US20020164802A1 - Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer - Google Patents

Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer Download PDF

Info

Publication number
US20020164802A1
US20020164802A1 US10/136,139 US13613902A US2002164802A1 US 20020164802 A1 US20020164802 A1 US 20020164802A1 US 13613902 A US13613902 A US 13613902A US 2002164802 A1 US2002164802 A1 US 2002164802A1
Authority
US
United States
Prior art keywords
adenovirus
nucleic acid
cell
deletion
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/136,139
Inventor
Frits Fallaux
Robert Hoeben
Abraham Bout
Domenico Valerio
Alex van der Eb
Govert Schouten
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=26139401&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20020164802(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Individual filed Critical Individual
Priority to US10/136,139 priority Critical patent/US20020164802A1/en
Publication of US20020164802A1 publication Critical patent/US20020164802A1/en
Priority to US11/134,674 priority patent/US8236293B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10Cells modified by introduction of foreign genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10321Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10351Methods of production or purification of viral material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10351Methods of production or purification of viral material
    • C12N2710/10352Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/15Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/60Vector systems having a special element relevant for transcription from viruses

Definitions

  • the present invention relates to the field of recombinant DNA technology, more in particular to the field of gene therapy. Specifically, the present invention relates to gene therapy using materials derived from adenovirus, in particular human recombinant adenovirus, and relates to novel virus derived vectors and novel packaging cell lines for vectors based on adenoviruses. Furthermore, this invention also pertains to the screening of replication-competent and revertant E1 and/or E2A adenoviruses from recombinant adenoviruses used in gene therapy.
  • E1 early region 1
  • CTLs cytotoxic T-lymphocytes
  • Activated CTLs subsequently eradicate transduced cells from the recipient. Consistent with this, the longevity of transgene expression is significantly extended in immuno-deficient and immuno-compromised animals.
  • Expression of at least some adenoviral genes in a target cell is at least in part due to background replication of the recombinant adenoviral vector genome and/or background activity of promoters driving the respective adenoviral genes (Yang et al., Nature Genet. 7: 362, 1994; Lusky et al., J. Virol. 72: 2022, 1998).
  • an immune response may be mounted against transduced cells. Such an immune response is often not desired, especially when long-term expression of a transgene is aimed for.
  • adenovirus proteins in a target cell in a recipient may cause the immune system of the recipient to remove the target cell
  • Proteins encoded by expressed adenovirus genes can be processed into small peptides in a proteosome of the target cell. Peptides produced during this processing can subsequently be presented at the cell surface of the transduced cells in the complex of MHC class-I and ⁇ 2-microglobulin molecules.
  • one or more of the peptides may be recognized as non-self peptides by circulating CTLs whereupon transduced cells can be eradicated from the recipient (reviewed in Ploegh, Science 280: 248, 1998).
  • the present invention provides at least in part a solution to the problem of undesired removal of target cells in a recipient.
  • the present invention also provides, at least in part, a solution for the immune response against viral proteins.
  • the invention provides improved recombinant adenoviral vectors that, in addition to deletion of E1, are also deleted for the adenoviral early 2A gene (“E2A gene” or “E2A”).
  • E2A gene adenoviral early 2A gene
  • the protein encoded by E2A is expressed from recombinant E1-deleted adenoviral vectors.
  • E2A E1-deleted recombinant adenoviral vectors induces the expression of the viral late genes, since DNA binding protein (“DBP”) has a positive regulatory effect on the adenovirus major late promoter (“MLP”) and, therefore, on the expression of the late genes (Chang et al., J Virol. 64: 2103, 1990).
  • DBP DNA binding protein
  • MLP adenovirus major late promoter
  • Deletion of the E2A gene from the recombinant adenoviral genome will therefore improve the characteristics of recombinant adenoviral vectors.
  • deletion of E2A will eliminate the synthesis of DBP.
  • it will inhibit the background replication of the recombinant adenoviral backbone.
  • it will increase the capacity of the vector to harbor larger and/or multiple transgenes.
  • the E2A gene encodes the 72-kDa protein single stranded DBP whose activity is pivotal for the adenovirus DNA replication (reviewed in The Molecular Repertoire of Adenoviruses II, Springer-Verlag 1995). Therefore, manufacturing of vectors that are deleted for E2A requires a cell line that complements for the deletion of E2A in the recombinant adenoviral vector. Major hurdles in this approach are:
  • the current invention involves the use of a temperature sensitive mutant of E2A derived from a temperature sensitive adenovirus under control of strong viral enhancer sequences, e.g., the cytomegalovirus enhancer for the generation of E2A complementing cell lines.
  • DBP ts125E2A
  • hAd5ts125 is inactive at 39° C., but is fully active at 32° C. High levels of this protein can be maintained in the new complementing cells of the invention at the non-permissive temperature, until the switch is made to the permissive temperature.
  • the invention also provides means and methods to use the complementing cell line, comprising E2A, tsE2A, or both E1 and tsE2A, for the generation of E2A- or E1- and E2A-deleted adenoviral vectors.
  • the invention also involves inducible expression of E2A or tsE2A.
  • the invention also provides new cell lines that complement for E2A or for both the E1 and the E2A deletion in the vector.
  • the invention also provides new recombinant adenoviral vectors deleted for E2A or both E1 and E2A.
  • FIG. 1 depicts the temperature dependent growth of PER.C6.
  • PER.C6 cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% Fetal Bovine Serum (FBS, Gibco BRL) and 10 mM MgCl 2 in a 10% CO 2 atmosphere at either 32° C., 37° C. or 39° C.
  • FBS Fetal Bovine Serum
  • MgCl 2 MgCl 2
  • FIG. 2 depicts DBP levels in PER.C6 cells transfected with pcDNA3, pcDNA3wtE2A or pcDNA3ts125E2A. Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes and DBP protein was visualized using the aDBP monoclonal B6 in an ECL detection system. All of the cell lines derived from the pcDNA3ts 125E2A transfection express the 72-kDa E2A-encoded DBP protein (left panel, lanes 4-14; middle panel, lanes 1-13; right panel, lanes 1-12).
  • FIG. 3 depicts DBP expression in pcDNA3ts125E2A transfected 293 cells. Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes and DBP protein was visualized using the aDBP monoclonal B6 in an ECL detection system. Clone 20 (lane 8) from the pcDNA3ts125E2A transfected 293 cells expressed the full-length ts125E2A encoded 72-kDa DBP. No E2A encoded DBP was detected in the extract from a cell line (clone 4) derived from the pcDNA3 transfected 293 cells (lane 1), which serves as a negative control.
  • Extract from PER.C6 cells stably expressing ts125E2A encoded DBP (polyclonal cell line 5) (lane 2) served as a positive control for the Western blot procedure.
  • the other 293 clones either did not express ts125E2A encoded DBP (clones 21 and 22, lanes 9 and 10 respectively) or expressed aberrant products running with a faster (clones 3, 12, 16 and 18, lanes 4-7) or slower (clone 2, lane 3) mobility in SDS/PAGE.
  • FIG. 4 depicts suspension growth of PER.C6ts125E2A cell line c5-9.
  • PER.C6ts125E2Ac5-9 cells were seeded in a 125ml tissue culture Erlenmeyer at a seeding density of 3 ⁇ 10 5 cells per ml in a total volume of 20 ml serum-free medium. Cells were further cultured at 125 RPM on an orbital shaker at 39° C. in a 10% CO 2 atmosphere. Cells were counted at each of days 1-6. The mean growth curve from 8 cultures is shown.
  • PER.C6ts125E2Ac5-9 performs well in serum-free suspension culture. The maximum cell density of approximately 2 ⁇ 10 6 cells per ml is reached within 5 days of culture.
  • FIG. 5 depicts growth curve PER.C6 and PER.C6tsE2A.
  • PER.C6 cells or PER.C6ts125E2A (c8-4) cells were cultured at 37° C. or 39° C., respectively.
  • a total of 1 ⁇ 10 6 cells was seeded per 25 cm 2 tissue culture flask.
  • cells were counted.
  • the growth of PER.C6 cells at 37° C. is comparable to the growth of PER.C6ts125E2A c8-4 at 39° C. This shows that constitutive over-expression of ts125E2A has no adverse effect on the growth of cells at the non-permissive temperature of 39° C.
  • FIG. 6 depicts stability of PER.C6ts125E2A.
  • the PER.C6ts125E2A cell line clone 8-4 was cultured at 39° C. in medium without G418. Equal amounts of whole-cell extract from different passage numbers were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes and DBP protein was visualized using the aDBP monoclonal B6 in an ECL detection system.
  • the expression of ts125E2A encoded DBP is stable for at least 16 passages, which is equivalent to approximately 40 cell doublings. No decrease in DBP levels was observed during this culture period, indicating that the expression of ts125E2A is stable, even in the absence of G418 selection pressure.
  • FIG. 7 depicts revertant-free manufacturing of DE1/E2A vectors.
  • the recombinant adenoviral vector DNA was screened for reversion of the E2A deleted phenotype by PCR.
  • E2A sequences were amplified from the DNA samples (+) and control samples ( ⁇ ) spiked with both 1, 10 and 40 molecules using primer set A, as evidenced by the amplification of a 260 base pair (“bp”) DNA fragment.
  • bp 260 base pair
  • the PCR reactions with primer set B yielded the expected DNA fragment of 169 bp in the samples containing the recombinant adenoviral vector DNA (+). From the negative control samples containing the water instead of DNA ( ⁇ ), no DNA fragment of 169 bp was amplified.
  • FIG. 8 depicts transduction of HeLa cells with IG.Ad/CMV.LacZ and IG.Ad/CMV.LacZDE2A.
  • HeLa cells were infected with a multiplicity of infection (“m.o.i.”) of either 0, 10, 100 or 1000 viral particles IG.Ad/CMV.LacZ or IG.Ad/CMV.LacZDE2A per cell. Forty-eight hours post infection, cells were stained with X-gal solution.
  • IG.Ad/CMV.LacZDE2A transduced HeLa cells stained at least as good as did IG.Ad/CMV.LacZ, at all m.o.i.'s.
  • FIG. 9 depicts luciferase activity in infected A549 and HeLa cells.
  • HeLa and A549 cells were infected with a m.o.i. of either 0, 10, 100, 1,000 or 10,000 virus particles (“vp”) IG.Ad/CLIP.Luc or IG.Ad/CLIP.LucDE2A per cell.
  • vp virus particles
  • IG.Ad/CLIP.Luc virus particles
  • IG.Ad/CLIP.LucDE2A Two days post infection, cells were lysed and the luciferase activity was determined.
  • Both the IG.Ad/CLIP.LucDE2A infected HeLa and A549 cells produce more luciferase enzyme than the IG.Ad/CLIP.Luc infected HeLa and A549 and HeLa cells, at all m.o.i.'s tested.
  • FIG. 10 depicts the expression of DBP, Penton and Fiber.
  • A549 cells were infected with a m.o.i. of either 0, 100, 1,000 or 10,000 vp/cell IG.Ad/CLIP or IG.Ad.CLIPDE2A. Seventy-two hours post infection, cell extracts were prepared and equal amounts of whole cell extract were fractionated by SDS-PAGE on 10% gels. The proteins were visualized with the aDBP monoclonal B6, the polyclonal a-Penton base Ad2-Pb571 or the polyclonal a-knob domain of fiber E641/3, using an ECL detection system.
  • IG.Ad.CLIP Cells infected with IG.Ad.CLIP express both E2A encoded DBP, Penton base and Fiber proteins.
  • the proteins co-migrate with the respective proteins in the positive control (lane P, extract from PER.C6 cells infected with IG.Ad.CLIP harvested at starting CPE).
  • no DBP, penton-base or fiber was detected in the non-infected A549 cells or cells infected with IG.Ad.CLIPDE2A.
  • a cell according to the invention is capable of at least, in part, complementing adenovirus E2A function of an adenovirus defective in E2A function.
  • a cell includes a nucleic acid encoding adenovirus E2A or a functional part, derivative and/or analogue thereof, integrated into the genome of the cell.
  • the cell has E2A nucleic acid derived from a temperature sensitive adenovirus such as but not limited to adenovirus ts125. More preferably, such a cell further includes a nucleic acid encoding adenovirus E1-region proteins or a functional part, derivative and/or analogue thereof.
  • Such a cell could be derived from the “PER.C6” cell line (commercially available from IntroGene, by, and deposited, under ECACC deposit accession number 96022940 under the provisions of the Budapest Treaty with the Centre for Applied Microbiology and Research Authority (European Collection of Animal Cell Cultures), Porton Down, Salisbury, Wiltshire SP4, OJG, United Kingdom, an International Depository Authority, in accordance with the Budapest Treaty, on Feb. 29, 1996.
  • the invention also includes a method for producing an adenovirus particle containing an adenovirus vector with a functional deletion of E2A.
  • a method for producing an adenovirus particle containing an adenovirus vector with a functional deletion of E2A involves providing a cell as previously described with the functionally deleted adenovirus vector, culturing the cell, and harvesting the virus particle.
  • the functional deletion can comprise a deletion of at least part of the nucleic acid encoding E2A.
  • the nucleic acid encoding adenovirus E2A in the genome of the cell preferably has no sequence overlap with the vector which leads to replication competent adenovirus and/or to the formation of an adenovirus vector comprising E2A function.
  • the adenovirus vector preferably further comprises a functional deletion of E1-region encoding nucleic acid, comprising providing one of the previously described cells with the adenovirus vector, culturing the cell and harvesting the virus particle.
  • the nucleic acid encoding adenovirus E1-region preferably does not comprise sequence overlap with the vector which leads to replication competent adenovirus and/or to the formation of an adenovirus vector comprising an E1 function.
  • the adenovirus vector further comprises at least one nucleic acid of interest.
  • the invention also includes an adenovirus vector comprising a functional deletion of adenovirus E2A.
  • a functional deletion is preferably a deletion of at least part of the nucleic acid encoding E2A.
  • the deletion may encompass the entire coding region of E2A.
  • Such an adenovirus vector preferably includes a deletion corresponding to a deletion of nucleotides 22443 to 24032 in adenovirus 5.
  • the deletion can include a deletion of nucleic acid encoding E1-region proteins.
  • the deletion of nucleic acid encoding E1-region proteins can comprise a deletion corresponding to a deletion of nucleotides 459 to 3510 in adenovirus 5.
  • the adenovirus vector preferably further includes at least one nucleic acid of interest.
  • An adenovirus vector according to the invention can, but does not necessarily, also comprise at least a deletion of a region which in adenovirus 5 corresponds to nucleotides 22418-24037 or a deletion of a region which in adenovirus 5 corresponds to nucleotides 22443-24032.
  • Such vectors can further comprise at least nucleic acid which in adenovirus 5 corresponds to nucleotides 3534-22347 and/or nucleotides 24060 until the right ITR or at least 3534-22417 and/or 24038 until the right ITR or at least nucleic acid which in adenovirus 5 corresponds to nucleotides 3534-22442 and/or nucleotides 24033 until the right ITR.
  • the invention also includes preparations of adenovirus vector containing adenovirus particles wherein the adenovirus vector comprises a functional deletion of E2A.
  • an adenovirus vector preferably further includes a deletion of nucleic acid encoding E1-region proteins, and may be free of adenovirus vectors comprising E2A function.
  • the preparation may be free of adenovirus vectors comprising nucleic acid encoding a functional E2A, or a functional part, derivative and/or analogue thereof.
  • the preparation is preferably free of adenovirus vectors comprising nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
  • the invention also includes a method for providing cells of an individual with a nucleic acid of interest, without risk of administering simultaneously a replication competent adenovirus vector, comprising administering the individual one of the previously described preparations.
  • the producer cell lines complement for the E1 and E2A deletion from recombinant adenoviral vectors in trans by constitutive expression of the E1 and E2A genes, respectively.
  • the pre-established Ad5-E1 transformed human embryo retinoblast cell line PER.C6 commercially available from IntroGene, by (now Crucell, NV) of Leiden, NL, see also, International Patent Appln. WO 97/00326) and Ad5 transformed human embryo kidney cell line 293 (Graham et al., J Gen. Virol. 36: 59, 1977) were further equipped with E2A expression cassettes.
  • the adenoviral E2A gene encodes a 72 kDa DBP which has a high affinity for single stranded DNA. Because of its function, constitutive expression of DBP is toxic for cells.
  • the ts125E2A mutant encodes a DBP which has a Pro ⁇ Ser substitution of amino acid 413 (van der Vliet, J Virol. 15: 348, 1975). Due to this mutation, the ts125E2A encoded DBP is fully active at the permissive temperature of 32° C., but does not bind to ssDNA at the non-permissive temperature of 39° C.
  • pcDNA3wtE2A The complete wild-type E2A coding region was amplified from the plasmid pBR/Ad.Bam-rITR (ECACC deposit P97082122) with the primers DBPpcr1 and DBPpcr2 using the ExpandTM Long Template PCR system according to the standard protocol of the supplier (Boehringer Mannheim). The PCR was performed on a Biometra TRIO THERMOBLOCK, using the following amplification program: 94° C. for 2 minutes, 1 cycle; 94° C. for 10 seconds+51° C. for 30 seconds+68° C. for 2 minutes, 1 cycle; 94° C. for 10 seconds+58° C. for 30 seconds+68° C.
  • the primer DBPpcr1 CG G GAT CC G CCA CCA TGG CCA GTC GGG AAG AGG AG (5′ to 3′) (SEQ ID NO:1) contains a unique BamHI restriction site (underlined) 5′ of the Kozak sequence (italic) and start codon of the E2A coding sequence.
  • the primer DBPpcr2 CG G AAT TC T TAA AAA TCA AAG GGG TTC TGC CGC (5′ to 3′) (SEQ ID NO:2) contains a unique EcoRI restriction site (underlined) 3 ′ of the stop codon of the E2A coding sequence.
  • the bold characters refer to sequences derived from the E2A coding region.
  • the PCR fragment was digested with BamHI/EcoRI and cloned into BamHI/EcoRI digested pcDNA3 (Invitrogen), giving rise to pcDNA3wtE2A.
  • pcDNA3tsE2A The complete ts125E2A-coding region was amplified from DNA isolated from the temperature sensitive adenovirus mutant H5ts125 (Ensinger et al., J. Virol. 10: 328, 1972; van der Vliet et al., J Virol. 15: 348, 1975). The PCR amplification procedure was identical to that for the amplification of wtE2A. The PCR fragment was digested with BamHI/EcoRI and cloned into BamHI/EcoRI digested pcDNA3 (Invitrogen), giving rise to pcDNA3tsE2A. The integrity of the coding sequence of wtE2A and tsE2A was confirmed by sequencing.
  • PER.C6 cells were cultured in Dulbecco's Modified Eagle Medium (“DMEM”, Gibco BRL) supplemented with 10% FBS and 10 mM MgCl 2 in a 10% CO 2 atmosphere at either 32° C., 37° C. or 39° C.
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS 10% FBS
  • 10 mM MgCl 2 10 mM MgCl 2
  • PER.C6 performs very well both at 32° C. and 39° C., the permissive and non-permissive temperature for ts125E2A, respectively.
  • PER.C6 cells were seeded per 6 cm tissue culture dish (Greiner) in DMEM, supplemented with 10% FBS and 10 mM MgCl 2 and incubated at 37° C. in a 10% CO 2 atmosphere.
  • the cells were transfected with 3, 5 or 8 ⁇ g of either pcDNA3, pcDNA3wtE2A or pcDNA3tsE2A plasmid DNA per dish, using the LipofectAMINE PLUSTM Reagent Kit according to the standard protocol of the supplier (Gibco BRL), except that the cells were transfected at 39° C. in a 10% CO 2 atmosphere.
  • the cells were constantly kept at 39° C., the non-permissive temperature for ts125E2A. Three days later, the cells were put on DMEM, supplemented with 10% FBS, 10 mM MgCl 2 and 0.25 mg/ml G418 (Gibco BRL) and the first G418 resistant colonies appeared at 10 days post transfection. As shown in Table 1, there was a dramatic difference between the total number of colonies obtained after transfection of pcDNA3 ( ⁇ 200 colonies) or pcDNA3tsE2A ( ⁇ 100 colonies) and pcDNA3wtE2A (only 4 colonies).
  • PER.C6 cells were transfected with either pcDNA3, pcDNA3wtE2A or pcDNA3wtE2A and cultured in selection medium containing 0.25 mg/ml G418 at 39° C. All colonies (4/4) picked from the pcDNA3 transfection and 82% (37/45) of the colonies from the pcDNA3tsE2A transfection were established to stable cell lines. In contrast, only 25% (1/4) of the colonies from the pcDNA3wtE2A transfection could be established to a cell line.
  • the E2A expression levels in the different cell lines were determined by Western blotting.
  • the cell lines were seeded on 6 well tissue culture dishes and sub-confluent cultures were washed twice with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor). After 15 minutes incubation on ice, the lysates were cleared by centrifugation. Protein concentrations were determined by the Bio-Rad protein assay, according to standard procedures of the supplier(BioRad).
  • Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes (Millipore) and incubated with the aDBP monoclonal antibody B6 (Reich et al., Virology 128: 480, 1983). The secondary antibody was a horseradish-peroxidase-conjugated goat anti mouse antibody (BioRad). The Western blotting procedure and incubations were performed according to the protocol provided by Millipore. The complexes were visualized with the ECL detection system according to the manufacturer's protocol (Amersham). FIG.
  • Cells were transfected with 7.2 ⁇ g of either pcDNA3, pcDNA3wtE2A or pcDNA3tsE2A plasmid DNA using the Calcium Phosphate Transfection System according to the standard protocol of the supplier (Gibco BRL). Two days post transfection, cells were put on selection medium, i.e., DMEM supplemented with 10% FBS, 10 mM MgCl 2 and 0.1 mg/ml G418. The first colonies appeared at day 12 post transfection.
  • selection medium i.e., DMEM supplemented with 10% FBS, 10 mM MgCl 2 and 0.1 mg/ml G418.
  • the E2A expression level in 8 different cell lines was determined by Western blotting.
  • the cell lines were seeded on 6 well tissue culture dishes and sub-confluent cultures were washed twice with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor). After 15 minutes incubation on ice, the lysates were cleared by centrifugation. Protein concentrations were determined by the BioRad protein assay, according to standard procedures of the supplier (BioRad).
  • Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes (Millipore) and incubated with the aDBP monoclonal antibody B6 (Reich et al., Virology 128: 480, 1983). The secondary antibody was a horseradish-peroxidase-conjugated goat anti mouse antibody (BioRad). The Western blotting procedure and incubations were performed according to the protocol provided by Millipore. The complexes were visualized with the ECL detection system according to the manufacturer's protocol (Amersham). FIG.
  • FIG. 3 shows, that, in contrast to the PER.C6tsE2A cell lines, only clone 20 (lane 8) from the pcDNA3tsE2A transfected 293 cells expressed the full-length ts125E2A encoded 72-kDa DBP.
  • No E2A encoded DBP was detected in extract from a cell line (clone 4) derived from the pcDNA3 transfected 293 cells (lane 1), which serves as a negative control.
  • Extract from PER.C6 cells stably expressing ts125E2A encoded DBP (polyclonal cell line 5) (lane 2) served as a positive control for the Western blot procedure.
  • the other 293 clones either did not express ts125E2A encoded DBP (clones 21 and 22, lanes 9 and 10 respectively) or expressed aberrant products running with a faster (clones 3, 12, 16 and 18 lanes 4-7) or slower (clone 2, lane 3) mobility in SDS/PAGE.
  • These results show that generation of E2A complementing cell line by using temperature sensitive mutants of E2A is not specific for PER.C6 cells, but that it applies to eukaryotic cells in general (e.g., 293 cells).
  • the 293 data show that keeping the temperature sensitive E2A encoded DBP as inactive as possible is crucial for easy generation of such cell lines.
  • the 293 cell lines were generated at an intermediate temperature of 37° C., a temperature at which ts125E2A encoded DBP is only partially inactivated. This explains the high number of cell lines expressing aberrant DBP products.
  • the adenovirus Ad5.dl802 is an Ad 5 derived vector deleted for the major part of the E2A coding region and does not produce functional DBP (Rice et al., J Virol. 56: 767, 1985). Ad5.dl802 was used to test the E2A trans-complementing activity of PER.C6 cells constitutively expressing ts125E2A. Parental PER.C6 cells or PER.C6tsE2A clone 3-9 were cultured in DMEM, supplemented with 10% FBS and 1 mM MgCl 2 at 39° C. .
  • the 293tsE2A clones c2, c16, c18 and c20 and the 293pcDNA3-clone c4 were tested for their E2A trans-complementing activity as follows.
  • the cell lines were cultured in DMEM, supplemented with 10% FBS and 10 mM MgCl 2 at 39° C. and 10% CO 2 in 6 well plates and either mock infected or infected with IG.Ad.CLIP.Luc (see below) at an m.o.i. of 10. Subsequently, the infected cells were cultured at either 32° C. or 39° C.
  • CPE cytopathic effect
  • the 293ts125E2A clones c2, c16, c18 and c20 and the 293pcDNA3-clone c4 were tested for their E2A trans-complementing activity as follows.
  • the cell lines were either mock infected or infected with IG.Ad.CLIP.Luc at an m.o.i. of 10. Subsequently, the infected cells were cultured at either 32° C. or 39° C. and cells were screened for the appearance of a cytopathic effect (CPE) 3 days post infection, as determined by changes in cell morphology and detachment of the cells from the flask.
  • CPE cytopathic effect
  • adenoviral vectors for human gene therapy requires an easy and scalable culturing method for the producer cell line, preferably a suspension culture in medium devoid of any human or animal constituents.
  • the cell line PER.C6tsE2A c5-9 (designated c5-9) was cultured at 39° C. and 10% CO 2 in a 175 cm 2 tissue culture flask (Nunc) in DMEM, supplemented with 10% FBS and 10mM MgCl 2 .
  • the cells were washed with PBS (NPBI) and the medium was replaced by 25 ml serum free suspension medium Ex-cellTM 525 (JRH) supplemented with 1 ⁇ L-Glutamin (Gibco BRL), hereafter designated SFM.
  • SFM serum free suspension medium
  • the cells were seeded in a 125 ml tissue culture Erlenmeyer (Corning) at a seeding density of 3 ⁇ 10 5 cells per ml in a total volume of 20 ml SFM. Cells were further cultured at 125 RPM on an orbital shaker (GFL) at 39° C. in a 10% CO 2 atmosphere. Cells were counted at day 1-6 in a Burker cell counter. In FIG. 4, the mean growth curve from 8 cultures is shown. PER.C6tsE2A c5-9 performs well in serum free suspension culture. The maximum cell density of approximately 2 ⁇ 10 6 cells per ml is reached within 5 days of culture.
  • PER.C6 cells or PER.C6ts125E2A (c8-4) cells were cultured in DMEM supplemented with 10% FBS and 10 mM MgCl 2 in a 10% CO 2 atmosphere at either 37° C. (PER.C6) or 39° C. (PER.C6ts125E2A c8-4).
  • PER.C6 37° C.
  • PER.C6ts125E2A c8-4 a total of 1 ⁇ 10 6 cells were seeded per 25 cm 2 tissue culture flask (Nunc) and the cells were cultured at the respective temperatures. At the indicated time points, cells were counted.
  • FIG. 5 shows that the growth of PER.C6 cells at 37° C. is comparable to the growth of PER.C6ts125E2A c8-4 at 39° C. This shows that constitutive expression of ts125E2A encoded DBP has no adverse effect on the growth of cells at the non-permissive temperature of 39° C.
  • the PER.C6ts125E2A cell line clone 8-4 was cultured at 39° C. and 10% CO 2 in a 25 cm 2 tissue culture flask (Nunc) in DMEM, supplemented with 10% FBS and 10 mM MgCl 2 in the absence of selection pressure (G418).
  • the cells were washed with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1 % SDS in PBS, supplemented with 1 mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor).
  • FIG. 6 shows that the expression of ts125E2A encoded DBP is stable for at least 16 passages, which is equivalent to approximately 40 cell doublings. No decrease in DBP levels was observed during this culture period, indicating that the expression of ts125E2A is stable, even in the absence of G418 selection pressure.
  • inverted terminal repeat (“ITR”) sequences wild-type human adenovirus type 5 (Ad5) DNA was treated with Klenow enzyme in the presence of excess dNTPs. After inactivation of the Klenow enzyme and purification by phenol/chloroform extraction followed by ethanol precipitation, the DNA was digested with BamHI. This DNA preparation was used without further purification in a ligation reaction with pBr322 derived vector DNA prepared as follows: pBr322 DNA was digested with EcoRV and BamHI, de-phosphorylated by treatment with TSAP enzyme (Life Technologies) and purified on LMP agarose gel (SeaPlaque GTG). After transformation into competent E.coli nDH5a (Life Techn.) and analysis of ampicillin resistant colonies, one clone was selected that showed a digestion pattern as expected for an insert extending from the BamHI site in Ad5 to the right ITR.
  • ITR inverted terminal repeat
  • pBr/Ad.Bam-rITR was digested with BamHI and SalI.
  • the vector fragment including the adenovirus insert was isolated in LMP agarose (SeaPlaque GTG) and ligated to a 4.8 kb SalI-BamHI fragment obtained from wt Ad5 DNA and purified with the Geneclean II kit (Bio 101, Inc.).
  • One clone was chosen and the integrity of the Ad5 sequences was determined by restriction enzyme analysis.
  • Clone pBr/Ad.Sal-rITR contains adeno type 5 sequences from the SalI site at bp 16746 up to and including the rITR (missing the most 3′ G residue).
  • wt Adeno type 5 DNA was digested with ClaI and BamHI, and the 20.6-kb fragment was isolated from gel by electro-elution.
  • pBr322 was digested with the same enzymes and purified from agarose gel by Geneclean. Both fragments were ligated and transformed into competent DH5a.
  • the resulting clone pBr/Ad.Cla-Bam was analyzed by restriction enzyme digestion and shown to contain an insert with adenovirus sequences from bp 919 to 21566.
  • This linker was made by annealing the following two oligonucleotides: 5′-AATTGTCTTAATTAACCGC-3′ (SEQ ID NO:4) and 5′-AATTGCGGTTAATTAAGAC-3 ′ (SEQ ID NO:5), followed by blunting with Klenow enzyme. After precipitation of the ligated DNA to change buffer, the ligations were digested with an excess PacI enzyme to remove concatemers of the oligo.
  • the 22016 bp partial fragment containing Ad5 sequences from bp 3534 up to 21566 and the vector sequences was isolated in LMP agarose (SeaPlaque GTG), re-ligated and transformed into competent DH5a.
  • One clone that was found to contain the PacI site and that had retained the large adeno fragment was selected and sequenced at the 5′ end to verify correct insertion of the PacI linker in the (lost) AflII site.
  • pBr/Ad.Bam-rITR was digested with ClaI and treated with nuclease Bal31 for varying lengths of time (2 minutes, 5 minutes, 10 minutes and 15 minutes). The extent of nucleotide removal was followed by separate reactions on pBr322 DNA (also digested at the ClaI site), using identical buffers and conditions. Bal31 enzyme was inactivated by incubation at 75° C.
  • Cosmid vector pWE15 (Clontech) was used to clone larger Ad5 inserts. First, a linker containing a unique PacI site was inserted in the EcoRI sites of pWE 15 creating pWE.pac. To this end, the double stranded PacI oligo as described for pBr/Ad.AflII-BamHI was used but now with its EcoRI protruding ends.
  • pWE.pac digested with PacI pBr/AflII-Bam digested with PacI and BamHI
  • pBr/Ad.Bam-rITR#2 digested with Bam-HI and PacI.
  • These fragments were ligated together and packaged using 1 phage packaging extracts (Stratagene) according to the manufacturer's protocol. After infection into host bacteria, colonies were grown on plates and analyzed for presence of the complete insert.
  • pWE/Ad.AflII-rITR contains all adenovirus type 5 sequences from bp 3534 (AflII site) up to and including the right ITR (missing the most 3′G residue).
  • pWE.pac was digested with ClaI and 5′ protruding ends were filled using Klenow enzyme. The DNA was then digested with PacI and isolated from agarose gel. pWE/AflII-rITR was digested with EcoRI and after treatment with Klenow enzyme digested with PacI. The large 24-kb fragment containing the adenoviral sequences was isolated from agarose gel and ligated to the ClaI-digested and blunted pWE.pac vector using the Ligation ExpressTM kit from Clontech. After transformation of Ultra-competent XL10-Gold cells from Stratagene, clones were identified that contained the expected insert. pWE/AflII-EcoRI contains Ad5 sequences from bp 3534-27336.
  • DE2A.SnaBI 5′-GGC GTA CGT AGC CCT GTC GAA AG-3′ (SEQ ID NO:6)
  • DE2A.DBP-start 5′-CCA ATG CAT TCG AAG TAC TTC CTT CTC CTA TAG GC-3′ (SEQ ID NO:7).
  • the amplified DNA fragment was digested with SnaBI and NsiI (NsiI site is generated in the primer DE2A.DBP-start, underlined). In addition, a unique BstBI site is generated in this primer (italics).
  • DE2A.DBP-stop 5′-CCA ATG CAT ACG GCG CAG ACG G-3′ (SEQ ID NO:8)
  • DE2A.BamHI 5′-GAG GTG GAT CCC ATG GAC GAG-3′ (SEQ ID NO:9)
  • the amplified DNA was digested with BamHI and NsiI (NsiI site is generated in the primer DE2A.DBP-stop, underlined). Subsequently, the digested DNA fragments were ligated into SnaBI/BamHI digested pBr/Ad.Sal-rITR. Sequencing confirmed the exact replacement of the DBP coding region with a unique NsiI site and BstBI site in plasmid pBr/Ad.Sal-rITRDE2A. The unique NsiI site and BstBI site can be used to introduce an expression cassette for a gene to be transduced by the recombinant vector.
  • the deletion of the E2A coding sequences was performed such that the splice acceptor sites of the 100K encoding L4-gene at position 24048 in the top strand was left intact.
  • the polyadenylation signals of the original E2A-RNA and L3-RNAs at the left-hand site of the E2A coding sequences were left intact. This ensures proper expression of the L3-genes and the gene encoding the 100K L4-protein during the adenovirus life cycle.
  • the plasmid pWE/Ad.AflII-rITRDE2A was generated.
  • the plasmid pBr/Ad.Sal-rITRDE2A was digested with BamHI and Spel.
  • the 3.9-Kb fragment in which the E2A coding region was replaced by the unique NsiI site and BstBI site was isolated.
  • the pWE/Ad.AflII-rITR was digested with BamHil and SpeI.
  • the fragments were ligated and packaged using 1 phage-packaging extracts according to the manufacturer protocol (Stratagene), yielding the plasmid pWE/Ad.AflII-rITRDE2A. Note that there is no sequence overlap between the adenoviral sequences present in pWE/Ad.AflII-rITRDE2A and the E2A sequences present in the expression vectors pcDNA3tsE2A and pcDNAwtE2A or the cell lines derived from this vector.
  • Adapter plasmid pMLP.TK (European patent application no. EP 95202213) was modified as follows: SV40 polyA sequences were amplified with primer SV40-1 (introduces a BamHI site) and SV40-2 (introduces a BglII site). In addition, Ad5 sequences present in this construct (from nt. 2496 to nt. 2779; Ad5 sequences nt. 3511 to 3794) were amplified with primers Ad5-1 (introduces a BglII site) and Ad5-2.
  • SV40-1 5′-GGGGGATCCGAACTTGTTTATTGCAGC-3′ (SEQ ID NO: 10).
  • SV40-2 5′-GGGAGATCTAGACATGATAAGATAC-3′ (SEQ ID NO:11).
  • Ad5-1 5′-GGGAGATCTGTACTGAAATGTGTGGGC-3′ (SEQ ID NO:12).
  • Ad5-2:5′-GGAGGCTGCAGTCTCCAACGGCGT-3′ (SEQ ID NO: 13).
  • Both PCR fragments were digested with BglII and ligated.
  • the ligation product was amplified with primers SV40-1 and Ad5-2 and digested with BamHI and AflII.
  • the digested fragment was then ligated into pMLP.TK predigested with the same enzymes.
  • the resulting construct named pMLPI.TK, contains a deletion in adenovirus E1 sequences from nt. 459 to nt. 3510.
  • This plasmid was used as the starting material to make a new vector in which nucleic acid molecules comprising specific promoter and gene sequences can be easily exchanged.
  • a PCR fragment was generated from pZipDMo+PyF101(N ⁇ ) template DNA (described in PCT/NL96/00195) with the following primers: LTR-1: 5′-CTG TAC GTA CCA GTG CAC TGG CCT AGG CAT GGA AAA ATA CAT AAC TG-3′ (SEQ ID NO:14) and LTR-2: 5′-GCG GAT CCT TCG AAC CAT GGT AAG CTT GGT ACC GCT AGC GTT AAC CGG GCG ACT CAG TCA ATC G-3′ (SEQ ID NO: 15).
  • Pwo DNA polymerase (Boehringer Mannheim) was used according to manufacturer's protocol with the following temperature cycles: once 5 minutes at 95° C.; 3 minutes at 55° C.; and 1 minute at 72° C., and 30 cycles of 1 minute at 95° C., 1 minute at 60° C., 1 minute at 72° C., followed by once for 10 minutes at 72° C.
  • the PCR product was then digested with BamHI and ligated into pMLP10 (Levrero et al., 1991; Gene 101, 195-202) digested with PvuII and BamHI, thereby generating vector pLTR10.
  • This vector contains adenoviral sequences from bp 1 up to bp 454 followed by a promoter consisting of apart of the Mo-MuLV LTR having its wild-type enhancer sequences replaced by the enhancer from a mutant polyoma virus (PyF101).
  • the promoter fragment was designated L420. Sequencing confirmed correct amplification of the LTR fragment; however, most 5′ bases in the PCR fragment were missing so that the PvuII site was not restored.
  • the coding region of the murine HSA gene was inserted.
  • pLTR10 was digested with BstBI followed by Klenow treatment and digestion withNcoI.
  • the HSA gene was obtained by PCR amplification on pUC 18-HSA (Kay et al., 1990; J. Immunol. 145, 1952-1959) using the following primers: HSA1, 5′-GCG CCA CCA TGG GCA GAG CGA TGG TGG C-3′ (SEQ ID NO: 16) and HSA2, 5′-GTT AGA TCT AAG CTT GTC GAC ATC GAT CTA CTA ACA GTA GAG ATG TAG AA-3′ (SEQ ID NO:17).
  • the 269 bp-amplified fragment was sub-cloned in a shuttle vector using the NcoI and BglII sites.
  • pLTR-HSA10 was digested with EcoRI and BamHI after which the fragment containing the left ITR, packaging signal, L420 promoter and HSA gene was inserted into vector pMLPI.TK digested with the same enzymes and thereby replacing the promoter and gene sequences.
  • SnaBI and AvrII can be combined with HpaI, NheI, KpnI, and HindIII to exchange promoter sequences, while the latter sites can be combined with the ClaI or BamHI sites 3′ from HSA coding region to replace genes in this construct.
  • Another adapter plasmid that was designed to allow easy exchange of nucleic acid molecules was made by replacing the promoter, gene and polyA sequences in pAd5/L420-HSA with the CMV promoter, a multiple cloning site, an intron and a polyA signal.
  • pAd/L420-HSA was digested with AvrII and BglII followed by treatment with Klenow to obtain blunt ends.
  • the 5.1 kb fragment with pBr322 vector and adenoviral sequences was isolated and ligated to a blunt 1570 bp fragment from pcDNA 1/amp (Invitrogen) obtained by digestion with HhaI and AvrII followed by treatment with T4 DNA polymerase.
  • This adapter plasmid was named pAd5/Clip.
  • the adapter plasmid pCMV.LacZ was generated as follows: The plasmid pCMV.TK (EP 95-202 213) was digested with HindIII, blunted with Klenow and dNTPs and subsequently digested with SalI. The DNA fragment containing the CMV promoter was isolated. The plasmid pMLP.nlsLacZ (EP 95-202 213) was digested with KpnI, blunted with T4 DNA polymerase and subsequently digested with SalI. The DNA fragment containing the LacZ gene and adjacent adenoviral sequences was isolated. Next, the two DNA fragments were ligated with T4 DNA ligase in the presence of ATP, giving rise to pCMV.nlsLacZ.
  • the adapter plasmid pAd5/CLIP.LacZ was generated as follows: The E.coli LacZ gene was amplified from the plasmid pMLP.nlsLacZ (EP 95-202 213) by PCR with the primers 5′GGGGTGGCCAGGGTACCTCTAGGCTTTTGCAA (SEQ ID NO:18) and 5′GGGGGGATCCATAAACAAGTTCAGAATCC (SEQ ID NO:19). The PCR reaction was performed Ex Taq (Takara) according to the suppliers protocol at the following amplification program: 5 minutes 94° C., 1 cycle; 45 seconds 94° C. and 30 seconds 60° C. and 2 minutes 72° C.,5 cycles; 45 seconds 94° C.
  • the PCR product was subsequently digested with Kpn1 and BamHI and the digested DNA fragment was ligated into KpnI/BamHI digested pcDNA3 (Invitrogen), giving rise to pcDNA3.nlsLacZ.
  • the plasmid pAd/CLIP was digested with Spel. The large fragment containing part of the 5′ part CMV promoter and the adenoviral sequences was isolated.
  • the plasmid pcDNA3.nlsLacZ was digested with SpeI and the fragment containing the 3′ part of the CMV promoter and the LacZ gene was isolated. Subsequently, the fragments were ligated, giving rise to pAd/CLIP.LacZ. The reconstitution of the CMV promoter was confirmed by restriction digestion.
  • the adapter plasmid pAd5/CLIP.Luc was generated as follows: The plasmid pCMV.Luc (EP 95-202 213) was digested with HindIII and BamHI. The DNA fragment containing the luciferase gene was isolated. The adapter plasmid pAd/CLIP was digested with HindIII and BamHI, and the large fragment was isolated. Next, the isolated DNA fragments were ligated, giving rise to pAdS/CLIP.Luc.
  • a general protocol as outlined hereinafter and meant as a non-limiting example of the present invention has been performed to produce several recombinant adenoviruses using various adapter plasmids and the Ad.AflII-rITR fragment.
  • Adenovirus packaging cells (PER.C6) were seeded in ⁇ 25 cm 2 flasks and the next day, when they were at ⁇ 80% confluency, transfected with a mixture of DNA and lipofectamine agent (Life Techn.) as described by the manufacturer.
  • CPE cytopathic effect
  • adenoviruses comprising the luciferase gene (IG.Ad.CLIP.Luc), the bacterial LacZ gene (IG.Ad.CLIP.LacZ and IG.Ad.CMV.LacZ) or an empty CLIP cassette (IG.Ad.CLIP) have been produced using this protocol.
  • IG.Ad.CLIP.Luc the luciferase gene
  • bacterial LacZ gene IG.Ad.CLIP.LacZ
  • IG.Ad.CMV.LacZ IG.Ad.CLIP
  • an empty CLIP cassette IG.Ad.CLIP
  • Recombinant viruses that are both E1 and E2A deleted are generated by a homologous recombination procedure as described above for E1-replacement vectors using a plasmid-based system consisting of:
  • Ad5 wt sequences 28592-30470 including all known E3 coding regions.
  • Another example is the precise replacement of the coding region of gp19K in the E3 region with a polylinker allowing insertion of new sequences. This 1) leaves all other coding regions intact and 2) obviates the need for a heterologous promoter since the transgene is driven by the E3 promoter and pA sequences, leaving more space for coding sequences.
  • Primers 1 (5′-GGG TAT TAG GCC AAA GGC GCA-3′ (SEQ ID NO:20)) and 2 (5′-GAT CCC ATG GAA GCT TGG GTG GCG ACC CCA GCG-3′ (SEQ ID NO:21)) were used to amplify a sequence from pBS.Eco-Eco/ad5DHIII corresponding to sequences 28511 to 28734 in wt Ad5 DNA.
  • Primers 3 (5′-GAT CCC ATG GGG ATC CTT TAC TAA GTT ACA AAG CTA-3′ (SEQ ID NO:22)) and 4 (5′-GTC GCT GTA GTT GGA CTG G-3′ (SEQ ID NO:23)) were used on the same DNA to amplify Ad5 sequences from 29217 to 29476.
  • the two resulting PCR fragments were ligated together by virtue of the new introduced NcoI site and subsequently digested with XbaI and MunI.
  • the resulting plasmid pBS.Eco-Eco/ad5DHIII.Dgp19KDXbaI contains unique HindIII and BamHI sites corresponding to sequences 28733 (HindIII) and 29218 (BamHI) in Ad5. After introduction of a foreign gene into these sites, either the deleted XbaI fragment is re-introduced, or the insert is re-cloned into pBS.Eco-Eco/ad5DHIII.Dgp19K using HindIII and, for example, MunI. Using this procedure, we have generated plasmids expressing HSV-TK, hIL-la, rat IL-3, luciferase or LacZ.
  • the unique SrfI and NotI sites in the pBS.Eco-Eco/ad5DHIII.Dgp19K plasmid are used to transfer the region comprising the gene of interest into the corresponding region of pBr/Ad.Bam-rITR, yielding construct pBr/Ad.Bam-rITRDgp19K (with or without inserted gene of interest).
  • This construct is used as described supra to produce recombinant adenoviruses.
  • expression of inserted genes is driven by the adenovirus E3 promoter.
  • Recombinant viruses that are both E1 and E3 deleted are generated by a double homologous recombination procedure for E1-replacement vectors using a plasmid-based system consisting of:
  • the cell lines and E1/E2A deleted vectors described hereinbefore are developed such that overlap between sequences in the recombinant adenoviral genome and E2A sequences in the complementing cell lines is avoided. This eliminates reversion of the E2A-deleted phenotype in the E1/E2A deleted recombinant adenoviral vectors due to homologous recombination. The occurrence of reversion of the E2A deleted phenotype was studied in a PCR assay.
  • PER. C6tsE2A clone 3-9 cells were cultured in DMEM supplemented with 10% FBS and 10 mM MgCl 2 in a 10% CO 2 atmosphere at 39° C. in a 25 cm 2 tissue culture flask. At 50% confluency, cells were infected with the recombinant adenoviral vector IG.Ad.CMV.LacZDE2A and the cells were put at 32° C. Four days post infection CPE appeared and the cells were harvested by flicking the flask.
  • the supernatant was put into a new tube and 100 ⁇ l 10% SDS (Baker) and 5 ⁇ l Proteinase K (20 mg/ml; Boehringer) were added. The mixture was incubated for 30 minutes at 37° C. and subsequently for 15 minutes at 65° C. Next, 1 ml phenol (Sigma) was added and the mixture was tumbled for 1 hour and centrifuged. One ml of supernatant was put into a fresh tube and 1 ml chloroform (Baker) was added. The mixture was tumbled for another 30 minutes and centrifuged. The supernatant was put into a fresh tube and mixed with 1 ml 2-Propanol (Baker) and the DNA was pelleted by centrifugation. The DNA was washed in 70% Ethanol (Baker) and re-suspended in 200 ⁇ l TE and 1 ⁇ l RNase (10 mg/ml; Boehringer). The DNA concentration was determined at a spectrophotometer.
  • the recombinant adenoviral vector DNA was screened for reversion of the E2A deleted phenotype by PCR. Two PCR reactions were performed (FIG. 7). The first was a nested PCR reaction for the detection of E2A sequences in the DNA sample. Two primer sets were designed. Set A contains the primers 551:5′CCGGCAAGTCTTGCGGCATG (SEQ ID NO :24) and 556: 5′TAGCAGGTCGGGCGCCGATAT (SEQ ID NO:25) and the nested primers 553: 5′GGCTCAGGTGGCTTTTAAGCAG (SEQ ID NO:26) and 554: 5′GAGTTGCGATACACAGGGTTGC (SEQ ID NO:27).
  • the PCR reaction was performed using the eLONGase enzyme mix (Gibco) according to the manufacturer's protocol. DNA from 1 ⁇ 10 9 viral particles (+), which is equivalent to ⁇ 40 ng, or water ( ⁇ ) was added as template.
  • the PCR reactions were either not spiked, or spiked with 1, 10 and 40 molecules pBR/Ad.Sal-rITR, respectively, as indicated in FIG. 7.
  • the following amplification program for the PCR reaction with primers 551 and 556 was used: 30 seconds at 94° C., 1 cycle; 30 seconds 94° C. and 30 seconds at 66° C. and 90 seconds at 68° C., 35 cycles; 10 minutes 68° C., 1 cycle.
  • a set of primers (Set B) was used that flank the E2A gene in the adenoviral genome on the left- and the right-hand site.
  • This PCR reaction amplifies a DNA fragment spanning the site from which the E2A gene was deleted (FIG. 6).
  • Primer set B comprises primer 731 5′AGTGCGCAGATTAGGAGCGC (SEQ ID NO:28) and primer 734 5′TCTGCCTATAGGAGAAGGAA (SEQ ID NO:29).
  • the PCR reaction was performed using the eLONGase enzyme mix (Gibco) according to the manufacturer protocol. DNA from 1 ⁇ 10 9 viral particles (+), which is equivalent to ⁇ 40 ng, or water ( ⁇ ) was added as template.
  • the PCR reactions were either not spiked, or spiked with 1, 10 and 40 molecules pBR/Ad.Sal-rITR, respectively, as indicated in FIG. 7.
  • the following amplification program was used: 30 seconds at 94° C., 1 cycle; 30 seconds 94° C. and 30 seconds at 50° C. and 90 seconds at 68° C., 35 cycles; 10 minutes 68° C., 1 cycle.
  • This PCR reaction yields a DNA fragment of 169 bp.
  • E2A sequences were amplified from the DNA samples (+) and control samples ( ⁇ ) spiked with both 1, 10 and 40 molecules, as evidenced by the amplification of a 260 bp DNA fragment.
  • no E2A sequences were amplified from the non-spiked samples. This shows that reversion of the E2A-deleted does not occur.
  • the PCR reactions with primers 731/734 yielded the expected DNA fragment of 169 bp in the samples containing the recombinant adenoviral vector DNA (+). From the negative control samples containing the water instead of DNA ( ⁇ ), no DNA fragment of 169 bp was amplified.
  • E1/E2A deleted vectors were compared to E1 deleted vectors.
  • HeLa cells were seeded at 5 ⁇ 10 5 cells/well in 6 well plates (Greiner) in DMEM supplemented with 10% FBS in a 10% CO 2 atmosphere at 37° C.
  • cells were infected with a m.o.i. of either 0, 10, 100 or 1000 viral particles IG.Ad/CMV.LacZ or IG.Ad/CMV.LacZDE2A per cell.
  • NPBI PBS
  • NPBI glutaraldehyde
  • FIG. 8 shows that IG.Ad/CMV.LacZDE2A transduced HeLa cells at least as good as did IG.Ad/CMV.LacZ at all m.o.i.'s.
  • vp/tu ratio of E1- and E1/E2A-deleted vectors was determined in a more sensitive assay, i.e., a luciferase assay.
  • HeLa and A549 cells were seeded at 5 ⁇ 10 5 cells/well in 6 well plates (Greiner) in DMEM supplemented with 10% FBS in a 10% CO 2 atmosphere at 37° C.
  • cells were infected with a m.o.i. of either 0, 10, 100, 1,000 or 10,000 vp/cell IG.Ad/CLIP.Luc or IG.Ad/CLIP.LucDE2A per cell.
  • FIG. 9 shows that both the IG.Ad/CLIP.LucDE2A infected HeLa and A549 cells produce more luciferase enzyme than the IG.Ad/CLIP.Luc infected HeLa and A549 and HeLa cells, at all m.o.i.'s tested.
  • the cells were washed with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor). After 15 minutes incubation on ice, the lysates were cleared by centrifugation. Protein concentrations were determined by the BioRad protein assay, according to standard procedures of the supplier (BioRad). Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels in triplicate.
  • Proteins were transferred onto Immobilon-P membranes (Millipore) and incubated with the aDBP monoclonal antibody B6, the polyclonal a-Penton base antibody Ad2-Pb571 (kind gift of Dr. P. Boulanger, adjoin, France) and the polyclonal a-knob domain antibody of fiber E641/3 (kind gift of R. Gerard, Leuven, Belgium).
  • the secondary antibodies were ahorseradish-peroxidase-conjugated goat anti mouse and ahorseradish-peroxidase-conjugated goat anti rabbit (BioRad).
  • the Western blotting procedure and incubations were performed according to the protocol provided by Millipore.
  • FIG. 10 shows that cells infected with IG.Ad.CLIP express both E2A encoded DBP, Penton base and Fiber proteins.
  • the proteins co-migrated with the respective proteins in the positive control (lane P, extract from PER.C6 cells infected with IG.Ad.CLIP harvested at starting CPE).
  • the residual expression of these proteins in A549 cells was m.o.i. dependent.
  • no DBP, penton-base or fiber was detected in the non-infected A549 cells or cells infected with IG.Ad.CLIPDE2A.
  • E1/E2A deleted vectors produced on PER.C6/tsE2A complementing cell lines have a favorable phenotype.
  • these vectors have an ideal vp/tu ratio, which is at least as good as that of E1 deleted vectors.
  • the E1/E2A deleted vectors do not residually express detectable amounts of E2A encoded DBP or late gene encoded penton-base or fiber. This favorable phenotype improves the prospects for the use of recombinant adenoviral vectors in gene therapy.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Cells capable of at least, in part, complementing adenovirus E2A function of an adenovirus defective in E2A function. Such cells include a nucleic acid encoding adenovirus E2A or a functional part, derivative and/or analogue thereof, integrated into the cell's genome. The cell may have E2A nucleic acid derived from a temperature sensitive adenovirus. Methods for producing an adenovirus particle containing an adenovirus vector with a functional deletion of E2A are also disclosed. Such methods involve providing a cell with the functionally deleted adenovirus vector, culturing the cell, and harvesting viral particle. The functional deletion can comprise a deletion of nucleic acid encoding E2A. In such a method, the nucleic acid encoding adenovirus E2A in the cell's genome has no sequence overlap with the vector leading to replication competent adenovirus and/or to the formation of an adenovirus vector comprising E2A function. In the method, the adenovirus vector may further include a functional deletion of E1-region encoding nucleic acid. Methods for providing cells of an individual with a nucleic acid of interest, without risk of administering simultaneously a replication competent adenovirus vector, comprising administering the individual one of the previously described preparations are also disclosed.

Description

    RELATED APPLICATIONS
  • This application is a continuation of U.S. Ser. No. 09/298,745, now U.S. Pat. No. ______, incorporated by reference, which is a continuation-in-part of U.S. patent application No. 08/793,170 filed Mar. 25, 1997, pending, incorporated herein by reference, which is the national stage filing of PCT/NL96/00244 filed Jun. 14, 1996, incorporated herein by reference, claiming priority from EP 95201611.1 filed June 15, 1995 and EP 95201728.3 filed Jun. 26, 1995, all of which are incorporated herein by reference.[0001]
  • TECHNICAL FIELD
  • The present invention relates to the field of recombinant DNA technology, more in particular to the field of gene therapy. Specifically, the present invention relates to gene therapy using materials derived from adenovirus, in particular human recombinant adenovirus, and relates to novel virus derived vectors and novel packaging cell lines for vectors based on adenoviruses. Furthermore, this invention also pertains to the screening of replication-competent and revertant E1 and/or E2A adenoviruses from recombinant adenoviruses used in gene therapy. [0002]
  • BACKGROUND
  • The current generation of adenoviral vectors for gene therapy contains deletions of the early region 1 (“E1”), where new genetic information can be introduced. The E1 deletion renders the recombinant virus replication defective. It was generally thought that E1-deleted vectors would not express any other adenoviral genes, because E1 is reported to trigger the transcription of the other adenoviral genes. It has been shown by us and others that these vectors express several early (e.g., E2A) and late genes (e.g., fiber and penton-base) in the absence of E1. This means that delivery of a therapeutic gene using E1-deleted adenoviral vectors will result in expression of the therapeutic protein and adenoviral proteins. A cytotoxic immune response is evoked against such transduced cells. It has been shown that cytotoxic T-lymphocytes (“CTLs”) directed against both the transgene product and products encoded by the vector are activated, following vector administration into immunocompetent animals (Song et al., Hum. Gene Ther. 8: 1207, 1997; Yang et al., J. Virol. 70: 7209, 1996). Activated CTLs subsequently eradicate transduced cells from the recipient. Consistent with this, the longevity of transgene expression is significantly extended in immuno-deficient and immuno-compromised animals. [0003]
  • Expression of at least some adenoviral genes in a target cell is at least in part due to background replication of the recombinant adenoviral vector genome and/or background activity of promoters driving the respective adenoviral genes (Yang et al., Nature Genet. 7: 362, 1994; Lusky et al., J. Virol. 72: 2022, 1998). As a result of the expression of at least some adenovirus proteins in a target cell in a recipient, an immune response may be mounted against transduced cells. Such an immune response is often not desired, especially when long-term expression of a transgene is aimed for. One mechanism by which adenovirus proteins in a target cell in a recipient may cause the immune system of the recipient to remove the target cell is the following. Proteins encoded by expressed adenovirus genes can be processed into small peptides in a proteosome of the target cell. Peptides produced during this processing can subsequently be presented at the cell surface of the transduced cells in the complex of MHC class-I and β2-microglobulin molecules. Finally, one or more of the peptides may be recognized as non-self peptides by circulating CTLs whereupon transduced cells can be eradicated from the recipient (reviewed in Ploegh, [0004] Science 280: 248, 1998).
  • DISCLOSURE OF THE INVENTION
  • In one aspect the present invention provides at least in part a solution to the problem of undesired removal of target cells in a recipient. [0005]
  • The present invention also provides, at least in part, a solution for the immune response against viral proteins. To this end, the invention provides improved recombinant adenoviral vectors that, in addition to deletion of E1, are also deleted for the adenoviral early 2A gene (“E2A gene” or “E2A”). The protein encoded by E2A is expressed from recombinant E1-deleted adenoviral vectors. In addition to that, residual expression of E2A from E1-deleted recombinant adenoviral vectors induces the expression of the viral late genes, since DNA binding protein (“DBP”) has a positive regulatory effect on the adenovirus major late promoter (“MLP”) and, therefore, on the expression of the late genes (Chang et al., [0006] J Virol. 64: 2103, 1990). Deletion of the E2A gene from the recombinant adenoviral genome will therefore improve the characteristics of recombinant adenoviral vectors. First, deletion of E2A will eliminate the synthesis of DBP. Second, it will inhibit the background replication of the recombinant adenoviral backbone. Third, it will reduce the residual expression of the late genes. Finally, it will increase the capacity of the vector to harbor larger and/or multiple transgenes.
  • The E2A gene encodes the 72-kDa protein single stranded DBP whose activity is pivotal for the adenovirus DNA replication (reviewed in [0007] The Molecular Repertoire of Adenoviruses II, Springer-Verlag 1995). Therefore, manufacturing of vectors that are deleted for E2A requires a cell line that complements for the deletion of E2A in the recombinant adenoviral vector. Major hurdles in this approach are:
  • a) that E2A should be expressed to very high levels and [0008]
  • b) that constitutive expression of E2A is toxic for cells and, therefore, impossible to achieve (Klessig et al., [0009] Mol. Cell Biol. 4: 1354, 1984).
  • The current invention, therefore, involves the use of a temperature sensitive mutant of E2A derived from a temperature sensitive adenovirus under control of strong viral enhancer sequences, e.g., the cytomegalovirus enhancer for the generation of E2A complementing cell lines. DBP (ts125E2A) from hAd5ts125 is inactive at 39° C., but is fully active at 32° C. High levels of this protein can be maintained in the new complementing cells of the invention at the non-permissive temperature, until the switch is made to the permissive temperature. The invention also provides means and methods to use the complementing cell line, comprising E2A, tsE2A, or both E1 and tsE2A, for the generation of E2A- or E1- and E2A-deleted adenoviral vectors. The invention also involves inducible expression of E2A or tsE2A. [0010]
  • The invention also provides new cell lines that complement for E2A or for both the E1 and the E2A deletion in the vector. The invention also provides new recombinant adenoviral vectors deleted for E2A or both E1 and E2A. [0011]
  • BRIEF DESCRIPTION OF THE FIGURES
  • FIG. 1 depicts the temperature dependent growth of PER.C6. PER.C6 cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% Fetal Bovine Serum (FBS, Gibco BRL) and 10 mM MgCl[0012] 2 in a 10% CO2 atmosphere at either 32° C., 37° C. or 39° C. At a total of 1×106 PER.C6 cells were seeded per 25 cm2 tissue culture flask (Nunc) and the cells were cultured at either 32° C., 37° C. or 39° C. At each of days 1-8, cells were counted. The growth rate and the final cell density of the PER.C6 culture at 39° C. are comparable to that at 37° C. The growth rate and final density of the PER.C6 culture at 32° C. were slightly reduced as compared to that at 37° C. or 39° C.
  • FIG. 2 depicts DBP levels in PER.C6 cells transfected with pcDNA3, pcDNA3wtE2A or pcDNA3ts125E2A. Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes and DBP protein was visualized using the aDBP monoclonal B6 in an ECL detection system. All of the cell lines derived from the pcDNA3ts 125E2A transfection express the 72-kDa E2A-encoded DBP protein (left panel, lanes 4-14; middle panel, lanes 1-13; right panel, lanes 1-12). In contrast, the only cell line derived from the pcDNAwtE2A transfection did not express the DBP protein (left panel, lane 2). No DBP protein was detected in extract from a cell line derived from the pcDNA3 transfection (left panel, lane 1), which serves as a negative control. Extract from PER.C6 cells transiently transfected with pcDNA3ts125 (left panel, lane 3) served as a positive control for the Western blot procedure. These data confirm that constitutive expression of wtE2A is toxic for cells and that using the ts125 mutant of E2A can circumvent this toxicity. [0013]
  • FIG. 3 depicts DBP expression in pcDNA3ts125E2A transfected 293 cells. Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes and DBP protein was visualized using the aDBP monoclonal B6 in an ECL detection system. Clone 20 (lane 8) from the pcDNA3ts125E2A transfected 293 cells expressed the full-length ts125E2A encoded 72-kDa DBP. No E2A encoded DBP was detected in the extract from a cell line (clone 4) derived from the pcDNA3 transfected 293 cells (lane 1), which serves as a negative control. Extract from PER.C6 cells stably expressing ts125E2A encoded DBP (polyclonal cell line 5) (lane 2) served as a positive control for the Western blot procedure. The other 293 clones either did not express ts125E2A encoded DBP (clones 21 and 22, [0014] lanes 9 and 10 respectively) or expressed aberrant products running with a faster ( clones 3, 12, 16 and 18, lanes 4-7) or slower (clone 2, lane 3) mobility in SDS/PAGE.
  • FIG. 4 depicts suspension growth of PER.C6ts125E2A cell line c5-9. PER.C6ts125E2Ac5-9 cells were seeded in a 125ml tissue culture Erlenmeyer at a seeding density of 3×10[0015] 5 cells per ml in a total volume of 20 ml serum-free medium. Cells were further cultured at 125 RPM on an orbital shaker at 39° C. in a 10% CO2 atmosphere. Cells were counted at each of days 1-6. The mean growth curve from 8 cultures is shown. PER.C6ts125E2Ac5-9 performs well in serum-free suspension culture. The maximum cell density of approximately 2×106 cells per ml is reached within 5 days of culture.
  • FIG. 5 depicts growth curve PER.C6 and PER.C6tsE2A. PER.C6 cells or PER.C6ts125E2A (c8-4) cells were cultured at 37° C. or 39° C., respectively. At [0016] day 0, a total of 1×106 cells was seeded per 25 cm2 tissue culture flask. At the indicated time points, cells were counted. The growth of PER.C6 cells at 37° C. is comparable to the growth of PER.C6ts125E2A c8-4 at 39° C. This shows that constitutive over-expression of ts125E2A has no adverse effect on the growth of cells at the non-permissive temperature of 39° C.
  • FIG. 6 depicts stability of PER.C6ts125E2A. For several passages, the PER.C6ts125E2A cell line clone 8-4 was cultured at 39° C. in medium without G418. Equal amounts of whole-cell extract from different passage numbers were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes and DBP protein was visualized using the aDBP monoclonal B6 in an ECL detection system. The expression of ts125E2A encoded DBP is stable for at least 16 passages, which is equivalent to approximately 40 cell doublings. No decrease in DBP levels was observed during this culture period, indicating that the expression of ts125E2A is stable, even in the absence of G418 selection pressure. [0017]
  • FIG. 7 depicts revertant-free manufacturing of DE1/E2A vectors. The recombinant adenoviral vector DNA was screened for reversion of the E2A deleted phenotype by PCR. As shown in the left panel, E2A sequences were amplified from the DNA samples (+) and control samples (−) spiked with both 1, 10 and 40 molecules using primer set A, as evidenced by the amplification of a 260 base pair (“bp”) DNA fragment. In contrast, no E2A sequences were amplified from the non-spiked samples, showing that reversion of the E2A-deleted did not occur. As shown in the right panel, the PCR reactions with primer set B yielded the expected DNA fragment of 169 bp in the samples containing the recombinant adenoviral vector DNA (+). From the negative control samples containing the water instead of DNA (−), no DNA fragment of 169 bp was amplified. These data show that elimination of overlap between adenoviral sequences in the vector and cell line prevents reversion of the E2A-deleted phenotype. [0018]
  • FIG. 8 depicts transduction of HeLa cells with IG.Ad/CMV.LacZ and IG.Ad/CMV.LacZDE2A. HeLa cells were infected with a multiplicity of infection (“m.o.i.”) of either 0, 10, 100 or 1000 viral particles IG.Ad/CMV.LacZ or IG.Ad/CMV.LacZDE2A per cell. Forty-eight hours post infection, cells were stained with X-gal solution. IG.Ad/CMV.LacZDE2A transduced HeLa cells stained at least as good as did IG.Ad/CMV.LacZ, at all m.o.i.'s. [0019]
  • FIG. 9 depicts luciferase activity in infected A549 and HeLa cells. HeLa and A549 cells were infected with a m.o.i. of either 0, 10, 100, 1,000 or 10,000 virus particles (“vp”) IG.Ad/CLIP.Luc or IG.Ad/CLIP.LucDE2A per cell. Two days post infection, cells were lysed and the luciferase activity was determined. Both the IG.Ad/CLIP.LucDE2A infected HeLa and A549 cells produce more luciferase enzyme than the IG.Ad/CLIP.Luc infected HeLa and A549 and HeLa cells, at all m.o.i.'s tested. [0020]
  • FIG. 10 depicts the expression of DBP, Penton and Fiber. A549 cells were infected with a m.o.i. of either 0, 100, 1,000 or 10,000 vp/cell IG.Ad/CLIP or IG.Ad.CLIPDE2A. Seventy-two hours post infection, cell extracts were prepared and equal amounts of whole cell extract were fractionated by SDS-PAGE on 10% gels. The proteins were visualized with the aDBP monoclonal B6, the polyclonal a-Penton base Ad2-Pb571 or the polyclonal a-knob domain of fiber E641/3, using an ECL detection system. Cells infected with IG.Ad.CLIP express both E2A encoded DBP, Penton base and Fiber proteins. The proteins co-migrate with the respective proteins in the positive control (lane P, extract from PER.C6 cells infected with IG.Ad.CLIP harvested at starting CPE). In contrast, no DBP, penton-base or fiber was detected in the non-infected A549 cells or cells infected with IG.Ad.CLIPDE2A. These data show that deletion of the E2A gene did not only eliminate residual DBP expression, but also the residual expression of the late adenoviral proteins penton-base and fiber. [0021]
  • Best Mode of The Invention
  • According to a presently preferred embodiment of the invention, a cell according to the invention is capable of at least, in part, complementing adenovirus E2A function of an adenovirus defective in E2A function. Such a cell includes a nucleic acid encoding adenovirus E2A or a functional part, derivative and/or analogue thereof, integrated into the genome of the cell. Preferably, the cell has E2A nucleic acid derived from a temperature sensitive adenovirus such as but not limited to adenovirus ts125. More preferably, such a cell further includes a nucleic acid encoding adenovirus E1-region proteins or a functional part, derivative and/or analogue thereof. Such a cell could be derived from the “PER.C6” cell line (commercially available from IntroGene, by, and deposited, under ECACC deposit accession number 96022940 under the provisions of the Budapest Treaty with the Centre for Applied Microbiology and Research Authority (European Collection of Animal Cell Cultures), Porton Down, Salisbury, Wiltshire SP4, OJG, United Kingdom, an International Depository Authority, in accordance with the Budapest Treaty, on Feb. 29, 1996. [0022]
  • The invention also includes a method for producing an adenovirus particle containing an adenovirus vector with a functional deletion of E2A. Such a method involves providing a cell as previously described with the functionally deleted adenovirus vector, culturing the cell, and harvesting the virus particle. In such a method, the functional deletion can comprise a deletion of at least part of the nucleic acid encoding E2A. In such a method, the nucleic acid encoding adenovirus E2A in the genome of the cell preferably has no sequence overlap with the vector which leads to replication competent adenovirus and/or to the formation of an adenovirus vector comprising E2A function. In the method, the adenovirus vector preferably further comprises a functional deletion of E1-region encoding nucleic acid, comprising providing one of the previously described cells with the adenovirus vector, culturing the cell and harvesting the virus particle. In such a method, the nucleic acid encoding adenovirus E1-region preferably does not comprise sequence overlap with the vector which leads to replication competent adenovirus and/or to the formation of an adenovirus vector comprising an E1 function. Furthermore, in the method, the adenovirus vector further comprises at least one nucleic acid of interest. [0023]
  • The invention also includes an adenovirus vector comprising a functional deletion of adenovirus E2A. Such a functional deletion is preferably a deletion of at least part of the nucleic acid encoding E2A. The deletion may encompass the entire coding region of E2A. Such an adenovirus vector preferably includes a deletion corresponding to a deletion of nucleotides 22443 to 24032 in [0024] adenovirus 5. The deletion can include a deletion of nucleic acid encoding E1-region proteins. The deletion of nucleic acid encoding E1-region proteins can comprise a deletion corresponding to a deletion of nucleotides 459 to 3510 in adenovirus 5. Again, the adenovirus vector preferably further includes at least one nucleic acid of interest.
  • An adenovirus vector according to the invention can, but does not necessarily, also comprise at least a deletion of a region which in [0025] adenovirus 5 corresponds to nucleotides 22418-24037 or a deletion of a region which in adenovirus 5 corresponds to nucleotides 22443-24032. Such vectors can further comprise at least nucleic acid which in adenovirus 5 corresponds to nucleotides 3534-22347 and/or nucleotides 24060 until the right ITR or at least 3534-22417 and/or 24038 until the right ITR or at least nucleic acid which in adenovirus 5 corresponds to nucleotides 3534-22442 and/or nucleotides 24033 until the right ITR.
  • The invention also includes preparations of adenovirus vector containing adenovirus particles wherein the adenovirus vector comprises a functional deletion of E2A. Such an adenovirus vector preferably further includes a deletion of nucleic acid encoding E1-region proteins, and may be free of adenovirus vectors comprising E2A function. In such a case, the preparation may be free of adenovirus vectors comprising nucleic acid encoding a functional E2A, or a functional part, derivative and/or analogue thereof. The preparation is preferably free of adenovirus vectors comprising nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof. [0026]
  • The invention also includes a method for providing cells of an individual with a nucleic acid of interest, without risk of administering simultaneously a replication competent adenovirus vector, comprising administering the individual one of the previously described preparations. [0027]
  • The invention is further described by the use of the following illustrative Examples. [0028]
  • EXAMPLE I
  • Generation of producer cell lines for the production of recombinant adenoviral vectors deleted in E1 and E2A or E1 and E2A [0029]
  • Here is described the generation of cell lines for the production of recombinant adenoviral vectors that are deleted in E1 and E2A. The producer cell lines complement for the E1 and E2A deletion from recombinant adenoviral vectors in trans by constitutive expression of the E1 and E2A genes, respectively. The pre-established Ad5-E1 transformed human embryo retinoblast cell line PER.C6 (commercially available from IntroGene, by (now Crucell, NV) of Leiden, NL, see also, International Patent Appln. WO 97/00326) and Ad5 transformed human embryo kidney cell line 293 (Graham et al., [0030] J Gen. Virol. 36: 59, 1977) were further equipped with E2A expression cassettes.
  • The adenoviral E2A gene encodes a 72 kDa DBP which has a high affinity for single stranded DNA. Because of its function, constitutive expression of DBP is toxic for cells. The ts125E2A mutant encodes a DBP which has a Pro→Ser substitution of amino acid 413 (van der Vliet, [0031] J Virol. 15: 348, 1975). Due to this mutation, the ts125E2A encoded DBP is fully active at the permissive temperature of 32° C., but does not bind to ssDNA at the non-permissive temperature of 39° C. This allows the generation of cell lines that constitutively express E2A, which is not functional and is not toxic at the non-permissive temperature of 39° C. Temperature sensitive E2A gradually becomes functional upon temperature decrease and becomes fully functional at a temperature of 32° C., the permissive temperature.
  • A. Generation of Plasmids Expressing the Wild Type E2A—or Temperature Sensitive ts125E2A Gene. [0032]
  • pcDNA3wtE2A: The complete wild-type E2A coding region was amplified from the plasmid pBR/Ad.Bam-rITR (ECACC deposit P97082122) with the primers DBPpcr1 and DBPpcr2 using the Expand™ Long Template PCR system according to the standard protocol of the supplier (Boehringer Mannheim). The PCR was performed on a Biometra TRIO THERMOBLOCK, using the following amplification program: 94° C. for 2 minutes, 1 cycle; 94° C. for 10 seconds+51° C. for 30 seconds+68° C. for 2 minutes, 1 cycle; 94° C. for 10 seconds+58° C. for 30 seconds+68° C. for 2 minutes, 10 cycles; 94° C. for 10 seconds+58° C. for 30 seconds+68° C. for 2 minutes with 10 seconds extension per cycle, 20 cycles; 68° C. for 5 minutes, 1 cycle. The primer DBPpcr1: CG[0033] G GAT CCG CCA CCA TGG CCA GTC GGG AAG AGG AG (5′ to 3′) (SEQ ID NO:1) contains a unique BamHI restriction site (underlined) 5′ of the Kozak sequence (italic) and start codon of the E2A coding sequence. The primer DBPpcr2: CGG AAT TCT TAA AAA TCA AAG GGG TTC TGC CGC (5′ to 3′) (SEQ ID NO:2) contains a unique EcoRI restriction site (underlined) 3 ′ of the stop codon of the E2A coding sequence. The bold characters refer to sequences derived from the E2A coding region. The PCR fragment was digested with BamHI/EcoRI and cloned into BamHI/EcoRI digested pcDNA3 (Invitrogen), giving rise to pcDNA3wtE2A.
  • pcDNA3tsE2A: The complete ts125E2A-coding region was amplified from DNA isolated from the temperature sensitive adenovirus mutant H5ts125 (Ensinger et al., J. Virol. 10: 328, 1972; van der Vliet et al., [0034] J Virol. 15: 348, 1975). The PCR amplification procedure was identical to that for the amplification of wtE2A. The PCR fragment was digested with BamHI/EcoRI and cloned into BamHI/EcoRI digested pcDNA3 (Invitrogen), giving rise to pcDNA3tsE2A. The integrity of the coding sequence of wtE2A and tsE2A was confirmed by sequencing.
  • B. Growth Characteristics of Producer Cells for the Production of Recombinant Adenoviral Vectors Cultured at 32°, 37° and 39° C. [0035]
  • PER.C6 cells were cultured in Dulbecco's Modified Eagle Medium (“DMEM”, Gibco BRL) supplemented with 10% FBS and 10 mM MgCl[0036] 2 in a 10% CO2 atmosphere at either 32° C., 37° C. or 39° C. At day 0, a total of 1×106 PER.C6 cells were seeded per 25 cm2 tissue culture flask (Nunc) and the cells were cultured at either 32° C., 37° C. or 39° C. At each of days 1-8, cells were counted. FIG. 1 shows that the growth rate and the final cell density of the PER.C6 culture at 39° C. are comparable to that at 37° C. The growth rate and final density of the PER.C6 culture at 32° C. were slightly reduced as compared to that at 37° C or 39° C. No significant cell death was observed at any of the incubation temperatures. Thus PER.C6 performs very well both at 32° C. and 39° C., the permissive and non-permissive temperature for ts125E2A, respectively.
  • C. Transfection of PER.C6 and 293 With E2A Expression Vectors; Colony Formation and Generation of Cell Lines. [0037]
  • One day prior to transfection, 2×10[0038] 6 PER.C6 cells were seeded per 6 cm tissue culture dish (Greiner) in DMEM, supplemented with 10% FBS and 10 mM MgCl2 and incubated at 37° C. in a 10% CO2 atmosphere. The next day, the cells were transfected with 3, 5 or 8μg of either pcDNA3, pcDNA3wtE2A or pcDNA3tsE2A plasmid DNA per dish, using the LipofectAMINE PLUS™ Reagent Kit according to the standard protocol of the supplier (Gibco BRL), except that the cells were transfected at 39° C. in a 10% CO2 atmosphere. After the transfection, the cells were constantly kept at 39° C., the non-permissive temperature for ts125E2A. Three days later, the cells were put on DMEM, supplemented with 10% FBS, 10 mM MgCl2 and 0.25 mg/ml G418 (Gibco BRL) and the first G418 resistant colonies appeared at 10 days post transfection. As shown in Table 1, there was a dramatic difference between the total number of colonies obtained after transfection of pcDNA3 (˜200 colonies) or pcDNA3tsE2A (˜100 colonies) and pcDNA3wtE2A (only 4 colonies). These results indicate that the constitutive expression of E2A is toxic and the toxicity of constitutively expressed E2A can be overcome by using a temperature sensitive mutant of E2A (ts125E2A) and culturing of the cells at the non-permissive temperature of 39° C.
    TABLE 1
    Number of colonies after transfection of PER.C6 with
    E2A expression vectors:
    plasmid number of colonies cell lines established
    pcDNA3 ˜200 4/4
    PcDNA3wtE2A 4 1/4
    PcDNA3tsE2A ˜100 37/45
  • PER.C6 cells were transfected with either pcDNA3, pcDNA3wtE2A or pcDNA3wtE2A and cultured in selection medium containing 0.25 mg/ml G418 at 39° C. All colonies (4/4) picked from the pcDNA3 transfection and 82% (37/45) of the colonies from the pcDNA3tsE2A transfection were established to stable cell lines. In contrast, only 25% (1/4) of the colonies from the pcDNA3wtE2A transfection could be established to a cell line. [0039]
  • From each transfection, a number of colonies was picked by scraping the cells from the dish with a pipette. The detached cells were subsequently put into 24 well tissue culture dishes (Greiner) and cultured further at 39° C. in a 10% CO[0040] 2 atmosphere in DMEM, supplemented with 10% FBS, 10 mM MgCl2 and 0.25mg/ml G418. As shown in Table 1, 100% of the pcDNA3 transfected colonies (4/4) and 82% of the pcDNA3tsE2A transfected colonies (37/45) were established to stable cell lines (the remaining 8 pcDNA3tsE2A transfected colonies grew slowly and were discarded). In contrast, only 1 pcDNA3wtE2A-transfected colony could be established. The other 3 died directly after picking.
  • Next, the E2A expression levels in the different cell lines were determined by Western blotting. The cell lines were seeded on 6 well tissue culture dishes and sub-confluent cultures were washed twice with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor). After 15 minutes incubation on ice, the lysates were cleared by centrifugation. Protein concentrations were determined by the Bio-Rad protein assay, according to standard procedures of the supplier(BioRad). Equal amounts of whole-cell extractwere fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes (Millipore) and incubated with the aDBP monoclonal antibody B6 (Reich et al., Virology 128: 480, 1983). The secondary antibody was a horseradish-peroxidase-conjugated goat anti mouse antibody (BioRad). The Western blotting procedure and incubations were performed according to the protocol provided by Millipore. The complexes were visualized with the ECL detection system according to the manufacturer's protocol (Amersham). FIG. 2 shows that all of the cell lines derived from the pcDNA3tsE2A transfection express the 72-kDa E2A protein (left panel, lanes 4-14; middle panel, lanes 1- 13; right panel, lanes 1- 12). In contrast, the only cell line derived from the pcDNAwtE2A transfection did not express the E2A protein (left panel, lane 2). No E2A protein was detected in extract from a cell line derived from the pcDNA3 transfection (left panel, lane 1), which serves as a negative control. Extract from PER.C6 cells transiently transfected with pcDNA3ts125 (left panel, lane 3) served as a positive control for the Western blot procedure. These data confirm that constitutive expression of wtE2A is toxic for cells and that using the ts125 mutant of E2A can circumvent this toxicity. [0041]
  • In contrast to PER.C6 cells, the culturing of 293 cells at 39° C. is troublesome. Therefore, the transfection of 293 cells with either pcDNA3, pcDNA3wtE2A or pcDNA3tsE2A was performed at 37° C. in an atmosphere of 10% CO[0042] 2, a semi-permissive temperature for ts125E2A encoded DBP. A day prior to transfection, 293 cells were seeded in DMEM, supplemented with 10% FBS and 10 MM MgCl2, at a density of 3.6×105 cells per 6 cm tissue culture dish (Greiner). Five hours before transfection, cells received fresh medium. Cells were transfected with 7.2 μg of either pcDNA3, pcDNA3wtE2A or pcDNA3tsE2A plasmid DNA using the Calcium Phosphate Transfection System according to the standard protocol of the supplier (Gibco BRL). Two days post transfection, cells were put on selection medium, i.e., DMEM supplemented with 10% FBS, 10 mM MgCl2 and 0.1 mg/ml G418. The first colonies appeared at day 12 post transfection. As shown in Table 2, the total number of colonies obtained after transfection of pcDNA3 (18 100 colonies) or pcDNA3tsE2A (˜25 colonies) was significantly higher than that obtained after transfection of pcDNA3wtE2A (only 2 colonies). A total of 22 clones from the pcDNA3tsE2A transfection were picked by scraping the cells from the dish with a pipette. The detached cells were subsequently put into 96 well tissue culture dishes (Greiner) and cultured further at 37° C. in a 10% CO2 atmosphere in DMEM, supplemented with 10% FBS, 10 mM MgCl2 and 0.1 mg/ml G418. Sixteen out of the 22 picked colonies could be established as cell lines (the 6 remaining colonies grew badly and were discarded).
    TABLE 2
    Number of colonies after transfection of 293 with E2A
    expression vectors:
    plasmid number of colonies
    pcDNA3 ˜100
    PcDNA3wtE2A 2
    PcDNA3tsE2A 25
  • Selection of colonies derived from 293 cells transfected with E2A expression cassettes. [0043] Cell line 293 was transfected with either pcDNA3, pcDNA3wtE2A or pcDNA3wtE2A and cultured in selection medium containing 0.1 mg/ml G418 at 37° C.
  • Next, the E2A expression level in 8 different cell lines was determined by Western blotting. The cell lines were seeded on 6 well tissue culture dishes and sub-confluent cultures were washed twice with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor). After 15 minutes incubation on ice, the lysates were cleared by centrifugation. Protein concentrations were determined by the BioRad protein assay, according to standard procedures of the supplier (BioRad). Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes (Millipore) and incubated with the aDBP monoclonal antibody B6 (Reich et al., Virology 128: 480, 1983). The secondary antibody was a horseradish-peroxidase-conjugated goat anti mouse antibody (BioRad). The Western blotting procedure and incubations were performed according to the protocol provided by Millipore. The complexes were visualized with the ECL detection system according to the manufacturer's protocol (Amersham). FIG. 3 shows, that, in contrast to the PER.C6tsE2A cell lines, only clone 20 (lane 8) from the pcDNA3tsE2A transfected 293 cells expressed the full-length ts125E2A encoded 72-kDa DBP. No E2A encoded DBP was detected in extract from a cell line (clone 4) derived from the pcDNA3 transfected 293 cells (lane 1), which serves as a negative control. Extract from PER.C6 cells stably expressing ts125E2A encoded DBP (polyclonal cell line 5) (lane 2) served as a positive control for the Western blot procedure. The other 293 clones either did not express ts125E2A encoded DBP (clones 21 and 22, [0044] lanes 9 and 10 respectively) or expressed aberrant products running with a faster ( clones 3, 12, 16 and 18 lanes 4-7) or slower (clone 2, lane 3) mobility in SDS/PAGE. These results show that generation of E2A complementing cell line by using temperature sensitive mutants of E2A is not specific for PER.C6 cells, but that it applies to eukaryotic cells in general (e.g., 293 cells). In addition, the 293 data show that keeping the temperature sensitive E2A encoded DBP as inactive as possible is crucial for easy generation of such cell lines. The 293 cell lines were generated at an intermediate temperature of 37° C., a temperature at which ts125E2A encoded DBP is only partially inactivated. This explains the high number of cell lines expressing aberrant DBP products.
  • D. Complementation of E2A Deletion in Adenoviral Vectors on PER.C6- and 293 Cells Constitutively Expressing Full-length ts125E2A Encoded DBP. [0045]
  • The adenovirus Ad5.dl802 is an [0046] Ad 5 derived vector deleted for the major part of the E2A coding region and does not produce functional DBP (Rice et al., J Virol. 56: 767, 1985). Ad5.dl802 was used to test the E2A trans-complementing activity of PER.C6 cells constitutively expressing ts125E2A. Parental PER.C6 cells or PER.C6tsE2A clone 3-9 were cultured in DMEM, supplemented with 10% FBS and 1 mM MgCl2 at 39° C. . d 10% CO2 in 25 cm2 flasks and either mock infected or infected with Ad5.dl802 at an m.o.i. of 5. Subsequently, the infected cells were cultured at 32° C. and cells were screened for the appearance of a cytopathic effect (CPE) as determined by changes in cell morphology and detachment of the cells from the flask. Table 3 shows that full CPE appeared in the Ad5.dl802 infrected PER.C6tsE2A clone 3-9 within 2 days. No CPE appeared in the Ad5.dl802 infected PER.C6 cells or the mock infected cells. These data show that PER.C6 cells constitutively expresing ts125E2A complement in trans for the E2A deletion in the Ad5.dl802 vector at the permissive temperature of 32° C.
  • These cells are therefore suitable for production of recombinant adenoviral vector that are deficient for functional E2A. [0047]
    TABLE 3
    Complementation of E2A deletion in adenoviral vectors on PER.C6
    cells and PER.C6 cells constitutively expressing temperature
    sensitive E2A.
    32° C. day 2
    PER.C6 mock
    PER.C6 d1802
    PER.C6ts125c3-9 mock
    PER.C6ts125c3-9 d1802 Full CPE
  • Parental PER.C6 cells or PER.C6ts125E2A clone 3-9 were infected with Ad5.dl802, an Ad5 adenovirus deleted for the E2A gene, at m.o.i. of 5. Subsequently, the infected cells were cultured at 32° C. and cells were screened for the appearance of a cytopathic effect (CPE) as determined by changes in cell morphology and detachment of the cells from the flask. [0048]
  • The 293tsE2A clones c2, c16, c18 and c20 and the 293pcDNA3-clone c4 were tested for their E2A trans-complementing activity as follows. The cell lines were cultured in DMEM, supplemented with 10% FBS and 10 mM MgCl[0049] 2 at 39° C. and 10% CO2 in 6 well plates and either mock infected or infected with IG.Ad.CLIP.Luc (see below) at an m.o.i. of 10. Subsequently, the infected cells were cultured at either 32° C. or 39° C. and cells were screened for the appearance of a cytopathic effect (CPE) 3 days post infection, as determined by changes in cell morphology and detachment of the cells from the flask. Table 4 shows that no CPE appeared in the control cell line 293pcDNA3-c4. Moreover, the cell lines expressing aberrant forms of DBP either failed to complement this vector (clones 16 and 18) or were intermediate in the trans-complementing ability (clone 2). Only the 293 cell line expressing full-length ts125E2A encoded DBP (i. e., clone 20) fully complemented for the E2A deletion in the vector IG.Ad.CLIP.Luc at the permissive temperature of 32° C. No CPE appeared at the non-permissive temperature of 39° C.
    TABLE 4
    Complementation of E2A deletion in adenoviral vectors on 293
    cells and 293 cells constitutively expressing temperature sensitive E2A.
    Cell line CPE at 32° C. CPE at 39° C.
    293pcDNA3-c4
    293ts125E2A-c2 +/−
    293ts125E2A-c16
    293ts125E2A-c18
    293ts125E2A-c20 +
  • The 293ts125E2A clones c2, c16, c18 and c20 and the 293pcDNA3-clone c4 were tested for their E2A trans-complementing activity as follows. The cell lines were either mock infected or infected with IG.Ad.CLIP.Luc at an m.o.i. of 10. Subsequently, the infected cells were cultured at either 32° C. or 39° C. and cells were screened for the appearance of a cytopathic effect (CPE) 3 days post infection, as determined by changes in cell morphology and detachment of the cells from the flask. [0050]
  • E. Serum-free Suspension Culture of PER.C6tsE2A Cell Lines. [0051]
  • Large-scale production of recombinant adenoviral vectors for human gene therapy requires an easy and scalable culturing method for the producer cell line, preferably a suspension culture in medium devoid of any human or animal constituents. To that end, the cell line PER.C6tsE2A c5-9 (designated c5-9) was cultured at 39° C. and 10% CO[0052] 2 in a 175 cm2 tissue culture flask (Nunc) in DMEM, supplemented with 10% FBS and 10mM MgCl2. At sub-confluency (70-80% confluent), the cells were washed with PBS (NPBI) and the medium was replaced by 25 ml serum free suspension medium Ex-cell™ 525 (JRH) supplemented with 1×L-Glutamin (Gibco BRL), hereafter designated SFM. Two days later, cells were detached from the flask by flicking and the cells were centrifuged at 1000 rpm for 5 minutes. The cell pellet was re-suspended in 5 ml SFM and 0.5 ml cell suspension was transferred to an 80 cm2 tissue culture flask (Nunc), together with 12 ml fresh SFM. After 2 days, cells were harvested (all cells are in suspension) and counted in a Burker cell counter. Next, the cells were seeded in a 125 ml tissue culture Erlenmeyer (Corning) at a seeding density of 3×105 cells per ml in a total volume of 20 ml SFM. Cells were further cultured at 125 RPM on an orbital shaker (GFL) at 39° C. in a 10% CO2 atmosphere. Cells were counted at day 1-6 in a Burker cell counter. In FIG. 4, the mean growth curve from 8 cultures is shown. PER.C6tsE2A c5-9 performs well in serum free suspension culture. The maximum cell density of approximately 2×106 cells per ml is reached within 5 days of culture.
  • F. Growth Characteristics of PER.C6 and PER.C6/E2A at 37° C. and 39° C. [0053]
  • PER.C6 cells or PER.C6ts125E2A (c8-4) cells were cultured in DMEM supplemented with 10% FBS and 10 mM MgCl[0054] 2in a 10% CO2 atmosphere at either 37° C. (PER.C6) or 39° C. (PER.C6ts125E2A c8-4). At day 0, a total of 1×106 cells were seeded per 25 cm2 tissue culture flask (Nunc) and the cells were cultured at the respective temperatures. At the indicated time points, cells were counted. FIG. 5 shows that the growth of PER.C6 cells at 37° C. is comparable to the growth of PER.C6ts125E2A c8-4 at 39° C. This shows that constitutive expression of ts125E2A encoded DBP has no adverse effect on the growth of cells at the non-permissive temperature of 39° C.
  • G. Stability of PER. C6ts125E2A. [0055]
  • For several passages, the PER.C6ts125E2A cell line clone 8-4 was cultured at 39° C. and 10% CO[0056] 2 in a 25 cm2 tissue culture flask (Nunc) in DMEM, supplemented with 10% FBS and 10 mM MgCl2 in the absence of selection pressure (G418). At sub-confluency (70-80% confluent), the cells were washed with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1 % SDS in PBS, supplemented with 1 mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor). After 15 minutes incubation on ice, the lysates were cleared by centrifugation. Protein concentrations were determined by the BioRad protein assay, according to standard procedures of the supplier (BioRad). Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels. Proteins were transferred onto Immobilon-P membranes (Millipore) and incubated with the aDBP monoclonal antibody B6 (Reich et al., Virology 128: 480, 1983). The secondary antibody was a horseradish-peroxidase-conjugated goat anti mouse antibody (BioRad). The Western blotting procedure and incubations were performed according to the protocol provided by Millipore. The complexes were visualized with the ECL detection system according to the manufacturer's protocol (Amersham). FIG. 6 shows that the expression of ts125E2A encoded DBP is stable for at least 16 passages, which is equivalent to approximately 40 cell doublings. No decrease in DBP levels was observed during this culture period, indicating that the expression of ts125E2A is stable, even in the absence of G418 selection pressure.
  • EXAMPLE II
  • Plasmid based system for the generation of recombinant adenoviral vectors deleted in E1 and E2A [0057]
  • A. Generation of pBr/Ad.Bam-rITR (ECACC deposit P97082122). [0058]
  • In order to facilitate blunt end cloning of the inverted terminal repeat (“ITR”) sequences, wild-type human adenovirus type 5 (Ad5) DNA was treated with Klenow enzyme in the presence of excess dNTPs. After inactivation of the Klenow enzyme and purification by phenol/chloroform extraction followed by ethanol precipitation, the DNA was digested with BamHI. This DNA preparation was used without further purification in a ligation reaction with pBr322 derived vector DNA prepared as follows: pBr322 DNA was digested with EcoRV and BamHI, de-phosphorylated by treatment with TSAP enzyme (Life Technologies) and purified on LMP agarose gel (SeaPlaque GTG). After transformation into competent [0059] E.coli nDH5a (Life Techn.) and analysis of ampicillin resistant colonies, one clone was selected that showed a digestion pattern as expected for an insert extending from the BamHI site in Ad5 to the right ITR.
  • Sequence analysis of the cloning border at the right ITR revealed that the most 3′G residue of the ITR was missing, the remainder of the ITR was found to be correct. The missing G residue is complemented by the other ITR during replication. [0060]
  • B. Generation of pBr/Ad.Sal-rITR (ECACC Deposit P97082119). [0061]
  • pBr/Ad.Bam-rITR was digested with BamHI and SalI. The vector fragment including the adenovirus insert was isolated in LMP agarose (SeaPlaque GTG) and ligated to a 4.8 kb SalI-BamHI fragment obtained from wt Ad5 DNA and purified with the Geneclean II kit (Bio 101, Inc.). One clone was chosen and the integrity of the Ad5 sequences was determined by restriction enzyme analysis. Clone pBr/Ad.Sal-rITR contains [0062] adeno type 5 sequences from the SalI site at bp 16746 up to and including the rITR (missing the most 3′ G residue).
  • C. pBr/Ad.Cla-Bam (ECACC Deposit P97082117). [0063]
  • wt [0064] Adeno type 5 DNA was digested with ClaI and BamHI, and the 20.6-kb fragment was isolated from gel by electro-elution. pBr322 was digested with the same enzymes and purified from agarose gel by Geneclean. Both fragments were ligated and transformed into competent DH5a. The resulting clone pBr/Ad.Cla-Bam was analyzed by restriction enzyme digestion and shown to contain an insert with adenovirus sequences from bp 919 to 21566.
  • D. Generation of pBr/Ad.AflII-Bam (ECACC Deposit P97082114). [0065]
  • Clone pBr/Ad.Cla-Bam was linearized with EcoRi (in pBr322) and partially digested with AflII. After heat inactivation of AflII for 20 minutes at 65° C., the fragment ends were filled in with Klenow enzyme. The DNA was then ligated to a blunt double stranded oligo linker containing a PacI site (5′-AATTGTCTTAATTAACCGCTTAA-3′ (SEQ ID NO:3)). This linker was made by annealing the following two oligonucleotides: 5′-AATTGTCTTAATTAACCGC-3′ (SEQ ID NO:4) and 5′-AATTGCGGTTAATTAAGAC-3 ′ (SEQ ID NO:5), followed by blunting with Klenow enzyme. After precipitation of the ligated DNA to change buffer, the ligations were digested with an excess PacI enzyme to remove concatemers of the oligo. The 22016 bp partial fragment containing Ad5 sequences from bp 3534 up to 21566 and the vector sequences was isolated in LMP agarose (SeaPlaque GTG), re-ligated and transformed into competent DH5a. One clone that was found to contain the PacI site and that had retained the large adeno fragment was selected and sequenced at the 5′ end to verify correct insertion of the PacI linker in the (lost) AflII site. [0066]
  • E. Generation of pBr/Ad.Bam-rITRpac#2 (ECACC Deposit P97082120) and pBr/Ad.Bam-rITR#8 (ECACC Deposit P97082121). [0067]
  • To allow insertion of a PacI site near the ITR of Ad5 in clone pBr/Ad.Bam-rITR, about 190 nucleotides were removed between the ClaI site in the pBr322 backbone and the start of the ITR sequences. This was done as follows: pBr/Ad.Bam-rITR was digested with ClaI and treated with nuclease Bal31 for varying lengths of time (2 minutes, 5 minutes, 10 minutes and 15 minutes). The extent of nucleotide removal was followed by separate reactions on pBr322 DNA (also digested at the ClaI site), using identical buffers and conditions. Bal31 enzyme was inactivated by incubation at 75° C. for 10 minutes, and the DNA was precipitated and re-suspended in a smaller volume TE buffer. To ensure blunt ends, DNA's were further treated with T4 DNA polymerase in the presence of excess dNTPs. After digestion of the (control) pBr322 DNA with SalI, satisfactory degradation (˜150 bp) was observed in the samples treated for 10 minutes or 15 minutes. The 10 minutes or 15 minutes treated pBr/Ad.Bam-rITR samples were then ligated to the above-described blunted PacI linkers (See pBr/Ad.AflII-Bam). Ligations were purified by precipitation, digested with excess PacI and separated from the linkers on an LMP agarose gel. After re-ligation, DNA's were transformed into competent DH5a and colonies analyzed. Ten clones were selected that showed a deletion of approximately the desired length and these were further analyzed by T-track sequencing (T7 sequencing kit, Pharmacia Biotech). Two clones were found with the PacI linker inserted just downstream of the rITR. After digestion with PacI, [0068] clone #2 has 28 bp and clone #8 has 27 bp attached to the ITR.
  • F. Generation of pWE/Ad.AflII-rITR (ECACC Deposit P97082116). [0069]
  • Cosmid vector pWE15 (Clontech) was used to clone larger Ad5 inserts. First, a linker containing a unique PacI site was inserted in the EcoRI sites of [0070] pWE 15 creating pWE.pac. To this end, the double stranded PacI oligo as described for pBr/Ad.AflII-BamHI was used but now with its EcoRI protruding ends. The following fragments were then isolated by electro-elution from agarose gel: pWE.pac digested with PacI, pBr/AflII-Bam digested with PacI and BamHI and pBr/Ad.Bam-rITR#2 digested with Bam-HI and PacI. These fragments were ligated together and packaged using 1 phage packaging extracts (Stratagene) according to the manufacturer's protocol. After infection into host bacteria, colonies were grown on plates and analyzed for presence of the complete insert. pWE/Ad.AflII-rITR contains all adenovirus type 5 sequences from bp 3534 (AflII site) up to and including the right ITR (missing the most 3′G residue).
  • G. Generation of pWE/Ad.AflII-EcoRI. [0071]
  • pWE.pac was digested with ClaI and 5′ protruding ends were filled using Klenow enzyme. The DNA was then digested with PacI and isolated from agarose gel. pWE/AflII-rITR was digested with EcoRI and after treatment with Klenow enzyme digested with PacI. The large 24-kb fragment containing the adenoviral sequences was isolated from agarose gel and ligated to the ClaI-digested and blunted pWE.pac vector using the Ligation Express™ kit from Clontech. After transformation of Ultra-competent XL10-Gold cells from Stratagene, clones were identified that contained the expected insert. pWE/AflII-EcoRI contains Ad5 sequences from bp 3534-27336. [0072]
  • H. Generation of pWE/Ad.AflII-rITRDE2A: [0073]
  • Deletion of the E2A coding sequences from pWE/Ad.AflII-rITR (ECACC deposit P97082116) has been accomplished as follows. The adenoviral sequences flanking the E2A coding region at the left and the right site were amplified from the plasmid pBr/Ad.Sal.rITR (ECACC deposit P97082119) in a PCR reaction with the Expand PCR system (Boehringer) according to the manufacturer's protocol. The following primers were used: Right flanking sequences (corresponding Ad5 nucleotides 24033 to 25180): [0074]
  • DE2A.SnaBI: 5′-GGC GTA CGT AGC CCT GTC GAA AG-3′ (SEQ ID NO:6) [0075]
  • DE2A.DBP-start: 5′-CCA ATG CAT TCG AAG TAC TTC CTT CTC CTA TAG GC-3′ (SEQ ID NO:7). [0076]
  • The amplified DNA fragment was digested with SnaBI and NsiI (NsiI site is generated in the primer DE2A.DBP-start, underlined). In addition, a unique BstBI site is generated in this primer (italics). [0077]
  • Left flanking sequences (corresponding Ad5 nucleotides 21557 to 22442): [0078]
  • DE2A.DBP-stop: 5′-CCA ATG CAT ACG GCG CAG ACG G-3′ (SEQ ID NO:8) [0079]
  • DE2A.BamHI: 5′-GAG GTG GAT CCC ATG GAC GAG-3′ (SEQ ID NO:9) [0080]
  • The amplified DNA was digested with BamHI and NsiI (NsiI site is generated in the primer DE2A.DBP-stop, underlined). Subsequently, the digested DNA fragments were ligated into SnaBI/BamHI digested pBr/Ad.Sal-rITR. Sequencing confirmed the exact replacement of the DBP coding region with a unique NsiI site and BstBI site in plasmid pBr/Ad.Sal-rITRDE2A. The unique NsiI site and BstBI site can be used to introduce an expression cassette for a gene to be transduced by the recombinant vector. [0081]
  • The deletion of the E2A coding sequences was performed such that the splice acceptor sites of the 100K encoding L4-gene at position 24048 in the top strand was left intact. In addition, the polyadenylation signals of the original E2A-RNA and L3-RNAs at the left-hand site of the E2A coding sequences were left intact. This ensures proper expression of the L3-genes and the gene encoding the 100K L4-protein during the adenovirus life cycle. [0082]
  • Next, the plasmid pWE/Ad.AflII-rITRDE2A was generated. The plasmid pBr/Ad.Sal-rITRDE2A was digested with BamHI and Spel. The 3.9-Kb fragment in which the E2A coding region was replaced by the unique NsiI site and BstBI site was isolated. The pWE/Ad.AflII-rITR was digested with BamHil and SpeI. The 35 Kb DNA fragment, from which the BamHI/SpeI fragment containing the E2A coding sequence was removed, was isolated. The fragments were ligated and packaged using 1 phage-packaging extracts according to the manufacturer protocol (Stratagene), yielding the plasmid pWE/Ad.AflII-rITRDE2A. Note that there is no sequence overlap between the adenoviral sequences present in pWE/Ad.AflII-rITRDE2A and the E2A sequences present in the expression vectors pcDNA3tsE2A and pcDNAwtE2A or the cell lines derived from this vector. [0083]
  • I. Generation of the Adapter Plasmids. [0084]
  • Adapter plasmid pMLP.TK (European patent application no. EP 95202213) was modified as follows: SV40 polyA sequences were amplified with primer SV40-1 (introduces a BamHI site) and SV40-2 (introduces a BglII site). In addition, Ad5 sequences present in this construct (from nt. 2496 to nt. 2779; Ad5 sequences nt. 3511 to 3794) were amplified with primers Ad5-1 (introduces a BglII site) and Ad5-2. [0085]
  • SV40-1: 5′-GGGGGATCCGAACTTGTTTATTGCAGC-3′ (SEQ ID NO: 10). [0086]
  • SV40-2: 5′-GGGAGATCTAGACATGATAAGATAC-3′ (SEQ ID NO:11). [0087]
  • Ad5-1: 5′-GGGAGATCTGTACTGAAATGTGTGGGC-3′ (SEQ ID NO:12). [0088]
  • Ad5-2:5′-GGAGGCTGCAGTCTCCAACGGCGT-3′ (SEQ ID NO: 13). [0089]
  • Both PCR fragments were digested with BglII and ligated. The ligation product was amplified with primers SV40-1 and Ad5-2 and digested with BamHI and AflII. The digested fragment was then ligated into pMLP.TK predigested with the same enzymes. The resulting construct, named pMLPI.TK, contains a deletion in adenovirus E1 sequences from nt. 459 to nt. 3510. [0090]
  • This plasmid was used as the starting material to make a new vector in which nucleic acid molecules comprising specific promoter and gene sequences can be easily exchanged. First, a PCR fragment was generated from pZipDMo+PyF101(N[0091] ) template DNA (described in PCT/NL96/00195) with the following primers: LTR-1: 5′-CTG TAC GTA CCA GTG CAC TGG CCT AGG CAT GGA AAA ATA CAT AAC TG-3′ (SEQ ID NO:14) and LTR-2: 5′-GCG GAT CCT TCG AAC CAT GGT AAG CTT GGT ACC GCT AGC GTT AAC CGG GCG ACT CAG TCA ATC G-3′ (SEQ ID NO: 15). Pwo DNA polymerase (Boehringer Mannheim) was used according to manufacturer's protocol with the following temperature cycles: once 5 minutes at 95° C.; 3 minutes at 55° C.; and 1 minute at 72° C., and 30 cycles of 1 minute at 95° C., 1 minute at 60° C., 1 minute at 72° C., followed by once for 10 minutes at 72° C. The PCR product was then digested with BamHI and ligated into pMLP10 (Levrero et al., 1991; Gene 101, 195-202) digested with PvuII and BamHI, thereby generating vector pLTR10. This vector contains adenoviral sequences from bp 1 up to bp 454 followed by a promoter consisting of apart of the Mo-MuLV LTR having its wild-type enhancer sequences replaced by the enhancer from a mutant polyoma virus (PyF101). The promoter fragment was designated L420. Sequencing confirmed correct amplification of the LTR fragment; however, most 5′ bases in the PCR fragment were missing so that the PvuII site was not restored. Next, the coding region of the murine HSA gene was inserted. pLTR10 was digested with BstBI followed by Klenow treatment and digestion withNcoI. The HSA gene was obtained by PCR amplification on pUC 18-HSA (Kay et al., 1990; J. Immunol. 145, 1952-1959) using the following primers: HSA1, 5′-GCG CCA CCA TGG GCA GAG CGA TGG TGG C-3′ (SEQ ID NO: 16) and HSA2, 5′-GTT AGA TCT AAG CTT GTC GAC ATC GAT CTA CTA ACA GTA GAG ATG TAG AA-3′ (SEQ ID NO:17). The 269 bp-amplified fragment was sub-cloned in a shuttle vector using the NcoI and BglII sites. Sequencing confirmed incorporation of the correct coding sequence of the HSA gene, but with an extra TAG insertion directly following the TAG stop codon. The coding region of the HSA gene, including the TAG duplication, was then excised as a NcoI (sticky)-SalI (blunt) fragment and cloned into the 3.5 kb NcoI (sticky)/BstBI (blunt) fragment from pLTR10, resulting in pLTR-HSA10.
  • Finally, pLTR-HSA10 was digested with EcoRI and BamHI after which the fragment containing the left ITR, packaging signal, L420 promoter and HSA gene was inserted into vector pMLPI.TK digested with the same enzymes and thereby replacing the promoter and gene sequences. This resulted in the new adapter plasmid pAd5/L420-HSA that contains convenient recognition sites for various restriction enzymes around the promoter and gene sequences. SnaBI and AvrII can be combined with HpaI, NheI, KpnI, and HindIII to exchange promoter sequences, while the latter sites can be combined with the ClaI or [0092] BamHI sites 3′ from HSA coding region to replace genes in this construct.
  • Another adapter plasmid that was designed to allow easy exchange of nucleic acid molecules was made by replacing the promoter, gene and polyA sequences in pAd5/L420-HSA with the CMV promoter, a multiple cloning site, an intron and a polyA signal. For this purpose, pAd/L420-HSA was digested with AvrII and BglII followed by treatment with Klenow to obtain blunt ends. The 5.1 kb fragment with pBr322 vector and adenoviral sequences was isolated and ligated to a blunt 1570 bp fragment from [0093] pcDNA 1/amp (Invitrogen) obtained by digestion with HhaI and AvrII followed by treatment with T4 DNA polymerase. This adapter plasmid was named pAd5/Clip.
  • The adapter plasmid pCMV.LacZ was generated as follows: The plasmid pCMV.TK (EP 95-202 213) was digested with HindIII, blunted with Klenow and dNTPs and subsequently digested with SalI. The DNA fragment containing the CMV promoter was isolated. The plasmid pMLP.nlsLacZ (EP 95-202 213) was digested with KpnI, blunted with T4 DNA polymerase and subsequently digested with SalI. The DNA fragment containing the LacZ gene and adjacent adenoviral sequences was isolated. Next, the two DNA fragments were ligated with T4 DNA ligase in the presence of ATP, giving rise to pCMV.nlsLacZ. [0094]
  • The adapter plasmid pAd5/CLIP.LacZwas generated as follows: The [0095] E.coli LacZ gene was amplified from the plasmid pMLP.nlsLacZ (EP 95-202 213) by PCR with the primers 5′GGGGTGGCCAGGGTACCTCTAGGCTTTTGCAA (SEQ ID NO:18) and 5′GGGGGGATCCATAAACAAGTTCAGAATCC (SEQ ID NO:19). The PCR reaction was performed Ex Taq (Takara) according to the suppliers protocol at the following amplification program: 5 minutes 94° C., 1 cycle; 45 seconds 94° C. and 30 seconds 60° C. and 2 minutes 72° C.,5 cycles; 45 seconds 94° C. and 30 seconds 65° C. and 2 minutes 72° C., 25 cycles; 10 minutes 72° C., 1 cycle; 45 seconds 94° C. and 30 seconds 60° C. and 2 minutes 72° C., 5 cycles, 1 cycle. The PCR product was subsequently digested with Kpn1 and BamHI and the digested DNA fragment was ligated into KpnI/BamHI digested pcDNA3 (Invitrogen), giving rise to pcDNA3.nlsLacZ. Next, the plasmid pAd/CLIP was digested with Spel. The large fragment containing part of the 5′ part CMV promoter and the adenoviral sequences was isolated. The plasmid pcDNA3.nlsLacZ was digested with SpeI and the fragment containing the 3′ part of the CMV promoter and the LacZ gene was isolated. Subsequently, the fragments were ligated, giving rise to pAd/CLIP.LacZ. The reconstitution of the CMV promoter was confirmed by restriction digestion.
  • The adapter plasmid pAd5/CLIP.Luc was generated as follows: The plasmid pCMV.Luc (EP 95-202 213) was digested with HindIII and BamHI. The DNA fragment containing the luciferase gene was isolated. The adapter plasmid pAd/CLIP was digested with HindIII and BamHI, and the large fragment was isolated. Next, the isolated DNA fragments were ligated, giving rise to pAdS/CLIP.Luc. [0096]
  • EXAMPLE III
  • Generation of Recombinant Adenoviruses [0097]
  • A. E1-deleted Recombinant Adenoviruses With wt E3 Sequences. [0098]
  • To generate E1 deleted recombinant adenoviruses with the plasmid-based system, the following constructs are prepared: [0099]
  • a) An adapter construct containing the expression cassette with the gene of interest linearized with a restriction enzyme that cuts at the 3′ side of the overlapping adenoviral genome fragment, preferably not containing any pBr322 vector sequences, and [0100]
  • b) A complementing adenoviral genome construct pWE/Ad.AflII-rITR digested with PacI. These two DNA molecules are further purified by phenol/chloroform extraction and ethanol precipitation. Co-transfection of these plasmids into an adenovirus packaging cell line, preferably a cell line according to the invention, generates recombinant replication deficient adenoviruses by a one-step homologous recombination between the adapter and the complementing construct. [0101]
  • A general protocol as outlined hereinafter and meant as a non-limiting example of the present invention has been performed to produce several recombinant adenoviruses using various adapter plasmids and the Ad.AflII-rITR fragment. Adenovirus packaging cells (PER.C6) were seeded in ˜25 cm[0102] 2 flasks and the next day, when they were at ˜80% confluency, transfected with a mixture of DNA and lipofectamine agent (Life Techn.) as described by the manufacturer. Routinely, 40μl lipofectamine, 4 μg adapter plasmid and 4 μg of the complementing adenovirus genome fragment AflII-rITR (or 2 μg of all three plasmids for the double homologous recombination) are used. Under these conditions, transient transfection efficiencies of ˜50% (48 hrs post transfection) are obtained as determined with control transfections using a pAd/CMV-LacZ adapter. Two days later, cells are passaged to ˜80 cm2 flasks and further cultured. Approximately five (for the single homologous recombination) to eleven days (for the double homologous recombination) later a cytopathic effect (CPE) is seen, indicating that functional adenovirus has formed. Cells and medium are harvested upon full CPE and recombinant virus is released by freeze-thawing. An extra amplification step in a 80 cm2 flask is routinely performed to increase the yield since at the initial stage the titers are found to be variable despite the occurrence of full CPE. After amplification, viruses are harvested and plaque purified on PER.C6 cells. Individual plaques are tested for viruses with active trans-genes.
  • Several different recombinant adenoviruses, comprising the luciferase gene (IG.Ad.CLIP.Luc), the bacterial LacZ gene (IG.Ad.CLIP.LacZ and IG.Ad.CMV.LacZ) or an empty CLIP cassette (IG.Ad.CLIP) have been produced using this protocol. In all cases, functional adenovirus was formed and all isolated plaques contained viruses with the expected expression cassettes. [0103]
  • B. Generation of Recombinant Adenoviruses Deleted for E1 and E2A. [0104]
  • Besides replacements in the E1 region, it is possible to delete or replace the E2A region in the adenovirus. This creates the opportunity to use a larger insert or to insert more than one gene without exceeding the maximum packagable size (approximately 105% of wt genome length). [0105]
  • Recombinant viruses that are both E1 and E2A deleted are generated by a homologous recombination procedure as described above for E1-replacement vectors using a plasmid-based system consisting of: [0106]
  • a) An adapter plasmid for E1 replacement according to the invention, with or without insertion of a first gene of interest. [0107]
  • b) The pWE/Ad.AflII-rITRDE2A fragment, with or without insertion of a second gene of interest. [0108]
  • Generation and propagation of such viruses, e.g., IG.Ad.CMV.LacZDE2A, IG.Ad.CLIP.LacZDE2A, IG.Ad.CLIPDE2A or IG.Ad.CLIP.LucDE2A, requires a complementing cell line for complementation of both E1 and E2A proteins in trans, as previously described herein. [0109]
  • In addition to replacements in the E1 and E2A region, it is also possible to delete or replace (part of) the E3 region in the E1-deleted adenoviral vector, because E3 functions are not necessary for the replication, packaging and infection of the (recombinant) virus. This creates the opportunity to use larger inserts or to insert more than one gene without exceeding the maximum packagable size (approximately 105% of wt genome length). This can be done, e.g., by deleting part of the E3 region in the pBr/Ad.Bam-rITR clone by digestion with XbaI and re-ligation. This removes Ad5 wt sequences 28592-30470 including all known E3 coding regions. Another example is the precise replacement of the coding region of gp19K in the E3 region with a polylinker allowing insertion of new sequences. This 1) leaves all other coding regions intact and 2) obviates the need for a heterologous promoter since the transgene is driven by the E3 promoter and pA sequences, leaving more space for coding sequences. [0110]
  • To this end, the 2.7-kb EcoRI fragment from wt Ad5 containing the 5′ part of the E3 region was cloned into the EcoRI site of pBluescript (KS-) (Stratagene). Next, the HindIll site in the polylinker was removed by digestion with EcoRV and HincIl and subsequent re-ligation. The resulting clone pBS.Eco-Eco/ad5DHII was used to delete the gp 19K-coding region. Primers 1 (5′-GGG TAT TAG GCC AAA GGC GCA-3′ (SEQ ID NO:20)) and 2 (5′-GAT CCC ATG GAA GCT TGG GTG GCG ACC CCA GCG-3′ (SEQ ID NO:21)) were used to amplify a sequence from pBS.Eco-Eco/ad5DHIII corresponding to sequences 28511 to 28734 in wt Ad5 DNA. Primers 3 (5′-GAT CCC ATG GGG ATC CTT TAC TAA GTT ACA AAG CTA-3′ (SEQ ID NO:22)) and 4 (5′-GTC GCT GTA GTT GGA CTG G-3′ (SEQ ID NO:23)) were used on the same DNA to amplify Ad5 sequences from 29217 to 29476. The two resulting PCR fragments were ligated together by virtue of the new introduced NcoI site and subsequently digested with XbaI and MunI. This fragment was then ligated into the pBS.Eco-Eco/ad5DHIII vector that was digested with XbaI (partially) and MunI generating pBS.Eco-Eco/ad5DHIII.Dgp19K. To allow insertion of foreign genes into the HindIII and BamiHI site, an XbaI deletion was made in pBS.Eco-Eco/ad5DHIII.Dgp19K to remove the BamHI site in the Bluescript polylinker. The resulting plasmid pBS.Eco-Eco/ad5DHIII.Dgp19KDXbaI, contains unique HindIII and BamHI sites corresponding to sequences 28733 (HindIII) and 29218 (BamHI) in Ad5. After introduction of a foreign gene into these sites, either the deleted XbaI fragment is re-introduced, or the insert is re-cloned into pBS.Eco-Eco/ad5DHIII.Dgp19K using HindIII and, for example, MunI. Using this procedure, we have generated plasmids expressing HSV-TK, hIL-la, rat IL-3, luciferase or LacZ. The unique SrfI and NotI sites in the pBS.Eco-Eco/ad5DHIII.Dgp19K plasmid (with orwithout inserted gene of interest) are used to transfer the region comprising the gene of interest into the corresponding region of pBr/Ad.Bam-rITR, yielding construct pBr/Ad.Bam-rITRDgp19K (with or without inserted gene of interest). This construct is used as described supra to produce recombinant adenoviruses. In the viral context, expression of inserted genes is driven by the adenovirus E3 promoter. [0111]
  • Recombinant viruses that are both E1 and E3 deleted are generated by a double homologous recombination procedure for E1-replacement vectors using a plasmid-based system consisting of: [0112]
  • a) an adapter plasmid for E1 replacement according to the invention, with or without insertion of a first gene of interest, [0113]
  • b) the pWE/Ad.AflII-EcoRI fragment, and [0114]
  • c) the pBr/Ad.Bam-rITRDgp19K plasmid with or without insertion of a second gene of interest. [0115]
  • In addition to manipulations in the E3 region, changes of (parts of) the E4 region can be accomplished easily in pBr/Ad.Bam-rITR. Moreover, combinations of manipulations in the E3 and/or E2A and/or E4 region can be made. Generation and propagation of such vectors, however, demands packaging cell lines that complement for E1 and/or E2A and/or E4 in trans. [0116]
  • EXAMPLE IV
  • E2A Revertant-free Manufacturing of E1/E2A Deleted Vectors on PER.C6/E2A Cells [0117]
  • The cell lines and E1/E2A deleted vectors described hereinbefore are developed such that overlap between sequences in the recombinant adenoviral genome and E2A sequences in the complementing cell lines is avoided. This eliminates reversion of the E2A-deleted phenotype in the E1/E2A deleted recombinant adenoviral vectors due to homologous recombination. The occurrence of reversion of the E2A deleted phenotype was studied in a PCR assay. [0118]
  • PER. C6tsE2A clone 3-9 cells were cultured in DMEM supplemented with 10% FBS and 10 mM MgCl[0119] 2in a 10% CO2 atmosphere at 39° C. in a 25 cm2 tissue culture flask. At 50% confluency, cells were infected with the recombinant adenoviral vector IG.Ad.CMV.LacZDE2A and the cells were put at 32° C. Four days post infection CPE appeared and the cells were harvested by flicking the flask. Cells were pelleted by centrifugation and the cell pellet was re-suspended in 1 ml/10 mM phosphate buffer (18 ml 0.2M Na2HPO4 (Baker) and 7 ml 0.2M NaH2PO4 (Merck) in 500 ml H2O pH=7.2). Next, 200 μl 5% sodium deoxycholate (Sigma) was added. The mixture was incubated for 30 minutes at 37° C. and 50 μl 1M MgCl2 and 10 μl DNase (1 MU/ml; ICN) was added. The mixture was incubated for another half hour at 37° C. and than cleared by centrifugation. The supernatant was put into a new tube and 100 μl 10% SDS (Baker) and 5 μl Proteinase K (20 mg/ml; Boehringer) were added. The mixture was incubated for 30 minutes at 37° C. and subsequently for 15 minutes at 65° C. Next, 1 ml phenol (Sigma) was added and the mixture was tumbled for 1 hour and centrifuged. One ml of supernatant was put into a fresh tube and 1 ml chloroform (Baker) was added. The mixture was tumbled for another 30 minutes and centrifuged. The supernatant was put into a fresh tube and mixed with 1 ml 2-Propanol (Baker) and the DNA was pelleted by centrifugation. The DNA was washed in 70% Ethanol (Baker) and re-suspended in 200 μl TE and 1 μl RNase (10 mg/ml; Boehringer). The DNA concentration was determined at a spectrophotometer.
  • The recombinant adenoviral vector DNA was screened for reversion of the E2A deleted phenotype by PCR. Two PCR reactions were performed (FIG. 7). The first was a nested PCR reaction for the detection of E2A sequences in the DNA sample. Two primer sets were designed. Set A contains the primers 551:5′CCGGCAAGTCTTGCGGCATG (SEQ ID NO :24) and 556: 5′TAGCAGGTCGGGCGCCGATAT (SEQ ID NO:25) and the nested primers 553: 5′GGCTCAGGTGGCTTTTAAGCAG (SEQ ID NO:26) and 554: 5′GAGTTGCGATACACAGGGTTGC (SEQ ID NO:27). The PCR reaction was performed using the eLONGase enzyme mix (Gibco) according to the manufacturer's protocol. DNA from 1×10[0120] 9 viral particles (+), which is equivalent to ˜40 ng, or water (−) was added as template. The PCR reactions were either not spiked, or spiked with 1, 10 and 40 molecules pBR/Ad.Sal-rITR, respectively, as indicated in FIG. 7. The following amplification program for the PCR reaction with primers 551 and 556 was used: 30 seconds at 94° C., 1 cycle; 30 seconds 94° C. and 30 seconds at 66° C. and 90 seconds at 68° C., 35 cycles; 10 minutes 68° C., 1 cycle. One μl of this reaction was put into a nested PCR with primers 553 and 554 at the following amplification program: 30 seconds at 94° C., 1 cycle; 30 seconds 94° C. and 30 seconds at 66° C. and 90 seconds at 68° C., 35 cycles; 10 minutes 68° C., 1 cycle. This reaction yields a DNA fragment of 260 bp.
  • In the second PCR reaction, a set of primers (Set B) was used that flank the E2A gene in the adenoviral genome on the left- and the right-hand site. This PCR reaction amplifies a DNA fragment spanning the site from which the E2A gene was deleted (FIG. 6). Primer set B comprises primer 731 5′AGTGCGCAGATTAGGAGCGC (SEQ ID NO:28) and primer 734 5′TCTGCCTATAGGAGAAGGAA (SEQ ID NO:29). The PCR reaction was performed using the eLONGase enzyme mix (Gibco) according to the manufacturer protocol. DNA from 1×10[0121] 9 viral particles (+), which is equivalent to ˜40 ng, or water (−) was added as template. The PCR reactions were either not spiked, or spiked with 1, 10 and 40 molecules pBR/Ad.Sal-rITR, respectively, as indicated in FIG. 7. The following amplification program was used: 30 seconds at 94° C., 1 cycle; 30 seconds 94° C. and 30 seconds at 50° C. and 90 seconds at 68° C., 35 cycles; 10 minutes 68° C., 1 cycle. This PCR reaction yields a DNA fragment of 169 bp.
  • As shown in FIG. 7, left panel (set A), E2A sequences were amplified from the DNA samples (+) and control samples (−) spiked with both 1, 10 and 40 molecules, as evidenced by the amplification of a 260 bp DNA fragment. In contrast, no E2A sequences were amplified from the non-spiked samples. This shows that reversion of the E2A-deleted does not occur. The PCR reactions with primers 731/734 yielded the expected DNA fragment of 169 bp in the samples containing the recombinant adenoviral vector DNA (+). From the negative control samples containing the water instead of DNA (−), no DNA fragment of 169 bp was amplified. These data show that elimination of overlap between adenoviral sequences in the vector and cell line prevents reversion of the E2A-deleted phenotype. [0122]
  • EXAMPLE V
  • Transduction Capacity of and Residual Expression of Adenoviral Genes from E1-deleted and E1/E2A-deleted Recombinant Adenoviral Vectors [0123]
  • The transduction capacity of E1/E2A deleted vectors was compared to E1 deleted vectors. HeLa cells were seeded at 5×10[0124] 5 cells/well in 6 well plates (Greiner) in DMEM supplemented with 10% FBS in a 10% CO2 atmosphere at 37° C. The next day, cells were infected with a m.o.i. of either 0, 10, 100 or 1000 viral particles IG.Ad/CMV.LacZ or IG.Ad/CMV.LacZDE2A per cell. Forty-eight hours post infection, cells were washed with PBS (NPBI) and fixed for 8 minutes in 0.25% glutaraldehyde (Sigma) in PBS (NPBI). Subsequently, the cells were washed twice with PBS and stained for 8 hours with X-gal solution (1 mg/ml X-gal in DMSO (Gibco), 2 mM MgCl2 (Merck), 5 mM K4[Fe(CN)6].3H2O (Merck), 5mM K3[Fe(CN)6] (Merck) in PBS. The reaction was stopped by removal of the X-gal solution and washing of the cells with PBS. FIG. 8 shows that IG.Ad/CMV.LacZDE2A transduced HeLa cells at least as good as did IG.Ad/CMV.LacZ at all m.o.i.'s. Comparable results were obtained after infection of IG.Ad.CLIP.LacZ and IG.Ad.CLIP.LacZDE2A and after infection of A549 cells with the respective recombinant adenoviral vectors. These data show that the viral particle to transduction unit ratio (vp/tu) of E1/E2A deleted vectors (e.g., IG.Ad/CMV.LacZDE2A) is at least as good as the vp/tu of E1 deleted vectors (e.g., IG.Ad/CMV.LacZ).
  • Next, the vp/tu ratio of E1- and E1/E2A-deleted vectors was determined in a more sensitive assay, i.e., a luciferase assay. HeLa and A549 cells were seeded at 5×10[0125] 5 cells/well in 6 well plates (Greiner) in DMEM supplemented with 10% FBS in a 10% CO2 atmosphere at 37° C. The next day, cells were infected with a m.o.i. of either 0, 10, 100, 1,000 or 10,000 vp/cell IG.Ad/CLIP.Luc or IG.Ad/CLIP.LucDE2A per cell. Two days post infection, cells were lysed and the luciferase activity was determined with the Luciferase Assay System according to the protocol of the supplier (Promega). FIG. 9 shows that both the IG.Ad/CLIP.LucDE2A infected HeLa and A549 cells produce more luciferase enzyme than the IG.Ad/CLIP.Luc infected HeLa and A549 and HeLa cells, at all m.o.i.'s tested. These data confirm that E1/E2A deleted recombinant adenoviral vectors produced on PER.C6ts125E2A cells have a vp/tu ratio that is at least as good as the vp/tu ratio of E1 deleted vectors. The above is in contrast to what has recently been reported by others (O'Neal et al., 1998; Lusky et al., 1998), who found that the vp/tu ratio of E1/E2A deleted recombinant adenoviral vectors is impaired significantly. However, these vectors were produced on two independent 293 based E2A complementing cell lines harboring inducible E2A genes. This suggests that the use of temperature sensitive E2A genes, such as ts125E2A, yields superior E2A complementing cell lines as compared to the commonly used inducible E2A genes.
  • In order to test whether E1/E2A deleted vectors residually express adenoviral proteins, the following experiment has been performed. A549 cells were seeded on 6 well plates (Greiner) at a density of 5×10[0126] 5 cells/well in DMEM supplemented with 10% FBS in a 10% CO2 atmosphere at 37° C. The next day, cells were infected with a m.o.i. of either 0, 100, 1,000 or 10,000 vp/cell IG.Ad/CLIP or IG.Ad.CLIPDE2A. After 12 hours, the infection medium was replaced by fresh DMEM supplemented with 10% FBS. Seventy-two hours post infection, the cells were washed with PBS (NPBI) and lysed and scraped in RIPA (1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS in PBS, supplemented with 1 mM phenylmethylsulfonylfluoride and 0.1 mg/ml trypsin inhibitor). After 15 minutes incubation on ice, the lysates were cleared by centrifugation. Protein concentrations were determined by the BioRad protein assay, according to standard procedures of the supplier (BioRad). Equal amounts of whole-cell extract were fractionated by SDS-PAGE on 10% gels in triplicate. Proteins were transferred onto Immobilon-P membranes (Millipore) and incubated with the aDBP monoclonal antibody B6, the polyclonal a-Penton base antibody Ad2-Pb571 (kind gift of Dr. P. Boulanger, Montpellier, France) and the polyclonal a-knob domain antibody of fiber E641/3 (kind gift of R. Gerard, Leuven, Belgium). The secondary antibodies were ahorseradish-peroxidase-conjugated goat anti mouse and ahorseradish-peroxidase-conjugated goat anti rabbit (BioRad). The Western blotting procedure and incubations were performed according to the protocol provided by Millipore. The complexes were visualized with the ECL detection system according to the manufacturer's protocol (Amersham). FIG. 10 shows that cells infected with IG.Ad.CLIP express both E2A encoded DBP, Penton base and Fiber proteins. The proteins co-migrated with the respective proteins in the positive control (lane P, extract from PER.C6 cells infected with IG.Ad.CLIP harvested at starting CPE). The residual expression of these proteins in A549 cells was m.o.i. dependent. In contrast, no DBP, penton-base or fiber was detected in the non-infected A549 cells or cells infected with IG.Ad.CLIPDE2A. These data show that deletion of the E2A gene did not only eliminate residual DBP expression, but also the residual expression of the late adenoviral proteins, penton-base and fiber.
  • In conclusion, the foregoing shows that E1/E2A deleted vectors produced on PER.C6/tsE2A complementing cell lines have a favorable phenotype. First, these vectors have an ideal vp/tu ratio, which is at least as good as that of E1 deleted vectors. Second, the E1/E2A deleted vectors do not residually express detectable amounts of E2A encoded DBP or late gene encoded penton-base or fiber. This favorable phenotype improves the prospects for the use of recombinant adenoviral vectors in gene therapy. [0127]
  • 1 29 1 35 DNA Artificial Sequence Description of Artificial Sequence primer DBPpcr1 1 cgggatccgc caccatggcc agtcgggaag aggag 35 2 33 DNA Artificial Sequence Description of Artificial Sequence primer DBPpcr2 2 cggaattctt aaaaatcaaa ggggttctgc cgc 33 3 23 DNA Artificial Sequence Description of Artificial Sequence oligo-linker containing PacI site 3 aattgtctta attaaccgct taa 23 4 19 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide used to form oligo-linker described by SEQ. ID. NO. 3 4 aattgtctta attaaccgc 19 5 19 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide used to form oligo-linker described by SEQ. ID. NO. 3 5 aattgcggtt aattaagac 19 6 23 DNA Artificial Sequence Description of Artificial Sequence primer DE2A.SnaBI 6 ggcgtacgta gccctgtcga aag 23 7 35 DNA Artificial Sequence Description of Artificial Sequence primer DE2A.DBP-start 7 ccaatgcatt cgaagtactt ccttctccta taggc 35 8 22 DNA Artificial Sequence Description of Artificial Sequence primer DE2A.DBP-stop 8 ccaatgcata cggcgcagac gg 22 9 21 DNA Artificial Sequence Description of Artificial Sequence primer DE2A.BamHI 9 gaggtggatc ccatggacga g 21 10 27 DNA Artificial Sequence Description of Artificial Sequence primer SV40-1 10 gggggatccg aacttgttta ttgcagc 27 11 25 DNA Artificial Sequence Description of Artificial Sequence primer SV40-2 11 gggagatcta gacatgataa gatac 25 12 27 DNA Artificial Sequence Description of Artificial Sequence primer Ad5-1 12 gggagatctg tactgaaatg tgtgggc 27 13 24 DNA Artificial Sequence Description of Artificial Sequence primer Ad5-2 13 ggaggctgca gtctccaacg gcgt 24 14 47 DNA Artificial Sequence Description of Artificial Sequence primer LTR-1 14 ctgtacgtac cagtgcactg gcctaggcat ggaaaaatac ataactg 47 15 63 DNA Artificial Sequence Description of Artificial Sequence primer LTR-2 15 gcggatcctt cgaaccatgg taagcttggt accgctagcg ttaaccgggc gactcagtca 60 atc 63 16 27 DNA Artificial Sequence Description of Artificial Sequence primer HSA1 16 gcgccaccat gggcagagcg atggtgg 27 17 50 DNA Artificial Sequence Description of Artificial Sequence primer HSA2 17 gttagatcta agcttgtcga catcgatcta ctaacagtag agatgtagaa 50 18 32 DNA Artificial Sequence Description of Artificial Sequence primer used for amplification of E. coli LacZ 18 ggggtggcca gggtacctct aggcttttgc aa 32 19 29 DNA Artificial Sequence Description of Artificial Sequence primer used for amplification of E. coli LacZ 19 ggggggatcc ataaacaagt tcagaatcc 29 20 20 DNA Artificial Sequence Description of Artificial Sequence primer 1 20 gggtattagg ccaaaggcgc 20 21 33 DNA Artificial Sequence Description of Artificial Sequence primer 2 21 gatcccatgg aagcttgggt ggcgacccca gcg 33 22 36 DNA Artificial Sequence Description of Artificial Sequence primer 3 22 gatcccatgg ggatccttta ctaagttaca aagcta 36 23 19 DNA Artificial Sequence Description of Artificial Sequence primer 4 23 gtcgctgtag ttggactgg 19 24 20 DNA Artificial Sequence Description of Artificial Sequence primer 551 24 ccggcaagtc ttgcggcatg 20 25 21 DNA Artificial Sequence Description of Artificial Sequence primer 556 25 tagcaggtcg ggcgccgata t 21 26 22 DNA Artificial Sequence Description of Artificial Sequence primer 553 26 ggctcaggtg gcttttaagc ag 22 27 22 DNA Artificial Sequence Description of Artificial Sequence primer 554 27 gagttgcgat acacagggtt gc 22 28 20 DNA Artificial Sequence Description of Artificial Sequence primer 731 28 agtgcgcaga ttaggagcgc 20 29 20 DNA Artificial Sequence Description of Artificial Sequence primer 734 29 tctgcctata ggagaaggaa 20

Claims (69)

What is claimed is:
1. A cell capable of at least in part complementing adenovirus E2A function of an adenovirus defective in E2A function, said cell comprising a nucleic acid encoding adenovirus E2A or a functional part thereof, derivative thereof, analogue thereof, or mixture of any of these.
2. The cell of claim 1 wherein said nucleic acid encoding adenovirus E2A is a temperature sensitive adenovirus.
3. The cell of claim 2 wherein said nucleic acid encoding adenovirus E2A is of adenovirus ts125 origin.
4. The cell of claim 1, claim 2, or claim 3 further comprising a nucleic acid encoding adenovirus E1-region proteins or a functional part, derivative thereof, analogue thereof, or mixture of any thereof.
5. The cell of claim 4 wherein said cell is of PER.C6 (ECACC deposit number 96022940) origin.
6. A method for producing an adenoviral particle containing an adenovirus vector with a functional deletion of E2A, said method comprising:
providing a cell according to claim 1, claim 2, claim 3, claim 4, or claim 5 with said
adenovirus vector,
culturing said cell, and
harvesting said adenoviral particle.
7. The method for producing an adenoviral particle containing an adenovirus vector with a functional deletion of E2A according to claim 6 wherein said functional deletion comprises a deletion of at least part of the nucleic acid encoding E2A.
8. The method for producing an adenoviral particle containing an adenovirus vector with a functional deletion of E2A according to claim 6 wherein said nucleic acid encoding adenovirus E2A in said cell's genome does not comprise sequence overlap with said vector which leads to replication competent adenovirus and/or to the formation of an adenovirus vector comprising E2A function.
9. The method for producing an adenoviral particle according to claim 6, said method further comprising:
providing an adenovirus vector further comprising a functional deletion of E1-region encoding nucleic acid said adenovirus vector to said cell, said cell further characterized in:
being capable of at least in part complementing adenovirus E2A function of an adenovirus defective in E2A function,
comprising a nucleic acid encoding adenovirus E2A or a functional part thereof, derivative thereof, and/or analogue thereof, and
further comprising a nucleic acid sequence encoding adenovirus E1-region proteins or a functional part, derivative thereof, and/or analogue thereof,
culturing said cell, and
harvesting said virus particle.
10. The method according to claim 9 wherein said nucleic acid encoding adenovirus E1-region has no sequence overlap with said vector which leads to replication competent adenovirus and/or to the formation of an adenovirus vector comprising an E1 function.
11. A method according to claim 6, claim 7, claim 8, claim 9, or claim 10 wherein said adenovirus vector further comprises at least one nucleic acid of interest.
12. An adenovirus vector comprising a functional deletion of adenovirus E2A.
13. The adenovirus vector of claim 12 wherein said vector comprises a deletion of at least part of the nucleic acid encoding E2A.
14. The adenovirus vector of claim 13 wherein said deletion encompasses at least the entire coding region of E2A.
15. The adenovirus vector of claim 14 further comprising a deletion corresponding to a deletion of nucleotides 22443 to 24032 in adenovirus 5.
16. The adenovirus vector of claim 12, claim 13, claim 14, or claim 15 further comprising a deletion of nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
17. The adenovirus vector of claim 12, claim 13, claim 14, claim 15, or claim 16 wherein said deletion of nucleic acid encoding E1-region proteins comprises a deletion corresponding to a deletion of nucleotides 459 to 3510 in adenovirus 5.
18. The adenovirus vector of claim 12, claim 13, claim 14, claim 15, claim 16, or claim 17 further comprising at least one nucleic acid of interest.
19. A preparation of adenovirus vector containing adenovirus particles wherein said adenovirus vector comprises a functional deletion of E2A.
20. The preparation of claim 19 wherein said adenovirus vector further comprises a deletion of nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
21. The preparation of claim 19 or claim 20 free of adenovirus vectors comprising E2A function.
22. The preparation of claim 21, said preparation characterized in being free of adenovirus vectors comprising nucleic acid encoding a functional E2A, or a functional part, derivative and/or analogue thereof.
23. The preparation according to claim 21 or claim 22 free of adenovirus vectors comprising nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
24. A method for providing cells of an individual with a nucleic acid of interest, without risk of administering simultaneously a replication competent adenovirus vector, comprising administering said individual a preparation according to claim 19, claim 20, claim 21, claim 22, or claim 23.
25. The method of claim 24 wherein said preparation is characterized in being free of adenovirus vectors comprising nucleic acid encoding a functional E2A, or a functional part, derivative and/or analogue thereof.
26. The method of claim 24 or claim 25 wherein said preparation is free of adenovirus vectors comprising nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
27. An adenovirus vector comprising at least a deletion of a region which in adenovirus 5 corresponds to nucleotides 22443-24032.
28. An adenovirus vector comprising at least a deletion of a region which in adenovirus 5 corresponds to nucleotides 22418-24037.
29. An adenovirus vector comprising at least a deletion of a region which in adenovirus 5 corresponds to nucleotides 22348-24060.
30. An adenovirus vector according to claim 27, claim 28, or claim 29 further comprising at leastnucleic acidwhichin adenovirus 5 corresponds to nucleotides 3534-22347 and/ornucleotides 24061 until the right ITR.
31. An adenovirus vector according to claim 27 or claim 28 further comprising at least nucleic acid which in adenovirus 5 corresponds to nucleotides 3534-22417 and/ornucleotides 24038 until the right ITR.
32. An adenovirus vector according to claim 27 further comprising at least nucleic acid which in adenovirus 5 corresponds to nucleotides 3534-22442 and/or nucleotides 24033 until the right ITR.
33. An adenovirus vector according to claim 27 further comprising at least nucleic acid which in adenovirus 5 corresponds to nucleotides 3534-22442 and/or nucleotides 24033 until the right ITR.
34. The cell of claim 1 wherein said nucleic acid is integrated into said cell's genome.
35. The cell of claim 4 wherein said cell is derived from cell line 293.
36. The method according to claim 9 wherein said nucleic acid is integrated into said cell's genome.
37. A cell capable of at least in part complementing adenovirus E2A function of an adenovirus defective in E2A function, said cell comprising a nucleic acid encoding adenovirus E2A or a functional part thereof.
38. The cell of claim 37, said cell further comprising a nucleic acid encoding adenovirus E1-region proteins or a functional part thereof.
39. The cell of claim 38, wherein said nucleic acid encoding adenovirus E2A encodes a temperature sensitive E2A mutant.
40. The cell of claim 39, wherein said temperature sensitive E2A mutant is an E2A mutant encoded by adenovirus ts125.
41. The cell of claim 38, wherein said cell is of cell line 293 origin.
42. The cell of claim 39, wherein said cell is of cell line 293 origin.
43. The cell of claim 40, wherein said cell is of cell line 293 origin.
44. A method for producing an adenoviral particle containing an adenovirus vector with a functional deletion of E2A, said method comprising:
providing a cell according to any one of claims 37-43 with said adenovirus vector,
culturing said cell, and
harvesting said adenoviral particle.
45. The method according to claim 44, wherein said functional deletion comprises a deletion of at least part of the nucleic acid encoding E2A.
46. The method according to claim 45, wherein said nucleic acid encoding adenovirus E2A in said cell's genome does not comprise sequence overlap with said vector which leads to replication competent adenovirus and/or to the formation of an adenovirus vector comprising E2A function.
47. The method according to claim 45, said method further comprising:
providing an adenovirus vector further comprising a functional deletion of E1-region encoding nucleic acid said adenovirus vector to said cell, said cell further characterized by:
being capable of at least in part complementing adenovirus E2A function of an adenovirus defective in E2A function,
comprising a nucleic acid encoding adenovirus E2A or a functional part thereof, derivative thereof, and/or analogue thereof, and
further comprising a nucleic acid sequence encoding adenovirus E1-region proteins or a functional part, derivative thereof, and/or analogue thereof,
culturing said cell, and
harvesting said virus particle.
48. An adenovirus vector comprising a functional deletion of adenovirus E2A.
49. The adenovirus vector of claim 48 wherein said vector comprises a deletion of at least part of the nucleic acid encoding E2A.
50. The adenovirus vector of claim 49 wherein said deletion encompasses at least the entire coding region of E2A.
51. The adenovirus vector of claim 48, further having a deletion of nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
52. The adenovirus vector of claim 49, further having a deletion of nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
53. The adenovirus vector of claim 50 further having a deletion of nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
54. A preparation of adenovirus vector containing adenovirus particles wherein said adenovirus vector has a functional deletion of E2A.
55. The preparation of claim 54 wherein said adenovirus vector further has a deletion of nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
56. The preparation of claim 54 free of adenovirus vectors comprising E2A function.
57. The preparation of claim 55 free of adenovirus vectors comprising E2A function.
58. The preparation of claim 56, said preparation characterized in being free of adenovirus vectors comprising nucleic acid encoding a functional E2A, or a functional part, derivative and/or analogue thereof.
59. The preparation of claim 57, said preparation characterized in being free of adenovirus vectors comprising nucleic acid encoding a functional E2A, or a functional part, derivative and/or analogue thereof.
60. The preparation of claim 56, free of adenovirus vectors comprising nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
61. The preparation of claim 57, free of adenovirus vectors comprising nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
62. The preparation of claim 58, free of adenovirus vectors comprising nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
63. The preparation of claim 59 free of adenovirus vectors comprising nucleic acid encoding E1-region proteins or parts, derivatives and/or analogues thereof.
64. A method for providing cells of a subject with a nucleic acid of interest, with a decreased risk of administering simultaneously a replication competent adenovirus vector, said method comprising administering to the subject's cells the preparation of any one of claims 54-63.
65. An adenovirus vector comprising at least a deletion of a region which in adenovirus 5 corresponds to nucleotides 22443-24032, or nucleotides 22418-24037, or nucleotides 22348-24060, further comprising at least nucleic acid which in adenovirus 5 corresponds to nucleotides 3534-22347 and/or nucleotides 24061 until the right ITR.
66. The method according to claim 44, wherein said nucleic acid is integrated into said cell's genome.
67. The method according to claim 45, wherein said nucleic acid is integrated into said cell's genome.
68. The method according to of claim 46, wherein said nucleic acid is integrated into said cell's genome.
69. The method according to claim 47, wherein said nucleic acid is integrated into said cell's genome.
US10/136,139 1995-06-15 2002-05-01 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer Abandoned US20020164802A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/136,139 US20020164802A1 (en) 1995-06-15 2002-05-01 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US11/134,674 US8236293B2 (en) 1995-06-15 2005-05-19 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
EP95201611.1 1995-06-15
EP95201611 1995-06-15
EP95201728.3 1995-06-26
EP95201728 1995-06-26
US08/793,170 US5994128A (en) 1995-06-15 1996-06-14 Packaging systems for human recombinant adenovirus to be used in gene therapy
US09/298,745 US6395519B1 (en) 1995-06-15 1999-04-23 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US10/136,139 US20020164802A1 (en) 1995-06-15 2002-05-01 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/298,745 Continuation US6395519B1 (en) 1995-06-15 1999-04-23 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/134,674 Division US8236293B2 (en) 1995-06-15 2005-05-19 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer

Publications (1)

Publication Number Publication Date
US20020164802A1 true US20020164802A1 (en) 2002-11-07

Family

ID=26139401

Family Applications (10)

Application Number Title Priority Date Filing Date
US08/793,170 Expired - Lifetime US5994128A (en) 1995-06-15 1996-06-14 Packaging systems for human recombinant adenovirus to be used in gene therapy
US08/892,873 Expired - Lifetime US6033908A (en) 1995-06-15 1997-07-15 Packaging systems for human recombinant adenovirus to be used in gene therapy
US09/298,745 Expired - Lifetime US6395519B1 (en) 1995-06-15 1999-04-23 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US09/333,820 Expired - Lifetime US6306652B1 (en) 1995-06-15 1999-06-15 Packaging systems for human recombinant adenovirus to be used in gene therapy
US09/334,765 Expired - Lifetime US6238893B1 (en) 1995-06-15 1999-06-16 Method for intracellular DNA amplification
US09/506,548 Expired - Lifetime US6602706B1 (en) 1995-06-15 2000-02-17 Packaging systems for human recombinant adenovirus to be used in gene therapy
US10/038,271 Abandoned US20020151032A1 (en) 1995-06-15 2001-10-23 Packaging systems for human recombinant adenovirus to be used in gene therapy
US10/136,139 Abandoned US20020164802A1 (en) 1995-06-15 2002-05-01 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US11/134,674 Expired - Fee Related US8236293B2 (en) 1995-06-15 2005-05-19 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US11/879,421 Abandoned US20090023196A1 (en) 1995-06-15 2007-07-16 Stocks of replication-deficient adenovirus

Family Applications Before (7)

Application Number Title Priority Date Filing Date
US08/793,170 Expired - Lifetime US5994128A (en) 1995-06-15 1996-06-14 Packaging systems for human recombinant adenovirus to be used in gene therapy
US08/892,873 Expired - Lifetime US6033908A (en) 1995-06-15 1997-07-15 Packaging systems for human recombinant adenovirus to be used in gene therapy
US09/298,745 Expired - Lifetime US6395519B1 (en) 1995-06-15 1999-04-23 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US09/333,820 Expired - Lifetime US6306652B1 (en) 1995-06-15 1999-06-15 Packaging systems for human recombinant adenovirus to be used in gene therapy
US09/334,765 Expired - Lifetime US6238893B1 (en) 1995-06-15 1999-06-16 Method for intracellular DNA amplification
US09/506,548 Expired - Lifetime US6602706B1 (en) 1995-06-15 2000-02-17 Packaging systems for human recombinant adenovirus to be used in gene therapy
US10/038,271 Abandoned US20020151032A1 (en) 1995-06-15 2001-10-23 Packaging systems for human recombinant adenovirus to be used in gene therapy

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/134,674 Expired - Fee Related US8236293B2 (en) 1995-06-15 2005-05-19 Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US11/879,421 Abandoned US20090023196A1 (en) 1995-06-15 2007-07-16 Stocks of replication-deficient adenovirus

Country Status (15)

Country Link
US (10) US5994128A (en)
EP (2) EP1445322B2 (en)
JP (2) JP4051416B2 (en)
KR (2) KR100449181B1 (en)
AT (2) ATE445705T1 (en)
AU (1) AU731767B2 (en)
CA (1) CA2222140C (en)
DE (2) DE69633565T3 (en)
DK (2) DK0833934T4 (en)
ES (2) ES2231813T5 (en)
HK (1) HK1064406A1 (en)
IL (3) IL122614A0 (en)
PT (2) PT1445322E (en)
SI (2) SI1445322T2 (en)
WO (1) WO1997000326A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030104626A1 (en) * 1995-06-15 2003-06-05 Fallaux Frits Jacobus Packaging systems for human recombinant adenovirus to be used in gene therapy
US20090023196A1 (en) * 1995-06-15 2009-01-22 Introgene Stocks of replication-deficient adenovirus

Families Citing this family (356)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0872552A1 (en) * 1997-04-15 1998-10-21 Leadd B.V. A gene delivery vehicle expressing the apoptosis-inducing proteins VP2 and/or Apoptin
NL9101680A (en) 1991-10-04 1993-05-03 Tno METHOD FOR GENETICALLY MODIFYING PRIMATE BONE MARROW CELLS AND USE CELLS PRODUCING RECOMBINANT RETROVIRAL VECTORS.
FR2705686B1 (en) * 1993-05-28 1995-08-18 Transgene Sa New defective adenoviruses and corresponding complementation lines.
US6080569A (en) * 1993-06-24 2000-06-27 Merck & Co., Inc. Adenovirus vectors generated from helper viruses and helper-dependent vectors
DE69533295T3 (en) * 1994-02-16 2009-07-16 The Government Of The United States Of America, As Represented By The Secretary, The Department Of Health And Human Services Melanoma-associated antigens, epitopes thereof and melanoma-containing vaccines
US7252989B1 (en) * 1994-04-04 2007-08-07 Board Of Regents, The University Of Texas System Adenovirus supervector system
CA2156132A1 (en) 1994-08-16 1996-02-17 Abraham Bout Recombinant vectors derived from adenovirus for use in gene therapy
US5998205A (en) * 1994-11-28 1999-12-07 Genetic Therapy, Inc. Vectors for tissue-specific replication
US6281010B1 (en) * 1995-06-05 2001-08-28 The Trustees Of The University Of Pennsylvania Adenovirus gene therapy vehicle and cell line
US6265212B1 (en) 1995-06-15 2001-07-24 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US20020068049A1 (en) * 1998-09-10 2002-06-06 Henderson Daniel R. Tissue specific adenoviral vectors
EP0840797B1 (en) 1995-07-25 2014-09-03 Crucell Holland B.V. Methods and means for targeted gene delivery
ES2219700T3 (en) * 1995-12-01 2004-12-01 Crucell Holland B.V. REGULATED EXPRESSION OF PROTEINS IN CELLS OF TRANSFECTED MAMMALS IN A STABLE WAY.
US20040156861A1 (en) * 1996-07-11 2004-08-12 Figdor Carl Gustav Melanoma associated peptide analogues and vaccines against melanoma
US6110744A (en) * 1996-11-13 2000-08-29 Board Of Regents, The University Of Texas System Diminishing viral gene expression by promoter replacement
CA2274146C (en) 1996-12-05 2007-02-06 Introgene B.V. Genetic modification of primate hemopoietic repopulating stem cells
US6403370B1 (en) 1997-02-10 2002-06-11 Genstar Therapeutics Corporation Oncolytic/immunogenic complementary-adenoviral vector system
JP2000509614A (en) 1997-03-04 2000-08-02 バクスター インターナショナル インコーポレイテッド Adenovirus E1-complementation cell line
US6696423B1 (en) 1997-08-29 2004-02-24 Biogen, Inc. Methods and compositions for therapies using genes encoding secreted proteins such as interferon-beta
FR2774699B1 (en) * 1997-11-17 2003-10-03 Rhone Poulenc Rorer Sa METHOD FOR REDUCING HOMOLOGATED RECOMBINATION EVENTS
AU1536999A (en) * 1997-11-26 1999-06-15 Board Of Regents, The University Of Texas System Modified sv40 viral vectors
EP1042494A1 (en) 1997-12-23 2000-10-11 Introgene B.V. Adeno-associated virus and adenovirus chimeric recombinant viruses useful for the integration of foreign genetic information into the chromosomal dna of target cells
DE69933856D1 (en) 1998-02-13 2006-12-14 Koester Hubert USE OF RIBOZYMES FOR DETERMINING THE FUNCTION OF GENES
US5981225A (en) * 1998-04-16 1999-11-09 Baylor College Of Medicine Gene transfer vector, recombinant adenovirus particles containing the same, method for producing the same and method of use of the same
US6670188B1 (en) 1998-04-24 2003-12-30 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
EP0959136A1 (en) 1998-05-20 1999-11-24 Introgene B.V. Targeted delivery through a cationic amino acid transporter
US6413776B1 (en) 1998-06-12 2002-07-02 Galapagos Geonomics N.V. High throughput screening of gene function using adenoviral libraries for functional genomics applications
US20040043489A1 (en) * 1998-07-08 2004-03-04 Menzo Havenga Gene delivery vectors provided with a tissue tropism for dendritic cells and methods of use
US20030017138A1 (en) * 1998-07-08 2003-01-23 Menzo Havenga Chimeric adenoviruses
US6900049B2 (en) * 1998-09-10 2005-05-31 Cell Genesys, Inc. Adenovirus vectors containing cell status-specific response elements and methods of use thereof
AU764130B2 (en) * 1998-10-27 2003-08-14 Crucell Holland B.V. Improved AAV vector production
IT1302403B1 (en) * 1998-11-06 2000-09-05 Angeletti P Ist Richerche Bio CELLS FOR THE PRODUCTION OF DEFECTIVE ADENOVIRAL VECTORS, METHOD FOR THEIR PREPARATION AND USE.
US6929946B1 (en) 1998-11-20 2005-08-16 Crucell Holland B.V. Gene delivery vectors provided with a tissue tropism for smooth muscle cells, and/or endothelial cells
IL133032A (en) * 1998-11-20 2007-06-03 Introgene Bv Adenoviral gene delivery vectors provided with a tissue tropism for smooth muscle cells and /or endothelial cells
EP1016726A1 (en) * 1998-12-30 2000-07-05 Introgene B.V. Gene therapy to promote angiogenesis
US6869936B1 (en) 1999-03-04 2005-03-22 Crucell Holland B.V. Means and methods for fibroblast-like or macrophage-like cell transduction
DE60039683D1 (en) * 1999-03-04 2008-09-11 Crucell Holland Bv USE OF AN ADENOVIRUS VECTOR FOR THE TRANSDUCTION OF SYNOVIAL CELLS
US20050170463A1 (en) * 1999-04-15 2005-08-04 Abraham Bout Recombinant protein production in permanent amniocytic cells that comprise nucleic acid encoding adenovirus E1A and E1B proteins
US8236561B2 (en) * 1999-04-15 2012-08-07 Crucell Holland B.V. Efficient production of IgA in recombinant mammalian cells
US7604960B2 (en) * 1999-04-15 2009-10-20 Crucell Holland B.V. Transient protein expression methods
US20060099685A1 (en) * 1999-04-15 2006-05-11 Yallop Christopher A Recombinant expression of factor VIII in human cells
ATE536417T1 (en) * 1999-04-15 2011-12-15 Crucell Holland Bv PRODUCTION OF RECOMBINANT PROTEINS IN A HUMAN CELL WITH AT LEAST ONE E1 ADENOVIRUS PROTEIN
US6855544B1 (en) 1999-04-15 2005-02-15 Crucell Holland B.V. Recombinant protein production in a human cell
US20050164386A1 (en) * 1999-04-15 2005-07-28 Uytdehaag Alphonsus G. Overexpression of enzymes involved in post-translational protein modifications in human cells
US7297680B2 (en) * 1999-04-15 2007-11-20 Crucell Holland B.V. Compositions of erythropoietin isoforms comprising Lewis-X structures and high sialic acid content
WO2001007571A1 (en) * 1999-04-23 2001-02-01 Introgene B.V. Means and methods for nucleic acid transfer
DK1818408T3 (en) 1999-05-17 2011-10-17 Crucell Holland Bv Recombinant adenovirus of the serotype Ad11
US6492169B1 (en) * 1999-05-18 2002-12-10 Crucell Holland, B.V. Complementing cell lines
US20050232900A1 (en) * 1999-05-18 2005-10-20 Crucell Holland B.V. Serotype of adenovirus and uses thereof
US6913922B1 (en) * 1999-05-18 2005-07-05 Crucell Holland B.V. Serotype of adenovirus and uses thereof
EP1200622A4 (en) * 1999-07-06 2004-12-22 Merck & Co Inc Adenovirus carrying gag gene hiv vaccine
EP1067190A1 (en) * 1999-07-09 2001-01-10 Introgene B.V. Gene therapy for enhancing and/or inducing angiogenesis
EP1083228A1 (en) * 1999-09-10 2001-03-14 Introgene B.V. Modified adenoviral vectors for use in gene therapy
AU7560500A (en) * 1999-09-10 2001-04-17 Crucell Holland B.V. Modified adenoviral vectors for use in gene therapy
EP1083229A1 (en) * 1999-09-10 2001-03-14 Introgene B.V. Modified adenoviral vectors for use in gene therapy
US6365394B1 (en) 1999-09-29 2002-04-02 The Trustees Of The University Of Pennsylvania Cell lines and constructs useful in production of E1-deleted adenoviruses in absence of replication competent adenovirus
US7115391B1 (en) 1999-10-01 2006-10-03 Genovo, Inc. Production of recombinant AAV using adenovirus comprising AAV rep/cap genes
DE19955558C2 (en) * 1999-11-18 2003-03-20 Stefan Kochanek Permanent amniocyte cell line, its production and use for the production of gene transfer vectors
US6558948B1 (en) 1999-11-23 2003-05-06 Stefan Kochanek Permanent amniocytic cell line, its production and use for the production of gene transfer vectors
US7521220B2 (en) 1999-11-26 2009-04-21 Crucell Holland B.V. Production of vaccines
US7527961B2 (en) 1999-11-26 2009-05-05 Crucell Holland B.V. Production of vaccines
US7192759B1 (en) 1999-11-26 2007-03-20 Crucell Holland B.V. Production of vaccines
AU1817401A (en) * 1999-12-14 2001-06-25 Genovo, Incorporated Methods and compositions for the manufacture of replication incompetent adenovirus
EP1248653A2 (en) * 2000-01-07 2002-10-16 Stichting Klinische Farmacologie Groningen Gene therapy to promote angiogenesis and/or the treatment of heart failure
US7132277B1 (en) 2000-01-31 2006-11-07 Merck & Co., Inc. Helper dependent vector system for gene therapy
AU2001245944B2 (en) * 2000-03-24 2007-01-18 Cell Genesys, Inc. Human urothelial cell specific uroplakin transcriptional regulatory sequences, vectors comprising the same, and methods of use thereof
US6680172B1 (en) 2000-05-16 2004-01-20 Regents Of The University Of Michigan Treatments and markers for cancers of the central nervous system
EP1157999A1 (en) * 2000-05-24 2001-11-28 Introgene B.V. Methods and means for enhancing skin transplantation using gene delivery vehicles having tropism for primary fibroblasts, as well as other uses thereof
KR20010064682A (en) * 2000-07-01 2001-07-11 김재호 Double Suicide Gene System using E1B attenuated adenovirus
US20020164333A1 (en) * 2000-07-10 2002-11-07 The Scripps Research Institute Bifunctional molecules and vectors complexed therewith for targeted gene delivery
US7223406B2 (en) 2000-07-21 2007-05-29 The Regents Of The University Of California Methods and compositions for preventing and treating male erectile dysfunction and female sexual arousal disorder
WO2002007757A2 (en) * 2000-07-21 2002-01-31 Lue Tom F Prevention and treatment of sexual arousal disorders
US6984522B2 (en) * 2000-08-03 2006-01-10 Regents Of The University Of Michigan Isolation and use of solid tumor stem cells
US8044259B2 (en) 2000-08-03 2011-10-25 The Regents Of The University Of Michigan Determining the capability of a test compound to affect solid tumor stem cells
US20080194022A1 (en) * 2000-08-03 2008-08-14 Clarke Michael F Isolation and use of solid tumor stem cells
US6733993B2 (en) * 2000-09-15 2004-05-11 Merck & Co., Inc. Enhanced first generation adenovirus vaccines expressing codon optimized HIV1-gag, pol, nef and modifications
US20040101957A1 (en) * 2001-09-14 2004-05-27 Emini Emilio A. Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol.nef and modifications
WO2002024730A2 (en) * 2000-09-20 2002-03-28 Crucell Holland B.V. Transduction of dendritic cells using adenoviral vectors
DE60138403D1 (en) 2000-09-26 2009-05-28 Crucell Holland Bv ADENOVIRAL VECTORS FOR THE TRANSFER OF GENES IN CELLS OF THE SKELETAL MUSCULATORY OR MYOBLAST
US6573092B1 (en) * 2000-10-10 2003-06-03 Genvec, Inc. Method of preparing a eukaryotic viral vector
IL152423A0 (en) * 2001-02-23 2003-05-29 Novartis Ag Novel vector constructs
DE60232785D1 (en) 2001-03-14 2009-08-13 Myriad Genetics Inc TSG101 GAG INTERACTION AND ITS USE
EP1256803A1 (en) * 2001-05-07 2002-11-13 Crucell Holland B.V. Methods for the identification of antiviral compounds
US6682929B2 (en) 2001-07-23 2004-01-27 Genvec, Inc. Adenovector complementing cells
US7229774B2 (en) 2001-08-02 2007-06-12 Regents Of The University Of Michigan Expression profile of prostate cancer
US20030119771A1 (en) * 2001-08-22 2003-06-26 Rompaey Luc Van Modulators of bone homeostasis identified in a high-throughput screen
DK1436397T3 (en) * 2001-10-11 2010-08-09 Merck Sharp & Dohme Hepatitis C virus vaccine
DE60236364D1 (en) 2001-10-11 2010-06-24 Angeletti P Ist Richerche Bio Hepatitis-c-virus-impfstoff
JP4583029B2 (en) 2001-10-29 2010-11-17 クルセル ホランド ベー ヴェー Method and method for producing a protein having a predetermined post-translational modification
AU2002351444B2 (en) 2001-12-07 2008-02-21 Crucell Holland B.V. Production of viruses, viral isolates and vaccines
SI1456238T1 (en) * 2001-12-17 2008-08-31 Crucell Holland Bv Production of f(ab')2 fragments in mammalian cells
US20030165954A1 (en) 2002-01-09 2003-09-04 Third Wave Technologies, Inc. Cancer profiles
US20040002060A1 (en) * 2002-01-24 2004-01-01 Novartis Ag Fiber shaft modifications for efficient targeting
EP1474533B1 (en) * 2002-02-20 2006-04-26 Merck & Co., Inc. Method of determining adenovirus particle concentration
CN101264325B (en) 2002-03-01 2017-03-01 免疫医疗公司 RS7 antibody
DE60319210T2 (en) * 2002-03-29 2009-02-12 Merck & Co., Inc. PROCESS FOR VIRUS PRODUCTION
AU2003228466A1 (en) * 2002-04-08 2003-10-27 The Johns Hopkins University Packaging cell line for diphtheria toxin expressing non-replicating adenovirus
DK1497438T3 (en) * 2002-04-25 2010-01-04 Crucell Holland Bv Means and methods for producing adenovirus vectors
EP1497440B1 (en) * 2002-04-25 2008-08-20 Crucell Holland B.V. Stable adenoviral vectors and methods for propagation thereof
US20030219696A1 (en) * 2002-05-23 2003-11-27 Moreland Gerald W. Method and apparatus for preventing backflow in dental saliva evacuators
ES2524767T3 (en) 2002-06-14 2014-12-12 Immunomedics, Inc. HPAM4 humanized monoclonal antibody
US7226755B1 (en) * 2002-09-25 2007-06-05 The Procter & Gamble Company HPTPbeta as a target in treatment of angiogenesis mediated disorders
US7507568B2 (en) * 2002-09-25 2009-03-24 The Proctor & Gamble Company Three dimensional coordinates of HPTPbeta
EP1553983A2 (en) * 2002-10-23 2005-07-20 Crucell Holland B.V. New settings for recombinant adenoviral-based vaccines
US20080153083A1 (en) * 2003-10-23 2008-06-26 Crucell Holland B.V. Settings for recombinant adenoviral-based vaccines
US20050221493A1 (en) * 2002-12-04 2005-10-06 Crucell Holland B.V. Recombinant virus production for the manufacturing of vaccines
EP1573012B1 (en) 2002-12-17 2011-11-30 Crucell Holland B.V. Recombinant viral-based malaria vaccines
EP1572994B1 (en) * 2002-12-20 2007-02-21 Chromagenics B.V. Means and methods for producing a protein through chromatin openers that are capable of rendering chromatin more accessible to transcription factors
ATE457716T1 (en) 2002-12-30 2010-03-15 Angiotech Int Ag RELEASE OF ACTIVE INGREDIENTS FROM QUICK-GELLING POLYMER COMPOSITION
US20040166091A1 (en) * 2003-02-24 2004-08-26 Genvec, Inc. Materials and methods for treating disorders of the ear
US20070275915A1 (en) * 2003-04-15 2007-11-29 Cell Genesys, Inc. Tmprss2 Regulatory Sequences and Uses Thereof
WO2004092396A2 (en) * 2003-04-15 2004-10-28 Novartis Ag Flap endonuclease 1 (fen1) regulatory sequences and uses thereof
EA008670B1 (en) 2003-05-09 2007-06-29 Круселл Холланд Б.В. Cultures of e1-immortalized cells and processes for culturing the same to increase product yields therefrom
DE602004027483D1 (en) * 2003-05-23 2010-07-15 Crucell Holland Bv PREPARATION OF RECOMBINANT IGM IN THE PER.C6 CELLS
US20050136035A1 (en) * 2003-06-03 2005-06-23 Derek Ko Cell specific replication-competent viral vectors comprising a self processing peptide cleavage site
JP4644663B2 (en) * 2003-06-03 2011-03-02 セル ジェネシス インコーポレイテッド Construction and method for enhanced expression of recombinant polypeptides from a single vector using peptide cleavage sites
WO2005005601A2 (en) * 2003-06-09 2005-01-20 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
US7261882B2 (en) 2003-06-23 2007-08-28 Reagents Of The University Of Colorado Methods for treating neuropathic pain by administering IL-10 polypeptides
US7026164B2 (en) * 2003-07-03 2006-04-11 Cell Genesys, Inc. Adenovirus packaging cell lines
US20050186178A1 (en) * 2003-08-28 2005-08-25 Ennist David L. Oncolytic adenoviral vectors encoding GM-CSF
CA2538025C (en) * 2003-10-02 2012-07-17 Crucell Holland B.V. Packaging cells for recombinant adenovirus
US7482156B2 (en) * 2003-10-15 2009-01-27 Cell Genesys, Inc. Hepatocellular carcinoma specific promoter and uses thereof
EP1528101A1 (en) 2003-11-03 2005-05-04 ProBioGen AG Immortalized avian cell lines for virus production
EP2168603A1 (en) 2003-11-14 2010-03-31 GenVec, Inc. Therapeutic regimen for treating cancer
PL1711518T3 (en) 2004-01-23 2010-06-30 St Di Richerche Di Biologia Molecolare P Angeletti S P A Chimpanzee adenovirus vaccine carriers
CA2554779A1 (en) * 2004-02-03 2005-08-18 The Regents Of The University Of Michigan Compositions and methods for characterizing, regulating, diagnosing, and treating cancer
WO2005080556A2 (en) * 2004-02-23 2005-09-01 Crucell Holland B.V. Virus purification methods
US7473418B2 (en) 2004-03-25 2009-01-06 Cell Genesys, Inc. Pan cancer oncolytic vectors and methods of use thereof
CN1972958B (en) 2004-04-12 2013-01-23 美国政府卫生与公共服务部 Method of using adenoviral vectors to induce an immune response
JP2008505853A (en) 2004-04-13 2008-02-28 クインテセンス バイオサイエンシーズ インコーポレーティッド Non-natural ribonuclease complex as a cytotoxic agent
US7964196B2 (en) * 2004-05-25 2011-06-21 Chimeros, Inc. Self-assembling nanoparticle drug delivery system
US7858323B2 (en) 2004-06-09 2010-12-28 The Regents Of The University Of Michigan Phage microarray profiling of the humoral response to disease
US20060062764A1 (en) * 2004-08-25 2006-03-23 Seshidar-Reddy Police Fiber-modified adenoviral vectors for enhanced transduction of tumor cells
EP1784493A2 (en) * 2004-09-01 2007-05-16 The Government of the United States of America as Represented by The Department of Health and Human Services Adenoviral vectors able to transduce apcs, potential use in immune response generation
EP2229956B1 (en) 2004-09-13 2013-04-24 Genzyme Corporation Multimeric constructs
CN102626336A (en) 2004-10-05 2012-08-08 建新公司 Stepped cannula
AU2005294265A1 (en) 2004-10-06 2006-04-20 University Of Rochester Treatment of pulmonary hypertension using an agent that inhibits a tissue factor pathway
KR20070100241A (en) 2004-10-28 2007-10-10 유니버시티 오브 피츠버그 오브 더 커먼웰쓰 시스템 오브 하이어 에듀케이션 Peripherally delivered glutamic acid decarboxylase gene therapy for spinal cord injury pain
US8039230B2 (en) * 2004-11-08 2011-10-18 Chromagenics B.V. Selection of host cells expressing protein at high levels
DK1809750T3 (en) * 2004-11-08 2012-06-25 Chromagenics Bv Selection of host cells expressing protein at high levels
US8999667B2 (en) * 2004-11-08 2015-04-07 Chromagenics B.V. Selection of host cells expressing protein at high levels
US20060195935A1 (en) * 2004-11-08 2006-08-31 Chromagenics B.V. Selection of host cells expressing protein at high levels
WO2006048459A2 (en) 2004-11-08 2006-05-11 Chromagenics B.V. Selection of host cells expressing protein at high levels
ATE516343T1 (en) * 2004-12-13 2011-07-15 Canji Inc CELL LINES FOR PRODUCING REPLICATION DEFECTIVE ADENOVIRUS
AU2006206376B2 (en) 2005-01-20 2012-03-08 University Of Rochester Thioredoxin interacting protein (TXNIP) as regulator of vascular function
US20080254059A1 (en) * 2005-02-11 2008-10-16 Bett Andrew J Adenovirus Serotype 26 Vectors, Nucleic Acid and Viruses Produced Thereby
WO2006108707A1 (en) * 2005-04-11 2006-10-19 Crucell Holland B.V. Virus purification using ultrafiltration
US20060234347A1 (en) * 2005-04-13 2006-10-19 Harding Thomas C Targeting multiple angiogenic pathways for cancer therapy using soluble tyrosine kinase receptors
LT2816118T (en) 2005-05-31 2018-12-10 The Regents Of The University Of Colorado, A Body Corporate Methods for delivering genes
JP2008546387A (en) * 2005-06-13 2008-12-25 ザ リージェンツ オブ ザ ユニバーシティ オブ ミシガン Compositions and methods for treating and diagnosing cancer
US20070099209A1 (en) * 2005-06-13 2007-05-03 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
ES2948791T3 (en) * 2005-06-17 2023-09-19 Msd Italia Srl Hepatitis C virus nucleic acid vaccine
EP1907536B1 (en) * 2005-07-22 2010-04-07 Crucell Holland B.V. Cell line for producing coronaviruses
US9651543B2 (en) 2005-08-31 2017-05-16 The United States Of America As Represented By The Secretary Of The Navy Malaria antigen screening method
EP1929021A2 (en) 2005-08-31 2008-06-11 Genvec, Inc. Adenoviral vector-based malaria vaccines
US8450055B2 (en) * 2005-08-31 2013-05-28 The United States Of America As Represented By The Secretary Of The Navy Malaria antigen screening method
US7718369B2 (en) 2005-09-12 2010-05-18 The Regents Of The University Of Michigan Recurrent gene fusions in prostate cancer
WO2007047907A2 (en) * 2005-10-14 2007-04-26 The Regents Of The University Of Michigan Dek protein compositions and methods of using the same
US7794951B2 (en) * 2005-10-18 2010-09-14 University Of Massachusetts Medical School SREBP2gc transcription factors and uses thereof
US7723477B2 (en) 2005-10-31 2010-05-25 Oncomed Pharmaceuticals, Inc. Compositions and methods for inhibiting Wnt-dependent solid tumor cell growth
HUE031122T2 (en) 2005-10-31 2017-07-28 Oncomed Pharm Inc Compositions and methods for treating cancer based on human fzd receptors
US7723112B2 (en) * 2005-10-31 2010-05-25 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing cancer
BRPI0618441B8 (en) * 2005-11-10 2021-07-27 Genvec Inc adenoviral vector
CA2633087C (en) * 2005-12-12 2014-12-02 Canji, Inc. Adenoviral expression vectors
AR059089A1 (en) 2006-01-20 2008-03-12 Genzyme Corp INTRAVENTRICULAR ADMINISTRATION OF AN ENZYME FOR LISOSOMAL STORAGE DISEASES
LT1988823T (en) 2006-02-09 2018-12-10 Genzyme Corporation Slow intraventricular delivery
WO2008121102A2 (en) * 2006-02-21 2008-10-09 The Regents Of The University Of Michigan Hedgehog signaling pathway antagonist cancer treatment
WO2007107578A1 (en) * 2006-03-20 2007-09-27 Chromagenics B.V. Expression augmenting dna fragments, use thereof, and methods for finding thereof
EP2018156B1 (en) * 2006-04-07 2010-03-17 Chimeros, Inc. Compositions and methods for treating b- cell malignancies
RU2473565C2 (en) * 2006-04-07 2013-01-27 Аерпио Терапетикс, Инк. HUMAN PROTEIN TYROSINE PHOSPHATASE BETA BINDING ANTIBODIES (HPTPβ), AND USE THEREOF
EP2044097A4 (en) * 2006-06-23 2010-10-06 Quintessence Biosciences Inc Modified ribonucleases
NZ573624A (en) 2006-06-23 2011-03-31 Myriad Genetics Inc Dpyd gene variants and use thereof
US7622593B2 (en) 2006-06-27 2009-11-24 The Procter & Gamble Company Human protein tyrosine phosphatase inhibitors and methods of use
US7589212B2 (en) 2006-06-27 2009-09-15 Procter & Gamble Company Human protein tyrosine phosphatase inhibitors and methods of use
US7795444B2 (en) * 2006-06-27 2010-09-14 Warner Chilcott Company Human protein tyrosine phosphatase inhibitors and methods of use
US8846685B2 (en) 2006-06-27 2014-09-30 Aerpio Therapeutics Inc. Human protein tyrosine phosphatase inhibitors and methods of use
SI2634243T1 (en) 2006-07-14 2018-01-31 Patheon Holdings I B.V. Improved process for the culturing of cells
JP2009543868A (en) 2006-07-17 2009-12-10 クインテセンス バイオサイエンシーズ インコーポレーティッド Methods and compositions for cancer treatment
WO2008030605A2 (en) * 2006-09-08 2008-03-13 The Regents Of The University Of Michigan Herv group ii viruses in lymphoma and cancer
CA2675022A1 (en) * 2007-01-09 2008-07-17 Genvec, Inc. Adenoviral vector-based malaria vaccines
US11371194B2 (en) * 2007-01-19 2022-06-28 Brock Usa, Llc Base for turf system
US8148147B2 (en) * 2007-01-24 2012-04-03 The Regents Of The University Of Michigan Compositions and methods for treating and diagnosing pancreatic cancer
EP2132300B1 (en) * 2007-03-09 2011-01-12 Vectorlogics, Inc. Cells for adenovirus vector and protein production
US20090226525A1 (en) * 2007-04-09 2009-09-10 Chimeros Inc. Self-assembling nanoparticle drug delivery system
US10745701B2 (en) 2007-06-28 2020-08-18 The Trustees Of Princeton University Methods of identifying and treating poor-prognosis cancers
US20090324596A1 (en) 2008-06-30 2009-12-31 The Trustees Of Princeton University Methods of identifying and treating poor-prognosis cancers
JP5529732B2 (en) 2007-07-06 2014-06-25 ザ リージェンツ オブ ザ ユニバーシティ オブ ミシガン Recurrent gene fusion in prostate cancer
AU2008289172B2 (en) 2007-08-16 2013-01-17 Metabolon, Inc. Metabolomic profiling of prostate cancer
DE102007041655A1 (en) 2007-09-03 2009-03-05 Medicyte Gmbh Propagation of primary cells and their use
WO2009048909A1 (en) * 2007-10-08 2009-04-16 Quintessence Biosciences, Inc. Compositions and methods for ribonuclease-based therapies
TWI488640B (en) 2008-04-16 2015-06-21 Ferring Int Ct Sa Pharmaceutical preparation
US8193151B2 (en) * 2008-04-25 2012-06-05 Northwestern University Methods for treating atrial or ventricular arrhythmias
US8518884B2 (en) 2008-04-25 2013-08-27 Northwestern University Methods for treating atrial or ventricular arrhythmias by administering a G-protein alpha inhibitor
PL2307538T3 (en) * 2008-07-15 2016-03-31 Crucell Holland Bv Scalable process for culturing per.c6 cells and producing products therefrom
EP2342321B1 (en) 2008-09-17 2018-04-11 Isogenis, Inc. Construction of fully-deleted adenovirus-based gene delivery vectors and uses thereof
BRPI0919473A2 (en) 2008-09-26 2017-08-29 Oncomed Pharm Inc FRIZZLED BINDING AGENTS AND THEIR USES
JP2012504423A (en) 2008-10-01 2012-02-23 クインテッセンス バイオサイエンシズ,インコーポレーテッド Therapeutic ribonuclease
US20110184154A1 (en) * 2008-10-17 2011-07-28 Percivia Llc Cell broth clarification and host cell protein removal
EP2350268B1 (en) * 2008-11-03 2014-12-24 Crucell Holland B.V. Method for the production of adenoviral vectors
KR20110111474A (en) 2009-01-09 2011-10-11 더 리젠츠 오브 더 유니버시티 오브 미시간 Recurrent gene fusions in cancer
US9096555B2 (en) 2009-01-12 2015-08-04 Aerpio Therapeutics, Inc. Methods for treating vascular leak syndrome
BRPI1006901A2 (en) 2009-01-20 2016-02-16 Transgène S A ex vivo method and kit for testing if a patient will respond therapeutically to a treatment method, and use of sicam-1 levels in a blood sample
WO2010107991A2 (en) 2009-03-18 2010-09-23 Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services Use of ixolaris, a tissue factor inhibitor, for the treatment and prevention of cancer
NZ595290A (en) 2009-03-24 2012-09-28 Transgene Sa Biomarker for monitoring patients
WO2010120874A2 (en) 2009-04-14 2010-10-21 Chimeros, Inc. Chimeric therapeutics, compositions, and methods for using same
CA2759050A1 (en) 2009-04-17 2010-10-21 Transgene Sa Biomarker for monitoring patients
CA2756591C (en) 2009-04-23 2018-11-06 Crucell Holland B.V. Recombinant human alpha1-antitrypsin
EP4218794A3 (en) 2009-06-10 2023-09-13 New York University Immunological targeting of pathological tau proteins
JP5536113B2 (en) 2009-07-06 2014-07-02 アケビア セラピューティクス インコーポレイテッド Compounds, compositions and methods for preventing metastasis of cancer cells
US8883832B2 (en) 2009-07-06 2014-11-11 Aerpio Therapeutics Inc. Compounds, compositions, and methods for preventing metastasis of cancer cells
EP2451935A2 (en) 2009-07-08 2012-05-16 Glycotope GmbH Perfusion bioreactor
JP5650212B2 (en) 2009-07-10 2015-01-07 トランジェーヌ、ソシエテ、アノニムTransgene S.A. Biomarkers and related methods for selecting patients
PE20120571A1 (en) * 2009-07-16 2012-06-06 Crucell Holland Bv PRODUCTION OF ELEVATED TITLES OF POLIVIRUS FOR VACCINE PRODUCTION
SG178254A1 (en) 2009-08-07 2012-03-29 Transgene Sa Composition for treating hbv infection
US9605844B2 (en) * 2009-09-01 2017-03-28 Cree, Inc. Lighting device with heat dissipation elements
CA2776461C (en) 2009-10-15 2020-08-25 Crucell Holland B.V. Method for the purification of adenovirus particles.
BR112012008507B8 (en) * 2009-10-15 2021-05-25 Crucell Holland Bv method for purifying adenovirus particles from a cell suspension
US20120219583A1 (en) 2009-10-16 2012-08-30 Los Alamos National Security, Llc Nucleic acid sequences encoding expandable hiv mosaic proteins
WO2011057254A2 (en) 2009-11-09 2011-05-12 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Simian adenoviral vector-based vaccines
BR112012010824A2 (en) 2009-11-09 2018-03-06 Genvec Inc simian adenoviruses and methods of use
WO2011083153A2 (en) 2010-01-08 2011-07-14 Profibrix Bv Fibrinogen preparations enriched in fibrinogen with an extended alpha chain
TWI535445B (en) 2010-01-12 2016-06-01 安可美德藥物股份有限公司 Wnt antagonists and methods of treatment and screening
NZ601424A (en) 2010-02-15 2014-07-25 Crucell Holland Bv Method for the production of ad26 adenoviral vectors
CN102892429B (en) 2010-03-17 2016-08-31 康奈尔大学 Abuse resistant drugs vaccine based on destroyed adenovirus
EP2548025A4 (en) * 2010-03-17 2013-09-25 Univ Michigan Using phage epitopes to profile the immune response
JP2013527753A (en) 2010-03-23 2013-07-04 イントレキソン コーポレーション Vectors that conditionally express therapeutic proteins, host cells containing the vectors, and uses thereof
MX347515B (en) 2010-04-01 2017-04-28 Oncomed Pharmaceuticals Inc * Frizzled-binding agents and uses thereof.
WO2012021730A2 (en) 2010-08-11 2012-02-16 Genvec, Inc. Respiratory syncytial virus (rsv) vaccine
WO2012030512A1 (en) 2010-09-03 2012-03-08 Percivia Llc. Flow-through protein purification process
CA2808556A1 (en) 2010-09-20 2012-03-29 Crucell Holland B.V. Therapeutic vaccination against active tuberculosis
WO2012041669A1 (en) 2010-09-27 2012-04-05 Crucell Holland B.V. Heterologous prime boost vaccination regimen against malaria
DE102010041958A1 (en) 2010-10-04 2012-04-05 Medicyte Gmbh Suitable hepatocytes for in vitro genotoxicity tests
WO2012083297A2 (en) 2010-12-17 2012-06-21 Genvec, Inc. Adenoviral vectors with modified hexon regions
EP2654786B1 (en) 2010-12-20 2019-02-20 GenVec, Inc. Adenoviral vector-based dengue fever vaccine
WO2012092341A1 (en) 2010-12-28 2012-07-05 University Of Rochester Methods of modifying insulin signaling using biliverdin reductase (bvr) and bvr derived peptides
WO2012106281A2 (en) 2011-01-31 2012-08-09 The General Hospital Corporation Multimodal trail molecules and uses in cellular therapies
JP6189754B2 (en) 2011-03-04 2017-08-30 イントレキソン コーポレーション Vectors that conditionally express proteins
WO2013001372A2 (en) 2011-06-30 2013-01-03 University Of Oslo Methods and compositions for inhibition of activation of regulatory t cells
PT2729173T (en) 2011-07-06 2016-09-22 Sykehuset Sorlandet Hf Egfr targeted therapy
TWI575070B (en) 2011-07-12 2017-03-21 傳斯堅公司 Hbv polymerase mutants
PL2753346T3 (en) 2011-09-07 2020-10-19 Mount Sinai School Of Medicine Ceramidase and cell differentiation
WO2013036973A2 (en) 2011-09-09 2013-03-14 Biomed Realty, L.P. Methods and compositions for controlling assembly of viral proteins
TW201318637A (en) 2011-09-29 2013-05-16 Transgene Sa Immunotherapy composition and regimen for treating hepatitis C virus infection
TW201321016A (en) 2011-09-29 2013-06-01 Transgene Sa Immunotherapy composition and regimen for treating hepatitis C virus infection
WO2013052811A2 (en) 2011-10-05 2013-04-11 Genvec, Inc. Adenoviral vectors and methods of use
US9580476B2 (en) 2011-10-05 2017-02-28 Genvec, Inc. Adenoviral vector-based respiratory syncytial virus (RSV) vaccine
US9617560B2 (en) 2011-10-05 2017-04-11 Genvec, Inc. Simian (gorilla) adenovirus or adenoviral vectors and methods of use
JP6757119B2 (en) 2011-10-05 2020-09-16 ジェンヴェック エルエルシー Afen adenovirus (gorilla) or adenovirus vector, and how to use
JP2014530244A (en) 2011-10-13 2014-11-17 エアピオ セラピューティックス, インコーポレイテッド Methods for treating vascular leak syndrome and cancer
EP2780034A1 (en) 2011-11-14 2014-09-24 Crucell Holland B.V. Heterologous prime-boost immunization using measles virus-based vaccines
EP2784155B1 (en) 2011-11-24 2018-06-13 Viromed Co. Ltd. Adenovirus producing novel cell line and the use thereof
US20150004144A1 (en) 2011-12-02 2015-01-01 The General Hospital Corporation Differentiation into brown adipocytes
US9175312B2 (en) 2011-12-08 2015-11-03 Virovek Incorporation Vectors harboring toxic genes, methods and uses therefor
US20150157700A1 (en) 2012-02-02 2015-06-11 GanVec, Inc. Adenoviral vector-based malaria vaccine
CN104428009A (en) 2012-02-07 2015-03-18 全球生物疗法美国有限公司 Compartmentalized method of nucleic acid delivery and compositions and uses thereof
NZ628385A (en) 2012-03-12 2016-09-30 Crucell Holland Bv Batches of recombinant adenovirus with altered terminal ends
US8932607B2 (en) 2012-03-12 2015-01-13 Crucell Holland B.V. Batches of recombinant adenovirus with altered terminal ends
AP2014007994A0 (en) 2012-03-22 2014-10-31 Crucell Holland Bv Vaccine against rsv
US9119813B2 (en) 2012-03-22 2015-09-01 Crucell Holland B.V. Vaccine against RSV
US9790519B2 (en) 2012-05-29 2017-10-17 Genvec, Inc. Modified serotype 28 adenoviral vectors
EP2855511B1 (en) 2012-05-29 2019-07-24 GenVec, Inc. Herpes simplex virus vaccine
WO2014009433A1 (en) 2012-07-10 2014-01-16 Transgene Sa Mycobacterium resuscitation promoting factor for use as adjuvant
MY173004A (en) 2012-07-10 2019-12-18 Transgene Sa Mycobacterial antigen vaccine
EP2880154B1 (en) 2012-08-03 2019-05-15 Sanofi Pasteur SA Production of infectious influenza viruses
EP2890720B1 (en) 2012-08-30 2019-07-17 The General Hospital Corporation Compositions and methods for treating cancer
EP2908853B1 (en) 2012-10-21 2018-12-05 University Of Rochester Thy1 (cd90) as a therapy to control adipose tissue accumulation
CA2887711A1 (en) 2012-10-23 2014-05-01 Oncomed Pharmaceuticals, Inc. Methods of treating neuroendocrine tumors using wnt pathway-binding agents
DK2920313T3 (en) 2012-11-16 2019-09-02 Beth Israel Deaconess Medical Ct Inc RECOMBINANT ADENOVIRA AND ITS USE
BR112015013849A2 (en) 2012-12-21 2017-07-11 Sykehuset Soerlandet Hf egfr targeted therapy of neurological disorders and pain
WO2014121196A1 (en) 2013-02-04 2014-08-07 Oncomed Pharmaceuticals, Inc. Methods and monitoring of treatment with a wnt pathway inhibitor
US9168300B2 (en) 2013-03-14 2015-10-27 Oncomed Pharmaceuticals, Inc. MET-binding agents and uses thereof
KR101606910B1 (en) 2013-03-29 2016-04-04 충북보건과학대학교 산학협력단 A549 Based Cell Line for Preparing Adenovirus Vector
MX2015014568A (en) 2013-04-17 2016-12-02 Genzyme Corp Compositions and methods for treating and preventing macular degeneration.
WO2014176259A1 (en) 2013-04-22 2014-10-30 Icahn School Of Medicine At Mount Sinai Mutations in pdgfrb and notch3 as causes of autosomal dominant infantile myofibromatosis
CA2910067C (en) 2013-04-25 2023-10-17 Crucell Holland B.V. Stabilized soluble pre-fusion rsv f polypeptides
JP6649250B2 (en) 2013-05-21 2020-02-19 プレジデント・アンド・フェロウズ・オブ・ハーバード・カレッジ Engineered heme binding constructs and uses thereof
KR102313153B1 (en) 2013-06-17 2021-10-15 얀센 백신스 앤드 프리벤션 비.브이. Stabilized soluble pre-fusion rsv f polypeptides
ES2525768B1 (en) * 2013-06-24 2015-10-07 Curaxis, S.L. Procedure for the production of glycosylated recombinant proteins.
US11364032B2 (en) 2013-08-08 2022-06-21 Global Bio Therapeutics, Inc. Clamp device for minimally invasive procedures and uses thereof
EP3046536B1 (en) 2013-09-19 2018-11-28 Janssen Vaccines & Prevention B.V. Improved adenovirus formulations
US10421986B2 (en) 2013-09-30 2019-09-24 Janssen Vaccines & Prevention B.V. Method for the clarification of high-density crude cell culture harvest
CN106103471B (en) 2014-01-09 2020-01-07 特兰斯吉恩股份有限公司 Fusion of heterooligomeric mycobacterial antigens
MX2016010215A (en) 2014-02-06 2016-11-15 Genzyme Corp Compositions and methods for treating and preventing macular degeneration.
EP2927685A1 (en) 2014-04-02 2015-10-07 Medicyte GmbH Suitable hepatocytes for in-vitro hepatitis tests
DK3172317T3 (en) 2014-07-24 2019-07-22 Janssen Vaccines & Prevention Bv PROCEDURE FOR CLEANING POLIOVIRUS FROM CELL CULTURES
MX2017002933A (en) 2014-09-07 2017-05-30 Selecta Biosciences Inc Methods and compositions for attenuating gene editing anti-viral transfer vector immune responses.
WO2016044707A1 (en) 2014-09-18 2016-03-24 Cedars-Sinai Medical Center Compositions and methods for treating fibrosis
TWI710635B (en) 2014-10-09 2020-11-21 美商珍維克公司 Adenoviral vector encoding human atonal homolog-1 (hath1)
MY181175A (en) 2014-11-04 2020-12-21 Janssen Vaccines & Prevention Bv Therapeutic hpv16 vaccines
WO2016131895A1 (en) 2015-02-19 2016-08-25 Janssen Vaccines & Prevention B.V. Method for quantification of virus particles using capillary zone electrophoresis
WO2016131945A1 (en) 2015-02-20 2016-08-25 Transgene Sa Combination product with autophagy modulator
PT3271729T (en) 2015-03-18 2020-12-15 Janssen Vaccines & Prevention Bv Assays for recombinant expression systems
CN107466324B (en) 2015-04-14 2022-01-14 扬森疫苗与预防公司 Recombinant adenovirus expressing two transgenes with bidirectional promoter
EP3283529B1 (en) 2015-04-17 2023-06-07 The General Hospital Corporation Agents, systems and methods for treating cancer
CN107708718B (en) 2015-04-22 2022-01-11 西达-赛奈医疗中心 Enterally delivered bitter oligopeptides for the treatment of type 2 diabetes
CA2991540A1 (en) 2015-07-07 2017-01-12 Janssen Vaccines & Prevention B.V. Stabilized soluble pre-fusion respiratory syncytial sirus polypeptides
BR112017027448A2 (en) 2015-07-07 2018-09-04 Janssen Vaccines & Prevention Bv rsv vaccine
EA037295B1 (en) 2015-08-20 2021-03-05 Янссен Вэксинс Энд Превеншн Б.В. Therapeutic hpv18 vaccines
CA3001050C (en) 2015-10-06 2023-03-28 Janssen Vaccines & Prevention B.V. Method for preventing surface-induced degradation of viruses using cyclodextrins
WO2017074517A1 (en) * 2015-10-30 2017-05-04 Seracare Life Sciences, Inc. Adenovirus control virus
US10377801B2 (en) 2015-11-04 2019-08-13 Northwestern University Amelioration of chronic kidney disease
US11273151B2 (en) 2015-11-04 2022-03-15 Icahn School Of Medicine At Mount Sinai Methods of treating tumors and cancer, and identifying candidate subjects for such treatment
MY190320A (en) 2016-04-05 2022-04-13 Janssen Vaccines & Prevention Bv Stabilized soluble pre-fusion rsv f proteins
KR102401247B1 (en) 2016-04-05 2022-05-25 얀센 백신스 앤드 프리벤션 비.브이. Vaccine against RSV
EP3448881B1 (en) 2016-04-26 2023-06-07 Icahn School of Medicine at Mount Sinai Treatment of hippo pathway mutant tumors and methods of identifying subjects as candidates for treatment
MX2018013340A (en) 2016-05-02 2019-08-21 Janssen Vaccines & Prevention Bv Therapeutic hpv vaccine combinations.
WO2017191147A1 (en) 2016-05-04 2017-11-09 Transgene Sa Combination therapy with cpg tlr9 ligand
RU2758238C2 (en) 2016-05-12 2021-10-26 Янссен Вэксинс Энд Превеншн Б.В. Effective and balanced bidirectional promoter
CA3025441A1 (en) 2016-05-30 2017-12-07 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion rsv f proteins
RU2745500C2 (en) 2016-06-20 2021-03-25 Янссен Вэксинс Энд Превеншн Б.В. Efficient and balanced bidirectional promotor
WO2018013509A1 (en) 2016-07-11 2018-01-18 Arizona Board Of Regents On Behalf Of The University Of Arizona Compositions and methods for diagnosing and treating arrhythmias
US10744196B2 (en) 2016-07-14 2020-08-18 Janssen Vaccines & Prevention B.V. HPV vaccines
WO2018064523A1 (en) 2016-09-30 2018-04-05 Genvec, Inc. Adenovectors for delivery of therapeutic genetic material into t cells
US20190328869A1 (en) 2016-10-10 2019-10-31 Transgene Sa Immunotherapeutic product and mdsc modulator combination therapy
US20180193482A1 (en) 2017-01-07 2018-07-12 Selecta Biosciences, Inc. Patterned dosing of immunosuppressants coupled to synthetic nanocarriers
US11241436B2 (en) 2017-01-25 2022-02-08 Northwestern University Autophagy inducers for treatment of CNS conditions
JP6721797B2 (en) 2017-02-09 2020-07-15 ヤンセン ファッシンズ アンド プリベンション ベーフェーJanssen Vaccines & Prevention B.V. Strong and short promoter for heterologous gene expression
US11781116B2 (en) 2017-02-17 2023-10-10 Lonza Ltd. Mammalian cells for producing adeno-associated viruses
KR102122117B1 (en) 2017-04-21 2020-06-11 (주)지뉴인텍 A Cell Line for Producing Adenovirus having limitedautoreplication capability and A Method of the same
CA3061278A1 (en) 2017-05-17 2018-11-22 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against rsv infection
CN111163800A (en) 2017-09-15 2020-05-15 扬森疫苗与预防公司 Methods for safely inducing immunity to RSV
AU2018347583A1 (en) 2017-10-13 2020-05-21 Selecta Biosciences, Inc. Methods and compositions for attenuating anti-viral transfer vector IgM responses
CN111372943B (en) 2017-10-31 2023-12-05 扬森疫苗与预防公司 Adenovirus and use thereof
KR20200074988A (en) 2017-10-31 2020-06-25 얀센 백신스 앤드 프리벤션 비.브이. Adenovirus vectors and uses thereof
SG11202003200VA (en) 2017-10-31 2020-05-28 Janssen Vaccines & Prevention Bv Adenovirus and uses thereof
EP3704139A1 (en) 2017-10-31 2020-09-09 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
CA3083183A1 (en) 2017-11-22 2019-05-31 The Regents Of The University Of Michigan Compositions and methods for treating cancer
WO2019118480A1 (en) 2017-12-11 2019-06-20 Beth Israel Deaconess Medical Center, Inc. Recombinant adenoviruses and uses thereof
US11447526B2 (en) 2018-01-23 2022-09-20 Janssen Vaccines & Prevention B.V. Influenza virus vaccines and uses thereof
EP3762010A4 (en) 2018-03-06 2022-04-06 Precigen, Inc. Hepatitis b vaccines and uses of the same
KR20210113655A (en) 2019-01-10 2021-09-16 얀센 바이오테크 인코포레이티드 Prostate neoantigens and uses thereof
MX2021012991A (en) 2019-04-25 2021-12-10 Janssen Vaccines & Prevention Bv Recombinant influenza antigens.
EP3962537A1 (en) 2019-04-28 2022-03-09 Selecta Biosciences, Inc. Methods for treatment of subjects with preexisting immunity to viral transfer vectors
MX2021013947A (en) 2019-05-15 2021-12-14 Janssen Vaccines & Prevention Bv Prophylactic treatment of respiratory syncytial virus infection with an adenovirus based vaccine.
BR112021022087A2 (en) 2019-05-15 2021-12-28 Janssen Vaccines & Prevention Bv Coadministration of seasonal influenza vaccine and adenovirus-based respiratory syncytial virus vaccine
WO2020229581A1 (en) 2019-05-16 2020-11-19 Janssen Vaccines & Prevention B.V. Methods for inducing a safe immune response against polio virus
CA3141863A1 (en) 2019-05-28 2020-12-03 Selecta Biosciences, Inc. Methods and compositions for attenuated anti-viral transfer vector immune response
EP4025247A1 (en) 2019-09-05 2022-07-13 Janssen Vaccines & Prevention B.V. Influenza virus vaccines and uses thereof
JP2022551107A (en) 2019-10-03 2022-12-07 ヤンセン ファッシンズ アンド プリベンション ベーフェー Adenoviral vectors and uses thereof
EP4041873A4 (en) 2019-10-08 2023-10-25 Trustees of Boston College Proteins containing multiple, different unnatural amino acids and methods of making and using such proteins
BR112022009598A2 (en) 2019-11-18 2022-08-16 Janssen Biotech Inc VACCINES BASED ON MUTANTS CALR AND JAK2 AND USE THEREOF
TW202144388A (en) 2020-02-14 2021-12-01 美商健生生物科技公司 Neoantigens expressed in ovarian cancer and their uses
TW202144389A (en) 2020-02-14 2021-12-01 美商健生生物科技公司 Neoantigens expressed in multiple myeloma and their uses
JP2023517011A (en) 2020-03-05 2023-04-21 ネオティーエックス セラピューティクス リミテッド Methods and compositions for treating cancer using immune cells
EP4135757A1 (en) 2020-04-13 2023-02-22 Janssen Biotech, Inc. Psma and steap1 vaccines and their uses
CA3172618A1 (en) 2020-04-21 2021-10-28 Jjp Biologics Sp. Z O.O. Humanized anti-human cd89 antibodies and uses thereof
US20230024133A1 (en) 2020-07-06 2023-01-26 Janssen Biotech, Inc. Prostate Neoantigens And Their Uses
WO2022009052A2 (en) 2020-07-06 2022-01-13 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2022009051A1 (en) 2020-07-06 2022-01-13 Janssen Biotech, Inc. A method for determining responsiveness to prostate cancer treatment
JP2023533584A (en) 2020-07-13 2023-08-03 トランジェーヌ treatment of immunosuppression
KR20230051221A (en) 2020-08-11 2023-04-17 머스큘로스켈레탈 트랜스플랜트 파운데이션 Methods of Treating Cardiac Conditions with Placenta-Derived Compositions
CN118139655A (en) 2021-08-13 2024-06-04 特里奥万斯控股公司 Skin substitute compositions and methods of making and using the same
WO2023064367A1 (en) 2021-10-12 2023-04-20 Selecta Biosciences, Inc. Methods and compositions for attenuating anti-viral transfer vector igm responses
WO2023172624A1 (en) 2022-03-09 2023-09-14 Selecta Biosciences, Inc. Immunosuppressants in combination with anti-igm agents and related dosing
WO2023213764A1 (en) 2022-05-02 2023-11-09 Transgene Fusion polypeptide comprising an anti-pd-l1 sdab and a member of the tnfsf
EP4338727A1 (en) 2022-09-14 2024-03-20 Roquette Freres Adenovirus formulations

Citations (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US545522A (en) * 1895-09-03 Vehicle-wheel
US4405712A (en) * 1981-07-01 1983-09-20 The United States Of America As Represented By The Department Of Health And Human Services LTR-Vectors
US4497796A (en) * 1980-03-26 1985-02-05 The Regents Of The University Of California Gene transfer in intact mammals
US4727028A (en) * 1981-06-22 1988-02-23 Eli Lilly And Company Recombinant DNA cloning vectors and the eukaryotic and prokaryotic transformants thereof
US4740463A (en) * 1984-04-13 1988-04-26 Massachusetts Institute Of Technology Methods and artificial genes for antagonizing the function of an oncogene
US5190931A (en) * 1983-10-20 1993-03-02 The Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5208149A (en) * 1983-10-20 1993-05-04 The Research Foundation Of State University Of New York Nucleic acid constructs containing stable stem and loop structures
US5378618A (en) * 1988-04-15 1995-01-03 E. I. Du Pont De Nemours And Company Vitro headful packaging system for cloning DNA fragments as large as 95kb
US5518913A (en) * 1991-10-10 1996-05-21 National Research Council Of Canada High level recombinant protein production using conditional helper-free adenovirus vector
US5652224A (en) * 1995-02-24 1997-07-29 The Trustees Of The University Of Pennsylvania Methods and compositions for gene therapy for the treatment of defects in lipoprotein metabolism
US5670488A (en) * 1992-12-03 1997-09-23 Genzyme Corporation Adenovirus vector for gene therapy
US5707618A (en) * 1995-03-24 1998-01-13 Genzyme Corporation Adenovirus vectors for gene therapy
US5753500A (en) * 1989-09-07 1998-05-19 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US5837511A (en) * 1995-10-02 1998-11-17 Cornell Research Foundation, Inc. Non-group C adenoviral vectors
US5994128A (en) * 1995-06-15 1999-11-30 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US5994106A (en) * 1994-06-10 1999-11-30 Genvec, Inc. Stocks of recombinant, replication-deficient adenovirus free of replication-competent adenovirus
US6040174A (en) * 1993-05-28 2000-03-21 Transgene S.A. Defective adenoviruses and corresponding complementation lines
US6051430A (en) * 1996-02-09 2000-04-18 Het Nederlands Kanker Instituut Vectors and methods for providing cells with additional nucleic acid material integrated in the genome of said cells
US6140103A (en) * 1995-12-01 2000-10-31 Introgene B.V. Regulated protein expression in stably transfected mammalian cells
US6204052B1 (en) * 1994-08-16 2001-03-20 Introgene B.V. Adenoviral vectors with reduced TNF response and partial E3 region deletion
US6232105B1 (en) * 1997-01-29 2001-05-15 Introgene B.V. Conditional replication and expression system
US6265212B1 (en) * 1995-06-15 2001-07-24 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy

Family Cites Families (144)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4593002A (en) * 1982-01-11 1986-06-03 Salk Institute Biotechnology/Industrial Associates, Inc. Viruses with recombinant surface proteins
US4487829A (en) * 1982-03-23 1984-12-11 Massachusetts Institute Of Technology Production and use of monoclonal antibodies against adenoviruses
US4792525A (en) * 1982-08-04 1988-12-20 La Jolla Cancer Research Foundation Tetrapeptide
US4517686A (en) * 1982-08-04 1985-05-21 La Jolla Cancer Research Foundation Polypeptide
US4589881A (en) * 1982-08-04 1986-05-20 La Jolla Cancer Research Foundation Polypeptide
US4578079A (en) * 1982-08-04 1986-03-25 La Jolla Cancer Research Foundation Tetrapeptide
NZ210501A (en) 1983-12-13 1991-08-27 Kirin Amgen Inc Erythropoietin produced by procaryotic or eucaryotic expression of an exogenous dna sequence
US4703008A (en) 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
FR2573436B1 (en) 1984-11-20 1989-02-17 Pasteur Institut RECOMBINANT DNA COMPRISING A NUCLEOTIDE SEQUENCE ENCODING A DETERMINED POLYPEPTIDE UNDER THE CONTROL OF AN ADENOVIRUS PROMOTER, VECTORS CONTAINING THIS RECOMBINANT DNA, EUKARYOT CELLS TRANSFORMED BY THIS RECOMBINANT DNA, THE CONSTITUTION OF VACCINES
IL77081A (en) 1984-12-04 1999-10-28 Genetics Inst Dna sequence encoding human erythropoietin process for the preparation thereof and a pharmaceutical composition of human erythropoietin
US4797368A (en) * 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US6007806A (en) 1986-08-13 1999-12-28 Transgene S.A. Expression of a tumor-specific antigen by a recombinant vector virus and use thereof in preventive or curative treatment of the corresponding tumor
US5744133A (en) 1986-08-13 1998-04-28 Transgene S.A. Expression of a tumor-specific antigen by a recombinant vector virus and use thereof in preventitive or curative treatment of the corresponding tumor
US4835260A (en) 1987-03-20 1989-05-30 Genetics Institute, Inc. Erythropoietin composition
US5166320A (en) * 1987-04-22 1992-11-24 University Of Connecticut Carrier system and method for the introduction of genes into mammalian cells
US4956281A (en) * 1987-06-03 1990-09-11 Biogen, Inc. DNA sequences, recombinant DNA molecules and processes for producing lymphocyte function associated antigen-3
US5024939A (en) * 1987-07-09 1991-06-18 Genentech, Inc. Transient expression system for producing recombinant protein
US5192539A (en) 1988-07-21 1993-03-09 Akzo N.V. Infectious bursal disease virus production in continuous cell lines
US5223409A (en) * 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5204445A (en) * 1988-10-03 1993-04-20 The Scripps Research Institute Peptides and antibodies that inhibit integrin-ligand binding
US5047335A (en) 1988-12-21 1991-09-10 The Regents Of The University Of Calif. Process for controlling intracellular glycosylation of proteins
US5198346A (en) * 1989-01-06 1993-03-30 Protein Engineering Corp. Generation and selection of novel DNA-binding proteins and polypeptides
US5096815A (en) * 1989-01-06 1992-03-17 Protein Engineering Corporation Generation and selection of novel dna-binding proteins and polypeptides
GB8900483D0 (en) 1989-01-10 1989-03-08 Celltech Ltd Recombinant dna method
US5223394A (en) * 1989-04-10 1993-06-29 Biogen, Inc. Recombinant dna molecule comprising lymphocyte function-associated antigen 3 phosphatidylinositol linkage signal sequence
DE3923963A1 (en) 1989-07-20 1991-01-31 Behringwerke Ag MUTEINE OF HUMAN ERYTHROPOETIN, THEIR PRODUCTION AND THEIR USE
US5240846A (en) * 1989-08-22 1993-08-31 The Regents Of The University Of Michigan Gene therapy vector for cystic fibrosis
US5585362A (en) 1989-08-22 1996-12-17 The Regents Of The University Of Michigan Adenovirus vectors for gene therapy
US5332567A (en) * 1989-08-24 1994-07-26 Immunomedics Detection and treatment of infections with immunoconjugates
US5545522A (en) * 1989-09-22 1996-08-13 Van Gelder; Russell N. Process for amplifying a target polynucleotide sequence using a single primer-promoter complex
US5856298A (en) 1989-10-13 1999-01-05 Amgen Inc. Erythropoietin isoforms
AU7906691A (en) * 1990-05-23 1991-12-10 United States of America, as represented by the Secretary, U.S. Department of Commerce, The Adeno-associated virus (aav)-based eucaryotic vectors
US5349053A (en) * 1990-06-01 1994-09-20 Protein Design Labs, Inc. Chimeric ligand/immunoglobulin molecules and their uses
US5246921A (en) * 1990-06-26 1993-09-21 The Wistar Institute Of Anatomy And Biology Method for treating leukemias
US6743623B2 (en) 1991-09-27 2004-06-01 Centre National De La Recherche Scientifique Viral recombinant vectors for expression in muscle cells
US5521291A (en) * 1991-09-30 1996-05-28 Boehringer Ingelheim International, Gmbh Conjugates for introducing nucleic acid into higher eucaryotic cells
NZ244306A (en) * 1991-09-30 1995-07-26 Boehringer Ingelheim Int Composition for introducing nucleic acid complexes into eucaryotic cells, complex containing nucleic acid and endosomolytic agent, peptide with endosomolytic domain and nucleic acid binding domain and preparation
CA2053187A1 (en) 1991-10-10 1993-04-11 National Research Council Of Canada High level recombinant protein production using conditional helper-free adenovirus vector
US5384249A (en) 1991-12-17 1995-01-24 Kyowa Hakko Kogyo Co., Ltd. α2→3 sialyltransferase
ES2312164T3 (en) 1992-09-25 2009-02-16 Aventis Pharma S.A. ADENOVIRUS VECTORS FOR THE TRANSFER OF STRANGE GENES IN CELLS OF THE CENTRAL NERVOUS SYSTEM, PARTICULARLY IN THE BRAIN.
WO1994011506A1 (en) 1992-11-18 1994-05-26 Arch Development Corporation Adenovirus-mediated gene transfer to cardiac and vascular smooth muscle
EP0673431A1 (en) * 1992-12-03 1995-09-27 Genzyme Corporation Gene therapy for cystic fibrosis
DK0604684T3 (en) 1992-12-23 1998-01-26 Campina Melkunie Bv Process for Recovery of Alphalactalbumin and Betalactoglobulin from a Milk Protein Product
DE4311651A1 (en) 1993-04-08 1994-10-13 Boehringer Ingelheim Int Virus for the transport of foreign DNA into higher eukaryotic cells
JPH09500782A (en) * 1993-04-08 1997-01-28 ジェネティック セラピー,インコーポレイテッド Adenovirus vector containing DNA encoding lung surfactant protein
FR2704234B1 (en) 1993-04-22 1995-07-21 Centre Nat Rech Scient RECOMBINANT VIRUSES, PREPARATION AND USE IN GENE THERAPY.
FR2705361B1 (en) * 1993-05-18 1995-08-04 Centre Nat Rech Scient Viral vectors and use in gene therapy.
US6133028A (en) * 1993-05-28 2000-10-17 Transgene S.A. Defective adenoviruses and corresponding complementation lines
DE69434486T2 (en) * 1993-06-24 2006-07-06 Advec Inc. ADENOVIRUS VECTORS FOR GENE THERAPY
US5919676A (en) * 1993-06-24 1999-07-06 Advec, Inc. Adenoviral vector system comprising Cre-loxP recombination
CA2144040A1 (en) * 1993-07-13 1995-01-26 Michel Perricaudet Defective adenovirus vectors and use thereof in gene therapy
FR2707664B1 (en) 1993-07-13 1995-09-29 Centre Nat Rech Scient Viral vectors and use in gene therapy.
US5543328A (en) * 1993-08-13 1996-08-06 Genetic Therapy, Inc. Adenoviruses having modified fiber proteins
US5552311A (en) * 1993-09-14 1996-09-03 University Of Alabama At Birmingham Research Foundation Purine nucleoside phosphorylase gene therapy for human malignancy
US5534423A (en) * 1993-10-08 1996-07-09 Regents Of The University Of Michigan Methods of increasing rates of infection by directing motion of vectors
US5733782A (en) 1993-10-25 1998-03-31 Creative Biomolecules, Inc. Methods and compositions for high protein production from non-native DNA
US6210939B1 (en) * 1993-10-25 2001-04-03 Canji, Inc. Recombinant adenoviral vector and methods of use
US20010006629A1 (en) 1993-10-25 2001-07-05 Richard J. Gregory Recombinant adenoviral vector and methods of use
US5773569A (en) 1993-11-19 1998-06-30 Affymax Technologies N.V. Compounds and peptides that bind to the erythropoietin receptor
US5830851A (en) 1993-11-19 1998-11-03 Affymax Technologies N.V. Methods of administering peptides that bind to the erythropoietin receptor
US5443953A (en) * 1993-12-08 1995-08-22 Immunomedics, Inc. Preparation and use of immunoconjugates
WO1995016772A1 (en) 1993-12-14 1995-06-22 Cornell Research Foundation, Inc. Adenovirus gene expression system
US5698443A (en) 1995-06-27 1997-12-16 Calydon, Inc. Tissue specific viral vectors
US6057299A (en) 1994-01-13 2000-05-02 Calydon, Inc. Tissue-specific enhancer active in prostate
US5731172A (en) 1994-03-09 1998-03-24 Sumitomo Pharmaceuticals Company, Ltd. Recombinant adenovirus and process for producing the same
AU2194895A (en) 1994-03-25 1995-10-17 Uab Research Foundation, The Composition and methods for creating syngeneic recombinant virus-producing cells
US5789247A (en) 1994-04-01 1998-08-04 Ballay; Annick Expression in non-tumoral human lymphoblastoid lines with an integrative vector
US7252989B1 (en) * 1994-04-04 2007-08-07 Board Of Regents, The University Of Texas System Adenovirus supervector system
US5718923A (en) 1994-04-26 1998-02-17 Chugai Seiyaku Kabushiki Kaisha Melt granulated sucralfate preparations and a process for their production
US5851806A (en) * 1994-06-10 1998-12-22 Genvec, Inc. Complementary adenoviral systems and cell lines
FR2721943B1 (en) 1994-06-29 1996-08-02 Rhone Poulenc Rorer Sa ADENOVIRUS COMPRISING A GENE ENCODING A SUPEROXIDE DISMUTASE
US5559099A (en) * 1994-09-08 1996-09-24 Genvec, Inc. Penton base protein and methods of using same
US5846782A (en) * 1995-11-28 1998-12-08 Genvec, Inc. Targeting adenovirus with use of constrained peptide motifs
US5552309A (en) * 1994-09-30 1996-09-03 Indiana University Foundation Use of polyols for improving the introduction of genetic material into cells
FR2725726B1 (en) * 1994-10-17 1997-01-03 Centre Nat Rech Scient VIRAL VECTORS AND USE IN GENE THERAPY
US5856152A (en) * 1994-10-28 1999-01-05 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV vector and methods of use therefor
FR2726285B1 (en) 1994-10-28 1996-11-29 Centre Nat Rech Scient ADENOVIRUSES CONTAINING VIABLE CONTAMINANT PARTICLES, PREPARATION AND USE
EP0787200B1 (en) * 1994-10-28 2005-04-20 The Trustees Of The University Of Pennsylvania Improved adenovirus and methods of use thereof
US5872005A (en) 1994-11-03 1999-02-16 Cell Genesys Inc. Packaging cell lines for adeno-associated viral vectors
WO1996016676A1 (en) * 1994-11-28 1996-06-06 Genetic Therapy, Inc. Tissue-specific treatment, diagnostic methods, and compositions using replication-deficient vectors
WO1996018418A1 (en) * 1994-12-12 1996-06-20 Genetic Therapy, Inc. Improved adenoviral vectors and producer cells
FR2727867B1 (en) 1994-12-13 1997-01-31 Rhone Poulenc Rorer Sa GENE TRANSFER IN MEDULLAR MOTONURONES USING ADENOVIRAL VECTORS
GB9500659D0 (en) 1995-01-13 1995-03-08 Camco Drilling Group Ltd Improvements in or relating to rotary drill bits
US5770442A (en) * 1995-02-21 1998-06-23 Cornell Research Foundation, Inc. Chimeric adenoviral fiber protein and methods of using same
US6127525A (en) * 1995-02-21 2000-10-03 Cornell Research Foundation, Inc. Chimeric adenoviral coat protein and methods of using same
US6037453A (en) 1995-03-15 2000-03-14 Genentech, Inc. Immunoglobulin variants
ATE243260T1 (en) * 1995-04-17 2003-07-15 Univ Texas ADENOVIRUS HELPER VIRUS SYSTEM
JPH08303576A (en) 1995-05-10 1996-11-19 Aisin Seiki Co Ltd Shift control device for automatic transmission
US5767078A (en) 1995-06-07 1998-06-16 Johnson; Dana L. Agonist peptide dimers
US6783980B2 (en) 1995-06-15 2004-08-31 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
FR2735789B1 (en) * 1995-06-23 1997-07-25 Centre Nat Rech Scient RECOMBINANT ADENOVIRUSES, THEIR USE FOR PREPARING AVA, COMPLEMENTARY CELL LINE AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM
US7001764B2 (en) 1995-06-27 2006-02-21 Cell Genesys, Inc. Compositions comprising tissue specific adenoviral vectors
US6676935B2 (en) 1995-06-27 2004-01-13 Cell Genesys, Inc. Tissue specific adenoviral vectors
FR2737222B1 (en) * 1995-07-24 1997-10-17 Transgene Sa NEW VIRAL AND LINEAR VECTORS FOR GENE THERAPY
FR2737501B1 (en) * 1995-07-31 1997-10-24 Transgene Sa NOVEL AUXILIARY VIRUSES FOR THE PREPARATION OF RECOMBINANT VIRAL VECTORS
US5622699A (en) * 1995-09-11 1997-04-22 La Jolla Cancer Research Foundation Method of identifying molecules that home to a selected organ in vivo
EA003195B1 (en) 1995-11-13 2003-02-27 Такара Сузо Ко., Лтд. Method for gene transfer into target cells with retrovirus
JP2001520511A (en) * 1995-12-08 2001-10-30 ザ ユーナヴァーサティ オブ アラバマ アト バーミングハム リサーチ ファンデーション Targeting adenovirus vector
CA2177085C (en) * 1996-04-26 2007-08-14 National Research Council Of Canada Adenovirus e1-complementing cell lines
US5835382A (en) 1996-04-26 1998-11-10 The Scripps Research Institute Small molecule mimetics of erythropoietin
US5877011A (en) * 1996-11-20 1999-03-02 Genzyme Corporation Chimeric adenoviral vectors
US5922315A (en) * 1997-01-24 1999-07-13 Genetic Therapy, Inc. Adenoviruses having altered hexon proteins
EP1017421B1 (en) * 1997-03-07 2005-05-25 The Wistar Institute Of Anatomy And Biology Use of adenoviral vectors expressing VEGF or PDGF FOR HEALING TISSUE DEFECTS AND INDUCING HYPERVASCULARITY IN MAMMALIAN TISSUE
WO1999066041A1 (en) 1998-06-16 1999-12-23 Human Genome Sciences, Inc. 94 human secreted proteins
CA2221819A1 (en) 1997-03-27 1998-09-27 Thomas A. Gigliatti Insect expression vectors
US6100086A (en) * 1997-04-14 2000-08-08 Genzyme Corporation Transgene expression systems
US5981275A (en) 1997-04-14 1999-11-09 Genzyme Corporation Transgene expression system for increased persistence
IL132673A0 (en) 1997-05-08 2001-03-19 Genetic Therapy Inc Gene transfer with adenoviruses having modified fiber proteins
US5849561A (en) * 1997-05-22 1998-12-15 Cornell Research Foundation, Inc. Method for the production of non-group C adenoviral vectors
US6287857B1 (en) * 1998-02-09 2001-09-11 Genzyme Corporation Nucleic acid delivery vehicles
US6417168B1 (en) 1998-03-04 2002-07-09 The Trustees Of The University Of Pennsylvania Compositions and methods of treating tumors
AU3358999A (en) 1998-03-20 1999-10-11 Genzyme Corporation Chimeric adenoviral vectors for targeted gene delivery
US6670188B1 (en) 1998-04-24 2003-12-30 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US6413776B1 (en) 1998-06-12 2002-07-02 Galapagos Geonomics N.V. High throughput screening of gene function using adenoviral libraries for functional genomics applications
US20030017138A1 (en) 1998-07-08 2003-01-23 Menzo Havenga Chimeric adenoviruses
EP1020529B1 (en) 1998-11-20 2005-06-01 Crucell Holland B.V. Gene delivery vectors provided with a tissue tropism for smooth muscle cells, and/or endothelial cells
US6929946B1 (en) 1998-11-20 2005-08-16 Crucell Holland B.V. Gene delivery vectors provided with a tissue tropism for smooth muscle cells, and/or endothelial cells
EP1016726A1 (en) 1998-12-30 2000-07-05 Introgene B.V. Gene therapy to promote angiogenesis
US6855544B1 (en) 1999-04-15 2005-02-15 Crucell Holland B.V. Recombinant protein production in a human cell
DK1818408T3 (en) 1999-05-17 2011-10-17 Crucell Holland Bv Recombinant adenovirus of the serotype Ad11
US20050232900A1 (en) 1999-05-18 2005-10-20 Crucell Holland B.V. Serotype of adenovirus and uses thereof
US6492169B1 (en) 1999-05-18 2002-12-10 Crucell Holland, B.V. Complementing cell lines
US6913922B1 (en) 1999-05-18 2005-07-05 Crucell Holland B.V. Serotype of adenovirus and uses thereof
EP1067188A1 (en) 1999-07-08 2001-01-10 Introgene B.V. Infection with chimaeric adenoviruses of cells negative for the adenovirus serotype 5 Coxsacki adenovirus receptor (CAR)
US6558948B1 (en) 1999-11-23 2003-05-06 Stefan Kochanek Permanent amniocytic cell line, its production and use for the production of gene transfer vectors
US7521220B2 (en) 1999-11-26 2009-04-21 Crucell Holland B.V. Production of vaccines
US7527961B2 (en) 1999-11-26 2009-05-05 Crucell Holland B.V. Production of vaccines
EP1103610A1 (en) 1999-11-26 2001-05-30 Introgene B.V. Production of vaccines from immortalised mammalian cell lines
AU2001257611A1 (en) 2000-04-28 2001-11-12 Avigen, Inc. Polynucleotides for use in recombinant adeno-associated virus virion production
EP1157999A1 (en) 2000-05-24 2001-11-28 Introgene B.V. Methods and means for enhancing skin transplantation using gene delivery vehicles having tropism for primary fibroblasts, as well as other uses thereof
US6844192B2 (en) 2001-06-29 2005-01-18 Wake Forest University Adenovirus E4 protein variants for virus production
US20030026783A1 (en) 2001-08-03 2003-02-06 Amine Abina Method of modulating neutralizing antibodies formation in mammals, and uses thereof in gene therapy, animal transgenesis and in functional inactivation of an endogenous proteins
JP4583029B2 (en) 2001-10-29 2010-11-17 クルセル ホランド ベー ヴェー Method and method for producing a protein having a predetermined post-translational modification
AU2002225509A1 (en) 2001-12-07 2003-06-17 Crucell Holland B.V. Production and of viruses, viral isolates and vaccines
AU2002351444B2 (en) 2001-12-07 2008-02-21 Crucell Holland B.V. Production of viruses, viral isolates and vaccines
DK1497438T3 (en) 2002-04-25 2010-01-04 Crucell Holland Bv Means and methods for producing adenovirus vectors
EP1497440B1 (en) 2002-04-25 2008-08-20 Crucell Holland B.V. Stable adenoviral vectors and methods for propagation thereof
NZ537277A (en) 2002-07-18 2008-04-30 Crucell Holland Bv Recombinant production of mixtures of antibodies
EP1553983A2 (en) 2002-10-23 2005-07-20 Crucell Holland B.V. New settings for recombinant adenoviral-based vaccines
EP1573012B1 (en) 2002-12-17 2011-11-30 Crucell Holland B.V. Recombinant viral-based malaria vaccines
EA008670B1 (en) 2003-05-09 2007-06-29 Круселл Холланд Б.В. Cultures of e1-immortalized cells and processes for culturing the same to increase product yields therefrom
WO2005080556A2 (en) 2004-02-23 2005-09-01 Crucell Holland B.V. Virus purification methods
PT1802336E (en) 2004-10-14 2011-11-15 Glaxosmithkline Biolog Sa Malaria prime/boost vaccines
US20070010016A1 (en) 2005-03-11 2007-01-11 Mccelland Alan Gene transfer with adenoviruses having modified fiber proteins

Patent Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US545522A (en) * 1895-09-03 Vehicle-wheel
US4497796A (en) * 1980-03-26 1985-02-05 The Regents Of The University Of California Gene transfer in intact mammals
US4727028A (en) * 1981-06-22 1988-02-23 Eli Lilly And Company Recombinant DNA cloning vectors and the eukaryotic and prokaryotic transformants thereof
US4405712A (en) * 1981-07-01 1983-09-20 The United States Of America As Represented By The Department Of Health And Human Services LTR-Vectors
US5190931A (en) * 1983-10-20 1993-03-02 The Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5208149A (en) * 1983-10-20 1993-05-04 The Research Foundation Of State University Of New York Nucleic acid constructs containing stable stem and loop structures
US4740463A (en) * 1984-04-13 1988-04-26 Massachusetts Institute Of Technology Methods and artificial genes for antagonizing the function of an oncogene
US5378618A (en) * 1988-04-15 1995-01-03 E. I. Du Pont De Nemours And Company Vitro headful packaging system for cloning DNA fragments as large as 95kb
US5753500A (en) * 1989-09-07 1998-05-19 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US5518913A (en) * 1991-10-10 1996-05-21 National Research Council Of Canada High level recombinant protein production using conditional helper-free adenovirus vector
US5670488A (en) * 1992-12-03 1997-09-23 Genzyme Corporation Adenovirus vector for gene therapy
US6040174A (en) * 1993-05-28 2000-03-21 Transgene S.A. Defective adenoviruses and corresponding complementation lines
US5994106A (en) * 1994-06-10 1999-11-30 Genvec, Inc. Stocks of recombinant, replication-deficient adenovirus free of replication-competent adenovirus
US6204052B1 (en) * 1994-08-16 2001-03-20 Introgene B.V. Adenoviral vectors with reduced TNF response and partial E3 region deletion
US5652224A (en) * 1995-02-24 1997-07-29 The Trustees Of The University Of Pennsylvania Methods and compositions for gene therapy for the treatment of defects in lipoprotein metabolism
US5707618A (en) * 1995-03-24 1998-01-13 Genzyme Corporation Adenovirus vectors for gene therapy
US5994128A (en) * 1995-06-15 1999-11-30 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US6238893B1 (en) * 1995-06-15 2001-05-29 Introgene B.V. Method for intracellular DNA amplification
US6033908A (en) * 1995-06-15 2000-03-07 Introgene, B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US6602706B1 (en) * 1995-06-15 2003-08-05 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US6306652B1 (en) * 1995-06-15 2001-10-23 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US6265212B1 (en) * 1995-06-15 2001-07-24 Introgene B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US5837511A (en) * 1995-10-02 1998-11-17 Cornell Research Foundation, Inc. Non-group C adenoviral vectors
US6140103A (en) * 1995-12-01 2000-10-31 Introgene B.V. Regulated protein expression in stably transfected mammalian cells
US6051430A (en) * 1996-02-09 2000-04-18 Het Nederlands Kanker Instituut Vectors and methods for providing cells with additional nucleic acid material integrated in the genome of said cells
US6232105B1 (en) * 1997-01-29 2001-05-15 Introgene B.V. Conditional replication and expression system

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030104626A1 (en) * 1995-06-15 2003-06-05 Fallaux Frits Jacobus Packaging systems for human recombinant adenovirus to be used in gene therapy
US20040228843A1 (en) * 1995-06-15 2004-11-18 Fallaux Frits Jacobus Packaging systems for human recombinant adenovirus to be used in gene therapy
US20050260596A1 (en) * 1995-06-15 2005-11-24 Fallaux Frits J Packaging systems for human recombinant adenovirus to be used in gene therapy
US7052881B2 (en) 1995-06-15 2006-05-30 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US7105346B2 (en) 1995-06-15 2006-09-12 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US20060246569A1 (en) * 1995-06-15 2006-11-02 Crucell Holland B.V. Packaging systems for human recombinant adenovirus to be used in gene therapy
US20090023196A1 (en) * 1995-06-15 2009-01-22 Introgene Stocks of replication-deficient adenovirus
US8236293B2 (en) 1995-06-15 2012-08-07 Crucell Holland B.V. Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer

Also Published As

Publication number Publication date
HK1064406A1 (en) 2005-01-28
SI1445322T2 (en) 2012-10-30
KR20040065317A (en) 2004-07-21
EP1445322B2 (en) 2012-06-06
KR19990022941A (en) 1999-03-25
US8236293B2 (en) 2012-08-07
DK0833934T4 (en) 2012-11-19
ATE278794T1 (en) 2004-10-15
US6238893B1 (en) 2001-05-29
DE69633565T3 (en) 2013-01-17
DE69633565T2 (en) 2005-12-22
EP0833934B1 (en) 2004-10-06
US20020151032A1 (en) 2002-10-17
EP1445322B1 (en) 2009-10-14
DK1445322T3 (en) 2010-01-04
KR100449181B1 (en) 2005-01-24
US5994128A (en) 1999-11-30
ES2333425T5 (en) 2012-08-28
CA2222140A1 (en) 1997-01-03
IL160406A0 (en) 2004-07-25
JPH11507552A (en) 1999-07-06
ES2333425T3 (en) 2010-02-22
ATE445705T1 (en) 2009-10-15
SI0833934T2 (en) 2013-04-30
US6306652B1 (en) 2001-10-23
DK1445322T4 (en) 2012-09-03
US6033908A (en) 2000-03-07
IL160406A (en) 2008-03-20
EP1445322A1 (en) 2004-08-11
PT1445322E (en) 2010-01-19
KR100470180B1 (en) 2005-02-04
WO1997000326A1 (en) 1997-01-03
AU6018296A (en) 1997-01-15
US6602706B1 (en) 2003-08-05
US6395519B1 (en) 2002-05-28
SI1445322T1 (en) 2010-01-29
EP0833934A1 (en) 1998-04-08
DE69638058D1 (en) 2009-11-26
ES2231813T5 (en) 2012-12-17
DK0833934T3 (en) 2005-02-07
US20090023196A1 (en) 2009-01-22
ES2231813T3 (en) 2005-05-16
IL122614A0 (en) 1998-08-16
JP4051416B2 (en) 2008-02-27
AU731767B2 (en) 2001-04-05
PT833934E (en) 2005-02-28
SI0833934T1 (en) 2005-02-28
DE69633565D1 (en) 2004-11-11
US20050221492A1 (en) 2005-10-06
CA2222140C (en) 2010-11-23
EP0833934B2 (en) 2012-08-15
JP2006345872A (en) 2006-12-28

Similar Documents

Publication Publication Date Title
US6395519B1 (en) Means and methods for nucleic acid delivery vehicle design and nucleic acid transfer
US7037716B2 (en) Packaging systems for human recombinant adenovirus to be used in gene therapy
AU773005B2 (en) Gene therapy to promote angiogenesis
KR100741247B1 (en) Adenovirus Derived Gene Delivery Vehicles Comprising At least One Element of Adenovirus Type 35
US7270811B2 (en) Serotype of adenovirus and uses thereof
KR100356615B1 (en) Defective Adenovirus Vectors and Their Use in Gene Therapy
CA2378061A1 (en) Packaging systems for human recombinant adenovirus to be used in gene therapy
KR100484441B1 (en) Defective Adenovirus Deactivated IVa2 Gene
AU4437100A (en) Means and methods for nucleic acid transfer
EP1016727A1 (en) Gene therapy to promote angiogenesis.
EP1083229A1 (en) Modified adenoviral vectors for use in gene therapy
AU7560500A (en) Modified adenoviral vectors for use in gene therapy
AU725843B2 (en) Defective adenovirus vectors and use thereof in gene therapy
MXPA99011998A (en) Generation of packaging system for human recombinant adenoviral vectors

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION