JP2002291481A - New g protein-conjugated receptor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a gene and a protein that are involved in diseases in liver, testis, and other organs, and to provide a method for efficiently evaluating an agent regulating the activity of the protein. SOLUTION: A DNA that is derived from a human colon cell and has a specific base sequence, G protein-conjugated receptor protein encoded by the DNA, an antisense nucleic acid against the DNA sequence, a method for searching a ligand, an agonist or antagonist for the protein using the protein, an antisense nucleic acid against the DNA and a specific antibody against the protein, are provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a novel G protein-coupled receptor protein, a DNA encoding the protein, a recombinant vector, a transformant using the vector, a specific antibody against the protein, Antisense nucleic acid that suppresses expression, and the protein or DN encoding the same
The present invention relates to a method for screening diagnostic agents, inhibitors, pharmaceuticals, and the like using A.

[0002]

2. Description of the Related Art Cells express various receptor proteins on cell membranes, nuclear membranes and other biological membranes. These bind to a very large number of physiologically active substances, such as hormones and neurotransmitters, in a highly specific manner, and play a role in regulating the function of cells or whole organisms by giving the information to cells. I have.

[0003] As one of the mechanisms for giving information on binding to a physiologically active substance to cells and the like, a GTP-binding protein (guanos) is used.
Signaling through the activation of ine 5'-triphosohate-binding protein (hereinafter abbreviated as G protein) is known. Receptors involved in this mechanism are generally G protein-coupled receptor proteins (hereinafter referred to as G proteins). , GPCRs). Since this receptor has a common structure having seven transmembrane regions, it is sometimes called a seven-transmembrane receptor protein.

[0004] The existence of a large number of G protein-coupled receptor proteins has been reported from various organs and cells such as the brain, liver and spleen, and the genes encoding them have been actively cloned. This indicates that each G protein-coupled receptor protein has a different physiological function, corresponding to a unique in vivo ligand. For example, in organs such as the stomach, small intestine, and spleen,
Many secreted proteins are produced under the control of a wide variety of hormones, hormone-like substances, neurotransmitters, and physiologically active substances, and this control is thought to be mediated by the corresponding receptor. . Therefore,
It is expected that G protein-coupled receptor proteins involved in the regulation of such secreted proteins will be found in organ cells expressing a large amount of secreted proteins. Further, it is clear that many receptors also act on the neurotransmitter action between nerve cells, and in fact, a single G protein-coupled receptor protein that can specifically bind to a neurotransmitter from such cells. Departures have been reported.

[0005] As described above, isolating and identifying a G protein-coupled receptor protein and a gene encoding the same and specifying its in vivo ligand are not only of academic significance but also of drug development utilizing such functions. Can be an important factor. Further, by using the G protein-coupled receptor protein or the gene encoding the same, a drug candidate substance can be efficiently produced.
It is also possible to search for and evaluate specific agonists or antagonists.

[0006]

From such a background,
A novel human-derived G protein-coupled receptor protein and a gene encoding the same are found, and a method for producing the protein and efficiently screening for a substance that regulates the activity of the protein is provided. There is a strong need for the development of specific antibodies or antisense nucleic acids.

[0007] An object of the present invention is to provide a novel G protein-coupled receptor protein and a DNA encoding the same. Furthermore, another object of the present invention is to provide a method for producing the protein using the DNA, and a method for screening for an agonist or antagonist for the protein.

[0008]

The present invention provides a novel gene (referred to as gpcr6318) isolated from human colon-derived cells,
The present invention relates to a G protein-coupled receptor protein encoded by the gene (referred to as GPCR6318). Further, a host cell transformed with the gene, a recombinant using the transformed cell
A method for producing GPCR6318 and a method for searching for a ligand, agonist or antagonist for GPCR6318 are provided.

(Nucleic acid) The present invention provides a gene gpcr6318 encoding GPCR6318 (described in detail below). The gene can be isolated and identified from a human colon-derived cDNA library, but based on the sequences disclosed herein, cloning using a genetic engineering technique such as general hybridization or the phosphoamidite method. Or DNA prepared by a chemical synthesis technique such as Examples of the form include cDNA, genomic DNA, and chemically synthesized DNA, but are not particularly limited. Further, the DNA of the present invention may be single-stranded or may form a double or triple chain by binding to DNA or RNA having a sequence complementary thereto. Also,
The DNA is horseradish peroxidase (HRP
It may be labeled with an enzyme such as O), a radioisotope, a fluorescent substance, a chemiluminescent substance, or the like.

If the nucleotide sequence of gpcr6318 is provided, the sequence of RNA derived therefrom and the sequence of complementary DNA and RNA are uniquely determined.
It should be understood that RNA corresponding to DNA or DNA and RNA having a sequence complementary to the DNA of the present invention is also provided.

Furthermore, the DNA of the present invention also includes a DNA that hybridizes under stringent conditions with a DNA consisting of the nucleotide sequence of SEQ ID NO: 1.

A DNA comprising the nucleotide sequence of SEQ ID NO: 1
As a result, a variation in the base sequence is allowed within a range that hybridizes with this under stringent conditions and that the protein encoded by the DNA is a G protein-coupled receptor protein. For example, the presence of multiple codons encoding the same amino acid residue due to so-called codon degeneracy, various artificial treatments such as site-directed mutagenesis, random mutation by mutagen treatment, and mutation / deletion of DNA fragments by restriction enzyme cleavage. Even if the DNA sequence is partially changed due to loss or ligation, etc., these DNA variants hybridize with the DNA of SEQ ID NO: 1 under stringent conditions, and the G protein-coupled receptor A DNA encoding a protein is within the scope of the present invention regardless of the difference from the DNA sequence shown in SEQ ID NO: 1.

The degree of the above-mentioned DNA mutation is within an allowable range as long as it has 70% or more, preferably 80% or more, more preferably 90% or more homology with the DNA sequence of SEQ ID NO: 1. . As for the degree of hybridization,
Under normal conditions, for example, DIG DNALabeling kit (Roche
When the probe was labeled with Diagnostics Cat No. 1175033), the probe was hybridized in a DIG Easy Hyb solution (Roche Diagnostics Cat No. 1603558) at 32 ° C. × SSC solution (0.
Conditions for washing the membrane in 1% [w / v] SDS (1 × SSC is 0.15 M NaCl, 0.01%)
5M sodium citrate) as long as it hybridizes to the nucleic acid of SEQ ID NO: 1.

A DNA comprising the nucleotide sequence of SEQ ID NO: 1
Since its expression has been confirmed in the liver, testis and the like, DNA comprising the nucleotide sequence of SEQ ID NO: 1 or a partial fragment thereof is considered to be useful as a specific probe for diseases in such organs.

The DNA of the present invention can be used to produce GPCR6318 in large quantities. The DNA can also be labeled with an enzyme or the like and used to examine the expression status of the protein of the present invention in tissues. That is, the DN
Using A as a probe, by confirming the expression level of the protein of the present invention in the cells using the mRNA expression level as an index, it is possible to determine cells and culture conditions suitable for producing the protein of the present invention, It is also possible to diagnose diseases associated with the protein of the present invention.

Further, PCR-RFLP (Restriction fragment length p) using a part of the DNA of the present invention as a primer
olymorphism) method, PCR-SSCP (Single strand conformat)
An abnormality or polymorphism in the nucleic acid sequence can be examined and diagnosed by a method such as ionpolymorphism) or sequencing.

The DNA of the present invention can be introduced into cells in a living body and used for gene therapy for diseases caused by impaired expression or activity of the protein of the present invention.

The DNA of the present invention is extremely useful for preparing transformed cells, further producing a recombinant protein GPCR6318 using the transformed cells, or searching for a compound that specifically inhibits the expression of gpcr6318. .

The transformed cells of the present invention can be prepared by applying techniques known to those skilled in the art. For example, appropriate transformants can be prepared by using various vectors that are commercially available or generally available to those skilled in the art. It is possible to incorporate the DNA of the present invention into a host cell. At that time, the gene gpcr6318
Under the influence of an expression control gene represented by a promoter or an enhancer, the expression of the gene gpcr6318 in a host cell can be arbitrarily controlled. This technique is suitable for use in the production of protein GPCR6318 using transformed host cells,
The present invention can also be applied to research on the mechanism of controlling the expression of gpcr6318 or search for substances that can regulate the expression of the gene.

For example, any test substance and the gene gpcr6318
By contacting the cells transformed with the vector containing under appropriate conditions, a substance having an action of promoting or suppressing the expression of the test substance gene gpcr6318 can be searched for or evaluated.

Further, a transgenic animal can be prepared based on a mouse or other suitable animal by combining the DNA of the present invention with a known method. By using the gene gpcr6318 of the present invention, it is also possible to produce a so-called knockout animal in which a gene corresponding to human gpcr6318 is disrupted from an animal other than human. The animal in which the endogenous gene has been disrupted in this manner has a human gpcr63 of the present invention.
By introducing 18, it becomes possible to create a model animal having only human gpcr6318. By observing such transgenic animals, particularly animals expressing the gene gpcr6318 or protein GPCR6318 of the present invention in large amounts or conversely, it is possible to specify the function of the gene gpcr6318 or protein GPCR6318. . In addition, the model animal contains the introduced human gpcr.
It is useful for the development and evaluation of drugs targeting 6318. Substances that specifically act on the gene gpcr6318 or the protein GPCR6318 or complement the function, etc., can be examined at a biological level.
GPCR6318 is expected to be a drug that functions in biological control to function specifically. In particular, since the expression of the gene or protein of the present invention is specifically observed in the liver and testis, the compounds and the like obtained through the search using the above-mentioned transformed cells or transgenic animals may have abnormal liver and testis functions. Is expected to be an effective therapeutic or prophylactic agent for diseases caused by the disease.

(Protein GPCR6318) The protein encoded by gpcr6318 is a protein comprising the amino acid sequence shown in SEQ ID NO: 2
CR6318. GPCR6318 has a typical seven transmembrane structure and is a GPCR, CD97, latrophilin.
n), 43-46%, VIP (vasoactive intestina)
l peptide) receptor, PTH (parathyroid) receptor, diuretic hormone receptor and other peptide hormone receptors have about 40% homology. In general, the primary structural similarity of GPCRs is concentrated in the transmembrane region, and sequence conservation across the transmembrane region is 85-95% between different species for a particular receptor, a particular ligand 60-80% between receptor subtypes, 35-45% between the same families, and 20 between different families
-25% (biochemistry 46
545-549 (1995)). From this point, GPCR631
8 is presumed to be a protein belonging to the secretin receptor family, which is a concept that includes peptide hormone receptors such as secretin receptor and calcitonin receptor together with CD97 and latrophilin. On the other hand, unlike CD97 and latrophilin, it does not have an N-terminal lectin domain, EGF domain, or RGD sequence, and has no homology with other peptide hormone receptors in the N-terminal extracellular domain. Therefore, it is considered that the protein of the present invention has a function different from that of known GPCRs and can be a novel drug target.

As a common function of the secretin receptor family, it is known that the secretion of a physiologically active substance is regulated by using an extracellular matrix, an adhesion molecule or a peptide hormone as a ligand. Regarding the GPCR6318 of the present invention, it is a protein belonging to the secretin receptor family, the gene gpcr6318 has been isolated from cells derived from the large intestine, and the expression distribution in the living body is selectively to liver, an organ having a secretory function called testis. From its expression, etc., it is presumed to be involved in the regulation of secretion of a physiologically active substance.

Therefore, agonists or antagonists to GPCR6318 are expected to have utility as pharmaceuticals, and the search for agonists or antagonists using GPCR6318 is expected to have important significance in drug development.

As long as it is a G protein-coupled receptor protein, a polypeptide or protein consisting of an amino acid sequence in which one or more amino acids have been substituted, deleted and / or added in the amino acid sequence of the protein shown in SEQ ID NO: 2 Are also within the scope of the present invention.

Amino acid residue side chains which are constituents of proteins differ in hydrophobicity, charge, size, etc., but do not substantially affect the three-dimensional structure (also called three-dimensional structure) of the whole protein. Several highly conservative relationships are known in the sense. For example, for substitution of amino acid residues, glycine (Gly) and proline (Pro), Gly and alanine (Ala) or valine (Val), leucine (Le
u) and isoleucine (Ile), glutamic acid (Glu) and glutamine (Gln), aspartic acid (Asp) and asparagine (Asn), cysteine (Cys) and threonine (Thr), T
hr and serine (Ser) or Ala; lysine (Lys) and arginine (Arg); Even if the above-mentioned conservative property is impaired, many mutations that do not lose the essential function of the protein, that is, the function as a G protein-coupled receptor protein in the present invention, are well known to those skilled in the art.
In addition, the same type of protein stored between different species
In many cases, even though some amino acids are deleted or inserted in a concentrated or dispersed manner, the amino acid still retains its essential function.

Therefore, even if it is a mutant protein resulting from substitution, insertion, deletion, etc. on the amino acid sequence shown in SEQ ID NO: 2,
If the mutant proteins are G protein-coupled receptor proteins, they can be said to be within the scope of the present invention. The G protein-coupled receptor protein referred to herein means, for example, a function substantially the same as GPCR6318 which is a G protein-coupled receptor protein consisting of the amino acid sequence of SEQ ID NO: 2 in ligand binding activity and signal transduction function. Having the following. Therefore, it is only necessary that the ligand binding activity and signal transduction are of the same nature, and it is understood that a change in the strength of the ligand binding activity or a quantitative change in the molecular weight of the protein due to a difference in sugar chain binding or the like is acceptable. Should be.

Such amino acid modifications can be found in nature, such as mutations caused by gene polymorphisms, etc., as well as methods known to those skilled in the art, for example, mutagenesis using a mutagen such as NTG, and various other methods. Utilizing a site-directed mutagenesis method using the recombinant gene technique described above. The mutation site and number of amino acids are not particularly limited as long as the mutant protein is a G protein-coupled receptor protein, but the number of mutations is usually within several tens of amino acids, preferably 10 to 10 amino acids.
Within amino acids.

It goes without saying that the above-mentioned protein may be in the form of a salt which is within the ordinary recognizing range of those skilled in the art. And proteins converted into various forms, including. For example, conversion by various methods known to those skilled in the art, such as various chemical modifications to proteins, binding to a polymer such as polyethylene glycol, binding to an insoluble carrier, and the like can be considered. Naturally, depending on the host used, the presence or absence of sugar chains or the difference in the degree of sugar chain addition may be mentioned. Even in such a case, it should be understood that the present invention is still the present invention as long as it functions as a G protein-coupled receptor protein.

The protein of the present invention or its partial fragment peptide can be used for searching for a substance that regulates the activity of the protein. Compounds and the like obtained through the search are expected to be effective therapeutic or prophylactic agents for diseases associated with the protein of the present invention.

(Method for Searching for Ligand, Agonist, Antagonist) A ligand which is an in vivo substance that specifically binds to GPCR6318 of the present invention has not been identified yet. However, as described above, it is clear that GPCR6318 itself has a certain specific regulatory function, and using this protein to identify its specific ligand has led to elucidation of complex biological control mechanisms. Thus, it is possible to lead a medicine by a completely novel mechanism of action. Therefore, the identification, search, and evaluation of a specific ligand, agonist or antagonist for GPCR6318 has important significance.

This ligand can be determined by using the gene gpcr6318 in a suitable transformed cell, for example, human embryonic kidney-derived HE.
Preparing K293 cells (ATCC 293 cells), culturing the cells expressing GPCR6318 under appropriate conditions, adding a substance that is assumed to be a ligand, agonist, or antagonist thereto and confirming the cell response. Can be. As for the cellular response, GPCR6318 is coupled to the G protein and belongs to the secretin receptor family.
Although an increase in MP is considered, other response changes that can be measured using cells include changes in intracellular Ca ²⁺ concentration and IP.
A change in 3 (inositol triphosphate) concentration and the like are conceivable. Further, the GPCR6318 or a partial peptide corresponding to the extracellular domain thereof is supported on a suitable supporting membrane such as a biological membrane, and a substance supposed to be a ligand, an agonist, or an antagonist is added thereto and bound to the GPCR6318 or the extracellular domain thereof. Alternatively, the binding substance can be recovered and specified later.

As candidates for specific ligands, in addition to integrins, latrotoxin and various peptide hormones which have been reported as ligands of the secretin receptor family, generally, ligands for G protein-coupled receptor proteins have been reported. Various polypeptides (angiotensin, somatostatin, etc.), amino acids (glutamine, dopamine, serotonin, melatonin, etc.), biologically active substances (prostaglandin, thromboxane, adrenaline, etc.), nucleic acids (adenosine, purine, etc.), others A wide variety of substances have been reported up to now. On the other hand, since the existence of a ligand which has never been reported is also assumed, the target ligand may be specified using a tissue extract of mouse, rat, human or the like or a cell culture supernatant as a candidate.

(Antibody) The present invention further provides an antibody that binds to GPCR6318. The antibody of the present invention is an antibody that specifically recognizes the whole protein or a partial peptide thereof as an antigen, and includes a monoclonal antibody and / or a polyclonal antibody. Also, the structure of immunoglobulins,
It may belong to any of the five classes (IgG, IgA, IgM, IgD, IgE) classified as physicochemical properties and immunological properties, or subclasses depending on the type of H chain. Furthermore, F (ab ') ₂ when immunoglobulin is decomposed with pepsin, Fab when decomposed with papain
And chimeric antibodies. These antibodies are useful for research or clinical detection of GPCR6318, clinical treatment of diseases that can be caused by GPCR6318, and the like.

(Antisense Nucleic Acid) The present invention provides a so-called antisense nucleic acid capable of suppressing GPCR6318 biosynthesis at the nucleic acid level in vivo. Such an antisense nucleic acid has a transcription step from a genomic region necessary for producing mRNA encoding GPCR6318 to a pre-mRNA, a processing step from the pre-mRNA to a mature mRNA, a nuclear membrane transit step, a translation step to a protein. Any means that binds to DNA or RNA that carries genetic information and affects the normal flow of transmission of genetic information and regulates protein expression, meaning the entire nucleic acid sequence of the gene gpcr6318 or any It may be composed of a sequence complementary to the portion. Preferably, a nucleic acid comprising a sequence corresponding to or complementary to the nucleic acid sequence of SEQ ID NO: 1, 3 or 4 (DNA, R
NA). Also, m transcribed from the genomic region
When the RNA has an intron structure or a form containing a region to be translated at the 5 ′ end or 3 ′ end, an antisense nucleic acid corresponding to or complementary to the sequence of the untranslated portion also has a function equivalent to that of the antisense nucleic acid of the present invention. Will have.

The antisense nucleic acid of the present invention includes not only DNA and RNA but also all derivatives having a three-dimensional structure and function similar to those of DNA and RNA. For example, at least one of the base, sugar, and phosphate of a nucleic acid or oligonucleotide having another substance bound to the 3 ′ end or 5 ′ end
In addition, a nucleic acid having a substitution or modification in it, a nucleic acid having a base, sugar or phosphate which does not exist in nature, a nucleic acid having a skeleton (backbone) other than the sugar-phosphate skeleton, and the like can be given. These nucleic acids are suitable as derivatives in which at least one of nuclease resistance, tissue selectivity, cell permeability, and binding strength is enhanced. That is, the form of the nucleic acid is not limited as long as it has a function of suppressing the expression of GPCR6318 activity.

In the present invention, in general, a nucleotide sequence that hybridizes to a loop portion of an mRNA forming a stem loop, that is, a nucleotide sequence complementary to a nucleotide sequence of a region forming a stem loop. Antisense nucleic acids having a suitable base sequence are preferred. Alternatively, antisense nucleic acids that bind to the vicinity of the translation initiation codon, ribosome binding site, capping site, or splice site, that is, antisense nucleic acids having a sequence complementary to the sequence of these sites, are also generally expected to have a high expression suppression effect. It is preferable because it can be performed.

In order for such an antisense nucleic acid to be taken into cells and to act efficiently, the antisense nucleic acid of the present invention has a chain length of 15 bases or more and 30 bases or less, preferably
Those having a base sequence consisting of 15 to 25 bases, more preferably 18 to 22 bases, are suitable.

The effect of suppressing the expression of the antisense nucleic acid of the present invention can be determined by a known method, for example, the expression control region, 5 ′ untranslated region, region near the translation start site or 5 ′ of the gene of the present invention.
An expression plasmid is prepared by linking a DNA containing a translation region and the like to a reporter gene such as luciferase.
In vitro transcription reaction (Promega: Ribo max system, etc.) and in vivo
tro translation reaction (Promega Corporation: R
abbit Reticulocyte Lysate
The system can be evaluated by adding a candidate substance to the system in an environment in which the gene of the present invention is transcribed or translated, such as a system that uses a combination of System and the like, and measuring the expression level of the reporter gene.

The antisense nucleic acid of the present invention can suppress the expression of GPCR6318 in vivo,
6318 is useful as a prophylactic / therapeutic agent for diseases associated with it.

[0041]

BEST MODE FOR CARRYING OUT THE INVENTION Embodiments of the present invention will be described below. The principle of various instruments such as a genetic engineering technique, a biochemical technique using proteins, cells or animals, chromatography and a peptide synthesizer, etc. Unless otherwise specified, there is no limitation on the usage, and all techniques, principles, and methods of use that can be used by those skilled in the art are applicable to the present invention, and are limited to the following description. It should be understood that it is not.

(Nucleic acid) Examples of obtaining the DNA of the present invention from a DNA library include a suitable genomic DNA library and cDNA.
There is a method in which the A library is screened by a screening method using hybridization, an immunoscreening method using an antibody, or the like, a clone having the target DNA is grown, and cut out therefrom using a restriction enzyme or the like. Screening by the hybridization method is carried out by labeling a DNA having the nucleotide sequence of SEQ ID NO: 1 or a part thereof with ³² P or the like as a probe, using any cDN
The A library is prepared by a known method (for example, Mania
tis T. et al., Molecular Cloning, a Laboratory Manual, C
old Spring harbor Laboratory, New York, 1982). As the antibody used in the immunoscreening method, the antibody of the present invention described later can be used. The novel DNA of the present invention may also be a genomic DNA library or
PCR (Polymerase Chain R using cDNA library as template)
eaction). In PCR, sense primers and antisense primers are prepared based on the nucleotide sequence shown in SEQ ID NO: 1, and any DNA library can be prepared by a known method (for example, Michael A.I.
tocols, a Guide to Methods and Applications, Academ
ic Press, 1990) can be performed to obtain the DNA of the present invention. As the DNA library used in the above various methods, a DNA library having the DNA of the present invention is selected and used. As the DNA library, any library can be used as long as it has the DNA of the present invention. A commercially available DNA library can be used, or the DNA of the present invention can be used.
A cell suitable for preparing a cDNA library is selected from cells having the above-mentioned method and a known method (J. Sambrook et al., Molecular C
loning, a Laboratory Manual 2nd ed., Cold Spring H
arbor Laboratory, New York, 1989).
A cDNA library can be created and used.

Further, it can be prepared by a chemical synthesis technique such as the phosphoramidite method based on the sequence disclosed in the present specification.

The recombinant vector having the DNA of the present invention comprises:
Any form such as cyclic or linear may be used. Such a recombinant vector may have another base sequence, if necessary, in addition to the DNA of the present invention. The other nucleotide sequence is an enhancer sequence, a promoter sequence, a ribosome binding sequence, a nucleotide sequence used for the purpose of copy number amplification, a nucleotide sequence encoding a signal peptide, a nucleotide sequence encoding another polypeptide, It refers to a polyA addition sequence, a splicing sequence, a replication origin, a base sequence of a gene serving as a selection marker, and the like.

In gene recombination, an appropriate synthetic DN
It is also possible to add a translation initiation codon and a translation termination codon to the DNA of the present invention using an A adapter, or to newly generate or eliminate an appropriate restriction enzyme cleavage sequence in the nucleotide sequence. These are within the range of tasks normally performed by those skilled in the art, and can be arbitrarily and easily processed based on the DNA of the present invention.

The vector carrying the DNA of the present invention comprises
An appropriate vector according to the host to be used may be selected and used, and various viruses such as bacteriophage, baculovirus, retrovirus, and vaccinia virus can be used in addition to the plasmid, and there is no particular limitation. . As described above, the gene of the present invention includes those obtained by adding or modifying various elements usually used in genetic engineering techniques. It is to be understood that there is no particular limitation on elements and techniques available to those skilled in the art.

The gene of the present invention can be expressed under the control of a promoter sequence specific to the gene.
If such an expression system is used, a substance that promotes or suppresses transcription of the gene of the present invention can be more advantageously searched. Alternatively, another suitable expression promoter upstream of the gene of the present invention can be used by connecting to or replacing the promoter sequence specific to the gene. The promoter used in this case may be appropriately selected depending on the host and the purpose of expression. For example, when the host is Escherichia coli, a T7 promoter, a lac promoter, a trp promoter, a λPL promoter, etc., and a host is yeast. In the case, PHO5 promoter, GAP promoter, AD
The H promoter and the like are S when the host is an animal cell.
V40-derived promoters, retroviral promoters and the like can be exemplified, but are not of course limited thereto.

A method for introducing DNA into a vector is known (J. Sambrook et al., Molecular Cloning, a Laboratory).
Manual 2nd ed., Cold Spring Harbor Laboratory, New York, New York, 1989). That is, DN
A and the vector are each digested with appropriate restriction enzymes, and the obtained fragments may be ligated using DNA ligase.

(Recombinant animal) The transgenic non-human mammal of the present invention can be prepared by a conventional method such as that usually used in the production of transgenic animals (for example, the latest manual for animal cell experiments, published by LCI, No. 7). Chapter 3
61 to 408 (1990)).

For example, in the case of a transgenic mouse, embryonic stem cells (Embryonic Stem Cell, ES Cell) obtained from a normal mouse blastcyst are used for gpcr63.
Transformation is performed with an expression vector into which 18 and a marker gene (for example, a neomycin resistance gene) have been inserted so as to allow expression. Fertilized eggs (pulmonary blastocysts) obtained by selecting ES cells in which gpcr6318 has been incorporated into the chromosome by a conventional method based on the presence or absence of the marker gene and obtaining from another normal mouse
Microinjection (Proc. Natl. Acad.
Sci. USA, Vol. 77, No. 12, pp. 7380-7384, 1980; U.S. Pat. No. 4,873,191). The blastocyst is transplanted into the uterus of another normal mouse as a foster mother to produce a founder mouse. A heterotransgenic mouse can be obtained by breeding the founder mouse with a normal mouse, and a homogenic transgenic mouse can be prepared by breeding the heterogeneic transgenic mice.

Further, a so-called “knockout mouse” can be prepared based on the nucleotide sequence of gpcr6318. The “knockout mouse” in the present invention is a mouse in which an endogenous gene encoding a mouse-derived protein of the present invention has been knocked out (inactivated). For example, a positive negative selection method utilizing homologous recombination (US Pat. Nos. 5,464,764, 5,487,992 and 5,627,059, Proc. Natl.Acad.Sci.
A, Vol. 86, 8932-8935, 1989, Nature, Vol. 342, 435-4
38, 1989), and such a knockout mouse is also one embodiment of the present invention.

(Protein) The protein of the present invention can be prepared from various naturally expressed organs, and can be prepared by a chemical synthesis method using a peptide synthesizer (eg, peptide synthesizer 430A, Applied Biosystems). However, it can also be prepared by a recombinant method using an appropriate host cell selected from prokaryotes or eukaryotes. However, from the viewpoint of its purity, production by genetic engineering techniques and recombinant proteins are preferred.

There are no particular restrictions on the host cells transformed with the recombinant vector of the preceding paragraph, and E. coli, B. subtilis
Alternatively, many cells, such as lower cells, insect cells, COS7 cells, CHO cells, and animal cells represented by HeLa cells, which can be used in genetic engineering techniques represented by S. cerevisiae,
It can also be used for the present invention.

Methods for introducing the recombinant vector into host cells include known methods such as electroporation, protoplast method, alkali metal method, calcium phosphate precipitation method, DEAE dextran method, microinjection method, and method using virus particles ( Special edition of Experimental Medicine, Genetic Engineering Handbook, published on March 20, 1991, see Youdosha), but any method may be used.

To produce the protein by genetic engineering, the above-mentioned transformant is cultured to recover a culture mixture.
The protein is purified. The transformant can be cultured by a general method. There are various books on cultivation of transformants (for example, see “Microbial Experiment Method”, edited by The Biochemical Society of Japan, Tokyo Kagaku Dojin, 1992). it can.

The method of purifying the protein of the present invention from the culture mixture can be carried out by appropriately selecting an appropriate method from the methods usually used for purifying proteins.
That is, various kinds of affinity chromatography such as salting out method, ultrafiltration method, isoelectric point precipitation method, gel filtration method, electrophoresis method, ion exchange chromatography, hydrophobic chromatography and antibody chromatography, chromatofocusing method, adsorption An appropriate method may be appropriately selected from commonly used methods such as chromatography and reverse phase chromatography, and if necessary, purification may be performed in an appropriate order using an HPLC system or the like.

The protein of the present invention can be expressed as a fusion protein with another protein or a tag (eg, glutathione S-transferase, protein A, hexahistidine tag, FLAG tag, etc.). The expressed fusion form can be excised using an appropriate protease (eg, thrombin or the like), and sometimes the protein can be prepared more advantageously. The protein of the present invention may be purified by appropriately combining general techniques known to those skilled in the art. In particular, when expression is performed in the form of a fusion protein, it is preferable to employ a purification method characteristic of the form.

A cell-free synthesis method using recombinant DNA molecules (J. Sambrook, et al .: Molecular Cloning)
2nd ed. (1989)) is one of the methods for production by genetic engineering.

As described above, the protein of the present invention can be prepared in its own form or in the form of a fusion protein with another kind of protein, but is not limited thereto. Conversion to various forms is also possible. For example, processing by various methods known to those skilled in the art, such as various chemical modifications to the protein, bonding to a polymer such as polyethylene glycol, and bonding to an insoluble carrier, can be considered. Further, depending on the host used, the presence or absence of sugar chains and the degree of addition are also different. Even in such a case, as long as it functions as a G protein-coupled receptor protein, it should still be under the concept of the present invention.

The protein of the present invention is useful because it can be used as an antigen for producing an antibody, or used for screening for a substance that binds to the protein or a substance that regulates the activity of the protein.

The GPCR6318 of the present invention can express a target molecule at a high level on the cell surface by culturing the above-mentioned transformed cells, particularly animal cells. On the other hand, when producing an appropriate fragment such as the extracellular region protein fragment of GPCR6318 as a soluble protein,
DNA encoding the extracellular region or each domain
Can be produced by preparing a transformant as described above using, and culturing the outer transformant to secrete it into the culture supernatant. It is preferable to add a signal sequence such as a mouse Ig kappa chain signal peptide to promote secretion.

On the other hand, when GPCR6318 is present in the periplasm or cytoplasm of the transformant, the cells suspended in an appropriate buffer are subjected to, for example, sonication, freeze-thawing, or lysozyme treatment. After disrupting the cell wall and / or cell membrane, a membrane fraction containing the protein of the present invention is obtained by a method such as centrifugation or filtration, and the membrane fraction is further solubilized with an appropriate surfactant to obtain a crude fraction. Prepare solution. Then, the target protein can be isolated and purified from the crude solution by an ordinary method.

(Antibodies) The antibodies of the present invention can be obtained by referring to known methods for both polyclonal antibodies and monoclonal antibodies (for example, immunization experiment procedures, edited by the Japan Society of Immunology, published by the Japan Society of Immunology). This will be briefly described below.

In order to obtain the novel antibody, first, the protein of the present invention is added to an animal as an immunizing antigen, if necessary, using Freund's complete adjuvant (FCA) or incomplete adjuvant (FIA).
Inoculate with an appropriate adjuvant such as A) and boost if necessary at 2-4 week intervals. After boosting, blood is collected to obtain antiserum. The protein of the present invention used as an antigen may be obtained by any method as long as it has a purification degree that can be used for preparing an antibody. The partial polypeptide of the protein of the present invention can also be suitably used as an immunizing antigen. When the polypeptide used as an immunizing antigen is a low-molecular polypeptide, that is, a polypeptide consisting of about 10 to 20 amino acids, it is bound to a carrier such as keyhole limpet hemocyanin (KLH) to form an antigen. Just use it. The animal to be immunized may be any animal, but is preferably selected from rats, mice, rabbits, sheep, horses, chickens, goats, pigs, cows, etc., which are usually used in immunological experiments by those skilled in the art. It is preferable to select and use an animal species that can produce the antibody.

A polyclonal antibody can be obtained by purifying the obtained antiserum. Purification includes salting out,
Any known method such as ion exchange chromatography and affinity chromatography may be appropriately combined.

A monoclonal antibody is obtained as follows. That is, antibody-producing cells such as spleen cells or lymphocytes are collected from the immunized animal, and fused with a myeloma cell line or the like by a known method using polyethylene glycol, Sendai virus, electric pulse, etc., to produce a hybridoma. Thereafter, a clone producing an antibody that binds to the protein of the present invention is selected and cultured, and the culture supernatant of the selected clone is purified to obtain good results. Purification may be performed by appropriately combining known methods such as salting out, ion exchange chromatography, and affinity chromatography.

The novel antibody can be obtained by using a genetic engineering method. For example, from cells of an animal immunized with the protein of the present invention or a partial polypeptide thereof, lymphocytes, or a hybridoma producing a monoclonal antibody against the protein of the present invention or a partial polypeptide thereof.
mRNA is collected and a cDNA library is prepared based on the mRNA. Cells are transformed using the cDNA library, a clone producing an antibody that reacts with the antigen is screened, the resulting clone is cultured, and the desired antibody is purified from the culture mixture by a known method. can do. When antibodies are used for therapy, humanized antibodies are preferred in terms of immunogenicity. Humanized antibodies were obtained by replacing the immune system with that of a human (eg, Nat. Gene).
t. 15; 146-156 (1997))). It can also be prepared by genetic engineering using the hypervariable region of a monoclonal antibody (Method in Enzymolo).
gy 203; 99-121 (1991)).

(Antisense Nucleic Acid) The antisense nucleic acid can be produced by a known method (for example, Stanle
y edited by T. CrooKe and BeRNAld Lebleu, in Antisense Res
earch and Applications, CRC Publishing, Florida, 1993
Year). Natural DNA or RNA can be synthesized using a chemical synthesizer, or the antisense nucleic acid of the present invention can be obtained by PCR using gpcr6318 as a template. Some derivatives, such as methylphosphonate type and phosphorothioate type, can be synthesized using a chemical synthesizer (for example, Applied Biosystems, Inc., Model 394). In this case, the antisense nucleic acid can also be obtained by performing an operation according to the manual attached to the chemical synthesizer and purifying the obtained synthetic product by an HPLC method using reverse phase chromatography or the like.

When the DNA or antisense nucleic acid of the present invention is used as a diagnostic probe, it is labeled with a radioisotope, an enzyme, a fluorescent substance, a luminescent substance or the like according to a known method. Next, DNA or mRNA is prepared from the sample by a known method, and using this as a test substance, the above-mentioned labeled probe is added and reacted, followed by washing to remove the unreacted labeled probe. Gene in the test substance
If gpcr6318 or RNA is included, the antisense nucleic acid will bind to them. The presence or absence of bond formation can be determined by using, as an index, luminescence, fluorescence, radioactivity, or the like by a labeled enzyme, fluorescent substance, luminescent substance, or radioisotope.

When the nucleic acid of the present invention, in particular, an antisense nucleic acid is used for a medical application, it is preferable to use a nucleic acid having a purity suitable for use as a pharmaceutical in a pharmacologically acceptable use method. .

The nucleic acid or antisense nucleic acid of the present invention may be used by directly dissolving or suspending it in an appropriate solvent, or may be used after being encapsulated in a liposome or incorporated in an appropriate vector. You may. Also, if necessary, pharmacologically acceptable auxiliary components are added, and injections, tablets, capsules, eye drops, creams,
Suppositories, sprays, poultices and the like may be used in appropriate dosage forms. Pharmaceutically acceptable auxiliary ingredients are solvents, bases, stabilizers, preservatives, solubilizers, excipients, buffers and the like.

When the nucleic acid or antisense nucleic acid of the present invention is in the above-mentioned dosage form, its administration method and dosage are determined according to the patient's age, gender, type and degree of disease. Can be used. That is, oral administration, or inhalation, transdermal administration, eye drop, vaginal administration, intraarticular administration, rectal administration, intravenous administration, topical administration, intramuscular administration, subcutaneous administration in an amount suitable for improving the disease state An appropriate method such as intraperitoneal administration may be selected and administered.

(Screening Method) The present invention relates to a protein of the present invention, a transformed cell expressing the protein, a DNA of the present invention, a recombinant vector containing the DNA, or a cell transformed with the recombinant vector. The present invention relates to a method for screening for a substance that regulates the function or expression of the protein of the present invention, particularly a ligand, agonist or antagonist for the protein of the present invention, characterized by using a transformed cell. More specifically, (1) GPCR of candidate substance
A method for evaluating the activity of binding to 6318, (2) a method for evaluating the activity of the protein of the present invention in the presence / absence of a candidate substance, and (3) a method of the present invention in the presence / absence of a candidate substance. A method of comparing the expression level of a protein or gene and screening a substance that regulates the expression of the protein of the present invention can be used. As an example of (1) or (2), in the system shown in Example 6, a binding assay or activity measurement using a biological membrane or a transformed cell expressing GPCR6318 can be considered. As an example of (3), an expression plasmid in which a reporter gene such as luciferase is ligated to a DNA containing an expression control region of the gpcr6318 gene, a 5 ′ untranslated region, a region near the translation start site or a 5 ′ translated region, and the like, is prepared. A method of measuring the expression level of the reporter gene in the presence or absence of a candidate substance in an environment where the gene of the present invention is transcribed or translated, and confirming the transcription promoting activity or the transcription repressing activity of the candidate substance. . The expression control region and 5 ′ untranslated region of the gene of the present invention can be obtained by a known method (New Cell Engineering Protocol (Shujunsha), 1993).

The protein of the present invention is a GPCR specifically expressed in the liver, kidney and testis, and is presumed to be involved in the regulation of secretion of various physiologically active substances in these organs. Compounds and the like obtained through the above-described screening method or search using transgenic animals are expected to be therapeutic or preventive agents for various diseases caused by such secretion enhancement or imbalance of physiologically active substances. Candidate substances include, but are not limited to, proteins, peptides, oligonucleotides, synthetic compounds, naturally occurring compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc. May be.

[0075]

The present invention will be described in more detail with reference to the following Examples, but it should not be understood that the present invention is limited to these Examples.

Example 1 Cloning of gene gpcr6318 (1) Preparation of full-length cDNA library by oligocap method From human large intestine, the method of Sambrook et al. (Molecular Cloning. A)
^{Laboratory Manual, 2 nd ed. Cold} Spring Harbor Labo
ratory, Cold Spring Harbor, NY.)
Poly (A) ⁺ RNA was prepared using cellulose. Then 5-10
μg of poly (A) ⁺ RNA with 100 mM Tris-HCl (pH 8.0), 5 mM
2-mercaptoethanol and 100 U of RNasin (Promega)
1.2 U Bacterial Alkaline Phospha in a buffer containing
By reacting with tase (hereinafter abbreviated as BAP) (TaKaRa) at 37 ° C. for 40 minutes, poly (A) ⁺ RNA having no cap structure was dephosphorylated. Then, phenol: chloroform =
The reaction solution was extracted twice with a 1: 1 mixture, and the poly (A) ⁺ RNA was recovered as an ethanol precipitate. Recovered poly (A) ⁺ RNA
Is 50 mM sodium acetate (pH 5.5), 1 mM EDTA, 5 mM
20 U of Tobacco acidpyrophosphatase (hereinafter abbreviated as TAP) in a buffer containing 2-mercaptoethanol and 100 U of RNasin (Maruyama and Sugano, Gene vol. 138, 171-1)
74) at 37 ° C. for 45 minutes to remove the cap structure. Thereafter, the reaction solution was extracted twice with a phenol: chloroform = 1: 1 mixed solution, and ethanol precipitation was performed.
AP-TAP treated poly (A) ⁺ RNA was recovered.

0.4 μg of the recovered poly (A) ⁺ RNA2-4 μg
5 'oligomer (5'-AGC AUC GAGUCG GCC UUG UUG GC
Ligation reaction was performed with C UAC UGG-3 ′). The reaction is 50mM of Tris-HCl (pH7.5), 2- mercaptoethanol MgCl _2, 5 mM of 5 mM, 0.5 mM of ATP, 25% of PEG8000 and 10
In a buffer containing 0 U of RNasin, 250 U of RNA ligase (TaK
aRa) at 20 ° C. for 3-16 hours. Then, cDNA synthesis was performed by removing unreacted oligomers. That is,
2-4 μg of oligocap poly (A) ⁺ RNA was added to 10 pmol of dT adapter primer (5'-GCG GCT GAA GAC GGC CTA TGT
GGC CTT TTT TTT TTT TTT TTT-3 ') and mix with SuperSc
ript II RNase H ^- Reverse Transcriptase (GibcoBR
Using L), the mixture was reacted at 42 ° C. for 1 hour in the attached buffer.

After removing the template RNA by using 15 mM NaOH at 65 ° C. for 1 hour, cDNA was amplified. CDNA synthesized from 1 μg of oligocap poly (A) ⁺ RNA was combined with 16 pmol of sense primer 1 (5′-AGC ATC G
AG TCG GCC TTG TTG-3 ') and antisense primer
1 (5'-GCG GCT GAA GAC GGC CTA TGT-3 ')
Amplification was performed using XL PCR kit (Perkin-Elmer). The PCR reaction conditions at this time were: 94 ° C for 1 minute, 58 ° C for 1 minute, 72 ° C
For 5 minutes 10 cycles. The PCR product was extracted with a phenol: chloroform = 1: 1 mixture, and collected as an ethanol precipitate. Thereafter, the recovered product was digested with SfiI, and a cDNA of 1000 bp or more was separated by agarose gel electrophoresis, and the mammalian cell expression vector pME18S-FL3 was used.
(GenBank accession No. AB009864) at the DraIII site. Since the DraIII site of pME18S-FL3 is asymmetric and the end of the cDNA fragment is a SfiI site complementary to this, the inserted cDNA fragment is unidirectionally inserted.

(2) Analysis of cDNA clone base sequence and information on its deduced protein Plasmids were prepared from the cDNA library prepared by the methods (1) and (2) using a PI-100 robot (KURABO), and The nucleotide sequence of the clone was confirmed, and a database was created. For nucleotide sequencing, use the AutoCycle sequencing kit
(Amersham Pharmacia) and ROB DNA processor (A
mersham Pharmacia) and performed a sequencing reaction according to the attached protocol, and ALF DNA sequencer (Ame
rsham Pharmacia).

The plasmid obtained by the method described in (1)
C-COL06318 has a total length of 2399 base pairs including an open reading frame consisting of a base sequence of 1680 bases represented by SEQ ID NO: 1, which encodes a novel protein consisting of 560 amino acids represented by SEQ ID NO: 2. (SEQ ID NO: 3). Plasmid C-COL
06318 is registered with the International Microorganisms Depositary, the National Institute of Advanced Industrial Science and Technology, National Institute of Advanced Industrial Science and Technology
Deposited as 8272.

(3) Homology Analysis of cDNA Clone and Its Putative Protein For homology search, BLAST (J Mol Evol
36; 290-300 (1993), J Mol B
iol 215; 403-10 (1990)) for local sequence matches.

Using the blastp program for homology search of the protein sequence deduced from the C-COL06318 cDNA sequence, the Genbank protein database (ht
tp: // www. ncbi. nlm. nih. gov
A BLAST homology search was performed for /). Human CD97 antigen (GenB
ank Accession: XP_008973) 46%, 51
Bovine latlophilin-3 (GenBank A
ccession: AAD05332).

Further, the deduced protein sequence and the protein sequence obtained from the homology search were compared with the multiple alignment program ClustalW (Nucleic Acid).
sRes. 22; 4673-80 (1994)).

Transmembrane prediction program t using weight matrix
map (J Mol Biol. 237; 182-92)
(1994)), the transmembrane helix was predicted.
227th, 230-254th, 296-324th, 327-355th, 389-417th, 434-th
Transmembrane regions were predicted at the 454th position and the 463-483rd positions. FIG. 1 shows the structure of the GPCR6318 on the primary sequence. In the figure, TM indicates a transmembrane region.

Example 2 Analysis of Expression Profile Using ATAC-PCR Adapter-tagged competitive PCR (ATAC-PCR) was outsourced to an external organization and performed according to the method of Kato et al. (Nucleic Ac
ids Research, 1997, Vol.25, 4694-4696). The human RNA used in the analysis is as follows. Total amount of human coronary artery endothelial cells (HCAEC) and human placental tissue
RNA was prepared. In addition, leukocytes derived from human peripheral blood 50 μg /
After culturing for 24 hours in the presence of ml of PHA, total RNA was prepared by an ordinary method. In addition, human lung, kidney, pancreas, small intestine, thymus, spleen, heart, uterus, testis, prostate, skeletal muscle total
RNA was purchased from Clontech, and total RNA for liver, large intestine, leukocytes and brain was purchased from BioChain Institute. Next, single-stranded cDNA was synthesized from 6 μg of each of these total RNAs using an oligo dT primer according to a standard method.
SuperScriptIIRNase H ^- Reverse Tr as reverse transcriptase
Anscriptase (GibcoBRL) was used. The sequence of the C-COL06318-specific primer used for PCR was 5'-GTA GTG T
TG AAA AGG CAG AA-3 '. As a result of analysis, gpcr6318
Was specifically expressed only in the liver and testis (FIG. 3).

Example 3 Search for Transcription Start Position of gpcr6318 C-COL06318 contained a 5 'untranslated region consisting of about 220 base pairs. To search for the 5' end of cDNA, Nippon Gene's Cap Site was used. cDNA dT human liver cDNA as template
Nested PCR was performed. Primer is Cap Sit for 1st PCR
e cDNA dT Using the 1RDT primer attached to the sense primer as a sense primer, an antisense primer (5'-ACA AGC AAA TCC CCA CAC AC-3 ') specific to the 3' end sequence of C-COL06318, In PCR, the attached 2RDT Primer and 5 'of C-COL06318
Antisense primer specific to the terminal sequence (5'-TCT
TCA CTG GCA TCT AGG AG-3 ') was used. In addition, PLATINUM Taq (GibcoBRL) was used for the reaction. About 280b obtained
As a result of direct sequence of the PCR product of p, C-COL06318
An untranslated region with a length of 120 bp was further confirmed upstream of the 5 'end. That is, the full-length cDNA sequence of gpcr6318 is SEQ ID NO:
It was 2519 bp represented by 4 (SEQ ID NO: 4).

Example 4 Expression of Soluble GPCR6318 As a soluble GPCR6318 protein, a chimeric protein in which a His tag was bound to the C-terminal side of the extracellular domain was expressed. The expression plasmid was constructed by the following method. First, the sense primer (5'-GGA ATT CAA AGA AAG TTG CCA TAG TAA C
AG-3 ') and antisense primer (5'-CGG GAT CCA AG
T GAT TTG GGA TAT TGA TAA-3 ') and C-COL06318
Using a template as a template, a cycle of 98 ° C for 10 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute using Pyrobest DNA Polymerase (TaKaRa)
The PCR reaction was repeated 0 times. About 0.7 kb PCR obtained
The product was digested with EcoRI and BamHI and recovered by agarose gel electrophoresis. PcDNA3.1 (+) / Myc-His C (Invit
rogen) similarly digested with EcoRI and BamHI,
It was collected by agarose gel electrophoresis and used as a vector.
This vector DNA was ligated with the above-mentioned PCR fragment, and the competence and cell JM109 were transformed according to a standard method.
A 318ex-His tag chimeric protein expression plasmid was constructed.

12.5 μg of the obtained plasmid was added to FuGNEN6
(Roche Diagnostics, Inc.)
Mix according to protocol, 150cm^TwoSemiconf in flask
Added to COS-1 cells grown to Luent. 5% CO_Two, 37
After culturing for 72 hours under the condition of⁻Wash cells with
PBS containing 1% EDTA⁻ Cells were detached with 5 ml. PBS
⁻After washing twice more with 2% Triton X100, 0.5M NaCl
And Complete, EDTA-free (Roche Diagnostics)
Cells in PBS (pH 7.4) containing
Was. Then His Trap Kit (Amersham Pharmacia Bai
Otec Corporation), Bio Basic Experiment Guide 2000-20
01 (Amersham Pharmacia Biotech)
LO 6318-His was purified. Administer the obtained COLO 6318-His
The antigen was used.

Example 5 Preparation of Anti-GPCR6318 Monoclonal Antibody Purified soluble GPCR6318 protein prepared in Example 4 (GPCR63
18ex-His) was used as the administration antigen. The protein concentration was calculated using a protein quantification method (Bio-Rad) using BSA as a standard.

BALB / c mice 20 μg of antigen at 6 weeks of age
Was mixed in an equal volume with Freund's complete adjuvant (DIFCO) and administered intraperitoneally. 20 μg of antigen 2 weeks after administration
Was mixed with an equal amount of Freund's incomplete adjuvant (DIFCO) and then administered intraperitoneally. One week later, the increase in antibody titer was
It was confirmed by the LISA method. That is, purified GPCR6318ex
1 μg of -His in 0.01 M carbonate buffer (pH 9.5)
/ Ml and dilute 50 μl to an immunoplate (Maxiso
rb, NUNC), and allowed to react at 37 ° C. for 1 hour to solidify the antigen. After the plate was washed five times with ion-exchanged water, blocking was performed by adding 100 μl of 0.5% BSA / PBS. Discard the blocking solution and add 50 μl of the diluted series of antiserum diluted with PBS.
It was added and reacted at 37 ° C. for 1 hour. Next, 0.05% T
After washing three times with a saline solution containing ween 20, a peroxidase-labeled anti-mouse immunoglobulin antibody (DAKO) was diluted 1000-fold with PBS containing 10% rabbit serum, and 50 μl was added to each well. After reacting at 37 ° C. for 1 hour, washing was performed, and 50 μl of a tetramethylbenzidine solution containing 0.01% hydrogen peroxide was added to each well. After 10 minutes, the reaction was stopped with a 0.5 M sulfuric acid solution, and the absorbance at 450 nm was measured. Was measured. As a result, mice in which an increase in antibody titer was confirmed were selected and subjected to the following cell fusion. 100 μg of antigen diluted with saline was administered to the peritoneal cavity of the selected mice,
Three days later, the spleen was removed. Lymphocytes were separated from the spleen, and myeloma cells (P3 × 63-Ag. 8.U.1) and 1
0: 1 and mixed with polyethylene glycol 1540 (Si
gma) to perform cell fusion. Hybridomas were selected using a HAT medium, and after one week, screening of hybridomas producing the desired antibody was performed using the E described above.
Performed by the LISA method. From the results, the solid-phased GPCR63
Hybridomas producing antibodies that reacted with 18ex-His were selected and cloned by limiting dilution (monoclonal antibody experimental procedure, written by Tamie Ando, Kodansha). Ten days later, the same screening was carried out to obtain 12 hybridomas producing the anti-GPCR6318 monoclonal antibody.

To evaluate the above antibodies, hybridomas were cultured in 10% FCS / RPMI-1640 medium (GIBC
O), followed by Hybridoma-SFM medium (GI
(BCO) to produce an antibody, and a purified antibody was obtained using a Prosep-A column (Bioprocessing).

Example 6 Construction of Activity Measuring System The activity measuring system is described in Molecular Pharmacology, 56: p705-713 (1
999).

6-1) Preparation of GPCR6318-expressing cells C-COL06318 was digested with XhoI to cut out gpcr6318 cDNA. This DNA fragment was subcloned into a mammalian cell expression vector pCDNA3.1 (-) (Invitrogen) having a Neomycin resistance gene. The resulting plasmid is transferred to FuGENE 6
Was introduced into HEK293 cells, and a colony growing in the presence of 1.2 mg / ml G-418 was selected. The stable transformant (HEK6318) obtained in this way was 10% immobilized FBS, 100 U / ml
Penicillin, 100 μg / ml streptomycin, 1.2
The cells were subcultured and maintained in a DMEM medium containing mg / ml G-418, and cells were prepared by subculture immediately before use in the experiment using a medium without G-418.

6-2) Intracellular cAMP concentration measurement HEK6318 (3 × 10 ⁵ cells / ml) was added to a 24-well plate at 500 μl / weld.
After inoculation at 37 ° C. overnight in the presence of 5% CO _{2, the} medium was discarded, 450 μl of phenol red-free Eagle's MEM containing 0.1 mM papaverine was added, and the mixture was incubated at 37 ° C. for 15 minutes. Ligand or agonist / antagonist was prepared by dissolving phenol red-free Eagle's MEM containing 0.1 mM papaverine in 50 µl and adding, and incubated for 15 to 60 minutes. Buffer containing 2.5% dodecyltrimethylammonium (50 mM acetate buffer pH5.8 containing 0.02% BSA)
Was added to stop the reaction, the plate was centrifuged at 1500 rpm for 5 minutes, and 200 μl of the supernatant was collected and stored at −20 ° C.
The cAMP concentration contained in the stored culture supernatant was measured using an ELISA kit (Amersham-Pharmacia-Biotech). In this system, test drug (final 0.1% DMSO) before addition of ligand or agonist / antagonist
By adding, a substance that regulates the activity of the protein of the present invention can be screened.

6-3) Measurement of Intracellular Ca Concentration 1 μM of 1- [2- (5) was added to HEK6318 adhered on a culture plate.
-carboxyoxazol-2-yl) -6-aminobenzofuran-5-oxyl] -2'-
amino-5'-methylphenoxy) -ethane-N, N, N ', N',-tetraace
100 mM NaCl containing tic acid / acetoxymethyl ester, 5
mM KCl, 1 mM MgSO ₄ , 1 mM KH ₂ SO ₄ , 25 mM NaHCO ₃ , 0.5
mM CaCl ₂ , 2.7 g / l glucose, 20 mM Na-HEPES, 0.2
5% bovine serum albumin
Incubated for 5 minutes. The cells were washed, peeled off from the culture plate, and suspended at 1 × 10 ⁶ / mL in the above buffer except for bovine serum albumin. This cell suspension was placed in a cuvette kept at 37 ° C., and the fluorescence due to intracellular Ca was continuously measured using a spectrofluorometer. Excitation wavelength is 34
0 and 380 nm, and the absorption wavelength was 510 nM. The ligand or agonist / antagonist was added after the fluorescence was stabilized, and the change in intracellular Ca concentration was observed for 1 to 10 minutes. In this system, a substance that regulates the activity of the protein of the present invention can be screened by adding a test drug before adding a ligand or an agonist / antagonist.

[0096]

The GPCR6318 of the present invention is useful for identifying a ligand that specifically binds to the GPCR6318, and is useful for developing a drug that can act on a new biological control mechanism.

[0097]

[Sequence List] SEQUENCE LISTING <110> Mochida Pharmaceutical Co., Ltd. <120> Novel G-protein coupled reseptor <130> 45052 <160> 4 <170> PatentIn Ver. 2.1 <210> 1 <211> 1680 <212 > DNA <213> Homo sapiens <400> 1 atggagactt attccttgtc tttgggtaat caatcagtgg tggaacctaa catagcaata 60 cagtcagcaa atttctcttc agaaaatgcg gtggggcctt caaatgttcg cttctctgtg 120 cagaaaggag ctagcagttc tctagtttct agttcaacat ttatacatac aaatgtggat 180 ggccttaacc cagatgcaca gactgagctt caggtcttgc ttaatatgac gaaaaattac 240 accaagacat gcggctttgt agtttatcaa aatgacaagc ttttccaatc aaaaactttt 300 acagctaaat cggattttag tcaaaaaatt atctcaagca aaactgatga aaatgagcaa 360 gatcagagtg cttctgttga catggtcttt agtccaaagt acaaccaaaa agaatttcaa 420 ctctattcct atgcctgtgt ctattggaat ttgtcagcga aggactggga cacatatggc 480 tgtcaaaaag acaagggcac tgatggattc ctgcgctgcc gctgcaacca tactactaat 540 tttgctgtat taatgacttt cagaaaggat tatcaatatc ccaaatcact tgacatatta 600 tccaacgttg gatgtgcact gtctgttact ggtctggctc tcacagttat atttcagatt 660 gtcaccagga aagtcagaa a aacctcagta acctgggttt tggtcaatct gtgcatatca 720 atgttgattt tcaacctcct ctttgtgttt ggaattgaaa actccaataa gaacttgcag 780 acaagtgatg gtgacatcaa taatattgac tttgacaata atgacatacc caggacagac 840 accattaaca tcccgaatcc catgtgcact gcgattgccg ccttactgca ctattttctg 900 ttagtgacat ttacctggaa cgcactcagc gctgcacagc tctattacct tctaataagg 960 accatgaagc ctcttcctcg gcatttcatt cttttcatct cattaattgg atggggagtc 1020 ccagctatag tagtggctat aacagtggga gttatttatt ctcagaatgg aaataatcca 1080 cagtgggaat tagactaccg gcaagagaaa atctgctggc tggcaattcc agaacccaat 1140 ggtgttataa aaagtccgct gttgtggtca ttcatcgtac ctgtaaccat tatcctcatc 1200 agcaatgttg ttatgtttat tacaatctcg atcaaagtgc tgtggaagaa taaccagaac 1260 ctgacaagca caaaaaaagt ttcatccatg aagaagattg ttagcacatt atctgttgca 1320 gttgtttttg gaattacctg gattctagca tacctgatgc tagttaatga tgatagcatc 1380 aggatcgtct tcagctacat attctgcctt ttcaacacta cacagggatt gcaaattttt 1440 atcctgtaca ctgttagaac aaaagtcttc cagagtgaag cttccaaagt gttgatgttg 1500 ctatcgtcta ttgggagaag gaagtcatt g ccttcagtga cgcggccgag gctgcgtgta 1560 aagatgtata atttcctcag gtcattgcca accttacatg aacgctttag gctactggaa 1620 acctctccga gtactgagga aatcacactc tctgaaagtg acaatgcaaa ggaaagcat2 1120 <G> 1T <1> T <T> g <1> T <T> g <1> T <T> g <1> T> G Gln Ser Val Val Glu Pro 1 5 10 15 Asn Ile Ala Ile Gln Ser Ala Asn Phe Ser Ser Glu Asn Ala Val Gly 20 25 30 Pro Ser Asn Val Arg Phe Ser Val Gln Lys Gly Ala Ser Ser Ser Leu 35 40 45 Val Ser Ser Ser Thr Phe Ile His Thr Asn Val Asp Gly Leu Asn Pro 50 55 60 Asp Ala Gln Thr Glu Leu Gln Val Leu Leu Asn Met Thr Lys Asn Tyr 65 70 75 80 Thr Lys Thr Cys Gly Phe Val Val Tyr Gln Asn Asp Lys Leu Phe Gln 85 90 95 Ser Lys Thr Phe Thr Ala Lys Ser Asp Phe Ser Gln Lys Ile Ile Ser 100 105 110 Ser Lys Thr Asp Glu Asn Glu Gln Asp Gln Ser Ala Ser Val Asp Met 115 120 125 Val Phe Ser Pro Lys Tyr Asn Gln Lys Glu Phe Gln Leu Tyr Ser Tyr 130 135 140 Ala Cys Val Tyr Trp Asn Leu Ser Ala Lys Asp Trp Asp Thr Tyr Gly 145 150 155 160 Cys Gln Lys A sp Lys Gly Thr Asp Gly Phe Leu Arg Cys Arg Cys Asn 165 170 175 His Thr Thr Asn Phe Ala Val Leu Met Thr Phe Arg Lys Asp Tyr Gln 180 185 190 Tyr Pro Lys Ser Leu Asp Ile Leu Ser Asn Val Gly Cys Ala Leu Ser 195 200 205 Val Thr Gly Leu Ala Leu Thr Val Ile Phe Gln Ile Val Thr Arg Lys 210 215 220 Val Arg Lys Thr Ser Val Thr Trp Val Leu Val Asn Leu Cys Ile Ser 225 230 235 240 Met Leu Ile Phe Asn Leu Leu Phe Val Phe Gly Ile Glu Asn Ser Asn 245 250 255 Lys Asn Leu Gln Thr Ser Asp Gly Asp Ile Asn Asn Ile Asp Phe Asp 260 265 270 270 Asn Asn Asp Ile Pro Arg Thr Asp Thr Ile Asn Ile Pro Asn Pro Met 275 280 285 Cys Thr Ala Ile Ala Ala Leu Leu His Tyr Phe Leu Leu Val Thr Phe 290 295 300 Thr Trp Asn Ala Leu Ser Ala Ala Gln Leu Tyr Tyr Leu Leu Ile Arg 305 310 315 320 Thr Met Lys Pro Leu Pro Arg His Phe Ile Leu Phe Ile Ser Leu Ile 325 330 335 Gly Trp Gly Val Pro Ala Ile Val Val Ala Ile Thr Val Gly Val Ile 340 345 350 Tyr Ser Gln Asn Gly Asn Asn Pro Gln Trp Glu Leu Asp Tyr Arg Gln 355 360 365 Glu Lys Ile Cys T rp Leu Ala Ile Pro Glu Pro Asn Gly Val Ile Lys 370 375 380 Ser Pro Leu Leu Trp Ser Phe Ile Val Pro Val Thr Ile Ile Leu Ile 385 390 395 400 Ser Asn Val Val Met Phe Ile Thr Ile Ser Ile Lys Val Leu Trp Lys 405 410 415 Asn Asn Gln Asn Leu Thr Ser Thr Lys Lys Val Ser Ser Met Lys Lys 420 425 430 Ile Val Ser Thr Leu Ser Val Ala Val Val Phe Gly Ile Thr Trp Ile 435 440 445 Leu Ala Tyr Leu Met Leu Val Asn Asp Asp Ser Ile Arg Ile Val Phe 450 455 460 Ser Tyr Ile Phe Cys Leu Phe Asn Thr Thr Gln Gly Leu Gln Ile Phe 465 470 475 480 Ile Leu Tyr Thr Val Arg Thr Lys Val Phe Gln Ser Glu Ala Ser Lys 485 490 495 495 Val Leu Met Leu Leu Ser Ser Ile Gly Arg Arg Lys Ser Leu Pro Ser 500 505 510 Val Thr Arg Pro Arg Leu Arg Val Lys Met Tyr Asn Phe Leu Arg Ser 515 520 525 Leu Pro Thr Leu His Glu Arg Phe Arg Leu Leu Glu Thr Ser Pro Ser 530 535 540 Thr Glu Glu Ile Thr Leu Ser Glu Ser Asp Asn Ala Lys Glu Ser Ile 545 550 555 560 <210> 3 <211> 2399 <212> DNA <213> Homo sapiens <400> 3 tccagatttt aacatctgat gccaataaat taac tgctga gaacatcact agtgctacgc 60 gagtggttgg acagatattc aacacttcca gaaatgcttc acctgaggca aagaaagttg 120 ccatagtaac agtgagtcaa ctcctagatg ccagtgaaga tgcttttcaa agagttgctg 180 ctactgctaa tgatgatgcc cttacaacgc ttattgagca aatggagact tattccttgt 240 ctttgggtaa tcaatcagtg gtggaaccta acatagcaat acagtcagca aatttctctt 300 cagaaaatgc ggtggggcct tcaaatgttc gcttctctgt gcagaaagga gctagcagtt 360 ctctagtttc tagttcaaca tttatacata caaatgtgga tggccttaac ccagatgcac 420 agactgagct tcaggtcttg cttaatatga cgaaaaatta caccaagaca tgcggctttg 480 tagtttatca aaatgacaag cttttccaat caaaaacttt tacagctaaa tcggatttta 540 gtcaaaaaat tatctcaagc aaaactgatg aaaatgagca agatcagagt gcttctgttg 600 acatggtctt tagtccaaag tacaaccaaa aagaatttca actctattcc tatgcctgtg 660 tctattggaa tttgtcagcg aaggactggg acacatatgg ctgtcaaaaa gacaagggca 720 ctgatggatt cctgcgctgc cgctgcaacc atactactaa ttttgctgta ttaatgactt 780 tcagaaagga ttatcaatat cccaaatcac ttgacatatt atccaacgtt ggatgtgcac 840 tgtctgttac tggtctggct ctcacagtta tatttcagat tgtcaccagg aaa gtcagaa 900 aaacctcagt aacctgggtt ttggtcaatc tgtgcatatc aatgttgatt ttcaacctcc 960 tctttgtgtt tggaattgaa aactccaata agaacttgca gacaagtgat ggtgacatca 1020 ataatattga ctttgacaat aatgacatac ccaggacaga caccattaac atcccgaatc 1080 ccatgtgcac tgcgattgcc gccttactgc actattttct gttagtgaca tttacctgga 1140 acgcactcag cgctgcacag ctctattacc ttctaataag gaccatgaag cctcttcctc 1200 ggcatttcat tcttttcatc tcattaattg gatggggagt cccagctata gtagtggcta 1260 taacagtggg agttatttat tctcagaatg gaaataatcc acagtgggaa ttagactacc 1320 ggcaagagaa aatctgctgg ctggcaattc cagaacccaa tggtgttata aaaagtccgc 1380 tgttgtggtc attcatcgta cctgtaacca ttatcctcat cagcaatgtt gttatgttta 1440 ttacaatctc gatcaaagtg ctgtggaaga ataaccagaa cctgacaagc acaaaaaaag 1500 tttcatccat gaagaagatt gttagcacat tatctgttgc agttgttttt ggaattacct 1560 ggattctagc atacctgatg ctagttaatg atgatagcat caggatcgtc ttcagctaca 1620 tattctgcct tttcaacact acacagggat tgcaaatttt tatcctgtac actgttagaa 1680 caaaagtctt ccagagtgaa gcttccaaag tgttgatgtt gctatcgtct attgggagaa 1740 ggaagtcatt gccttcagtg acgcggccga ggctgcgtgt aaagatgtat aatttcctca 1800 ggtcattgcc aaccttacat gaacgcttta ggctactgga aacctctccg agtactgagg 1860 aaatcacact ctctgaaagt gacaatgcaa aggaaagcat ctagacagta aaacttacct 1920 gttgtggtct ttttaatcac ctcgcttgag ttttatctgt ctctctcctt tatttcccag 1980 tcctctcaga aagtcttcct caatgtattt tgctcaggat taagaattag ataaaacctg 2040 ttgtttatta ttattcggca taatggactt ggtagttttt ctatttttca atagatttgt 2100 acttgaataa ggtgaagaat ttcacacaac atacaagagt accattgttc cttatatcgt 2160 taaatctttg tgacacactt tgacaaaaat gtagaaccta taacaaattc ttttacaagt 2220 tactataaag gacacaaaga gaaaacttta ccttccagaa caaaatgact cctgatgaac 2280 agtgtgtggg gatttgcttg tatgtattaa acttttgacc tctgaatatt ttacagtcgt 2340 atgtgcttgt acttttattt ccaatgaaga atttggcacc aaaaaaaaaa aaaaaaaaa 2399 <210> 4 <211> 2519 <212> DNA <213> Homo sapiens <400> 4 ATTTACCTGC AGTTGCTTAC AAAGTGTTTG GACATAATTG TGTAAAGCTA GGGTTTTTTT 60 TCTGGTTTTT AAAACAGGTA AAGGATGTCA CAGCACCACT TAATAACATT TCTTCTGAAG 120 TCCAGATTTT AACATCTGA T GCCAATAAAT TAACTGCTGA GAACATCACT AGTGCTACGC 180 GAGTGGTTGG ACAGATATTC AACACTTCCA GAAATGCTTC ACCTGAGGCA AAGAAAGTTG 240 CCATAGTAAC AGTGAGTCAA CTCCTAGATG CCAGTGAAGA TGCTTTTCAA AGAGTTGCTG 300 CTACTGCTAA TGATGATGCC CTTACAACGC TTATTGAGCA AATGGAGACT TATTCCTTGT 360 CTTTGGGTAA TCAATCAGTG GTGGAACCTA ACATAGCAAT ACAGTCAGCA AATTTCTCTT 420 CAGAAAATGC GGTGGGGCCT TCAAATGTTC GCTTCTCTGT GCAGAAAGGA GCTAGCAGTT 480 CTCTAGTTTC TAGTTCAACA TTTATACATA CAAATGTGGA TGGCCTTAAC CCAGATGCAC 540 AGACTGAGCT TCAGGTCTTG CTTAATATGA CGAAAAATTA CACCAAGACA TGCGGCTTTG 600 TAGTTTATCA AAATGACAAG CTTTTCCAAT CAAAAACTTT TACAGCTAAA TCGGATTTTA 660 GTCAAAAAAT TATCTCAAGC AAAACTGATG AAAATGAGCA AGATCAGAGT GCTTCTGTTG 720 ACATGGTCTT TAGTCCAAAG TACAACCAAA AAGAATTTCA ACTCTATTCC TATGCCTGTG 780 TCTATTGGAA TTTGTCAGCG AAGGACTGGG ACACATATGG CTGTCAAAAA GACAAGGGCA 840 CTGATGGATT CCTGCGCTGC CGCTGCAACC ATACTACTAA TTTTGCTGTA TTAATGACTT 900 TCAGAAAGGA TTATCAATAT CCCAAATCAC TTGACATATT ATCCAACGTT GGATGTGCAC 960 TGTCTGTTAC TGGTCTGGCT CTCACAGTTA TATTTCA GAT TGTCACCAGG AAAGTCAGAA 1020 AAACCTCAGT AACCTGGGTT TTGGTCAATC TGTGCATATC AATGTTGATT TTCAACCTCC 1080 TCTTTGTGTT TGGAATTGAA AACTCCAATA AGAACTTGCA GACAAGTGAT GGTGACATCA 1140 ATAATATTGA CTTTGACAAT AATGACATAC CCAGGACAGA CACCATTAAC ATCCCGAATC 1200 CCATGTGCAC TGCGATTGCC GCCTTACTGC ACTATTTTCT GTTAGTGACA TTTACCTGGA 1260 ACGCACTCAG CGCTGCACAG CTCTATTACC TTCTAATAAG GACCATGAAG CCTCTTCCTC 1320 GGCATTTCAT TCTTTTCATC TCATTAATTG GATGGGGAGT CCCAGCTATA GTAGTGGCTA 1380 TAACAGTGGG AGTTATTTAT TCTCAGAATG GAAATAATCC ACAGTGGGAA TTAGACTACC 1440 GGCAAGAGAA AATCTGCTGG CTGGCAATTC CAGAACCCAA TGGTGTTATA AAAAGTCCGC 1500 TGTTGTGGTC ATTCATCGTA CCTGTAACCA TTATCCTCAT CAGCAATGTT GTTATGTTTA 1560 TTACAATCTC GATCAAAGTG CTGTGGAAGA ATAACCAGAA CCTGACAAGC ACAAAAAAAG 1620 TTTCATCCAT GAAGAAGATT GTTAGCACAT TATCTGTTGC AGTTGTTTTT GGAATTACCT 1680 GGATTCTAGC ATACCTGATG CTAGTTAATG ATGATAGCAT CAGGATCGTC TTCAGCTACA 1740 TATTCTGCCT TTTCAACACT ACACAGGGAT TGCAAATTTT TATCCTGTAC ACTGTTAGAA 1800 CAAAAGTCTT CCAGAGTGAA GCTTCCAAAG TGTTGATGTT GC TATCGTCT ATTGGGAGAA 1860 GGAAGTCATT GCCTTCAGTG ACGCGGCCGA GGCTGCGTGT AAAGATGTAT AATTTCCTCA 1920 GGTCATTGCC AACCTTACAT GAACGCTTTA GGCTACTGGA AACCTCTCCG AGTACTGAGG 1980 AAATCACACT CTCTGAAAGT GACAATGCAA AGGAAAGCAT CTAGACAGTA AAACTTACCT 2040 GTTGTGGTCT TTTTAATCAC CTCGCTTGAG TTTTATCTGT CTCTCTCCTT TATTTCCCAG 2100 TCCTCTCAGA AAGTCTTCCT CAATGTATTT TGCTCAGGAT TAAGAATTAG ATAAAACCTG 2160 TTGTTTATTA TTATTCGGCA TAATGGACTT GGTAGTTTTT CTATTTTTCA ATAGATTTGT 2220 ACTTGAATAA GGTGAAGAAT TTCACACAAC ATACAAGAGT ACCATTGTTC CTTATATCGT 2280 TAAATCTTTG TGACACACTT TGACAAAAAT GTAGAACCTA TAACAAATTC TTTTACAAGT 2340 TACTATAAAG GACACAAAGA GAAAACTTTA CCTTCCAGAA CAAAATGACT CCTGATGAAC 2400 AGTGTGTGGG GATTTGAATCTTTGTTAGAATCTTTGACC ATCTGA TGA TGA TGA TGA TGA TGA TGA

[Brief description of the drawings]

FIG. 1. GPCR6318 and human CD97 antigen (Ge
nBank Accession: XP_008973) and bovine latlophilin-
3 shows the results of amino acid sequence alignment with 3 (GenBank Accession: AAD05332).

FIG. 2 shows a structural diagram of the primary sequence of GPCR6318.

FIG. 3 shows the expression profile of the gpcr6318 gene in human organs and various cells.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 1/21 C12P 21/08 4H045 5/10 C12Q 1/02 C12P 21/08 1/68 A C12Q 1 / 02 G01N 33/15 Z 1/68 33/50 Z G01N 33/15 C12N 15/00 ZNAA 33/50 5/00 A (72) Inventor Tomohiro Takahashi 1-7 Yotsuya, Shinjuku-ku, Tokyo Mochida Pharmaceutical Co., Ltd. F-term (reference) 2G045 AA34 AA35 BB01 BB07 BB10 BB20 BB50 BB51 DA13 DA36 FA29 FB01 FB02 FB03 FB13 GC15 4B024 AA01 AA11 BA63 CA04 DA01 DA02 DA05 DA11 EA04 GA11 4B063 QA01 QA13 QA18 QQ02 QQ20 QQ42 QR55 QR80 QS34 4B064 AG27 DA03 DA13 4B065 AA01X AA57X AA87X AA93Y AB01 AC14 BA02 CA24 CA44 CA46 4H045 AA10 AA11 BA10 CA40 DA50 DA76 EA20 EA50 FA71 FA72

Claims (11)

[Claims] 1. A DNA of the following (a) or (b): (a) a DNA consisting of the nucleotide sequence of SEQ ID NO: 1; (b) hybridizing with a DNA of SEQ ID NO: 1 under stringent conditions And a G protein-coupled receptor protein-encoding DNA. 2. A protein encoded by the DNA according to claim 1. 3. A protein of the following (a) or (b): (a) a protein consisting of the amino acid sequence of SEQ ID NO: 2; (b) an amino acid deleted or substituted in the amino acid sequence of SEQ ID NO: 2 Or G comprising the added amino acid sequence
Protein-coupled receptor protein. 4. A recombinant vector containing the DNA according to claim 1. 5. A transformed cell transformed with the recombinant vector according to claim 4. 6. An antisense nucleic acid that suppresses the expression of the protein according to claim 2 or 3. 7. The antisense nucleic acid according to claim 6, wherein the nucleic acid sequence is a sequence complementary to all or a part of the nucleic acid of the DNA according to claim 1. 8. An antibody against the protein according to claim 2 or 3 or a partial peptide thereof. 9. A method according to claim 2, wherein a candidate substance is brought into contact with the protein according to claim 2 or the transformed cell expressing the protein, and a change in cell response is measured.
A method for identifying a ligand for the protein. 10. A method for regulating the activity of a protein according to claim 2, wherein the candidate substance is brought into contact with the protein according to claim 2 or 3 or a transformed cell expressing the protein, and a change in cell response is measured. How to search for substances that show action. 11. A recombinant vector according to claim 4 or a transformed cell according to claim 5, which is brought into contact with a candidate substance, and a change in the expression level of the DNA according to claim 1 is detected. 2. The method for searching for a substance exhibiting a DNA expression regulating action according to claim 1.