US20030208060A1 - DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein - Google Patents
DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein Download PDFInfo
- Publication number
- US20030208060A1 US20030208060A1 US10/459,876 US45987603A US2003208060A1 US 20030208060 A1 US20030208060 A1 US 20030208060A1 US 45987603 A US45987603 A US 45987603A US 2003208060 A1 US2003208060 A1 US 2003208060A1
- Authority
- US
- United States
- Prior art keywords
- individual
- apob
- receptor
- seq
- binding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides an isolated DNA molecule that codes for a cell-surface binding protein in human monocytes and macrophages. In addition, an amino acid sequence derived from the nucleotide sequence is provided. The newly-identified cell-surface binding protein described herein is instrumental in the apoB-mediated cellular uptake of plasma chylomicrons and remnants and hypertriglyceridemic triglyceride-rich lipoproteins in an ApoE- and lipoprotein lipase- and heparin sulfate proteoglycan-independent pathway. The new human macrophage receptor has been cloned and uniquely, binds TGRLP via apolipoprotein B48, the marker of dietary TGRLP (apoB48R). This process rapidly converts macrophages and apoB48R-transfected Chinese hamster ovary cells in vitro into lipid-filled “foam cells,” hallmarks of atherosclerotic lesions. The apoB48R cDNA (3744 bp) encodes a novel protein with no known homologs. Its ˜3.8 kb mRNA is expressed primarily by reticuloendothelial cells. Immunohistochemical studies indicate that foam cells of human atherosclerotic lesions express the apoB48R.
Description
- This application is a continuation-in-part and claims the benefit of priority under 35 USC §120 of U.S. patent application Ser. No. 09/130,242, filed Sep. 8, 1998.
- [0002] This invention was produced in part using funds from the Federal government under National Institutes of Health grant HL44480. Accordingly, the Federal government has certain rights in this invention.
- 1. Field of the Invention
- The present invention relates generally to the fields of molecular biology, cardiovascular medicine and cellular nutrition. More specifically, the present invention relates to DNA encoding the human monocyte-macrophage and placental triglyceride-rich lipoprotein/apolipoprotein B (apoB) receptor gene(s) and protein(s).
- 2. Description of the Related Art
- Hypertriglyceridemia is a common, heterogeneous disorder. When chylomicrons persist in the fasting state, lipid-filled monocyte-macrophage-derived foam cells can accumulate in the spleen, liver, bone marrow, atherosclerotic lesions, and skin (Fredrickson, 1978). Many, but not all, early studies (Carlson, 1972; Brunzell, 1976; Grundy, 1988; Schaefer, 1988; Austin, 1991) indicate elevated plasma triglycerides are a risk factor for coronary heart disease and myocardial infarction, sequelae of atherosclerosis. The possibility that triglyceride-rich lipoproteins (hepatic as well a s dietary) are involved in atherosclerosis has been strengthened recently. Both the Procam study and a follow-up of the Helsinki Heart Study implicate elevated triglycerides (and therefore triglyceride-rich lipoproteins) as an important risk factor in atherosclerosis (Assmann, 1992). Havel et al. demonstrated that plasma very low density lipoprotein and intermediate density lipoprotein cholesterol levels correlated with progression of coronary atherosclerosis disease, whereas low density lipoprotein cholesterol level did not (Phillips, 1993). Moreover, very low density lipoprotein-intermediate density lipoprotein particles enter the artery wall and are found in human atherosclerotic plaques (Rapp, 1994). Elevated postprandial chylomicron remnants of Sf<400 are significantly higher in subjects with coronary heart disease but with normal fasting lipid levels than in matched control subjects without this disease (Patsch, 1992; Weintraub, 1996). Thus, there is increasing biochemical as well as epidemiologic evidence that the major carriers of plasma triglycerides, very low density lipoproteins and plasma chylomicrons and their remnants, are atherogenic.
- Monocytes and macrophages play a key role in atherogenesis, accounting for many lipid-filled “foam cells” in atherosclerotic lesions (Gerrity, 1981; Faggiotto, 1984). Many studies on foam cell formation have focused on uptake of modified and oxidized low density lipoprotein by the macrophage scavenger receptor and putative oxidized low density lipoprotein receptors (van Berkel, 1994). However, monocytes and macrophages also take up intestinally-derived plasma chylomicrons, which contain apoB-48, and hepatically-derived very low density lipoprotein (apoB-100). Zilversmit and colleagues demonstrated extrahepatic uptake of ˜40% of chylomicrons in rabbits (Ross, 1977) that was decreased by inhibition of the reticuloendothelial system (Nagata, 1987). Furthermore, studies in marmosets (a primate) and rabbits demonstrated substantial uptake (20-40% of total) of chylomicrons in vivo by accessible, peripheral macrophages, particularly in bone marrow (both animals) and spleen (marmosets) (Hussain, 1989a, 1989b). This would suggest that triglyceride-rich lipoproteins serve as a non-modified, native source of lipid for monocytes' and macrophages' nutrition in the normal state.
- Triglyceride-rich lipoproteins are involved in the pathological conversion of monocytes and macrophages into foam cells in humans, a process seen in bone marrow, spleen, etc. in
types - Chylomicrons and hypertriglyceridemic-very low density lipoproteins (including β-very low density lipoproteins) are the only known native human lipoproteins, without modification, which directly cause rapid, receptor-mediated macrophage lipid accumulation in vitro, causing macrophages to resemble foam cells histologically (Gianturco, 1982b, 1986a, 1986b, 1988; Brown et al., 1983; Ostlund-Lindqvist, 1983; Bersot, 1986). The lipid that accumulates in macrophages after receptor-mediated uptake of a lipoprotein in vitro reflects the lipid composition of the lipoprotein (Gianturco, 1982b; Brown et al., 1983). Therefore, as seen in vivo, triglyceride is the predominant lipid which accumulates initially in macrophages exposed to hypertriglyceridemic-very low density lipoproteins or chylomicrons, but cholesterol and cholesteryl esters also accumulate even in short term incubations (Gianturco, 1986a). Triglyceride-rich lipoproteins enter the arterial wall in animals (Nordesgaard, 1994) and in man (Rapp, 1994). Since one triglyceride-rich lipoprotein Sf>100 contains 5 times or more cholesterol and cholesteryl esters than one low density lipoprotein (Shen, 1978), each triglyceride-rich lipoprotein that enters a monocyte, macrophage or the arterial wall is equivalent to 5 or more low density lipoprotein particles in terms of cholesterol delivery.
- A number of plausible mechanisms for the above-described observations exist, many involving apoE. Very low density lipoproteins from hypertriglyceridemic subjects were first shown to be abnormal and potentially atherogenic in studies which showed that very low density lipoproteins from hypertriglyceridemic, but not from normal subjects, deliver cholesterol to cultured fibroblasts via the low density lipoprotein receptor (Gianturco, 1978). The abnormality in hypertriglyceridemic-very low density lipoproteins is primarily in the Sf>60 subfraction which, in contrast to normal very low density lipoproteins fraction Sf>60, contains extra apoE of an accessible conformation that specifically binds to the low density lipoprotein receptor; apoB of Sf>60 particles does not bind to the LDL receptor (Gianturco, 1982a, 1983; Bradley, 1984; Hui, 1984; Krul, 1985; Eisenberg 1988). ApoE also mediates triglyceride-rich lipoprotein binding to other widely-distributed receptors in the low density lipoprotein receptor gene family, such as the low density lipoprotein receptor-related protein/α2-macroglobulin receptor (Beisiegel, 1989; Kowal, 1989) and a very low density lipoprotein receptor expressed primarily in heart, muscle, and adipose (Takahashi, 1992). One of these could account for apoE-mediated very low density lipoprotein uptake observed in monocytes and macrophages (Wang-Iverson, 1985).
- In contrast, apoB mediates the binding of low density lipoprotein (Goldstein, 1977), intermediate density lipoproteins (Sf12-20), and the predominant very low density lipoprotein in normal subjects, very low density lipoprotein3 (Sf20-60) (Bradley, 1984; Krul, 1985), the only very low density lipoprotein subclass from normal subjects that binds to the low density lipoprotein receptor of fibroblasts (Gianturco, 1980a, 1982a, Eisenberg, 1988) or of U937 monocytes (Sacks and Breslow, 1988). The domain of apoB that binds to the low density lipoprotein receptor is in the C-terminal portion not present in apoB-48 (Yang, 1986; Milne, 1989).
- Lipolysis of normal very low density lipoprotein Sf>60 permits binding of the lipolytic remnant to the low density lipoprotein receptor (Catapano, 1979; Schonfeld, 1979). Lipoprotein lipase secreted by macrophages (Khoo, 1981) hydrolyzes very low density lipoproteins and enhances its cellular uptake (Lindquist, 1983). This facilitation may occur through localization of triglyceride-rich lipoproteins to membrane heparin sulfate proteoglycan (Eisenberg, 1992) and/or through binding to low density lipoprotein receptor-related protein (Beisiegel, 1991).
- The substantial and rapid uptake of triglyceride-rich chylomicrons in vivo by bone marrow and spleen macrophages in marmosets and rabbits was not accelerated by infusion of apoE (Hussain, 1989a). This is surprising, since apoE is a necessary ligand for the uptake of large triglyceride-rich lipoproteins by members of the low density lipoprotein receptor gene family. Indeed, infused apoE diverted much of the uptake from the peripheral macrophages to the liver, suggesting that the observed peripheral macrophage chylomicron uptake was not mediated by apoE and that these macrophages have an apoE-independent uptake mechanism. The rate and magnitude of triglyceride-rich chylomicron uptake by bone marrow monocytes and macrophages (20-40% of chylomicrons cleared from the plasma at 20 minutes (Hussain, 1989a)) suggests this uptake is receptor mediated. Rapid, receptor-mediated delivery of intestinally-derived, triglyceride-enriched chylomicrons may b e necessary to assure delivery of sufficient energy and fat-soluble vitamins and other essential compounds to sustain hematopoiesis. In addition, and in contrast to inactivation of the apoE gene, loss of apoB by homologous recombination caused embryonic lethality in the homozygous state. ApoB is normally expressed early in yolk sak visceral endodermal cells for the synthesis of apoB-containing lipoprotein which are apparently necessary for the transport of lipids and lipid-soluble vitamins to embryonic tissues.
- Moreover, homologous recombinant (“knockout”) mice that completely lack apoE accumulate very low density lipoprotein and chylomicron remnants in their plasma (Plump, 1992; Zhang, 1992). These mice develop atherosclerosis that is accelerated by high fat diets. The lesions are characterized by monocyte-macrophage-derived foam cells, as in human lesions, demonstrating unequivocally that apoE is not necessary for the conversion of monocytes and macrophages into foam cells in vivo (Nakashima, 1994; Reddick, 1994). Taken together, these in vivo studies suggest strongly the existence of an apoE-independent pathway for the uptake of triglyceride-rich lipoproteins by monocytes and macrophages, which would result in foam cell formation in hypertriglyceridemia.
- In vitro evidence for an apoE- and lipoprotein lipase-independent, apoB-mediated triglyceride-rich lipoprotein receptor pathway in murine macrophages has been reported (Gianturco, 1988). Because of the potential importance of an apoE-independent, receptor-mediated pathway for triglyceride-rich lipoproteins in the formation of foam cells in human pathology, particularly in hypertriglyceridemic subjects, the human monocyte-macrophage receptor from the monocytic cell line THP-1 was characterized and purified and receptor-specific antibodies were produced. Briefly, this unique apoE-and lipoprotein lipase-independent pathway and binding site is in murine macrophages, human monocytes and macrophages, and in the human monocytic cell lines THP-1 and U937, but not in human fibroblasts or hepatoma cell lines or in Chinese hamster ovary (CHO) cells (Gianturco, 1988, 1994a). Further, ligand blotting studies in bovine and porcine aortic endothelial cells also were positive. Thus, endothelial cells specifically bound chylomicrons followed b y hydrolysis and uptake of their cholesteryl esters (Fielding, 1978) and very low density lipoproteins from hypertriglyceridemic subjects, but not from normal subjects, delivered cholesterol to cultured endothelial cells (Gianturco, 1980).
- Since the apoE-independent and lipoprotein lipase-independent receptor also binds 13-very low density lipoproteins, but with lower affinity, it was once referred to as a β-very low density lipoprotein receptor (Goldstein, 1980; Gianturco, 1986a). Subsequent studies, however, demonstrated that uptake of triglyceride-rich lipoproteins independent of apoE was not inhibited by anti-low density lipoprotein receptor antibodies that inhibited the low density lipoprotein receptor-mediated uptake of rabbit β-very low density lipoproteins in the same cells, nor did anti-low density lipoprotein receptor antibodies bind to the candidate receptor (Gianturco, 1988). The apoE-independent receptor differs from the low density lipoprotein receptor family or the scavenger receptor family in many properties including (1) unchanged expression during differentiation, (2) slower intracellular ligand degradation, (3) ligand specificity, (4) apparent molecular weight of the candidate receptors, and (5) cellular distribution.
- The prior art is deficient in the lack of the sequence of the DNA encoding for the monocyte-macrophage apoB receptor gene and protein, in the genomic structure and chromosomal localization and in the understanding of its expression in the placenta, human coronary, carotid, and aortic macrophage-derived foam cells in atherosclerotic lesions and in other immune tissues including peripheral blood leukocytes, bone marrow, spleen, tonsils and appendix. The present invention fulfills this longstanding need and desire in the art.
- Monocyte-macrophage-derived foam cells accumulate in atherosclerotic lesions and throughout the body in some types of hypertriglyceridemia. Uptake of plasma chylomicrons and hypertriglyceridemic triglyceride-rich lipoproteins by an apoE-independent human monocyte and macrophage receptor, distinct from previously-described lipoprotein receptors, may b e involved in foam cell formation in vivo. Two cell-surface membrane binding proteins (MBPs) of ˜200 and ˜235 kDa, in human monocytes and macrophages and THP-1 monocytes and macrophages, were characterized as the likely receptors. It was determined that both MBPs share a common 200 kDa ligand binding subunit. This ligand-binding subunit was purified and internal tryptic peptide sequences were obtained. Receptor-specific antipeptide antibodies were generated against a 10-residue unique and unambiguous internal sequence (to which no matches were found in GenBank, Swiss Pro, etc) that binds the active receptor forms MBP200, MBP200R and MBP235. Antibodies against the C-terminal ˜47 kDa receptor domain and other domains were produced and shown to bind to all active forms of the receptor. Overlapping partial cDNAs from a λgt10 THP-1 library and from a λgt10 human placental library corresponding to the receptor were obtained and sequenced.
- The present invention shows that cell-surface MBP200 and MBP235 are unique monocyte, macrophage, placental and endothelial cell receptors for apoB in plasma chylomicrons and some hypertriglyceridemic-triglyceride-rich lipoproteins and their remnants; other apoB-containing lipoproteins also bind to the receptor with varying, generally much lower, affinities. The present invention also shows that said receptors bind to apoB-48 and to the N-terminal portion of apoB-100 at or near the lipoprotein lipase binding site and not in a heparin-binding domain. Normally, the MBPs may be involved in nutrition of circulating monocytes and accessible, peripheral macrophages, e.g. bone marrow; in lipemic states, the pathway can be overwhelmed and contribute to foam cell formation and endothelial cell dysfunction. Therefore, diminished triglyceride-rich lipoprotein uptake by this receptor, due either to receptor defects or to triglyceride-rich lipoprotein defects leading to altered receptor affinity, may be involved with metabolic abnormalities associated with increased risk for cardiovascular disease, such as modest hypertriglyceridemia and small, dense low density lipoproteins (pattern B) and/or persistence of chylomicron-derived, (i.e., apoB-48-containing) lipoproteins in the fasting state. Diminished activity of the receptor in the placenta could result in fetal abnormalities due to reduced delivery of dietary fat-soluble vitamins (A, E, D) and essential fatty acids and other essential nutrients that are carried in chylomicrons.
- To clone the cDNA for MBP200R, PCR with degenerate primers were used and a THP-1 λgt10 cDNA library to produce a 631 bp product (pcr631) (SEQ ID No. 3) which contains three peptide sequences found in amino acid sequence from MBP200R. pcr631 was used to identify several distinct cDNA clones. One clone, THP-1 λ73-3 (SEQ ID No. 9), contains an 1851 bp insert with a 1381 bp open reading frame (ORF) and 470 bp untranslated region including the stop codon, the polyadenylation signal and the poly-A tail. PCR on a 5′ stretch human placenta λgt10 cDNA library using antisense primers derived from the 5′ end of THP-1 λ73-3 resulted in a 1466 bp clone with an open reading frame that overlapped the open reading frame of THP-1 λ73-3 (pcr1466) (SEQ ID No. 8) resulting in a 3071 bp sequence with a 2601 bp open reading frame. Glutathione-S-transferase fusion proteins were expressed using the pcr631, THP-1 λ73-3, and pcr1466 pGEX constructs. Polyclonal antibodies were produced to each protein domain. Immunoblots demonstrate that the antibodies specifically recognize the GST-fusion products and all receptor activities (MBP200, MBP235 and MBP200R). Additional 5′ sequence obtained by PCR of the human placenta λgt10 cDNA library with antisense primers from the 5′ end of pcr1466 resulted in a 75 bp clone (pcr751) (SEQ ID No. 7) that contained a 10 bp untranslated 5′ end, a Kozak consensus start sequence and the initial ATG start codon. The sequences obtained from multiple clones from THP-1 monocyte genomic DNA and the cDNA library result in 3744 bases of cDNA sequence (SEQ ID No. 1) with an open reading frame of 3264 b p encoding a 1088 residue protein for the human monocyte apoB48 receptor. Northern analysis of THP-1s, human placenta, bone marrow, peripheral blood leukocytes, spleen, tonsils, appendix, and lymph node reveal a messenger RNA of approximately 3.8 kb, indicating the complete cDNA sequence has been determined. A full-length cDNA was constructed in a pCDNA vector. Chinese hamster ovary (CHO) cells transfected with the vector containing the receptor cDNA, in contrast to the pCDNA vector alone, expressed full receptor activity as determined by rapid, high affinity binding and uptake of fluorescent DiI-labeled trypsinized VLDL and, in stably transfected CHOs, by rapid cellular triglyceride mass accumulation and by the rapid (˜1.5 hour) accumulation of cytoplasmic lipid droplets visualized by light microscopy after staining with the neutral
lipid Oil Red 0, after incubation with chylomicrons containing apoB48 as the B species, HTG-VLDL and tryp VLDL but not with normal VLDL or LDL. - One object of the present invention is to provide a n isolated DNA molecule encoding a monocyte-macrophage cell surface apoB48R binding protein selected from the group consisting of: (a) a DNA molecule comprising a sequence SEQ ID No. 1 and which encodes the monocyte-macrophage cell surface apoB48R binding protein (the apoB receptor) (SEQ ID No. 2) or a portion of the monocyte-macrophage cell surface apoB48R binding protein; and (b) a DNA molecule differing from the DNA molecule of (a) in codon sequence due to the degeneracy of the genetic code, and which encodes the monocyte-macrophage cell surface apoB48R binding protein (SEQ ID No. 2) or a portion of the monocyte-macrophage cell surface apoB48R binding protein. Embodiments of this object of the invention include provisions for a vector containing the isolated DNA molecule encoding a monocyte-macrophage cell surface apoB48R binding protein and regulatory elements necessary for expression of said isolated DNA molecule in a cell, the vector adapted for expression in a recombinant cell, as well as a host cell containing the vector.
- An additional object of the present invention is to provide a vector comprising an isolated DNA for a monocyte-macrophage cell surface apoB48R GST fusion binding protein having the sequence SEQ ID No. 2 or portions thereof.
- A further object of the present invention is to provide a method of cell-specific delivery of therapeutic compounds to human monocytes, macrophages, other reticuloendothelial cells that express the receptor or embryos comprising the steps of: providing a peptide or antibody(s) having the ability to bind to an isolated monocyte-macrophage cell surface apoB48R binding protein having the sequence SEQ ID No.2, or a portion of said sequence or comprising a related protein of the same gene family; and incorporating the peptide into liposomes containing said therapeutic compound. Yet another method of cell-specific delivery may utilize a receptor-specific antibody or an antibody fragment (Fab) that binds to a n isolated monocyte-macrophage cell surface apoB48R binding protein having the sequence SEQ ID No. 2, or a portion of the sequence, or comprising a related protein of the same gene family; and incorporating the antibody into liposomes.
- Yet another object of the present invention is to provide a method of inhibiting foam cell formation and increased monocyte adhesion to endothelial cells, comprising the step of treating a monocyte-macrophage with an agent which binds an isolated monocyte-macrophage cell surface apoB48 receptor protein having the sequence SEQ ID No.2, thereby blocking or inhibiting binding of apoB-containing lipoproteins to the receptor. Gene therapy such as adenoviral delivery of the receptor proteins of the present invention to LDL-receptor deficient subjects is also contemplated.
- Another object of the present invention is to provide delivery of the novel sequences disclosed herein, e.g., in an adenoviral vector, to the liver or elsewhere, for the purpose of correcting metabolic defects that cause abnormal accumulation of apoB-containing lipoproteins in the plasma.
- Yet another object of the present invention is to provide a method of evaluating an individual at risk for cardiovascular disease, comprising the steps of: (a) extracting a sample of monocytes-macrophages and triglyceride-rich lipoproteins from the plasma of the individual and from a control individual not considered at risk for cardiovascular disease; and (b) comparing the binding affinity (Kd) of the apoB receptor of the monocytes-macrophages for triglyceride-rich lipoproteins between the individual at risk and the control individual, whereby a difference in the binding affinity between the individual at risk and the control individual is indicative of an alteration in either or both the apoB cell-surface receptor protein and triglyceride-rich lipoproteins, and the alteration in the apoB cell-surface receptor protein or triglyceride-rich lipoproteins is indicative of dyslipidemias, abnormal postprandial triglyceride metabolism or Pattern B phenotype in the individual at risk. Alternatively, one may compare the rapid, receptor mediated monocyte-macrophage lipid accumulation induced by standardized tryp VLDL vs. normal TGRLP vs the patients TGRLP by quantifying lipid mass changes and by
Oil Red 0 staining. - This objective may also be accomplished by performing a Western blot analysis on proteins of the monocytes-macrophages using an antibody directed towards the protein of SEQ ID No. 2, or fragments thereof, or alternatively performing a Northern blot analysis on RNAs of the monocytes-macrophages using a DNA probe selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8 and SEQ ID No. 9, or fragments thereof, whereby a difference in the migration or mobility of the proteins and/or RNAs between the individual at risk and the control individual is indicative of an alteration in the apoB cell-surface receptor protein, and the alteration in the apoB cell-surface receptor protein is indicative of dyslipidemias, abnormal postprandial triglyceride metabolism or Pattern B phenotype in the individual at risk.
- As atherosclerotic plaques are enriched with ApoB48-receptor expressing cells, the instant invention may also be directed toward delivery of therapeutic agents to atherosclerotic plaques. These agents may include label to localize said plaques, inhibitors of apoB48 receptor to inhibit further development of the plaques, or agents designed to eliminate the plaques.
- Other and further aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention given for the purpose of disclosure.
- So that the matter in which the above-recited features, advantages and objects of the invention are attained and can be understood in detail, more particular descriptions of the invention may be had by reference to certain embodiments which are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, that the appended drawings illustrate preferred embodiments of the invention and therefore are not to be considered limiting in their scope.
- FIG. 1 shows a 2-dimensional SDS-PAGE of MBP200 and MBP235 before and after reduction. Detergent extracts of THP-1 monocytes were electrophoresed in the first dimension in a minigel without reduction. One cm strips containing the MBPs were removed and treated with buffer (panel A) or reductant, 2% 2-mercaptoethanol, (panel B), placed lengthwise on a second 5% slab minigel, electrophoresed and transferred to nitrocellulose for ligand binding analysis. Panel A illustrates that without reduction MBP200 and MBP235 maintain their distinct mobilities (seen on the diagonal), whereas after reduction (R) in the second dimension, both activities now have identical Rfs that are different from their original Rfs. The reduced form of both receptor proteins that retain ligand binding activity was called MBP200R. The single lane on the far left of each 2-D gel contains internal prestained markers, at approximately 200 kDa and 97 kDa.
- FIG. 2 shows (2A) ligand binding of MBPs by ligand blot analysis. Concentrations of the hypertriglyceridemic-very low density lipoproteins are given below each lane before (non-reduced) and after (reduced) treatment with 2-mercaptoethanol. Very low density lipoprotein binding was detected by apoB antibodies followed by IgG-specific enzyme-linked antibody and calorimetric substrate. Densitometry and quantification of the images utilized ImageQuant software. FIG. 2B shows the saturation binding of hypertriglyceridemic-very low density lipoprotein to MBP235, MBP200 and MBP200R. The amount of very low density lipoprotein bound to MBP200, MBP235 and MBP200R activities in FIG. 2A was determined by densitometry of each MBP region in the ligand blots using a calibration curve generated from known amounts of the same very low density lipoprotein applied to nitrocellulose and quantified with a purified anti-apoB antibody. The amount of ligand bound to each MBP region, expressed as ng very low density lipoprotein bound, was plotted as a function of the amount of very low density lipoprotein to which the nitrocellulose was exposed. The broken line represents the calculated sum of binding of the very low density lipoprotein to MBP200 and MBP235 at each level of very low density lipoprotein. FIG. 2C shows the data from FIG. 2B after transformation plotted by the method of Scatchard to determine the Kd for each of the MBPs, expressed as μg/ml.
- FIG. 3 shows a model of the relationship between MBP235 and MBP200 and how MBP200R is generated from MBP200 and MBP235 by treatment with reducing agents such as 2-mercaptoethanol.
- FIG. 4 shows that the ligand binding activity and antipeptide immunoreactivity are coincident before and after reduction of the MBPs, demonstrating that each MBP contains the 10-residue unique sequence obtained by microsequence data from peptides from purified MBP200R. C=preimmune sera at the appropriate concentration as control. Lanes 1-6 contain two levels of the THP-1 detergent extracts:
lanes lanes Lanes lane 9 is at 1:100 dilution of the antipeptide antibody. Ligand binding activity was visualized by incubation with hypertriglyceridemic-very low density lipoproteins for 2 hours at room temperature and detected with anti-apoB antibodies. Primary antibody binding was then detected with Anti-IgG alkaline phosphatase conjugated antibodies. - FIG. 5 shows that anti-apoB antibodies block binding of triglyceride-rich lipoproteins to MBP200 and MBP235. Biotinylated very low density lipoproteins were incubated for 0.5 hour with anti-apoB antibodies,
lane 2, or with preimmune serum,lane 1, prior to ligand blotting for 1.5 hours. Biotinylated very low density lipoprotein binding was detected with streptavidin-alkaline phosphatase. The blots were imaged, then quantitated with ImageQuant. The relative total binding to the MBPs with the specific apoB antisera and the preimmune sera are as indicated. The insert contains the imaged lanes from the ligand blot. - FIG. 6 shows the analysis of THP-1 monocytes by FACS. Antipeptide antibodies are shown to bind to the surface of THP-1 monocytes using two concentrations of the primary antibody. Goat(Fab′)2 rabbit anti-IgG (H+L)-FITC only (used as the negative control) and the alpha chain of the monocyte integrin VLA-4 was used as a known positive control.
- FIG. 7 shows the amino acid sequence derived from the 631 base pair PCR product. The carboxyterminal sequence (shaded) represents the peptide sequence used to produce the initial degenerate oligonucleotide primer and is from the same peptide used to develop the anti-peptide antibodies and used for surface labeling of the THP-1 monocytes. The underlined peptides represent sequences found by tryptic peptide mapping and microsequence analysis of MBP200R.
- FIG. 8 shows that THP-1 monocytes contain mRNA coding for MBP200R. RT-PCR using primer pairs from t h e PCR631/MBP200R sequence and mRNA from THP-1 monocytes produced a RT-PCR product of the correct size. The ethidium bromide stained gel (inverse image) of the RT-PCR products is shown. Lane 1: 572 bp product using primers 53-72, sense and 624-604, antisense; Lane 2: Glucose-6-phosphate dehydrogenase (GPDH) control product; Lane 3: MW ladder; Lane 4: second round product generated with internal second antisense primer, 490 bp.
- FIG. 9 shows the restriction mapping of the 572 bp RT-PCR product described in FIG. 8 (inverse image). Lane 1: 572 bp product; Lane 2: EcoRI control, no digestion; Lane 3: BamH1; Lane 4:
MW ladder 50 bp, 100, 200, 300, 400, 500, 700, 1000, 1500 and 2000 bp; Lane 5: PstI; Lane 6: HindIII; Lane 7: XbaI. - FIG. 10 shows that monospecific rabbit anti-human apoB IgGs specifically inhibit the binding of HTG-VLDL to the monocyte TGRLP receptor (MBP200 or MBP235). THP-1 monocyte aqueous phase extracts were electrophoresed and transferred to nitrocellulose (˜100 μg/lane). Biotinylated HTG-VLDL Sf100-400 (0.5 μg/ml) was preincubated with buffer (lane 1) or with 2 levels of anti-apoB (rabbit 1325) 40 μg/
mL lane 2; 400 μg/ml lane 3; or two levels of preimmune (rabbit 1325)IgG 90 μg/mL,lane lane 5. Lipoproteins and IgGs were preincubated for 30 minutes and then incubated with the nitrocellulose strips for 3 hours at 4° C. After extensive washing, bound lipoprotein was detected with streptavidin linked to alkaline phosphatase followed by colorimetric substrates (the digitized image is shown in (FIG. 10A) and quantified by scanning densitometry (FIG. 10B) using two-dimension area integration and illustrated as VLDL binding in densitometric units (pixels). - FIG. 11 shows that anti-apoB, but not anti-apoE, anti-apoCIII, or nonimmune IgG, inhibits the binding of HTG-VLDL Sf100-400 to MBP200 or MBP235. THP-1 monocyte aqueous phase extracts were electrophoresed and transferred to nitrocellulose, blocked, and incubated with biotinylated HTG-VLDL and the indicated antibodies at 4°
C. Lane 1, buffer;lane lane 3, 2.4 mg/ml nonimmune IgG;lane 4, 2.3 mg/ml anti-apoE;lane - FIG. 12 shows that anti-apoB IgG, but not nonimmune IgGs, inhibit the binding of125I-HTG-VLDL to THP-1 macrophages (top panel) but not to human fibroblasts with upregulated LDL receptors. (bottom panel) THP-1 monocyte-macrophages one day after adherence were grown as described. Duplicate dishes of cells and no cells for controls were incubated with 125I-HTG-VLDL Sf100-400, 5 μg/ml, alone (none) or in the presence of a 30-fold excess of unlabeled HTG-VLDL (self), in the presence of affinity-purified sheep anti-apoB IgG (anti-apoB), or the equivalent level of sheep nonimmune IgG (Non-1 mm) at 4° C. for 16 hours and then incubated with precooled, washed cells for 1.5 hours at 4° C. After extensive washing, the cells were dissolved in 0.1 NaOH for determination of bound 125I-HTG-VLDL as described. Values represent the average of duplicate dishes corrected for background by subtracting the averages of the no-cell controls and are expressed in terms of percent of control, that is percent of the uninhibited activity (100%). Specific binding activity for 1251-HTG-VLDL, 5 μg/ml was 24 ng/mg THP-1 cell protein which represented 100% uninhibited activity. (top panel) Human skin fibroblasts were grown to 75% confluency and preincubated with DME containing 5% lipoprotein-deficient serum for 36 h to induce the LDL receptor. The binding and competition protocols were identical to those for the THP-1 cells as described above. Specific binding activity for 125I-HTG-VLDL, 5 μg/ml was 237 ng/mg fibroblast cell protein which represented 100% uninhibited activity.
- FIG. 13 shows the effects of lactoferrin and heparin on binding of HTG-VLDL to MBP200 and MBP235 (these agents fail to inhibit or enhance binding). THP-1 monocyte aqueous phase extracts were electrophoresed and transferred to nitrocellulose. The nitrocellulose strips were incubated for 4 hours at 4° C. with 0.5 μg biotinylated HTG-VLDL/ml in the absence (lane 1) or in the presence of lactoferrin at 50 μg protein/ml (lane 2) or 500 μg protein/ml (lane 3); heparin at 10 U/ml (lane 4) and 100 U/ml (lane 5); or unlabeled HTG-VLDL at 25 μg/ml (lane 6) or 5 μg/ml (lane 7). Biotinylated HTG-VLDL binding was detected with streptavidin linked alkaline phosphatase (digitized image, (FIG. 13A) and quantified by densitometry (FIG. 13B).
- FIG. 14 shows that lipoprotein lipase inhibits the binding of HTG-VLDL to MBP200 and MBP235. THP-1 monocyte aqueous phase extracts were electrophoresed and transferred to nitrocellulose, blocked, and incubated at 4° C. with biotinylated HTG-VLDL Sf100-400 (3 μg of protein/ml) in the absence (lane 1) or in the presence of lipoprotein lipase (0.2 μg/ml,
lane 2; 2.0 μg/ml,lane 3; 20 μg/ml, lane 4) or in the presence of bovine serum albumin (0.2 μg/ml,lane 5; 2.0 μg/ml,lane 6; 20 μg/ml, lane 7). Binding was detected by incubation with streptavidin-alkaline phosphatase and the image digitized (FIG. 14A) and quantified (FIG. 14B) by densitometry. - FIG. 15 shows immunoblots that demonstrate that plasma chylomicrons of Sf>1100 contain apoB-48 but not apoB-100. Plasma was isolated from a hypertriglyceridemic subject 4 hours after a standardized test fat meal. Total chylomicrons Sf>400 were subfractionated through a salt gradient into 3 subclasses: Sf>3200 (CM I), Sf1100-3200 (CM II), Sf400-1100 (CM III). These were electrophoresed at two levels of each (1 and 2 μg total apoprotein/lane) on a 4-20% SDS-PAGE, transferred to nitrocellulose, and probed for apoB (above the line) and apoE (below the line). CM I,
lanes lanes lanes lane 7; lane M=prestained protein molecular weight markers. - FIG. 16 shows the binding of chylomicron subspecies to MBP200 and MBP235 (odd lanes) or to the partially purified LDL receptor (even lanes). THP-1 monocyte aqueous phase extracts and the partially purified bovine LDL receptor were electrophoresed in alternating lanes, transferred to nitrocellulose, blocked, and incubated with chylomicron subfractions (10 μg/ml). CM I (Sf>3200) were incubated with
lanes lanes lanes - FIG. 17 shows that anti-apoB antibodies specifically block the binding of chylomicrons Sf1100-3200 (CM II) that contain apoB-48 as the only apoB species to MBP200 and MBP235. Thus, this receptor is also referred to as the apoB48 receptor. THP-1 aqueous phase extracts were electrophoresed and transferred to nitrocellulose. Prior to incubation with the nitrocellulose strips for 3 hours at 4° C., biotinylated CM II were preincubated at 4° C. for 30 minutes with buffer (lane 1), with anti-apoB (rabbit 1325) (lane 2), or with an equivalent level of nonimmune IgG (lane 3). Chylomicron binding was visualized after incubation with streptavidin-linked alkaline phosphatase, digitized (FIG. 17A) and quantified (FIG. 17B) by scanning densitometry.
- FIG. 18 shows the expression of the 3.8 kb TGRLP/ApoB Receptor mRNA in human placenta and THP-1 monocytes-macrophages.
- FIG. 19 shows the expression of TGRLP/ApoB Receptor mRNA in human immune tissues, including spleen, lymph node, thymus, appendix, blood leukocytes and bone marrow.
- FIG. 20 shows the relative positions of the overlapping clones used to characterize the full-length human monocyte TGRLP/ApoB Receptor cDNA.
- FIG. 21 shows the nucleotide sequence and derived amino acid sequence of the THP-1 monocyte apoB48 receptor cDNA. Nucleotides are numbered at the right on top with every 10 bp indicated by a “V”. The amino acid residues are also numbered at the right with 20 residues per line. The ATG start site codon is preceded by 10 bp; a Kozak start sequence is at bp 5-14. The entire cDNA sequence is 3744 bp. The derived protein length is 1088 residues, with the TGA stop codon at bp 3275. The 10-residue unambiguous amino acid sequence (amino acids 910-919) determined from microsequence analysis of the tryptic hydrolysis of purified apoB48 receptor and used to design the degenerate oligonucleotide primers is indicated with a double underline, as are two other tryptic peptides likewise identified. The single underlined 23 amino acid segment (amino acids 751-773) is the putative transmembrane domain. Cysteine residues are bold and underlined (C); potential coiled-coil interactive domains are bold and italicized (amino acid 155-189; amino acid 473-486; and amino acid 520-533). There are two potential polyadenylation signals beginning at bp 3700 and bp 3708. Both strands of the cDNA were sequenced; additional sequencing runs were carried out in some cases in regions of high CG content.
- FIG. 22 shows the localization of the apoB48 receptor gene to chromosome 16p11 by fluorescence in situ hybridization (FISH). Human apoB48R cDNA (1-2614) was labeled with Cy3-dUTP by nick translation and hybridized to normal human metaphase and interphase nuclei from phytohaemagglutinin-stimulated blood lymphocytes. Chromosomes were counterstained with DAPI and the fluorescence images captured with digitized image microscopy. DAPI-stained chromosomes (blue) with Cy3-labeled hybridization signal (red) are paired with the black and white images of the DAPI-stained chromosomes pair for chromosome identification and for hybridization location.
- FIG. 23 shows PCR screening of a multiple human tissue cDNA panel. A multiple tissue cDNA panel (MTC™, Clontech) containing normalized, first strand cDNA from (in order from left to right) brain, heart, kidney, liver, lung, pancreas, placenta, skeletal muscle, positive control (for combined tissues), no DNA control, and GPDH control were PCR-amplified using apoB48 receptor sequence specific
primers overlapping introns 2 and 3 (Table 2) to ensure that only mRNA species are reflected. The expected 455 bp product was found in all but skeletal muscle. The level of apoB48R cDNA appeared greatest in lung and placenta (seen after 25 cycles) and lowest in brain and heart (seen only after 35 cycles). Control PCR analyses of the individual tissues for the GPDH cDNA verified normalization of tissues and reflect relative mRNA abundance in that tissue. - FIG. 24 shows western and ligand blotting activity detected in apoB48R transfected CHO-K1s. A ligand blot (Gianturco, S. H., et al., 1998) is shown on the left and western blot on the right of detergent extracts of, from outer to inner lanes, THP-1 monocytes as a positive control, CHO-K1's transfected with the empty pcDNA expression vector, and CHO-K1's transfected with the apoB48 receptor minigene that contains the first intron. Tryp-VLDL Sf 100-400 (Gianturco, S. H., et al., 1986) served as the ligand, detected with an anti-apoB antibody and alkaline phosphatase-linked IgG second antibody. The apoB48R protein was visualized using a polyclonal antibody prepared against an apoB48R-GST fusion protein containing amino acids 223 to 710. The THP-1 extracts illustrate the two reported forms of the receptor, the ˜200 kDa ligand binding species and a ˜235 kDa form that contains both the ligand binding ˜200 kD species and a noncovalently bound protein, possibly a chaperone (Ramprasad, M. P. et al., 1995). Neither ligand blotting activity nor receptor immunoreactivity is detected in the vector-transfected negative controls. In contrast, the apoB48R-transfected CHOs exhibit both ligand blotting activity and apoB48R immunoreactivity with identical electrophoretic mobilities. The apparent molecular weight of the transfected apoB48R is slightly less (190 kD) than that of the 200 kDa activity in THP-1s. This is likely due to processing differences in CHO cells versus human monocyte-macrophages. Of note, however, the apparent molecular weight of the apoB48R in the CHOs is approximately twice that predicted by the cDNA.
- FIGS. 25A and 25B show expression of the apoB48R: FIG. 25A shows TG accumulation in apoB48R-transfected CHO-K1 cells, but not in control cells, incubated with tryp-VLDL Sf 100-400. G418-selected, stable transfected CHOs were grown in 6 well tissue culture dishes. Both apoB48R-transfected and vector with inverted insert-transfected cells were incubated with tryp-VLDL Sf 100-400 (Gianturco, S. H., et al. 1986) at the concentrations indicated for 4 hrs at 37° C. and the cells processed to measure TG mass a s previously reported (Gianturco, S. H., et al., 1988). The upper curve (closed squares; apoB48R transfected) indicates a rapid, curvilinear accumulation of TG with increasing levels of tryp-VLDL Sf 100-400 reflective of the receptor-mediated uptake as seen in monocyte-macrophages (Gianturco, S.H., et al., 1994C), while the lower curve (open squares; pcDNA 3.1 vector plus inverted insert transfected) demonstrates a low affinity, linear accumulation, as seen in cells where no apoB48R activity is present, representing low affinity, nonspecific uptake. Values are averages from duplicate dishes that differ by <10%; This is one representative experiment of four experiments with the full length cDNA and four with the cDNA containing the first intron. FIG. 25B shows transfection of the apoB48R and its role in uptake of TGRLP and cellular TG accumulation. ApoB48R was transfected into CHO K1 cells and selected with G418 as described in FIG. 25A. The transfected cells were placed in 6-well plates and tested for their ability to accumulate TG when exposed to different TGRLP as a measure of lipoprotein-specific receptor function, as previously reported (Gianturco, S. H, et al., 1994c). After a 2 hour incubation at 37° C., the transfected cells were washed in cold PBS to remove excess TGRLP, the cellular lipid extracted with hexanes:isopropanol (3:2, v/v) and the TG level measured enzymatically. The bar graph indicates the amount of TG that accumulated per mg of cell protein relative to a buffer control (the buffer level was subtracted from the level for each indicated lipoprotein). This value was also corrected for nonspecific binding of TGRLP to the well by subtracting a no-cell control value at each level of TGRLP used. Like human THP-1 macrophages, the apoB48R-transfected cells accumulate TG when exposed to apoB48-only containing chylomicrons Sf 1100-3200 (CMII) and to the model ligand, tryp-VLDL Sf 100-400 (t-V1) but not to VLDL Sf 100-400 from a subject with normal plasma TG levels (N-V1). The experiment was repeated twice with identical results. Concurrent experiments with receptor-negative, vector-only transfected CHO-K1s detected no significant TG accumulation under the same experimental conditions (data not shown).
- FIGS. 26A and 26B show oil-red-O staining of neutral lipid, which was used to assess receptor activity in transfected cells. In FIG. 26A, ApoB48R-transfected CHO-KI cells show massive accumulation of lipid after a three hour incubation at 37° C. with chylomicrons Sf>400 at 100 μg TG/ml in RPMI medium with no other serum components, as demonstrated by the Oil Red O-positive cytoplasmic lipid droplets in the cells. These chylomicrons contain apoB48 as their only apoB species, consistent with the ligand specificity of this receptor. FIG. 26B demonstrates that vector only-transfected cells showed no appreciable Oil-red-O staining after incubation under identical conditions. Receptor- and vector-transfected cells treated with buffer also showed no lipid staining inclusions (not shown).
- FIGS. 27A, 27B,27C, and 27D show immunohistochemical demonstration of apoB48R in human carotid artery atherosclerotic lesions. Serial sections of carotid arteries obtained by endarterectomy were processed as described. Rabbit polyclonal antibodies produced against an apoB48R-domain specific (amino acid 223-710) GST-fusion protein were used to determine apB48R expression and location. All magnifications are 100×, except for FIG. 27C, which is 80×. FIG. 27A shows a hematoxylin-stained section of an advanced lesion with the lumen oriented toward the top and a lipid core surrounded by foam cells seen to the right and center. FIG. 27B shows staining with a macrophage-specific monoclonal antibody (HAM56), which identifies the macrophage-derived foam cells on the edge of the acellular lipid core. FIG. 27C is a negative control, which used preimmune IgG from the same rabbits used to generate the anti-apoB48R-specific antibodies. In FIG. 27D, anti-apoB48R antibodies indicate apoB48R-expression by lesion macrophages and foam cells.
- Two major triglyceride-rich lipoprotein membrane binding activities with apparent molecular weights of approximately 200 and approximately 235 kDa (MBP200 and MBP235) were identified by ligand blotting analysis in both normal human blood-borne monocyte-macrophages and the long term human THP-1 and U937 monocytes and macrophages. MBP200 and MBP235 are cell surface proteins that share a common backbone (MBP200) containing the ligand binding domain. MBP235 is comprised of MBP200 plus one (or more) small subunit(s) of ˜35 kDa apparent total mass (as determined by mobilities on SDS-PAGE) that associate(s) noncovalently with MBP200, does not inhibit triglyceride-rich lipoprotein binding, and is immunochemically distinct from the receptor-associated protein (RAP), a 39 kDa protein that modulates ligand binding to low density lipoprotein receptor-related protein and other low density lipoprotein receptor family members (Strickland, 1990).
- Amino acid sequence data obtained from tryptic peptides from purified MBP200R, the reduced ligand-binding subunit of the receptor, had no matches in gene and protein databases, indicating that MBP200 is a unique protein. The sequence data was used to produce antipeptide antibodies that were then found to bind solely to the MBP200, MBP235, and MBP200R receptors, thereby confirming that MBP200 is a unique protein. The receptor-specific antibodies also confirmed the structure, chemistry and relationships of MBPs obtained initially by biochemical and ligand blotting analyses.
- The specific, apoE-independent binding of plasma chylomicrons and other apoB-containing lipoproteins to this monocyte-macrophage receptor, coupled with in vivo studies, suggests a role of this pathway in the nutrition of circulating monocytes and accessible macrophages, such as in bone marrow in the postprandial state. Moreover, anti-apoB blocking studies indicate this previously-undiscovered human monocyte-macrophage receptor binds triglyceride-rich lipoproteins via apoB. In addition, apoB-48 appears to be sufficient, and neither apoB-100 nor apoE is necessary for binding. This also suggests a new role for apoB-48; i.e., targeting plasma chylomicrons and their remnants to accessible monocytes and macrophages for uptake while still triglyceride-rich, before reaching the triglyceride-depleted, cholesteryl ester- and apoE-enriched remnant that is targeted by apoE to the liver for uptake by hepatic receptors which bind lipoproteins via apoE. A defect in this monocyte-macrophage receptor or in its ligands could result in aberrant triglyceride-rich lipoprotein metabolism (rerouting of chylomicrons for lipolysis and eventual liver uptake) that would lead to delayed chylomicron clearance and abnormal persistence of chylomicron remnants and/or small, dense low density lipoprotein. This condition has been termed Pattern B phenotype.
- The Pattern B phenotype is expressed primarily in adults, is associated with increased risk of cardiovascular disease, and is inherited in an autosomal dominant or codominant manner with varying polygenic effects, including lipoprotein lipase deficiency, insulin resistance, apo CIII, and an as-yet, unidentified gene defect(s) (Krauss, 1994). Since candidate mechanisms for this phenotype include altered triglyceride-rich lipoprotein metabolism and clearance, the monocyte-macrophage receptor of the present invention is a candidate gene for one contributing cause of this pattern. The potential role of apo CIII in modulating the binding of triglyceride-rich lipoproteins to this receptor fits with the observation that CIII-enriched triglyceride-rich lipoproteins are found in Pattern B and that transgenic mice that overexpress CIII or CII are hypertriglyceridemic. The apoCs (especially CIII) could interfere with apoE-mediated uptake mechanisms and also mask the apoB domain(s) that bind to MBP200. Identification of genes related to this phenotype allows identification of subjects before the phenotype is expressed. As subjects with this phenotype are extremely responsive to changes in dietary fat (Krauss, 1994), early identification permits dietary intervention so as to delay atherogenic changes.
- The experiments leading to the present invention addressed several interactions of triglyceride-rich lipoproteins with monocytes and macrophages and their relation to lipoprotein metabolism and foam cell formation. Such interactions include a) whether MBP200 and MBP235 are chylomicron/apoB-48 receptors; b) the molecular structure and function of MBP200; c) the structure and function of the small subunit(s) in MBP235 (such as chaperone(s)); d) whether MBP200 and MBP235 are restricted to monocytes, macrophages and endothelial cells; e) the receptor binding domains in apoB; and f) whether apoCIII and apoE modulate receptor binding.
- The present invention provides a composition of matter comprising isolated DNA molecules encoding overlapping domains of the monocyte-macrophage and placental cell-surface binding protein and the full-length cDNA construct selected from the group consisting of: (a) a DNA molecule comprising a sequence SEQ ID No. 1 and which encodes the full-length cDNA of said monocyte-macrophage cell surface apoB48R binding protein (SEQ ID No. 2) or a portion of said monocyte-macrophage cell surface apoB48R binding protein domain of the sequence of the monocyte macrophage binding protein; and (b) a DNA molecule differing from the DNA molecule of (a) in codon sequence due to the degeneracy of the genetic code, and which encodes said monocyte-macrophage cell surface apoB48R binding protein (SEQ ID No. 2) or a portion of said monocyte-macrophage cell surface apoB48R binding protein; an isolated monocyte-macrophage cell surface apoB48R binding protein having the sequence SEQ ID No. 2; a method of cell-specific delivery of therapeutic compounds to human monocytes or macrophages, comprising the steps of: providing a peptide or antibody having the ability to bind to an isolated monocyte-macrophage cell surface apoB48R binding protein having the sequence SEQ ID No.2, or a portion of said sequence; and incorporating said peptide or antibody into liposomes containing said therapeutic compound or directly linking said peptide or antibody to therapeutic compound; and a method of inhibiting foam cell formation and increased monocyte adhesion to endothelial cells, comprising the step of treating a monocyte-macrophage with an agent which binds an isolated monocyte-macrophage cell surface apoB48R binding protein having the sequence SEQ ID No.2.
- Further provided are methods of evaluating an individual at risk for cardiovascular disease using the compositions of matter provided herein for examining either the apoB receptor-ligand interaction, or the RNA and/or protein corresponding to apoB in an individual at risk as compared to a control individual, to determine the presence of any abnormalities in the apoB receptor of the individual at risk.
- In accordance with the present invention, there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, “Molecular Cloning: A Laboratory Manual (1982); “DNA Cloning: A Practical Approach,” Volumes I and II (D.N. Glover ed. 1985); “Oligonucleotide Synthesis” (M. J. Gait ed. 1984); “Nucleic Acid Hybridization” [B. D. Hames & S. J. Higgins eds. (1985)]; “Transcription and Translation” [B. D. Hames & S. J. Higgins eds. (1984)]; “Animal Cell Culture” [R. I. Freshney, ed. (1986)]; “Immobilized Cells And Enzymes” [IRL Press, (1986)]; B. Perbal, “A Practical Guide To Molecular Cloning” (1984). Therefore, if appearing herein, the following terms shall have the definitions set out below.
- A “DNA molecule” refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or a double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
- A “vector” is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment. A “replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control. An “origin of replication” refers to those DNA sequences that participate in DNA synthesis. An “expression control sequence” is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. A coding sequence is “operably linked” and “under the control” of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
- In general, expression vectors containing promoter sequences which facilitate the efficient transcription and translation of the inserted DNA fragment are used in connection with the host. The expression vector typically contains an origin of replication, promoter(s), terminator(s), as well as specific genes which are capable of providing phenotypic selection in transformed cells. The transformed hosts can be fermented and cultured according to means known in the art to achieve optimal cell growth.
- A DNA “coding sequence” is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3′ to the coding sequence. A “cDNA” is defined as copy-DNA or complementary-DNA, and is a product of a reverse transcription reaction from an mRNA transcript. An “exon” is an expressed sequence transcribed from the gene locus, whereas an “intron” is a non-expressed sequence that is from the gene locus.
- Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell. A “cis-element” is a nucleotide sequence, also termed a “consensus sequence” or “motif”, that interacts with other proteins which can upregulate or downregulate expression of a specific gene locus. A “signal sequence” can also be included with the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell and directs the polypeptide to the appropriate cellular location. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.
- A “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3′ direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3′ terminus by the transcription initiation site and extends upstream (5′ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters often, but not always (especially in monocyte-macrophage specific promoters), contain “TATA” boxes and “CAT” boxes. Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the −10 and -35 consensus sequences.
- The term “oligonucleotide” is defined as a molecule comprised of two or more deoxyribonucleotides, preferably more than three. Its exact size will depend upon many factors which in turn, depend upon the ultimate function and use of the oligonucleotide. The term “primer” as used herein refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon many factors, including temperature, source of primer and use the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides. The oligonucleotides herein are selected to b e “substantially” complementary to a particular target DNA or RNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands. Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5′ end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence or hybridize therewith and thereby form the template for the synthesis of the extension product.
- As used herein, the terms “restriction endonucleases” and “restriction enzymes” refer to enzymes which cut double-stranded DNA at or near a specific nucleotide sequence.
- A cell has been “transformed” or “transfected” with exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a vector or plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A “clone” is a population of cells derived from a single cell or ancestor by mitosis. A “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations. An organism, such as a plant or animal, that has been transformed with exogenous DNA is termed “transgenic”.
- As used herein, the term “host” is meant to include not only prokaryotes but also eukaryotes such as yeast, plant and animal cells. A recombinant DNA molecule or gene can be used to transform a host using any of the techniques commonly known to those of ordinary skill in the art. One preferred embodiment is the use of vectors containing coding sequences for purposes of prokaryotic transformation. Prokaryotic hosts may includeE. coli, S. tymphimurium, Serratia marcescens and Bacillus subtilis. Eukaryotic hosts include yeasts such as Pichia pastoris, mammalian cells, insect cells and plant cells, such as Arabidopsis thaliana and Tobaccum nicotiana.
- Two DNA sequences are “substantially homologous” when at least about 75% (preferably at least about 80%, and most preferably at least about 90% or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.
- A “heterologous’ region of the DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. In another example, the coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.
- In addition, the invention also includes fragments (e.g., antigenic fragments or enzymatically or ligand binding functional fragments) of the apoB cell-surface receptor protein. As used herein, “fragment,” as applied to a polypeptide, will ordinarily be at least 10 residues, more typically at least 20 residues, and preferably at least 30 (e.g., 50) residues in length, but less than the entire, intact sequence. Fragments of the apoB cell-surface receptor protein can be generated by methods known to those skilled in the art, e.g., by enzymatic digestion of naturally occurring or recombinant apoB cell-surface receptor protein, by recombinant DNA techniques using an expression vector that encodes a defined fragment of apoB cell-surface receptor protein, or by chemical synthesis. The ability of a candidate fragment to exhibit a characteristic of apoB cell-surface receptor protein (e.g., binding to an antibody specific for apoB cell-surface receptor protein, or binding to a ligand of the receptor or exhibiting partial enzymatic or catalytic activity) can be assessed by methods described herein. Purified fragments of apoB cell-surface receptor protein or antigenic fragments of apoB cell-surface receptor protein can be used to generate antibodies by employing standard protocols known to those skilled in the art.
- As atherosclerotic plaques are enriched with ApoB48 expressing cells, the instant invention may also be directed toward delivery of therapeutic agents to atherosclerotic plaques. These agents may include label to localize said plaques, inhibitors of apoB48R to inhibit further development of the plaques, or agents designed to eliminate the plaques.
- A standard Northern blot assay can be used to ascertain the relative amounts of apoB cell-surface receptor protein mRNA in a cell or tissue in accordance with conventional Northern hybridization techniques known to those persons of ordinary skill in the art. Alternatively, a standard Southern blot assay may be used to confirm the presence and the copy number of the gene encoding the apoB cell-surface receptor in transgenic systems, in accordance with conventional Southern hybridization techniques known to those of ordinary skill in the art. Both the Northern blot and Southern blot use a hybridization probe, e.g. radiolabeled apoB cell-surface receptor cDNA, either containing the full-length, single stranded DNA having a sequence complementary to SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9 or a fragment of those DNA sequences at least 20 (preferably at least 30, more preferably at least 50, and most preferably at least 100 consecutive nucleotides in length). The DNA hybridization probe can be labeled by any of the many different methods known to those skilled in this art.
- The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to specific wavelengths of light, and others. A number of fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow and green fluorescent protein (GFP). The present invention also provides GFP-apoB48R fusion constructs that, e.g., transfect CHO cells and confer receptor activity. A particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate. Proteins can also be labeled with a radioactive element or with an enzyme. The radioactive label can be detected by any of the currently available counting procedures. The preferred isotope may be selected from3H, 14C, 32P, 35S, 36Cl, 51Cr, 57Co, 58Co, 59Fe, 90Y, 125I, 131I, and 186Re.
- Enzyme labels are likewise useful, and can be detected by any of the presently utilized calorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques. The enzyme is conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Many enzymes which can be used in these procedures are known and can be utilized. The preferred are peroxidase, β-glucuronidase, β-D-glucosidase, β-D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. U.S. Pat. Nos. 3,654,090, 3,850,752, and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods.
- The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion.
- Cells and Cell Extracts
- Human monocytes are isolated by adhesion to plastic from peripheral mononuclear cells isolated on a Ficoll-Paque gradient (Boyum, 1968). The adherent cells (90-95% monocytes) are used after isolation or after 1-7 days culture in RPM1-1640 containing 20% autologous serum (Gianturco, 1994).
- THP-1 monocyte-macrophages (ATCC) are grown in suspension in RPMI 1640 with 10% fetal bovine serum, 2 mM glutamine, 100 μg streptomycin and 100 units of penicillin/ml and 5×10−5 M 2-mercaptoethanol. Cells were maintained in tissue culture flasks at 37° C. in a humidified atmosphere of 5% CO2 and 95% air at ≦1×106 cells/ml. THP-1 monocytes differentiate into adherent macrophages when treated with 10−7 M phorbol 12-myristate, 13-acetate (PMA) (Hara, 1987; Gianturco, 1988). For differentiation, cells were seeded (1.5×106 cells/35 mm3 dish) in complete media; PMA was then added. Adherent cells were used for experiments between 1 and 7 days. Cellular triglycerides, cholesterol, and cholesteryl ester masses (Gianturco, 1986a) were determined as described. Human skin fibroblasts were early passage cells from newborn foreskin and maintained as described (Gianturco et al., 1978, 1980).
- 1.5×108 THP-1 monocytes were harvested and washed twice with 50 ml of buffer A (0.15 M NaCl containing 50 U aprotinin/ml, 5 mM benzamidine, and 0.1 mM PMSF) a n d resuspended in 2 ml of 20 mM Tris, pH 8.0, 50 mM NaCl, 0.1 mM EDTA, containing the protease inhibitor mix of buffer A plus leupeptin and PPACK and solubilized with 1% Triton X-114 for 15 minutes on ice. Aqueous phase extracts were prepared as described (Gianturco e t al., 1988, 1994; Ramprasad et al., 1995) by the method of Bordier (1985) and immediately frozen in liquid nitrogen after the addition of glycerol to a final concentration of 10% (v/v). Protein content was estimated by the Bradford method using the Bio-Rad Protein Assay reagent (Bradford, 1976).
- Purification and Microsequencing of the MBP Protein
- MBP200R was purified from 75 liters of THP-1 monocytes (75×109 cells) by a four-step procedure, capitalizing on the unique properties discovered during other purification attempts, such as the relative resistance of MBP200 activity to heat and to reduction. Briefly, the purification scheme used to isolate the protein for microsequencing was: Triton X-114 aqueous-phase extracts were reduced with 2-mercaptoethanol to convert MBP200 and MBP235 to MBP200R and then heated (90-100° C.) for up to 10 minutes and centrifuged, which selectively eliminates ˜90% of the contaminating proteins without significant loss of MBP200R ligand binding activity. The supernatant containing MBP200R activity was fractionated on DEAE and then hydroxyapatite, and finally resolved by preparative SDS-PAGE. The electroeluted MBP200R band appeared homogeneous by two-dimensional electrophoresis and silver staining. Starting at the extraction step, this represented approximately a 1200-fold purification, which reflects the difference between purification from pure cells and tissues. If one can obtain sufficient cells and stabilize the desired product, cultured cells are significantly enriched over a tissue source since there is no extracellular material. After transfer to Immobilon, strips containing MBP200R were processed for gas-phase microsequence analysis [City of Hope Microsequencing and Mass Spectrometry Core Facility]. Two independent attempts indicated that the N-terminus was blocked. Therefore, the protein was trypsinized on the membrane (0.1 M ammonium bicarbonate pH 8.0 and 10 pmole trypsin at 37° C. for 24 hours), the peptides eluted and separated by micro-LC-chromatography on a Vydac C18 column (530 μm ID) with a TFA/acetonitrile gradient; peaks were detected by UV monitoring and analyzed by mass spectrometry and microsequencing techniques.
- Seven peptides contained sufficient mass and were sequenced; the most useful data were from peptide 29, a thirteen residue fragment in which 10 contiguous residues were unambiguously identified: E/L/A,A/L,Q/V/E,A,E,G,L,M,V,T,G,G,R (MH+=1333) (SEQ ID No. 5). Searches of peptide and nucleotide sequence databases revealed this was a unique sequence, as was peptide 18 (V/E,A/L,V,M,G,Q,M (SEQ ID No. 6)), useful for making oligonucleotides because of its 2 methionines. A peptide corresponding to the unambiguous portion of peptide 29 ((C)AEGLMVTGGR; (SEQ ID No. 10)) was synthesized in the peptide core at University of Alabama-Birmingham; the C-terminal arginine was amidated and the cysteine was added for coupling to keyhole limpet hemocyanin (KLH) and used for antibody production in rabbits. The first immunoblots of the first bleed were positive for all three active forms of the receptor (FIG. 4). Immunoreactivity perfectly coincided with ligand blotting activity in the native (MBP200 and MBP235), and upon reduction, tracked the electrophoretic mobility shift along with ligand blotting activity into the reduced form, MBP200R; preimmune antisera did not bind to these proteins, showing the antipeptide antibodies are specific for the MBPs. These data also confirm immunochemically the ligand blot data that showed that MBP235 contains MBP200 and that both are converted into MBP200R upon reduction. Antibodies generated against GST-fusion proteins representing various domains of MBP200R verified these results.
- The immunoblotting/ligand blotting experiments were repeated with numerous THP-1 extracts and three different antipeptide antisera and affinity-purified anti-peptide antibodies and compared to extracts of other receptor positive and receptor-negative cells. Consistent with cell binding and ligand blotting studies, extracts of human U937 monocytes, but not human skin fibroblasts or CHO extracts, showed specific antipeptide immunoreactivity that coincided with ligand blotting activity. The antipeptide antibodies show that this unique sequence, AEGLMVTGGR (SEQ ID No. 5), unmatched in GenBank, is indeed from the major ligand binding subunit, MBP200. Thus, a unique protein that has all of the biochemical characteristics necessary for a monocyte and macrophage-specific triglyceride-rich lipoprotein receptor was purified.
- cDNA Cloning and Characterization of MBP200 and MBP235
- The protein/peptide microsequence data yielded two useful peptides from which oligonucleotides were generated. Since using highly degenerate oligos for screening cDNA libraries is not a simple task, an alternative PCR approach was sought to produce suitable probes for use in screening (Yokayama, 1993). The contiguous decapeptide sequence (obtained from a tryptic thirteen-residue fragment) was used to design nested, degenerate 17-mer oligonucleotide probes from the carboxyl-terminal end of the peptide and from the overlapping amino-terminal end. Using a THP-1 monocyte λgt10 cDNA library (Clontech) as template DNA, the carboxy-terminal primers were used in the first round of PCR with λ forward and reverse primers; the PCR products were fractionated over Qiagen columns to remove primers and subjected to a second round of PCR with the more amino-terminal degenerate primers and the λ forward and reverse primers. The second round yielded ethidium-bromide stainable products of about 150 base pairs in size. The products were subcloned into a pCRII vector using a TA cloning kit (Invitrogen) and into a pBluescript II vector. Sequencing by the dideoxy chain termination method indicated a clone with a 139 base pair open reading frame containing the decapeptide sequence.
- Importantly, the DNA sequencing identified the first three residues of the peptide sequence unambiguously as Leu, Leu, Asp (Leucines were possible choices in the peptide microsequence analysis). This sequence, LLDAEGLMVTGGR (SEQ ID No. 5), correctly fits the mass spectral parent ion, MH+=1333, of the LC-isolated tryptic peptides). Importantly, the DNA sequence placed an Arg immediately before the Leu N-terminal residue of the sequenced peptide, which correctly predicts the trypsin cleavage site used to produce the peptide. Furthermore, that the same peptide sequence was used to produce an antipeptide antibody that correctly and specifically identified the intact MBPs was strongly supportive of the initial PCR results.
- Based upon the PCR results, nondegenerate PCR primers were synthesized from the original nested primers and used with the λ primers in a new PCRprotocol. PCRproducts of ˜1 kb in size were produced and subcloned into the pCRII vector. pcr631 (SEQ ID No. 3) codes for three of the peptides obtained by microsequence analysis of tryptic peptide from MBP200R and correctly predicts Arg before each. FIG. 7 shows the predicted amino acid sequence derived from the 631 base pair PCR product (SEQ ID No. 4) and the 3 tryptic peptides are underlined.
- Standard molecular biology approaches were used to clone and sequence the cDNA of MBP200 (Sambrook, 1989; Ausubel, 1987). Since MBP200 was isolated from THP-1 monocytes, a commercial λgt10 poly dT primed cDNA library from human THP-1 monocyte/macrophages (Clontech; Palo Alto, Calif.) was screened. The cDNA inserts range in size from 0.5-4 kb, with the average size around 1 kb. The amplified libraries contain approximately 1.4×106 independent clones, sufficient to include low abundance mRNAs. The expression libraries were screened by in situ plaque hybridization. The phage were plated on agarose-topped agar plates, and the plaques adsorbed onto duplicate nitrocellulose filters, denatured and probed with labeled oligonucleotides or partial cDNAs.
- Expression of Unique MBPs in THP-1 Cells
- Thus, the present studies demonstrate, as shown in FIG. 6, that THP-1 monocytes were surface-labeled with the affinity-purified anti-receptor antibody generated against a 10-residue synthetic peptide based on an unambiguous sequence of a tryptic peptide from purified MBP200R. Cell-surface location of this receptor epitope confirms that MBP200 and MBP235 are located on the cell surface, a criterion for a receptor of extracellular ligands. A unique 631 base pair PCR product (pcr631) (SEQ ID No. 3) was generated, cloned, and sequenced from a λgt10 THP-1 monocyte library using oligonucleotide primers based on the same unambiguous tryptic peptide from MBP200R that was used to generate receptor-specific, anti-peptide antibodies. The PCR631 product (SEQ ID No.3) contained an open reading frame (bp3-630) which predicts a unique 209-residue protein sequence (SEQ ID No. 4) that contains three of the tryptic peptides determined by microsequence analysis of purified MBP200R, and contains arginine residues before each of these three peptides, correctly predicting the trypsin cleavage sites in MBP200 needed to generate the microsequenced peptides (see FIG. 7). This is direct evidence that the THP-1 λgt10 library contains MBP200-specific cDNAs. Neither the 209-residue predicted protein sequence nor the determined 631 nucleotide sequence has any identities or close matches in the NCBI nonredundant peptide and nucleotide databases (PDB+Swiss Prot+PIR+SPUpdate+GPUpdate+GenBank+EmblUpdate+EMBL), confirming its uniqueness. PCR631 labeled with digoxigenin was used to identify receptor-specific clones from the THP-1 library for sequencing.
- Reverse transcriptase (RT)-PCR demonstrates that THP-1 monocytes contain mRNA coding for MBP200R. RT-PCR using primer pairs derived from the PCR631/MBP200R sequence and mRNA isolated from THP-1 monocytes produced an RT-PCR product of the correct size (FIG. 8, lane 1). Notably, a second round of PCR using an internal antisense primer produced a single, predicted 490 bp product (FIG. 8, lane 4), indicating the THP-1 cells from which MBP200R was purified do indeed express MBP200 mRNA (FIG. 8, digitized negative image of gel photo). Restriction-site mapping verified the sequence of the RT-PCR product, correctly producing the predicted-size fragments for BamHI, HindIII, PstI, and XbaI (FIG. 9, digitized negative scan of gel photo). This further confirms that the sequence of PCR631 (SEQ ID No. 3), which contains coding sequences for three tryptic peptides derived from MBP200R, and RT-PCR product sequences are correct.
- The dig-labeled PCR631 probe was used to screen a THP-1 λgt10 library and eight receptor clones were identified (partials, ranging from ˜1 to ˜3 kb in length) from ˜600,000 screened. A 3 kb clone was sequenced (λ73-3). The nucleotide sequence is unique. More 5′ probes from this sequence were used to screen a human placenta λgt10 random primed library to obtain the complete cDNA. The sequence was confirmed by sequencing multiple clones.
- Reverse transcriptase experiments with PCR631-specific primers and murine P388D1 macrophages, human blood monocytes, human umbilical vein endothelial cells, and U937 monocytes, but not human skin fibroblasts or CHO cells, produced RT-PCR products of the correct size and with the same restriction sites, indicating that monocytic and endothelial cells, but not fibroblasts or CHO cells, contain mRNA for this receptor protein. These primers also produced a PCR product of the same size and with the same restriction enzyme sites from placental polyA mRNA and a λgt10 human placenta library, indicating this receptor mRNA is expressed in human placenta. Northern analysis revealed an mRNA of approximately 3,800 bases in RNA of human THP-1, placenta (FIG. 18), peripheral blood leukocytes, bone marrow, lymph nodes, tonsils, spleen, thymus and appendix (FIG. 19). This is in close agreement with the approximately 3,744 bases of the full-length cDNA construct.
- Characterization and Location of the Gene Encoding MBP200 (apoB48R)
- The isolation, characterization and chromosomal location of the MBP200 gene were determined in the following manner. Initially, the number of MBP200 genes in the human genome was determined. For this, human genomic DNA is digested with various restriction enzymes and probed by Southern blot analyses using various portions of the MBP200 cDNA. From the number of positive hybridizing bands for each digest, one can determine whether there is a single MBP200 gene, or if MBP200 belongs to a multigene family. The chromosomal location of MBP200 is probed by in situ hybridization of metaphase chromosomes. The latter analysis provides information on copy number if different members of the gene family are located on different chromosomes.
- A human genomic library is screened by in situ plaque hybridization. Probes from both the 5′ and 3′ ends of the cDNA are used to ensure the isolation of overlapping genomic clones. Positive clones are isolated, and overlapping clones aligned by restriction endonuclease mapping and Southern blot hybridization. Selected regions of the gene encoding specific cDNA sequences are identified by blot hybridization, subcloned in a plasmid vector, and sequenced to identify individual genes.
- Organization of exons and introns in the gene is determined by PCR amplification of human genomic DNA with a series of gene-specific primers, followed by cloning of the PCR products into TA vectors and sequence analysis of the inserts. Comparison of the gene sequence with that of the cDNA would directly establish the intron-exon structure of the gene. There are three introns within the coding sequence. The characterization of the gene from murine genomic libraries provides the basis for analysis of MBP200 function in transgenic and knockout mice. In addition, if MBP200 is a candidate gene for subclass Pattern B phenotype or other dyslipidemias or immune system pathologies, then the isolated MBP200 gene would be highly useful in obtaining probes for more refined linkage analysis as well as identifying putative mutations in the human genome. The gene is located on chromosome 16p11, as determined by FISH.
- Small, dense low density lipoprotein (subclass Pattern B) is an independent, genetically determined coronary atherosclerosis disease risk factor (Krauss, 1994). Although the mechanism leading to the subclass Pattern B phenotype is unknown, one potential scenario may involve reduced clearance of chylomicrons by accessible macrophages by this receptor and the conversion of abnormally high levels of chylomicrons into remnants in plasma. The latter would be cleared by hepatocytes which would then down regulate hepatic LDL receptor and exacerbate the delayed remnant removal. The increased total hepatic uptake of chylomicrons remnants would increase the synthesis of apo-B containing particles, and, combined with the down regulation of low density lipoprotein receptor, could, in the presence of slightly elevated triglyceride-rich lipoproteins and cholesterol ester transfer proteins (CETPs), result in the conversion of normal low density lipoproteins to small, dense low density lipoproteins, resulting in the Pattern B phenotype. Since as much as 30% of chylomicrons may be taken up by bone marrow macrophages, alterations in MBP200 and triglyceride-rich lipoprotein uptake by macrophages may be involved directly in the generation of the subclass Pattern B phenotype. Thus, the MBP200 (or the associated 35 kD peptide) may be candidate gene(s) for this phenotype.
- Lipoprotein Purification
- Since the receptor-binding domains appear to be in apoB-48, postprandial triglyceride-rich lipoproteins of differing flotation classes were used to identify the domain and effects of particle size on expression. Lipoprotein isolation was as detailed (Gianturco, 1986b) from fresh plasma containing antioxidants and protease inhibitors. Very low density lipoprotein1 (Sf100-400), very low density lipoprotein2 (Sf60-100), and very low density lipoprotein3 (Sf20-60) were isolated from very low density lipoprotein (d<1.006) by cumulative flotation and sterilized as described (Lindgren, 1972; Gianturco, 1986b). Chylomicrons and remnants of Sf>400 triglyceride-rich lipoproteins were subfractionated into Sf>3200, Sf1,100-3,200, and Sf400-1100 by cumulative flotation through a discontinuous NaCl gradient (Lindgren, 1972).
- To isolate chylomicrons and remnants enriched in apoB-48, normal and hypertriglyceridemic volunteers, after a 12 hour overnight fast, eat within 10 minutes a meal of scrambled eggs, bread, cheese and a milkshake containing 60,000 U of aqueous vitamin A/m2 body surface (Weintraub, 1987). The meal contains 50 g of fat/m2 body surface, and 65% of calories as fat, 20% as carbohydrate, and 15% as protein, with 600 mg cholesterol/11,000 calories and a P/S ratio of 0.3. This meal was (1) well tolerated by all subjects, (2) caused a reproducible postprandial response, (3) gave equivalent gastric emptying rates in normal subjects and in patients, and (4) the vitamin A dose was shown to be well within the capacity of the intestine to absorb it (Weintraub, 1987). Subjects who previously volunteered in an ongoing study using this meal were asked to repeat the fat load and blood was isolated at peak lipemia (as determined previously) to obtain postprandial triglyceride-rich lipoproteins for the isolation of apoB-48-containing particles.
- Plasma chylomicron remnant fractions of Sf>3200 and Sf1100-3200 contained apoB-48 as the only apoB species (FIG. 15) and bound to the MBPs with high affinity (FIG. 16). This binding was inhibited by anti-apoB antibodies (FIG. 17), showing that apoB-48 is sufficient to mediate binding to the MBPs and apoB-100 is not necessary. Postprandial triglyceride-rich lipoproteins of different Sf are separated into apoB-48 enriched particles by immunoaffinity chromatography using a monoclonal antibody that binds apoB-100 but not apoB-48 (JI-H) (Havel, 1992) and can be used directly. ApoB-100 particles bind and can then be eluted (Havel, 1992). The purified apoB-100-only (isolated both fasting and postprandially) and apoB-48-enriched subspecies are used in cell binding and ligand blotting studies to show that particles containing apoB-48 primarily, as well as only apoB-100, bind to the receptor. At peak lipemia, there were at least 3 mg protein of triglyceride-rich lipoprotein subfractions/dl in four subjects with normal fasting triglyceride levels. Immunochemical blots demonstrated that apoB-48 comprised 30-50% of the total apoB at peak lipemia. The apoB-48 particles were present in all subclasses, even at 8 hrs postprandially (even in the Sf20-60 fraction). There were ≧6 times more of each subclass in hypertriglyceridemic subjects than in normal subjects. So there are at least 900 fig of each apoB-48 triglyceride-rich lipoprotein subclass from normal subjects from 100 ml of plasma at peak lipemia. Anti-CIII immunoaffinity columns using polyclonal antibodies provided subfractions depleted (unbound fraction) versus enriched (bound) in Apo CIII.
- Protein concentrations of the lipoproteins were obtained by a modified Lowry procedure with 0.1% SDS (Lowry et al., 1951; Helenius et al., 1971). Trypsinized-VLDL, reisolated and devoid of immunochemically detectable apoE, was prepared as described (Gianturco et al., 1983, 1986; Bradley et al., 1984). Functional loss of apoE was demonstrated by lack of binding of tryp-VLDL to partially purified bovine LDL receptors on ligand blots (Gianturco et al., 1983, 1988, 1994; Bradley et al, 1984; Gianturco and Bradley, 1986). Although tryp-VLDL is devoid of immunochemically detectable apoE and apoCIII, it retains essentially all immunochemically detectable apoB in fragments of 100 kDa and less as determined by SDS-PAGE (size) and RIA or by SDS-PAGE and quantitative dot blot analysis of parent VLDL and tryp-VLDL (Ramprasad et al., 1995).
- Lipoprotein Modifications, Production of Model Very Low Density Lipoproteins and Lipoprotein Binding Assays
- Proteolytic degradations were as described. Chemical modifications such as acetylation, reductive methylation, maleylation, and succinylation of lysines, cyclohexandione modification of arginine and its reversal were done (Means, 1971; Basu, 1977). Modification of lysine ε-NH2 by acetylation or by reductive methylation had no effect on binding to MBP200 or MBP235, but these procedures blocked binding to the LDL receptor and enhanced binding to the scavenger (acetyl LDL) receptor.
- ApoB, apoE and apoCs were quantified by SDS-PAGE densitometric methods and for integrity by Western blotting (Gianturco, 1983). Cholesterol, cholesteryl esters, triglycerides, and phospholipids were quantified enzymatically (Boehringer Mannheim kits). Total phosphorus was determined as described (Bartlett, 1959).
- Intralipids are subfractionated by cumulative flotation to remove PL-rich (smaller) particles with 2.5% glycerol included to stabilize the large particles (Bradley, 1986). Defined lipids are used to make more physiological very low density lipoprotein models with triglycerides, cholesteryl esters, cholesterol, and specific phospholipids (Miller and Small, 1983). The triglyceride-rich particles are incubated with desired apoproteins/synthetic fragments at room temperature for 2 hours and reisolated by cumulative flotation. Defined model very low density lipoproteins are constructed with and without desired apoproteins, synthetic peptides, and fragments. Native and specific protease-generated apoB fragments are solubilized in 1% octylglucoside to prepare model very low density lipoprotein by the dialysis method, as done successfully with low density lipoprotein-size lipid emulsions and apoB (Ginsburg, 1984). Model studies pinpoint protein components involved in receptor binding and were used to show that apoE is sufficient and apoB is not necessary for binding of large triglyceride-rich lipoproteins to the low density lipoprotein receptor (Bradley, 1986a).
- Lipoproteins were iodinated as reported (Bilheimer, 1972; Gianturco, 1986b) and samples were filtered immediately before use. Specific activities ranged from 100-200 cpm/ng protein. Less than 10% of the label was extracted into organic solvent. Lipoprotein binding studies were carried out essentially as described by Goldstein and Brown (1974). THP-1 monocytes were seeded in 6-well tissue culture plates (1.5×106 cells/well) and phorbol ester (10−7 M) was added to induce adherence (Gianturco et al., 1994; Ramprasad et al., 1995). As controls, cultured human skin fibroblasts were subcultured and grown to ˜75% confluency (3-4 d after subculture at a 1:4 split ratio) in complete medium [Dulbecco's modified Eagles (DME) containing 10% NuSerum, 2 mM glutamine, 100 μg streptomycin/ml and 100 U penicillin/ml], washed with sterile saline, and preincubated in DME containing 5% LPDS for 36 h to induce the LDL receptor (Gianturco et al., 1982). Cells were then preincubated for 30 min at 4° C. to cool the cells. Cells were then incubated with RPMI-1640 (THP-1 cells) or DME (fibroblasts) containing 10 mM HEPES (pH 7.4), 2 mg BSA/ml, and indicated amounts of 125I HTG-VLDL or 125I-tryp-VLDL alone and in the presence of 200 μg/ml unlabeled VLDL or other potential competitors for 1.5 hours at 4° C. prior to extensive washing with cold buffered saline containing 2 mg BSA/ml (Goldstein et al., 1974) as described (Gianturco et al., 1982, 1983, 1988, 1994, 1986; Ramprasad et al., 1995; Bradley et al., 1984). Cells were dissolved in 0.1 N NaOH prior to the measurements of cell-associated radioactivity and cell protein. Dishes with no cells were used to correct for the amount of nonspecific binding to the plastic wells, as described (Gianturco et al., 1986). Duplicate dishes of cells were incubated with a range of concentrations of each lipoprotein, alone and with excess unlabeled lipoprotein to calculate specific binding at 4° C. (Gianturco, 1982a,b). Triton X-114 solubilization of human monocytes and macrophages plasma membranes were a s described (Gianturco, 1988, 1994).
- Antibodies and Antibody Production
- Since MBP200 and MBP235 did not biochemically or immunochemically resemble other low density lipoprotein-like receptors or the acetyl low density lipoprotein receptor (they do not cross react with antibodies against the bovine low density lipoprotein receptor or the human low density lipoprotein receptor-related protein), it was necessary to purify the protein. Several tissue sources were examined and the highest activities were found in human monocytes and macrophages, which are a limited source. Thus the human THP-1 monocyte cell line was used as a source for purification, since it grows continuously in suspension with a doubling time of ˜60 hours, has identical binding proteins to human monocytes and macrophages, and has higher activities than the U937 human monocytic line.
- After many attempts at ligand-affinity steps with various triglyceride-rich lipoprotein subfractions, both modified and native, a scaled-up two-dimensional electrophoresis procedure to obtain sufficient, partially purified MBP for monoclonal antibody production was used. Briefly, binding activity from plasma membrane preparations made from 2 billion THP-1 monocytes was solubilized with octyl glucoside. Solution phase isoelectric focusing (IEF) (Rotofor apparatus) was performed. The IEF fractions containing binding activity were concentrated and purified by preparative SDS-PAGE and transferred to nitrocellulose or Immobilon. Binding activity was identified by ligand blotting; strips with activity were cut out for implantation in mice. Binding activity of MBP235 was lost after IEF, although MBP200 remained active and was used for monoclonal antibody production. Approximately 2,400 hybridomas and 1,000 single cell clones were screened by two methods: immunochemical blotting and an immunoprecipitation, followed by ligand blotting, to detect loss of MBP200 binding activity. Only IgMs were generated and they had very low affinities for native MBPs. Although they immunoblotted, when coupled to Sepharose, the IgMs failed to bind MBP200 in solution. The fact that only IgMs were produced suggested that the antigen was monocyte-macrophage specific and/or an essential, highly conserved protein.
- Polyclonal antisera of high titer specific for apoB (both commercial and laboratory generated) were used (Bradley, 1984). Five polyclonal rabbit antisera to human apoE for RIA and blotting (Bradley, 1984; Gianturco, 1983) were generated and used, as was a mapped monoclonal antibody against apoB. Mab J I-H, which binds to apoB-100 but not to apoB-48, was also used (Havel, 1992).
- Sheep anti-human apoB IgG (1001400, Boehringer Mannheim, Indianapolis, Ind.) was purified by affinity chromatography using an LDL-conjugated Sepharose column prepared as described (Schneider et al., 1982). Immunoaffinity purified rabbit anti-sheep IgG conjugated to alkaline phosphatase and sheep gamma globulin was purchased from Jackson Labs (West Grove, Pa.). Rabbit anti-human apoB antibodies were isolated b y ammonium sulfate precipitation of serum from rabbits immunized intradermally with human LDL, isolated at d=1.03-1.05 g/ml, and emulsified in adjuvant. The anti-apoB-100 antibodies generated and/or affinity purified were monospecific for apoB and did not recognize apoE, apoCs, or apoHDL. Anti-apoE was generated in rabbits using human apoE purified and was monospecific for apoE. Affinity purified goat anti-apoCIII and anti-apoCII were from Dr. Ronald Krauss and Dr. G. M. Anantharamaiah, respectively.
- Ligand Blotting
- The ligand blotting assay was performed essentially as described (Gianturco et al., 1988, 1994; Ramprasad et al., 1995) with minor modifications. Aliquots of the detergent extracts were electrophoresed on 5% polyacrylamide gels containing 0.1% SDS (Laemmli, 1970) under non-reducing conditions in a Bio-Rad minigel apparatus and electrotransferred to nitrocellulose. After blocking for 1 hour with 5% Carnation nonfat dry milk in ligand buffer (50 mM Tris-HCl (pH 8), 90 mM NaCl and 2 mM CaCl2), the blots were rinsed with 0.5% milk in ligand buffer before incubation with lipoproteins in ligand buffer containing 0.05% milk (Gianturco et al., 1988).
- For competitive ligand blots, TGRLP were biotinylated as described (O'Shannessy et al., 1984) and dialyzed extensively before use. Biotin-labeled lipoproteins (with and without antisera), IgGs (the 50% [NH4]2 SO4 precipitate of antisera), or other potential competitors were preincubated for 30 minutes at 4° C. and then incubated with the nitrocellulose strips for 1.5-3 hours as indicated. After extensive washing, bound lipoprotein was detected by incubation with streptavidin linked to alkaline phosphatase, followed by substrates BCIP and NBT (Bio-Rad Laboratories, CA). In some experiments without antibodies as potential competitors, native, unlabeled TGRLP were used as the ligand, and bound TGRLP was detected with anti-apoB followed by alkaline phosphatase-linked secondary antibody. Ligand blots were scanned on an optical scanner (Hewlett-Packard, Atlanta, Ga.) and binding activity was quantitated using the Image Quant software (Molecular Dynamics densitometer, Sunnyvale, Calif.) as described (Gianturco et al., 1994; Ramprasad et al., 1995).
- Membrane Binding Proteins (MBPs) for Triglyceride-Rich Lipoproteins
- Direct binding studies at 4° C. demonstrate that human monocyte-macrophages, 1-6 days after isolation from blood, and human THP-1 monocytic cells, before and up to 7 days after differentiation with phorbol ester, exhibit a high affinity (Kd 3-6 nM), saturable, specific, apolipoprotein E-independent binding site for the uptake and degradation of certain triglyceride-rich lipoproteins. Trypsinized-very low density lipoprotein (tryp-very low density lipoprotein) was used as the surrogate ligand to test for the apoE-independent triglyceride-rich lipoprotein binding site. This is because tryp-very low density lipoprotein binds to the macrophage specific binding site and MBPs for hypertriglyceridemic-very low density lipoproteins (Gianturco, 1988, 1994), but does not bind to low density lipoprotein receptors or to related receptors either in cells (Gianturco, 1983; Bradley, 1984) or in ligand blots (Brown, 1986) due to the absence of apoE or apoE fragments in tryp-very low density lipoproteins (Gianturco, 1983; Bradley, 1984). Tryp-very low density lipoproteins do not bind to other lipoprotein receptors, such as those in the scavenger receptor pathway (Gianturco et al., 1988, 1994). Notably, tryp-very low density lipoproteins retain essentially all of the parent very low density lipoproteins' immunochemically detectable apoB, in fragments of ˜100 kDa and less. Use of ligands with mutually exclusive receptor specificities simplifies the interpretation of comparative and competitive binding studies b y reducing the ambiguity seen when hypertriglyceridemic-very low density lipoprotein is used, since hypertriglyceridemic-very low density lipoprotein also binds to the low density lipoprotein receptor via apoE (Gianturco, 1983). Moreover, the absence of apoE in tryp-very low density lipoprotein would reduce the potential binding to other members of the low density lipoprotein receptor gene family that bind via apoE, such as low density lipoprotein receptor-related protein (Beisiegel, 1989; Kowal, 1989; Kowal, 1990) and the related very low density lipoprotein receptor (Takahashi, 1992). Studies were conducted at 4° C. in prechilled, washed cells to preclude secretion of apoE or other confounders, such as lipoprotein lipase, which modulate/mediate lipoprotein binding to the low density lipoprotein receptor family members. In addition, the medium contained no serum components to avoid adding any apoE that could be in lipoprotein-deficient serum (LPDS).
- Ligand blots identified two membrane binding proteins of apparent MW of approximately 200 and approximately 235 kDa (MBP200 and MBP235) in both cell types. The MBPs share the same ligand specificity as the cellular site and bind dietary plasma chylomicrons Sf>400 from normal subjects, hypertriglyceridemic very low density lipoprotein, and the surrogate ligand trypsinized very low density lipoprotein devoid of apoE (tryp-very low density lipoprotein). The MBPs also bind t apoE-free B-VLDL from apoE knockout mice; this VLDL contains apoB48 as the predominant apoB species. The MBPs do not bind with high affinity low density lipoproteins, acetyl low density lipoprotein or normal very low density lipoprotein. Neither lipoprotein lipase nor apoE are required for triglyceride-rich lipoprotein binding to the cells or the isolated MBPs. The cellular binding site and the MBPs are expressed a t similar levels at all stages of differentiation, unlike the low density lipoprotein or the acetyl low density lipoprotein receptor. Triglyceride-rich lipoproteins, which bind to the MBPs, induce rapid, saturable cellular triglyceride accumulation in monocytes as well a s macrophages; normal very low density lipoprotein does not. In addition, the cell binding site and MBP200 and MBP235 are not affected by the media sterol content, unlike the low density lipoprotein receptor. Taken together, these data indicate that human monocytes and macrophages exhibit a high affinity, saturable, specific, apoE- and lipoprotein lipase-independent binding site and MBPs for triglyceride-rich lipoproteins which differ in expression, specificity, and molecular size from receptors of the low density lipoprotein receptor gene family or the acetyl low density lipoprotein receptor (Gianturco et al., 1994). The characteristics of MBP200 and MBP235 suggest that they are candidates for the receptor-mediated, apoE-independent uptake of hypertriglyceridemic-very low density lipoprotein and chylomicrons by monocytes and macrophages. Therefore, MBP200 and/or MBP235 may be involved in cellular nutrition or, when overwhelmed, in foam cell formation.
- Triglyceride-Rich Lipoprotein Receptors with Unique Properties
- Protease and heparinase susceptibility studies demonstrate that (1) these MBP activities have essential protein components, but not heparan sulfate proteoglycan components; (2) the MBPs are located on the cell surface; (3) heparan sulfate proteoglycans do not facilitate triglyceride-rich lipoprotein binding to this specific cellular site (Ramprasad et al., 1995).
- To determine protease effects on the high affinity, apoE-independent cell binding sites, THP-1 macrophages were treated with RPMI-1640 alone (control) or with 3 μg pronase/ml at 37° C. for 40 minutes prior to the binding studies at 4° C. These conditions have been shown to have no effect on cell growth, but to alter cell surface receptors (Burger, 1970; Goldstein & Brown, 1974). The cell and ligand conditions used precluded potential ambiguities introduced b y alternate lipoprotein pathways. Pronase pretreatment of cells significantly reduced the binding of125I-tryp-very low density lipoprotein by 50-65% compared to controls (viability>95%). Recovery of the binding of triglyceride-rich lipoprotein to cells (>80%) occurred within 2 to 4 hours after the pronase-treated cells were washed and further incubated at 37° C. in complete medium prior to assessment of binding at 4° C. Ligand blots demonstrated that THP-1 monocytes treated with 3 μg pronase/ml for 40 minutes a t 37° C. lost approximately 50-60% of their MBP200 and MBP235 activities, as compared to control cells. After the 4 hour recovery period in complete media, total MBP activities in control a n d pronase-treated cells were equal and somewhat greater than seen immediately after treatment, in parallel with the kinetics of recovery of triglyceride-rich lipoprotein binding to cells. Thus, proteolysis experiments establish the cell surface location of both MBPs. The parallel pronase-induced loss and subsequent recovery of MBP binding activity and cellular binding of triglyceride-rich lipoprotein strongly support their role as triglyceride-rich lipoprotein receptors.
- Protease susceptibility did not rule out the possibility that the activities were proteoglycans. Moreover, others have reported that proteoglycans, specifically heparan sulfate proteoglycan, augmented and/or facilitated lipoprotein binding to the low density lipoprotein receptor (Mulder 1992), to low density lipoprotein receptor-related protein (Nykjaer, 1993), and to the very low density lipoprotein receptor (Takahashi, 1994). Heparinase treatment of THP-1 extracts had no effect on either MBP activity in ligand blots, indicating these MBPs are not themselves heparan sulfate proteoglycans. Likewise, there was no decrease in the total, nonspecific, or specific binding of hypertriglyceridemic-very low density lipoprotein or tryp-very low density lipoprotein to THP-1 macrophages pretreated with active heparinase prior to 4° C. binding studies. The heparinase experiments demonstrated that neither MBP200 nor MBP235 nor the equivalent cellular triglyceride-rich lipoprotein binding site were heparan sulfate proteoglycan.
- Effects of Reduction on MBP200 and MBP235
- The LDL receptor, LDL receptor-related protein and the VLDL receptor have multiple cysteine-rich domains which comprise their complex ligand binding domains and specificities. The low density lipoprotein receptor loses activity upon reduction (Daniel, 1983) and the other lipoprotein receptors would be expected to lose binding activity upon reduction. For example, the scavenger receptor's trimeric structure (MW˜260 kDa) could be selectively reduced with thiols to active monomers, but upon exhaustive reduction, all ligand binding activity was lost (Via, 1992). In contrast, reduction of MBP200 and MBP235 generated a new active species, MBP200R, which retained full activity even under exhaustive reduction conditions (boiling in 100 mM DTT or 5% 2-mercaptoethanol (2-ME)). In addition, although disulfides were present in both MBPs (both mobilities changed upon reduction), these disulfides were not essential for ligand binding activities.
- To demonstrate that MBP200R arose from both MBP200 and MBP235, two-dimensional (2-D) SDS-PAGE was used to separate the MBPs on the basis of size, both before and after reduction with 2-ME. In many independent experiments, both MBP200 and MBP235, in the absence of reduction in the second dimension, retained their original, distinct mobilities and activities (FIG. 1A, seen on the diagonal). In contrast, upon reduction in the second dimension, both MBP200 and MBP235 mobilities were altered relative to the ˜200 kDa standard, and migrated with identical mobilities (seen off the diagonal), intermediate between MBP200 and MBP235, (FIG. 1, panel B) (Ramprasad et al., 1995). This demonstrates unequivocally that MBP200R arises from both MBP200 and MBP235. These changes in electrophoretic mobility reflect reduction of intramolecular disulfide bonds and, in the case of MBP235 where its electrophoretic mobility increased upon reduction, the possible loss of a small subunit(s) not involved in ligand binding. These conclusions were confirmed with receptor-specific antibodies.
- Ligand Binding Affinities of MBP200, MBP235 and MBP200R
- The 2-D experiments proved that both MBP235 and MBP200 are converted into MBP200R upon reduction. The ligand binding properties of each MBP was measured before and after reduction by quantitative ligand blotting analyses detected with anti-apoB antibodies and quantified by scanning densitometry (Ramprasad et al., 1995). MBP200 and MBP235 exhibited similar, high affinity saturable binding, with saturation occurring between 5 and 10 μg apo very low density lipoprotein/ml (FIG. 2A&B). Scatchard analyses of the data indicate that MBP200 and MBP235 have similar Kds of 1.6 and 2.2 μg apo very low density lipoprotein/ml and Bmax of 96 and 66 ng apo very low density lipoprotein/mg cell protein, respectively (FIG. 2C).
- The binding of hypertriglyceridemic-very low density lipoprotein to MBP200R exhibits similar, high affinity, saturable binding with a Kd of 1.4 μg/ml and a Bmax of 160, approximately equal to the sum of the maximal binding activities of its precursors, MBP200 and MBP235 (FIG. 2C). Indeed, the theoretical curve (dashed line) obtained by adding the amount of very low density lipoprotein bound to MBP200 and MBP235 at each level of lipoprotein is nearly superimposable on the measured binding curve for MBP200R (FIG. 2B). The binding affinities of hypertriglyceridemic-very low density lipoprotein and tryp-very low density lipoprotein for the MBPs were similar to their binding affinities for intact human blood-borne and THP-1 monocytes and macrophages, where Kd of 2-4 μg apo very low density lipoprotein/ml were determined (Gianturco, 1994). This striking similarity in ligand affinities provides additional supporting evidence that these MBPs are responsible for the apoE-independent, high affinity and saturable binding of triglyceride-rich lipoproteins to monocytes and macrophages.
- Thermal Conversion of MBP235 into MBP200 Binding Activity
- The reduction data indicated that MBP200 and MBP235 share a common protein component of approximately 200 kDa, which retains all the ligand binding activity. Since the mobility of MBP235 increased upon reduction, this suggested that one or more small subunits may be present in MBP235 and lost, either due to reduction of an intermolecular disulfide bridge(s) or by an allosteric process caused by the disruption of the intramolecular disulfides during reduction of the 200 kDa protein. At 65° C., MBP235 was converted into MBP200 without loss of total binding activity, suggesting heat dissociates a small subunit(s) not required for ligand binding from a common large protein subunit that binds triglyceride-rich lipoproteins. Thus, MBP235 can be converted into MBP200 with full retention of ligand binding activity. Moreover, these data suggest that MBP235 has (a) noncovalent subunit(s) of approximately 35 kDa total mass that is/are lost upon heating or disruption of the intramolecular cysteines of the parent backbone shared by MBP235 and MBP200. Additionally, the subunit(s) is/are not involved directly in triglyceride-rich lipoprotein binding. The subunits are not the receptor associated protein that interats with and modulates members of the LDL receptor family, as determined immunochemically.
- In a working model (FIG. 3), MBP235 is comprised of two subunits, MBP200 and a ˜35 kDa subunit, consistent with its apparent molecular weight on SDS-PAGE. The MBP235 complex dissociates upon heating into the active MBP200 subunit and an inactive smaller subunit(s). Upon reduction, the MBP235 complex also dissociates, losing its smaller subunit, and its active MBP200 component is extended by the reduction of intramolecular cysteines, yielding an active binding protein (MBP200R) with a slightly slower migration, intermediate between MBP235 and MBP200 mobilities. MBP200 lacks the associated subunit(s), has saturation binding characteristics like those of MBP235, and upon reduction, is extended due to loss of its intramolecular disulfide bonds, yielding a product with identical electrophoretic mobility as that produced by reduction of the MBP235 complex. The model thus emphasizes the conclusion that a large and similar, if not identical, protein backbone is common to both MBP200 and MBP235 and contains the ligand binding domain(s). This suggests that the ligand binding domain(s) are not located either in domain(s) involved in the structural changes that occur upon reduction, or in domains that bind to the putative 35 kDa subunit. The conclusions reached from the reduction and heat-dissociation studies based on ligand blotting analyses have been confirmed using the antipeptide antibodies derived from MBP200.
- Expression of MBP200 Confers Receptor Activity on Receptor-Negative Cells
- The reconstruction and sequence characterization of the MBP200 cDNA has been completed to determine the primary structure of this unique protein and to express the protein in receptor-negative cells (CHO, fibroblasts, COS). This process examines (1) if MBP200 is sufficient for receptor function; (2) if MBP200 possesses functional ligand binding domains; and (3) whether the effects of receptor expression on the cellular binding and uptake of triglyceride-rich lipoproteins is independent of macrophage-associated apoE and/or lipoprotein lipase. Eight cDNA clones were identified in the THP-1 library and four in the placenta library. The MBP cDNA was reconstructed from overlapping cDNAs by the direct ligation of appropriate restriction fragments. Isolation of the full-length cDNA was verified by comparing its size (3744 bases) to the size of the mRNA (about 3.8 kb), and verified by the complete sequencing of the cDNA.
- The complete characterization of the cDNA provides information necessary for expressing the protein in vitro and for the characterization of the corresponding gene. Characterization of the cDNA also provides information on the primary structure of the protein, the potential functional binding domain of the protein and possibly the relationship of the 35 kD subunit(s) to MBP200, as it is possible that the subunit is derived by post-translational proteolysis as has been shown for the low density lipoprotein receptor-related protein (˜600 kDa=520+85 kDa).
- Obtaining a full-length MBP200 cDNA allows the functions of the protein in vitro in receptor-negative cells to be shown in detail. The MBP200 cDNA was cloned into a pCDNA vector downstream of the cytomegalovirus promoter and transfected with a selectable marker gene (neomycin) into receptor-negative cells (CHO). Stable and transient transformants are then selected with G418, and mass cultures and specific clonal lines examined for receptor activity by incubation with DiI-labeled tryp-very low density lipoprotein. Uptake of the fluorescent label by cells transfected with pCDNA plus receptor cDNA, but not by cells transfected with the pCDNA vector alone, demonstrates that the cDNA is sufficient to confer full receptor activity, and hence, the plasma membrane targeting of the receptor. The number of gene copies incorporated into stable transformants can be determined and MBP expression evaluated. Using both cDNA and antibody probes, the expression of both the mRNA and proteins, as well as the membrane targeting of MBP200, is determined. By comparing the size of MBP expressed in vivo to the protein synthesized by cell translation in vitro, one can obtain information on the intracellular processing of MBP200 and determine if the 35 kD protein is proteolytically derived from MBP200. For the latter analysis, messenger RNA corresponding to MBP200 is synthesized by run-off transcription using either T7 or T3 RNA polymerase in the presence of pGppG.
- As receptor function is evident from expression of the DNA encoding MBP200, characterization of the protein domains involved in ligand binding can also be determined. 5′-deletion and site-directed mutants are constructed and expressed in stably transformed receptor-negative cells. By examining plasma membrane targeting and stability of the protein using the antibodies against MBP200, one can identify domains of the proteins important for ligand binding.
- In addition, as receptor function is mediated by MBP200 alone, increased expression of MBP200 should increase triglyceride-rich lipoprotein uptake and downregulation should diminish uptake. MBP200 is placed under tetracycline (tet) regulation using a minimal CMV promoter fused to tet operator (0) sequences (tetO-CMV) in cells expressing a hybrid, tet-controlled transactivator (tetTA, the tet repressor DNA binding domain fused to the transactivation domain of VP16 from HSV that is essential for transcription). TetTA stimulates tetO-CMV promoters in the absence of tet (Gossen and Bujard, 1992). Tet binds to tetTA with high affinity and prevents its binding to the tetO-CMV promoter, thereby silencing the promoter. Varying the concentration of tet allows down-regulation of gene expression by up to 5 orders of magnitude. Thus, using such a system, one can examine the effect of expression of MBP on triglyceride-rich lipoprotein uptake and determine if there is a direct dose-dependent effect on uptake. To obtain receptor-negative cell lines expressing the tetTA, stable transformants containing plasmids encoding tetTA and the hygromycin-resistance gene are isolated, and lines expressing tetTA and capable of regulating a transfected reporter gene driven b y tetO-CMV selected. These are also now commercially available. The receptor-negative, tetTA-expressing cell lines are then transfected with MBP200 driven by the tetO-CMV promoter with a neomycin resistance gene, and neomycin-, hygromycin-resistant cells selected. Transformants are examined for the expression of MBP200, ligand binding and triglyceride-rich lipoprotein uptake in the absence (full expression) and presence of varying tet concentrations to control the degree of downregulation. Alternatively, other regulatable promoters (e.g. metallothionein) can be used.
- The Smaller MBP200-Associated Subunit(s)
- The ˜35 kD protein(s) associated with MBP200 does not appear to be the receptor-associated protein described (Strickland, 1990). Three lines of evidence for this conclusion include: (1) rabbit anti-human receptor-associated protein antibodies did not exhibit cross-reactivity with MBP235 in immunoblots, while readily detecting purified human receptor-associated protein and free receptor-associated protein in extracts of human skin fibroblasts and THP-1s; (2) receptor-associated protein did not associate with MBPs following ligand blotting under conditions where receptor-associated protein binds to members of the low density lipoprotein receptor gene family; and (3) receptor-associated protein did not compete for hypertriglyceridemic-very low density lipoprotein binding to MBP200 or MBP235, even when in 1000-fold molar excess, but readily competed for the binding of this ligand to the low density lipoprotein receptor. It is highly likely, therefore, that the 35 kD protein(s) corresponds to a unique MBP-associated protein.
- Ligand Identification
- Neither apoE nor lipoprotein lipase is required for binding of triglyceride-rich lipoprotein to monocytes and macrophages or to MBP200 and MBP235 on ligand blots (Gianturco, 1994). Anti-apoB antibodies inhibit binding of hypertriglyceridemic-very low density lipoprotein and tryp-very low density lipoprotein, devoid of apoE, to both THP-1 cells (FIG. 12) and MBP200 and MBP235 on ligand blots (FIGS. 5, 10 and11). Control, nonimmune IgG tested at the same level had no effect on binding of triglyceride-rich lipoprotein to either cells (FIG. 12) or MBP200 or MBP235 on ligand blots (FIGS. 5, 10 and 11). The region of apoB that binds to the receptor is in the apoB-48 region (the N-terminal 48% of apoB-100), since chylomicrons containing apoB-48, but not apoB-100, bind with high affinity (Gianturco, 1995) (FIG. 16), and this binding is inhibited specifically by antibodies against apoB (FIG. 17).
- Competitive 4° C. cell binding and ligand blotting studies demonstrated that pretreatment and/or coincubation of cells (Table 1) and blots (FIG. 13) with heparin (up to 10 mg/ml) or lactoferrin (up to 500 μg/ml) had no effect on the apoE-independent binding of triglyceride-rich lipoprotein to cells or to MBP200 and MBP235, or on the triglyceride accumulation induced by triglyceride-rich lipoprotein in THP-1 cells. Since heparin pretreatment removes surface-bound lipoprotein lipase, and coincubation causes release of surface-bound lipoprotein lipase thereby enhancing triglyceride accumulation induced by triglyceride-rich lipoprotein when lipoprotein lipase is on the cell surface, these studies demonstrate that lipoprotein lipase is not necessary for the observed interactions. In contrast to studies with low density lipoprotein receptor family members, lipoprotein lipase at 1-2 mg/ml showed partial inhibition (-25% of specific binding) during co-incubations (FIG. 14; Table 1), and had no effect when blots were pretreated with lipoprotein lipase and then incubated with triglyceride-rich lipoprotein. Thus, lipoprotein lipase does not interact with the MBPs directly, but the partial inhibition during coincubation suggests that the binding domain for the MBPs in apoB is near the lipoprotein lipase binding site(s) of apoB, which has been shown to be in the N-terminal region. Thus, the receptor binding domains are in the N-terminal apoB region at or near the lipoprotein lipase binding site and not in a heparin binding domain, which is consistent with the observed binding of apoB48-containing chylomicrons to cells and to MBP200 and MBP235.
- Thus, the binding determinant(s) appear to be in apoB. All native triglyceride-rich lipoproteins were isolated in the presence of antioxidants and show no evidence of oxidation, such as thiobarbituric acid reacting species (TBARs) or apoB fragmentation that oxidation produces. Thus, oxidation of triglyceride-rich lipoproteins is not required for their binding to this receptor. Although oxidized low density lipoprotein can compete for binding to the cellular site, it binds to numerous monocyte and macrophage proteins, and the competition appears to be non-specific.
- Anti-apoB Antibodies Inhibit the Binding of HTG-VLDL Sf100-400 to MBP200 and MBP235
- Previous experiments in human blood-borne and THP-1 monocytes and macrophages (Gianturco et al., 1994; Ramprasad et al., 1995) with the surrogate ligand, trypsinized-VLDL, which retained essentially all apoB immunoreactivity (in fragments of ≦100 kDa) but was devoid of immunochemically detectable apoE (Gianturco et al., 1983, 1986; Bradley et al., 1984) and apoCIII and failed to bind to the LDL receptor in cells (Gianturco et al., 1983) and in ligand blots (Gianturco et al., 1988), suggested that apoB may be the ligand for this monocyte-macrophage cell site and corresponding MBPs. Thus competitive ligand blotting experiments were done with several polyclonal anti-apoB specific antibodies to determine if these were capable of specifically blocking binding of HTG-VLDL to the putative TGRLP receptor proteins MBP200 and MBP235.
- In the representative experiment shown in FIG. 10, THP-1 monocyte extracts were electrophoresed and transferred to nitrocellulose, blocked, and incubated with biotinylated VLDL in the absence (lane 1) and the presence of a monospecific rabbit (1325) anti-apoB IgG (40 μg/ml,
lane 2; 400 μg/ml, lane 3), or the corresponding preimmune IgG (rabbit 1325) (90 μg/ml,lane 4; 400 μg/ml, lane 5). Binding of biotinylated HTG-VLDL Sf100-400 was visualized with streptavidin-linked alkaline phosphatase and the image digitized (FIG. 10A) and quantified by scanning densitometry (FIG. 10B). The lower level of anti-apoB IgG (40 μg/ml, lane 2) blocked ˜50% of binding, and the higher level (400 μg/ml, lane 3) blocked all visibly detectable HTG-VLDL binding to MBP200 and MBP235 (˜80% by densitometry). In contrast, the preimmune IgG at 90 μg/ml blocked none of the binding (lane 4), and at 400 μg/ml, blocked 25% (lane 5). In a separate ligand blotting experiment, this apoB antibody did not inhibit the binding of the same biotinylated VLDL to the bovine LDL receptor. FIG. 10 is representative of 12 separate experiments with four different anti-apoB antibodies; in all cases, anti-apoB antibodies specifically inhibited binding of HTG-VLDL, chylomicrons, or tryp-VLDL to MBP200 and MBP235. Thus, apoB is involved in the binding of HTG-VLDL to the MBPs. These results are consistent with studies demonstrating specific, high affinity binding of tryp-VLDL and implicate apoB in the binding of TGRLP to MBP200 and MBP235. Alternatively, the anti-apoB antibodies could sterically hinder another component of the ligand for MBP200 or MBP235. - Antibodies Against Other Apoproteins of HTG-VLDL Fail to Inhibit its Binding to MBP200 or MBP235
- ApoB is only approximately 30% of the total protein mass in HTG-VLDL Sf100-400; apoE is 6-8%, and apoCs are ˜63% (Gianturco et al., 1980, 1983). On a molar basis, HTG-VLDL SflOO-400 contains 1 mole of apoB, approximately 3-6 moles of apoE, and >150 moles apoCs (primarily apoCIII) per mole VLDL. To directly determine if any of these other apoproteins are the ligand sterically hindered by the anti-apoB antibodies in the experiments represented by FIG. 10, or if these apoproteins contribute to the binding of HTG-VLDL to MBP200 and MBP235, a series of competitive ligand blotting experiments with polyclonal antibodies against the other major apoproteins of HTG-VLDL were performed. All antibodies recognized their antigens in native VLDL and the anti-apoCIII antibody was used to isolate apoCIII-rich VLDLs.
- In FIG. 11, MBP200 and MBP235 activities (either or both) appear as a complex of two or more bands due to the existence of several permissible oxidation states and/or disulfide isomers, as previously published (Ramprasad et al., 1995). In the experiment shown in FIG. 11A, biotinylated HTG-VLDL Sf100-400 incubated with buffer (lane 1) or with nonimmune IgG (lane 3) binds to MBP200 and MBP235 to a similar extent. Neither anti-apoE (lane 4) nor anti-apoCIII (lane 5) diminishes the binding of HTG-VLDL to MBP200 or MBP235, but anti-apoB again effectively blocks >90% of the binding of HTG-VLDL (
lane 2 and FIG. 11B). That anti-CIII antibody failed to block binding of HTG-VLDL to MBP200 or MBP235, even though the total apoCIII mass is approximately two times the mass of apoB in HTG-VLDL Sf100-400, argues against the alternative explanation offered above that the anti-apoB antibodies block by sterically hindering another apoproteins interaction with the MBPs. In other ligand blotting experiments, the concentration of anti-apoE IgG used in these experiments blocked all binding of HTG-VLDL to the LDL receptor. Competitive ligand blotting studies with anti-apoCII IgGs demonstrated that these antibodies do not inhibit binding. Taken together, the competitive ligand blotting studies strongly suggest that apoB, but not apoE, apoCIII, or apoCII, mediates the binding of HTG-VLDL to MBP200 and MBP235. - Anti-apoB Antibodies Inhibit the Binding of TGRLP to the TGRLP Receptor of THP-1 Monocytes but not to the LDL Receptor of Fibroblasts
- To confirm that apoB mediates the binding of TGRLP to the lipoprotein lipase- and apoE-independent TGRLP cellular receptor, competitive cell binding studies with THP-1 monocyte-macrophages were conducted under experimental conditions which minimize the expression of the LDL receptor, the LDL receptor-related protein/α2 macroglobulin receptor (LRP), lipoprotein lipase, and apoE (one day after adherence was induced by PMA) as described (Gianturco et al., 1994). As a control, competitive binding studies were also done simultaneously with cultured human skin fibroblasts with upregulated LDL receptors, since HTG-VLDL Sf100-400 binds to the LDL receptor via apoE and not via apoB (Gianturco et al., 1983; Bradley et al., 1984). Consistent with the ligand blotting studies (FIG. 10), the high affinity, specific binding of 125I-HTG-VLDL to THP-1s was inhibited by antibodies to apoB but not by the equivalent level of nonimmune IgGs (FIG. 12A). In contrast, and indicating the specificity of the blocking experiments in THP-1s, the same anti-apoB antibody did not inhibit the LDL receptor specific binding of 125I-HTG-VLDL to the fibroblasts (FIG. 12B), consistent with previous studies. This representative experiment shows that the inhibition of 125I-HTG-VLDL binding to THP-1s by anti-apoB antibodies was not significantly different from the inhibition by homologous, unlabeled HTG-VLDL. This indicates that apoB is the component of TGRLP responsible for their high affinity, specific binding to THP-1 cells when the LDL receptor, LRP, lipoprotein lipase, and apoE are suppressed.
- Effects of Lactoferrin, Heparin, and Lipoprotein Lipase on Binding of HTG-VLDL Sf100-400 to MBP200 and MBP235 and to THP-1 Monocyte-Macrophages
- A series of competitive ligand blotting studies were carried out to further distinguish
MBP 200 and MBP235 from receptors of the LDL receptor family and to further delineate the binding domains in apoB for this distinct receptor. As shown in FIG. 13, neither lactoferrin nor heparin is effective inhibitors of the binding of HTG-VLDL to MBP200 and MPB235. Ir this representative experiment, nitrocellulose strips containing MBP200 or MBP235 were incubated with 0.5 μg of biotinylated HTG-VLDL/ml in the absence (lane 1) or in the presence of lactoferrin at 50 μg protein/ml (lane 2) or 500 μg protein/ml (lane 3); heparin at 10 U/ml (lane 4) and 100 U/ml (lane 5); or HTG-VLDL at 25 μg/ml (lane 6) or 5 μg/ml (lane 7). Binding of biotinylated VLDL was visualized with streptavidin-linked alkaline phosphatase (FIG. 13A) and quantified by scanning densitometry (FIG. 13B). Only unlabeled HTG-VLDL effectively competed with biotinylated HTG-VLDL for binding to MBP200 and MBP235. Lack of inhibition of TGRLP binding to MBP200 and MBP235 by heparin at levels that are known to displace lipoprotein lipase from cells indicates that binding is not mediated by lipoprotein lipase potentially bound to the VLDL. It also suggests that the apoB domain involved in binding to MBP200 and MBP235 is different from the apoB domain involved in the binding of LDL to the LDL receptor, since the apoB-LDL receptor interaction is disrupted by heparin (Goldstein et al., 1974). Further, it suggests that the domain in apoB that binds to MBP200 and MBP235 is not in a heparin-binding domain. Lack of inhibition of binding by lactoferrin indicates that MBP200 and MBP235 are distinct from the putative hepatic remnant receptors (van Berkel et al., 1995). - To further characterize the receptor binding domain in apoB of HTG-VLDL, and distinguish its binding to the monocyte TGRLP receptor from binding to the LDL receptor or related receptors, competitive ligand binding studies were carried out with levels of lipoprotein lipase reported to enhance binding of lipoproteins to LDL receptor family members or to heparan sulfate proteoglycans (HSPG) on cells. In the representative experiment shown in FIG. 14, THP-1 monocyte extracts were electrophoresed and transferred to nitrocellulose. Biotinylated HTG-VLDL (3 μg/ml) was preincubated for 30 min at 4° C. (to inhibit potential lipolysis by lipoprotein lipase) and then with the nitrocellulose strips for 3 h at 4° C. with buffer (lane 1) or with lipoprotein lipase (at 0.2, 2.0, 20 μg/ml; lanes 2-4) or with the same levels of bovine serum albumin as controls (lanes 5-7). Surprisingly, lipoprotein lipase, at levels which enhance binding to LRP, blocks the binding of HTG-VLDL to MBP200 and MBP235 in a concentration-dependent manner (FIG. 14B). In contrast, albumin has minimal effects on HTG-VLDL binding. Thus, lipoprotein lipase does not mediate the interaction of VLDL with this monocyte-macrophage receptor, rather, it inhibits binding. Inhibition of binding by LpL is likely due to its binding to the N-terminal domain of apoB (Choi et al., 1995), since preincubation of the receptors on nitrocellulose strips with lipoprotein lipase failed to inhibit the subsequent binding of TGRLP.
- Competitive cell binding studies also demonstrated that lactoferrin fails to significantly inhibit the binding of tryp-VLDL or HTG-VLDL to monocyte-macrophages (<5%), and high levels of heparin (10 mg/ml) have only a small effect (≦18%) (Table 1). Other studies with heparin at lower levels (1 mg/ml) show little to no inhibition of TGRLP binding. These binding studies also indicate that lipoprotein lipase, at levels shown by others to enhance binding of lipoproteins to cellular HSPG (Eisenberg et al., 1992; Rumsey et al., 1992), to LRP (Beisiegel et al., 1991; Chappel et al., 1993) and to the LDL receptor (Mulder et al., 1993) (1-2 μg/ml), do not enhance uptake of tryp-VLDL, rather they partially inhibit binding (to 26% a t 1.6 μg lipoprotein lipase/ml). That the inhibition of binding of TGRLP to cells by lipoprotein lipase is less than the inhibition of TGRLP binding to MBP200 or MBP235 is likely due to the competing enhancement of lipoprotein binding to cellular HSPGs by lipoprotein lipase, which is not a confounder in ligand blots. Thus, the results of cell binding studies are similar to the results of ligand blotting studies, with inhibition of binding by anti-apoB and by lipoprotein lipase, but not by pre- or non-immune IgG, lactoferrin, or heparin.
TABLE 1 Competition of specific TGRLP binding to THP-1 monocyte-macrophages Percent Inhibition Experiment 1 Experiment 2Experiment 3Additions 125I-tryp-VLDL1 125I-HTG-VLDL1 125I-tryp-VLDL2 Buffer (control) 0 0 0 Lactoferrin 4* 5* ND LpL 26† ND 17† Heparin 14 18 ND (10 mg/ml) Unlabeled 100 100 100 VLDL (20x) # inhibition, with unlabeled VLDL inhibition as 100%. The specific binding (0% inhibition) ranged from ˜140 to ˜20 fmol/mg cell protein reflecting the particles differing affinities (tryp-VLDL1 > HTG-VLDL1 > tryp-VLDL2). - Chylomicrons Sf>1100 Containing apoB-48 but not apoB-100 Bind to MBP200 and MBP235
- The specific inhibition of HTG-VLDL and tryp-VLDL binding to cells and MBP200 and MBP235 on ligand blots by antibodies to apoB indicate that this apoprotein is necessary for the binding of HTG-VLDL to this receptor. The inhibition by LpL in cells and in ligand blots implicates the N-terminal domain of apoB. Previous studies showed that HTG-VLDL, but not normal VLDL Sf>60, bind with high affinity to cells, cause lipid accumulation, and bind to MBP200 and MBP235. HTG-VLDL subfractions from subjects with elevated plasma triglyceride (>150 mg/dl) contain more apoB-48 than VLDL subfractions from subjects with normal plasma triglycerides (<150 mg/dl) after purification by cumulative flotation because of delayed chylomicron remnant clearance (Bradley et al., 1984). Taken together, these results suggest that apoB-48 may be a preferred ligand, or at least contain a preferred conformational domain of apoB that enhances binding to this receptor. Thus, chylomicron subfractions isolated 4 h after a standardized fat load was studied (Weintraub et al., 1987). Chylomicrons, that is the TGRLP of Sf>400, were purified further by cumulative flotation into more homogeneous subfractions of Sf>3200 (CM I), Sf1100-3200 (CM II), and Sf400-1100 (CM III) (Lingren et al., 1972). The largest two chylomicron fractions (CM I and II) contained apoB-48 as the only detectable apoB species (FIG. 15, lanes 1-4) whereas the smallest fraction (CM III) (
lanes 5, 6) contained both apoB-48 and apoB-100. Immunochemical blotting (FIG. 15), allowed estimation that <0.1%, or <1 in 1,000 particles, contain apoB-100 in the Sf>1100 subfractions.Lane 7 contains a typical fasting HTG-VLDL Sf100-400, with apoB-48 as well as apoB-100 and apoE. All chylomicron subfractions contained immunochemically detectable apoE (FIG. 15) and apoCs. - The three chylomicron subfractions were then tested for binding to MBP200 and MBP235 and to the partially purified bovine LDL receptor by ligand blotting analysis; a representative experiment is shown in FIG. 16. All of the chylomicron subfractions, added at equivalent concentrations, bound with high affinity to MBP200 and MBP235 (
lanes lanes - Cloning of the Full Length cDNA of ApoB48 Receptor
- MBP200 and MBP235 appear to be receptors for apoB48. To clone the cDNA for the human apoB48 receptor, designated apoB48R, nested degenerate oligonucleotide primers {bp 2763-2745, CCNCCNGTNACCATNARNC(SEQ ID No. 12) with 2048-fold degeneracy; and bp 2754-2738, ACCATNARNCCYTCNGC (SEQ ID No. 13) with 256-fold degeneracy based on the unambiguous 10-residue sequence {AEGLMVTGGR (SEQ ID No. 11)} previously used to produce receptor-specific antibodies (19), and the λgt10 forward primer (AGCAAGTTCAGCCTGGTTAAG (SEQ ID No. 14) were used to prime nested polymerase chain reactions (PCR) with a human THP-1 monocyte cDNA library (Clontech) as a template. Based on the sequence of the 137 bp product, new primers {bp 2763-2745, CCCCCCGICACCATGAG (SEQ ID No. 15) and bp 2754-2738, ACCATGAGRCCCTCTGC (SEQ ID No. 16)} were used in PCR with the λgt10 forward arm primer to produce a 631 bp product (pcr-631) which was subcloned and sequenced.
- The GeneAmp kit with AmpliTaq polymerase (Perkin Elmer) or the Advantage-GC kit with KlenTaq polymerase (Clontech) was used for PCR experiments. Initial cDNA clones were sequenced using the Sequenase 2.0 kit (US Biochemicals); most were sequenced using the Dye Termination Cycle Sequencing kit (ABI/Perkin Elmer) in the automated sequencing cores at the University of Alabama at Birmingham (UAB). The cDNA clones identified by phage hybridization screening were sequenced directly or were first subcloned into EcoRI-digested pBluescript II sk (Stratagene). PCR-generated clones were ligated into the TA cloning vector (PCR 2.1, Invitrogen) for sequencing. Both strands of all clones were sequenced; some regions were verified with different sequencing primers, particularly in GC-rich regions.
- To screen the human THP-1 λgt10 cDNA library, the plasmid containing pcr-631 was digested with EcoRI and the agarose gel-purified pcr-631 (1 μg) was labeled by random priming using the Genius digoxigenin (DIG) labeling system (Boehringer Mannheim). The library lysate was plated according to Clontech's protocol and plaques were lifted onto nylon filters. Filters were processed with the DIG-labeled pcr-631 according to the manufacturer's protocol and positive plaques were detected by chemiluminescence using the Lumiphos 530 reagent and exposed to Fuji NR film.
- Antisense primers were based on the 5′-end sequence of the THP-1×λ73 clone {bp 2203-2187, CCAGCCTCTTCTGGATG (SEQ ID No. 17) and 2139-2123, TCTCCCAGTGACGGGCA (SEQ ID No. 18)}. Nested PCR using these and the λgt10 forward arm primer and a human placenta λgt10 cDNA library (Clontech) as template produced a 1465 bp product which was cloned and sequenced (clone pcr-4-3).
- Antisense primers based on the 5′ end sequence of clone pcr-4-3 {722-699, CCTCAGTTTCCCCTGCATCTGCCT (SEQ ID No. 19) and PCR with gt10 forward primer produced a 722 bp product (pcr-722) which was cloned and sequenced. Primers based on the sequence were used in PCR to amplify 5′ end cDNA clones from the THP-1 cDNA library and THP-1 genomic DNA. Both clones pcr-4-3 and pcr-722 were used as probes for phage hybridization screening of the human placenta λgt10 cDNA library. Six positive clones were sequenced and used to confirm the sequence of the PCR clones.
- The apoB48R cDNA
- The full length THP-1 monocyte cDNA (SEQ ID No. 1) (GenBank accession #AF141332) is 3,744-basepairs (bp) with a Kozak start site (bp 5-14), a 3264 bp ORF beginning at
bp 11, and a stop codon (TGA) at bp 3275 (FIG. 21). The 3′ untranslated region contains an Alu-like sequence, two polyadenylation signals (AATAAA) and a poly A tail (FIG. 21). Sequencing multiple clones from both placenta and THP-1 monocytes spanning the full-length sequence indicated the human THP-1 monocyte and placenta (GenBank accession #AF141334) sequences differ at 6 bases (mutations or gene polymorphisms); 3 of these predict identical amino acids (b 520, A to G; b 574, A to G; b 1084, A to T), one is in the 3′ untranslated region (b 3446, T to G), one causes a conservative amino acid (aa) change (b 1434, G to A; R to K, aa residue 475), and one introduces a premature stop codon at aa 1077 (b 3239, G to T) that would cause a 12 residue truncation at the C-terminus in the placental receptor. - FISH Analysis of the apoB48R Gene
- Normal human metaphase and interphase nuclei were prepared from phytohaemagglutinin (PHA)-stimulated cultured blood lymphocytes using standard procedures. A cDNA insert was cut from a full length apoB48R cDNA which corresponded to
base pairs bp 1 to 2614 of the cDNA clone lacked the 3′ untranslated region to eliminate the Alu-like sequence. The probe was labeled with Cy3-dUTP (Amersham) by nick translation, and the chromosomal location was determined by FISH, as described previously with slight modification {T. Stokke et al., Genomics 26, 134 (1995)}. Briefly, 200 ng of Cy3-labeled cDNA was co-precipitated in the presence of 1 μg ofhuman Cot 1 DNA (Life Technologies) and hybridized to normal metaphase and interphase nuclei. The cells were then counterstained with DAPI for chromosome identification. Fluorescent images were captured with digitized image microscopy as described [M. Sakamoto et al., Cytometry 19, 60 (1995)]. The apoB48R gene (GenBank accession #AF141333) is located on chromosome 16p.1 as shown in FIG. 22. - apoB48R Genomic DNA
- As only one chromosomal site was identified, there appear to be no closely related or duplicated apoB48R genes elsewhere in the human genome. PCR cloning and sequencing of human THP-1 genomic DNA identified three small introns within the coding sequence (Table 2).
TABLE 2 ApoB48R intronic sequences and location identified by PCR cloning using THP-1 monocyte- macrophage genomic DNA as template. Double underlining indicates intron-exon boundary motif GT . . . AG. Intron 1 (360 bp) between bp 67 and 68 of the cDNA, FIG. 21 GTGAGAAGGGCAGACAGCTGCCAGATACTTGCACCCCATTCCCTGGGGCCTCACTTCCGGGC ACCTCCCCTGGGGCCTCACCTTTCCCCTCCTCCTTCTGATCTCCTCTAACTGGAGATTGCTTT CTCAGGTTCAGGCAGACTCCTGGCCTAATATTTTCTGAATTTCAGTCCCCACCTCCAACCATG CGTCCTCGTACCCCTAATCGATGCCCCTTCTGGCTCCTTCTGCAAATCCTCTTCTTCTCCTTT CAGATCCCAGTACCCTCTTCCTTAACCTGGGCTCCTCCAGCCAGGGCCCCCAGGGAAAGGGCT GGGACTCTCCTCAATGACTCTCCCCTCTCTCTCTCTTTTTTCCTAG (SEQ ID No. 20) Intron 2 (84) between bp 3228 and 3229 of the cDNA, FIG. 21 GTGAGGGCTCTTGGTGGGGTCTCGGGGGGAACGAGTGGAATCCCGAAGCCGGCCCCATGGTC CTCTGTGCCCCCTTTCCTGCAG (SEQ ID No.21) Intron 3 (86) between bp 3207 and 3208 of the cDNA, FIG. 21 GTGAGGGCTCTTGGTGGGGTCTCGGGGGGAACGAGTGGAATCCCGAAGCCGGCCCCATGGTC CTCTGTGCCCCCTTTCCTGCAG (SEQ ID No.22) - apoB48R Genomic DNA
- The 1088 amino acid deduced sequence (SEQ ID No. 2) of the THP-1 monocyte apoprotein contains three internal sequences previously obtained by microsequence analysis of tryptic digests of the purified receptor (FIG. 21). Immunoblotting data and transfection studies presented below indicate this cDNA is sufficient to encode a functional apoB48R. The sequence is unique; moreover, in that it is not closely related to any known protein. Unlike other lipoprotein receptors, which have functionally important cysteine-rich domains, there are only eight cysteines distributed throughout the apoB48R sequence. These may be involved in internal disulfides, giving rise to the observed microheterogeneity of unreduced receptor extracts observed on SDS-PAGE that disappears upon reduction (17, 21). The reduced and nonreduced forms of the receptor have full ligand binding activity, indicating that the cysteines are not directly involved in ligand binding.
- The apoB48R protein is highly polar, with 242 negative and 122 positive amino acids, and contains only two hydrophobic regions that are potential membrane spanning or lipid-interacting domains. The first hydrophobic region,
amino acids 1 to 30, is predicted to be helical by some but not all analyses, contains a putative leader sequence, a leucine zipper motif (amino acids 8 to 29), and a hydrophobic domain encompassing three-fourths of the helical face. The other hydrophobic domain (amino acids 751 to 773) is 23-residues long and has a high helical potential, consistent with known transmembrane domains. - Posttranslational glycosylation or other modification might account for the disparity between the deduced (˜114.8 kD) and the apparent Mr determined by SDS-PAGE (˜200 kD). A potential glycosaminoglycan attachment site is at amino acid 118, a potential N-glycosylation site is at
amino acid 617, and 4 possible O-glycosylation sites are at amino acids 265, 514, 565 and 942. However, treatment of partially purified receptor preparations with various glycosidases failed to affect significantly the mobility of the apoB48R on SDS-PAGE or its ligand binding properties (data not shown), suggesting that it contains little, if any, functionally significant carbohydrate. - ApoB48R does not contain a tyrosine-based internalization signal like that in the LDLR family. Rather, it contains tyrosine-independent di-leucine motifs (ExxxLL) (FIG. 21), which signal coated pit localization and internalization in immune cells (Mellman, R., 1996). As the apoB48R functions as a receptor for uptake of TGRLP when transfected into CHOs as described below, one of these di-leucine motifs may perform this function. The significance of the internal, unique repeating element (3 repeats of the 9 residue sequence GGEEAETAS and 8 nonexact repeats) is not known.
- Repeated attempts to dissociate polymeric species failed to shift the mobility of the apoB48R from ˜200 kD Mr, including boiling and reducing (Ramprasad, M. P., et al., 1995). There are, however, three potential coiled-coil domains in the predicted protein sequence that could promote homodimerization of the apoB48R and account for the size discrepancy (FIG. 21). Other than the motifs noted above, the apoB48R protein has no other common homologies to known proteins represented in GenBank.
- Evidence for Homodimerization of apoB48R
- Homodimerization is supported by results with glutathione-S-transferase (GST)-fusion proteins. GST fusion proteins of three domains encoded by clone pcr-4-3, 73-3, and pcr-631 were constructed in the pGEX-5X-3 vector (Pharmacia) according to the manufacturer's instruction. cDNA was digested from the vectors with EcoRI and ligated into the EcoRI-digested pGEX-5X-3. Transformants were screened for production of the appropriate fusion product and the plasmid DNA was sequenced to verify that the clones were in the correct orientation and reading frame for expression. Fusion proteins were produced by batch culture (24 L) of selected transformants and purified according to the manufacturer's protocol on glutathione-Sepharose.
- The fusion proteins were used as immunogens to generate polyclonal antibodies in rabbits by standard techniques. IgG were precipitated from antisera with (NH4)2 SO4, reconstituted in PBS, stored at 4%C (short term), and demonstrated specificity for all forms of the apoB48R (MBP200, MBP235, and MBP200R) by immunoblotting.
- Homodimerization is supported by the results with the glutathione-S-transferase (GST)-fusion protein containing amino acid 223 to 710. This fusion protein migrates as a dimer when analyzed on SDS-PAGE, suggesting spontaneous dimerization of this domain (27). In contrast, GST fusion proteins from more C-terminal domains of the apoB48R that lack potential coiled-coil domains (amino acid 629-1088 and amino acid 714-917) do not dimerize but instead migrate as expected by their predicted Mrs.
- Analysis of apoB48 Expression.
- Expression of apoB48 was analyzed in multiple tissues using a reverse transcriptase PCR technique. Total RNA was isolated from cells using the single-step protocol (Ausubel et al., 1995). Oligonucleotide primers were synthesized corresponding to bp 2756-2736 (antisense) and bp 2185-2204 (sense). First strand cDNA synthesis was performed on 5 μg of total RNA from each cell type primed with the antisense primer and Superscript II reverse transcriptase (Gibco/BRL). The subsequent PCR amplification used 10 pmol of the antisense primer, 10 pmol of the sense primer, and 20 μL of the first strand cDNA. The PCR products were analyzed b y electrophoresis on a 1% agarose.
- PCR screening of a human tissue cDNA panel with gene-specific primers identified the receptor cDNA in the brain, heart, kidney, liver, lung, pancreas, and placenta but not in skeletal muscle (FIG. 23). The level of receptor cDNA appeared to be greatest in lung and placenta as these were the only positive tissues after 25 PCR cycles. Control reactions with GPDH probes or primers verified approximately equal representation of transcripts in the mRNA and cDNA panels. Not shown are RT-PCR data indicating the expression of the apoB48R mRNA in human blood-borne, THP-1, and U-937 monocyte-macrophages; in murine P388D1 macrophages and NIH-3T3 cells (thought to be of EC origin); and in human umbilical vein ECs. CHOs, human fibroblasts, and HepG2s were negative, consistent with previous studies (Gianturco, S.H., et al., 1988 and 1994c that indicate that apoB48R is expressed primarily by cells of reticuloendothelial origin.
- Transfection Studies
- Transfection studies used THP-1 monocyte apoB48R cDNA including the first intron. The minigene was constructed by ligation of a 2454 bp PCR-generated genomic clone (bp 2-2095 of cDNA) that includes the first intron (Table 2) with the λ73 clone after digestion with EagI. The minigene was removed from its pBluescriptII KS (−) vector by EcoRI/NotI digestion and ligated into pcDNA 3.1 (−) with Ready-to-go T4 ligase (Pharmacia) according to the manufacturer's procedure. Clones were isolated by standard procedures and verified by partial DNA sequencing as described.
- The minigene was transfected into CHO-KI cells (ATCC) using lipofectamine (Gibco) according to the manufacturer's recommendations for adherent cells, and cells were selected in medium containing G418 (0.5 mg/ml; Agribio). After two-four weeks periods in selection medium, cells were harvested by trypsin treatment and subcultured onto coverslips (12 mm) for visualization experiments (Oil red O staining and DiI) or into 35 mm dishes for measurement of lipid accumulation after incubation with lipoproteins at the levels and times given for each experiment.
- Transfection of full length apoB48R cDNA constructs (with and without the first intron) into CHO-K1 cells conferred apoB48R expression and activity, whereas transfection with vector alone or inverted cDNA insert did not. Ligand and western blotting experiments performed as previously described (Gianturco, S. H., et al., 1994c and 1998) document expression of a single apoB48R species in the R-transfected cells, but not in vector-transfected cells, that exhibits coincident ligand binding activity and apoB48R immunoreactivity (FIG. 24).
- The apparent Mr of 190 kD in the R-transfected CHOs is slightly lower than the active forms in THP-l's (200 and 235 kD). The Mr differences and the presence of a single rather than two ligand binding species are likely due to differences in processing in CHO cells versus macrophages. Of note, however, the apparent Mr of the receptor in the apoB48R-transfected CHOs approaches twice that predicted by the cDNA, consistent with homodimerization of the receptor via protein interacting motifs previously noted.
- Analysis of TGRLP Uptake
- ApoB48R-mediated TGRLP uptake by transfected CHOs was determined by three alternative methods: first, by TGRLP-induced increases in cellular TG mass (FIG. 25), a sensitive, quantitative endpoint since TG is the predominant lipid in the lipoprotein and thus the predominant lipid accumulated by cells. The second method is by the rapid and massive TGRLP-induced accumulation of large Oil Red O-positive cytoplasmic lipid droplets that form after lysosomal hydrolysis and reesterification (Gianturco, S. H., et al., 1982 and 1988) (FIG. 26). Finally, the third method is b y uptake of TGRLP labeled with the lipid-
soluble fluorescent dye - When transfected cells are incubated with increasing concentrations of tryp-VLDL (Gianturco, S. H. et al., 1986) for 4 hours at 37° C. (FIG. 25A), apoB48R-transfected cells show a rapid and curvilinear accumulation of TG, indicating saturable R-mediated uptake. In contrast, vector-transfected cells show only linear, nonspecific uptake. Similar results were obtained in multiple experiments with tryp-VLDL devoid of apoE, chylomicrons containing apoB48 as the only apoB species, and HTG-VLDL containing apoB48 and apoB100, but no uptake was with normal VLDL containing apoB100 as the only detectable apoB species (FIG. 25B). G418-selected CHOs transfected with an apoB48R minigene containing the first intron show massive, rapid accumulation of large Oil Red O-positive lipid droplets when incubated for about 3 hours with tryp-VLDL devoid of apoE or with chylomicrons that contain apoB48 but not apoB100 (FIG. 26). This is not seen with CHOs containing vector alone.
- These experiments (each replicated 3 to 10 times) indicate by three alternative endpoints that the protein encoded b y this cDNA is sufficient to confer apoB48R activity on the transfected cells similar that observed in human monocyte-macrophages in ligand specificity and kinetics of uptake (Gianturco, S. H., et al., 1994c and 1998). These transfection studies demonstrate unequivocally that the apoB48R binds and internalizes TGRLP when out of the context of the macrophage, i.e., in the absence of other macrophage-specific proteins such as apoE or lipoprotein lipase that can enhance macrophage uptake of lipoproteins. Thus the apoB48-specific receptor activity, previously documented by both cell and ligand blotting studies in human blood-borne and THP-1 monocytes and macrophages, can indeed be attributed to this new and unique receptor protein encoded by this cDNA and not to a combination of other macrophage processes.
- ApoB48R and Atherosclerotic Plaques
- Excessive uptake of TGRLP by the apoB48R may promote atherosclerosis in vivo. To test this hypothesis, immunohistochemical studies were undertaken to determine if apoB48R is expressed in atherosclerotic plaques. Immunohistochemical staining used the same polyclonal antibodies against a domain of the apoB48R (amino acid 223 to 710) (27) which were used for immunoblotting (FIG. 24) and a labeled streptavidin-biotin kit (Nichirei Co., Tokyo) according to manufacturer's instruction. Paraffin sections were treated with xylene, then ethanol, and finally immersed in 0.3% H2O2 in methanol for 45 min to block endogenous peroxidase activity. All specimens were rinsed with phosphate buffered saline (PBS, pH 7.4) and incubated with 10% normal goat serum for 12 h at 4° C. The antibody used for staining was anti-apoB48R polyclonal rabbit IgG (1:1000) directed against the GST fusion protein linked to aa 223 to 710 of the apoB48R. Preimmune rabbit IgG was used as a negative control. To detect macrophages in atherosclerotic lesions, a monoclonal antibody against human macrophages was used (HAM56; Dako, Glostrup, Denmark). The specimens were incubated overnight with each primary antibody, rinsed 3× with PBS, and incubated with a biotinylated horse anti-mouse or anti-rabbit IgG for 30 min at room temperature. The specimens were rinsed 3 times with PBS, incubated with peroxidase-conjugated streptavidin for 30 min and visualized using a 3-amino-9-ethylcarbazole (AEC) substrate (Nichirei, Tokyo), and stained with hematoxylin.
- FIG. 27 shows representative serial sections of a carotid artery atheroma. The macrophage-specific monoclonal antibody HAM56 identifies macrophages and macrophage foam cells around the lipid core. Anti-apoB48R IgGs bind to macrophages and foam cells on the shoulder of the plaque. Preimmune IgGs do not bind to any cells in the lesion. Foam cells in early, aortic fatty streak lesions as well as in more advanced coronary lesions were also apoB48R-positive (35), supporting the possibility that the apoB48R may contribute to foam cell formation and atherogenesis in vivo.
- The present invention discloses the ligand for a novel receptor and identification of the minimal requirements for receptor binding. Therefore, this invention describes means by which agents can be delivered to specific cells expressing the receptor or means b y which the entry of ligands may be regulated for therapeutic use. Triglyceride-rich lipoprotein ligands of this receptor, in addition to causing lipid accumulation in monocytes and macrophages, cause increased monocyte adhesion to endothelial cells in vitro—a potentially atherogenic effect—by inducing the expression of adhesion molecules on both endothelial cells and on monocytes; cause phenotypic conversion of endothelial cells into multinucleated giant cells, like those found over human coronary atherosclerotic lesions; impair endothelial cell-mediated fibrinolysis; and induce enhanced expression of tissue factor mRNA and antigen in endothelial cells and monocytes, a prothrombotic effect.
- Lipoproteins bind to this receptor via an apoB domain within the amino-terminal region. Competitive cell and ligand blotting studies demonstrate that anti-apoB, but not anti-apoE, anti-CII or nonimmune IgG, inhibit binding of triglyceride-rich lipoproteins both to THP-1s and to the receptor proteins. Lactoferrin (100 μg/ml), heparin (10 mg/ml), and the human receptor associated protein do not inhibit triglyceride-rich lipoprotein binding. In contrast, lipoprotein lipase, which is known to bind to an N-terminal domain of apoB (Choi et al., 1995), partially inhibits binding of triglyceride-rich lipoproteins in both cell and ligand blotting studies via its interaction with apoB. Plasma chylomicrons Sf1100-3200 (4 h postprandial) that contain apoB-48 as the only apoB species bind specifically to the receptor proteins, and this can be inhibited b y anti-apoB antibodies. Lipolysis of these Sf>1,100 apoB-48 particles diminishes binding to the receptor particles proteins (MBP200 and MBP235), while enhancing binding to the low density lipoprotein receptor. Smaller apoB-100 containing lipoprotein (intermediate density lipoprotein and low density lipoprotein) and normal very low density lipoprotein binding to the receptor on ligand blots can b e detected. Competitive binding studies in monocyte-macrophages and in ligand blots, however, indicate the binding is of lower affinity than that of hypertriglyceridemic triglyceride-rich lipoproteins of Sf>60 and chylomicrons and their remnants, since twenty- to forty-fold excess of these lipoproteins do not inhibit binding of the primary lipoprotein ligands (Gianturco, 1994). However, binding to MBP200 and MBP235 of low density lipoprotein that contains apoB-100 as the only detectable apo protein indicates that apoB is sufficient to mediate binding. These data strongly support that the monocyte-macrophage triglyceride-rich lipoprotein receptor-binding domain is within the N-terminal half of apoB corresponding to apoB-48 at or near the lipoprotein lipase binding domain and not in a heparin binding domain. These data also suggest that these receptors could account for the observed rapid peripheral macrophage uptake of plasma chylomicrons and represent a new apoB and monocyte-macrophage (and related cell type)-specific apoB receptor that is important in the nutrition of receptor-expressing cells, including circulating monocytes, accessible macrophages and placenta, especially in the postprandial state.
- Knowledge of the receptor-binding determinants in the natural ligands (and knowledge of the domain(s) in the receptor that bind the ligands, i.e., the ligand-binding domains) provides an individual having ordinary skill in this art with the knowledge to design agents for the cell-specific delivery of drugs, vitamins, genes, enzymes, hormones, cytokines, growth factors, or inhibitors to cells expressing the receptor, including monocytes, macrophages, endothelial cells, placental cells, astrocytes, and the tissues which contain these cells, including bone marrow, blood vessels, spleen, lymph nodes, tonsils, appendix, thymus, liver, placenta, brain. For example, determination of the minimal peptide sequence sufficient to bind to the receptor and determination of the domain in the receptor which binds the ligand can be used to design synthetic peptides for incorporation in liposomes containing the desired chemical, enzyme, or gene. Alternatively, the agent could be directly linked to the peptide or to antibodies against the receptor. Such strategies could be useful for: (1) the treatment of monocytic leukemia; (2) the treatment of tuberculosis and other diseases, such as leprosy, caused by pathogenic mycobacteria, which require uptake by macrophages for pathogenesis (Schorey et al., 1997); (3) the treatment of AIDS, since HIV is harbored in macrophages after eradication from lymphocytes; (4) the inhibition or enhancement of angiogenesis (to inhibit angiogenesis in tumors or to promote angiogenesis in wound healing or after infarcts); (5) the inhibition or enhancement of fibrinolysis to promote clot formation or dissolution; (6) enhancement or inhibition of tissue factor production; and (7) the delivery of agents to the developing embryo. Conversely, synthetic agents which bind to the receptor and block or inhibit lipoprotein or other ligand binding to the receptor may also be useful in preventing excess uptake of lipoproteins/ligands via this route, thereby inhibiting foam cell formation and increased monocyte adhesion to endothelial cells, and decreasing inhibition of fibrinolysis by VLDL and inhibition of uptake of lipoprotein-soluble agents that are pathogenic for a specific cell or tissue, etc. Receptor mutations may be associated with specific dyslipidemias or abnormal postprandial triglyceride metabolism, which in turn are linked to increased risk of cardiovascular disease. Tests for receptor structure/function could be used to identify subjects at increased risk due to receptor defects. Abnormalities in the ligands of the receptor could also lead to defective or enhanced binding and uptake via this receptor and may also be predictive of increased disease risk. Receptor abnormalities may be involved in placental pathologies.
- The following references were cited herein:
- Assmann G, et al.,Am J Card, 1992;70:733-737.
- Austin M.,Arteriosclerosis and Thrombosis, 1991; 11:2-14.
- Ausubel.Current Protocols in Molecular Biol. NY: Wiley & Sons, 1987.
- Bartlett G R.,J Biol Chem, 1959;234:466-468.
- Basu S K, et al.,J Cell Biol, 1977;74:119-135.
- Beisiegel U, et al.,Nature, 1989;341:162-164.
- Beisiegel U, et al.,Proc Natl Acad Sci USA, 1991;88:8342-8346.
- Bergeron N, et al., Simultaneous Quantification of apoB-100, apoB-48 and apoE separated by SDS-PAGE. In: Gianturco SH, et al., eds.,Methods in Enzymology. Orlando, Fla.: Academic Press, 1995.
- Bersot T P, et al.,J Clin Invest, 1986;77:622-630.
- Bilheimer D W, et al.,Biochim Biophys Acta, 1972;250:212-221.
- Bordier C.J Biol Chem., 1985;256:1604-1607.
- Boyum A.,Scand J Clin Lab Invest, 1968;21:77-89.
- Bradford M M.Analytical Biochem., 1976;72:248-254.
- Bradley W A, et al.,J Biol Chem, 1984;259:14728-14735.
- Bradley W A, et al.,J Lipid Research, 1986;27:40-48.
- Bradley W A, et al., Triglyceride Rich Lipoproteins and Endothelial Cell Fibrinolysis. P Stein, et al. (eds.) In:Atherosclerosis IX: Proceedings of the Ninth International Symposium on Atherosclerosis. Tel Aviv, Israel, R & L Creative Commun. Ltd., 527-530, 1992.
- Bradley W A, et al., Triglyceride Rich Lipoprotein Structure, Function, and Metabolism: Role in Coronary Heart Disease. RA Kreisberg, (eds.) In:Plasma Lipoproteins and Coronary Artery Disease Cambridge, Mass., Blackwell Scientific Pub., Inc., 151-173, 1992.
- Bradley W A, et al.,Atherosclerosis, 108:S31-S39, 1994.
- Bradley W A, et al.,J. Internal Med. 236:33-39, 1994.
- Bradley W A et al.,Circulation, 92(8):I-691, 1995.
- Bradley W A, et al., AHA (Submitted), 1996
- Breslow J. L.,Science 272, 685 (1996).
- Brown M S, et al.,Ann Rev Biochem, 1983;52:223-261.
- Brown, M. S., et al.,Science 232, 34, 1986.
- Brown S A, et al.,Biochem Biophys Res Comm, 1986;139:333-340.
- Brunzell J D, et al.,Metabolism, 1976;25(3):313-320.
- Bryne CD, et al.,Arteriosclerosis and Thrombosis, and Vascular Biology, 1995; 15:65-70.
- Burger, Monocytes and macrophages,Nature, 1970;227:170-171.
- Carlson L A, et al.,Lancet, 1972;1:865-868.
- Catapano A L, et al.,J Biol Chem, 1979;254:1007-1009.
- Chappel D A, et al.,J Biol Chem., 1993;268:14168-14175.
- Cheung M C, et al.,J Biol Chem, 1984;259:12201-12209.
- Choi S Y, et al.,J Biol Chem., 1995;270:8081-8086.
- Cribbs L L, et al.,J Biol Chem, 1989;264:10672-10678.
- D'Andrea A D, et al.,Cell, 1989;57(2):277-285.
- Daniel O D, et al.,J Biol Chem, 1983;258:4606-4611.
- Eisenberg S, et al.,Arteriosclerosis, 1988;8:480-487.
- Eisenberg S, et al.,J Clin Invest, 1992;90:2013-2021.
- Farese, R. V. Jr., et al.,Proc. Natl. Acad. Sci. USA 92, 1774 (1995).
- Farese, R. V. Jr. et al.,Proc. Natl. Acad. Sci. USA 93, 6393 (1996).
- Faggiotto A, et al.,Arteriosclerosis, 1984;4:341-356.
- Fickett J W.,Nucleic Acids Res, 1982;10:5303-5318.
- Fielding C J, et al.,J Biol Chem, 1979;254:8861-8868.
- Fredrickson D S, et al., The familial hyperlipoproteinemias. In: Stanbury et al., eds. Themetabolic basis of inherited diseases. NY: McGraw-Hill, 1978:604-655.
- Freedman A S, et al.,Science, 1990;249:1030-1033.
- Gerrity R G.,Am J Path, 1981;103:181-190.
- Gianturco S H, et al.,J Clin Invest, 1978;61:320-328.
- Gianturco S H, et al.,Lipids, 1980a;15:456-463.
- Gianturco S. H., et al.,Biochim. Biophys. Acta. 618, 143 (1980b).
- Gianturco S H, et al.,J Lipid Res, 1982a;23:984-993.
- Gianturco S H, et al.,J Clin Invest, 1982b;70:168-178.
- Gianturco S H, et al.,J Biol Chem, 1983;258:4526-4533.
- Gianturco S H, et al.,J Lipid Res, 1986a;27:412-420.
- Gianturco S H, et al., The role of apolipoprotein processing in receptor recognition. In: Segrest et al., eds.Methods in enzymology. NY: Academic Press, Inc., 1986b:319-344.
- Gianturco S H, et al.,J Clin Invest, 1988;82(5):1633-1643.
- Gianturco S H, et al.,Current Opinion in Lipidology, 1991;2:324-328.
- Gianturco S H, et al.,J Lipid Res, 1994;35:1674-1687.
- Gianturco S H, et al., A Cellular Basis for the Atherogenicity of Triglyceride-Rich Lipoproteins inAtherosclerosis Reviews, Raven Press, Ltd. A. Gotto Jr. (eid) 22:9-14, 1991.
- Gianturco S H, et al.,Ann. Nutr. Metab. 36:349-350, 1992.
- Gianturco S H, et al.,Arterioscl. and Thromb., 13(4):472-481, 1993.
- Gianturco S H, et al., Atherogenicity of Triglyceride-Rich Lipoproteins: Cellular Aspects. Catapano, et al. (eds.) InDrugs Affecting Lipid Metabolism, The Netherlands, Kluwer Acad. Pub., 447-451, 1993.
- Gianturco S H, et al.,Cur Opin in Lipidology, 5(5):313-315, 1994a.
- Gianturco S H, et al.,Atherosclerosis X,109:260, 1994b.
- Gianturco, S. H., et al.,J. Lipid Res. 35, 1674, 1994c.
- Gianturco S H, et al., Interactions of Triglyceride-rich Lipoprotein Particles with the Arterial Wall, In:Excerpta Medica: Proceedings of the Xth International Symposium on Atherosclerosis, Elsevier Science, The Netherlands.
- Gianturco S H, and Bradley W A, Current Opinion Lipidology,Atherosclerosis: Cell biology and lipoproteins, 1995a.
- Gianturco S H et al.,Circulation, 92(8):I-690, 1995b.
- Gianturco S. H., et al.,Arteriosclerosis, Thrombosis, and Vascular Biology 18, 968 (1998).
- Ginsburg G S, et al.,J Biol Chem, 1984;259:6667-6673.
- Gladson C L, et al.,Amer J Path, 1995;
- Goldstein J L, et al.,J Biol Chem, 1974;249:5153-5162.
- Goldstein J L, et al.,Ann Rev Biochem, 1977;46:897-930.
- Goldstein J L, et al.,Proc Natl Acad Sci USA, 1979;76:333-337.
- Goldstein J L, et al.,J Biol Chem, 1980;255:1839-1848.
- Goldstein J L, et al., Familial hypercholesterolemia. In: Stanbury J B, Wyngaarden J B, Fredrickson D S, eds.The metabolic basis of inherited disease. NY: McGraw-Hill, 1983:672-712.
- Gossen M, et al.,Proc Natl Acad Sci USA, 1992;89:5547-5551.
- Grundy S M, et al.,Seminars in Thrombosis and Hemostasis, 1988;14(2):149-164.
- Habeeb AF.,Analytical Biochemistry, 1966;14:328-336.
- Hara H, et al.,Biochem Biophys Res Comm, 1987;146(2):802-808.
- Havel, R. J.,
Arteriosclerosis 5, 569 (1985). - Helenius A, et al.,Biochemistry, 1971;10:2542-2547.
- Henikoff S.,Gene, 1984;28(3):351-359.
- Henikoff S.,Methods in Enzymology, 1987; 155:156-165.
- Hokanson, J. E. et al.,J. Cardiovascular Risk, 1996; 213.
- Huang L. S. et al.,J. Clin. Invest. 96(5), 2152 (1995).
- Hui D Y, et al.,J Biol Chem, 1984;259:15060-15068.
- Hussain M., et al.,J Biol Chem,1989;264:9571-9582.
- Hussain M., et al.,J Biol Chem, 1989;264:17931-17938.
- Karlin J B, et al., Immunological heterogeneity of human apolipoprotein E as measured by radioimmunoassay. In: Lippel K, ed.Proceedings of the workshop on apolipoprotein quantification. Washington, D.C.: NIH, 1983:212-221.
- Kates M.Techniques of lipidology. NY: Holland/Amer. Elsevier, 1972.
- Khoo J C, et al.,J Biol Chem, 1981;256:7105-7108.
- Kleinman Y, et al.,J Lipid Res, 1988;29:729-743.
- Kodama T, et al.,Proc Natl Acad Sci USA, 1988;85:9238-9242.
- Kodama T, et al.,Nature, 1990;343:531-535.
- Kowal R C, et al.,J Biol Chem, 1990;265:10771-10779.
- Kowal R C, et al.,Proc Natl Acad Sci USA, 1989;86:5810-5814.
- Krauss R M.,Cur Opin in Lipidology, 1994;5:339-349.
- Krul E S, et al.,J Clin Invest, 1985;75:361-369.
- Laemmli U K.Nature., 1970;227:680-685.
- Lang I, et al.,Circulation, 1994;89:2715-2721.
- Lang I, et al.,Circulation,1994;90(2):706-712.
- Lindgren F T, et al., The isolation and quantitative analysis of lipoproteins in blood lipids and lipoproteins. In: Nelson GJ, ed.Blood lipids and lipoproteins. New York: Wiley interscience, 1972:181-274.
- Lindqvist P, et al.,J Biol Chem, 1983;258:9086-9092.
- Lowry O H, et al.,J Biol Chem., 1951;193:265-275.
- Maurice receptor, et al.,J Lipid Res, 1989;30:587-596.
- Maxam A M, et al.,Methods in Enzymology, 1980;65(1):499-560.
- Means G E, et al.,Chemical modification of proteins. Holden Day, Inc., 1971.
- Mellman, R.Annual Review Cell Development Biology 12, 575 (1996).
- Miller K W, et al.,Biochemistry, 1983;22:443-451.
- Milne R W, et al.,J Clin Invest, 1984;73:816-823.
- Milne receptor, et al.,J Biol Chem, 1989;264:19754-19760.
- Moestrup S K, et al.,Exp Cell Res, 1990;190:195-203.
- Morrisett J D, et al.,American Oil Chemists
Society Monograph # 4. Champaign, Ill.: A.O.C.S. Pub., 1977:139-161. - Mulder M, et al.,Biochem Biophys Res Com, 1992;185:582-587.
- Mulder M, et al.,J Biol Chem., 1993;268:9369-9375.
- Nagata Y, et al.,J Lipid Res, 1987;28:684-692.
- Nakashima et al.,Arteriosclerosis and Thrombosis, 1994;14:133-140.
- Nordestgaard B G, et al.Cur Opin Lipidology, 1994;5:252-257.
- Novitsky T. Choosing a method. In: Novitsky T, ed.
LAL update 1. 1983:1-3. - Nykjaer A, et al.,J Biol Chem, 1993;268:15048-15055.
- O'Hara O, et al.,Proc Natl Acad Sci USA, 1989;86(15):5673-5677.
- O'Shannessy D J, et al.,Immunology Letters., 1984;8:273-277.
- Ostlund-Lindqvist A M, et al.,Arteriosclerosis, 1983;3:433-440.
- Parker F, et al.,J Clin Invest, 1970;49:2172-2187.
- Parks J M, et al.,Circulation, 88(4-2):1227A, 1993.
- Phillips N R, et al.,Circulation, 1993;88:2762-2770.
- Plump A S, et al.,Cell, 1992;71:343-353.
- Ramprasad M P, et al.,Circulation, 86(4):2434, 1992.
- Ramprasad M P, et al.,Circulation, 90(4):I-2, 1994.
- Ramprasad M P et al.,Biochem., 1995a;34:9126-9135.
- Ramprasad et al.,Biochem. Biophys. Res. Comm.,1995b;210:491-497.
- Rapp J H, et al.,Arteriosclerosis and Thrombosis, 1994;14:1767-1774.
- Reddick R L, et al.,Arteriosclerosis and Thrombosis, 1994;14:141-147.
- Ross C A, et al.,J Lipid Res, 1977;18:169-181.
- Rumsey S C, et al.,J Clin Invest., 1992;90:1504-1512.
- Sacks F M, et al.,Arteriosclerosis, 1987;7:35-46.
- Sambrook J, et al.,Molecular cloning: A laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989.
- Sanger F, et al.,Proc Natl Acad Sci USA, 1977;74:5463-5467.
- Schaefer E J, et al.,Sem Thromb Hem, 1988;14:143-148.
- Schneider W J, et al.,J Biol Chem, 1982;257:2664-2673.
- Schonfeld G, et al.,J Clin Invest, 1979;64:1288-1297.
- Schorey J S et al.,Science, 1997,277:1091-3.
- Sehayek E, et al.,Cur Opin Lipidology, 1994;5:350-353.
- Shen B W, et al.,Proc Natl Acad Sci USA, 1977;74:837-841.
- Sparrow C P, et al.,J Lipid Res, 1988;29:745-753.
- Strickland D K, et al.,J Biol Chem, 1990;265:17401-17404.
- Takahashi S, et al.,Proc Natl Acad Sci USA, 1992;89:9252-9256.
- Takahashi S, et al.,Circulation, 1994;90:I-2.
- Tarpey, Monocytes and macrophages, Am. Lung Association, 1993.
- Terce F, et al.,Arteriosclerosis, 1985;5:201-211.
- van Berkel T J C, et al.,Cur Opin Lipidology, 1994;5:331-338.
- van Berkel T J C, et al.,Biochem J., 1995;310:359-360.
- Varma V K, et al.,Circulation, 86(4):2192, 1992.
- Via D P, et al.,J Lipid Res, 1989;30:1515-1524.
- Via D P, et al.,J Biol Chem, 1985;260:7379-7386.
- Wang-Iverson P, et al.,Bioc. Biophys Res Comm, 1985;126:578-586.
- Weintraub M S, et al.,J Clin Invest 1987;79:1110-1119.
- Williams K J, et al.,J Biol Chem, 1992;267:13284-13292.
- Yang C, et al.,Nature, 1986;323:738-742.
- Yokoyama C, et al.,Cell, 1993;75:187-197.
- Zhang S H, et al.,Science, 1992;258:468-471.
- Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. These patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
- One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present examples along with the methods, procedures, treatments, molecules, and specific compounds described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.
-
-
1 22 1 3773 DNA Homo sapien ApoB48R cDNA sequence 1 gcggccgcgt ctaccgcggc cgcgtctacg acagacagga tggacttcct ccggctatac 60 ctccctgggc tgcaccaggc cttgaggggg gcactggatt ccctcggcac ctttgtctcc 120 tacctcctgg gagatgcagt ccccactgta gagcgggagg cgcaggcggc tgaggaactg 180 ggggtggtgg cggtgggaaa gacagggaag attgtagagg aggaagccca ggaggacctg 240 gagggcctta gaggcagcca aaacgagggg gctggaaggc tgagagggcc tggagatgac 300 agaagacatg aagtggggag ctcagctgta gaacagacct ggggctgggg agatggcagc 360 tcccatgggt cccaagcaga gaggcaggac agtggggctg gggagacagc caaggctgcc 420 aggtgccagg agccaagcgc ccacttggag gccagaaaga aatccaaggc agggtctggg 480 gcttgccaag acaggagcgg ccaagcccag gagaggcagg agtcccatga gcaggaagtg 540 aacagagagg agaggctgag aagctgggaa caggaggagg aggaggaaga ggtcagggca 600 agggagccag ggatggccag aggggcggag tcagagtgga cctggcatgg ggagacggag 660 gggaaggctg gtgctgttgg gccaaaggcg gcaggggaca accgggagat ggagcagggg 720 gtcagggagg cagatgcagg ggaaactgag gagcctgggg ccgaaggggc tgggaaagga 780 gaagaggtgg tagtggtgga gaaggcctgt gaaagcacta gggcatgggg gacgtggggc 840 ccaggggcag agcctgagga ctggggaatc ttaggcagag aggaggccag gacaacccca 900 ggtagggaag aggccagggc aattttagat ggggaggaag ccaggacaat ctcaggcggg 960 gaggaggctg agacagcctc aggcggggag gaggctgaaa cagcctcagg cggggaggag 1020 gccgggacag cctcgggagg ggaggaggcc gggatatcct caggcgggga ggctgggaca 1080 gcctcaggag gggaggaggc cgggacagcc tctggagggg acgaggcctg gacaacctca 1140 ggcaaagagg aggctgacct gctgggagtc agacagactc aatatggagc agttccagga 1200 gaaaggctcc tagaggctac tggaaaagtc tgggtcctag aggaggaggg ggatgaggag 1260 agagaggctg aggtgagccc tttccccaaa caggcccagg tcctgggcac tgaaagaaca 1320 gaagaggctg ctgagagcca gaccgcaggg agggaagctg tgggaggcca ggaggcaggg 1380 gagagctttg agggccaggt agacctgcgt ggtaaggagg ctgagatgag gcaggacttg 1440 gggatcaggg ccgaccgggc caagatggaa gagctggtac aggcagagga ggcccaggag 1500 gagagaggga gcagcaggga tccagtggct gagctgccct cagatggaga ggctgaaggc 1560 actgccgact tggaggcaac tccagaggcc aggcctgagg aggagctcac aggggaggag 1620 agtgaggcgg cccagactag ctgtggccta ctgggcgtgg aatggggtgg cctcacacac 1680 agcgtcacca aaggccaggg acctgagctg atggggggtg cccagacccc aactaagcaa 1740 cccgaggaaa gggaggcagg ggaggtggag ctcatgggag ttctggccct gagcaaagag 1800 gagcaggaga ggagcctgga ggcaggtccc aggcacgcgg ggtctgtaaa gcctgaggcc 1860 tccgaggcct tcccaggagc ctgggaaaac cgcacgagaa aggacatgga gagaggaaat 1920 actcaggagg atgcggccga tggcgagcag cgggaggagg aggagactgc gggaggccag 1980 accctggcgg ctgaggctga aggagaccga gagtctgaac tatcagaagt cccagaggca 2040 ggcggggagg ggctgacaac ccaggacgcg ggatgtggaa ctgaggaggg agaggcatct 2100 gtctcagaga accaggagct ggacggaagc acaggggcag acgcagggcc ttgcccgtca 2160 ctgggagagg cctatgccag agaaactgag gatgaggagg cggaggctga cagaacatcc 2220 agaagaggct ggaggctgca agcggtggct gtgggcctcc cggaccgtga ggatgcacag 2280 actggctctg tggctgctgg gattatgggg ggtgatgtgg tcccacacat cagcgctgct 2340 ggcgctggtg aagctttgga aggggcgctt gggcaaggct gggactcgaa agaaaaggaa 2400 gaggcagcag caggagagca tgcaggtggg caagaatttg gtctggaggg ctcagcagag 2460 gaagaggtga ctggcagagg cagccaagta gaggcttttg agtccaggga gggaggacct 2520 tggggagggc gggtagaggc cgaggaatct gcaggcgcag aggacagctg tgggctggat 2580 cccgcgggct cccagacagc gagggcagag gggatgggag ccatggtgga ggctgggggg 2640 cttctagaaa agtggacgct gttggaagaa gaggctgttg gatggcagga gagagaacag 2700 agggaagaca gtgaggggcg gtgtggggac taccaccctg agggagaggc accaaggctc 2760 cttgatgcag agggtctcat ggtgaccggg ggccggaggg cagaggccaa ggagactgag 2820 ccagaaagcc tggaacatgt caggggccag gaggagcagc caacacacca ggcccctgca 2880 gaagctgcgc cggagtcagt cggggaagcc gagacggctg aggccatggg cagtgccaga 2940 ggaggtgctg ccaacagctg gagcgaggcc ccgctccccg ggtccctcct agacgtctct 3000 gtcccaagga gtcgcgtgca cctctcgaga agctcctcac agcgtcgctc ccggccctct 3060 tttcgtcgga ctccggcctg ggagcagcag gaggagcccc cagcccccaa ccctcctgag 3120 gaggagctgt cagctcctga gcagagaccc ctccagctgg aggaacccct ggagccaagc 3180 cctctgaggc atgatgggac cccggtgcca gccaggagaa ggcccctggg acacgggttt 3240 ggcctcgcgc accctggcat gatgcaggag ctgcaagccc gtctgggccg gcctaagccc 3300 cagtgactga gacccggtgc tctgggagcc aggccctgag tgggtgccag aaggcttgct 3360 ccaatgccac tgagccctgc tccctctgcc actgtggaca catcctctcc accctctggg 3420 cctcagtgtc ttgatgtatc attcatggag caggcaaaac cagacgtctg ggaataccgt 3480 gaacttaagg agtctgattc tccgacacag gctggtggac cacctacccc actgagacca 3540 cctctcaggg tgcctgccct ggttcctccc cagcctgagt cagctgtctg gactgcaagg 3600 aggctgggca cgggggctca cgcctgtcac cccagagctt tgggaggcca aggtgggagg 3660 atcgcttgag accaggagtt cgagaccagc ctgggcagca tagcaagatc cccatctttt 3720 aaaaacaaaa taaaacaata aagactgcaa ggaaaaaaaa aaaaaaaaaa aaa 3773 2 1088 PRT Homo sapien 2 Met Asp Phe Leu Arg Leu Tyr Leu Pro Gly Leu His Gln Ala Leu 5 10 15 Arg Gly Ala Leu Asp Ser Leu Gly Thr Phe Val Ser Tyr Leu Leu 20 25 30 Gly Asp Ala Val Pro Thr Val Glu Arg Glu Ala Gln Ala Ala Glu 35 40 45 Glu Leu Gly Val Val Ala Val Gly Lys Thr Gly Lys Ile Val Glu 50 55 60 Glu Glu Ala Gln Glu Asp Leu Glu Gly Leu Arg Gly Ser Gln Asn 65 70 75 Glu Gly Ala Gly Arg Leu Arg Gly Pro Gly Asp Asp Arg Arg His 80 85 90 Glu Val Gly Ser Ser Ala Val Glu Gln Thr Trp Gly Trp Gly Asp 95 100 105 Gly Ser Ser His Gly Ser Gln Ala Glu Arg Gln Asp Ser Gly Ala 110 115 120 Gly Glu Thr Ala Lys Ala Ala Arg Cys Gln Glu Pro Ser Ala His 125 130 135 Leu Glu Ala Arg Lys Lys Ser Lys Ala Gly Ser Gly Ala Cys Gln 140 145 150 Asp Arg Ser Gly Gln Ala Gln Glu Arg Gln Glu Ser His Glu Gln 155 160 165 Glu Val Asn Arg Glu Glu Arg Leu Arg Ser Trp Glu Gln Glu Glu 170 175 180 Glu Glu Glu Glu Val Arg Ala Arg Glu Pro Gly Met Ala Arg Gly 185 190 195 Ala Glu Ser Glu Trp Thr Trp His Gly Glu Thr Glu Gly Lys Ala 200 205 210 Gly Ala Val Gly Pro Lys Ala Ala Gly Asp Asn Arg Glu Met Glu 215 220 225 Gln Gly Val Arg Glu Ala Asp Ala Gly Glu Thr Glu Glu Pro Gly 230 235 240 Ala Glu Gly Ala Gly Lys Gly Glu Glu Val Val Val Val Glu Lys 245 250 255 Ala Cys Glu Ser Thr Arg Ala Trp Gly Thr Trp Gly Pro Gly Ala 260 265 270 Glu Pro Glu Asp Trp Gly Ile Leu Gly Arg Glu Glu Ala Arg Thr 275 280 285 Thr Pro Gly Arg Glu Glu Ala Arg Ala Ile Leu Asp Gly Glu Glu 290 295 300 Ala Arg Thr Ile Ser Gly Gly Glu Glu Ala Glu Thr Ala Ser Gly 305 310 315 Gly Glu Glu Ala Glu Thr Ala Ser Gly Gly Glu Glu Ala Gly Thr 320 325 330 Ala Ser Gly Gly Glu Glu Ala Gly Ile Ser Ser Gly Gly Glu Ala 335 340 345 Gly Thr Ala Ser Gly Gly Glu Glu Ala Gly Thr Ala Ser Gly Gly 350 355 360 Asp Glu Ala Trp Thr Thr Ser Gly Lys Glu Glu Ala Asp Leu Leu 365 370 375 Gly Val Arg Gln Thr Gln Tyr Gly Ala Val Pro Gly Glu Arg Leu 380 385 390 Leu Glu Ala Thr Gly Lys Val Trp Val Leu Glu Glu Glu Gly Asp 395 400 405 Glu Glu Arg Glu Ala Glu Val Ser Pro Phe Pro Lys Gln Ala Gln 410 415 420 Val Leu Gly Thr Glu Arg Thr Glu Glu Ala Ala Glu Ser Gln Thr 425 430 435 Ala Gly Arg Glu Ala Val Gly Gly Gln Glu Ala Gly Glu Ser Phe 440 445 450 Glu Gly Gln Val Asp Leu Arg Gly Lys Glu Ala Glu Met Arg Gln 455 460 465 Asp Leu Gly Ile Arg Ala Asp Arg Ala Lys Met Glu Glu Leu Val 470 475 480 Gln Ala Glu Glu Ala Gln Glu Glu Arg Gly Ser Ser Arg Asp Pro 485 490 495 Val Ala Glu Leu Pro Ser Asp Gly Glu Ala Glu Gly Thr Ala Asp 500 505 510 Leu Glu Ala Thr Pro Glu Ala Arg Pro Glu Glu Glu Leu Thr Gly 515 520 525 Glu Glu Ser Glu Ala Ala Gln Thr Ser Cys Gly Leu Leu Gly Val 530 535 540 Glu Trp Gly Gly Leu Thr His Ser Val Thr Lys Gly Gln Gly Pro 545 550 555 Glu Leu Met Gly Gly Ala Gln Thr Pro Thr Lys Gln Pro Glu Glu 560 565 570 Arg Glu Ala Gly Glu Val Glu Leu Met Gly Val Leu Ala Leu Ser 575 580 585 Lys Glu Glu Gln Glu Arg Ser Leu Glu Ala Gly Pro Arg His Ala 590 595 600 Gly Ser Val Lys Pro Glu Ala Ser Glu Ala Phe Pro Gly Ala Trp 605 610 615 Glu Asn Arg Thr Arg Lys Asp Met Glu Arg Gly Asn Thr Gln Glu 620 625 630 Asp Ala Ala Asp Gly Glu Gln Arg Glu Glu Glu Glu Thr Ala Gly 635 640 645 Gly Gln Thr Leu Ala Ala Glu Ala Glu Gly Asp Arg Glu Ser Glu 650 655 660 Leu Ser Glu Val Pro Glu Ala Gly Gly Glu Gly Leu Thr Thr Gln 665 670 675 Asp Ala Gly Cys Gly Thr Glu Glu Gly Glu Ala Ser Val Ser Glu 680 685 690 Asn Gln Glu Leu Asp Gly Ser Thr Gly Ala Asp Ala Gly Pro Cys 695 700 705 Pro Ser Leu Gly Glu Ala Tyr Ala Arg Glu Thr Glu Asp Glu Glu 710 715 720 Ala Glu Ala Asp Arg Thr Ser Arg Arg Gly Trp Arg Leu Gln Ala 725 730 735 Val Ala Val Gly Leu Pro Asp Arg Glu Asp Ala Gln Thr Gly Ser 740 745 750 Val Ala Ala Gly Ile Met Gly Gly Asp Val Val Pro His Ile Ser 755 760 765 Ala Ala Gly Ala Gly Glu Ala Leu Glu Gly Ala Leu Gly Gln Gly 770 775 780 Trp Asp Ser Lys Glu Lys Glu Glu Ala Ala Ala Gly Glu His Ala 785 790 795 Gly Gly Gln Glu Phe Gly Leu Glu Gly Ser Ala Glu Glu Glu Val 800 805 810 Thr Gly Arg Gly Ser Gln Val Glu Ala Phe Glu Ser Arg Glu Gly 815 820 825 Gly Pro Trp Gly Gly Arg Val Glu Ala Glu Glu Ser Ala Gly Ala 830 835 840 Glu Asp Ser Cys Gly Leu Asp Pro Ala Gly Ser Gln Thr Ala Arg 845 850 855 Ala Glu Gly Met Gly Ala Met Val Glu Ala Gly Gly Leu Leu Glu 860 865 870 Lys Trp Thr Leu Leu Glu Glu Glu Ala Val Gly Trp Gln Glu Arg 875 880 885 Glu Gln Arg Glu Asp Ser Glu Gly Arg Cys Gly Asp Tyr His Pro 890 895 900 Glu Gly Glu Ala Pro Arg Leu Leu Asp Ala Glu Gly Leu Met Val 905 910 915 Thr Gly Gly Arg Arg Ala Glu Ala Lys Glu Thr Glu Pro Glu Ser 920 925 930 Leu Glu His Val Arg Gly Gln Glu Glu Gln Pro Thr His Gln Ala 935 940 945 Pro Ala Glu Ala Ala Pro Glu Ser Val Gly Glu Ala Glu Thr Ala 950 955 960 Glu Ala Met Gly Ser Ala Arg Gly Gly Ala Ala Asn Ser Trp Ser 965 970 975 Glu Ala Pro Leu Pro Gly Ser Leu Leu Asp Val Ser Val Pro Arg 980 985 990 Ser Arg Val His Leu Ser Arg Ser Ser Ser Gln Arg Arg Ser Arg 995 1000 1005 Pro Ser Phe Arg Arg Thr Pro Ala Trp Glu Gln Gln Glu Glu Pro 1010 1015 1020 Pro Ala Pro Asn Pro Pro Glu Glu Glu Leu Ser Ala Pro Glu Gln 1025 1030 1035 Arg Pro Leu Gln Leu Glu Glu Pro Leu Glu Pro Ser Pro Leu Arg 1040 1045 1050 His Asp Gly Thr Pro Val Pro Ala Arg Arg Arg Pro Leu Gly His 1055 1060 1065 Gly Phe Gly Leu Ala His Pro Gly Met Met Gln Glu Leu Gln Ala 1070 1075 1080 Arg Leu Gly Arg Pro Lys Pro Gln 1085 3 631 DNA Homo sapien 3 aagctgttgt atgggtcaga gaaactgagg atgaggaggc ggaggctgac agaacatcca 60 gaagaggctg gaggctgcaa gcggtggctg tgggcctccc ggaccgtgag gatgcacaga 120 ctggctctgt ggctgctggg attatggggg gtgatgtggt cccacacatc agcgctgctg 180 gccgtggtga agctttggaa ggggcgcttg ggcaaggctg ggactcgaaa gaaaaggaag 240 aggcagcagc aggagagcat gcaggtgggc aagaatttgg tctggagggc tcagcagagg 300 aagaggtgac tggcagaggc agccaagtag aggcttttga gtccagggag ggaggacctt 360 ggggagggcg ggtagaggcc gaggaatctg caggcgcaga ggacagctgt gggctggatc 420 ccgcgggctc ccagacagcg agggcagagg ggatgggagc catggtggag gctggggggc 480 ttctagaaaa gtggacgctg ttggaagaag aggctgttgg atggcaggag agagaacaga 540 gggaagacag tgaggggcgg tgtggggact accaccctga gggagaggca ccaaggctcc 600 ttgatgcaga gggactcatg gtgacggggg g 631 4 209 PRT Homo sapien 4 Ala Val Val Trp Val Arg Glu Thr Glu Asp Glu Glu Ala Glu Ala 5 10 15 Asp Arg Thr Ser Arg Arg Gly Trp Arg Leu Gln Ala Val Ala Val 20 25 30 Gly Leu Pro Asp Arg Glu Asp Ala Gln Thr Gly Ser Val Ala Ala 35 40 45 Gly Ile Met Gly Gly Asp Val Val Pro His Ile Ser Ala Ala Gly 50 55 60 Arg Gly Glu Ala Leu Glu Gly Ala Leu Gly Gln Gly Trp Asp Ser 65 70 75 Lys Glu Lys Glu Glu Ala Ala Ala Gly Glu His Ala Gly Gly Gln 80 85 90 Glu Phe Gly Leu Glu Gly Ser Ala Glu Glu Glu Val Thr Gly Arg 95 100 105 Gly Ser Gln Val Glu Ala Phe Glu Ser Arg Glu Gly Gly Pro Trp 110 115 120 Gly Gly Arg Val Glu Ala Glu Glu Ser Ala Gly Ala Glu Asp Ser 125 130 135 Cys Gly Leu Asp Pro Ala Gly Ser Gln Thr Ala Arg Ala Glu Gly 140 145 150 Met Gly Ala Met Val Glu Ala Gly Gly Leu Leu Glu Lys Trp Thr 155 160 165 Leu Leu Glu Glu Glu Ala Val Gly Trp Gln Glu Arg Glu Gln Arg 170 175 180 Glu Asp Ser Glu Gly Arg Cys Gly Asp Tyr His Pro Glu Gly Glu 185 190 195 Ala Pro Arg Leu Leu Asp Ala Glu Gly Leu Met Val Thr Gly 200 205 5 13 PRT artificial sequence UNSURE Amino acid sequence of a fragment from peptide 29 from MBP protein; Xaa at position 1 is Glu, Leu or Ala; Xaa at position 2 is Ala or Leu; Xaa at position 3 is Gln, Val or Glu 5 Xaa Xaa Xaa Ala Glu Gly Leu Met Val Thr Gly Gly Arg 5 10 6 7 PRT artificial sequence UNSURE Amino acid sequence of a fragment from peptide 18 from MBP protein; Xaa at position 1 is Val or Glu; Xaa at position 2 is Ala or Leu 6 Xaa Xaa Val Met Gly Gln Met 5 7 751 DNA Homo sapien 7 gcggccgcgt ctaccgcggc cgcgtctacg acagacagga tggacttcct ccggctatac 60 ctccctgggc tgcaccaggc cttgaggggg gcactggatt ccctcggcac ctttgtctcc 120 tacctcctgg gagatgcagt ccccactgta gagcgggagg cgcaggcggc tgaggaactg 180 ggggtggtgg cggtgggaaa gacagggaag attgtagagg aggaagccca ggaggacctg 240 gagggcctta gaggcagcca aaacgagggg gctggaaggc tgagagggcc tggagatgac 300 agaagacatg aagtggggag ctcagctgta gaacagacct ggggctgggg agatggcagc 360 tcccatgggt cccaagcaga gaggcaggac agtggggctg gggagacagc caaggctgcc 420 aggtgccagg agccaagcgc ccacttggag gccagaaaga aatccaaggc agggtctggg 480 gcttgccaag acaggagcgg ccaagcccag gagaggcagg agtcccatga gcaggaagtg 540 aacagagagg agaggctgag aagctgggaa caggaggagg aggaggaaga ggtcagggca 600 agggagccag ggatggccag aggggcggag tcagagtgga cctggcatgg ggagacggag 660 gggaaggctg gtgctgttgg gccaaaggcg gcaggggaca accgggagat ggagcagggg 720 gtcagggagg cagatgcagg ggaaactgag g 751 8 1466 DNA Homo sapien 8 cgggagatgg agcagggggt cagggaggca gatgcagggg aaactgagga gcctggggcc 60 gaaggggctg ggaaaggaga agaggtggta gtggtggaga aggcctgtga aagcactagg 120 gcatggggga cgtggggccc aggggcagag cctgaggact ggggaatctt aggcagagag 180 gaggccagga caaccccagg tagggaagag gccagggcaa ttttagatgg ggaggaagcc 240 aggacaatct caggcgggga ggaggctgag acagcctcag gcggggagga ggctgaaaca 300 gcctcaggcg gggaggaggc cgggacagcc tcgggagggg aggaggccgg gatatcctca 360 ggcggggagg ctgggacagc ctcaggaggg gaggaggccg ggacagcctc tggaggggac 420 gaggcctgga caacctcagg caaagaggag gctgacctgc tgggagtcag acagactcaa 480 tatggagcag ttccaggaga aaggctccta gaggctactg gaaaagtctg ggtcctagag 540 gaggaggggg atgaggagag agaggctgag gtgagccctt tccccaaaca ggcccaggtc 600 ctgggcactg aaagaacaga agaggctgct gagagccaga ccgcagggag ggaagctgtg 660 ggaggccagg aggcagggga gagctttgag ggccaggtag acctgcgtgg taaggaggct 720 gagatgaggc aggacttggg gatcagggcc gaccgggcca agatggaaga gctggtacag 780 gcagaggagg cccaggagga gagagggagc agcagggatc cagtggctga gctgccctca 840 gatggagagg ctgaaggcac tgccgacttg gaggcaactc cagaggccag gcctgaggag 900 gagctcacag gggaggagag tgaggcggcc cagactagct gtggcctact gggcgtggaa 960 tggggtggcc tcacacacag cgtcaccaaa ggccagggac ctgagctgat ggggggtgcc 1020 cagaccccaa ctaagcaacc cgaggaaagg gaggcagggg aggtggagct catgggagtt 1080 ctggccctga gcaaagagga gcaggagagg agcctggagg caggtcccag gcacgcgggg 1140 tctgtaaagc ctgaggcctc cgaggccttc ccaggagcct gggaaaaccg cacgagaaag 1200 gacatggaga gaggaaatac tcaggaggat gcggccgatg gcgagcagcg ggaggaggag 1260 gagactgcgg gaggccagac cctggcggct gaggctgaag gagaccgaga gtctgaacta 1320 tcagaagtcc cagaggcagg cggggagggg ctgacaaccc aggacgcggg atgtggaact 1380 gaggagggag aggcatctgt ctcagagaac caggagctgg acggaagcac aggggcagac 1440 gcagggcctt gcccgtcact gggaga 1466 9 1851 DNA Homo sapien 9 tcaggaggat gcggccgatg gcgagcagcg ggaggaggag gagactgcgg gaggccagac 60 cctggcggct gaggctgaag gagaccgaga gtctgaacta tcagaagtcc cagaggcagg 120 cggggagggg ctgacaaccc aggacgcggg atgtggaact gaggagggag aggcatctgt 180 ctcagagaac caggagctgg acggaagcac aggggcagac gcagggcctt gcccgtcact 240 gggagaggcc tatgccagag aaactgagga tgaggaggcg gaggctgaca gaacatccag 300 aagaggctgg aggctgcaag cggtggctgt gggcctcccg gaccgtgagg atgcacagac 360 tggctctgtg gctgctggga ttatgggggg tgatgtggtc ccacacatca gcgctgctgg 420 cgctggtgaa gctttggaag gggcgcttgg gcaaggctgg gactcgaaag aaaaggaaga 480 ggcagcagca ggagagcatg caggtgggca agaatttggt ctggagggct cagcagagga 540 agaggtgact ggcagaggca gccaagtaga ggcttttgag tccagggagg gaggaccttg 600 gggagggcgg gtagaggccg aggaatctgc aggcgcagag gacagctgtg ggctggatcc 660 cgcgggctcc cagacagcga gggcagaggg gatgggagcc atggtggagg ctggggggct 720 tctagaaaag tggacgctgt tggaagaaga ggctgttgga tggcaggaga gagaacagag 780 ggaagacagt gaggggcggt gtggggacta ccaccctgag ggagaggcac caaggctcct 840 tgatgcagag ggtctcatgg tgaccggggg ccggagggca gaggccaagg agactgagcc 900 agaaagcctg gaacatgtca ggggccagga ggagcagcca acacaccagg cccctgcaga 960 agctgcgccg gagtcagtcg gggaagccga gacggctgag gccatgggca gtgccagagg 1020 aggtgctgcc aacagctgga gcgaggcccc gctccccggg tccctcctag acgtctctgt 1080 cccaaggagt cgcgtgcacc tctcgagaag ctcctcacag cgtcgctccc ggccctcttt 1140 tcgtcggact ccggcctggg agcagcagga ggagccccca gcccccaacc ctcctgagga 1200 ggagctgtca gctcctgagc agagacccct ccagctggag gaacccctgg agccaagccc 1260 tctgaggcat gatgggaccc cggtgccagc caggagaagg cccctgggac acgggtttgg 1320 cctcgcgcac cctggcatga tgcaggagct gcaagcccgt ctgggccggc ctaagcccca 1380 gtgactgaga cccggtgctc tgggagccag gccctgagtg ggtgccagaa ggcttgctcc 1440 aatgccactg agccctgctc cctctgccac tgtggacaca tcctctccac cctctgggcc 1500 tcagtgtctt gatgtatcat tcatggagca ggcaaaacca gacgtctggg aataccgtga 1560 acttaaggag tctgattctc cgacacaggc tggtggacca cctaccccac tgagaccacc 1620 tctcagggtg cctgccctgg ttcctcccca gcctgagtca gctgtctgga ctgcaaggag 1680 gctgggcacg ggggctcacg cctgtcaccc cagagctttg ggaggccaag gtgggaggat 1740 cgcttgagac caggagttcg agaccagcct gggcagcata gcaagatccc catcttttaa 1800 aaacaaaata aaacaataaa gactgcaagg aaaaaaaaaa aaaaaaaaaa a 1851 10 11 PRT artificial sequence MOD_RES/AMIDATION Amino acid sequence of a fragment from peptide 29 from MBP protein; C-terminal arginine was amidated at position 11 10 Cys Ala Glu Gly Leu Met Val Thr Gly Gly Arg 5 10 11 10 PRT Artificial Sequence Peptide previously used to produce receptor-specific antibodies 11 Ala Glu Gly Leu Met Val Thr Gly Gly Arg 5 10 12 19 DNA Artificial Sequence 2048-fold degenerate oligonucleotide corresponding to base pairs 2763-2745 of apoB48R cDNA sequence; n = a,t,c, or g at positions 3, 6, 9, 15, and 18 12 ccnccngtna ccatnarnc 19 13 17 DNA Artificial Sequence 256-fold degenerate oligonucleotide corresponding to base pairs 2754-2738 of apoB48R cDNA sequence; n = a, t, c, or g at positions 6, 9, and 15 13 accatnarnc cytcngc 17 14 21 DNA Artificial Sequence (gt10 forward primer 14 agcaagttca gcctggttaa g 21 15 17 DNA Artificial Sequence Primer based on the sequence of the pcr-137 PCR product (bp 2763-2745 of ApoB48R cDNA) 15 ccccccgtca ccatgag 17 16 17 DNA Artificial Sequence Primer based on the sequence of the pcr-137 PCR product (bp 2754-2738 of ApoB48R cDNA) 16 accatgagrc cctctgc 17 17 17 DNA Artificial Sequence Antisense primers were based on the 5′-end sequence of the THP-1 (73 clone (bp 2203-2187 of ApoB48R cDNA) 17 ccagcctctt ctggatg 17 18 17 DNA Artificial Sequence Antisense primers were based on the 5′-end sequence of the THP-1 (73 clone (bp 2139-2123 of ApoB48R cDNA) 18 tctcccagtg acgggca 17 19 24 DNA Artificial Sequence Antisense primers based on the 5′ end sequence of clone pcr-4-3 (bp 722-699) 19 cctcagtttc ccctgcatct gcct 24 20 360 DNA Homo sapiens Intron 1 of ApoB48R Genomic DNA, between bp 67 and 68 of the cDNA 20 gtgagaaggg cagacagctg ccagatactt gcaccccatt ccctggggcc tcacttccgg 60 gcacctcccc tggggcctca cctttcccct cctccttctg atctcctcta actggagatt 120 gctttctcag gttcaggcag actcctggcc taatattttc tgaatttcag tccccacctc 180 caaccatgcg tcctcgtacc cctaatcgat gccccttctg gctccttctg caaatcctct 240 tcttctcctt tcagatccca gtaccctctt ccttaacctg ggctcctcca gccagggccc 300 ccagggaaag ggctgggact ctcctcaatg actctcccct ctctctctct tttttcctag 360 21 84 DNA Homo sapiens Intron 2 of ApoB48R Genomic DNA (between bp 3228 and 3229 of the cDNA) 21 gtgagggctc ttggtggggt ctcgggggga acgagtggaa tcccgaagcc ggccccatgg 60 tcctctgtgc cccctttcct gcag 84 22 84 DNA Homo sapiens Intron 3 of ApoB48R Genomic DNA (between bp 3207 and 3208 of the cDNA) 22 gtgagggctc ttggtggggt ctcgggggga acgagtggaa tcccgaagcc ggccccatgg 60 tcctctgtgc cccctttcct gcag 84
Claims (34)
1. An isolated DNA molecule encoding a monocyte-macrophage cell surface apoB48 receptor protein (apoB48R), said DNA molecule selected from the group consisting of:
(a) a DNA molecule comprising SEQ ID No. 1 encoding said monocyte-macrophage cell surface apoB48 receptor protein as set forth in SEQ ID No. 2 or a fragment thereof; and,
(b) a DNA molecule differing from the DNA molecule of (a) in codon sequence due to the degeneracy of the genetic code, and which encodes said monocyte-macrophage cell surface apoB48 receptor protein as set forth in SEQ ID No. 2 or a fragment thereof.
2. A vector containing the DNA molecule of claim 1 and regulatory elements necessary for expression of said DNA in a cell, said vector adapted for expression in a recombinant cell.
3. A host cell containing the vector of claim 2 .
4. An isolated DNA molecule encoding a portion of the apoB48 receptor protein, said DNA molecule selected from the group consisting of SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8 and SEQ ID No. 9.
5. A vector containing the isolated DNA molecule of claim 4 and regulatory elements necessary for expression of said DNA in a cell, said vector adapted for expression in a recombinant cell.
6. A host cell containing the vector of claim 5 .
7. An isolated monocyte-macrophage cell surface apoB48 receptor protein (apoB48R) having the sequence SEQ ID No. 2.
8. An antibody directed to an isolated monocyte-macrophage cell surface apoB48 receptor protein having the sequence encoded by a DNA molecule selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9 and a fragment thereof.
9. A method of cell-specific delivery of a therapeutic compound to an individual in need of such treatment, comprising the steps of:
providing a recognition compound selected from the group consisting of a peptide, an antibody and an antibody fragment having the ability to bind to the monocyte-macrophage cell surface apoB48 receptor protein of claim 7 (SEQ ID No. 2), or a portion of said sequence; and
incorporating said recognition compound into a delivery vehicle containing said therapeutic compound.
10. The method of claim 9 , wherein said delivery vehicle is a liposome.
11. The method of claim 9 , wherein said therapeutic compound is selected from the group consisting of cytocidal drugs, cytotoxic drugs, genes, vitamins, hormones, cytokines, growth factors and growth inhibitors.
12. The method of claim 9 , wherein said cell is selected from the group consisting of monocytes, macrophages, endothelial cells, placental cells, peripheral blood leukocytes, bone marrow cells, astrocytes, osteoclasts and other monocyte-derived cells.
13. The method of claim 9 , wherein said individual has a disease selected from the group consisting of monocytic leukemia, tuberculosis, leprosy, and AIDS.
14. The method of claim 9 , wherein said therapeutic compound delivered to said individual has an effect selected from the group consisting of inhibition of angiogenesis, enhancement of angiogenesis, inhibition of fibrinolysis, enhancement of fibrinolysis, inhibition of tissue factor production and enhancement of tissue factor production.
15. The method of claim 9 , wherein said therapeutic compound is delivered to a developing embryo in said individual.
16. The method of claim 9 , wherein said therapeutic compound is a label used to locate atherosclerotic plaques.
17. The method of claim 9 , wherein said therapeutic compound is a compound used to eliminate atherosclerotic plaques.
18. A method of inhibiting the binding of lipoproteins to cells, comprising the step of treating said cells with an agent which binds a monocyte-macrophage cell surface apoB48 receptor protein of claim 7 (SEQ ID No. 2), wherein said binding inhibits the binding of lipoproteins to cells, thereby inhibiting foam cell formation and increased monocyte adhesion to endothelial cells.
19. The method of claim 18 , wherein said agent is selected from the group consisting of a peptide, an antibody directed to an isolated apoB48 receptor protein having the sequence encoded by a DNA molecule selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9 and a fragment thereof.
20. The method of claim 19 , wherein said peptide is lipoprotein lipase or a fragment thereof.
21. The method of claim 18 , wherein said cells are selected from the group consisting of monocytes, macrophages, endothelial cells, placental cells, peripheral blood leukocytes, bone marrow cells, astrocytes, osteoclasts and other monocyte-derived cells.
22. A method of enhancing hepatic uptake and catabolism of apoB48-containing lipoproteins in an individual in need of such treatment, comprising the step of administering to said individual an effective amount of a vector encoding the monocyte-macrophage cell surface apoB48 receptor protein of claim 7 (SEQ ID No. 2), or a portion of said protein.
23. The method of claim 22 , wherein said individual has been diagnosed with a disease selected from the group consisting of Pattern B phenotype, familial combined hyperlipidemia, familial hypercholesterolemia, non-familial hypercholesterolemia, hypertriglyceridemia and low plasma high density lipoprotein levels.
24. A method of evaluating an individual at risk for cardiovascular disease, comprising the steps of:
(a) extracting a sample of monocytes-macrophages and triglyceride-rich lipoproteins from plasma of said individual and from a control individual not considered at risk for cardiovascular disease; and
(b) comparing the binding affinity (Kd) of the apoB48 receptor of claim 7 between said individual at risk and said control individual, whereby a difference in said binding affinity between said individual at risk and said control individual is indicative of an alteration in either or both the apoB cell-surface receptor protein an d triglyceride-rich lipoproteins, wherein said alteration in said apoB cell-surface receptor protein or triglyceride-rich lipoproteins is indicative of dyslipidemias, abnormal postprandial triglyceride metabolism or Pattern B phenotype in said individual at risk.
25. A method of evaluating an individual at risk for cardiovascular disease, comprising the steps of:
(a) extracting a sample of monocytes-macrophages from plasma of said individual; and
(b) comparing the binding affinity (Kd) of the apoB48 receptor of claim 7 of said individual at risk and the apoB48 receptor of control THP-1 cells for triglyceride-rich lipoproteins, whereby a difference in said binding affinity between said individual at risk and said control cells is indicative of an alteration in the apoB cell-surface receptor protein in said individual at risk, wherein said alteration in said apoB cell-surface receptor protein is indicative of dyslipidemias, abnormal postprandial triglyceride metabolism or Pattern B phenotype in said individual at risk.
26. A method of evaluating an individual at risk for cardiovascular disease, comprising the steps of:
(a) extracting a sample of monocytes-macrophages and triglyceride-rich lipoproteins from plasma of said individual; and
(b) comparing the binding affinity (Kd) of said triglyceride-rich lipoproteins for the apoB receptor of claim 7 said individual at risk and the apoB receptor of THP-1 control cells, whereby a difference in said binding affinity between said individual at risk and said control cells is indicative of an alteration in the triglyceride-rich lipoproteins, wherein said alteration in said triglyceride-rich lipoproteins is indicative of dyslipidemias, abnormal postprandial triglyceride metabolism or Pattern B phenotype in said individual at risk.
27. A method of evaluating an individual at risk for cardiovascular disease, comprising the steps of:
(a) extracting a sample of monocytes-macrophages from plasma of said individual; and
(b) performing a Western blot analysis on proteins of said monocytes-macrophages using an antibody directed towards the protein of claim 7 (SEQ ID No. 2), or fragments thereof, whereby a difference in the migration or mobility of said proteins between said individual at risk and said control is indicative of an alteration in the apoB cell-surface receptor protein, wherein said alteration in said apoB cell-surface receptor protein is indicative of dyslipidemias, abnormal postprandial triglyceride metabolism or Pattern B phenotype in said individual at risk.
28. The method of claim 27 , wherein said control is selected from the group consisting of a THP-1 clonal cell line or a sample of monocytes-macrophages from plasma of a control individual not considered at risk for cardiovascular disease.
29. A method of evaluating an individual at risk for cardiovascular disease, comprising the steps of:
(a) extracting a sample of monocytes-macrophages from plasma of said individual; and
(b) isolating and analyzing RNAs of said monocytes-macrophages, whereby a difference in said RNAs between said individual at risk and said control is indicative of an alteration in the apoB cell-surface receptor protein, wherein said alteration in said apoB cell-surface receptor protein is indicative of dyslipidemias, abnormal postprandial triglyceride metabolism or Pattern B phenotype in said individual at risk.
30. The method of claim 29 , wherein said analyzing is performed by Northern blot analysis using a DNA probe selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8 and SEQ ID No. 9, or fragments thereof.
31. The method of claim 29 , wherein said analyzing is performed by RT-PCR using oligonucleotides complementary to SEQ ID No. 1.
32. The method of claim 29 , wherein said control is selected from the group consisting of a THP-1 clonal cell line or a sample of monocytes-macrophages from plasma of a control individual not considered at risk for cardiovascular disease.
33. A method of evaluating an individual at risk for cardiovascular disease, comprising the steps of:
(a) extracting a sample of monocytes-macrophages from plasma of said individual; and
(b) comparing the number of apoB receptors on said monocytes-macrophages between said individual at risk and said control, whereby a difference in said number of receptors between said individual at risk and said control is indicative of an alteration in the apoB cell-surface receptor protein, wherein said alteration in said apoB cell-surface receptor protein is indicative of dyslipidemias, abnormal postprandial triglyceride metabolism or Pattern B phenotype in said individual at risk.
34. The method of claim 33 , wherein said control is selected from the group consisting of a THP-1 clonal cell line or a sample of monocytes-macrophages from plasma of a control individual not considered at risk for cardiovascular disease.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/459,876 US20030208060A1 (en) | 1998-08-06 | 2003-06-12 | DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/130,242 US6194558B1 (en) | 1998-08-06 | 1998-08-06 | DNA encoding human monocyte-macrophage apolipoprotein B receptor gene and protein |
US09/583,610 US6740735B1 (en) | 1998-08-06 | 2000-05-31 | DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein |
US10/459,876 US20030208060A1 (en) | 1998-08-06 | 2003-06-12 | DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/583,610 Division US6740735B1 (en) | 1998-08-06 | 2000-05-31 | DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein |
Publications (1)
Publication Number | Publication Date |
---|---|
US20030208060A1 true US20030208060A1 (en) | 2003-11-06 |
Family
ID=22443746
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/130,242 Expired - Fee Related US6194558B1 (en) | 1998-08-06 | 1998-08-06 | DNA encoding human monocyte-macrophage apolipoprotein B receptor gene and protein |
US09/583,610 Expired - Fee Related US6740735B1 (en) | 1998-08-06 | 2000-05-31 | DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein |
US10/459,876 Abandoned US20030208060A1 (en) | 1998-08-06 | 2003-06-12 | DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein |
Family Applications Before (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/130,242 Expired - Fee Related US6194558B1 (en) | 1998-08-06 | 1998-08-06 | DNA encoding human monocyte-macrophage apolipoprotein B receptor gene and protein |
US09/583,610 Expired - Fee Related US6740735B1 (en) | 1998-08-06 | 2000-05-31 | DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein |
Country Status (3)
Country | Link |
---|---|
US (3) | US6194558B1 (en) |
AU (1) | AU5671299A (en) |
WO (1) | WO2000008050A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20100137263A1 (en) * | 2006-10-20 | 2010-06-03 | Newcastle Innovation Limited | Assay for the detection of biomarkers associated with pregnancy related conditions |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20030228600A1 (en) * | 2000-07-14 | 2003-12-11 | Eppendorf 5 Prime, Inc. | DNA isolation method and kit |
US7259140B2 (en) | 2003-03-28 | 2007-08-21 | Thomas Jefferson University | Heparin-binding peptides and uses thereof |
CN103065065A (en) * | 2012-11-18 | 2013-04-24 | 浙江大学 | Active tuberculosis differential expression protein profile model and building method thereof |
CN106248972A (en) * | 2016-08-24 | 2016-12-21 | 李俊香 | A kind of quantum dot immune chromatograph test strip of quick detection apolipoprotein B48 R and preparation method thereof |
-
1998
- 1998-08-06 US US09/130,242 patent/US6194558B1/en not_active Expired - Fee Related
-
1999
- 1999-08-06 AU AU56712/99A patent/AU5671299A/en not_active Abandoned
- 1999-08-06 WO PCT/US1999/017890 patent/WO2000008050A1/en active Application Filing
-
2000
- 2000-05-31 US US09/583,610 patent/US6740735B1/en not_active Expired - Fee Related
-
2003
- 2003-06-12 US US10/459,876 patent/US20030208060A1/en not_active Abandoned
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20100137263A1 (en) * | 2006-10-20 | 2010-06-03 | Newcastle Innovation Limited | Assay for the detection of biomarkers associated with pregnancy related conditions |
Also Published As
Publication number | Publication date |
---|---|
AU5671299A (en) | 2000-02-28 |
US6194558B1 (en) | 2001-02-27 |
WO2000008050A9 (en) | 2000-08-03 |
US6740735B1 (en) | 2004-05-25 |
WO2000008050A1 (en) | 2000-02-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP4726302B2 (en) | Methods and reagents for regulating ABC1 polypeptide and cholesterol levels | |
JP2001504324A (en) | Treatment of α-galactosidase A deficiency | |
US5652210A (en) | Soluble splice variant of the Fas (APO-1) antigen, FasΔTM | |
CA2316403A1 (en) | Mammalian edg-5 receptor homologs | |
US5686073A (en) | Polyclonal and monoclonal antibodies against a 43 KDA dystrophin associated protein | |
AU3606301A (en) | Human monoclonal antibodies against oxidized LDL receptor and pharmaceutical uses thereof | |
PT1003861E (en) | Mammalian cell membrane proteins; related reagents | |
JPH08504577A (en) | Compositions and methods for modifying the regulatory activity of TGF-β | |
US5449616A (en) | Nucleic acid encoding dystrophin-associated protein | |
US6225451B1 (en) | Chromosome 11-linked coronary heart disease susceptibility gene CHD1 | |
WO2000017345A1 (en) | Ly6h gene | |
EP1046652A1 (en) | Method for quantitating denatured ldls | |
US6740735B1 (en) | DNA encoding human apoB48R: a monocyte-macrophage apolipoprotein B48 receptor gene and protein | |
ZA200207955B (en) | Phosphatidyl serine receptors and uses thereof. | |
US20040266674A1 (en) | Lp mammalian proteins; related reagents | |
JP4249927B2 (en) | Collagen-like novel protein CLAC and its precursor, and gene encoding them | |
AU762392B2 (en) | Methods and materials relating to novel CD39-like polypeptides | |
US6172210B1 (en) | DNA encoding phospholipid scramblase | |
CA2399865C (en) | Novel scavenger receptor | |
EP1369478A1 (en) | Novel scavenger receptor class a protein | |
US6447771B1 (en) | Methods and materials relating to novel CD39-like polypeptides | |
US20100034788A1 (en) | Method for diagnosing and treating bone-related diseases | |
US20030166909A1 (en) | EGF motif protein, EGFL6 materials and methods | |
JP2003325185A (en) | New immune function inhibitory molecule having itim motif | |
JP2002291481A (en) | New g protein-conjugated receptor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |