modest size and therefore is often referred to as lipooligosaccharide or LOS. Although the molecular size of the LOS is similar to that seen in rough LPS mutants of Salmonella ssp., this substance has considerable antigenic diversity. In the case of the meningococcus, a serological typing scheme has been developed that separates strains into 12 immunotypes (Zollinger and Mandrell, 1977, Infect. Immun. 18:424; Zollinger and Mandrell, 1980, Infect. Immun. 28:451). A remarkably complete understanding of the structure of meningococcal LPS (recently reviewed (Verheul et al., 1993, Microbiol. Rev. 57:34) has resulted from the studies of Jennings and his colleagues (Jennings et al., 1983, Carbohyd. Res. 121:233; Michon et al., 1990, J. Biol. Chem. 265:7243; Gamian et al., 1992, J. Biol. Chem. 267:922; Pavliak et al., 1993, J. Biol. Chem. 268:14146). In the case of Neisseria gonorrhoeae, antigenic variability is so pronounced that a serological classification scheme has proved elusive. In part this is due to the heterogeneity of LOS synthesized by a particular strain; LOS preparations frequently contain several closely spaced bands by SDS-PAGE (Mandrell et al., 1986, Infect. Immun. 54:63). Further, studies using monoclonal antibodies indicate, that gonococci are able to change the serological characteristics of the LOS they express and that this antigenic variation occurs at a frequency of 10−2 to 10−3, indicating that some genetic mechanism must exist to achieve these high frequency variations. (Schneider et al., 1988, Infect. Immun. 56:942; Apicella et al., 1987, Infect. Immun. 55:1755). Because of the molecular heterogeneity and antigenic variation of the LOS produced by gonococci the determination of the structural chemistry of this antigen has proved to be a difficult problem, and definitive information based on very sophisticated analyses has only recently become available (Yamasaki et al, 1991, Biochemistry 30:10566; Kerwood et al., 1992, Biochemistry 31:12760; John et al., 1991, J. Biol. Chem. 266:19303; Gibson et al., 1993, J. Bacteriol. 175:2702). These are summarized in FIG. 1. Of particular interest is the presence of the tetrasaccharide Galβ1→4GlcNAcβ1→3Galβ1→4Glcβ1→4, which is a perfect mimic of lacto-N-neotetraose of the sphingolipid paragloboside (Mandrell et al., 1988, J. Exp. Med. 168:107; Tsai and Civin, 1991, Infect. Immun. 59:3604). In LOS this tetrasaccharide frequently bears an additional N-acetyl galactosamine residue (GalNAcβ1→3Galβ1→4GlcNAcβ1→3Galβ1→4Glcβ1→4), and then mimics gangliosides. In some strains of gonococci an alternative side chain is found which has the structure Galα1→4Galβ1→4Glcβ1→4Hep→R (John et al., 1991, J. Biol. Chem. 266:19303). This is a mimic of the saccharide portion of globo-glycolipids (Mandrell, 1992, Infect. Immun. 60:3017), and is the structure characteristically found in Neisseria meningitidis immunotype L1.
  • The LOS molecules have a number of biological activities. They are potent endotoxic molecules believed to be the toxin responsible for adrenal cortical necrosis seen in severe meningococcal disease. They serve as the target antigen for much of the bactericidal activity present in normal or convalescent human sera (Rice et al., 1980, J. Immunol. 124:2105). Gonococci possess a very unusual sialyl transferase activity which is able to use externally supplied CMP-NANA and add N-acetyl neuraminic acid to the LOS on the surface of the organism (Nairn et al., 1988, J. Gen. Microbiol. 134:3295; Parsons et al., 1989, Microb. Pathog. 7:63; Mandrell et al., 1990, J. Exp. Med. 171:1649). Group B and C meningococci, have the capacity to synthesize CMP-NANA, and frequently sialylate their LOS without requiring exogenous CMP-NANA (Mandrell et al., 1991, J. Bacteriol. 173:2823). In [0004] Neisseria meningitidis strain 6275 immunotype L3, the sialic acid unit is linked α2→3 to the terminal Gal residue of the lacto-N-neotetraose (Yamasaki et al., 1993, J. Bacteriol. 175:4565). The levels of CMP-NANA found in various host environments is sufficient to support this reaction (Apicella et al., 1990, J. Infect. Dis. 162:506). The sialylation of the LOS causes gonococci to become resistant to the antibody-complement dependent bactericidal effect of serum (Parsons et al., 1989, Microb. Pathog. 7:63). The resistance is not only to the bactericidal effect mediated by antibodies to LOS, but to other surface antigens as well (Wetzler et al., 1992, Infect. Immun. 60:39). van Putten has demonstrated that exposure of gonococci to CMP-NANA markedly reduces their ability to invade epithelial cells in tissue culture (Van Putten, 1993, EMBO J. 12:4043). These findings strongly suggest that the ability of gonococci to vary the chemical nature of the LOS provides them with the ability to cope with different host environments (Mandrell and Apicella, 1993, Immunobiology 187:382).
  • Perhaps most telling, it has been found that LOS variation is selected in vivo in infections of human beings. A well characterized gonococcal laboratory strain MS11[0005] mk variant A was used to inoculate volunteers (Swanson et al., 1988, J. Exp. Med. 168:2121). In the two infected individuals over a period of 4 to 6 days the population of gonococci recovered in their urine increasingly shifted to two variants that expressed antigenically different LOS (Schneider et al., 1991, J. Exp. Med. 174:1601). A structural analysis revealed that the inoculated variant A produced a truncated LOS containing only the β-lactosyl group linked to Hep1, while one of the new variants (variant C) produced a complete LOS (Kerwood et al., 1992, Biochemistry 31:12760). This suggests that the addition of the additional sugars GalNAcβ1→3Galβ1→4GlcNAcβ1→3 is likely to be under control of a phase variation mechanism.
  • Little information on the genetics of LOS synthesis of in Neisseria is available. A major advance has been the creation (Dudas and Apicella, 1988, Infect. Immun. 56:499) and biochemical characterization (John et al., 1991, J. Biol. Chem. 266:19303) of five pyocin mutants of gonococcal strain 1291, dubbed 1291a-e. Immunological and biochemical data have shown that 1291a, 1291c, 1291d and 1291e produce LOS with sequential shortening of the lacto-N-neotetraose chain, with mutant 1291e lacking the glucose substitution on the heptose. Mutant 1291b synthesizes the alternative LOS structure Galα1→4Galβ1→4Glc (see FIG. 1). Only the genetic basis of the 1291e mutant is now defined. It is a mutation of phosphoglucomutase (pgm), which precludes the synthesis of UDP-glucose, and hence the addition of the first residue of the lacto-N-neotetraose unit (Zhou et al., 1994, J. Biol. Chem. 269:11162; Sandlin and Stein, 1994, J. Bacteriol. 176:2930). It also has been shown that galE mutants of meningococcus or gonococcus produce truncated LOS in keeping with the inability to synthesize UDP-galactose (Robertson et al., 1993, Molec. Microbiol. 8:891; Jennings et al., 1993, Molec. Microbiol. 10:361). [0006]
    • Biosynthesis of Oligosaccharides
  • Oligosaccharides are polymers of varying number of residues, linkages, and subunits. The basic subunit is a carbohydrate monosaccharide or sugar, such as mannose, glucose, galactose, N-acetylglucosamine, N-acetylgalactosamine, and the like. The number of different possible stereoisomeric oligosaccharide chains is enormous. [0007]
  • Oligosaccharides and polysaccharides play an important role in protein function and activity, by serving as half-life modulators, and, in some instances, by providing structure. As pointed out above, oligosaccharides are critical to the antigenic variability, and hence immune evasion, of Neisseria, especially gonococcus. [0008]
  • Numerous classical techniques for the synthesis of carbohydrates have been developed, but these techniques suffer the difficulty of requiring selective protection and deprotection. Organic synthesis of oligosaccharides is further hampered by the lability of may glycosidic bonds, difficulties in achieving regio-selective sugar coupling, and generally low synthetic yields. In short, unlike the experience with peptide synthesis, traditional synthetic organic chemistry cannot provide for quantitative, reliable synthesis of even fairly simple oligosaccharides. [0009]
  • Recent advances in oligosaccharide synthesis have occurred with the isolation of glycosyltransferases. These enzymes can be used in vitro to prepare oligosaccharides and polysaccharides (see, e.g., Roth, U.S. Pat. No. 5,180,674, issued Jan. 19, 1993). The advantage of biosynthesis with glycosyltransferases is that the glycosidic linkages formed by enzymes are highly stereo and regio-specific. However, each enzyme catalyzes linkage of specific sugar residues to other specific acceptor molecules, e.g., an oligosaccharide or lipid. Thus, synthesis of a desired oligosaccharide may be limited by the availability of glycosyltransferases (see, Roth, International Patent Publication No. WO 93/13198, published Jul. 8, 1993). [0010]
  • Another drawback of biosynthesis is that the glycosyltransferases themselves are usually present in fairly low quantities in cells. It is difficult to obtain enough of the enzyme to be commercially practicable. [0011]
  • Thus, there is a great need in the art for glycosyltransferases. There is a further need for genes encoding such glycosyltransferases, to provide an unlimited source of glycosyltransferases through recombinant technology. [0012]
  • The citation of any reference herein should not be construed as an admission that such reference is available as prior art to the instant invention. [0013]
    • SUMMARY OF THE INVENTION
  • The present invention is directed to nucleic acids encoding glycosyltransferases, the proteins encoded thereby, and to methods for synthesizing oligosaccharides using the glycosyltransferases of the invention. Accordingly, in one aspect, the invention is directed to a purified nucleic acid that is hybridizable under moderately stringent conditions to a nucleic acid corresponding to the LOS locus of Neisseria, e.g., a nucleic acid having a nucleotide sequence corresponding to or complementary to the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1). Preferably, the nucleic acid of the invention is hybridizable to a portion of the coding sequence for a gene of the LOS locus, i.e., a portion of the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1) that encodes a functionally active glycosyltransferase. [0014]
  • In specific embodiments, the invention relates to a nucleic acid that has a nucleotide sequence corresponding to or complementary to a portion of the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1) that encodes a functionally active glycosyltransferase. In a further aspect, the nucleic acid encodes a functionally active glycosyltransferase. In a specific embodiment, the invention is directed to a nucleic acid that has a nucleotide sequence corresponding to or complementary to the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1). [0015]
  • The functionally active glycosyltransferases of the invention are characterized by catalyzing a reaction selected from the group consisting of: [0016]
  • adding Gal β1→4 to GlcNAc or Glc; [0017]
  • adding GalNAc or GlcNAc β1→3 to Gal; and [0018]
  • adding Gal α1→4 to Gal. [0019]
  • Most preferably, the claimed nucleic acid encodes a functionally active glycosyltransferase. However, nucleic acids of the invention include oligonucleotides useful as primers for polymerase chain reaction (PCR) or for probes for the presence and level of transcription of a glycosyltransferase gene. [0020]
  • In specific embodiments, exemplified herein, the nucleic acid encodes a glycosyltransferase having an amino acid sequence of SEQ ID NO:2; SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. [0021]
  • The invention further relates to an expression vector comprising the nucleic acid encoding a glycosyltransferase of the invention operatively associated with an expression control sequence. Accordingly, the invention extends to recombinant host cell transformed with such an expression vector. [0022]
  • In another aspect, the invention is directed to a method for producing a glycosyltransferase comprising culturing the recombinant host cell under conditions that allow expression of the glycosyltransferase; and recovering the expressed glycosyltransferase. [0023]
  • In a primary aspect, the invention is directed to glycosyltransferase having an amino acid sequence of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, or a functionally active fragment thereof. The invention further contemplates a composition comprising a glycosyltransferase conjugated to a solid phase support, wherein the glycosyltransferase is selected from the group consisting of a glycosyltransferase having an amino acid sequence of SEQ ID NO:2, or a functionally active fragment thereof; a glycosyltransferase having an amino acid sequence of SEQ ID NO:3, or a functionally active fragment thereof; a glycosyltransferase having an amino acid sequence of. SEQ ID NO:4, or a functionally active fragment thereof; and a glycosyltransferase having an amino acid sequence of SEQ ID NO:5, or a functionally active fragment thereof; and a glycosyltransferase having an amino acid sequence of SEQ ID NO:6, or a functionally active fragment thereof. [0024]
  • Having provided novel glycosyltransferases, and genes encoding the same, the invention accordingly further provides methods for preparing oligosaccharides, e.g., two or more saccharides. In specific embodiments, the invention relates to a method for adding GalNAc or GlcNAc β1→3 to Gal, comprising contacting a reaction mixture comprising an activated GalNAc or GlcNAc to an acceptor moiety comprising a Gal residue in the presence of the glycosyltransferase having an amino acid sequence of SEQ ID NO:2; a method for adding Gal β1→4 to GlcNAc or Glc, comprising contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a GlcNAc or Glc residue in the presence of the glycosyltransferase having an amino acid sequence of SEQ ID NO:3; a method for adding Gal α1→4 to Gal, comprising contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Gal residue in the presence of the glycosyltransferase having an amino acid sequence of SEQ ID NO:4; a method for adding GalNAc or GlcNAc β1→3 to Gal, comprising contacting a reaction mixture comprising an activated GalNAc or GlcNAc to an acceptor moiety comprising a Gal residue in the presence of the glycosyltransferase having an amino acid sequence of SEQ ID NO:5; and a method for adding Gal β1→4 to GlcNAc or Glc, comprising contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a GlcNAc or Glc residue in the presence of the glycosyltransferase having an amino acid sequence of SEQ ID NO:6. [0025]
  • In a preferred embodiment, the oligosaccharides are prepared on a carrier that is non-toxic to a mammal, in particular a human, such as a lipid isoprenoid or polyisoprenoid alcohol. A specific example of such a carrier is dolichol phosphate. In a specific embodiment, the oligosaccharide is attached to the carrier via a labile bond, thus allowing for chemically removing the oligosaccharide from the lipid carrier. Alternatively, an oligosaccharide transferase can be used, e.g., to transfer the oligosaccharide from a lipid carrier to a protein. In yet another embodiment, the glycosyltransferases can be expressed in a eukaryotic expression system, to provide for glycosylation of a protein expressed in such a system. [0026]
  • An important advantage of the present invention is that it provides for the synthesis of oligosaccharide antigens of Neisseria independently of lipid A, which is highly toxic. Use of the natural LOS from Neisseria, while theoretically desirable for vaccine preparation, fails. The lipid A portion of LOS is a potent endotoxin, and highly toxic. Chemical treatment of the LOS, e.g., by hydrolysis, destroys the antigenicity of the oligosaccharide, leaving a useless product. Thus, it is highly desirable to have a source of Neisseria oligosaccharides attached to non-toxic lipids for vaccine preparation. [0027]
  • Thus, the invention provides glycosyltransferases and strategies for preparing a number of oligosaccharides, such as but not limited to, Galα1→4Galβ1→4Glc, Galβ1→4GlcNAcβ1→3Galβ1→4Glc, and GalNAcβ1→3Galβ1→4GlcNAcβ1→3Galβ1→4Glc. [0028]
  • Accordingly, it is a primary object of the invention to provide glycosyltransferases useful for the synthesis of oligosaccharides. [0029]
  • It is a further object of the invention to provide for the synthesis of oligosaccharides characteristic of [0030] Neisseria meningitidis and N. gonorrhoeae.
  • It is a further object of the invention to provide for the synthesis of oligosaccharides characteristic of mammalian oligosaccharides, including blood group core oligosaccharides. [0031]
  • It is still a further object of the invention to provide for vaccines having the oligosaccharide unit of LOS, but lacking lipid A. [0032]
  • Still a further object of the invention is to provide for synthesis of therapeutically useful oligosaccharides. [0033]
  • These and other objects of the present will be made clear by reference to the following Drawings and Detailed Description.[0034]
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1: Alternative structures found in gonococcal LOS. R1 refers to the inner core region of LOS consisting of two keto-deoxy-octulosonic acid (KDO) residues. These in turn are attached to a lipid A structure. R2 in gonococci is typically GlcNAcβ1→2Hepα1→3. The structure in the top panel contains a tetrasaccharide identical to lacto-N-neotetraose found in paragloboside glycolipids. In many strains this tetrasaccharide bears a terminal GalNAcβ1→3. The lower panel shows an alternative trisaccharide structure with the terminal Gal α1→4 linked. This trisaccharide is seen in meningococci of the L1 serotype and in some gonococcal strains. The portions of the two structures recognized by the monoclonal antibodies used in this study are indicated (4C4) (Dudas and Apicella, 1988, Infect. Immun. 56:499) 3F11 (Mandrell et al., 1988, J. Exp. Med. 168-107; Yamasaki et al., 1991, Mol. Immunol. 28:1233) 1-1-M (Yamasaki et al., 1991, Mol. Immunol. 28:1233), 2-1-L8 (Kerwood et al., 1992, Biochemistry 31:12760; Schneider et al., 1991, J. Exp. Med. 174:1601; Schneider et al., 1985, Infect. Immun; 50:672) 9-2-L378 and 17-1-L1. [0035]
  • FIG. 2: (A) Genetic map of the LOS locus based on the DNA sequence. Sequence information bp 1-2725 was obtained from plasmid pPstCla, bp 2725-5859 from plasmid p3400 (see materials and methods). IS refers to an area of the sequence that has homology to a previously reported neisserial insertion sequence IS1106 (Knight et al., 1992, Molec. Microbiol. 6:1565). The positions of the reading frames of lgtA-E are indicated. Three tracts of poly-G were found in lgtA (17 bp), lgtC (10 bp) and lgtD (11 bp) and are indicated by vertical black bars. (B) Amino acid sequences of LgtA (SEQ ID NO:2), LgtB (SEQ ID NO:3), LgtC (SEQ ID NO:4), LgtD (SEQ ID NO:5), and LgtE (SEQ ID NO:6), and the nucleotide sequence of the lgt locus (SEQ ID NO:1). [0036]
  • FIG. 3: Homology of the protein products of lgtA and lgtD. The primary structure of two proteins is very similar, particularly in the first half of the sequences. The glycine residues starting at position 86 reflect the coding of the poly-G regions in the respective genes. The Bestfit program of the GCG package was used and the symbols |, :, . represent degrees of similarity based on the Dayhoff PAM-250 matrix. [0037]
  • FIG. 4: Homology of the protein products of lgtB and lgtE. The primary structure of two proteins is very similar, particularly in the first half of the sequences. These sequences also have significant homology to lex-1 (Cope et al., 1991, Molec. Microbiol. 5:1113) or lic2A (High et al., 1993, Molec. Microbiol. 9:1275) genes of [0038] Haemophilus influenzae. For meaning of symbols see FIG. 3.
  • FIG. 5: Homology of the protein products of rfaI and lgtC. The [0039] E. coli rfaI and rfaJ genes are very closely related. They serve as glucosyl transferases of two glucose residues in the LPS core region (Pradel et al., 1992, J. Bacteriol. 174:4736). The glycines at position 54-56 in lgtC are encoded by the poly-G tract. For meaning of symbols see FIG. 3.
  • FIG. 6: Deletions in the LOS locus. Three insertion and five deletions of the LOS locus were constructed as detailed in the methods section. The restriction sites that were used are indicated. The insertions are marked by triangles and the extent of the deletions by stippled boxes. The open arrows indicate the open reading frames disrupted by the construction. In each of the constructs the erythromycin marker ermC′ was inserted at the site of the insertion or the deletion. [0040]
  • FIG. 7: Silver-stained SDS-PAGE of LOS preparations. Gel electrophoresis of purified LOS samples of 375 ng was performed and stained as described in materials and methods. Above the gel are indicated the structure of the LOS of the major bands inferred to be present in each of the preparations. These structures are based on the reactivity with monoclonal antibodies shown in FIG. 8, but are presented in this Figure to facilitate interpretation of the patterns observed. R stands for the inner core region and lipid A. 1291e is a pyocin resistant mutant (Dudas and Apicella, 1988, Infect. Immun. 56:499) [0041]
  • FIG. 8: Reactivity of LOS from strain F62 wt and mutants with monoclonal antibodies. The names of the following monoclonal antibodies were abbreviated: 17-1-L1 (L1), 9-2-L378 (L3), 2-1-L8 (L8). Purified LOS was applied to Immobilon-P membranes, allowed to react with the antibodies and developed as described in materials and methods. The specificity of the monoclonal antibodies is summarized in FIG. 1.[0042]
    • DETAILED DESCRIPTION OF THE INVENTION
  • As disclosed above, the present invention provides five novel glycosyltransferases, genes encoding the glycosyltransferases, and methods for biosynthesis of oligosaccharides using such glycosyltransferases. The glycosyl transferases of the invention can be used for in vitro biosynthesis of various oligosaccharides, such as the core oligosaccharide of the human blood group antigens, i.e., lacto-N-neotetraose. [0043]
  • Cloning and expression of glycosyltransferases of the invention can be accomplished using standard techniques, as disclosed herein. Such glycosyl transferases are useful for biosynthesis of oligosaccharides in vitro, or alternatively genes encoding such glycosyltransferases can be transfected into cells, e.g., yeast cells or eukaryotic cells, to provide for alternative glycosylation of proteins and lipids. [0044]
  • The instant invention is based, in part, on the discovery and cloning of a locus involved in the biosynthesis of gonococcal LOS has from gonococcal strain F62. The locus contains five open reading frames. The first and the second reading frames are homologous, but not identical to the fourth and the fifth reading frames respectively. Interposed is an additional reading frame which has distant homology to the [0045] E. coli rfaI and rfaJ genes, both glucosyl transferases involved in LPS core biosynthesis. The second-and the fifth reading frames show strong homology to the lex-1 or lic2A gene of Haemophilus influenzae, but do not contain the CAAT repeats found in this gene. Deletions of each of these five genes, of combinations of genes, and of the entire locus were constructed and introduced into parental gonococcal strain F62 by transformation. The LOS phenotypes were then analyzed by SDS-PAGE and reactivity with monoclonal antibodies. Analysis of the gonococcal mutants indicates that four of these genes are the glycosyl transferases that add GalNAcβ1→3Galβ1→4GlcNAcβ1→3Galβ1→4 to the substrate Glcβ1→4Hep→R of the inner core region. The gene with homology to E. coli rfaI/rfaJ is involved with the addition of the α-linked galactose residue in the biosynthesis of the alternative LOS structure Galα1→4Galβ1→4Glcβ1→4Hep→R.
  • Since these genes encode LOS glycosyl transferases they have been named lgtA, lgtB, lgtC, lgtD and lgtE. The DNA sequence analysis revealed that lgtA, lgtC and lgtD contain poly-G tracts, which in strain F62 were respectively 17, 10 and 11 bp. Thus, three of the LOS biosynthetic enzymes are potentially susceptible to premature termination by reading-frame changes. It is likely that these structural features are responsible for the high frequency genetic variation of gonococcal LOS. [0046]
  • Abbreviations used throughout this specification include: Lipopolysaccharide, LPS; Lipooligosaccharide, LOS; N-Acetyl-neuraminic acid cytidine mono phosphate, CMP-NANA; wild type, wt; Gal, galactose; Glc, glucose; NAc, N-acetyl (e.g., GalNAc or GlcNAc). [0047]
  • In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, “Molecular Cloning: A Laboratory Manual,” Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (herein “Sambrook et al., 1989”); “DNA Cloning: A Practical Approach,” Volumes I and II (D. N. Glover ed. 1985); “Oligonucleotide Synthesis” (M. J. Gait ed. 1984); “Nucleic Acid Hybridization” [B. D. Hames & S. J. Higgins eds. (1985)]; “Transcription And Translation” [B. D. Hames & S. J. Higgins, eds. (1984)]; “Animal Cell Culture” [R. I. Freshney, ed. (1986)]; “Immobilized Cells And Enzymes” [IRL Press, (1986)]; B. Perbal, “A Practical Guide, To Molecular Cloning” (1984). [0048]
  • Therefore, if appearing herein, the following terms shall have the definitions set out below. [0049]
  • A cell has been “transformed” by exogenous or heterologous DNA when such DNA has been introduced inside the cell; the cell may express a gene or genes encoded by such DNA. The transforming DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell, or may be contained on an autonomous replicon. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. A “clone” is a population of cells derived from a single cell or common ancestor by mitosis. [0050]
  • A “nucleic acid molecule” refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; “RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecules”) in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A “recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation. [0051]
  • A nucleic acid molecule is “hybridizable” to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al., 1989, supra). The conditions of temperature and ionic strength determine the “stringency” of the hybridization. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T[0052] m for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Sambrook et al., supra, 9.50-9.51). For hybridization with shorter nucleic acids, i.e., oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-11.8). Preferably a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; more preferably at least about 15 nucleotides; most preferably the length is at least about 20 nucleotides.
  • A DNA “coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3′ to the coding sequence. [0053]
  • Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding sequence in a host cell. Although the individual genes encoding glycosyltransferases of the invention are found in a single locus with very short non-coding sequences between them, phase variation resulting in deletion of any of lgtA, lgtB, or lgtC does not preclude reinitiation of transcription at the downstream genes. Thus, the locus provided herein includes transcription initiation sequences for transcription in Neisseria. Alternatively, the coding sequences of the invention can be engineered for expression under control of heterologous control sequences. [0054]
  • A “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3′ direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3′ terminus by the transcription initiation site and extends upstream (5′ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain “TATA” boxes and “CAT” boxes. [0055]
  • A coding sequence is “under the control” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence. [0056]
  • A “signal sequence” can be included before the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that directs the host cell to translocate the polypeptide to the cell surface or to organelles within the cell, or secrete the polypeptide into the media, and this signal peptide is usually selectively cleaved by the protein transport machinery. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes. Incorporation of a signal sequence may be desirable for high level expression of a glycosyltransferase of the invention by bacteria, yeast, insect cells (baculovirus), or eukaryotic cells, to avoid affecting endogenous glycosyltransfer in the host cell. [0057]
  • A molecule is “antigenic” when it is capable of specifically interacting with an antigen recognition molecule of the immune system, such as an immunoglobulin (antibody) or T cell antigen receptor. As mentioned above, the carbohydrate (oligosaccharide) moiety of the LOS of Neisseria is an important antigenic determinant, which determines serotype of meningococcus (Zollinger and Mandrell, 1977, Infect. Immun. 18:424; Zollinger and Mandrell, 1980, Infect. Immun. 28:451). An antigenic portion of a molecule can be that portion that is immunodominant for antibody, or it can be a portion used to generate an antibody to the molecule by conjugating the antigenic portion to a carrier molecule for immunization. A molecule that is antigenic need not be itself immunogenic, i.e., capable of eliciting an immune response without a carrier. [0058]
  • A composition comprising “A” (where “A” is a single protein, DNA molecule, vector, etc.) is substantially free of “B” (where “B” comprises one or more contaminating proteins, DNA molecules, vectors, etc.) when at least about 75% by weight of the proteins, DNA, vectors (depending on the category of species to which A and B belong) in the composition is “A”. Preferably, “A” comprises at least about 90% by weight of the A+B species in the composition, most preferably at least about 99% by weight. It is also preferred that a composition, which is substantially free of contamination, contain only a single molecular weight species having the activity or characteristic of the species of interest. [0059]
  • The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human. Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Pharmaceutically acceptable compositions of the invention are free of amounts of lipid A effective to cause a response in a mammalian subject, in particular a human subject. [0060]
  • The term “adjuvant” refers to a compound or mixture that enhances the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifically enhances the immune response (Hood et al., [0061] Immunology, Second Ed., 1984, Benjamin/Cummings: Menlo Park, Calif., p. 384). Often, a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Adjuvants include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Preferably, the adjuvant is pharmaceutically acceptable.
    • Isolation of Genes for Glycosyltransferases
  • The present invention provides the full length coding sequence of the LOS locus of Neisseria, and thus, allows for obtaining any one or all five genes, termed herein lgt genes, encoding glycosyltransferases characteristic of that locus. Any Neisseria bacterial cell can potentially serve as the nucleic acid source for the molecular cloning of an lgt gene. In a specific embodiment, infra, the genes are isolated from [0062] Neisseria gonorrhoeae. The DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA “library”), by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell (See, for example, Sambrook et al., 1989, supra; Glover, D. M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II). For example, a N. gonorrhoeae genomic DNA can be digested with a restriction endonuclease or endonucleases, e.g., Sau3A, into a phage vector digested with a restriction endonuclease or endonucleases, e.g., BamHI/EcoRI, for creation of a phage genomic library. Whatever the source, the gene should be molecularly cloned into a suitable vector for propagation of the gene.
  • In the molecular cloning of the gene from genomic DNA, DNA fragments are generated, some of which will encode the desired gene. The DNA may be cleaved at specific sites using various restriction enzymes. Alternatively, one may use DNAse in the presence of manganese to fragment the DNA, or the DNA can be physically sheared, as for example, by sonication. The linear DNA fragments can then be separated according to size by standard techniques, including but not limited to, agarose and polyacrylamide gel electrophoresis and column chromatography. [0063]
  • Once the DNA fragments are generated, identification of the specific DNA fragment containing the desired lgt gene may be accomplished in a number of ways. For example, the generated DNA fragments may be screened by nucleic acid hybridization to the labeled probe synthesized with a sequence as disclosed herein (Benton and Davis, 1977, Science 196:180; Grunstein and Hogness, 1975, Proc. Natl. Acad. Sci. U.S.A. 72:3961). Those DNA fragments with substantial homology to the probe will hybridize. The present invention provides specific examples of DNA fragments that can be used as hybridization probes for glycosyltransferases, e.g., SEQ ID NO:1. [0064]
  • As described above, the presence of the gene may be detected by assays based on the physical, chemical, or immunological properties of its expressed product. For example DNA clones that produce a protein that, e.g., has similar or identical electrophoretic migration, isoelectric focusing behavior, proteolytic digestion maps, proteolytic activity, or functional properties, in particular glycosyltransferase activity the ability of a Lgt protein to mediate transfer of a sugar to an acceptor molecule. Alternatively, the putative lgt gene can be mutated, and its role as a glycosyltransferase established by detecting a variation in the structure of the oligosaccharide of LOS. [0065]
  • Alternatives to isolating the lgt genomic DNA include, but are not limited to, chemically synthesizing the gene sequence itself from a known sequence that encodes an Lgt, e.g., as shown in SEQ ID NO:1. In another embodiment, DNA for an lgt gene can be isolated PCR using oligonucleotide primers designed from the nucleotide sequences disclosed herein. Other methods are possible and within the scope of the invention. [0066]
  • The identified and isolated gene can then be inserted into an appropriate cloning vector. A large number of vector-host systems known in the art may be used. Possible vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used. In a specific aspect of the invention, the lgt coding sequence is inserted in an [0067] E. coli cloning vector. Other examples of vectors include, but are not limited to, bacteriophages such as lambda derivatives, or plasmids such as pBR322 derivatives or pUC plasmid derivatives, e.g., pGEX vectors, pmal-c, pFLAG, etc. The insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini. However, if the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules may be enzymatically modified. Alternatively, any site desired may be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences. In specific embodiment, PCR primers containing such linker sites can be used to amplify the DNA for cloning. Recombinant molecules can be introduced into host cells via transformation, transfection, infection, electroporation, etc., so that many copies of the gene sequence are generated.
  • Transformation of host cells with recombinant DNA molecules that incorporate the isolated lgt gene or synthesized DNA sequence enables generation of multiple copies of the gene. Thus, the gene may be obtained in large quantities by growing transformants, isolating the recombinant DNA molecules from the transformants and, when necessary, retrieving the inserted gene from the isolated recombinant DNA. [0068]
  • The present invention also relates to vectors containing genes encoding truncated forms of the enzyme (fragments) and derivatives of Lgt's that have the same functional activity as an Lgt. The production and use of fragments and derivatives related to an Lgt are within the scope of the present invention. In a specific embodiment, the fragment or derivative is functionally active, i.e., capable of mediating transfer of a sugar to an acceptor molecule. [0069]
  • Truncated fragments of the glycosyltransferases can be prepared by eliminating N-terminal, C-terminal, or internal regions of the protein that are not required for functional activity. Usually, such portions that are eliminated will include only a few, e.g., between 1 and 5, amino acid residues, but larger segments may be removed. [0070]
  • Chimeric molecules, e.g., fusion proteins, containing all or a functionally active portion of a glycosyltransferase of the invention joined to another protein are also envisioned. A glycosyltransferase fusion protein comprises at least a functionally active portion of a non-glycosyltransferase protein joined via a peptide bond to at least a functionally active portion of a glycosyltransferase polypeptide. The non-glycosyltransferase sequences can be amino- or carboxy-terminal to the glycosyltransferase sequences. Expression of a fusion protein can result in an enzymatically inactive glycosyltransferase fusion protein. A recombinant DNA molecule encoding such a fusion protein comprises a sequence encoding at least a functionally active portion of a non-glycosyltransferase protein joined in-frame to the glycosyltransferase coding sequence, and preferably encodes a cleavage site for a specific protease, e.g., thrombin or Factor Xa, preferably at the glycosyltransferase-non-glycosyltransferase juncture. In a specific embodiment, the fusion protein may be expressed in [0071] Escherichia coli.
  • In particular, Lgt derivatives can be made by altering encoding nucleic acid sequences by substitutions, additions or deletions that provide for functionally equivalent molecules. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as an lgt gene may be used in the practice of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of lgt genes that are altered by the substitution of different codons that encode the same amino acid residue within the sequence, thus producing a silent change. Likewise, the Lgt derivatives of the invention include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of an Lgt including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a conservative amino acid substitution. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. [0072]
  • The genes encoding Lgt derivatives and analogs of the invention can be produced by various methods known in the art (e.g., Sambrook et al., 1989, supra). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. In the production of the gene encoding a derivative or analog of Lgt, care should be taken to ensure that the modified gene remains within the same translational reading frame as the lgt gene, uninterrupted by translational stop signals, in the gene region where the desired activity is encoded. [0073]
  • Additionally, the lgt nucleic acid sequence can be mutated un vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including but not limited to, in vitro site directed mutagenesis (Hutchinson, C., et al., 1978, J. Biol. Chem. 253:6551; Zoller and Smith, 1984, DNA 3:479-488; Oliphant et al., 1986, Gene 44:177; Hutchinson et al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:710), use of TAB® linkers (Pharmacia), etc. PCR techniques are preferred for site directed mutagenesis (see Higuchi, 1989, “Using PCR to Engineer DNA”, in [0074] PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70). It is notable in this regard that the lgtA, lgtB, and lgtC genes contain long poly-G stretches that are particularly susceptible to phase variation mutation.
    • Expression of a Glycosyltransferase
  • The gene coding for an Lgt, or a functionally active fragment or other derivative thereof, can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. An expression vector also preferably includes a replication origin. The necessary transcriptional and translational signals can also be supplied by the native lgt gene and/or its flanking regions. A variety of host-vector systems may be utilized to express the protein-coding sequence. Preferably, however, a bacterial expression system is used to provide for high level expression of the protein with a higher probability of the native conformation. Potential host-vector systems include but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used. [0075]
  • Preferably, the periplasmic form of the Lgt (containing a signal sequence) is produced for export of the protein to the [0076] Escherichia coli periplasm or in an expression system based on Bacillus subtillis.
  • Any of the methods previously described for the insertion of DNA fragments into a vector may be used to construct expression vectors containing a chimeric gene consisting of appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). [0077]
  • Expression of nucleic acid sequence encoding an glycosyltransferase or peptide fragment may be regulated by a second nucleic acid sequence so that the glycosyltransferase or peptide is expressed in a host transformed with the recombinant DNA molecule. For example, expression of an glycosyltransferase may be controlled by any promoter/enhancer element known in the art, but these regulatory elements must be functional in the host selected for expression. For expression in bacteria, bacterial promoters are required. Eukaryotic viral or eukaryotic promoters, including tissue specific promoters, are preferred when a vector containing an lgt gene is injected directly into a subject for transient expression, resulting in heterologous protection against bacterial infection, as described in detail below. Promoters which may be used to control lgt gene expression include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto, et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:3942); prokaryotic expression vectors such as the β-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); see also “Useful proteins from recombinant bacteria” in Scientific American, 1980, 242:74-94; and the like. [0078]
  • Expression vectors containing lgt gene inserts can be identified by four general approaches: (a) PCR amplification of the desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of “marker” gene functions, and (d) expression of inserted sequences. In the first approach, the nucleic acids can be amplified by PCR with incorporation of radionucleotides or stained with ethidium bromide to provide for detection of the amplified product. In the second approach, the presence of a foreign gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted lgt gene. In the third approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain “marker” gene functions (e.g., β-galactosidase activity, PhoA activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector. If the lgt gene is inserted within the marker gene sequence of the vector, recombinants containing the lgt insert can be identified by the absence of the marker gene function. In the fourth approach, recombinant expression vectors can be identified by assaying for the activity of the lgt gene product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of the lgt gene product in in vitro assay systems, e.g., glycosyltransferase activity. Once a suitable host system and growth conditions are established, recombinant expression vectors can be propagated and prepared in quantity. [0079]
    • Biosynthesis of Oligosaccharides
  • The glycosyltransferases of the present invention can be used in the biosynthesis of oligosaccharides. The glycosyltransferases of the invention are capable of stereospecific conjugation of a specific activated saccharide unit to a specific acceptor molecule. Such activated saccharides generally consist of uridine, guanosine, and cytidine diphosphate derivatives of the saccharides, in which the nucleoside diphosphate serves as a leaving group. Thus, the activated saccharide may be a saccharide-UDP, a saccharide-GDP, or a saccharide-CDP. In specific embodiments, the activated saccharide is UDP-GlcNAC, UDP-GalNAc, or UDP-Gal. [0080]
  • The term “acceptor molecule” as used herein refers to the molecule to which the glycosyltransferase transfers an activated sugar. As is well known in the art, synthesis of carbohydrates proceeds by sequential coupling of sugar residues to a lipid, e.g., dolichol phosphate. In eukaryotic cells, which glycosylate proteins, the oligosaccharide or polysaccharide is transferred from the activated lipid carrier to the polypeptide on the luminal side of the endoplasmic reticulum. In prokaryotes, the carbohydrate can be synthesized directly on a lipid A molecule. It is likely that the glycosyltransferases of the invention may be sensitive to the core portion of the growing carbohydrate and the lipid molecule. Thus, in a preferred aspect, the acceptor molecule, or carrier, contains a lipid, preferably a polyisoprenoid alcohol lipid such as dolichol phosphate. Maximum synthetic efficiency may ensue from use of lipid A as the carrier. While the lipid A is not useful as a carrier for direct administration of the resulting oligosaccharide to a subject, e.g., as a vaccine preparation, it may be appropriate for use with a labile linkage for subsequent cleavage (under mild conditions) and separation of the oligosaccharide from the lipid carrier. It should further be noted that the glycosyltransferases will only work efficiently to add a specific activated saccharide to a saccharide residue on the acceptor molecule that corresponds to the natural acceptor molecule. For example, LgtE catalyzes transfer of Gal to Glcβ1→4Hep. Thus, where a glycosyltransferase mediates attachment of GalNAc to Glc, the nature of the Glc residue (whether it is attached directly or indirectly to the carrier, for example) will affect the reaction efficiency. It is unlikely that efficient synthesis can occur in the absence of a carrier, or using other than a lipid carrier. However, even inefficient synthesis may be desirable, and practice of the present invention is not limited to use of acceptor molecules containing lipids, but extends to saccharides, polysaccharides, polypeptides, glycoproteins, and the like. [0081]
  • For the synthesis of an oligosaccharide, a glycosyltransferase is contacted with an appropriate activated saccharide and an appropriate acceptor molecule under conditions effective to transfer and covalently bond the saccharide to the acceptor molecule. Conditions of time, temperature, and pH appropriate and optimal for a particular saccharide unit transfer can be determined through routine testing; generally, physiological conditions will be acceptable. Certain co-reagents may also be desirable; for example, it may be more effective to contact the glycosyltransferase with the activated saccharide and the acceptor molecule in the presence of a divalent cation. [0082]
  • According to the invention, the glycosyltransferase enzymes can be covalently or non-covalently immobilized on a solid phase support such as SEPHADEX, SEPHAROSE, or poly(acrylamide-co-N-acryloxysucciimide) (PAN) resin. A specific reaction can be performed in an isolated reaction solution, with facile separation of the solid phase enzyme from the reaction products. Immobilization of the enzyme also allows for a continuous biosynthetic stream, with the specific glycosyltransferases attached to a solid support, with the supports arranged randomly or in distinct zones in the specified order in a column, with passage of the reaction solution through the column and elution of the desired oligosaccharide at the end. An efficient method for attaching the glycosyltransferase to a solid support and using such immobilized glycosyltransferases is described in U.S. Pat. No. 5,180,674, issued Jan. 19, 1993 to Roth, which is specifically incorporated herein by reference in its entirety. [0083]
  • An oligosaccharide, e.g., a disaccharide, prepared using a glycosyltransferase of the present invention can serve as an acceptor molecule for further synthesis, either using other glycosyltransferases of the invention, or glycosyltransferases known in the art (see, e.g., Roth, U.S. Pat. No. 5,180,674, and Roth, International Patent Publication No. WO 93/13198, published Jul. 8, 1993, each of which is incorporated herein by reference in its entirety). The oligosaccharide compositions of the invention are useful in a wide variety of therapeutic and diagnostic applications. For example, the saccharide compositions can be used as blocking agents for cell surface receptors in the treatment of numerous diseases involving cellular adhesion. Alternatively, saccharide compositions useful as nutritional supplements, antibacterials, anti-metastases agents, anti-inflammatory agents (e.g., for binding to inflammatory-associated lectins or cell surface receptors), to mention but a few, are contemplated by the instant invention. As noted above, the glycosyltransferases of the invention can be used in conjunction with other glycosyltransferases known in the art or to be discovered to synthesize complex oligosaccharides or polysaccharides. [0084]
  • Alternatively, the glycosyltransferases of the invention can be used to synthesize oligosaccharides representative of the oligosaccharides found on various strains of Neisseria. For example, by deleting open reading frames from the locus, or by selecting only a few of the glycosyltransferases of the invention for synthesis, alternative oligosaccharide structures can be prepared. These can be used in vaccine preparations effective against Neisseria variants, in particular, subunit vaccines against gonococcus and meningococcus. [0085]
  • Alternatively, the glycosyltransferases of the present invention can be used to prepare oligosaccharides corresponding to oligosaccharides associated with human glycolipids. Thus, in specific embodiments, the present invention provides for synthesis of an oligosaccharide corresponding to lacto-N-neotetraose of the sphingolipid paragloboside; an oligosaccharide that mimics gangliosides; and a mimic of the saccharide portion of globoglycolipids, which is the structure characteristically found in [0086] Neisseria meningitidis immunotype L1. The oligosaccharides of the present invention correspond to the core oligosaccharides of the blood group antigens, and therefore have great utility in the preparation of such blood group antigens for diagnostic or therapeutic purposes.
  • Accordingly, a method for preparing an oligosaccharide having the structure GalNAcβ1→3Galβ1→4GlcNAcβ1→3Galβ1→4Glc (i.e., ganglioside) comprises sequentially performing the steps of: [0087]
  • a. contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO: 6, or a functionally active fragment thereof; [0088]
  • b. contacting a reaction mixture comprising an activated GlcNAc to the acceptor moiety comprising a Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:2, or a functionally active fragment thereof; [0089]
  • c. contacting a reaction mixture comprising an activated Gal to the acceptor moiety comprising a GlcNAcβ1→3Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid of SEQ ID NO:3; and [0090]
  • d. contacting a reaction mixture comprising an activated GalNAc to the acceptor moiety comprising a Galβ1→4GlcNAcβ1→3Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:5, or a functionally active fragment thereof. [0091]
  • Similarly, a method for preparing an oligosaccharide having the structure Galβ1→4GlcNAcβ1→3Galβ1→4Glc (i.e., lacto-N-neotetraose) comprises sequentially performing the steps of: [0092]
  • a. contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO: 6, or a functionally active fragment thereof; [0093]
  • b. contacting a reaction mixture comprising an activated GlcNAc to the acceptor moiety comprising a Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:2, or a functionally active fragment thereof; and [0094]
  • c. contacting a reaction m comprising an activated Gal to the acceptor moiety comprising a GlcNAcβ1→3Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid of SEQ ID NO:3. [0095]
  • In another embodiment, a method for preparing an oligosaccharide having the structure Galα1→4Galβ1→4Glc (i.e., globoglycolipids) comprises sequentially performing the steps of: [0096]
  • a. contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:6, or a functionally active fragment thereof; and [0097]
  • b. contacting a reaction mixture comprising an activated Gal to the acceptor moiety comprising Galβ1→4Glc in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:4, or a functionally active fragment thereof. [0098]
  • Such oligosaccharides can be prepared using lipid A as a carrier. Preferably, if the resulting glycolipid is to be used in a vaccine, a non-toxic lipid, such as dolichol phosphate, is used as the carrier. [0099]
    • Vaccination
  • Active immunity against Neisseria strains can be induced by immunization (vaccination) with an immunogenic amount of an oligosaccharide prepared according to the present invention in admixture with an adjuvant, wherein the oligosaccharide is the antigenic component of the vaccine. Preferably, the oligosaccharide is conjugated to a carrier protein. Alternatively, where the antigen is a glycolipid, it can be incorporated in a liposome. [0100]
  • The oligosaccharide alone cannot cause bacterial infection, although the oligosaccharide on lipid A is toxic, and the active immunity elicited by vaccination according to the present invention can result in immediate immune response. [0101]
  • Selection of an adjuvant depends on the subject to be vaccinated. Preferably, a pharmaceutically acceptable adjuvant is used. For example, a vaccine for a human should avoid oil or hydrocarbon emulsion adjuvants, including complete and incomplete Freund's adjuvant. One example of an adjuvant suitable for use with humans is alum (alumina gel). A vaccine for an animal, however, may contain adjuvants not appropriate for use with humans. [0102]
  • A vaccine of the invention, i.e., a vaccine comprising an oligosaccharide corresponding to an antigenic determinant on a strain of Neisseria, can be administered via any parenteral route, including but not limited to intramuscular, intraperitoneal, intravenous, and the like. [0103]
  • Administration of an amount of a Neisseria oligosaccharide sufficient to inhibit adhesion of the bacterium to its target cell may also be effective for treating meningococcal or gonococcal infection. The required amount can be determined by one of ordinary skill using standard techniques. [0104]
    • Expression of Glycosyltransferases in for Intracellular Glycosylation
  • The present invention further contemplates transforming a host cell with a glycosyltransferase or glycosyltransferases of the invention. It is expected that expression of the glycosyltransferase, possibly in a cell lacking one or more endogenous glycosyltransferases, may result in novel glycosylation of lipids and proteins in such eukaryotic cells, and novel glycosylation of lipids in procaryotic cells. [0105]
  • For example, transformation of a bacterium with non-toxic lipid molecules may provide for expression of Neisseria oligosaccharides on such a bacterium, which can then be used directly in a whole cell vaccine. [0106]
  • Alternatively, expression of such a glycosyl transferase in yeast, insect, or mammalian cell lines may result in novel glycosylation of lipids and proteins expressed by these cells. [0107]
    • Antibodies to Neisseria Oligosaccharides, and Diagnosis and Therapy Therewith
  • Just as the oligosaccharides can be used in vaccines, so to they can be used to generate antibodies to themselves, which antibodies, in turn, can be used to detect that particular strain of bacteria or for passive immunity. Antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library. Various procedures known in the art may be used for the production of polyclonal antibodies to oligosaccharide. For the production of antibody, various host animals can be immunized by injection with the oligosaccharide, including but not limited to rabbits, mice, rats, sheep, goats, etc. In one embodiment, the oligosaccharide can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Various adjuvants may be used to increase the immunological response, depending on the host species. For preparation of monoclonal antibodies directed toward the oligosaccharide, or fragment, analog, or derivative thereof, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. These include but are not limited to the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495-497), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, in [0108] Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilizing recent technology (PCT/US90/02545). According to the invention, human antibodies may be used and can be obtained by using human hybridomas (Cote et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pp. 77-96). In fact, according to the invention, techniques developed for the production of “chimeric antibodies” (Morrison et al., 1984, J. Bacteriol. 159-870; Neuberger et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by splicing the genes from a mouse antibody molecule specific for an oligosaccharide together with genes from a human antibody molecule of appropriate biological activity can be used; such antibodies are within the scope of this invention. Such human or humanized chimeric antibodies are preferred for use in therapy of human diseases or disorders, since the human or humanized antibodies are much less likely than xenogenic antibodies to induce an immune response, in particular an allergic response, themselves. According to the invention, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce oligosaccharide-specific single chain antibodies. An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al., 1989, Science 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for an oligosaccharide, or its derivatives, or analogs.
  • Antibody fragments which contain the idiotype of the antibody molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab′)[0109] 2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab′ fragments which can be generated by reducing the disulfide bridges of the F(ab′)2 fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.
  • In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA (enzyme-linked immunosorbant assay), “sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. For example, to select antibodies which recognize a specific oligosaccharide, one may assay generated hybridomas for a product which binds to an oligosaccharide containing such epitope. For selection of an antibody specific to an oligosaccharide from a particular species or strain of Neisseria, one can select on the basis of positive binding with oligosaccharide expressed by or isolated from cells of that species or strain. [0110]
  • The foregoing antibodies can be used in methods known in the art relating to the localization and activity of the oligosaccharide, e.g., for Western blotting, imaging oligosaccharide in situ, measuring levels thereof in appropriate physiological samples, etc. [0111]
  • Diagnosis of infection with a Gram positive bacterium can use any immunoassay formal known in the art, as desired. The antibodies can be labeled for detection in vitro, e.g., with labels such as enzymes, fluorophores, chromophores, radioisotopes, dyes, colloidal gold, latex particles, and chemiluminescent agents. Alternatively, the antibodies can be labeled for detection in vivo, e.g., with radioisotopes (preferably technetium or iodine); magnetic resonance shift reagents (such as gadolinium and manganese); or radio-opaque reagents. [0112]
  • Alternatively, the nucleic acids and sequences thereof of the invention can be used in the diagnosis of infection with Neisseria, in particular, to identify a particular strain, or to determine which, if any, of the glycosyltransferase genes are mutated. For example, the lgt genes or hybridizable fragments thereof can be used for in situ hybridization with a sample from a subject suspected of harboring an infection of Neisseria bacteria. In another embodiment, specific gene segments of a Neisseria can be identified using PCR amplification with probes based on the lgt genes of the invention. In one aspect of the invention, the hybridization with a probe or with the PCR primers can be performed under stringent conditions, or with a sequence specific for a unique strain or a limited number of strains of the bacterium, or both, thus allowing for diagnosis of infection with that particular strain (or strains). Alternatively, the hybridization can be under less stringent conditions, or the sequence may be homologous in any or all strains of a bacterium, thus allowing for diagnosis of infection with that species. [0113]
  • The present invention will be better understood from a review of the following illustrative description presenting the details of the constructs and procedures that were followed in its development and validation. [0114]
    • EXAMPLE
  • This Example describes a locus in [0115] Neisseria gonorrhoeae strain F62 containing five genes. Four of the genes are responsible for the sequential addition of the GalNAcβ1→3Galβ1→4GlcNAcβ1→3Galβ1→4 to the substrate Glcβ1→4Hep→R of the inner core region (Yamasaki et al., 1991, Biochemistry 30:10566). The fifth gene is involved with the addition of the α-linked galactose residue in the biosynthesis of the alternative LOS structure Galα1→4Galβ1→4Hep→R (John et al., 1991, J. Biol. Chem. 266:19303). The DNA sequence analysis revealed that the first, third and fourth reading frames contained poly-G tracts which in strain F62 were respectively 17, 10 and 11 bp. Thus, three of the LOS biosynthetic enzymes are potentially susceptible to premature termination by reading-frame changes, as has been reported for the gonococcal pilC genes (Jonsson et al., 1991, EMBO J. 10:477; Rudel et al., 1992, Molec. Microbiol. 6:3439). It is likely that these structural features are responsible for the high-frequency genetic variation of gonococcal LOS (Schneider et al., 1988, Infect. Immun. 56:942).
    • Materials and Methods
  • Reagents and chemicals. Most laboratory chemicals were obtained from Sigma Chemical Co (St. Louis, Mo.). Restriction enzymes were purchased from New England Biolabs (Beverly, Mass.). [0116]
  • Media and growth conditions. [0117] E. coli strains were grown in solid or liquid LB medium (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor); antibiotics were added as applicable. Carbenicillin was used at 50 μg/ml and erythromycin at 200 μg/ml. Neisseria gonorrhoeae strain F62 was grown on GC agar (Swanson, 1978, Infect. Immun. 19:320) or GC agar containing 2 μg/ml erythromycin. For isolation of LOS or genomic DNA, gonococci were grown in 1.5% proteose peptone broth (Difco Laboratories, Detroit Mich.), 30 mM phosphate, 8.5 mM NaCl supplemented with 1% isovitalex (Becton Dickinson Microbiology Systems, Cockeysville, Md.).
  • Recombinant DNA methods. Plasmids were purified using either Qiagen columns or the QIAprep spin columns obtained from Qiagen Inc. (Chatsworth, Calif.). Digestion with restriction enzymes, gel electrophoresis, ligations with T4 DNA polymerase and transformation of [0118] E. coli were done according to Sambrook et al. (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor). Southern hybridization was performed on Hybond N+ membranes Amersham Co. (Arlington Heights, Ill.) with DNA labeled using the ECL kit from Amersham Co. Genomic DNA was isolated as described by Moxon et al. (Moxon et al., 1984, J. Clin. Invest. 73:298).
  • A gene bank of [0119] Neisseria gonorrhoeae strain F62 genomic DNA was constructed by ligating ca 20 kb fragments obtained by incomplete digestion with Sau3A into BamHI/EcoRI digested λ2001 (Karn et al., 1984, Gene 32:217). The phage library was screened by hybridization with random-prime-labeled plasmid pR10PI, and 5 clones were isolated by plaque purification. The phage from these clones were purified by sedimentation followed by flotation on CsCl (Davis et al., 1980, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), and the DNA was isolated. From one of these clones, two ClaI fragments of 4.9 and 3.4 kb were isolated by gel electrophoresis and recovery with Geneclean II (BIO 101 Inc., La Jolla, Calif.). These were ligated into ClaI cut pBluescript II SK− from Stratagene (La Jolla, Calif.) and called p4900 and p3400 respectively. p4900 contained a PstI site in the insert and was subdivided into two clones containing inserts of 2.1 and 2.8 kb. The clone containing the 2.8 kb insert was called pPstCla. The inserts in p3400 and pPstCla were sequenced by the chain termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. USA 74:5463) using Sequenase II, (United States Biochemical Co., Cleveland, Ohio). All of the sequence presented in FIG. 2 was completed in both directions.
  • The insertion and deletions shown in FIG. 6 were constructed as follows. I1, I3, Δ1 and Δ2 used plasmid pPstCla cut respectively with BsaBI, AscI, StyI and double cut with StyI and BsaBI. I2 and Δ3 used plasmid p3400 cut with AgeI or StyI. The complete locus was assembled by cloning the ClaI-ApaI fragment from p3400 into pPstCla cut with ClaI and ApaI, and the plasmid was called pLOS5. Deletions Δ4 and Δ5 were constructed using pLOS5 and digestion with StyI and BbsI or with StyI alone. In all instances (except digestion with BsaBI) the cut plasmids were treated with the Klenow fragment of [0120] E. coli DNA polymerase to blunt the ends, and ermC′ (erythromycin resistance marker) was inserted. The ermC′ gene was isolated from plasmid pIM13 (Projan et al., 1987, J. Bacteriol. 169:5131) as a ClaI-HindIII fragment and cloned into the same sites in plasmid pHSS6 (Seifert et al., 1986, Proc. Natl. Acad. Sci. USA 83:735). From this plasmid it was excised as a NotI fragment, the ends blunted by treatment with Klenow fragment of DNA polymerase, purified by gel electrophoresis and recovery with Geneclean II.
  • Transformation of piliated [0121] Neisseria gonorrhoeae strain F62 was performed with plasmids isolated from E. coli (Klugman et al., 1989, Infect. Immun. 57:2066) and the transformants selected on GC agar (Swanson, 1978, Infect. Immun. 19:320) containing 2 μg/ml erythromycin. The fidelity of the genomic alteration of each of the gonococcal transformants was verified by sequencing the upstream and downstream junctions of the ermC′ gene in their genomic DNA using a PCR technique. Two 5′ biotinylated primers, GCCGAGAAAACTATTGGTGGA (SEQ. ID. NO:7) and AAAACATGCAGGAATTGACGAT) (SEQ. ID. NO:8), were synthesized; these were based on the ermC′ sequence near its upstream and its downstream end respectively. The primers were designed such that their 3′ ends pointed outward from the ermC′ gene. Each of these primers was used together with a suitable primer matching the sequence of the LOS locus near the putative insertion. PCR was performed according the instructions supplied with the GeneAmp PCR Reagent Kit from Perkin Elmer (Branchburg, N.J.) using 25 cycles. In all instances the expected size product was obtained. The DNA sequence of these products was determined by purifying the PCR product on magnetic streptavidin beads from Dynal, Inc. (Lake Success, N.Y.) and sequencing with the Sequenase II kit according to a protocol provided by Dynal, Inc., based on the method developed by Hultman et al (Hultman et al., 1989, Nucleic Acids Res. 17:4937). The sequences were analyzed by computer programs in the GCG package of Genetics Computer Group, Inc. (Madison, Wis.).
  • Immunological methods. Monoclonal antibodies 17-1-L1 (L1), 9-2-L378 (L3), 2-1-L8 (L8) were obtained as filtered ascites fluids. Antibody 1-1-M was obtained as ascites fluid and 3F11 and 4C4 were obtained as tissue culture supernatants. LOS was extracted from each of the gonococcal mutants by the hot phenol-water method (Westphal and Jann, 1965, Academic Press, New York-83-91) and purified as described (Johnston et al., 1976, J. Exp. Med. 143:741). The LOS was diluted to 200 μg/ml in the Western blot buffer described by Towbin et al. (Towbin et al., 1979, Proc. Natl. Acad. Sci. USA 76:4350), and 1.5 μl aliquots were spotted on Immobilon-P membrane from Millipore Corp (Bedford, Mass.) that was lying on 3 MM Whatman filter paper (Whatman Ltd., Maidstone, England) soaked in the blotting buffer. The spots were allowed to absorb into the membrane over a period of 2 min and the strips were placed in blocking buffer for at least 60 min. The blocking buffer consisted of 3% gelatin dissolved in 150 mM NaCl, 10 mM Tris-[0122] HCl 10 mM pH 7.5, 5 mM MgCl2, 0.02% NaN3. The strips were washed thrice in the same buffer containing 1% gelatin. The strips were treated for 2 h with monoclonal antibodies diluted in blocking buffer. The antibodies available as ascites fluids were diluted {fraction (1/1000)}, antibodies available as tissue culture supernatants {fraction (1/10)}. The strips were washed, incubated for 60 min with a {fraction (1/1000)} dilution of phosphatase-conjugated anti-IgG,IgA,IgM from Cappel (Organon Teknika Co., West Chester, Pa.), washed and stained as described previously (Blake et al., 1984, Analyt. Biochem. 136:175).
  • Gel electrophoresis. Gel electrophoresis of LOS samples was performed as described by Lesse et al (Less et al., 1990, J. Immunol. Meth. 126:109) and the gels silver stained (Hitchcock and Brown, 1983, J. Bacteriol. 154-269). [0123]
    • Results
  • Cloning of the LOS Locus. During attempts to isolate the porin gene of [0124] Neisseria gonorrhoeae, pBR322 clones containing a 4.9 kb ClaI fragment that reacted by colony blots with a rabbit antiserum to purified porin were repeatedly isolated. An immunoreactive subclone, pR10PI, consisting of a 1305 bp RsaI-ClaI fragment was derived and its DNA sequence was determined. This sequence had homology to a gene isolated from Haemophilus influenzae called lex-1 (Cope et al., 1991, Molec. Microbiol. 5:1113) or lic2A (High et al., 1993, Molec. Microbiol. 9:1275) that is known to be involved in LPS synthesis of that species. Using subclone pR10PI as a probe, Southern blots of Neisseria gonorrhoeae genomic DNA digested with ClaI revealed hybridization with two fragments, 4.9 and 3.4 kb. However, digestion with some other restriction enzymes gave rise to only a single band. Notably, digestion with BfaI gave rise to a single band of 4.1 kb, suggesting that the two copies were closely liked (data not shown).
  • A λ2001 bank of [0125] Neisseria gonorrhoeae strain F62 DNA was screened by hybridization with pR10PI and 5 clones were isolated. One of these clones, when digested with either Cal or BfaI and examined by Southern hybridization using pR10PI as the probe, gave rise to a pattern identical to that seen with genomic DNA. The appropriate ClaI fragments of this λ2001 clone were isolated and cloned into the ClaI site of pBluescript II SK−. The entire sequence of the 3400 ClaI fragment was determined. Mapping of the clone containing the 4900 bp ClaI fragment indicated that there was a single PstI site in the clone about 2.8 kb from one side, allowing the clone to be divided into two subclones. Partial sequence of the ends of the 2.1 kb subclone indicated that it contained a coding frame homologous to the E. coli COOH-terminal portion of the α subunit of glycyl-tRNA synthetase (glyS) and the majority of the β subunit of this gene (Webster et al., 1983, J. Biol. Chem. 258:10637. The predicted length of DNA needed to match the E. coli sequence was present; this clone was not examined further.
  • DNA Sequence of the LOS Locus. A summary of the features found by sequencing the two clones is illustrated in FIG. 2. Following the gas gene Ifound five closely spaced open reading frames. The last frame has 46 bp downstream of the termination codon a sequence typical of a rho independent termination signal. Subsequently, there is an area of [0126] ca 100 bp that has striking homology to the IS1106 neisserial insertion sequence (Knight et al., 1992, Molec. Microbiol. 6:1565). Further elucidation of the nature of this locus, presented below, showed the five open reading frames code for LOS glycosyl transferases and hence they have been named lgtA-lgtE.
  • Searches for internal homology within this locus indicates that the DNA coding for the first two genes (lgtA, lgtB) is repeated as the fourth and fifth genes (lgtD, lgtE) and that interposed is an additional open reading frame, lgtC. This is in keeping with the data obtained by Southern hybridization presented above, in which pR10PI probe containing the lgtB and a small portion of the lgtC gene hybridized with two ClaI fragments, but with only one BfaI fragment (see positions of the BfaI sites in the LOS locus in FIG. 2). In more detail, 16 bp following the stop codon of the tRNA synthetase (glyS) is the beginning of a stem loop structure followed closely by a consensus ribosome binding site (rbs), and within 6 bp is a TTG believed to be the initiation codon of lgtA. 2871 bp downstream from the beginning of the stem loop (closely following the stop codon of lgtC) there is an almost perfect repeat of the stem loop structure, the rbs and the TTG initiation codon of lgtD with the downstream sequence strongly homologous for about 500 bp. The sequences then diverge to some extent. However, at the beginning of lgtB and lgtE the homology again becomes nearly perfect for [0127] ca 200 bases to then diverge toward the latter part of the orfs. The similarity of the homologous proteins is illustrated in FIGS. 3 and 4. These comparisons, demonstrate the near-perfect conservation of the primary structure in the N-terminal portions of the molecules with increasing divergence toward the COOH-termini of the proteins.
  • The lgtC sequence interposed between the repeated portions of the locus is not repeated within the locus or in the [0128] Neisseria gonorrhoeae genome (data not shown). It appears to be homologous to E. coli rfaI or rfaJ genes, which are very closely related genes that serve as glucosyl transferases in core LPS biosynthesis (Pradel et al., 1992, J. Bacteriol. 174:4736). The similarity of rfaI with lgtC is illustrated in FIG. 5.
  • It was found that three of these genes contained within their coding frame mums of guanosines coding for stretches of glycines (see FIG. 2). These poly-G regions were found in lgtA (17 bp), lgtC (10 bp) and lgtD (11 bp); in each case the number G residues was one that maintained an intact reading frame (see FIGS. 3 and 5). In each of the three genes a change of 1 or 2 G bases would cause premature termination of the transcript. [0129]
  • LOS phenotype of [0130] Neisseria gonorrhoea F62 with deletions of the LOS locus. In order to define the function of the lgt genes, insertions or deletions of the LOS locus were constructed in plasmids propagated in E. coli. The insertions or deletions in each case were marked with the ermC′ gene, which is an excellent selective marker in Neisseria gonorrhoeae (Klugman et al., 1989, Infect. Immun. 57:2066). The constructions are summarized in FIG. 6. I1, I2 and I3 refer to insertions of the ermC′ marker into, respectively, a BsaBI, AgeI and AscI site. Similarly, the deletions were constructed by excising portions of the plasmids and substituting the erythromycin marker. The open arrows indicate the gene or genes disrupted. Each of these plasmids was used to transform Neisseria gonorrhoeae strain F62 and transformants were selected on erythromycin-containing plates. The fidelity of the genomic alteration of a prototype of each of the gonococcal transformants was verified by sequencing the upstream and downstream junction of the ermC′ gene. To simplify the nomenclature in this report the gonococcal mutants have been given the same names used to identify the plasmid constructs in FIG. 6.
  • The LOS of the mutants were examined by SDS-PAGE and compared to the LOS of strain 1291e. This strain was originally isolated by Dudas and Apicella (Dudas and Apicella, 1988, Infect. Immun. 56:499) as a pyocin-resistant mutant of strain 1291 wild type and has been extensively characterized both chemically and genetically. Chemical analysis has shown that this mutant lacks completely the lacto-N-neotetraose substitution on heptose 1 (John et al., 1991, J. Biol. Chem. 266:19303). The genetic basis of this mutant has been defined (Zhou et al., 1994, J. Biol. Chem. 269:11162; Sandlin and Stein, 1994, J. Bacteriol. 176:2930); it is a mutation of the pgm gene coding for phosphoglucomutase. This mutation prohibits the synthesis of UDP-glucose and hence the addition of glucose to the heptose. As seen in FIG. 7, the parental wild type F62 strain gives rise to two major LOS bands; their appearance is indistinguishable from SDS-PAGE patterns previously published by other workers (Schneider et al., 1985, Amer. Soc. Microbiology, Washington 400-405). The mutants are arranged on the gel according to the size of the major band that they contain. The size decreases from the top band of the F62 wt LOS in four clear steps to the size of the LOS of Δ4 or I2. Since the I2 mutant (with an insertion into lgtE, the last gene in the locus) has the same phenotype as Δ4 (which has a complete deletion of the locus), it suggests that the lgtE product performs the first biosynthetic step. Thus, the enzymes encoded by lgtA-D, although intact, do not have a substrate to act upon. Mutant Δ5 (a deletion of the locus with the exception of lgtE) gives rise to a LOS that is one step larger, supporting the idea that this gene accounts for the initial biosynthetic step. Note that the LOS of both I2 and Δ4 mutants is perceptibly larger than the LOS of strain 1291e which is known to be unable to add glucose, the first residue in the lacto-N-neotetraose chain. These data suggest that lgtE encodes the galactosyl transferase enzyme which adds the first galactose of the lacto-N-neotetraose. [0131]
  • The LOS preparations were also studied using a dot blot technique for their reactivity with monoclonal antibodies. The monoclonal antibodies employed and their reported specificities are shown in FIG. 1. The reactions observed with the LOS obtained from the parental strain and the mutants are summarize in FIG. 8. The reactivity of the parental F62 with 1-1-M, 3F11 and L8 was as reported previously by Mandrell et al (Mandrell et al., 1985, Amer. Soc. Microbiology, Washington 379-384) and by Yamasaki et al (Yamasaki et al., 1991, Mol. Immunol. 28:1233). Mutants Δ4 and I2 fail to react with any of the antibodies. However, Δ5 gives a strong reaction with antibodies 4C4 and L8, indicating that the first galactose residue is present. This is in keeping with the SDS-PAGE results (see FIG. 6) and supports the role of lgtE as the galactosyl transferase. It also indicates that deletions upstream of lgtE do not significantly inactivate its function by polar effects. The LOS of F62 wt parent has strong reactivity with L3 and weak reactivity with 3F11. It is known that reactivity 3F11 is occluded by the addition of the GalNAc residue (Schneider et al., J. Exp. Med. 174:1601); this is not the case with the L3 antibody. The wt LOS reacts with 1-1-M, the antibody reactive when the terminal GalNAc residue is present. The reactivity with 1-1-M is lost in Δ3 which has a deletion only in lgtD. This suggest that this gene encodes the GalNAc transferase. [0132]
  • The reactivity with antibody L1 (specific for the alternative LOS structure capped with an α1→4Gal) is not seen in wt LOS, is absent in I1, and all deletions which affect lgtC. The reactivity is strongest in Δ1, which has a deletion of lgtA only. Note that this mutant also has lost reactivity with 3F11 and L3. These two findings suggest that lgtA codes for the GlcNAc transferase, and when this residue is not added, the incomplete chain is a substrate for the action of lgtC to produce the alternative LOS structure. Note that the sizes of the LOS products seen in FIG. 7 are in accord with the immunological data. This conclusion suggests that lgtC encodes the α-Gal transferase. This is further supported by the weak reactivity of mutant Δ3 with antibody L1. Mutant Δ3 has a deletion of lgtD and fails to add the terminal GalNAc, allowing the α-Gal transferase to modify the lacto-N-neotetraose group to produce a P[0133] i-like globoside (Mandrell, 1992, Infect. Immun. 60:3017). Mutant I3 (with inactive lgtB) has lost reactivity with 1-1-M, 3F11 and L1, and remains only weakly reactive with L3. Together with the size of the product, these observations suggest that lgtB encodes the galactosyl transferase adding Galβ1→4 to the GlcNAc residue. Ricinus lectin RCA-I is specific for terminal galactose in β linkage (Nicolson and Blaustein, 1972, Biochim. Biophys. Acta 266:543; Lin and Li, 1980, Bur. J. Biochem. 105:453) and was used to confirm the presence of this structure on the LOS preparations. Using ELISA tests it was found that wild type, Δ3, Δ2 and Δ5 LOS, expected to bear a terminal βGal, bound the lectin (see FIG. 7), while Δ4, I2, Δ1 and I3 were unreactive (data not shown).
    • Discussion
  • A locus containing 5 open reading frames has been cloned. The effect of eight defined mutations within this locus on the size and serological reactivity of the LOS produced by gonococcal transformants suggests that these genes are the glycosyl transferases responsible for the biosynthesis of most of the lacto-N-neotetraose chain. The data obtained allow an identification of the function of each of these genes. It is noteworthy that lgtB and lgtE, which are structurally very closely related, also perform an apparently very similar biosynthetic task, i.e. the addition of Galβ1→4 to GlcNAc or Glc, respectively. Similarly, the closely related lgtA and lgtD add, GalNAc or GlcNAc β1→3, respectively, to a Gal residue. lgtC, which is unrelated to the other genes in the locus, is responsible for the addition of a Galα1→4. [0134]
  • The DNA sequence showed that three of the genes (lgtA, lgtC and lgtD) contain tracts of guanosines which code for glycine residues in the proteins. These provide a potential mechanism for high-frequency variation of expression of these genes. Slippage in such poly-G tracts is well documented to control the expression of the gonococcal pilC genes, with resultant effects on pilus adhesiveness to human epithelial cells (Rudel et al., 1992, Molec. Microbiol. 6:3439). In strain F62, the numbers of bases in each of the three poly-G regions were such that the proteins are in frame, and this is in keeping with the ability of F62 wild type to produce a complete LOS including the addition of the terminal GalNAc. [0135]
  • Three aspects of LOS biosynthesis appear potentially to be subject to high frequency variation. The first is the addition of the terminal GalNAc (lgtD). This would cause an alteration of reactivity with monoclonal antibody 1-1-M, and this phase variation has been reported by van Putten (Van Putten, 1993, EMBO J. 12:4043). Similarly, a change in lgtA would cause the failure of the addition of GlcNAc to the growing chain and truncate the LOS at the β-lactosyl level. This is a very common form of LOS in gonococci with a 3.6 kilodalton molecule, which confers resistance to the bactericidal effect of normal human serum (Schneider et al., 1985, Infect. Immun. 50:672). It is tempting to speculate that the in vitro variation between variant A and C of MS11[0136] mk from the β-lactosyl chain to a complete LOS (which had a selective advantage in vivo in the volunteers) could be explained by regaining functional expression, of the GlcNAc transferase lgtA. Finally, the variable addition of α1→4Gal to either the β-lactosyl (pk-like globo-triose) or the lacto-N-neotetraose group (Pi-like globoside) (Mandrell, 1992, Infect. Immun. 60:3017) would be under the control of the expression of lgtC. The activity of the lgtC transferase appears to compete poorly with the other transferases for precursor and its activity is evident only if either lgtA or lgtD are silent. For the Galα1→4Galβ1→4Glc trisaccharide to be synthesized the GlcNAc transferase lgtA must be inactive and for expression of the Pi-like globoside Galα1→4Galβ1→4GlcNAcβ1→3Galβ1→4Glc the GalNAc transferase lgtD must be silent.
  • Comparable high frequency antigenic variation of [0137] Haemophilus influenzae LOS has also been noted and has been attributed to changes in translational frame caused by shifts in the number of CAAT repeats in two separate loci, lic1 (Weiser et al., 1989, Cell 59:657) and lic2 (High et al., 1993, Molec. Microbiol. 9:1275). Shifts allowing the expression of the lic2 gene are correlated with the expression of an epitope with the structure Galα1→4Galβ1→. Since the lic2 gene is homologous to lgtB and lgtE the galactosyl transferases which link Galβ1→4 to respectively Glc or GlcNAc, it is likely that this is its function in Haemophilus influenzae LOS synthesis. It is remarkable that while both these mucosal pathogens have evolved frame shift mechanisms to cause antigenic variation of the LOS, that the gonococcal homologs of lic2, (lgtB and lgtE) are not the ones that contain poly-G tracts.
  • While the frame-shift mechanisms discussed above are suited for on/off regulation of gene expression, the structure of the locus also lends itself to more subtle regulation of the level of expression of the genes. It has been demonstrated that growth rate affects the molecular weight distribution and antigenic character LOS species produced (Morse et al., 1983, Infect. Immun. 41:74). While I have not determined the size of the RNA transcripts it is very likely that lgtA, lgtB and lgtC (in the instance where the poly-G tracts are such that the coding frame is maintained) are transcribed together. The termination codon of lgtA and the initiation codon of lgtB in fact overlap, and the distance between the TAA of lgtB and the ATG of lgtC is only 11 bp. Similarly, the stop codon of lgtD and the start codon of lgtE are separated by only 18 bp. Yet the organization is such that if any of the three genes subject to phase variation are in the off configuration, transcription is able to reinitiate effectively at the beginning of the next gene. This ability to reinitiate transcription was clearly seen with the mutations constructed in this study. [0138]
  • The correlation of LOS structure with function is still in its early stages. The major advances in the field have been the development of an understanding of the structure of the molecules and the ability to relate this, often unambiguously, to the reactivity with a number of well-characterized monoclonal antibodies. Added to this is the realization that in the in vivo environment, which provides CMP-NANA, the organism may or may not sialylate the LOS, depending whether the LOS synthesized is a competent acceptor structure. It is well known that sialylation induces a serum-resistant state in many strains. However, the effect of sialylation in local infection is not as well studied. van Putten has shown that sialylation of LOS has a marked inhibitory effect on epithelial cell invasion, without apparently greatly altering adhesion (Van Putten, 1993, EMBO J. 12:4043). His studies suggest that in the mucosal infection, LOS structures that cannot be sialylated may be important for efficient cell invasion. In the context of this report, such structures could be achieved either by the efficient addition of the terminal GalNAc or by shortening the LOS chain by silencing the GlcNAc transferase. The correlation of LOS chemistry with biological reaction has been complicated by the leakiness of the existing LOS mutants isolated by pyocin selection (Dudas and Apicella, 1988, Infect. Immun. 56:499; Sandlin et al., 1993, Infect. Immun. 61:3360). This is in fact exemplified with mutant 1291e which shows in addition to the major low molecular weight band, an additional higher band (see FIG. 7). The new insight provided into the genetics of the biosynthesis of gonococcal LOS will allow construction of mutants that are not leaky. For instance, Δ4 and Δ5 should be stable mutants since they no longer contain genes with poly-G tracts. The expression of the genes containing the poly-G tracts could be stabilized by engineering the areas so that glycines are encoded by other codons. [0139]
  • The present invention is not to be limited in scope by the specific embodiments described herein, since such embodiments are intended as but single illustrations of one aspect of the invention and any functionally equivalent embodiments are within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims. It is also to be understood that all base pair sizes given for nucleotides are approximate and are used for the purpose of description. Various references are cited herein, the disclosures of which are incorporated by reference herein in their entirety. [0140]
  • 1 13 1 5859 DNA Neisseria gonorrheae CDS (1)..(381) glys (glycyl tRNA syntetase beta chain) 1 ctg cag gcc gtc gcc gta ttc aaa caa ctg ccc gaa gcc gcc gcg ctc 48 Leu Gln Ala Val Ala Val Phe Lys Gln Leu Pro Glu Ala Ala Ala Leu 1 5 10 15 gcc gcc gcc aac aaa cgc gtg caa aac ctg ctg aaa aaa gcc gat gcc 96 Ala Ala Ala Asn Lys Arg Val Gln Asn Leu Leu Lys Lys Ala Asp Ala 20 25 30 gcg ttg ggc gaa gtc aat gaa agc ctg ctg caa cag gac gaa gaa aaa 144 Ala Leu Gly Glu Val Asn Glu Ser Leu Leu Gln Gln Asp Glu Glu Lys 35 40 45 gcc ctg tac gct gcc gcg caa ggt ttg cag ccg aaa att gcc gcc gcc 192 Ala Leu Tyr Ala Ala Ala Gln Gly Leu Gln Pro Lys Ile Ala Ala Ala 50 55 60 gtc gcc gaa ggc aat ttc cga acc gcc ttg tcc gaa ctg gct tcc gtc 240 Val Ala Glu Gly Asn Phe Arg Thr Ala Leu Ser Glu Leu Ala Ser Val 65 70 75 80 aag ccg cag gtt gat gcc ttc ttc gac ggc gtg atg gtg atg gcg gaa 288 Lys Pro Gln Val Asp Ala Phe Phe Asp Gly Val Met Val Met Ala Glu 85 90 95 gat gcc gcc gta aaa caa aac cgc ctg aac ctg ctg aac cgc ttg gca 336 Asp Ala Ala Val Lys Gln Asn Arg Leu Asn Leu Leu Asn Arg Leu Ala 100 105 110 gag cag atg aac gcg gtg gcc gac atc gcg ctt ttg ggc gag taa 381 Glu Gln Met Asn Ala Val Ala Asp Ile Ala Leu Leu Gly Glu 115 120 125 ccgttgtaca gtccaaatgc cgtctgaagc cttcaggcgg catcaaatta tcgggagagt 441 aaa ttg cag cct tta gtc agc gta ttg att tgc gcc tac aac gta gaa 489 Leu Gln Pro Leu Val Ser Val Leu Ile Cys Ala Tyr Asn Val Glu 130 135 140 aaa tat ttt gcc caa tca tta gcc gcc gtc gtg aat cag act tgg cgc 537 Lys Tyr Phe Ala Gln Ser Leu Ala Ala Val Val Asn Gln Thr Trp Arg 145 150 155 aac ttg gat att ttg att gtc gat gac ggc tcg aca gac ggc aca ctt 585 Asn Leu Asp Ile Leu Ile Val Asp Asp Gly Ser Thr Asp Gly Thr Leu 160 165 170 gcc att gcc aag gat ttt caa aag cgg gac agc cgt atc aaa atc ctt 633 Ala Ile Ala Lys Asp Phe Gln Lys Arg Asp Ser Arg Ile Lys Ile Leu 175 180 185 gca caa gct caa aat tcc ggc ctg att ccc tct tta aac atc ggg ctg 681 Ala Gln Ala Gln Asn Ser Gly Leu Ile Pro Ser Leu Asn Ile Gly Leu 190 195 200 205 gac gaa ttg gca aag tcg ggg ggg ggg ggg ggg gaa tat att gcg cgc 729 Asp Glu Leu Ala Lys Ser Gly Gly Gly Gly Gly Glu Tyr Ile Ala Arg 210 215 220 acc gat gcc gac gat att gcc tcc ccc ggc tgg att gag aaa atc gtg 777 Thr Asp Ala Asp Asp Ile Ala Ser Pro Gly Trp Ile Glu Lys Ile Val 225 230 235 ggc gag atg gaa aaa gac cgc agc atc att gcg atg ggc gcg tgg ctg 825 Gly Glu Met Glu Lys Asp Arg Ser Ile Ile Ala Met Gly Ala Trp Leu 240 245 250 gaa gtt ttg tcg gaa gaa aag gac ggc aac cgg ctg gcg cgg cac cac 873 Glu Val Leu Ser Glu Glu Lys Asp Gly Asn Arg Leu Ala Arg His His 255 260 265 aaa cac ggc aaa att tgg aaa aag ccg acc cgg cac gaa gac atc gcc 921 Lys His Gly Lys Ile Trp Lys Lys Pro Thr Arg His Glu Asp Ile Ala 270 275 280 285 gcc ttt ttc cct ttc ggc aac ccc ata cac aac aac acg atg att atg 969 Ala Phe Phe Pro Phe Gly Asn Pro Ile His Asn Asn Thr Met Ile Met 290 295 300 cgg cgc agc gtc att gac ggc ggt ttg cgt tac gac acc gag cgg gat 1017 Arg Arg Ser Val Ile Asp Gly Gly Leu Arg Tyr Asp Thr Glu Arg Asp 305 310 315 tgg gcg gaa gat tac caa ttt tgg tac gat gtc agc aaa ttg ggc agg 1065 Trp Ala Glu Asp Tyr Gln Phe Trp Tyr Asp Val Ser Lys Leu Gly Arg 320 325 330 ctg gct tat tat ccc gaa gcc ttg gtc aaa tac cgc ctt cac gcc aat 1113 Leu Ala Tyr Tyr Pro Glu Ala Leu Val Lys Tyr Arg Leu His Ala Asn 335 340 345 cag gtt tca tcc aaa cac agc gtc cgc caa cac gaa atc gcg caa ggc 1161 Gln Val Ser Ser Lys His Ser Val Arg Gln His Glu Ile Ala Gln Gly 350 355 360 365 atc caa aaa acc gcc aga aac gat ttt ttg cag tct atg ggt ttt aaa 1209 Ile Gln Lys Thr Ala Arg Asn Asp Phe Leu Gln Ser Met Gly Phe Lys 370 375 380 acc cgg ttc gac agc cta gaa tac cgc caa aca aaa gca gcg gcg tat 1257 Thr Arg Phe Asp Ser Leu Glu Tyr Arg Gln Thr Lys Ala Ala Ala Tyr 385 390 395 gaa ctg ccg gag aag gat ttg ccg gaa gaa gat ttt gaa cgc gcc cgc 1305 Glu Leu Pro Glu Lys Asp Leu Pro Glu Glu Asp Phe Glu Arg Ala Arg 400 405 410 cgg ttt ttg tac caa tgc ttc aaa cgg acg gac acg ccg ccc tcc ggc 1353 Arg Phe Leu Tyr Gln Cys Phe Lys Arg Thr Asp Thr Pro Pro Ser Gly 415 420 425 gcg tgg ctg gat ttc gcg gca gac ggc agg atg agg cgg ctg ttt acc 1401 Ala Trp Leu Asp Phe Ala Ala Asp Gly Arg Met Arg Arg Leu Phe Thr 430 435 440 445 ttg agg caa tac ttc ggc att ttg tac cgg ctg att aaa aac cgc cgg 1449 Leu Arg Gln Tyr Phe Gly Ile Leu Tyr Arg Leu Ile Lys Asn Arg Arg 450 455 460 cag gcg cgg tcg gat tcg gca ggg aaa gaa cag gag att taa 1491 Gln Ala Arg Ser Asp Ser Ala Gly Lys Glu Gln Glu Ile 465 470 tgcaaaacca cgttatcagc ttggcttccg ccgcagaacg cagggcgcac attgccgcaa 1551 ccttcggcag tcgcggcatc ccgttccagt ttttcgacgc actgatgccg tctgaaaggc 1611 tggaacgggc aatggcggaa ctcgtccccg gcttgtcggc gcacccctat ttgagcggag 1671 tggaaaaagc ctgctttatg agccacgccg tattgtggga acaggcattg gacgaaggcg 1731 taccgtatat cgccgtattt gaagatgatg tcttactcgg cgaaggcgcg gagcagttcc 1791 ttgccgaaga tacttggctg caagaacgct ttgaccccga ttccgccttt gtcgtccgct 1851 tggaaacgat gtttatgcac gtcctgacct cgccctccgg cgtggcggac tacggcgggc 1911 gcgcctttcc gcttttggaa agcgaacact gcgggacggc gggctatatt atttcccgaa 1971 aggcgatgcg ttttttcttg gacaggtttg ccgttttgcc gcccgaacgc ctgcaccctg 2031 tcgatttgat gatgttcggc aaccctgacg acagggaagg aatgccggtt tgccagctca 2091 atcccgcctt gtgcgcccaa gagctgcatt atgccaagtt tcacgaccaa aacagcgcat 2151 tgggcagcct gatcgaacat gaccgccgcc tgaaccgcaa acagcaatgg cgcgattccc 2211 ccgccaacac attcaaacac cgcctgatcc gcgccttgac caaaatcggc agggaaaggg 2271 aaaaacgccg gcaaaggcgc gaacagttaa tcggcaagat tattgtgcct ttccaataaa 2331 aggagaaaag atg gac atc gta ttt gcg gca gac gac aac tat gcc gcc 2380 Met Asp Ile Val Phe Ala Ala Asp Asp Asn Tyr Ala Ala 475 480 485 tac ctt tgc gtt gcg gca aaa agc gtg gaa gcg gcc cat ccc gat acg 2428 Tyr Leu Cys Val Ala Ala Lys Ser Val Glu Ala Ala His Pro Asp Thr 490 495 500 gaa atc agg ttc cac gtc ctc gat gcc ggc atc agt gag gaa aac cgg 2476 Glu Ile Arg Phe His Val Leu Asp Ala Gly Ile Ser Glu Glu Asn Arg 505 510 515 gcg gcg gtt gcc gcc aat ttg cgg ggg ggg ggt aat atc cgc ttt ata 2524 Ala Ala Val Ala Ala Asn Leu Arg Gly Gly Gly Asn Ile Arg Phe Ile 520 525 530 535 gac gta aac ccc gaa gat ttc gcc ggc ttc ccc tta aac atc agg cac 2572 Asp Val Asn Pro Glu Asp Phe Ala Gly Phe Pro Leu Asn Ile Arg His 540 545 550 att tcc att acg act tat gcc cgc ctg aaa ttg ggc gaa tac att gcc 2620 Ile Ser Ile Thr Thr Tyr Ala Arg Leu Lys Leu Gly Glu Tyr Ile Ala 555 560 565 gat tgc gac aaa gtc ctg tat ctg gat acg gac gta ttg gtc agg gac 2668 Asp Cys Asp Lys Val Leu Tyr Leu Asp Thr Asp Val Leu Val Arg Asp 570 575 580 ggc ctg aag ccc tta tgg gat acc gat ttg ggc ggt aac tgg gtc ggc 2716 Gly Leu Lys Pro Leu Trp Asp Thr Asp Leu Gly Gly Asn Trp Val Gly 585 590 595 gcg tgc atc gat ttg ttt gtc gaa agg cag gaa gga tac aaa caa aaa 2764 Ala Cys Ile Asp Leu Phe Val Glu Arg Gln Glu Gly Tyr Lys Gln Lys 600 605 610 615 atc ggt atg gcg gac gga gaa tat tat ttc aat gcc ggc gta ttg ctg 2812 Ile Gly Met Ala Asp Gly Glu Tyr Tyr Phe Asn Ala Gly Val Leu Leu 620 625 630 atc aac ctg aaa aag tgg cgg cgg cac gat att ttc aaa atg tcc tgc 2860 Ile Asn Leu Lys Lys Trp Arg Arg His Asp Ile Phe Lys Met Ser Cys 635 640 645 gaa tgg gtg gaa caa tac aag gac gtg atg caa tat cag gat cag gac 2908 Glu Trp Val Glu Gln Tyr Lys Asp Val Met Gln Tyr Gln Asp Gln Asp 650 655 660 att ttg aac ggg ctg ttt aaa ggc ggg gtg tgt tat gcg aac agc cgt 2956 Ile Leu Asn Gly Leu Phe Lys Gly Gly Val Cys Tyr Ala Asn Ser Arg 665 670 675 ttc aac ttt atg ccg acc aat tat gcc ttt atg gcg aac ggg ttt gcg 3004 Phe Asn Phe Met Pro Thr Asn Tyr Ala Phe Met Ala Asn Gly Phe Ala 680 685 690 695 tcc cgc cat acc gac ccg ctt tac ctc gac cgt acc aat acg gcg atg 3052 Ser Arg His Thr Asp Pro Leu Tyr Leu Asp Arg Thr Asn Thr Ala Met 700 705 710 ccc gtc gcc gtc agc cat tat tgc ggc tcg gca aag ccg tgg cac agg 3100 Pro Val Ala Val Ser His Tyr Cys Gly Ser Ala Lys Pro Trp His Arg 715 720 725 gac tgc acc gtt tgg ggt gcg gaa cgt ttc aca gag ttg gcc ggc agc 3148 Asp Cys Thr Val Trp Gly Ala Glu Arg Phe Thr Glu Leu Ala Gly Ser 730 735 740 ctg acg acc gtt ccc gaa gaa tgg cgc ggc aaa ctt gcc gtc ccg ccg 3196 Leu Thr Thr Val Pro Glu Glu Trp Arg Gly Lys Leu Ala Val Pro Pro 745 750 755 aca aag tgt atg ctt caa aga tgg cgc aaa aag ctg tct gcc aga ttc 3244 Thr Lys Cys Met Leu Gln Arg Trp Arg Lys Lys Leu Ser Ala Arg Phe 760 765 770 775 tta cgc aag att tat tga cggggcaggc cgtctgaagc cttcagacgg 3292 Leu Arg Lys Ile Tyr 780 catcggacgt atcggaaagg agaaacgga ttg cag cct tta gtc agc gta ttg 3345 Leu Gln Pro Leu Val Ser Val Leu 785 att tgc gcc tac aac gca gaa aaa tat ttt gcc caa tca ttg gcc gcc 3393 Ile Cys Ala Tyr Asn Ala Glu Lys Tyr Phe Ala Gln Ser Leu Ala Ala 790 795 800 gta gtg ggg cag act tgg cgc aac ttg gat att ttg att gtc gat gac 3441 Val Val Gly Gln Thr Trp Arg Asn Leu Asp Ile Leu Ile Val Asp Asp 805 810 815 820 ggc tcg acg gac ggc acg ccc gcc att gcc cgg cat ttc caa gaa cag 3489 Gly Ser Thr Asp Gly Thr Pro Ala Ile Ala Arg His Phe Gln Glu Gln 825 830 835 gac ggc agg atc agg ata att tcc aat ccc cgc aat ttg ggc ttt atc 3537 Asp Gly Arg Ile Arg Ile Ile Ser Asn Pro Arg Asn Leu Gly Phe Ile 840 845 850 gcc tct tta aac atc ggg ctg gac gaa ttg gca aag tcg ggg ggg ggg 3585 Ala Ser Leu Asn Ile Gly Leu Asp Glu Leu Ala Lys Ser Gly Gly Gly 855 860 865 gaa tat att gcg cgc acc gat gcc gac gat att gcc tcc ccc ggc tgg 3633 Glu Tyr Ile Ala Arg Thr Asp Ala Asp Asp Ile Ala Ser Pro Gly Trp 870 875 880 att gag aaa atc gtg ggc gag atg gaa aaa gac cgc agc atc att gcg 3681 Ile Glu Lys Ile Val Gly Glu Met Glu Lys Asp Arg Ser Ile Ile Ala 885 890 895 900 atg ggc gcg tgg ttg gaa gtt ttg tcg gaa gaa aac aat aaa agc gtg 3729 Met Gly Ala Trp Leu Glu Val Leu Ser Glu Glu Asn Asn Lys Ser Val 905 910 915 ctt gcc gcc att gcc cga aac ggc gca att tgg gac aaa ccg acc cgg 3777 Leu Ala Ala Ile Ala Arg Asn Gly Ala Ile Trp Asp Lys Pro Thr Arg 920 925 930 cat gaa gac att gtc gcc gtt ttc cct ttc ggc aac ccc ata cac aac 3825 His Glu Asp Ile Val Ala Val Phe Pro Phe Gly Asn Pro Ile His Asn 935 940 945 aac acg atg att atg agg cgc agc gtc att gac ggc ggt ttg cgg ttc 3873 Asn Thr Met Ile Met Arg Arg Ser Val Ile Asp Gly Gly Leu Arg Phe 950 955 960 gat cca gcc tat atc cac gcc gaa gac tat aag ttt tgg tac gaa gcc 3921 Asp Pro Ala Tyr Ile His Ala Glu Asp Tyr Lys Phe Trp Tyr Glu Ala 965 970 975 980 ggc aaa ctg ggc agg ctg gct tat tat ccc gaa gcc ttg gtc aaa tac 3969 Gly Lys Leu Gly Arg Leu Ala Tyr Tyr Pro Glu Ala Leu Val Lys Tyr 985 990 995 cgc ttc cat caa gac cag act tct tcc aaa tac aac ctg caa cag 4014 Arg Phe His Gln Asp Gln Thr Ser Ser Lys Tyr Asn Leu Gln Gln 1000 1005 1010 cgc agg acg gcg tgg aaa atc aaa gaa gaa atc agg gcg ggg tat 4059 Arg Arg Thr Ala Trp Lys Ile Lys Glu Glu Ile Arg Ala Gly Tyr 1015 1020 1025 tgg aag gcg gca ggc ata gcc gtc ggg gcg gac tgc ctg aat tac 4104 Trp Lys Ala Ala Gly Ile Ala Val Gly Ala Asp Cys Leu Asn Tyr 1030 1035 1040 ggg ctt ttg aaa tca acg gca tat gcg ttg tac gaa aaa gcc ttg 4149 Gly Leu Leu Lys Ser Thr Ala Tyr Ala Leu Tyr Glu Lys Ala Leu 1045 1050 1055 tcc gga cag gat atc gga tgc ctc cgc ctg ttc ctg tac gaa tat 4194 Ser Gly Gln Asp Ile Gly Cys Leu Arg Leu Phe Leu Tyr Glu Tyr 1060 1065 1070 ttc ttg tcg ttg gaa aag tat tct ttg acc gat ttg ctg gat ttc 4239 Phe Leu Ser Leu Glu Lys Tyr Ser Leu Thr Asp Leu Leu Asp Phe 1075 1080 1085 ttg aca gac cgc gtg atg agg aag ctg ttt gcc gca ccg caa tat 4284 Leu Thr Asp Arg Val Met Arg Lys Leu Phe Ala Ala Pro Gln Tyr 1090 1095 1100 agg aaa atc ctg aaa aaa atg tta cgc cct tgg aaa tac cgc agc 4329 Arg Lys Ile Leu Lys Lys Met Leu Arg Pro Trp Lys Tyr Arg Ser 1105 1110 1115 tat tga aaccgaacag gataaatc atg caa aac cac gtt atc agc ttg gct 4380 Tyr Met Gln Asn His Val Ile Ser Leu Ala 1120 1125 tcc gcc gca gag cgc agg gcg cac att gcc gat acc ttc ggc agt 4425 Ser Ala Ala Glu Arg Arg Ala His Ile Ala Asp Thr Phe Gly Ser 1130 1135 1140 cgc ggc atc ccg ttc cag ttt ttc gac gca ctg atg ccg tct gaa 4470 Arg Gly Ile Pro Phe Gln Phe Phe Asp Ala Leu Met Pro Ser Glu 1145 1150 1155 agg ctg gaa cag gcg atg gcg gaa ctc gtc ccc ggc ttg tcg gcg 4515 Arg Leu Glu Gln Ala Met Ala Glu Leu Val Pro Gly Leu Ser Ala 1160 1165 1170 cac ccc tat ttg agc gga gtg gaa aaa gcc tgc ttt atg agc cac 4560 His Pro Tyr Leu Ser Gly Val Glu Lys Ala Cys Phe Met Ser His 1175 1180 1185 gcc gta ttg tgg gaa cag gcg ttg gat gaa ggt ctg ccg tat atc 4605 Ala Val Leu Trp Glu Gln Ala Leu Asp Glu Gly Leu Pro Tyr Ile 1190 1195 1200 gcc gta ttt gag gac gac gtt tta ctc ggc gaa ggc gcg gag cag 4650 Ala Val Phe Glu Asp Asp Val Leu Leu Gly Glu Gly Ala Glu Gln 1205 1210 1215 ttc ctt gcc gaa gat act tgg ttg gaa gag cgt ttt gac aag gat 4695 Phe Leu Ala Glu Asp Thr Trp Leu Glu Glu Arg Phe Asp Lys Asp 1220 1225 1230 tcc gcc ttt atc gtc cgt ttg gaa acg atg ttt gcg aaa gtt att 4740 Ser Ala Phe Ile Val Arg Leu Glu Thr Met Phe Ala Lys Val Ile 1235 1240 1245 gtc aga ccg gat aaa gtc ctg aat tat gaa aac cgg tca ttt cct 4785 Val Arg Pro Asp Lys Val Leu Asn Tyr Glu Asn Arg Ser Phe Pro 1250 1255 1260 ttg ctg gag agc gaa cat tgt ggg acg gct ggc tat atc att tcg 4830 Leu Leu Glu Ser Glu His Cys Gly Thr Ala Gly Tyr Ile Ile Ser 1265 1270 1275 cgt gag gcg atg cgg ttt ttc ttg gac agg ttt gcc gtt ttg ccg 4875 Arg Glu Ala Met Arg Phe Phe Leu Asp Arg Phe Ala Val Leu Pro 1280 1285 1290 cca gag cgg att aaa gcg gta gat ttg atg atg ttt act tat ttc 4920 Pro Glu Arg Ile Lys Ala Val Asp Leu Met Met Phe Thr Tyr Phe 1295 1300 1305 ttt gat aag gag ggg atg cct gtt tat cag gtt agt ccc gcc tta 4965 Phe Asp Lys Glu Gly Met Pro Val Tyr Gln Val Ser Pro Ala Leu 1310 1315 1320 tgt acc caa gaa ttg cat tat gcc aag ttt ctc agt caa aac agt 5010 Cys Thr Gln Glu Leu His Tyr Ala Lys Phe Leu Ser Gln Asn Ser 1325 1330 1335 atg ttg ggt agc gat ttg gaa aaa gat agg gaa caa gga aga aga 5055 Met Leu Gly Ser Asp Leu Glu Lys Asp Arg Glu Gln Gly Arg Arg 1340 1345 1350 cac cgc cgt tcg ttg aag gtg atg ttt gac ttg aag cgt gct ttg 5100 His Arg Arg Ser Leu Lys Val Met Phe Asp Leu Lys Arg Ala Leu 1355 1360 1365 ggt aaa ttc ggt agg gaa aag aag aaa aga atg gag cgt caa agg 5145 Gly Lys Phe Gly Arg Glu Lys Lys Lys Arg Met Glu Arg Gln Arg 1370 1375 1380 cag gcg gag ctt gag aaa gtt tac ggc agg cgg gtc ata ttg ttc 5190 Gln Ala Glu Leu Glu Lys Val Tyr Gly Arg Arg Val Ile Leu Phe 1385 1390 1395 aaa tag tttgtgtaaa atatagggga ttaaaatcag aaatggacac actgtcattc 5246 Lys ccgcgcaggc gggaatctag gtctttaaac ttcggttttt tccgataaat tcttgccgca 5306 ttaaaattcc agattcccgc tttcgcgggg atgacggcgg ggggattgtt gctttttcgg 5366 ataaaatccc gtgttttttc atctgctagg taaaatcgcc ccaaagcgtc tgcatcgcgg 5426 cgatggcggc gagtggggcg gtttctgtgc gtaaaatccg ttttccgagt gtaaccgcct 5486 gaaagccggc ttcaaatgcc tgttgttctt cctgttctgt ccagccgcct tcgggcccga 5546 ccataaagac gattgcgccg gacgggtggc ggatgtcgcc gagtttgcag gcgcggttga 5606 tgctcataat cagcttggtg ttttcagacg gcattttgtc gagtgcttca cggtagccga 5666 tgatgggcag tacgggggga acggtgttcc tgccgctttg ttcgcacgcg gagatgacga 5726 tttcctgcca gcgtgcgagg cgtttggcgg cgcgttctcc gtcgaggcgg acgatgcagc 5786 gttcgctgat gacgggctgt atggcggtta cgccgagttc gacgcttttt tgcagggtga 5846 aatccatgcg atc 5859 2 126 PRT Neisseria gonorrheae 2 Leu Gln Ala Val Ala Val Phe Lys Gln Leu Pro Glu Ala Ala Ala Leu 1 5 10 15 Ala Ala Ala Asn Lys Arg Val Gln Asn Leu Leu Lys Lys Ala Asp Ala 20 25 30 Ala Leu Gly Glu Val Asn Glu Ser Leu Leu Gln Gln Asp Glu Glu Lys 35 40 45 Ala Leu Tyr Ala Ala Ala Gln Gly Leu Gln Pro Lys Ile Ala Ala Ala 50 55 60 Val Ala Glu Gly Asn Phe Arg Thr Ala Leu Ser Glu Leu Ala Ser Val 65 70 75 80 Lys Pro Gln Val Asp Ala Phe Phe Asp Gly Val Met Val Met Ala Glu 85 90 95 Asp Ala Ala Val Lys Gln Asn Arg Leu Asn Leu Leu Asn Arg Leu Ala 100 105 110 Glu Gln Met Asn Ala Val Ala Asp Ile Ala Leu Leu Gly Glu 115 120 125 3 348 PRT Neisseria gonorrheae 3 Leu Gln Pro Leu Val Ser Val Leu Ile Cys Ala Tyr Asn Val Glu Lys 1 5 10 15 Tyr Phe Ala Gln Ser Leu Ala Ala Val Val Asn Gln Thr Trp Arg Asn 20 25 30 Leu Asp Ile Leu Ile Val Asp Asp Gly Ser Thr Asp Gly Thr Leu Ala 35 40 45 Ile Ala Lys Asp Phe Gln Lys Arg Asp Ser Arg Ile Lys Ile Leu Ala 50 55 60 Gln Ala Gln Asn Ser Gly Leu Ile Pro Ser Leu Asn Ile Gly Leu Asp 65 70 75 80 Glu Leu Ala Lys Ser Gly Gly Gly Gly Gly Glu Tyr Ile Ala Arg Thr 85 90 95 Asp Ala Asp Asp Ile Ala Ser Pro Gly Trp Ile Glu Lys Ile Val Gly 100 105 110 Glu Met Glu Lys Asp Arg Ser Ile Ile Ala Met Gly Ala Trp Leu Glu 115 120 125 Val Leu Ser Glu Glu Lys Asp Gly Asn Arg Leu Ala Arg His His Lys 130 135 140 His Gly Lys Ile Trp Lys Lys Pro Thr Arg His Glu Asp Ile Ala Ala 145 150 155 160 Phe Phe Pro Phe Gly Asn Pro Ile His Asn Asn Thr Met Ile Met Arg 165 170 175 Arg Ser Val Ile Asp Gly Gly Leu Arg Tyr Asp Thr Glu Arg Asp Trp 180 185 190 Ala Glu Asp Tyr Gln Phe Trp Tyr Asp Val Ser Lys Leu Gly Arg Leu 195 200 205 Ala Tyr Tyr Pro Glu Ala Leu Val Lys Tyr Arg Leu His Ala Asn Gln 210 215 220 Val Ser Ser Lys His Ser Val Arg Gln His Glu Ile Ala Gln Gly Ile 225 230 235 240 Gln Lys Thr Ala Arg Asn Asp Phe Leu Gln Ser Met Gly Phe Lys Thr 245 250 255 Arg Phe Asp Ser Leu Glu Tyr Arg Gln Thr Lys Ala Ala Ala Tyr Glu 260 265 270 Leu Pro Glu Lys Asp Leu Pro Glu Glu Asp Phe Glu Arg Ala Arg Arg 275 280 285 Phe Leu Tyr Gln Cys Phe Lys Arg Thr Asp Thr Pro Pro Ser Gly Ala 290 295 300 Trp Leu Asp Phe Ala Ala Asp Gly Arg Met Arg Arg Leu Phe Thr Leu 305 310 315 320 Arg Gln Tyr Phe Gly Ile Leu Tyr Arg Leu Ile Lys Asn Arg Arg Gln 325 330 335 Ala Arg Ser Asp Ser Ala Gly Lys Glu Gln Glu Ile 340 345 4 306 PRT Neisseria gonorrheae 4 Met Asp Ile Val Phe Ala Ala Asp Asp Asn Tyr Ala Ala Tyr Leu Cys 1 5 10 15 Val Ala Ala Lys Ser Val Glu Ala Ala His Pro Asp Thr Glu Ile Arg 20 25 30 Phe His Val Leu Asp Ala Gly Ile Ser Glu Glu Asn Arg Ala Ala Val 35 40 45 Ala Ala Asn Leu Arg Gly Gly Gly Asn Ile Arg Phe Ile Asp Val Asn 50 55 60 Pro Glu Asp Phe Ala Gly Phe Pro Leu Asn Ile Arg His Ile Ser Ile 65 70 75 80 Thr Thr Tyr Ala Arg Leu Lys Leu Gly Glu Tyr Ile Ala Asp Cys Asp 85 90 95 Lys Val Leu Tyr Leu Asp Thr Asp Val Leu Val Arg Asp Gly Leu Lys 100 105 110 Pro Leu Trp Asp Thr Asp Leu Gly Gly Asn Trp Val Gly Ala Cys Ile 115 120 125 Asp Leu Phe Val Glu Arg Gln Glu Gly Tyr Lys Gln Lys Ile Gly Met 130 135 140 Ala Asp Gly Glu Tyr Tyr Phe Asn Ala Gly Val Leu Leu Ile Asn Leu 145 150 155 160 Lys Lys Trp Arg Arg His Asp Ile Phe Lys Met Ser Cys Glu Trp Val 165 170 175 Glu Gln Tyr Lys Asp Val Met Gln Tyr Gln Asp Gln Asp Ile Leu Asn 180 185 190 Gly Leu Phe Lys Gly Gly Val Cys Tyr Ala Asn Ser Arg Phe Asn Phe 195 200 205 Met Pro Thr Asn Tyr Ala Phe Met Ala Asn Gly Phe Ala Ser Arg His 210 215 220 Thr Asp Pro Leu Tyr Leu Asp Arg Thr Asn Thr Ala Met Pro Val Ala 225 230 235 240 Val Ser His Tyr Cys Gly Ser Ala Lys Pro Trp His Arg Asp Cys Thr 245 250 255 Val Trp Gly Ala Glu Arg Phe Thr Glu Leu Ala Gly Ser Leu Thr Thr 260 265 270 Val Pro Glu Glu Trp Arg Gly Lys Leu Ala Val Pro Pro Thr Lys Cys 275 280 285 Met Leu Gln Arg Trp Arg Lys Lys Leu Ser Ala Arg Phe Leu Arg Lys 290 295 300 Ile Tyr 305 5 337 PRT Neisseria gonorrheae 5 Leu Gln Pro Leu Val Ser Val Leu Ile Cys Ala Tyr Asn Ala Glu Lys 1 5 10 15 Tyr Phe Ala Gln Ser Leu Ala Ala Val Val Gly Gln Thr Trp Arg Asn 20 25 30 Leu Asp Ile Leu Ile Val Asp Asp Gly Ser Thr Asp Gly Thr Pro Ala 35 40 45 Ile Ala Arg His Phe Gln Glu Gln Asp Gly Arg Ile Arg Ile Ile Ser 50 55 60 Asn Pro Arg Asn Leu Gly Phe Ile Ala Ser Leu Asn Ile Gly Leu Asp 65 70 75 80 Glu Leu Ala Lys Ser Gly Gly Gly Glu Tyr Ile Ala Arg Thr Asp Ala 85 90 95 Asp Asp Ile Ala Ser Pro Gly Trp Ile Glu Lys Ile Val Gly Glu Met 100 105 110 Glu Lys Asp Arg Ser Ile Ile Ala Met Gly Ala Trp Leu Glu Val Leu 115 120 125 Ser Glu Glu Asn Asn Lys Ser Val Leu Ala Ala Ile Ala Arg Asn Gly 130 135 140 Ala Ile Trp Asp Lys Pro Thr Arg His Glu Asp Ile Val Ala Val Phe 145 150 155 160 Pro Phe Gly Asn Pro Ile His Asn Asn Thr Met Ile Met Arg Arg Ser 165 170 175 Val Ile Asp Gly Gly Leu Arg Phe Asp Pro Ala Tyr Ile His Ala Glu 180 185 190 Asp Tyr Lys Phe Trp Tyr Glu Ala Gly Lys Leu Gly Arg Leu Ala Tyr 195 200 205 Tyr Pro Glu Ala Leu Val Lys Tyr Arg Phe His Gln Asp Gln Thr Ser 210 215 220 Ser Lys Tyr Asn Leu Gln Gln Arg Arg Thr Ala Trp Lys Ile Lys Glu 225 230 235 240 Glu Ile Arg Ala Gly Tyr Trp Lys Ala Ala Gly Ile Ala Val Gly Ala 245 250 255 Asp Cys Leu Asn Tyr Gly Leu Leu Lys Ser Thr Ala Tyr Ala Leu Tyr 260 265 270 Glu Lys Ala Leu Ser Gly Gln Asp Ile Gly Cys Leu Arg Leu Phe Leu 275 280 285 Tyr Glu Tyr Phe Leu Ser Leu Glu Lys Tyr Ser Leu Thr Asp Leu Leu 290 295 300 Asp Phe Leu Thr Asp Arg Val Met Arg Lys Leu Phe Ala Ala Pro Gln 305 310 315 320 Tyr Arg Lys Ile Leu Lys Lys Met Leu Arg Pro Trp Lys Tyr Arg Ser 325 330 335 Tyr 6 280 PRT Neisseria gonorrheae 6 Met Gln Asn His Val Ile Ser Leu Ala Ser Ala Ala Glu Arg Arg Ala 1 5 10 15 His Ile Ala Asp Thr Phe Gly Ser Arg Gly Ile Pro Phe Gln Phe Phe 20 25 30 Asp Ala Leu Met Pro Ser Glu Arg Leu Glu Gln Ala Met Ala Glu Leu 35 40 45 Val Pro Gly Leu Ser Ala His Pro Tyr Leu Ser Gly Val Glu Lys Ala 50 55 60 Cys Phe Met Ser His Ala Val Leu Trp Glu Gln Ala Leu Asp Glu Gly 65 70 75 80 Leu Pro Tyr Ile Ala Val Phe Glu Asp Asp Val Leu Leu Gly Glu Gly 85 90 95 Ala Glu Gln Phe Leu Ala Glu Asp Thr Trp Leu Glu Glu Arg Phe Asp 100 105 110 Lys Asp Ser Ala Phe Ile Val Arg Leu Glu Thr Met Phe Ala Lys Val 115 120 125 Ile Val Arg Pro Asp Lys Val Leu Asn Tyr Glu Asn Arg Ser Phe Pro 130 135 140 Leu Leu Glu Ser Glu His Cys Gly Thr Ala Gly Tyr Ile Ile Ser Arg 145 150 155 160 Glu Ala Met Arg Phe Phe Leu Asp Arg Phe Ala Val Leu Pro Pro Glu 165 170 175 Arg Ile Lys Ala Val Asp Leu Met Met Phe Thr Tyr Phe Phe Asp Lys 180 185 190 Glu Gly Met Pro Val Tyr Gln Val Ser Pro Ala Leu Cys Thr Gln Glu 195 200 205 Leu His Tyr Ala Lys Phe Leu Ser Gln Asn Ser Met Leu Gly Ser Asp 210 215 220 Leu Glu Lys Asp Arg Glu Gln Gly Arg Arg His Arg Arg Ser Leu Lys 225 230 235 240 Val Met Phe Asp Leu Lys Arg Ala Leu Gly Lys Phe Gly Arg Glu Lys 245 250 255 Lys Lys Arg Met Glu Arg Gln Arg Gln Ala Glu Leu Glu Lys Val Tyr 260 265 270 Gly Arg Arg Val Ile Leu Phe Lys 275 280 7 5859 DNA Neisseria gonorrheae CDS (1491)..(2330) lgtB 7 ctgcaggccg tcgccgtatt caaacaactg cccgaagccg ccgcgctcgc cgccgccaac 60 aaacgcgtgc aaaacctgct gaaaaaagcc gatgccgcgt tgggcgaagt caatgaaagc 120 ctgctgcaac aggacgaaga aaaagccctg tacgctgccg cgcaaggttt gcagccgaaa 180 attgccgccg ccgtcgccga aggcaatttc cgaaccgcct tgtccgaact ggcttccgtc 240 aagccgcagg ttgatgcctt cttcgacggc gtgatggtga tggcggaaga tgccgccgta 300 aaacaaaacc gcctgaacct gctgaaccgc ttggcagagc agatgaacgc ggtggccgac 360 atcgcgcttt tgggcgagta accgttgtac agtccaaatg ccgtctgaag ccttcaggcg 420 gcatcaaatt atcgggagag taaattgcag cctttagtca gcgtattgat ttgcgcctac 480 aacgtagaaa aatattttgc ccaatcatta gccgccgtcg tgaatcagac ttggcgcaac 540 ttggatattt tgattgtcga tgacggctcg acagacggca cacttgccat tgccaaggat 600 tttcaaaagc gggacagccg tatcaaaatc cttgcacaag ctcaaaattc cggcctgatt 660 ccctctttaa acatcgggct ggacgaattg gcaaagtcgg gggggggggg gggggaatat 720 attgcgcgca ccgatgccga cgatattgcc tcccccggct ggattgagaa aatcgtgggc 780 gagatggaaa aagaccgcag catcattgcg atgggcgcgt ggctggaagt tttgtcggaa 840 gaaaaggacg gcaaccggct ggcgcggcac cacaaacacg gcaaaatttg gaaaaagccg 900 acccggcacg aagacatcgc cgcctttttc cctttcggca accccataca caacaacacg 960 atgattatgc ggcgcagcgt cattgacggc ggtttgcgtt acgacaccga gcgggattgg 1020 gcggaagatt accaattttg gtacgatgtc agcaaattgg gcaggctggc ttattatccc 1080 gaagccttgg tcaaataccg ccttcacgcc aatcaggttt catccaaaca cagcgtccgc 1140 caacacgaaa tcgcgcaagg catccaaaaa accgccagaa acgatttttt gcagtctatg 1200 ggttttaaaa cccggttcga cagcctagaa taccgccaaa caaaagcagc ggcgtatgaa 1260 ctgccggaga aggatttgcc ggaagaagat tttgaacgcg cccgccggtt tttgtaccaa 1320 tgcttcaaac ggacggacac gccgccctcc ggcgcgtggc tggatttcgc ggcagacggc 1380 aggatgaggc ggctgtttac cttgaggcaa tacttcggca ttttgtaccg gctgattaaa 1440 aaccgccggc aggcgcggtc ggattcggca gggaaagaac aggagattta atg caa 1496 Met Gln 1 aac cac gtt atc agc ttg gct tcc gcc gca gaa cgc agg gcg cac att 1544 Asn His Val Ile Ser Leu Ala Ser Ala Ala Glu Arg Arg Ala His Ile 5 10 15 gcc gca acc ttc ggc agt cgc ggc atc ccg ttc cag ttt ttc gac gca 1592 Ala Ala Thr Phe Gly Ser Arg Gly Ile Pro Phe Gln Phe Phe Asp Ala 20 25 30 ctg atg ccg tct gaa agg ctg gaa cgg gca atg gcg gaa ctc gtc ccc 1640 Leu Met Pro Ser Glu Arg Leu Glu Arg Ala Met Ala Glu Leu Val Pro 35 40 45 50 ggc ttg tcg gcg cac ccc tat ttg agc gga gtg gaa aaa gcc tgc ttt 1688 Gly Leu Ser Ala His Pro Tyr Leu Ser Gly Val Glu Lys Ala Cys Phe 55 60 65 atg agc cac gcc gta ttg tgg gaa cag gca ttg gac gaa ggc gta ccg 1736 Met Ser His Ala Val Leu Trp Glu Gln Ala Leu Asp Glu Gly Val Pro 70 75 80 tat atc gcc gta ttt gaa gat gat gtc tta ctc ggc gaa ggc gcg gag 1784 Tyr Ile Ala Val Phe Glu Asp Asp Val Leu Leu Gly Glu Gly Ala Glu 85 90 95 cag ttc ctt gcc gaa gat act tgg ctg caa gaa cgc ttt gac ccc gat 1832 Gln Phe Leu Ala Glu Asp Thr Trp Leu Gln Glu Arg Phe Asp Pro Asp 100 105 110 tcc gcc ttt gtc gtc cgc ttg gaa acg atg ttt atg cac gtc ctg acc 1880 Ser Ala Phe Val Val Arg Leu Glu Thr Met Phe Met His Val Leu Thr 115 120 125 130 tcg ccc tcc ggc gtg gcg gac tac ggc ggg cgc gcc ttt ccg ctt ttg 1928 Ser Pro Ser Gly Val Ala Asp Tyr Gly Gly Arg Ala Phe Pro Leu Leu 135 140 145 gaa agc gaa cac tgc ggg acg gcg ggc tat att att tcc cga aag gcg 1976 Glu Ser Glu His Cys Gly Thr Ala Gly Tyr Ile Ile Ser Arg Lys Ala 150 155 160 atg cgt ttt ttc ttg gac agg ttt gcc gtt ttg ccg ccc gaa cgc ctg 2024 Met Arg Phe Phe Leu Asp Arg Phe Ala Val Leu Pro Pro Glu Arg Leu 165 170 175 cac cct gtc gat ttg atg atg ttc ggc aac cct gac gac agg gaa gga 2072 His Pro Val Asp Leu Met Met Phe Gly Asn Pro Asp Asp Arg Glu Gly 180 185 190 atg ccg gtt tgc cag ctc aat ccc gcc ttg tgc gcc caa gag ctg cat 2120 Met Pro Val Cys Gln Leu Asn Pro Ala Leu Cys Ala Gln Glu Leu His 195 200 205 210 tat gcc aag ttt cac gac caa aac agc gca ttg ggc agc ctg atc gaa 2168 Tyr Ala Lys Phe His Asp Gln Asn Ser Ala Leu Gly Ser Leu Ile Glu 215 220 225 cat gac cgc cgc ctg aac cgc aaa cag caa tgg cgc gat tcc ccc gcc 2216 His Asp Arg Arg Leu Asn Arg Lys Gln Gln Trp Arg Asp Ser Pro Ala 230 235 240 aac aca ttc aaa cac cgc ctg atc cgc gcc ttg acc aaa atc ggc agg 2264 Asn Thr Phe Lys His Arg Leu Ile Arg Ala Leu Thr Lys Ile Gly Arg 245 250 255 gaa agg gaa aaa cgc cgg caa agg cgc gaa cag tta atc ggc aag att 2312 Glu Arg Glu Lys Arg Arg Gln Arg Arg Glu Gln Leu Ile Gly Lys Ile 260 265 270 att gtg cct ttc caa taa aaggagaaaa gatggacatc gtatttgcgg 2360 Ile Val Pro Phe Gln 275 cagacgacaa ctatgccgcc tacctttgcg ttgcggcaaa aagcgtggaa gcggcccatc 2420 ccgatacgga aatcaggttc cacgtcctcg atgccggcat cagtgaggaa aaccgggcgg 2480 cggttgccgc caatttgcgg ggggggggta atatccgctt tatagacgta aaccccgaag 2540 atttcgccgg cttcccctta aacatcaggc acatttccat tacgacttat gcccgcctga 2600 aattgggcga atacattgcc gattgcgaca aagtcctgta tctggatacg gacgtattgg 2660 tcagggacgg cctgaagccc ttatgggata ccgatttggg cggtaactgg gtcggcgcgt 2720 gcatcgattt gtttgtcgaa aggcaggaag gatacaaaca aaaaatcggt atggcggacg 2780 gagaatatta tttcaatgcc ggcgtattgc tgatcaacct gaaaaagtgg cggcggcacg 2840 atattttcaa aatgtcctgc gaatgggtgg aacaatacaa ggacgtgatg caatatcagg 2900 atcaggacat tttgaacggg ctgtttaaag gcggggtgtg ttatgcgaac agccgtttca 2960 actttatgcc gaccaattat gcctttatgg cgaacgggtt tgcgtcccgc cataccgacc 3020 cgctttacct cgaccgtacc aatacggcga tgcccgtcgc cgtcagccat tattgcggct 3080 cggcaaagcc gtggcacagg gactgcaccg tttggggtgc ggaacgtttc acagagttgg 3140 ccggcagcct gacgaccgtt cccgaagaat ggcgcggcaa acttgccgtc ccgccgacaa 3200 agtgtatgct tcaaagatgg cgcaaaaagc tgtctgccag attcttacgc aagatttatt 3260 gacggggcag gccgtctgaa gccttcagac ggcatcggac gtatcggaaa ggagaaacgg 3320 attgcagcct ttagtcagcg tattgatttg cgcctacaac gcagaaaaat attttgccca 3380 atcattggcc gccgtagtgg ggcagacttg gcgcaacttg gatattttga ttgtcgatga 3440 cggctcgacg gacggcacgc ccgccattgc ccggcatttc caagaacagg acggcaggat 3500 caggataatt tccaatcccc gcaatttggg ctttatcgcc tctttaaaca tcgggctgga 3560 cgaattggca aagtcggggg ggggggaata tattgcgcgc accgatgccg acgatattgc 3620 ctcccccggc tggattgaga aaatcgtggg cgagatggaa aaagaccgca gcatcattgc 3680 gatgggcgcg tggttggaag ttttgtcgga agaaaacaat aaaagcgtgc ttgccgccat 3740 tgcccgaaac ggcgcaattt gggacaaacc gacccggcat gaagacattg tcgccgtttt 3800 ccctttcggc aaccccatac acaacaacac gatgattatg aggcgcagcg tcattgacgg 3860 cggtttgcgg ttcgatccag cctatatcca cgccgaagac tataagtttt ggtacgaagc 3920 cggcaaactg ggcaggctgg cttattatcc cgaagccttg gtcaaatacc gcttccatca 3980 agaccagact tcttccaaat acaacctgca acagcgcagg acggcgtgga aaatcaaaga 4040 agaaatcagg gcggggtatt ggaaggcggc aggcatagcc gtcggggcgg actgcctgaa 4100 ttacgggctt ttgaaatcaa cggcatatgc gttgtacgaa aaagccttgt ccggacagga 4160 tatcggatgc ctccgcctgt tcctgtacga atatttcttg tcgttggaaa agtattcttt 4220 gaccgatttg ctggatttct tgacagaccg cgtgatgagg aagctgtttg ccgcaccgca 4280 atataggaaa atcctgaaaa aaatgttacg cccttggaaa taccgcagct attgaaaccg 4340 aacaggataa atcatgcaaa accacgttat cagcttggct tccgccgcag agcgcagggc 4400 gcacattgcc gataccttcg gcagtcgcgg catcccgttc cagtttttcg acgcactgat 4460 gccgtctgaa aggctggaac aggcgatggc ggaactcgtc cccggcttgt cggcgcaccc 4520 ctatttgagc ggagtggaaa aagcctgctt tatgagccac gccgtattgt gggaacaggc 4580 gttggatgaa ggtctgccgt atatcgccgt atttgaggac gacgttttac tcggcgaagg 4640 cgcggagcag ttccttgccg aagatacttg gttggaagag cgttttgaca aggattccgc 4700 ctttatcgtc cgtttggaaa cgatgtttgc gaaagttatt gtcagaccgg ataaagtcct 4760 gaattatgaa aaccggtcat ttcctttgct ggagagcgaa cattgtggga cggctggcta 4820 tatcatttcg cgtgaggcga tgcggttttt cttggacagg tttgccgttt tgccgccaga 4880 gcggattaaa gcggtagatt tgatgatgtt tacttatttc tttgataagg aggggatgcc 4940 tgtttatcag gttagtcccg ccttatgtac ccaagaattg cattatgcca agtttctcag 5000 tcaaaacagt atgttgggta gcgatttgga aaaagatagg gaacaaggaa gaagacaccg 5060 ccgttcgttg aaggtgatgt ttgacttgaa gcgtgctttg ggtaaattcg gtagggaaaa 5120 gaagaaaaga atggagcgtc aaaggcaggc ggagcttgag aaagtttacg gcaggcgggt 5180 catattgttc aaatagtttg tgtaaaatat aggggattaa aatcagaaat ggacacactg 5240 tcattcccgc gcaggcggga atctaggtct ttaaacttcg gttttttccg ataaattctt 5300 gccgcattaa aattccagat tcccgctttc gcggggatga cggcgggggg attgttgctt 5360 tttcggataa aatcccgtgt tttttcatct gctaggtaaa atcgccccaa agcgtctgca 5420 tcgcggcgat ggcggcgagt ggggcggttt ctgtgcgtaa aatccgtttt ccgagtgtaa 5480 ccgcctgaaa gccggcttca aatgcctgtt gttcttcctg ttctgtccag ccgccttcgg 5540 gcccgaccat aaagacgatt gcgccggacg ggtggcggat gtcgccgagt ttgcaggcgc 5600 ggttgatgct cataatcagc ttggtgtttt cagacggcat tttgtcgagt gcttcacggt 5660 agccgatgat gggcagtacg gggggaacgg tgttcctgcc gctttgttcg cacgcggaga 5720 tgacgatttc ctgccagcgt gcgaggcgtt tggcggcgcg ttctccgtcg aggcggacga 5780 tgcagcgttc gctgatgacg ggctgtatgg cggttacgcc gagttcgacg cttttttgca 5840 gggtgaaatc catgcgatc 5859 8 279 PRT Neisseria gonorrheae 8 Met Gln Asn His Val Ile Ser Leu Ala Ser Ala Ala Glu Arg Arg Ala 1 5 10 15 His Ile Ala Ala Thr Phe Gly Ser Arg Gly Ile Pro Phe Gln Phe Phe 20 25 30 Asp Ala Leu Met Pro Ser Glu Arg Leu Glu Arg Ala Met Ala Glu Leu 35 40 45 Val Pro Gly Leu Ser Ala His Pro Tyr Leu Ser Gly Val Glu Lys Ala 50 55 60 Cys Phe Met Ser His Ala Val Leu Trp Glu Gln Ala Leu Asp Glu Gly 65 70 75 80 Val Pro Tyr Ile Ala Val Phe Glu Asp Asp Val Leu Leu Gly Glu Gly 85 90 95 Ala Glu Gln Phe Leu Ala Glu Asp Thr Trp Leu Gln Glu Arg Phe Asp 100 105 110 Pro Asp Ser Ala Phe Val Val Arg Leu Glu Thr Met Phe Met His Val 115 120 125 Leu Thr Ser Pro Ser Gly Val Ala Asp Tyr Gly Gly Arg Ala Phe Pro 130 135 140 Leu Leu Glu Ser Glu His Cys Gly Thr Ala Gly Tyr Ile Ile Ser Arg 145 150 155 160 Lys Ala Met Arg Phe Phe Leu Asp Arg Phe Ala Val Leu Pro Pro Glu 165 170 175 Arg Leu His Pro Val Asp Leu Met Met Phe Gly Asn Pro Asp Asp Arg 180 185 190 Glu Gly Met Pro Val Cys Gln Leu Asn Pro Ala Leu Cys Ala Gln Glu 195 200 205 Leu His Tyr Ala Lys Phe His Asp Gln Asn Ser Ala Leu Gly Ser Leu 210 215 220 Ile Glu His Asp Arg Arg Leu Asn Arg Lys Gln Gln Trp Arg Asp Ser 225 230 235 240 Pro Ala Asn Thr Phe Lys His Arg Leu Ile Arg Ala Leu Thr Lys Ile 245 250 255 Gly Arg Glu Arg Glu Lys Arg Arg Gln Arg Arg Glu Gln Leu Ile Gly 260 265 270 Lys Ile Ile Val Pro Phe Gln 275 9 21 DNA Artificial Sequence PCR primer 9 gccgagaaaa ctattggtgg a 21 10 22 DNA Artificial Sequence PCR primer 10 aaaacatgca ggaattgacg at 22 11 348 PRT non-Neisseria 11 Leu Gln Pro Leu Val Ser Val Leu Ile Cys Ala Tyr Asn Val Glu Lys 1 5 10 15 Tyr Phe Ala Gln Ser Leu Ala Ala Val Val Asn Gln Thr Trp Arg Asn 20 25 30 Leu Asp Ile Leu Ile Val Asp Asp Gly Ser Thr Asp Gly Thr Leu Ala 35 40 45 Ile Ala Lys Asp Phe Gln Lys Arg Asp Ser Arg Ile Lys Ile Leu Ala 50 55 60 Gln Ala Gln Asn Ser Gly Leu Ile Pro Ser Leu Asn Ile Gly Leu Asp 65 70 75 80 Glu Leu Ala Lys Ser Gly Gly Gly Gly Gly Glu Tyr Ile Ala Arg Thr 85 90 95 Asp Ala Asp Asp Ile Ala Ser Pro Gly Trp Ile Glu Lys Ile Val Gly 100 105 110 Glu Met Glu Lys Asp Arg Ser Ile Ile Ala Met Gly Ala Trp Leu Glu 115 120 125 Val Leu Ser Glu Glu Lys Asp Gly Asn Arg Leu Ala Arg His His Lys 130 135 140 His Gly Lys Ile Trp Lys Lys Pro Thr Arg His Glu Asp Ile Ala Ala 145 150 155 160 Phe Phe Pro Phe Gly Asn Pro Ile His Asn Asn Thr Met Ile Met Arg 165 170 175 Arg Ser Val Ile Asp Gly Gly Leu Arg Tyr Asp Thr Glu Arg Asp Trp 180 185 190 Ala Glu Asp Tyr Gln Phe Trp Tyr Asp Val Ser Lys Leu Gly Arg Leu 195 200 205 Ala Tyr Tyr Pro Glu Ala Leu Val Lys Tyr Arg Leu His Ala Asn Gln 210 215 220 Val Ser Ser Lys His Ser Val Arg Gln His Glu Ile Ala Gln Gly Ile 225 230 235 240 Gln Lys Thr Ala Arg Asn Asp Phe Leu Gln Ser Met Gly Phe Lys Thr 245 250 255 Arg Phe Asp Ser Leu Glu Tyr Arg Gln Thr Lys Ala Ala Ala Tyr Glu 260 265 270 Leu Pro Glu Lys Asp Leu Pro Glu Glu Asp Phe Glu Arg Ala Arg Arg 275 280 285 Phe Leu Tyr Gln Cys Phe Lys Arg Thr Asp Thr Pro Pro Ser Gly Ala 290 295 300 Trp Leu Asp Phe Ala Ala Asp Gly Arg Met Arg Arg Leu Phe Thr Leu 305 310 315 320 Arg Gln Tyr Phe Gly Ile Leu Tyr Arg Leu Ile Lys Asn Arg Arg Gln 325 330 335 Ala Arg Ser Asp Ser Ala Gly Lys Glu Gln Glu Ile 340 345 12 337 PRT non-Neisseria 12 Leu Gln Pro Leu Val Ser Val Leu Ile Cys Ala Tyr Asn Ala Glu Lys 1 5 10 15 Tyr Phe Ala Gln Ser Leu Ala Ala Val Val Gly Gln Thr Trp Arg Asn 20 25 30 Leu Asp Ile Leu Ile Val Asp Asp Gly Ser Thr Asp Gly Thr Pro Ala 35 40 45 Ile Ala Arg His Phe Gln Glu Gln Asp Gly Arg Ile Arg Ile Ile Ser 50 55 60 Asn Pro Arg Asn Leu Gly Phe Ile Ala Ser Leu Asn Ile Gly Leu Asp 65 70 75 80 Glu Leu Ala Lys Ser Gly Gly Gly Glu Tyr Ile Ala Arg Thr Asp Ala 85 90 95 Asp Asp Ile Ala Ser Pro Gly Trp Ile Glu Lys Ile Val Gly Glu Met 100 105 110 Glu Lys Asp Arg Ser Ile Ile Ala Met Gly Ala Trp Leu Glu Val Leu 115 120 125 Ser Glu Glu Asn Asn Lys Ser Val Leu Ala Ala Ile Ala Arg Asn Gly 130 135 140 Ala Ile Trp Asp Lys Pro Thr Arg His Glu Asp Ile Val Ala Val Phe 145 150 155 160 Pro Phe Gly Asn Pro Ile His Asn Asn Thr Met Ile Met Arg Arg Ser 165 170 175 Val Ile Asp Gly Gly Leu Arg Phe Asp Pro Ala Tyr Ile His Ala Glu 180 185 190 Asp Tyr Lys Phe Trp Tyr Glu Ala Gly Lys Leu Gly Arg Leu Ala Tyr 195 200 205 Tyr Pro Glu Ala Leu Val Lys Tyr Arg Phe His Gln Asp Gln Thr Ser 210 215 220 Ser Lys Tyr Asn Leu Gln Gln Arg Arg Thr Ala Trp Lys Ile Lys Glu 225 230 235 240 Glu Ile Arg Ala Gly Tyr Trp Lys Ala Ala Gly Ile Ala Val Gly Ala 245 250 255 Asp Cys Leu Asn Tyr Gly Leu Leu Lys Ser Thr Ala Tyr Ala Leu Tyr 260 265 270 Glu Lys Ala Leu Ser Gly Gln Asp Ile Gly Cys Leu Arg Leu Phe Leu 275 280 285 Tyr Glu Tyr Phe Leu Ser Leu Glu Lys Tyr Ser Leu Thr Asp Leu Leu 290 295 300 Asp Phe Leu Thr Asp Arg Val Met Arg Lys Leu Phe Ala Ala Pro Gln 305 310 315 320 Tyr Arg Lys Ile Leu Lys Lys Met Leu Arg Pro Trp Lys Tyr Arg Ser 325 330 335 Tyr 13 306 PRT Escherichia coli 13 Leu Asp Ile Ala Tyr Gly Thr Asp Lys Asn Phe Leu Phe Gly Cys Gly 1 5 10 15 Ile Ser Ile Ala Ser Ile Leu Lys Tyr Asn Glu Gly Ser Arg Leu Cys 20 25 30 Phe His Ile Phe Thr Asp Tyr Phe Gly Asp Asp Asp Arg Lys Tyr Phe 35 40 45 Asp Ala Leu Ala Leu Gln Tyr Lys Thr Arg Ile Lys Ile Tyr Leu Ile 50 55 60 Asn Gly Asp Arg Leu Arg Ser Leu Pro Ser Thr Lys Asn Trp Thr His 65 70 75 80 Ala Ile Tyr Phe Arg Phe Val Ile Ala Asp Tyr Phe Ile Asn Lys Ala 85 90 95 Pro Lys Val Leu Tyr Leu Asp Ala Asp Ile Ile Cys Gln Gly Thr Ile 100 105 110 Glu Pro Leu Ile Asn Phe Ser Phe Pro Asp Asp Lys Val Ala Met Val 115 120 125 Val Thr Glu Gly Gln Ala Asp Trp Trp Glu Lys Arg Ala His Ser Leu 130 135 140 Gly Val Ala Gly Ile Ala Lys Gly Tyr Phe Asn Ser Gly Phe Leu Leu 145 150 155 160 Ile Asn Thr Ala Gln Trp Ala Ala Gln Gln Val Ser Ala Arg Ala Ile 165 170 175 Ala Met Leu Asn Glu Pro Glu Ile Ile Lys Lys Ile Thr His Pro Asp 180 185 190 Gln Asp Val Leu Asn Met Leu Leu Ala Asp Lys Leu Ile Phe Ala Asp 195 200 205 Ile Lys Tyr Asn Thr Gln Phe Ser Leu Asn Tyr Gln Leu Lys Glu Ser 210 215 220 Phe Ile Asn Pro Val Thr Asn Asp Thr Ile Phe Ile His Tyr Ile Gly 225 230 235 240 Pro Thr Lys Pro Trp His Asp Trp Ala Trp Asp Tyr Pro Val Ser Gln 245 250 255 Ala Phe Met Glu Ala Lys Asn Ala Ser Pro Trp Lys Asn Thr Ala Leu 260 265 270 Leu Lys Pro Asn Asn Ser Asn Gln Leu Arg Tyr Ser Ala Lys His Met 275 280 285 Leu Lys Lys His Arg Tyr Leu Lys Gly Phe Ser Asn Tyr Leu Phe Tyr 290 295 300 Phe Ile 305

Claims (33)

What is claimed is:
1. A purified nucleic acid that is hybridizable under moderately stringent conditions to a nucleic acid having a nucleotide sequence corresponding to or complementary to the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1).
2. The nucleic acid of claim 1 that is hybridizable under moderately stringent conditions to a nucleic acid having a nucleotide sequence corresponding to or complementary to a portion of the nucleotide sequence shown in FIG. 2 (SEQ ID NO: 1) that encodes a functionally active glycosyltransferase.
3. The nucleic acid of claim 2 that encodes a functionally active glycosyltransferase.
4. The nucleic acid of claim 1 that has a nucleotide sequence corresponding to or complementary to a portion of the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1) that encodes a functionally active glycosyltransferase.
5. The nucleic acid of claim 4 that encodes a functionally active glycosyltransferase.
6. The nucleic acid of claim 1 that has a nucleotide sequence corresponding to or complementary to the nucleotide sequence shown in FIG. 2 (SEQ ID NO:1).
7. The nucleic acid of claim 3, wherein the functionally active glycosyltransferase catalyzes a reaction selected from the group consisting of:
a) adding Gal β1→4 to GlcNAc or Glc;
b) adding GalNAc or GlcNAc β1→3 to Gal; and
c) adding Gal α1→4 to Gal.
8. The nucleic acid of claim 3 which encodes a glycosyltransferase having an amino acid sequence of SEQ ID NO:2.
9. The nucleic acid of claim 3 which encodes a glycosyltransferase having an amino acid sequence of SEQ ID NO:3.
10. The nucleic acid of claim 3 which encodes a glycosyltransferase having an amino acid sequence of SEQ ID NO:4.
11. The nucleic acid of claim 3 which encodes a glycosyltransferase having an amino acid sequence of SEQ ID NO:5.
12. The nucleic acid of claim 3 which encodes a glycosyltransferase having an amino acid sequence of SEQ ID NO:6.
13. An expression vector comprising the nucleic acid of claim 3 operatively associated with an expression control sequence.
14. A recombinant host cell transformed with the expression vector of claim 13.
15. A method for producing a glycosyltransferase comprising:
a) culturing the recombinant host cell of claim 14 under conditions that allow expression of the glycosyltransferase; and
b) recovering the expressed glycosyltransferase.
16. A glycosyltransferase having an amino acid sequence of SEQ ID NO:2, or a functionally active fragment thereof.
17. A glycosyltransferase having an amino acid sequence of SEQ ID NO:3, or a functionally active fragment thereof.
18. A glycosyltransferase having an amino acid sequence of SEQ ID NO:4, or a functionally active fragment thereof.
19. A glycosyltransferase having an amino acid sequence of SEQ ID NO:5, or a functionally active fragment thereof.
20. A glycosyltransferase having an amino acid sequence of SEQ ID NO:6, or a functionally active fragment thereof.
21. A composition comprising a glycosyltransferase conjugated to a solid phase support, wherein the glycosyltransferase is selected from the group consist of:
a) a glycosyltransferase having an amino acid sequence of SEQ ID NO:2, or a functionally active fragment thereof;
b) a glycosyltransferase having an amino acid sequence of SEQ ID NO:3, or a functionally active fragment thereof;
c) a glycosyltransferase having an amino acid sequence of SEQ !ID NO:4, or a functionally active fragment thereof;
d) a glycosyltransferase having an amino acid sequence of SEQ ID NO:5, or a functionally active fragment thereof; and
e) a glycosyltransferase having an amino acid sequence of SEQ ID NO:6, or a functionally active fragment thereof.
22. A method for adding GalNAc or GlcNAc β1→3 to Gal, comprising contacting a reaction mixture comprising an activated GalNAc or GlcNAc to an acceptor moiety comprising a Gal residue in the presence of the glycosyltransferase of claim 16.
23. A method for adding Gal β1→4 to GlcNAc or Glc, comprising contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a GlcNAc or Glc residue in the presence of the glycosyltransferase of claim 17.
24. A method for adding Gal α1→4 to Gal, comprising contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Gal residue in the presence of the glycosyltransferase of claim 18.
25. A method for adding GalNAc or GlcNAc β1→3 to Gal, comprising contacting a reaction mixture comprising an activated GalNAc or GlcNAc to an acceptor moiety comprising a Gal residue in the presence of the glycosyltransferase of claim 19.
26. A method for adding Gal β1→4 to GlcNAc or Glc, comprising contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a GlcNAc or Glc residue in the presence of the glycosyltransferase of claim 20.
27. A method for preparing an oligosaccharide having the structure Galα1→4Galβ1→4Glc, which comprises sequentially performing the steps of:
a) contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:6, or a functionally active fragment thereof; and
b) contacting a reaction mixture comprising an activated Gal to the acceptor moiety comprising Galβ1→4Glc in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:4, or a functionally active fragment thereof.
28. A method for preparing an oligosaccharide having the structure Galβ1→4Glc, which comprises contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Glc residue in the presence of the glycosyltransferase of claim 20.
29. A method for preparing an oligosaccharide having the structure GlcNAcβ1→3Galβ1→4Glc, which comprises contacting a reaction mixture comprising an activated GlcNAc to an acceptor moiety comprising a Galβ1→4Glc residue in the presence of the glycosyltransferase of claim 16.
30. A method for preparing an oligosaccharide having the structure Galβ1→4GlcNAcβ1→3Galβ1→4Glc, which comprises contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a GlcNAcβ1→3Galβ1→4Glc residue in the presence of the glycosyltransferase of claim 17.
31. A method for preparing an oligosaccharide having the structure GlcNAcβ1→3Galβ1→4GlcNAcβ1→3Galβ1→4Glc, which comprises contacting a reaction mixture comprising an activated GalNAc to an acceptor moiety comprising a Galβ1→4GlcNAcβ1→3Galβ1→4Glc residue in the presence of the glycosyltransferase of claim 19.
32. A method for preparing an oligosaccharide having the structure GalNAcβ1→3Galβ1→4GlcNAcβ1→3Galβ1→4Glc, which comprises sequentially performing the steps of:
a) contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO: 6, or a functionally active fragment thereof;
b) contacting a reaction mixture comprising an activated GlcNAc to the acceptor moiety comprising a Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:2, or a functionally active fragment thereof;
c) contacting a reaction mixture comprising an activated Gal to the acceptor moiety comprising a GlcNAcβ1→3Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid of SEQ ID NO:3; and
d) contacting a reaction mixture comprising an activated GalNAc to the acceptor moiety comprising a Galβ1→4GlcNAcβ1→3Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid sequenc of SEQ ID NO:5, or a functionally active fragment thereof.
33. A method for preparing an oligosaccharide having the structure Galβ1→4GlcNAcβ1→3Galβ1→4Glc, which comprises sequentially performing the steps of:
a) contacting a reaction mixture comprising an activated Gal to an acceptor moiety comprising a Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO: 6, or a functionally active fragment thereof;
b) contacting a reaction mixture comprising an activated GlcNAc to the acceptor moiety comprising a Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid sequence of SEQ ID NO:2, or a functionally active fragment thereof; and
c) contacting a reaction mixture comprising an activated Gal to the acceptor moiety comprising a GlcNAcβ1→3Galβ1→4Glc residue in the presence of a glycosyltransferase having an amino acid of SEQ ID NO:3.
US10/654,528 1994-09-26 2003-09-02 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them Abandoned US20040043464A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US10/654,528 US20040043464A1 (en) 1994-09-26 2003-09-02 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US11/102,497 US20050271690A1 (en) 1994-09-26 2005-04-08 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US12/815,272 US8268596B2 (en) 1994-09-26 2010-06-14 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US08/312,387 US5545553A (en) 1994-09-26 1994-09-26 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US08/683,426 US5705367A (en) 1994-09-26 1996-07-18 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US08/878,360 US5945322A (en) 1994-09-26 1997-06-18 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US09/333,412 US6342382B1 (en) 1994-09-26 1999-06-15 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US10/007,267 US6780624B2 (en) 1994-09-26 2001-12-03 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US10/654,528 US20040043464A1 (en) 1994-09-26 2003-09-02 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/007,267 Continuation US6780624B2 (en) 1994-09-26 2001-12-03 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/102,497 Division US20050271690A1 (en) 1994-09-26 2005-04-08 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them

Publications (1)

Publication Number Publication Date
US20040043464A1 true US20040043464A1 (en) 2004-03-04

Family

ID=23211210

Family Applications (9)

Application Number Title Priority Date Filing Date
US08/312,387 Expired - Lifetime US5545553A (en) 1994-09-26 1994-09-26 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US08/683,458 Expired - Fee Related US5798233A (en) 1994-09-26 1996-07-18 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US08/683,426 Expired - Lifetime US5705367A (en) 1994-09-26 1996-07-18 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US08/878,360 Expired - Lifetime US5945322A (en) 1994-09-26 1997-06-18 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US09/333,412 Expired - Lifetime US6342382B1 (en) 1994-09-26 1999-06-15 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US10/007,267 Expired - Fee Related US6780624B2 (en) 1994-09-26 2001-12-03 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US10/654,528 Abandoned US20040043464A1 (en) 1994-09-26 2003-09-02 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US11/102,497 Abandoned US20050271690A1 (en) 1994-09-26 2005-04-08 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US12/815,272 Expired - Fee Related US8268596B2 (en) 1994-09-26 2010-06-14 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them

Family Applications Before (6)

Application Number Title Priority Date Filing Date
US08/312,387 Expired - Lifetime US5545553A (en) 1994-09-26 1994-09-26 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US08/683,458 Expired - Fee Related US5798233A (en) 1994-09-26 1996-07-18 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US08/683,426 Expired - Lifetime US5705367A (en) 1994-09-26 1996-07-18 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US08/878,360 Expired - Lifetime US5945322A (en) 1994-09-26 1997-06-18 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US09/333,412 Expired - Lifetime US6342382B1 (en) 1994-09-26 1999-06-15 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US10/007,267 Expired - Fee Related US6780624B2 (en) 1994-09-26 2001-12-03 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/102,497 Abandoned US20050271690A1 (en) 1994-09-26 2005-04-08 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US12/815,272 Expired - Fee Related US8268596B2 (en) 1994-09-26 2010-06-14 Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them

Country Status (10)

Country Link
US (9) US5545553A (en)
EP (2) EP1568777B1 (en)
JP (2) JP3756182B2 (en)
KR (1) KR100465892B1 (en)
AT (2) ATE513916T1 (en)
CA (2) CA2502785C (en)
DE (1) DE69535975D1 (en)
ES (1) ES2371440T3 (en)
MX (1) MX9702351A (en)
WO (1) WO1996010086A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8404809B2 (en) 2005-05-25 2013-03-26 Novo Nordisk A/S Glycopegylated factor IX
US8632770B2 (en) 2003-12-03 2014-01-21 Novo Nordisk A/S Glycopegylated factor IX
US8791070B2 (en) 2003-04-09 2014-07-29 Novo Nordisk A/S Glycopegylated factor IX
US9050304B2 (en) 2007-04-03 2015-06-09 Ratiopharm Gmbh Methods of treatment using glycopegylated G-CSF
US9200049B2 (en) 2004-10-29 2015-12-01 Novo Nordisk A/S Remodeling and glycopegylation of fibroblast growth factor (FGF)
US9493499B2 (en) 2007-06-12 2016-11-15 Novo Nordisk A/S Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography

Families Citing this family (168)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH09503905A (en) 1993-07-15 1997-04-22 ネオゼ ファーマシューティカルス Method for synthesizing sugar composition
US6495348B1 (en) * 1993-10-07 2002-12-17 Regents Of The University Of Minnesota Mitomycin biosynthetic gene cluster
US6524812B1 (en) 1993-10-07 2003-02-25 Regents Of The University Of Minnesota Genes encoding resistance to DNA alkylating agents
US5545553A (en) * 1994-09-26 1996-08-13 The Rockefeller University Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US6127153A (en) 1995-06-07 2000-10-03 Neose Technologies, Inc. Method of transferring at least two saccharide units with a polyglycosyltransferase, a polyglycosyltransferase and gene encoding a polyglycosyltransferase
EP0870053A4 (en) 1995-12-19 2002-09-11 Univ Minnesota Metabolic engineering of polyhydroxyalkanoate monomer synthases
US6096529A (en) 1996-06-10 2000-08-01 National Research Council Of Canada Recombinant α-2,3-sialyltransferases and their uses
US6117651A (en) * 1996-11-08 2000-09-12 Neose Technologies, Inc. Expression vectors
US6045854A (en) * 1997-03-31 2000-04-04 Abbott Laboraties Nutritional formulations containing oligosaccharides
US5906982A (en) * 1997-03-31 1999-05-25 Abbott Laboratories Nutritional formulations containing Lacto-N-neoTetraose
US5945314A (en) * 1997-03-31 1999-08-31 Abbott Laboratories Process for synthesizing oligosaccharides
US6075183A (en) * 1997-04-11 2000-06-13 Abbott Laboratories Methods and compositions for synthesis of long chain poly-unsaturated fatty acids in plants
US7745694B1 (en) 1997-04-11 2010-06-29 Monsanto Technology Llc Methods and compositions for synthesis of long chain polyunsaturated fatty acids in plants
US6051754A (en) * 1997-04-11 2000-04-18 Abbott Laboratories Methods and compositions for synthesis of long chain poly-unsaturated fatty acids in plants
US5968809A (en) * 1997-04-11 1999-10-19 Abbot Laboratories Methods and compositions for synthesis of long chain poly-unsaturated fatty acids
US5972664A (en) * 1997-04-11 1999-10-26 Abbott Laboratories Methods and compositions for synthesis of long chain poly-unsaturated fatty acids
US6096725A (en) * 1997-07-02 2000-08-01 Neose Technologies, Inc. Methods of using αGal oligosaccharides as immune system targeting agents
JPH11221079A (en) 1998-02-04 1999-08-17 Kyowa Hakko Kogyo Co Ltd Transglycosidase and dna encoding the same enzyme
US6689604B1 (en) 1998-03-20 2004-02-10 National Research Council Of Canada Lipopolysaccharide α-2,3 sialyltransferase of Campylobacter jejuni and its uses
AU759792B2 (en) 1998-03-25 2003-05-01 Forschungszentrum Borstel Processive glycosyltransferase
WO1999064614A2 (en) 1998-06-12 1999-12-16 Calgene Llc Polyunsaturated fatty acids in plants
US6265202B1 (en) 1998-06-26 2001-07-24 Regents Of The University Of Minnesota DNA encoding methymycin and pikromycin
FR2780413B1 (en) * 1998-06-29 2003-03-21 Centre Nat Rech Scient ENZYMES WITH ALPHA-GALACTOSYLTRANSFERASE ACTIVITY OF INSECT CELLS, AND USES THEREOF
US6897052B1 (en) * 1998-08-07 2005-05-24 Glycodesign Holdings Ltd. N-acetylglycosaminyl transferase genes
WO2000012747A1 (en) * 1998-08-31 2000-03-09 Kurt Nilsson Method for enzymatic synthesis of glycosides, disaccharides, and oligosaccharides
US20030163845A1 (en) * 1998-09-02 2003-08-28 Pradip Mukerji Elongase genes and uses thereof
US6403349B1 (en) 1998-09-02 2002-06-11 Abbott Laboratories Elongase gene and uses thereof
WO2000029603A2 (en) * 1998-11-18 2000-05-25 Neose Technologies, Inc. Low cost manufacture of oligosaccharides
US7820393B2 (en) * 1999-01-14 2010-10-26 Scantibodies Laboratory, Inc. Methods, kits and antibodies for detecting parathyroid hormone
US6689566B1 (en) * 1999-01-14 2004-02-10 Scantibodies Laboratory, Inc. Methods, kits, and antibodies for detecting parathyroid hormone
US6503744B1 (en) 1999-02-01 2003-01-07 National Research Council Of Canada Campylobacter glycosyltransferases for biosynthesis of gangliosides and ganglioside mimics
US6699705B2 (en) * 1999-02-01 2004-03-02 National Research Council Of Canada Campylobacter glycosyltransferases for biosynthesis of gangliosides and ganglioside mimics
JP2004520001A (en) * 1999-05-18 2004-07-08 ユニバーシテイ・オブ・アイオワ・リサーチ・フアウンデーシヨン Production of glycoconjugates
FR2796082B1 (en) * 1999-07-07 2003-06-27 Centre Nat Rech Scient PROCESS FOR PRODUCING OLIGOSACCHARIDES
US7070970B2 (en) 1999-08-23 2006-07-04 Abbott Laboratories Elongase genes and uses thereof
AUPQ275799A0 (en) * 1999-09-10 1999-10-07 Luminis Pty Limited Recombinant bacterium expressing an oligosaccharide receptor mimic
US6518037B2 (en) * 1999-11-12 2003-02-11 University Of Iowa Research Foundation Two-component system that controls bacterial membrane synthesis
CA2399860A1 (en) 2000-02-11 2001-08-16 Glycozym Aps Udp-galactose: .beta.-d-galactose-r 4-.alpha.-d-galactosyltransferase, .alpha.4gal-t1
NZ523476A (en) 2000-06-28 2004-04-30 Glycofi Inc Methods for humanizing glycosylation of recombinant glycoproteins expressed in lower eukaryotes
US7863020B2 (en) * 2000-06-28 2011-01-04 Glycofi, Inc. Production of sialylated N-glycans in lower eukaryotes
US7625756B2 (en) * 2000-06-28 2009-12-01 GycoFi, Inc. Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells
US7598055B2 (en) * 2000-06-28 2009-10-06 Glycofi, Inc. N-acetylglucosaminyltransferase III expression in lower eukaryotes
US8697394B2 (en) * 2000-06-28 2014-04-15 Glycofi, Inc. Production of modified glycoproteins having multiple antennary structures
US7449308B2 (en) * 2000-06-28 2008-11-11 Glycofi, Inc. Combinatorial DNA library for producing modified N-glycans in lower eukaryotes
US20030194784A1 (en) * 2001-04-17 2003-10-16 Sherman David H. DNA encoding methymycin and pikromycin
JP2005500058A (en) 2001-08-17 2005-01-06 ネオーズ テクノロジーズ， インコーポレイテッド Chemoenzymatic synthesis of sialylated oligosaccharides.
WO2003025133A2 (en) * 2001-09-14 2003-03-27 Mimeon, Inc. Methods of making glycolmolecules with enhanced activities and uses thereof
US7399613B2 (en) * 2001-10-10 2008-07-15 Neose Technologies, Inc. Sialic acid nucleotide sugars
US7439043B2 (en) * 2001-10-10 2008-10-21 Neose Technologies, Inc. Galactosyl nucleotide sugars
US7125843B2 (en) * 2001-10-19 2006-10-24 Neose Technologies, Inc. Glycoconjugates including more than one peptide
US7214660B2 (en) * 2001-10-10 2007-05-08 Neose Technologies, Inc. Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7795210B2 (en) 2001-10-10 2010-09-14 Novo Nordisk A/S Protein remodeling methods and proteins/peptides produced by the methods
US7297511B2 (en) * 2001-10-10 2007-11-20 Neose Technologies, Inc. Interferon alpha: remodeling and glycoconjugation of interferon alpha
US7696163B2 (en) 2001-10-10 2010-04-13 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7173003B2 (en) 2001-10-10 2007-02-06 Neose Technologies, Inc. Granulocyte colony stimulating factor: remodeling and glycoconjugation of G-CSF
US7157277B2 (en) 2001-11-28 2007-01-02 Neose Technologies, Inc. Factor VIII remodeling and glycoconjugation of Factor VIII
US7265084B2 (en) * 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycopegylation methods and proteins/peptides produced by the methods
US8008252B2 (en) * 2001-10-10 2011-08-30 Novo Nordisk A/S Factor VII: remodeling and glycoconjugation of Factor VII
US7265085B2 (en) * 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycoconjugation methods and proteins/peptides produced by the methods
JP5232352B2 (en) 2001-10-10 2013-07-10 ノボ ノルデイスク エイ エス Peptide remodeling and glycoconjugation
US7179617B2 (en) 2001-10-10 2007-02-20 Neose Technologies, Inc. Factor IX: remolding and glycoconjugation of Factor IX
US7226903B2 (en) * 2001-10-10 2007-06-05 Neose Technologies, Inc. Interferon beta: remodeling and glycoconjugation of interferon beta
DK2279755T3 (en) 2001-10-10 2014-05-26 Ratiopharm Gmbh Remodeling and glycoconjugation of fibroblast growth factor (FGF)
US7473680B2 (en) * 2001-11-28 2009-01-06 Neose Technologies, Inc. Remodeling and glycoconjugation of peptides
DE60336555D1 (en) 2002-06-21 2011-05-12 Novo Nordisk Healthcare Ag PEGYLATED GLYCO FORMS OF FACTOR VII
PL375408A1 (en) 2002-08-02 2005-11-28 Glaxosmithkline Biologicals S.A. Vaccine composition comprising transferrin binding protein and hsf from gram negative bacteria
US7332299B2 (en) 2003-02-20 2008-02-19 Glycofi, Inc. Endomannosidases in the modification of glycoproteins in eukaryotes
WO2004080960A2 (en) 2003-03-06 2004-09-23 Neose Technologies Inc. Methods and compositions for the enzymatic synthesis of gangliosides
US7803777B2 (en) 2003-03-14 2010-09-28 Biogenerix Ag Branched water-soluble polymers and their conjugates
JP4674702B2 (en) 2003-04-09 2011-04-20 バイオジェネリクス エージー Glycopegylation method and protein / peptide produced by the method
WO2004091499A2 (en) * 2003-04-09 2004-10-28 Neose Technologies, Inc. Intracellular formation of peptide conjugates
MXPA05011832A (en) 2003-05-09 2006-02-17 Neose Technologies Inc Compositions and methods for the preparation of human growth hormone glycosylation mutants.
WO2005012484A2 (en) 2003-07-25 2005-02-10 Neose Technologies, Inc. Antibody-toxin conjugates
ES2323644T3 (en) 2003-08-21 2009-07-22 Monsanto Technology Llc DESATURASAS OF FATTY ACIDS FROM PRIMULA.
US8633157B2 (en) 2003-11-24 2014-01-21 Novo Nordisk A/S Glycopegylated erythropoietin
US20080305992A1 (en) * 2003-11-24 2008-12-11 Neose Technologies, Inc. Glycopegylated erythropoietin
US20070254834A1 (en) * 2003-11-24 2007-11-01 Defrees Shawn Glycopegylated Erythropoietin
US7956032B2 (en) * 2003-12-03 2011-06-07 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
WO2005055946A2 (en) * 2003-12-03 2005-06-23 Neose Technologies, Inc. Glycopegylated granulocyte colony stimulating factor
US20080318850A1 (en) * 2003-12-03 2008-12-25 Neose Technologies, Inc. Glycopegylated Factor Ix
EP2497478A3 (en) 2003-12-05 2012-11-07 Children's Hospital Medical Center Oligosaccaride compositions and use thereof in the treatment of infection
CA2552892C (en) * 2004-01-08 2014-08-05 Neose Technologies, Inc. O-linked glycosylation of peptides
EP2484759B1 (en) 2004-02-04 2014-06-25 ratiopharm GmbH Methods of refolding mammalian glycosyltransferases
ES2541537T3 (en) 2004-04-16 2015-07-21 Monsanto Technology, Llc Expression of fatty acid desaturases in corn
KR20070008645A (en) 2004-05-04 2007-01-17 노보 노르디스크 헬스 케어 악티엔게젤샤프트 O-linked glycoforms of polypeptides and method to manufacture them
EP1771066A2 (en) 2004-07-13 2007-04-11 Neose Technologies, Inc. Branched peg remodeling and glycosylation of glucagon-like peptide-1 glp-1
WO2006020372A2 (en) * 2004-07-23 2006-02-23 Neose Technologies, Inc. Enzymatic modification of glycopeptides
EP1799249A2 (en) 2004-09-10 2007-06-27 Neose Technologies, Inc. Glycopegylated interferon alpha
WO2006035057A1 (en) * 2004-09-29 2006-04-06 Novo Nordisk Health Care Ag Modified proteins
WO2006074279A1 (en) * 2005-01-06 2006-07-13 Neose Technologies, Inc. Glycoconjugation using saccharyl fragments
JP4951527B2 (en) 2005-01-10 2012-06-13 バイオジェネリックス アーゲー GlycoPEGylated granulocyte colony stimulating factor
US20060246544A1 (en) * 2005-03-30 2006-11-02 Neose Technologies,Inc. Manufacturing process for the production of peptides grown in insect cell lines
US20070154992A1 (en) * 2005-04-08 2007-07-05 Neose Technologies, Inc. Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants
US20110003744A1 (en) * 2005-05-25 2011-01-06 Novo Nordisk A/S Glycopegylated Erythropoietin Formulations
WO2006127910A2 (en) 2005-05-25 2006-11-30 Neose Technologies, Inc. Glycopegylated erythropoietin formulations
US20070105755A1 (en) 2005-10-26 2007-05-10 Neose Technologies, Inc. One pot desialylation and glycopegylation of therapeutic peptides
MX2008002395A (en) * 2005-08-19 2008-03-18 Neose Technologies Inc Glycopegylated factor vii and factor viia.
WO2007056191A2 (en) * 2005-11-03 2007-05-18 Neose Technologies, Inc. Nucleotide sugar purification using membranes
ES2337309T5 (en) 2006-06-12 2013-07-30 Glaxosmithkline Biologicals S.A. Vaccine
US20080043087A1 (en) 2006-07-19 2008-02-21 James Cowan Digital transfer method for printing on a target surface
CN101516388B (en) * 2006-07-21 2012-10-31 诺和诺德公司 Glycosylation of peptides via O-linked glycosylation sequences
JP2010505874A (en) 2006-10-03 2010-02-25 ノヴォ ノルディスク アー／エス Purification method for polypeptide conjugates
MX2009003470A (en) 2006-10-04 2009-04-14 Novo Nordisk As Glycerol linked pegylated sugars and glycopeptides.
US20080207487A1 (en) * 2006-11-02 2008-08-28 Neose Technologies, Inc. Manufacturing process for the production of polypeptides expressed in insect cell-lines
US20090053167A1 (en) * 2007-05-14 2009-02-26 Neose Technologies, Inc. C-, S- and N-glycosylation of peptides
EP2162535A4 (en) * 2007-06-04 2011-02-23 Novo Nordisk As O-linked glycosylation using n-acetylglucosaminyl transferases
US7968811B2 (en) * 2007-06-29 2011-06-28 Harley-Davidson Motor Company Group, Inc. Integrated ignition and key switch
US8207112B2 (en) 2007-08-29 2012-06-26 Biogenerix Ag Liquid formulation of G-CSF conjugate
US20100286067A1 (en) * 2008-01-08 2010-11-11 Biogenerix Ag Glycoconjugation of polypeptides using oligosaccharyltransferases
AU2009219232B2 (en) 2008-02-27 2014-02-27 Novo Nordisk A/S Conjugated Factor VIII molecules
CA2757169A1 (en) 2009-04-13 2010-10-21 Children's Hospital Medical Center Milk oligosaccharide compositions and use thereof in treating infection in animals
CA2767043C (en) 2009-07-06 2020-07-14 Children's Hospital Medical Center Inhibiting inflammation with milk oligosaccharides
WO2011127322A1 (en) 2010-04-07 2011-10-13 Momenta Pharmaceuticals, Inc. High mannose glycans
EP2465507A1 (en) 2010-11-23 2012-06-20 Nestec S.A. Oligosaccharide composition for treating skin diseases
EP2465509A1 (en) 2010-11-23 2012-06-20 Nestec S.A. Oligosaccharide composition for treating acute respiratory tract infections
EP2454948A1 (en) 2010-11-23 2012-05-23 Nestec S.A. Oligosaccharide mixture and food product comprising this mixture, especially infant formula
EP2465508A1 (en) 2010-11-23 2012-06-20 Nestec S.A. Composition comprising hydrolysed proteins and oligosaccharides for treating skin diseases
EP2663294B1 (en) 2011-01-11 2015-09-30 Capsugel Belgium NV New hard capsules comprising pullulan
CN103782168B (en) 2011-03-12 2016-03-16 动量制药公司 The N-comprising N-acetylhexosamine in glucoprotein product gathers candy
AU2012324993B2 (en) 2011-10-18 2015-11-26 Société des Produits Nestlé S.A. Composition for use in the promotion of magnesium absorption and/or magnesium retention
PT2775852T (en) 2011-10-18 2016-11-08 Nestec Sa Composition for use in brain growth and/or cognitive and/or psychomotor development
EP2768311B1 (en) 2011-10-18 2018-02-21 Nestec S.A. Composition for use in the promotion of intestinal angiogenesis and of nutrient absorption and of enteral feeding tolerance and/or in the prevention and/or treatment of intestinal inflammation and/or in the recovery after intestinal injury and surgery
BR112014008657A2 (en) 2011-10-18 2017-04-25 Nestec Sa composition for use in increasing insulin sensitivity and / or reducing insulin resistance.
EP2768312B1 (en) 2011-10-18 2015-12-09 Nestec S.A. Composition for use in the promotion of healthy bone growth and/or in the prevention and/or treatment of bone disease
US9695244B2 (en) 2012-06-01 2017-07-04 Momenta Pharmaceuticals, Inc. Methods related to denosumab
TWI567200B (en) * 2012-08-20 2017-01-21 中央研究院 Large scale enzymatic synthesis of oligosaccharides
EP2855533A4 (en) 2013-03-15 2015-11-25 Momenta Pharmaceuticals Inc Methods related to ctla4-fc fusion proteins
EP2996772B1 (en) 2013-05-13 2018-12-19 Momenta Pharmaceuticals, Inc. Methods for the treatment of neurodegeneration
US20160257754A1 (en) 2013-10-16 2016-09-08 Momenta Pharmaceuticals Inc. Sialylated glycoproteins
ES2895380T3 (en) 2013-11-15 2022-02-21 Nestle Sa Compositions for use in the prevention or treatment of necrotizing enterocolitis in infants and young children
CN105722515A (en) 2013-11-15 2016-06-29 雀巢产品技术援助有限公司 Compositions for use in the prevention or treatment of URT infections in infants or young children at risk
CN105722514A (en) 2013-11-15 2016-06-29 雀巢产品技术援助有限公司 Compositions for use in the prevention or treatment of necrotizing enterocolitis in infants or young children born by C-section
US9616114B1 (en) 2014-09-18 2017-04-11 David Gordon Bermudes Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity
US20180078572A1 (en) 2015-03-05 2018-03-22 Nestec S.A. Compositions for use in improving stool consistency or frequency in infants or young children
CN107427054A (en) 2015-03-05 2017-12-01 雀巢产品技术援助有限公司 For preventing or treating the otitis of baby or child or the composition of bronchitis
DE202016008919U1 (en) 2015-03-05 2020-09-07 Société des Produits Nestlé S.A. Compositions for use in the prevention or treatment of gastrointestinal infection / inflammation in infants or young children
MX2018015187A (en) 2016-08-04 2019-04-24 Nestec Sa Nutritional compositions with 2fl and lnnt for use in preventing and/or treating non-rotavirus diarrhea by acting on the gut microbiota dysbiosis.
EP3509438A1 (en) 2016-09-07 2019-07-17 Société des Produits Nestlé S.A. Nutritional compositions for infants and/or young children comprising oligosaccharides
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
US11129906B1 (en) 2016-12-07 2021-09-28 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria
CN110678555B (en) 2017-04-14 2023-10-13 比利时胶囊公司 Method for preparing pullulan
JP2020516653A (en) 2017-04-14 2020-06-11 カプスゲル・ベルギウム・ナムローゼ・フェンノートシャップＣａｐｓｕｇｅｌ Ｂｅｌｇｉｕｍ ＮＶ Pullulan capsule
EP4382108A2 (en) 2017-05-09 2024-06-12 Société des Produits Nestlé S.A. Synergistic production of butyrate associated with the complexity of hmos blend for use in infants or young children for health purposes
AU2018272764B2 (en) 2017-05-24 2024-05-30 Societe Des Produits Nestle S.A. HMOs blends for use in infants or young children for health purposes
CN110799045A (en) 2017-05-24 2020-02-14 雀巢产品有限公司 Compositions comprising Human Milk Oligosaccharides (HMOs) for improving short term memory and other cognitive benefits
RU2019141902A (en) 2017-05-24 2021-06-17 Сосьете Де Продюи Нестле С.А. COMPOSITION CONTAINING OLIGOFRUITOSE (OF) FOR USE IN IMPROVING SHORT-TERM MEMORY AND OBTAINING OTHER Cognitive Benefits
US20210008086A1 (en) 2017-12-21 2021-01-14 Societe Des Produits Nestle S.A. Compositions for use in the promotion of intestinal muscle growth and development and associated intestinal motility
AU2018387279A1 (en) 2017-12-21 2020-05-07 Societe Des Produits Nestle S.A. Compositions comprising at least on N-acetylated and at least one fucosylated oligosaccharide for use in the promotion of digestive capacity in infants and young children
CN111432661A (en) 2017-12-22 2020-07-17 雀巢产品有限公司 Composition for reducing the sensation of harm in infants and young children
EP3809879A1 (en) 2018-06-25 2021-04-28 Société des Produits Nestlé S.A. Composition comprising human milk oligosaccharides for use in improving, enhancing, promoting or modulating a gabaergic function in the central nervous system
US20210267252A1 (en) 2018-06-25 2021-09-02 Societe Des Produits Nestle S.A. Composition comprising human milk oligosaccharides for use in improving, enhancing, promoting or modulating a serotonergic function in the central nervous system
EP3650044A1 (en) * 2018-11-06 2020-05-13 ETH Zürich Anti-glycan vaccines
CN113163832A (en) 2018-11-30 2021-07-23 雀巢产品有限公司 Infant nutritional compositions for enhancing pancreatic maturation and insulin biosynthesis
US20220062311A1 (en) 2018-12-21 2022-03-03 Societe Des Produits Nestle S.A. A nutritional composition comprising a combination of human milk oligosaccharides to improve the gastrointestinal barrier
US20220287349A1 (en) 2018-12-21 2022-09-15 Societe Des Produits Nestle S.A. A nutritional composition comprising 6'sl and lnt in combination to improve the gastrointestinal barrier function
WO2020126587A1 (en) 2018-12-21 2020-06-25 Societe Des Produits Nestle S.A. A NUTRITIONAL COMPOSITION COMPRISING METABOLITES OF HMOs TO IMPROVE THE GASTROINTESTINAL BARRIER
EP3934656A1 (en) 2019-03-05 2022-01-12 Société des Produits Nestlé S.A. A nutritional composition for use to enhance executive function
AU2020309556A1 (en) * 2019-07-08 2022-03-03 Crapaud Bio, Inc. Methods of making and using lipooligosaccharide compositions and vaccines
WO2021074374A1 (en) 2019-10-17 2021-04-22 Société des Produits Nestlé S.A. Extensively hydrolysed infant formula
US20240138461A1 (en) 2019-10-17 2024-05-02 Societe Des Produits Nestle S.A. Infant formula
AU2020399200A1 (en) 2019-12-11 2022-06-09 Société des Produits Nestlé S.A. Compositions for use in the reduction of nociception and other health benefits in infants and young children
US20230026618A1 (en) 2019-12-30 2023-01-26 Societe Des Produits Nestle S.A. Infant formula
JP2023545928A (en) 2020-10-16 2023-11-01 ソシエテ・デ・プロデュイ・ネスレ・エス・アー Nutritional composition containing human milk oligosaccharides
EP4228435A1 (en) 2020-10-16 2023-08-23 Société des Produits Nestlé S.A. Infant or young child formula
CN116347997A (en) 2020-11-10 2023-06-27 雀巢产品有限公司 Nutritional composition
AU2021403857A1 (en) 2020-12-18 2023-06-08 Société des Produits Nestlé S.A. Compositions for use in promoting accelerated butyrate production in young children
AU2022301175A1 (en) 2021-06-29 2024-01-04 Société des Produits Nestlé S.A. Bifidobacterium longum transitional microorganisms, compositions and uses thereof
WO2023237306A1 (en) 2022-06-09 2023-12-14 Dsm Ip Assets B.V. Nutritional composition comprising gos and hmos

Family Cites Families (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1479268A (en) * 1973-07-05 1977-07-13 Beecham Group Ltd Pharmaceutical compositions
US4179337A (en) * 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
CH596313A5 (en) * 1975-05-30 1978-03-15 Battelle Memorial Institute
US4385260A (en) * 1975-09-09 1983-05-24 Beckman Instruments, Inc. Bargraph display
US4414147A (en) * 1981-04-17 1983-11-08 Massachusetts Institute Of Technology Methods of decreasing the hydrophobicity of fibroblast and other interferons
JPS57206622A (en) * 1981-06-10 1982-12-18 Ajinomoto Co Inc Blood substitute
US4496689A (en) * 1983-12-27 1985-01-29 Miles Laboratories, Inc. Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer
US4565653A (en) * 1984-03-30 1986-01-21 Pfizer Inc. Acyltripeptide immunostimulants
US4879236A (en) * 1984-05-16 1989-11-07 The Texas A&M University System Method for producing a recombinant baculovirus expression vector
JPS6238172A (en) * 1985-08-12 1987-02-19 株式会社　高研 Production of anti-thrombotic medical material
US4767702A (en) * 1986-02-06 1988-08-30 Cohenford Menashi A Paper strip assay for neisseria species
US4925796A (en) * 1986-03-07 1990-05-15 Massachusetts Institute Of Technology Method for enhancing glycoprotein stability
US5153265A (en) * 1988-01-20 1992-10-06 Cetus Corporation Conjugation of polymer to colony stimulating factor-1
GB8810808D0 (en) * 1988-05-06 1988-06-08 Wellcome Found Vectors
US5169933A (en) * 1988-08-15 1992-12-08 Neorx Corporation Covalently-linked complexes and methods for enhanced cytotoxicity and imaging
US5874261A (en) * 1988-09-02 1999-02-23 The Trustees Of The University Of Pennsylvania Method for the purification of glycosyltransferases
US6166183A (en) * 1992-11-30 2000-12-26 Kirin-Amgen, Inc. Chemically-modified G-CSF
US5194376A (en) * 1989-02-28 1993-03-16 University Of Ottawa Baculovirus expression system capable of producing foreign gene proteins at high levels
US5154924A (en) * 1989-09-07 1992-10-13 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical agent conjugates
US5977307A (en) * 1989-09-07 1999-11-02 Alkermes, Inc. Transferrin receptor specific ligand-neuropharmaceutical agent fusion proteins
US5527527A (en) * 1989-09-07 1996-06-18 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical agent conjugates
US5182107A (en) * 1989-09-07 1993-01-26 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical or diagnostic agent conjugates
US5672683A (en) * 1989-09-07 1997-09-30 Alkermes, Inc. Transferrin neuropharmaceutical agent fusion protein
DE4009630C2 (en) * 1990-03-26 1995-09-28 Reinhard Prof Dr Dr Brossmer CMP-activated fluorescent sialic acids and processes for their preparation
EP0481038B1 (en) * 1990-04-16 2002-10-02 The Trustees Of The University Of Pennsylvania Saccharide compositions, methods and apparatus for their synthesis
CU22302A1 (en) * 1990-09-07 1995-01-31 Cigb Codifying nucleotidic sequence for a protein of the external membrane of neisseria meningitidis and the use of that protein in preparing vaccines.
US5352670A (en) * 1991-06-10 1994-10-04 Alberta Research Council Methods for the enzymatic synthesis of alpha-sialylated oligosaccharide glycosides
KR950014915B1 (en) * 1991-06-19 1995-12-18 주식회사녹십자 Asialoglycoprotein-conjugated compounds
FI100051B (en) * 1992-02-18 1997-09-15 Favorit Oy composting
US6037452A (en) * 1992-04-10 2000-03-14 Alpha Therapeutic Corporation Poly(alkylene oxide)-Factor VIII or Factor IX conjugate
US5614184A (en) * 1992-07-28 1997-03-25 New England Deaconess Hospital Recombinant human erythropoietin mutants and therapeutic methods employing them
JP3979678B2 (en) * 1992-08-24 2007-09-19 サントリー株式会社 Novel glycosyltransferase, gene encoding the same, and method for producing the enzyme
US5374541A (en) * 1993-05-04 1994-12-20 The Scripps Research Institute Combined use of β-galactosidase and sialyltransferase coupled with in situ regeneration of CMP-sialic acid for one pot synthesis of oligosaccharides
EP0698103A1 (en) * 1993-05-14 1996-02-28 PHARMACIA & UPJOHN COMPANY CLONED DNA ENCODING A UDP-GALNAc:POLYPEPTIDE,N-ACETYLGALACTOS AMINYLTRANSFERASE
US5621039A (en) * 1993-06-08 1997-04-15 Hallahan; Terrence W. Factor IX- polymeric conjugates
US5443953A (en) * 1993-12-08 1995-08-22 Immunomedics, Inc. Preparation and use of immunoconjugates
US5369017A (en) * 1994-02-04 1994-11-29 The Scripps Research Institute Process for solid phase glycopeptide synthesis
US5492841A (en) * 1994-02-18 1996-02-20 E. I. Du Pont De Nemours And Company Quaternary ammonium immunogenic conjugates and immunoassay reagents
US5432059A (en) * 1994-04-01 1995-07-11 Specialty Laboratories, Inc. Assay for glycosylation deficiency disorders
US5646113A (en) * 1994-04-07 1997-07-08 Genentech, Inc. Treatment of partial growth hormone insensitivity syndrome
US5545553A (en) * 1994-09-26 1996-08-13 The Rockefeller University Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US5834251A (en) * 1994-12-30 1998-11-10 Alko Group Ltd. Methods of modifying carbohydrate moieties
US5932462A (en) * 1995-01-10 1999-08-03 Shearwater Polymers, Inc. Multiarmed, monofunctional, polymer for coupling to molecules and surfaces
US6030815A (en) * 1995-04-11 2000-02-29 Neose Technologies, Inc. Enzymatic synthesis of oligosaccharides
US5728554A (en) * 1995-04-11 1998-03-17 Cytel Corporation Enzymatic synthesis of glycosidic linkages
US5922577A (en) * 1995-04-11 1999-07-13 Cytel Corporation Enzymatic synthesis of glycosidic linkages
US5876980A (en) * 1995-04-11 1999-03-02 Cytel Corporation Enzymatic synthesis of oligosaccharides
US6015555A (en) * 1995-05-19 2000-01-18 Alkermes, Inc. Transferrin receptor specific antibody-neuropharmaceutical or diagnostic agent conjugates
DE69638117D1 (en) * 1995-09-21 2010-03-04 Genentech Inc Variants of human growth hormone
US5716812A (en) * 1995-12-12 1998-02-10 The University Of British Columbia Methods and compositions for synthesis of oligosaccharides, and the products formed thereby
US6087325A (en) * 1996-10-15 2000-07-11 The Liposome Company, Inc. Peptide-lipid conjugates
US5945314A (en) * 1997-03-31 1999-08-31 Abbott Laboratories Process for synthesizing oligosaccharides
US6183738B1 (en) * 1997-05-12 2001-02-06 Phoenix Pharamacologics, Inc. Modified arginine deiminase
US20030027257A1 (en) * 1997-08-21 2003-02-06 University Technologies International, Inc. Sequences for improving the efficiency of secretion of non-secreted protein from mammalian and insect cells
CA2312843A1 (en) * 1997-12-01 1999-06-10 Neose Technologies Inc. Enzymatic synthesis of gangliosides
EP0924298A1 (en) * 1997-12-18 1999-06-23 Stichting Instituut voor Dierhouderij en Diergezondheid (ID-DLO) Protein expression in baculovirus vector expression systems
ATE268609T1 (en) * 1998-03-12 2004-06-15 Nektar Therapeutics Al Corp POLYETHYLENE GLYCOL DERIVATIVES WITH ADJACENT REACTIVE GROUPS
DE19852729A1 (en) * 1998-11-16 2000-05-18 Werner Reutter Recombinant glycoproteins, processes for their preparation, medicaments containing them and their use
US6261805B1 (en) * 1999-07-15 2001-07-17 Boyce Thompson Institute For Plant Research, Inc. Sialyiation of N-linked glycoproteins in the baculovirus expression vector system
US6537785B1 (en) * 1999-09-14 2003-03-25 Genzyme Glycobiology Research Institute, Inc. Methods of treating lysosomal storage diseases
NZ522030A (en) * 2000-05-15 2004-11-26 F Erythropoietin composition with a multiple charged inorganic anion i.e. a sulfate a citrate or a phosphate to stabilize the composition
NZ523476A (en) * 2000-06-28 2004-04-30 Glycofi Inc Methods for humanizing glycosylation of recombinant glycoproteins expressed in lower eukaryotes
US6531121B2 (en) * 2000-12-29 2003-03-11 The Kenneth S. Warren Institute, Inc. Protection and enhancement of erythropoietin-responsive cells, tissues and organs
JP2004531550A (en) * 2001-05-11 2004-10-14 アラダイム コーポレーション Methods and formulations for optimizing molecular properties of proteins delivered by inhalation
JP5232352B2 (en) * 2001-10-10 2013-07-10 ノボ ノルデイスク エイ エス Peptide remodeling and glycoconjugation
US7125843B2 (en) * 2001-10-19 2006-10-24 Neose Technologies, Inc. Glycoconjugates including more than one peptide
US7795210B2 (en) * 2001-10-10 2010-09-14 Novo Nordisk A/S Protein remodeling methods and proteins/peptides produced by the methods
US7214660B2 (en) * 2001-10-10 2007-05-08 Neose Technologies, Inc. Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7696163B2 (en) * 2001-10-10 2010-04-13 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7368108B2 (en) * 2001-11-28 2008-05-06 Neose Technologies, Inc. Glycopeptide remodeling using amidases
EP1549332A4 (en) * 2002-09-05 2008-06-18 Gen Hospital Corp Modified asialo-interferons and uses thereof
US20070254834A1 (en) * 2003-11-24 2007-11-01 Defrees Shawn Glycopegylated Erythropoietin
US8633157B2 (en) * 2003-11-24 2014-01-21 Novo Nordisk A/S Glycopegylated erythropoietin
EP1694351A2 (en) * 2003-12-03 2006-08-30 Neose Technologies, Inc. Glycopegylated follicle stimulating hormone
CA2552892C (en) * 2004-01-08 2014-08-05 Neose Technologies, Inc. O-linked glycosylation of peptides
US20060024286A1 (en) * 2004-08-02 2006-02-02 Paul Glidden Variants of tRNA synthetase fragments and uses thereof
US20070105755A1 (en) * 2005-10-26 2007-05-10 Neose Technologies, Inc. One pot desialylation and glycopegylation of therapeutic peptides

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8791070B2 (en) 2003-04-09 2014-07-29 Novo Nordisk A/S Glycopegylated factor IX
US8632770B2 (en) 2003-12-03 2014-01-21 Novo Nordisk A/S Glycopegylated factor IX
US9200049B2 (en) 2004-10-29 2015-12-01 Novo Nordisk A/S Remodeling and glycopegylation of fibroblast growth factor (FGF)
US10874714B2 (en) 2004-10-29 2020-12-29 89Bio Ltd. Method of treating fibroblast growth factor 21 (FGF-21) deficiency
US8404809B2 (en) 2005-05-25 2013-03-26 Novo Nordisk A/S Glycopegylated factor IX
US9050304B2 (en) 2007-04-03 2015-06-09 Ratiopharm Gmbh Methods of treatment using glycopegylated G-CSF
US9493499B2 (en) 2007-06-12 2016-11-15 Novo Nordisk A/S Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography

Also Published As

Publication number Publication date
WO1996010086A1 (en) 1996-04-04
CA2502785C (en) 2011-05-17
US20100316675A1 (en) 2010-12-16
EP1568777B1 (en) 2011-06-22
US20020127682A1 (en) 2002-09-12
MX9702351A (en) 1997-10-31
US20050271690A1 (en) 2005-12-08
ATE435290T1 (en) 2009-07-15
CA2502785A1 (en) 1996-04-04
US6780624B2 (en) 2004-08-24
ES2371440T3 (en) 2012-01-02
US6342382B1 (en) 2002-01-29
EP0784688B1 (en) 2009-07-01
US8268596B2 (en) 2012-09-18
KR970706400A (en) 1997-11-03
EP1568777A1 (en) 2005-08-31
US5945322A (en) 1999-08-31
JP3756182B2 (en) 2006-03-15
US5705367A (en) 1998-01-06
DE69535975D1 (en) 2009-08-13
JP3976765B2 (en) 2007-09-19
JP2005296022A (en) 2005-10-27
US5545553A (en) 1996-08-13
CA2200973A1 (en) 1996-04-04
JPH10509301A (en) 1998-09-14
AU3685695A (en) 1996-04-19
AU714684B2 (en) 2000-01-06
US5798233A (en) 1998-08-25
ATE513916T1 (en) 2011-07-15
EP0784688A1 (en) 1997-07-23
KR100465892B1 (en) 2005-07-18

Similar Documents

Publication Publication Date Title
US8268596B2 (en) Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
US6379933B1 (en) Method of transferring at least two saccharide units with a polyglycosyltransferase
Gotschlich Genetic locus for the biosynthesis of the variable portion of Neisseria gonorrhoeae lipooligosaccharide.
JP2009000122A (en) Campylobacter glycosyltransferase for biosynthesis of ganglioside and ganglioside mimic
Ganguli et al. Molecular cloning and analysis of genes for sialic acid synthesis in Neisseria meningitidis group B and purification of the meningococcal CMP-NeuNAc synthetase enzyme
US6238894B1 (en) α1,2 fucosyltransferase
Sieberth et al. Expression and characterization of UDPGlc dehydrogenase (KfiD), which is encoded in the type-specific region 2 of the Escherichia coli K5 capsule genes
US6444804B1 (en) Proteins involved in the synthesis and assembly of core lipopolysaccharide of Pseudomonas aeruginosa
AU714684C (en) Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
Ullrich et al. Identification of the gonococcal glmU gene encoding the enzyme N-acetylglucosamine 1-phosphate uridyltransferase involved in the synthesis of UDP-GlcNAc
US5798243A (en) Bacterial peptide methionine sulfoxide reductase, and adhesion-associated protein, and antibiotic therapies based thereon
CA2308259A1 (en) Method for assaying the function of flaa1 and wbpm
Minor et al. The genetics of LPS synthesis by the gonococcus
MXPA97009505A (en) Method to transfer at least two units of success with a poliglicoslitransfer

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION