MXPA99011998A - Generation of packaging system for human recombinant adenoviral vectors - Google Patents

Abstract

The invention discloses novel means and methods for the generation of adenovirus vector. One method of the invention entails a method for generating an adenovirus vector comprising welding together two nucleic acid molecules whereby said molecules comprise partially overlapping sequences capable of combiningwith each other allowing the generation of a physically linked nucleic acid comprising at least two functional adenovirus inverted terminal repeats, a functional encapsulation signal and a nucleic acid of interest or functional parts, derivatives and/or analogues thereof. The invention further discloses nucleic acid molecules for generation adenovirus vectors.

Description

PACKAGING SYSTEMS FOR HUMAN RECOMBINANT ADENOVIRUS TO BE USED IN GENE THERAPY DESCRIPTION OF THE INVENTION The invention relates to the field of recombinant DNA technology, more particularly with the field of gene therapy. In particular, the invention relates to gene therapy using adenovirus-derived materials, in particular human recombinant adenovirus. It is especially related to novel virus-derived vectors and novel packaged cell lines for adenovirus-based vectors. Gene therapy has recently developed the concept for which a wide range of modifications can be and have been considered. In gene therapy, a molecule is introduced that presents genetic information within some or all of the cells of a host, as a result of which the genetic information is added to the host in a functional format. Treatment of genetic disorders is included by providing genetic information to supplement a protein or other substance which, because of the genetic disorder, is not present or is present at least in sufficient quantities in the host, the treatment of tumors and (other ) Acquired diseases such as diseases REF: 32351 . * 5¡ &iK £? Yes Ie, - (self) immune or infections, or other processes. The aggregated genetic information may be a gene or a derivative of a gene, such as a cDNA, which codes for a protein. In this case, the functional format means that the protein can be expressed by the machinery of the host cell. The genetic information may also be a nucleotide sequence complementary to a nucleotide sequence (either DNA or RNA) present in the host cell. In this case, the functional format is that in which the aggregated DNA molecule (nucleic acid) or copies made from it in itself are capable of base pairing with the complementary sequence present in the host cell. Therefore, there are basically three different solutions in gene therapy, one aimed at compensating for a deficiency present in a (mammalian) cell, - the second directed towards the removal or elimination of unwanted substances (organisms or cells), and the third directed towards the application of a recombinant vaccine (tumors or foreign microorganisms). For the purpose of gene therapy, adenoviruses exhibiting deletions have been proposed as suitable vehicles. Adenoviruses are non-enveloped DNA viruses. Adenovirus-derived gene transfer vectors (so-called adenoviral vectors) have numerous characteristics that make them particularly useful for gene transfer for such purposes. For example, the biology of adenoviruses is characterized in detail, adenoviruses are not associated with severe human disease, the virus is extremely efficient in introducing its DNA into the host cell, the virus can infect a wide variety of cells and has a range When the host population is large, the virus can be produced in large quantities with relative ease, and the replication defective virus can be returned by deletions in the early 1 (El) region of the viral genome. The adenovirus genome (Ad) is a linear, double-stranded DNA molecule of approximately 36,000 base pairs with the 55 kDa terminal protein covalently linked to the terminal part 51 of each chain. Ad DNA contains identical inverted terminal repeat (ITR) sequences of approximately 100 base pairs, the exact length depends on the serotype. Viral replication origins are located within the ITRs exactly where the genome ends. DNA synthesis occurs in two stages. First, replication proceeds by chain shift, generating a daughter duplex molecule and a parent displaced chain. The displaced chain is a single chain and can form what is called a "handle and pan" intermediary, which allows the initiation of replication and the generation of a daughter duplex molecule. Alternatively, replication can vary from both ends of the genome simultaneously, eliminating the requirement to form the pan handle structure. In Figure 14 the replication is summarized, adapted from Lechner et al, (1977) J. Mol. Biol. 174: 493-510. During the productive infection cycle, viral genes are expressed in two phases: the early phase, which is the period until viral DNA replication, and the late phase, which coincides with the start of viral DNA replication. During the early phase, only the early products of the gene, encoded by the El, E2, E3 and E4 regions, are expressed, which carry out numerous functions that prepare the cell for the synthesis of viral structural proteins (Berk, AJ (1986) Ann. Rev. Genet. 20: 45-79). During the late phase, the late products of the viral gene are expressed in addition to the products of the early gene, and the DNA of the host cell is inactivated as well as protein synthesis. Consequently, the cell is engaged in the production of viral DNA and viral structural proteins (Tooze, J. (1981) DNA Tumor Viruses (revised) Cold Spring Harbor Laboratory. Cold Spring Harbor,? Ew York. The El region of the adenovirus is the first region of the adenovirus expressed after infection of the target cell. This region consists of two transcriptional units, the E1A and E1B genes, both of which are necessary for the oncogenic transformation of primary (embryonic) rodent cultures. The main functions of the ElA gene products are to introduce cells at rest to enter the cell cycle and summarize the cellular synthesis of DNA, and to activate transcriptionally the E1B gene and other early regions (E2, E3 and E4) of the viral genome . Transfection of the primary cells with the ElA gene alone can induce unlimited proliferation (immortalization), but does not result in a complete transformation. However, the expression of ElA in most cases results in the induction of programmed cell death (apoptosis) and only occasionally immortalization is obtained (Jochemsen et al (19987) EMBO J. 6: 3399-3405). The co-expression of the E1B gene is required to avoid the induction of apoptosis and to produce a complete morphological transformation. In established immortal cell lines, high level expression of ElA can cause a complete transformation in the absence of E1B (Roberts et al, (1985) J. Virol. 56: 404-413). The proteins encoded by E1B help ElA in redirecting cellular functions to allow viral replication. E1B proteins of 55 kD and E4 of 33 kD, which form a complex that are located essentially in the nucleus, work to inhibit the synthesis of host proteins and facilitate the expression of viral genes. Its main influence is to establish a selective transport of viral mRNAs from the nucleus to the cytoplasm, concomitantly with the initiation ^^ - ^ M ^., - ^ * ^^ of the late phase of the infection. The ElB 21 kD protein is important for a correct temporal control of the productive infection cycle, so avoid the premature death of the host cell before the life cycle of the virus has been completed. Mutant viruses unable to express the ElB 21 kD gene product show a shortened infection cycle that is accompanied by excessive degradation of the host cell chromosomal DNA (deg phenotype) and an increased cytopathic effect (cyt phenotype) (Telling et al. , (1994) J. Virol 68: 541-7). The deg and cyt phenotypes are suppressed when, in addition, the ElA gene is mutated, indicating that these phenotypes are a function of ElA (White et al, (1988) J. Virol. 62: 3445-3454). In addition, the ElB protein of 21 kDa shows a decrease in the speed by which ElA activates the other viral genes. It is not known yet which 21KD ElB mechanisms interrupt these dependent functions of ElA. Vectors derived from human adenovirus, in which at least the El region has been deleted and replaced by a gene of interest, have been extensively used for gene therapy experiments in the preclinical and clinical phases, and all the adenoviral vectors currently used in gene therapy present a deletion in the El region, where novel genetic information can be introduced. The suppression The replication of the recombinant virus becomes defective (Stratford-Perricaudet et al, (1991) pp. 51-61, in O. Cohen-Adenaur, and M. Boiron (Eds): Human Gene Transfer, John Libbey Eurotext). In contrast to, for example, retroviruses, adenoviruses are not integrated into the genome of the host cell, are capable of infecting non-dividing cells and are capable of efficiently transferring recombinant genes in vivo (Brody et al, (1994) Ann NY Acad. Sci. 716: 90-101). These characteristics make attractive candidate adenoviruses for the transfer of genes in vivo from, for example, suicide or cytokine genes within tumor cells. However, a problem associated with the current technology of recombinant adenoviruses is the possibility of unwanted generation of adenovirus capable of replicating (RCA) during the production of recombinant adenoviruses (Lochmüller et al (1994) Hum. Gene Ther. 5: 1485 -1492; Imler et al, (1996) Gene Ther. 3: 75-84). This is caused by homologous recombination between superimposed sequences of the recombinant vector and the adenovirus constructs present in the complementary cell line, such as 293 cells (Graham et al, (1977) J. Gen. Virol. 36: 59-72) . The RCAs in lots that are going to be used in clinical trials are undesirable because the RCAs will: i) replicate in an uncontrolled manner; ii) can complement recombinant adenoviruses defective in their replication, which causes an uncontrolled multiplication of the recombinant adenovirus; and iii) batches containing RCA induce significant tissue damage and therefore strong pathological side effects during the production of recombinant adenoviruses (Lochmüller et al (1994) Hum. Gene Ther.5: 1485-1492). Therefore, the batches to be used in clinical trials should be tested and be free of RCA (Ostrove, J. M. (1994) Cancer Gene Ther. 1: 125-131). One of the additional problems associated with the use of recombinant adenoviral vectors is the host defense reaction against adenovirus treatment. Briefly, the recombinant adenoviruses are deleted in the El region (see above). Adenovirus El products activate the transcription of other early genes (E2, E3, E4), which consequently activate the expression of late viral genes. Therefore, it is generally considered that the vectors lacking El do not express any other adenoviral gene. However, it has recently been shown that some cell types are capable of expressing adenoviral genes in the absence of the El sequence. This indicates that some cell types possess the machinery to activate the transcription of adenoviral genes. In particular, it has been shown that such cells synthesize E2A and late adenoviral proteins. In a gene therapy setting, this means that the transfer of the therapeutic recombinant gene to somatic cells not only results in the expression of the therapeutic protein but also results in the synthesis of viral proteins. Cells that express adenoviral proteins are recognized and inactivated by cytotoxic T lymphocytes, both of which eradicate transduced cells and cause inflammation (Bout et al, 5 (1994a) Gene Therapy 1: 385-394; Engelhardt et al, (1993) Human Gene Therapy 4: 759-769; Simón et al, (1993) Human Gene Therapy 4: 771-780). Since this adverse reaction prevents gene therapy, various solutions to this problem have been suggested, such as the use of immunosuppressive agents after treatment, retention of the E3 region of the adenovirus in the recombinant vector (see patent application EP 952022 IB) or use of ts mutants of human adenovirus, which have a mutation site in the E2A region (WO / 28938 patent) . However, these strategies to surround or avoid the immune response have their limitations. The use of mutant recombinant adenovirus ts decreases the immune response to some extent, but is less effective in preventing pathological responses in the lungs (Engelhardt et al, (1994a) Human Gene Ther 5: 1217-1229). The E2A protein can It induces an immune response in itself and plays a fundamental role in the change to the synthesis of late adenoviral proteins. Therefore, it is attractive to produce recombinant adenoviruses which are mutated in the E2 region, making them sensitive to temperature (ts), as has been claimed in patent application WO / 28938. A major drawback of this system is the fact that, although the E2 protein is unstable at an impermissible temperature, the immunogenic protein is still synthesized. In addition, it is expected that the unstable protein activates the delayed expression of genes, although to a lesser degree. Recombinant tsl25 mutant adenoviruses have been tested and a prolonged expression of recombinant genes has been reported (Yang et al, (1994b) Nat Genet 7: 362-369; Engelhardt et al., (1994a) Hum. Gene Ther. 5: 1217- 1229, Engelhardt et al, (1994b) Proc. Nati, Acad Sci USA 91: 6196-200, Yang et al, (1995) J. Virol. 69: 2004-2015). However, the pathology in the lungs of cotton rats is still high (Engelhardt et al, (1994a) Human Gene Ther 5: 1217-1229), indicating that the use of ts mutants results only in a partial improvement in the recombinant adenovirus technology. Other researchers Fang et al, (1996) Gene Ther. 3: 217-222) do not observe prolonged gene expression in mice and dogs using the recombinant adenovirue tsl25. An additional difficulty associated with the use of tsl25 mutant adenoviruses is that a high frequency of reversion is observed. These reverted strains are real reverts or the result of mutations in a second site (Kruijer et al, (1983) Virology 124: 425-433; Nicolás et al, (1981) Virology 108: 521-524). Both types of reverse strains have an E2A protein that functions at normal temperature and therefore has toxicity similar to that of the wild type virus. The recombinant adenoviruses deleted in El are usually made by one of the following methods. In the first method, the DNA of the adenovirus, either of the wild type (wt) or in which El and / or E3 has been deleted, is digested with a restriction enzyme, for example Clal, to remove the left ITR, the packaging signal and at least part of the sequence El and the remnant fragment of the adenoviral genome (1) is purified. The cotransfection of (1) with a linearized adapter construction (2) containing the left ITR, the packaging signal, an expression cassette with the gene of interest and adenoviral sequences that overlap with (1) a cell line that complements the functions of El (packaging cell line) gives rise to recombinant adenoviral particles by intracellular homologous recombination. Alternatively, an adapter construct (3) containing the left ITR, the packaging signal and an expression cassette with the gene of interest can be ligated to an adenoviral DNA fragment (1) followed by transfection in packed cells. The disadvantage of these methods is that the purification of (1) is laborious and that the incomplete digestion of the wt DNA results in the introduction of wt adenovirus into the culture which leads to contamination. One solution to solve this problem has been the construction of the pHBGlO clone described by Bett et al, (1994) Nati. Acad. Sci. USA 91: 8802-8806. This plasmid clone contains Ad5 sequences with a deletion of the packaging signal and part of the El region and with the viral ITRs bound together. Nevertheless, this clone comprises adenoviral sequences that are also present in cell lines that complement El, including those of the present invention (see EP 95201611.1). Furthermore, since the ITRs are linked together, the clone can not be linearized, resulting in a less efficient recombination with the replacement plasmid El. In the second method, the recombinant adenoviruses are constructed either by homologous recombination in bacteria (Chartier et al, (1996), J. Virol. 70,? O. 7: 4805-4810; Crouzet et al, (1997) Proc. Nati Acad Sci USA 94: 1414-1419) or by cosmid vectors (Fu et al, (1997) Hum, Gene Ther 8: 1321-1330) and subsequent transfection in the line of complementary cells of El. The disadvantage of this method is which requires an extensive analysis of each generated clone ("35 kb) by digestion with restriction enzymes before transfection to exclude eupressions that have been produced due to recombination in the bacterium.In addition, the use of cloned adenovirus sequences does not resolve the problem of sequence overlap between commonly used packed cells and recombinant virue which leads to the production of RCA during propagation.

A third method is one in which a two-step gene replacement technique is used in yeast, starting with a complete adenovirus genome (Ad2, Ketner et al, (1994) Proc. Nati. Acad. Sci. USA 91: 6186-6190) cloned 5 into an artificial yeast chromosome (YAC) and a plasmid containing adenosequences to target a specific region in the YAC clone, an expression cassette for the gene of interest and a positive and negative selectable marker. This method requires yeast technology and an extensive analysis of each new recombinant clone (even more problematic than the method described above, due to the large size of the YAC). A fourth method uses a coemido clone (pAdexlw; Miyake et al, (1996) Medical Sciences 93: 1320-1324) which brings the Ad5 sequence with deletions in the sequence El and E3. Eeta clone has a unique restriction site that replaces part of the region that allows the insertion of a cassette of foreign expression. For the generation of recombinant adenovirus, a DNA-protein complex terminal (DNA-TPC) of infected cells is isolated with a adenovirus capable of replicating Ad-dlX (wt Ad5 with a Zbal eupreeon in the E3 region). This DNA is digested with EcoT221 to remove the 5 'part of the DNA and is cotransfected with the cosmid cloned in the complementary cells of El. Intracear recombination generates the recombinant virus (Miyake et al, (1996) Medical Sciences 93: 1320-1324). This method has the disadvantage Jfc * - .. ^^ A ^^ M ^ l ^ ^^ that replicating viral DNA is used and that the deletion in the cosmid clone is not enough to remove all the overlap with the currently used sequences in the packaging cell lines including those used in the present invention. Therefore, current methods for generating RCA-free recombinant adenovirue have several disadvantages, including the risk of introducing wild-type virus into the culture, ineligibility of cloned adenovirus sequences, the need to verify the entire recombinant clone of "35 kb per restriction analysis for each new virus that is generated, and the seventh one is only suitable for recombinant adenoviruses suppressed in El and much more useful for use with recombinant adenovirue that comprises E3 substitutions.In addition, despite the use of adenovirus DNA cloning in any of the methods, extensive overlap with adenocarid sequence in packaging cells commonly used as cell 293 and 911 does not solve the problem of RCA appearance due to homologous recombination during virus propagation. by method and means to produce recombinant adenoviral preparations l RCA fibers that revert the disadvantages of the prior art methods and the means discussed above. The addition of genee is currently by far the most widely applied gene therapy technique. This is mainly due to the fact that: a) homologous recombination is very inefficient, and b) for homologous recombination, relatively large fragments of DNA are required for which suitable vectors of vectors are not available. Therefore, there is currently a need not met by vector systems that efficiently introduce large nucleic acid molecules into the cells of mammals. Recombinant adenoviruses are capable of efficiently transferring recombinant genes to rat liver and the airway epithelium of rhesus monkeys (Bout et al, (1994b) Human Gene Therpay 5: 3-10; Bout et al, (1994a) Gene Therapy 1: 385-394). In addition, (Vincent et al, (1996) J. Neurosurg 85: 648-654; Vincent et al, (1996b) Hum. Gene Ther.7: 197-205) and other investigators (see for example Haddada et al, (1993 ) Hum, Gene Ther 4: 703-11) have observed an efficient adenovirus-mediated gene transfer in vivo to diversify tumor cells in vi tro and in solid tumors in animal models (lung and glioma tumors) and human xenografts in mice immunodeficient (lung) in vivo (reversed by Blaese et al., Cancer Gene Ther. 2: 291-297). The generation of minimal adenoviral vectors has been described in WO 94/12649. The method described exploits the function of protein IX for the packaging of minimal adenoviral vectors (pseudo-adenoviral vectors (PAV) in the terminology of WO 94/12649). The PAVs are produced by cloning an expression plasmid with the gene of interest between the left adenoviral ITRs (which includes the sequences required for encapsulation) and the right ones. PAVs propagate in preference to an auxiliary virus. The formation of PAV capsid compared to helper virus is preferred because the helper virus is partially defective for packaging (either by virtue of mutations in the packaging signal or by virtue of its size (viral genomes greater than 37.5). kb are packaged inefficiently)). In addition, the authors propose that, in the absence of the gene for protein IX, the PAV will be packaged preferentially. However, none of these mechanisms seems to be specific enough to allow the packing of only the PAV / vectoree mínimum. The mutations in the packaging signal decrease packaging, but do not provide absolute blockage as the packaging activity is required to propagate the helper virus. Furthermore, neither an increase in the size of the helper virus nor a mutation of the protein IX gene will ensure that PAV is exclusively packaged. Therefore, the method described in WO 94/12649 is unlikely to be useful for the production of concentrate and free of minimal adenoviral vector / PAV vectors. Novel compositions and methods are provided for producing recombinant adenoviruses, not only lacking El, but also minimal adenoviruses which are free of adenovirus capable of replication. The compositions include adequate construction for the generation of double infection virue. The system provided by the invention for generating, e.g., El euprimide adenovirus, consists of two nucleic acid molecules of which the first is a relatively small and easy-to-handle adapter plasmid that contains at least, in an operable configuration, the Left ITR, the packaging signal, it is desired an expression cap with the nucleic acid molecule of interest and sequences homologous to a part of a second molecule comprising at least one nucleic acid molecule that is partially eperposed, comprising at least the right ITR and preferably also comprising adenovirus sequences encoding adenoviral capsid protein; and the packaging cells of the invention described above. The cotransfection of talee nucleic acid molecule in the packed cells allows the binding of the nucleic acid molecules preferably through, essentially, a homologous recombination between the overlapping sequences in the nucleic acid molecules. Homologous recombination generates a recombinant viral DNA that is capable of replicating and propagating on the packed cells. The nucleic acid molecules preferably do not have sequences that overlap with the complementary sequences in the packaging of cells that can lead to the formation of adenovirus capacee to replicate (RCA). Preferably, at least one of the ITRs on the nucleic acid molecules is flanked by a restriction enzyme recognition cycle that is not present in the adenoviral sequences 5 so that the ITR can become essentially free of the vector sequences by digestion of the DNA with the restriction enzyme. In this way, the start of replication occurs in the most efficient manner. The system that is provided by the present invention also greatly facilitates measure the production of RCA-free recombinant adenoviruses with further modifications in the adenoviral genome, including but not limited to modifications in the coding regions for proteins of the E4 region, exon, pentone or protein proteins of fibers or E2A protein. The following modalities must be understood to be read in light of the combination of the adapter plasmid and the large nucleic acid to be bound thereto. In one aspect of the invention, the problem with the The production of RCA is solved to the extent that we have developed packaging cells that do not have sequences that overlap with a new basic vector and are therefore suitable for production at a large scale, thus, of recombinant adenovirue.

Mmt-mm ^ - *** - **! * ^ Another aspect of the present invention therefore is the suppression of sequences encoding E2A from the recombinant adenoviral genome and transfecting this sequence of E2A in the line of E2A. Cells (from packaging) containing the sequence to complement vectored recombinant adenovirals. The main drawbacks in this solution are: a) that E2A must be expressed at very high levels, and b) that the E2A protein is very toxic to cells. The present invention, in yet another aspect therefore discloses the use of the mutant E2A gene tsl25, which produces a protein that is not capable of uniree to DNA sequences at the non-permissive temperature. It can maintain high levels of this protein in the cells (because it is not toxic at this temperature) that makes the change to the permieiva temperature. This can be combined with the placement of the mutant E2A gene under the direction of an inducible promoter, such as for example tet, metallothionein, heteroloid inducible promoter, retinoic acid β receptor or other inducible eistemae. However, in another additional aspect of the invention, the use of an inducible promoter to control the time of production of toxic wild-type E2A is described. Two outstanding additional advantages of recombinant adenovirus with E2A suppressed are the capacity a & j m & z -fa¡¡a > increased host of heterologous sequences and permanent selection by cells expressing mutant E2A. This second advantage is related to the high frequency of revelation of tsl25 mutation: when reversion occurs in a cell line that houses E2A tsl25, this will be deadly for the cell. Therefore, there is a permanent selection for those cells that express the mutant E2A protein tsl25. In addition, since we in one aspect of the invention generate recombinant adenoviruses deleted from E2A, we now have no problem in reversion in our adenoviruses. In a further aspect of the invention, as a further improvement, the use of non-human cell lines as packaging cell lines is described. For the production of GMP from clinical batches of recombinant viruses it is desirable to use a cell line that has been widely used for the production of other biotechnology products. Most of these last cell lines are of monkey origin, which have been used to produce, for example, vaccines. These cells can not be used directly for the production of recombinant human adenovirue, since the human adenovirus can not replicate in monoequine cells or only replicates at low levels. A blockage in the change from early to late fae of the adenovirus lytic cycle underlies defective replication. However, lae mutations of the host (hr) in the human adenovirue genome have been described (hr400-404) which allows the replication of human virus in monkey cells. These mutations reside in the gene that codes for the E2A protein (Klessig et al, (1979) Cell 17: 957-966; Klessig et al, (1984) Virus Res. 1: 169-188; Rice et al, (1985) J. Virol. 56: 767-778) (Klessig et al, (1984) Virus Res. 1: 169-188). In addition, mutant viruses harboring both hr and senescent phenotypes have been described at tel25 (Brough et al, (1985) J. 0 Virol 55, 206-212; Rice et al, (1985) J. Virol. : 767-778). Therefore, we generate line of packaging cells from mono origin (for example VERO, CV1) that house: a) sequences that allow the replication of defective adenovirus in E1 / E2, and 5 b) E2A sequences, which contain the hr mutation and the tel25 mutation termed te400 (Brough et al, (1985) J. Virol. 55: 206-212; Rice et al., (1985) J. Virol. 56: 767-778 to prevent cell death by eobreexpreeion of E2A, and / or c) E2A sequences, which only contain the 0 hr mutation, under the control of an inducible promoter, and / or e) E2A sequences, which contain the mutation hr and the mutation tsl25 (ts400), under the control of an inducible promoter. In addition, we describe the construction of 5 novelty and improved combinations of packaging cell lines S £ ^ ^^^ j £ S ^^ (novel and improved) and recombinant adenoviral vectors (novel and improved). We provide: 1) A novel line of packaging cells derived from embryonic embryonic human diploidy (HER) retinoblasts that harbor nt.80-5788 of the Ad5 genome. Eeta cell line, designated 911, has been deposited under number 95062101 in the ECACC, and has many characteristics that make it superior to the 293 commonly used cell 10 (Fallaux et al, (1996) Hum. Gene Ther.7: 215 -222). 2) Line novel packaging cells that express only the ElA genes but not the ElB genes. The established cell lines (and not the diploid humane cells from which the 293 and 911 cells are derived) are capacee of expressing ElA at high levels without experiencing apoptotic cell death, as occurs in human diploid cells that express ElA in the absence of ElB. Such cell lines are capable of transcomplementing defective recombinant adenoviruses in ElB, because the virus mutated for The 21 kD ElB protein is capable of completing viral replication even faster than wild type adenoviruses (Telling et al, (1994), J. Virol. 68: 541-7). The constructions are described in detail in the following, and are represented graphically in Figures 1 to 5. The constructions are transfected into different cell lines eetablecidas and i ^ ______________ ^ ___ ^ ___ i elect for high expression of ElA. This is accomplished by operably linking a selectable marker gene (eg, the NEO gene) directly to the ElB promoter. The ElB promoter is transcriptionally activated by the ElA gene product and therefore the resistance to the selective agent (for example, it uses G418 in the NEO case as the selection marker), which results in a direct selection by the expired statement by the ElA gene. 3) Lae packaging constructs that are mutated or euprimen for ElB of 21 kD, but that express only the protein of 55 kD. 4) The packaging constructs to be used for online generation of complementary packaging cells from diploid cells (not exclusively of human origin) without the need for selection with marker genes. These cells are immortalized by ElA expression. However, in this particular case, the expression of ElB is essential to avoid apoptosis induced by ElA proteins. The selection of cells expressing ee is obtained by selection of focus formation (immortalization), as described for 293 cells (Graham et al, (1977) J. Gen. Virol. 36: 59-72) and 911 cells (Fallaux). et al, (1996) Hum. Gene Ther.1: 215-222), which are human embryonic kidney (HEK) cells transformed with El and human embryonic retinoblaetoe (HER), respectively.

) After the transfection of the HER cells with the connection pIG.ElA.ElB (figure 4), ee can establish seven independent cell lines. These cell lines are called PER.C1, PER.C3, PER.C4, PER.C5, PER.C6, PER.C8 and PER.C9. PER denotes PGK-El-retinoblastoe. Eetae lineae cellularee expresses proteins ElA and ElB, are stable (for example PER.C6 for more than 57 paeajee) and complement adenoviral vectors lacking El. The yields of recombinant adenoviruses obtained in PER cells are slightly higher than those obtained in 293 cells. One of these cell lines (PER.C6) has been deposited with the ECACC under the number 96022940. 6) Vectoree adenoviralee newe which extend the deletions El (deletion nt .459-3510). These viral vectors lack the sequences homologous to the El sequences in the packaging cell lines. These adenoviral vectors contain the promoter sequence pIX and the pIX gene, such as pIX (from their natural promoter sequences) and can only be expressed from the vector and not by packaging cells (Mateui et al, (1986) Mol. Cell Biol 6: 4149-4154, Hoeben and Fallaux, pers. Comm.; I ler et al, (1996) Gene Ther. 3: 75-84). 7) Lines of packaging cells expressing E2A are preferably already found in established cell lines expressing ElA or diploid cells expressing ElA + ElB (see base 2-4). The expression of E2A is under the control of either an inducible promoter or the E2A mutant tsl25 can be activated either by an inducible promoter or by a constitutive promoter. 5 8) Recombinant adenoviral vectors as they are described antee (see section 6) but which present an additional deletion of the E2A sequences. 9) Adenovirue packaging cell of monkey origin which is capable of transcomplementing adenovirus or recombinant defective in El. They are preferably cotransfected with pIG.ElA.ElB and pIG.NEO, and are selected for NEO reagent. Such cells expressing ElA and ElB are able to tranecomplement recombinant human adenovirus lacking El, but will do so inefficiently due to a blockade of the synthesis of late adenoviral proteins in cells of monkey origin (Kleseig et al, (1979). ) Cell 17: 957-966). To solve this problem, generate recombinant adenoviruee harboring a host-ranging mutation in the E2A gene, which allows human adenoviruses to replicate in monkey cells. Talee virue are generated as described in Figure 12, except DNA from a hr mutant that is used for homologous recombination. 10) Adenovirus packaging cells of monkey origin as described under subsection 9, except that they are also 5 cotransfected with E2A sequences harboring the hr mutation.

This allows the replication of human adenoviruses lacking El and E2A (see below under 8). In these cell lines, E2A is under the control of an inducible promoter or the mutant tsE2A is used. In this last case, 5 the E2A gene will carry both the ts mutation and the hr mutation (derived from ts400). Human replication-capable adenoviruses harboring both mutations have been described (Brough et al, J. Virol 55: 206-212, Rice et al, (1985) J. Virol 56: 767-778). In addition, the present invention in one aspect provides new cosmid and plamidid vectors containing large fragments of the adenovirus genome and an improved method for the generation of recombinant adenoviral vectors by using eetae eecuenciae adenoviralee cloned. Accordingly, the present invention provides a novel system for generating recombinant adenoviruses that is fast, highly flexible, reliable and requires only standard cloning technology. The new system is It is eminently efficient to generate recombinant adenoviruses. In combination with the packaging cells of the invention, it ensures a free generation of RCA and a propagation of recombinant adenovirus. The problem is indicated above, associated with current methods for generating recombinant adenovirus are resolved in one aspect by the ^^ rTffs. ^ t t ^ f ^ yc ^ t? r ^ r ^ ... f use of a functional combination of cloned adenoviral sequences and an intracellular homologous recombination in suitable packaging cells. Accordingly, the present invention provides methods and a means to efficiently generate and produce vectors that are capable of harboring very large fragments of (genomic) DNA. The vectors of the invention can be produced in a manner with very high titer and are capable of transducing mammalian cells, including human cells, with high efficiency, thus favoring homologous recombination with DNA (genomic) molecules present in the cells. mammalian cells, due to the high numbers of introduced DNA molecules and their large counterparts overlapping with the target DNA molecules for recombination. In one embodiment, the vectors according to the invention are based on adenoviral vectors derived from an adenoviral genome, from which it is deleted as much as possible from the adenoviral genome except for the ITR sequences and the sequences necessary for packaging (vectors). minimal adenovirals). Such vectors can accommodate up to 38 kb of foreign (genomic) DNA. Minimal adenoviral vectors with large genomic sequences function as gene replacement vectors that can be efficiently generated using the plasmid-based intracellular PCR enzyme described infra, P? Í. Its jü & a so it avoids the need for polluting auxiliary viruses. In addition, we describe an alternative way to produce minimal adenoviral vectors and the need for helper viruses. Replication and packaging of the minimal adenoviral vectors with large inserts can also be obtained by using them in combination with a complementary molecule that contains all the parts of the adenoviral genome that are required for replication and packaging except for the packaging signal and the sequences. . Such a complementary molecule is not necessarily replicated by virtue of the adenoviral replication machinery. For example, it can be cloned into a plamid that also contains the SV40 origin of replication. Transfection of this DNA with the minimal adenoviral vector in a packaging cell containing El that also expresses (inducibly) the SV40 large T protein will lead to the replication of the adenoviral molecule and the expression of adenoviral proteins. Eetae ultimae deepuée initiate the replication and packaging of the minimal adenoviral vectors. A further aspect of the invention provides adenoviral vectors improved in some other way, as well as novel strategies for the generation and application of such vectors and a method for the intracellular amplification of linear DNA fragments in mammalian cells.

What are called "minimal" adenoviral vectors according to the present invention retain at least a portion of the viral genome that is required for encapsulation of the virus particle genome (the encapsulation signal) as well as at least a copy of the virus. Less than a functional part or a derivative of the inverted terminal repeated sequence (ITR), which are DNA sequences derived from the lae partee of the linear adenoviral genome. Vectors according to the present invention typically also contain a transgene linked to a promoter sequence to control expression of the tranegene. The packaging of what is called a minimal adenoviral vector can be obtained by co-infection with an auxiliary virus or, alternatively, with an inadequate replicating auxiliary system in packaging, as described below. DNA fragments derived from adenoviruses that can replicate in suitable cell lines that can eervir as an auxiliary eietemae of replication deficient packaging and ee generate as follows. These DNA fragments retain at least a portion of the transcribed region of the "late" tranectric unit of the adenovirue genome and pre-suppress deletions in at least a portion of the El region and deletions in at least a portion of the signal of encapsulation. In addition, this DNA fragments contain at least one copy of an inverted terminal repeat sequence (ITR). An ITR is located in a terminal part of the transfected DNA molecule. The other end may contain an ITR, or alternatively, a DNA sequence that is complementary to a portion of the same chain of the DNA molecule other than ITR. In the latter case, if the two complementary sequences are reattached, the 3'-free hydroxyl group of the terminal 3 'nucleotide of the hairpin structure can serve as a primer for the synthesis of DNA by cellular DNA polymerases and / or encoded by adenovirus, resulting in the conversion into a double-stranded form of at least a portion of the DNA molecule. An additional replication that starts in the ITR will result in a linear double-stranded DNA molecule, which is flanked by ITR and larger than the original trane-infected DNA molecule (see Figure 13). Eeta molecule can replicate in the same cell in the tranefected cell by virtue of the adenoviral proteins encoded by the DNA molecule and the adenoviral and cellular proteins encoded by the genes in the genome of the host cell. This DNA molecule can not be encapsulated due to its large size (greater than 39,000 paree de baeee) and / or due to the absence of a functional encapsulation signal. It is intended that this DNA molecule serve as an auxiliary for the production of defective adenoviral vectors in suitable cell lines. The invention also comprises a method for the amplification of linear DNA fragments of variable size in suitable mammalian cells. These DNA fragments contain at least one copy of the ITR in one of the terminal portions of the fragment. As described above, the other end may contain an ITR, or alternatively a DNA sequence that is complementary to a portion of the same chain and the DNA molecule other than the ITR. In the latter case, if the sequence is supplemented, the free 3'-hydroxyl group of the terminal 3 'nucleotide of the hairpin structure can serve as a primer for the synthesis of DNA by cellular DNA polymerases and / or encoded by DNA. adenovirus, which results in the conversion of the displaced chain to a double-stranded form of at least a portion of the DNA molecule. A further initiation of replication in the ITR will result in a double-stranded linear DNA molecule that is flanked by ITR, which is larger than the original transfected DNA molecule. A DNA molecule containing the ITR sequence in both ends can replicate itself in transfected cells by virtue of the presence of at least the adenoviral E2 proteins (specifically the DNA-binding protein (DBP) and the adenoviral DNA polymerase) ( Ad-pol) and the preterminal protein (pTP)). The required proteins can be expressed from adenoviralee genes in the DNA molecule itself, from E2 genes of adenovirue in the genome of the huéeped cell, or from a replicating helper fragment as ee described above. Several groups have shown that the preemption of ITR sequences at the end of the DNA molecule are sufficient to generate adenoviral minichromosomae that can replicate if the adenoviral proteins required for their replication are provided in a trance, for example by infection with an auxiliary virus. (Hu et al, (1992) Gene 110: 145-150); (Wang et al, (1985) in vivo, Nucí Acids Res. 13: 5173-5187); Hay et al, (1984) J. Mol. Biol. 174: 493-510). Hu et al, (1992) Gene 110: 145-150, observed the presence of replication of symmetric adenoviral microsome dimers after tranefection of the plasmids containing a single ITR. The authors were able to demonstrate that these minichromosomae dimeric eurgen deepuée from the tail to tail ligation of DNA molecule of an ITR Iolo. The DNA extracted from particle adenocarcin defective type 2, have also obeyed dimeric molecules of various sizes using electron microscopy (Daniell (1976) J. Virol. 19: 685-708). It has been suggested that incomplete genomes are formed by illegitimate recombination between different molecules and that the variance in the position of the sequence in which the match of illegitimate baee occurs is responsible for the heterogeneous nature of incomplete genomes. On the basis of this mechanism, it is speculated that, in theory, defective molecules with a total length of up to twice the normal genome can be generated. Such molecules may contain duplicate sequences from either end of the genome. However, DNA molecules larger than the full length of the virus packaged in defective particles have not been found (Daniell (1976) J. Virol 19: 685-708) This can be explained by the size limitations that apply to the In addition, it has been observed that in virus particles, the DNA molecules with a left and duplicated end predominate on those containing a terminal part of the right end (Daniell (1976) J. Virol. 19: 685-708). This is completely explained by the presence of the encapsulation signal near the left end of the genome (Gráble et al, (1990) J. Virol 64: 2047-2056; Gráble et al, (1992) J. Virol. 66: 723 -731; Hearing et al, (1987) J. Virol 61: 2555-2558) The main problems associated with the active vectors derived from adenovirus are: a) The strong immunogenicity of the viral particle. b) The expression of adenoviral genes that reeiden in the adenoviral vectors, resulting in a response of cytotoxic T cells against the traneduced cells. c) The low amount of heterologous events that can be accommodated in current vectorers (up to a maximum of approximately 8000 bp of heterologous DNA). d) The infrequency and unreliability of methods and a means for the generation of new adenovirus vectors. With respect to A) the strong immunogenicity of the adenovirus particle results in an immunological response of the host, followed by a single administration of the adenoviral vector. As a result of the development of neutralizing antibodies, a subsequent administration of the virus will be less effective or even completely ineffective. However, a prolonged or persistent expression of the transferred genes would reduce the number of administrations required and may eliminate the problem. With respect to B), the experiments carried out by Wilson and collaborators have shown that after adenovirue-mediated gene transfer in immunocompetent animals, the expression of the transgene gradually decreases and appears approximately at 2-4 eemanae subsequent to infection (Yang et al. al, (1994a) Proc. Nati, Acad Sci USA 91: 4407-11, Yang et al, (1994b) Nat. Genet 7: 362-369). This is caused by the development of a response of cytotoxic T cells (CTL) against the traduced cells. CTLs are directed against adenovirus proteins expressed by viral vectors. In the synthesis of traneducted cells of the protein that binds AD? of adenovirus (the product of the E2A gene), ee can establish penton and fiber proteins (gene products) tardioe). These adenoviral proteins encoded by the viral vector are expressed despite deletion of the El region. This demonstrates that the deletion of the El region is not sufficient to completely avoid the expression of the viral gene (Engelhardt et al, (1994a) Human Gene Ther 5: 1217-1229). Regarding C), studies by Graham and colleagues have shown that the adenovirue are able to encapsulate DNA up to 105% of the size of the normal genome (Ben et al, (1993) J. Virol. 67: 5911-5921). The larger genomes tend to be unstable resulting in a loss of DNA sequences during the spread of the virus. Combining supreeiones in the El region and E3 of the viral genomes increases the maximum size of the stranger that can be encapsulated to approximately 8.3 kb. In addition, some eequences of the E4 region seem to be dispensable for virus growth (which adds another 1.8 kb to the maximum encapsulation capacity). In addition, the E2A region ee can be deleted from the vector, when the E2A gene product is provided in trans in the encapsulation cell line, adding another 1.6 kb. However, it is unlikely that the maximum capacity of foreign DNA can be significantly increased in addition to the 12 kb. We develop a new strategy for the generation and production of free concentrates of vector aids ^ ^ ^ ^ ^ ^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ Only two functional ITR sequences, and sequences that can function as an encapsulation signal, need to be part of the vector genome. Talee vectors are called minimum adenovectors. Auxiliary functions for minimal adenovectors are provided in trans by DNA molecules that are replication competent and defective in encapsulation that contain all viral genes that code for the required gene product, with the exception of those genes that are present. in the genome of the host cell, or genes that reside in the genome of the vector. With respect to section D) it is possible to generate a new adenovirus vector with the medium and methods in the prior art. However, the means and methods of the prior art are not very efficient in generating an adenovirus vector and furthermore in the process of generating an adenovirus vector there are many other vectors or even adenoviruses able to replicate, which requires an evaluation deep and elaborate of the viruses generated. This is not a desired characteristic, specifically for clinical installations where the presence of adenovirus capable of replicating is extremely undesirable. In addition, specifically in inelatations where many different adenovirus vectors need to be generated, so as to produce expression libraries in adenovirus vectors, for example for use with high throughput screening or screening, the efficiency and reliability of the vector production systems of adenovirus of the prior art is still inefficient. The reliability of adenoviral vector production is usually measured by determining the number of vectors of independent adenoviruses produced, the number of vectors of independent adenoviruses capable of functionally expressing a nucleic acid of interest or an analogous method capable of determining a value. analog for example in case the vector is not designed to express a nucleic acid of interest. Preferably, at least 80%, preferably at least 90% and much more preferably at least 95% of the adenovirus vectors produced in a method of the invention have functional vectors when they are present in the vector and eon capacee to express the transgene and / or the nucleic acid of interest. The reliability of adenovirus vector production is especially appreciated in applications where many different adenovirue vectors need to be produced in a relatively short time interval. A reliable system for the production of adenovirus vectors can then reduce significantly the time and costs involved. Preferably, the efficiency of adenovirue vector production for an average vector is greater than a vector ^ - ^ ád & L ^ ^, ^^ £ ^ i! *? &&&-Ar-independent produced by 106 cells, more preferably the efficiency is greater than a different vector produced by 2 x 105 cells, most preferably the efficiency is greater than 1 different vector produced by 5 x 10 4 cells . The applications of the described inventions are indicated below and illustrated in the examples.

Use of diploid cells from IG packaging constructions Constructs, in particular pIG.ElA.ElB, will be used to transfect human diploid cells, such as human embryonic retinoblast (HER), human embryonic kidney (HEK) cells and human embryonic lung (HEL) cells. The traefected cells will be selected for transformed phenotype (focus formation) and tested for their ability to support the propagation of recombinant adenovirue suppressed in El, such as IG.Ad.MLPI. IK. Such cell lines will be used for the generation and production (large scale) of recombinant adenovirus deleted in El. Such cells, infected with recombinant adenovirus, are also intended to be used in vivo as a local producer of recombinant adenovirus, for example for the treatment of solid tumors. 911 cells are used for the titration, vector generation and production of recombinant adenoviruses (Fallaux et al, (1996) Hum Gene 7: 215-222). HER cells transfected with pIG.ElA.ElB have resulted in 7 independent clones (termed PER cells). These clones are used for the production of recombinant adenovirue vectors deleted in El (including non-superimposed adenovirus vectors) or defective in El and provide the baee for the introduction of, for example, E2B or E2A constructs (eg tsl25E2A, see below), E4, etc., which will allow the propagation of the venoree of adenovirue that have mutations, for example, in E2A or E4. In addition, the diploid cells of other species that are permieivae for human adenoviruses, talee like the cotton rat (Sigmodon hispidus) (Pacini et al, (1984) J. Infect. Dis. 150: 92-97), the Syrian hamster ( Morin et al, (1987) Proc. Nati, Acad. Sci. USA 84: 4626-4630) or chimpanzee (Levrero et al, (1991) Gene 101: 195-202), will be immortalized with eetae constructions. Such cells, infected with recombinant adenovirus, are also intended to be used in vivo for the local production of recombinant adenovirus, for example, for the treatment of tumoree eolids.

Established cells Constructs, in particular pIG.ElA.NEO, can be used to transfect established cells, for example A549 (human bronchial carcinoma), KB (oral carcinoma), MRC-5 (human diploid lung cell line) or cell lines GLC (small cell lung cancer) by Leij et al, (1985) Cancer Res. 45: 6024-6033; Poetmus et al, (1988) Eur. J. Clin. Oncol. 24: 753-763) and are selected for NEO resistance. Individual colonies of resistant cells are isolated and tested for their ability to support the propagation of recombinant adenovirue euprimido in El, such as IG.Ad.MLPI .TK. When propagation of suppressed viruses is possible on ElA-containing cells, cells can be used for the generation and production of recombinant adenovirus deleted in El. They are also used for the propagation of recombinant adenovirus euprimido in ElA / retained in ElB. The established cells can also be cotransfected with pIG.ElA.ElB and pIG.NEO (or other expreration vector containing NEO). Receptor clones for G418 are tested to determine their ability to support the propagation of recombinant adenoviruses euprimido in El, such as IG.Ad.MLPI .TK and ee used for the generation and production of recombinant adenovirus deleted in El and will be applied in vivo for local production of recombinant virus, as described for diploid cells (see above). All cell lines can be used, including transformed diploid cell lines or NEO-resistant eetablecidae lines, as the basis for the generation of the "next generation" packaging cell lines, which support the propagation of defective recombinant adenoviruses in El, which also present euphoria in another one generates, taze like E2A and E. In addition, they will provide the baeee for the generation of minimal adenovirus vectors as described herein.

Cell lines that express E2 The packaging cells that express E2A sequences are and will be used for the generation and production (at a large scale) of recombinant adenovirus suppressed in E2A. Cell lines baling adenovirue humanae newly generated or cell lines derived from permisivae species for human adenovirus (E2A or tsl25E2A; ElA + E2A; ElA + ELB + E2A; ElA + E2A / tS 125; ElA + ELB + E2A / tel25) or Lineae nonpermissive cells such as monkey cells (hrE2A or hr + tsl25E2A; ElA + hrE2A; ElA + ELB + hrE2A; ElA + hrE2A / tsl25; ElA + ELB + hrE2A / ts 125) used for generating and production (large scale) of recombinant adenovirus vectors deleted in E2A. In addition, they will be applied in vivo for local production of recombinant virus, as described for the diploid celle (see above).

Novel adenovirue vectors The newly delaborated adenovirus vectors harboring a deletion of nt. 459-3510 will be used for gene transfer purposes. These vectors can also be the basis for the development of vectors of additional adenoviruses that have been mutated for, for example, E2A, E2B or E4. Such vectors will be generated, for example, in the newly developed packaging cell lines described above (see 1-3).

Minimum adenovirus packaging system Describe constructs packaged adenovirus (to be used for packaging vectors mínimoe adenovirus) to be preeentar following lae features: a) the construction of packaging replicates b) construction of packaging can not be packaged because has been deleted eeñal baling c) constructing packaging contains a forming sequence internal hairpin (see "Experimental, hairpins suggested" section see figure 15) d) because of the internal hairpin structure, the 5 construction of baling doubles, that is, the DNA of the packaging construct is twice as long as it was before the transfection in the packaging cell (in our model it doubles from 35 kb to 70 kb). This duplication also prevents packing. Note that this duplicate DNA molecule has its ITRs in both parts and ends (see, for example, Figure 13). e) EETA molecule duplicate baling is able to replicate as a DNA molecule "normal adenovirus' f) duplication of the genome is a prerequisite 15 for the production of sufficient nivelee protein adenovirue required to pack the vector minimum adenovirus g ) the packing structure does not have superimposed sequences with the minimum vector or cellularee sequences that can lead to the generation of RCA by homologous recombination. This packing system will be used to produce minimal adenovirus vectors. The advantage of the minimum adenoviral vectoree, for example for gene therapy or for vaccination purposes, well-known (accommodation of jÉfí- "eSiiiaffiS tfgr ~ ¡¡¡^ .g ^ ^ ^ gg ^ ^^^ ^^ a ^ MB6afeaa to¿ifa haeta 38 kb, loe ingestion of all genes potentially toxic and immunogenic adenovirus). The vectors Adenoviruses that contain mutations in genes eeencialee (including venoree of adenovirue 5 minimum) can also be propagated using this system.

Use of intracellular E2 expression vectors Minimal adenovirus vectors are generated using auxiliary functions provided in trans per molecule and replicating auxiliary packaging deficient. The ITR sequences derived from adenoviruses serve as origins of DNA replication in the presence of at least the products of the E2 gene. When the product of the E2 gene is expressed from gene in the vector genome (N.B. the gene or genes must be activated by an El-independent promoter), the vector genome can be replicated in target cells. This will allow a significantly increased number of template molecules in the target cell and, as a result, an increased expression of the genes of interest encoded by the vector. This is of particular interest for gene therapy approaches in cancer. a, ^^^^^^^, ^^ .., ^^ ,, ^ ,, ^^ ^ ^ ^ ^ ^ ihBiMlÉrmrri iriif f Ai ", * Application of intracellular amplification of linear DNA fraamentoe A similar solution can also be acquired in the amplification of linear DNA fragments if desired. DNA fragments of known or unknown sequence can be amplified in cells containing the E2 gene products if at least one ITR sequence is located near or in its terminal part. There are no apparent restrictions on the size of the fragment. Even fragments much larger than the adenovirus genome (36 kb) can be amplified using this approach. Therefore, it is possible to clone large fragments in mammalian cells without having to send the fragment to bacteriae (talee or E. coli) or to use chain reaction of die-cut polymer (P.C.R.). In the final stage of a productive adenoviral infection, one cell may contain more than 100,000 copies of the viral genome. In the optimal situation, linear DNA fragments can be amplified at similar levels. Therefore, one may be able to extract more than 5 jig of DNA fragment per 10 million cells (for a fragment of 35 kbp). This system can be used to express heterologous proteins (equivalent to the COS cell system harbored in Simium 40 virue) for inveetigation or for therapeutic purposes. In addition, the system can be used to identify genes in . i ^ s ^ íÉT ^ • ^ g ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ Random DNA fragments can be amplified (after addition of the ITRs) and can be expressed during intracellular amplification. The choice or selection of that cell with the identified phenotype can be used to enrich the fragment of interest and isolate the gene.

Genetic correction vectors The gene therapy procedures can be divided into two different concepts, that is, gene addition and gene replacement. The gene addition attempts to introduce a therapeutic nucleic acid molecule into eomatic cells of a patient, whereby the expression of the therapeutic nucleic acid molecule is often under the control of a heterologous promoter and a transcription termination signal. For example, when a patient suffers from an inherited disease, a functional copy of the defective nucleic acid molecule responsible for the disease phenotype is introduced into the patient's cells and, upon expression of the therapeutic nucleic acid molecule, is corrected. the phenotype of the disease. Obviously, the gene addition is also used to carry out the expression of genee that are otherwise not expressed, such as, for example, cytokine gene or eukaryotes such as HSV-TK to treat tumors. The gene replacement procedure attempts to repair at least one copy of a defective gene responsible for the disease phenotype. This can be done by introducing a functional version of a gene, a part of which comprises the mutant site of that gene, such that homologous recomtion occurs between the functional version and the defective gene. In this case, the defective gene or its mutant site is replaced by the functional vereión of that gene or part of the member. Thus, there is no nucleic acid material that is foreign to the species to which the patient is a member that is expressing the treated cell but at least one allele of the mutant gene is repaired. For most inherited diseases it is known that heterozygous carriers are not affected, or are affected at least to a lesser extent than a homozygous patient. Therefore, the replacement of genes for correction of inherited disorder can be used. It should be understood that this also includes the repair of gene suppressors of defective tumors. For gene therapy purposes, it is preferable to retain the E3 region. E3 contains vectors that will be superior to their E3 suppressed counterparts because they can prevent or reduce host cell responses such as CTL lysis of adenovirus-infected cells in cell lysis by TNF.

It will be understood that it may not be necessary to retain the entire E3 region in the vectors according to the invention, insofar as the retained part still has the function of reducing the host response against infected cells. For example, the expression of E3-14.7 kD alone may be sufficient to reduce the early response mediated by TNF (see Ginsberg, HS (1989) Proc. Nati. Acad Sci. USA 86: 3823-3827 Ginsberg, HS (1991) Proc. Nati, Acad. Sci. USA 88: 1651-1655). These vectors are useful for gene therapy of inherited diseases such as chemical fibrosie, Duchenne molecular dietrophy, hypercoleterolemia, blood coagulation disorders (hemophilia) and the like. They are also useful in the therapy of acquired diseases, such as tumors, hepatitis, (auto) immune diseases, restenoeis, rheumatoids and the like. The advantage of gene replacement on gene addition includes: (1) regulatory expression of the substitution gene which is identical to the endogenous expression pattern, and (2) the procedure is safe, because there is no risk of mutagenesis by inertiation due to random integration.

A seventh based on recombinant nucleic acid for generation of adenovirus vectors In one aspect, the invention provides a method for generating an adenovirus vector comprising joining two nucleic acid molecules whereby the molecules comprise partially euperposed sequences capable of combining with each other which allows the generation of a physically bound nucleic acid comprising at least doe repeat inverted functional adenovirue terminal sequences, a functional encapsulation signal and a nucleic acid of interest or functional parts, derivatives and / or analogues thereof. Talee nucleic acid molecules, together, comprise at least one left ITR, one right ITR and one adenovirue encapsulation signal or functional parts, derivatives and / or analogs thereof. With overlapping sequence they are meant to mean sequences that comprise sufficient similarity in the nucleic acid sequence to allow homologous recombination. The sequence uniformity is preferably greater than 80% and more preferably greater than 95%. They are also meant to mean complementary ends, for example an enzyme restriction site, where the nucleic acids are joined by hybridization of the complementary ends. Such binding can be performed through any means capable of physically joining doe nucleic acid molecules. Preferably, the binding is performed through complementary end binding which results in digethion with re-restriction enzyme of the nucleic acid molecule. Most preferably, the binding is performed through homologous recombination of sequences superimposed on the nucleic acid. In one embodiment, the invention provides a method for generating an adenovirus vector comprising joining through homologous recombination two nucleic acid molecules comprising partially overlapping eequences wherein the superimposed sequences essentially allow one of the recombination homologues to be which leads to the generation of a physically bound nucleic acid comprising at least two inverted terminal repeat sequences of functional adenoviruses, a functional encapsulation signal and a nucleic acid of functional interest or part, derivatives and / or analogs thereof. In this embodiment of the invention it is very important that the partially overlapping sequences allow that essentially only homologous recombination leads to the generation of a functional adenovirus vector capable of being replicated and packaged in adenovirus particles in the presence of the required transaction functions. By "essentially only one" it is meant that the superimposed sequences in each nucleic acid essentially comprise only one continuous sequence in which the homologous recombination leads to the generation of a functional adenovirue which can be preened. Within the continuous sequence, the actual number of homologous recombination events may be greater than one. Non-continuous overlapping sequences are not desired because they reduce the reliability of the method. The non-continuous superposition phenomena are also not desired because they reduce the overall efficiency of the method, probably due to the generation of unwanted homologous recombination products. A preferred embodiment of the invention provides a method of the invention wherein both nucleic acid molecules comprise only an inverted terminal repeat sequence of adenovirus or a functional part, derivative and / or analogue thereof. In one aspect of the invention, one or both of the two nucleic acid molecules have undergone modification prior to uniree. Talee modifications can include the binding of different nucleic acid molecules leading to the generation of one or both nucleic acid molecules. In a preferred embodiment, the different nucleic acids are joined by homologous recombination of partially euk- pposed sequences. In an aspect of the invention, the junction is performed in a cell or a functional part, derivative and / or analogue of the member. Preferably, the cell is a mammalian cell. a »In a preferred embodiment, the nucleic acid molecules are not capable of replicating the mammalian cells before they are bound. Such replication is undesirable since it reduces the reliability of the methods of the invention probably due to providing additional objectives for undesignated homologous recombination. Such replication is also not necessary because it reduces the efficiency of the methods of the invention, probably because replication competes for the adenoviral transaction substrate or functions with the replication of the adenovirus vector. In a preferred embodiment, one of the nucleic acid molecules is relatively small and the other is relatively large. This configuration is advantageous because it allows easy manipulation of the relatively small nucleic acid molecule which allows, for example, the generation of a large number of nucleic acid molecules comprising different nucleic acids of interest, for example, for the generation of an adenovirue vector library. Such a configuration is also desired because it allows the production of a large batch of the quality of the large nucleic acid molecule tested. The amplification of large nucleic acid molecules, for example in bacteria, is difficult in terms of obtaining sufficient quantities of such a large nucleic acid. The amplification of large nucleic acid molecules, for example in bacteria, to ^ M ^ Aa ^ a- «» ¿^^^ is also difficult to control because a small modification of the large nucleic acid is not easily detected. In addition, for reasons not well understood, some vegetables are more stable in bacteria or yeast than others. However, such a configuration allows the generation of a standard batch of a large nucleic acid molecule which can be carefully tested, for example by the generation of a control adenovirus of which production efficiency and reliability is known, and the parameters of a new batch of a large nucleic acid molecule. Once validated such a batch can be used for the generation of a large number of different adenoviral vectors by combining the large molecule with a large number of different small molecules of nucleic acid. Therefore, such a system also allows vector selection and / or manipulation comprising a large nucleic acid molecule of the invention to allow a suitable performance of intact large nucleic acid. In one embodiment of the invention, at least one of the nucleic acid molecule comprises an inverted terminal repeat sequence of adenovirus which, on one side, is essentially free of another nucleic acid. On an essentially adenovirus-free side, the inverted terminal repeat sequence is not essential for the generation of an adenovirus vector with a method or medium of the invention. Without ^ __ ^ __ ^ __ í __ ^ y__ __.

However, in an essentially adenovirus-free side the inverted terminal sequence improves the efficiency of adenovirus vector production compared to a non-essentially free inverted terminal repeat sequence. By essentially free it is meant that the outwardly directed end of the inverted terminal repeat sequence is essentially free of additional nucleic acid bath. Some additional bacteria do not significantly affect the generation of adenovirus vectors particularly if the additional bases are not greater than 50 baee, and preferably do not exceed 30 bases and more preferably not greater than 10 basee. Preferably, both the left ITR and the right ITR are produced essentially free of another nucleic acid on the outwardly directed side. Preferably, the inverted terminal repeat sequence of adenovirue becomes essentially free of another nucleic acid on one side by restriction enzyme digestion with a reection enzyme site present near the inverted terminal repeat sequence of adenovirue. Preferably, the restriction enzyme site is not present in any additional part in the nucleic acid defected to be part of the adenovirue vector, in the nucleic acid molecule. In one aspect, the invention provides a method for the invention for the generation of an adenovirus vector wherein the nucleic acids present in the cell do not compromise the superposition of the sequence leading to the formation of adenovirus capable of replication. Other semas for the generation of adenovirus vectors do not sufficiently suppress the generation of adenovirue capable of replicating the generation and / or propagation of adenoviral vectors. In an aspect of the present invention, the replication of competent adenoviruses is prevented by a system that prevents potential homologous recombination between, for example, an El region and an adenovirus vector. It is greatly desired to avoid the generation of competent adenovirus replication when the adenovirus vectors that are to be used are found in a clinical setting. Avoiding the generation of competent adenovirue replication increases the reliability of adenovirue production. Avoiding the generation of competent adenovirue replication also increases the efficiency of adenovirus vector production. One embodiment of the invention provides a method of the invention wherein the chromosomal nucleic acid in the cell comprises at least one functional part of an adenovirue region El, or a functional derivative and / or analogue of the amino. Preferably the cell is a PER.C6 cell (ECACC deposit number 96022940) or a functional derivative and / or an analogue of the mole. < * ^^ * ¡A * íí.

In another embodiment, the nucleic acid in the cell further comprises a nucleic acid encoding an E2 region of adenovirus and / or a protein from the E4 region of adenovirus. In another embodiment, the invention provides a method or means for the generation of an adenovirus vector, wherein at least one of the linear nucleic acid molecule is ee. A linear molecule is not essential for the production of the adenovirus vector, however, the efficiency of adenovirus vector production is increased compared to when circular or supercoiled molecules are used. In one embodiment, the invention provides a method according to the invention, wherein at least one of the molecules comprises adenovirus capsid proteins encoding nucleic acid derived from at least two serotypee different from adenovirue. Eeta modality of the invention is useful for the generation, for example, of an adenovirue particle with a chimeric or recombinant capsid comprising proteins of at least two different eukaryotes of adenovirus. An advantageous feature of a chimeric capsid is the ability to alter the tissue tropism of an adenovirus vector. The capeide of an adenovirue particle is, among others, a major determinant of whether the particle is able to enter a certain type of cell (tissue tropism) and by altering the capsid, The tissue tropism of an adenovirus vector can be altered and adapted to meet specific needs. Preferably, the capsid comprises at least one tissue tropism determinant portion of a fiber protein of a subgroup type B adenovirus such as adenovirus 16 and at least one other capsid protein derived from adenovirue type C eubgroup such as adenovirue 5. Preferably, the nucleic acid molecule comprises the adenovirue capeide protein encoding nucleic acid ee a large nucleic acid molecule, thus allowing the easy generation of a venoree library of adenovirue packed in the chimeric capsid. In another embodiment, the invention provides a method of the invention in which the binding of the nucleic acid molecule leads to the generation of a physically bound nucleic acid comprising at least two sequences sequentially inverted terminals of adenovirue works, an eign functional encapsulation, a nucleic acid encoding at least one protein from the adenovirus region, at least one protein encoding the E2 region of adenovirus and / or at least one protein coding for the E4 region of adenovirus and a nucleic acid of interest or functional parts, derivative and / or analogue of the member and in which at least one of the proteins coding for the region is found under the transcriptional control of a conditionally active promoter. With a "conditionally active promoter" is meant an active promoter in certain types of cells and inactive in other cell types. The method of this embodiment is particularly useful for the generation of a molecule capable of replicating in a cell with the proviso that the conditionally active promoter is active in the cell. Such a molecule is useful, for example, in vaccination where a very high expression of a transgene that is specifically required in antigen-presenting cells is required. When a vector of this embodiment is additionally provided with the ability to express adenovirus capsid proteins, the vector capable of replication is also capable of being packaged in a cell with the proviso that the conditionally active promoter is active in the cell. Thus, a conditional adenovirus vector incapable of replication is formed. In another embodiment, the invention provides a method of the invention in which the physically bound nucleic acid comprises another non-functional adenovirus nucleic acid different from the two inverted terminal repeat sequences and a functional packaging signal or functional parts, derivatives and / or analogs thereof, and wherein the physically bound nucleic acid is generated by joining two nucleic acid molecules, the molecules comprise partially overlapping sequences capable of combining with each other which allows the generation of the physically bound nucleic acid. The physically bound nucleic acid preferably further comprises a nucleic acid of interest. This establishment is favorable insofar as it allows rapid generation of minimal adenovirus vectors by combining relatively small and different nucleic acid molecules comprising different nucleic acids of interest with one tested and validating large nucleic acid molecules. The invention further provides a method for generating an adenovirus vector with an E2A gene overhang which comprises providing a cell with the nucleic acid molecule and growing the cell wherein the first nucleic acid comprises an inverted terminal repeat sequence of adenovirue and a Emboding signal or functional part, derivatives and / or analogues thereof, and a partially superimposed sequence which allows it to be linked with a second nucleic acid molecule comprising an inverted terminal repeat sequence of adenovirus or a functional part, derivative and / or analogous thereof, a supreeion of at least part of the E2A gene and a partially superpueeta sequence, wherein the cell is capable of expressing functional E2A, preferably at a senable temperature of E2A. Both or any of the nucleic acids can also comprise a nucleic acid of interest operatively linked to a tracification unit such as a promoter and a polyadenylation signal or functional parts, derivatives and / or analogs thereof. The binding of the partially overlapping sequences can be obtained by any means provided that it is capable of reliably binding two strands of nucleic acid. Preferably, the partially superpueetae sequences are joined by homologous recombination. In a preferred embodiment, the second nucleic acid is deleted from at least all E2A sequences that are present in the cell and therefore homologous recombination that prevents the suppression of E2A in the second nucleic acid or derivative of the mRNA is prevented. that reeulta of the union. The invention further provides a method for generating adenoviruses capable of replicating with a deletion in the E3 region which comprises providing a cell with nucleic acid molecules and growing the cell wherein a first nucleic acid comprises an inverted terminal repeat sequence of adenovirus and a Emboding signal or functional part, derivative and / or analogues thereof, a conditionally functional region, and a partially superimposed sequence that allows it to recombine with a second nucleic acid molecule comprising an inverted terminal repeat sequence of adenovirus or a part functional, derivative and / or analogous thereof, a deletion in the E3 region and a partially superpueeta sequence.

Preferably, the second nucleic acid contains a nucleic acid of interest in the E3 region. Most preferably, the nucleic acid of interest is operably linked to the E3 promoter. Such a nucleic acid of interest may be a suicide gene, a cytokine or a marker gene. The second nucleic acid molecule can be generated in the cell by homologous recombination of two smaller partially overlapping nucleic acid molecules, one of which comprises suppression in the E3 region with or without a nucleic acid of interest and only one of the Smaller nucleic acid molecules contain the inverted terminal inverted adenoviral sequence preferably positioned at the end of one of the nucleic acid molecules mae small opulete to the partially superimposed sequence. The invention further provides a method for generating adenoviral vectors with a modification in at least one of the last genes comprising providing a cell with nucleic acid molecules and growing the cell wherein the first nucleic acid molecule comprises a terminal repeat sequence. inverted adenovirus and an encapsulation signal or functional parts, derivatives and / or analogues thereof, and a partially superpueeta sequence which allows it to be recombined with a second nucleic acid molecule comprising an inverted terminal repeat sequence of adenovirus or a functional part, derivative and / or analogue thereof, a modification in at least one of the late genes and a partially overlapping sequence. Such modification in at least one of the late genes may comprise a modification in one of the capsid proteins, preferably a penton or exone or fiber, or more preferably in more than one of the proteins of the capsid, so more preferable in penton, exone and fiber. Such modification may be a change in the nucleotide sequence resulting from mutagenesis, deletion, insertion or combinations thereof, leading to a functional change of the adenoviral vector for example in immunogenicity, infectivity or stability. Preferably, such modification is a modification of the capsid genes generated by all or by parts of the equivalent capsid genes of one or more different serotypes of human or animal adenoviruses, leading to a functional change of the adenoviral vector, by example in immunogenicity, infectivity or stability. The second nucleic acid molecule can be generated in the cell by homologous recombination of two smaller partially overlapping nucleic acid molecules, at least one of which comprises such modification in one or more of the capsid genes so that only one of the smaller nucleic acid molecules contains an inverted adenoviral terminal repeat sequence or a functional part, derivative and / or analogue thereof, preferably placed at the end of one of the smaller nucleic acid molecules opposite the sequence that is overlaps partially. The invention further provides a recombinant nucleic acid deposited under the number P97082122 in the ECACC. The invention further provides a recombinant nucleic acid deposited under the number P97082119 in the ECACC. The invention further provides a recombinant nucleic acid deposited under the number P97082117 in the ECACC. The invention further provides a recombinant nucleic acid depoeited under number P97082114 in the ECACC. The invention also provides a recombinant nucleic acid depoeited under the number P97082120 in the ECACC. The invention also provides a recombinant nucleic acid depoeited under the number P97082121 in the ECACC. The invention also provides a recombinant nucleic acid deposited under the number P97082116 in the ECACC. The invention also provides a recombinant nucleic acid deposited under the number P97082115 in the ECACC. The invention also provides a recombinant nucleic acid deposited under the number P97082118 in the ECACC. The invention further provides a recombinant nucleic acid pWE / Ad.Af111-EcoRI. The invention further provides a recombinant nucleic acid comprising: adenovirus-derived nucleotides 1-454 and nucleotides 3511-6095 of adenovirus shown in Figures 21 and 22. The invention further provides a recombinant nucleic acid pAd5 / CLIP. The invention further provides a recombinant nucleic acid pAd5 / L420-HSA. The invention further provides a recombinant nucleic acid pBS. Eco-Eco / ad5? HIIl? Gpl9K? XbaI. The invention further provides a recombinant nucleic acid according to the invention, wherein the nucleic acid further comprises a transgene. The invention further provides a recombinant nucleic acid according to the invention, wherein the transgene is operably linked to an E3 promoter. The invention also provides a recombinant nucleic acid according to the invention, wherein the tranegen comprises a euicidal gene, a cytokine gene or an indicator gene. The invention also provides a recombinant nucleic acid according to the invention, wherein the suicide gene is an HSV-TK. The invention further provides a recombinant nucleic acid according to the invention, wherein the transgene comprises a coding sequence that is eected from the group that you linked from hIL-la, rat IL-3 and human IL-3. The invention further provides a recombinant nucleic acid according to the invention, wherein the transgene comprises a coding sequence for a luciferase gene or a LacZ gene. The invention further provides a recombinant nucleic acid according to the invention, wherein the tranegene comprises a coding sequence from the human ceNOS 10 gene. The invention further provides a recombinant nucleic acid of the invention, which comprises a deletion in an E3 region of a recombinant nucleic acid. The invention further provides a recombinant nucleic acid of the invention, comprising a deletion in a gpl9K region of a recombinant nucleic acid. The invention further provides a recombinant nucleic acid comprising a nucleotide sequence based on or derived from an adenovirus, wherein the nucleotide sequence comprises a functional encapsulation signal and two functional inverted terminal repeat sequences or functional or derivative fragments of the member, and wherein the recombinant nucleic acid does not have adenovirus genes and functions and superinition sequences which allows a homologous recombination leading to the replication of virue a ^ fe ^ -. ^^^^ A¿. ^^^ fe ^^. ^^ A ^ Mfe * .- ^ miffiffir • * • * - 'competent in a cell in which the nucleic acid is transferred inante Preferably, the recombinant nucleic acid further comprises a heterologous nucleotide sequence. The invention further provides a recombinant nucleic acid pMV / L420-H. The invention further provides a recombinant nucleic acid pMV / CMV-LacZ. The invention further provides a recombinant nucleic acid comprising: a nucleotide sequence based on or derived from an adenovirue, wherein the nucleotide sequence comprises eecuenciae euficientee of adenovirue neceeariae for replication and expreation of the capeid gene, wherein the nucleotide sequence comprises an euppression of at least the El region and the adenovirus encapsulation signal, and wherein the nucleotide sequence does not comprise eequence which allows for homologous recombination leading to replication of competent virue in a cell in which the recombinant nucleic acid is transferred. The invention further comprises a recombinant nucleic acid pWE / Ad. The invention further provides a recombinant nucleic acid comprising: a nucleotide sequence based on or derived from an adenovirus, wherein the nucleotide sequence comprises sufficient adenovirus sequences necessary for replication and expression of the capsid gene, and a sequence complementary to a part towards the 5 'end of the same nucleic acid chain, wherein the complementary sequence can be paired in baeee with the part towards the 5' end so that it functions as a site of start for a nucleic acid polymerase, wherein the nucleotide sequence comprises a deletion of an inverted terminal repeat sequence, the El region and the encapsulating signal of the adenovirus, and wherein the nucleic acid does not have an overlapping sequence which allows homologous recombination that lead to replication of the competent virus in a cell in which ee tr Anefires the nucleic acid. Preferably, the molecule ee pWE / AAV.? 5 '. The invention further provides a recombinant nucleic acid comprising: a nucleotide sequence based on or derived from an adenovirus, wherein the nucleotide sequence comprises a sequence for adenovirus-independent replication, and sufficient adenoviral sequences necessary for replication, wherein the nucleotide sequence comprises at least one deletion of the El region and an encapsulation signal of the adenovirue, and in which the nucleic acid does not have superposed sequences which allow homologous recombination leading to a virus capable of replicating in a cell within which it is transferred the nucleic acid. Preferably, the nucleotide sequence further comprises a deletion of at least one of the repeated and inverted terminals of the adenovirus. Preferably, such a sequence for adenovirue-independent replication comprises an SV40 origin of replication. The invention also provides a recombinant nucleic acid pWE / Ad-H. The invention further provides an adapter plamid comprising: a nucleotide sequence based on or derived from an adenovirus, wherein the nucleotide sequence comprises in operable configuration at least one functional inverted terminal repeat sequence, a functional encapsulation signal and adenoviral sequences which allow homologous recombination and the generation of a recombinant adenovirue genome defective in its replication, and where the adapter plamid has no sequence which allows homologous recombination leading to a virus capable of replicating in a cell in which the plasmid is transferred adapter. Preferably, the adapter plasmid does not comprise sequences of region Bl. Preferably, the adapter plasmid further comprises a multiple cloning site. Also preferred is an adapter plamid according to the invention which also comprises a nucleic acid inerted in the multiple cloning site. 5 In another modality, the invention provides a method for the generation of recombinant adenovirus having an El supri tion and a gpl9K eupreeion, comprising the step of: growing a cell comprising complementary sequences of adenovirue tranefected with 10 i) an adapter plasmid comprising a first nucleotide sequence baeada in or derived from an adenovirue, wherein the nucleotide sequence comprises an operable configuration of a functional inverted terminal repeat sequence, a functional envelope signal and sequences adenovirals which allow homologous recombination leading to the generation of a recombinant adenovirus genome, unable to replicate in a cell in which the adapter plasmid is transferred and which has no sequences from the El region, and ii) a nucleic acid recombinant comprising at least a second nucleotide sequence based on or derived from an adenovirus, wherein at least a second nucleotide sequence comprises an inverted terminal repeat sequence and sufficient adenoviral sequences for replication and a partial euperposition with the plasmid adapter, wherein at least the second nucleotide sequence comprises a deletion of at least the El region, encapsulating signal and gpl9K sequences; wherein the complementary sequences, the first nucleotide sequence and at least the second nucleotide sequence do not have superimposed sequences which allow homologous recombination leading to a virus capable of replicating, under conditions whereby a recombinant adenovirue which has an euppression is generated. The and a suppression gpl9K. Preferably, such an adapter plasmid also comprises a first heterologous nucleotide sequence in the eupreation of the El region and the recombinant nucleic acid also comprises a second heterologous nucleotide sequence in the gpl9K region. In another embodiment, the invention provides a method for the generation of recombinant adenovirue, comprising the step of: growing a cell comprising complementary sequences of adenoviruses transfected with i) a first recombinant nucleic acid comprising a first nucleotide sequence in baee in or derived from an adenovirus, wherein the first nucleotide sequence comprises a functional encapsulating signal and two functional inverted terminal repeat sequences or fragments or functional derivatives thereof, wherein the First, the first recombinant nucleic acid has no functional adenoviral genes, and ii) a second recombinant nucleic acid comprising a second nucleotide sequence based on or 5 derived from an adenovirus, wherein the second nucleotide sequence comprises adenovirus sequences sufficient for replication, wherein the second nucleotide sequence comprises a deletion of at least the El region and an adenovirus targeting signal; Where the complementary sequences, the first nucleotide sequence and the second nucleotide sequence do not have overlapping sequences which allow for homologous recombination leading to a replicable virus, under which a recombinant adenovirus is generated. In another embodiment, the invention provides a method for the generation of recombinant adenovirue, which comprises the steps of: growing a cell comprising complementary sequence of transfected adenovirus with i) a first recombinant nucleic acid comprising a first nucleotide sequence on the basis of in, or derived from an adenovirus, wherein the first nucleotide sequence comprises a functional encapsulating signal and two | gjsbj g "- *" ** ^ • * * * »** * m ^^ m functional inverted terminal repeat sequences or fragments or functional derivatives thereof, and wherein the first recombinant nucleic acid does not have functional adenovirus genes , and ii) a second recombinant nucleic acid comprising a second nucleotide sequence based on, or derived from an adenovirue, wherein the second nucleotide sequence comprises a sequence for independent replication of adenovirue, and adenoviruses are required for replication, where the second nucleotide sequence comprises at least one supreeion of the El region and one adenovirue encapsulating signal; where the complementary sequence, the first nucleotide sequence and the second nucleotide sequence do not have superimposed sequences which allow homologous recombination leading to a virus capable of replicating, under conditions by which recombinant adenovirus is generated. Preferably, the cell comprises at least one nucleic acid molecule whereby the cell expresses SV40 large T antigen proteins or functional fragments thereof. More preferably, the second recombinant nucleic acid molecule is replicated. In one embodiment, the invention provides a replication-defective adenovirus, comprising: a genome coiled in, or derived from, an adenovirue wherein the genome comprises at least one functional encapsulating signal and two functional inverted terminal repeat sequences or fragments or derivatives Its functionalities and where the genome does not include genes of adenovirue works and does not have superposed sequences that allow homologous recombination that leads to a virus capable of replicating in a cell within which adenovirue is defective in replication. Preferably, the adenovirue defective in replication further comprises one or more expression cassette. Preferably, the expression cassette comprises a gene functionally linked to transcription regulatory sequences. In one embodiment, the adenovirue defective in replication further comprises one or more non-adenoviral nucleic acid sequence. Preferably, one or more of the non-adenoviral nucleic acid sequences are inert in the El region or in the E3 region of the gpl9K gene. In another aspect, the invention provides a non-human cell comprising a genome of an adenovirus defective in replication, according to the invention. Preferably, the cell is a mammalian cell. In another aspect, the invention provides a method for transducing a cell, comprising the step of: ^^ jg ^^ g ^^^^ jj g contacting the cell with an adenovirue defective in the replication according to the invention under conditions through which the cell traneduce. In another aspect, the invention provides a non-human cell produced according to a method of the invention, preferably the cell is a mammalian cell. In one embodiment, the invention provides a method for generating recombinant adenovirue, comprising the step of: growing a cell comprising complementary adenovirue sequences, and i) a first recombinant nucleic acid comprising a first nucleotide sequence in or derived from an adenovirue, wherein the first nucleotide sequence comprises a signal of functional encapsulation and two sequential sequences of the inverted operae or fragment or functional derivative of the membrane, and wherein the first recombinant nucleic acid does not have adenoviral genes functioning, and ii) a second recombinant nucleic acid comprising a second nucleotide sequence based on, or derived from, an adenovirue, wherein the nucleotide sequence comprises at least all of the sequences of adenovirue, or fragments or functional derivatives of the miRNAs, necessary for replication and expression of the gene of capsid, and a co-occurrence complementary to a part towards the 5 'end of the same nucleic acid chain, wherein the complementary sequence may be paired in base with the part towards the 5' end so that it functions as a starting cycle for the polymerase nucleic acid, wherein the second nucleotide sequence comprises a deletion of an inverted terminal repeat sequence, the El region and the adenovirus encapsulation signal; wherein the complementary sequences, the first nucleotide sequence and the second nucleotide sequence do not have superimposed sequences which allow homologous recombination leading to a virus capable of replicating, under conditions that generate a recombinant adenovirue. In another aspect, the invention provides a cell comprising a recombinant nucleic acid and / or an adapter plamidid, according to the invention. In a further aspect, the invention provides a method for replacing a defective gene in a host cell genome comprising the steps of: growing the huéeped cell with a recombinant nucleic acid molecule derived from an adenovirus defective in its replication or unable to replicate, which comprises a functional version or part of it of the gene tttt ^ wg ^ ggj ^ ggH defective under conditions whereby at least one allele of the defective gene in the genome of the host cell is replaced. In one embodiment, the invention provides a method for transducing a cell according to the invention, wherein the replication-defective adenovirus expresses non-adenoviral gene. Preferably, the defective gene is a defective tumor suppressor gene. The invention further provides an isolated cell comprising a genome of an adenovirus defective in its replication, according to the invention. Preferably, the cell is a human cell. The invention also provides a recombinant nucleic acid according to the invention, wherein the eupression in the E3 region is replaced with a transgene. The invention further provides a recombinant nucleic acid according to the invention, wherein eupressure in the gpl9K region is substituted with a transgene. The invention further provides a method according to the invention, wherein at least a second nucleotide sequence comprises first and second molecules wherein the first molecule has a partial overlap with the adapter plasmid at the 3 A end and the second molecule comprises an inverted terminal repeat sequence and a region that includes the suppression of the gpl9K sequences.

The invention also provides a defective adenovirue in the replication, which comprises: a genome derived from or derived from an adenovirue, wherein the genome comprises a first eupreesion in and the El region, and a second deletion in a gpl9K region. Preferably, transcription of the transgene is directed by an E3 promoter. The invention further provides an isolated cell comprising: a recombinant nucleic acid and / or an adapter plasmid, according to the invention. Preferably, the cell is a human cell. The following examples are presented as illustrations and not as limitations.

EXAMPLES Ejepflo I Generation of cell lines capable of transcomplementing recombinant adenoviral vectors defective in El 1. 911 cell line A cell line harboring El-type adenovirus sequences, capable of transcomplementing deleted recombinant adenovirus in El (Fallaux et al, (1996) Hum. Gene Ther.7: 215-222) has been generated. This cell line is obtained by transfection of embryonic human diploid retinoblastoe (HER) with pAd5XhoIC containing nt. 80-5788 of Ad 5; one of the resulting transformants is designated 911. It has been shown that this cell line is useful in the preparation of defective recombinant adenovirue in El. It has been found to be superior to 29e lae. Unlike lae 29e, 9e cells lack a completely transformed phenotype, which is most likely the reason why it works best as an adenovirus packaging line: eneayoe in plaques can be carried out more quickly (4-5 days instead of 8-14 days in 293), in monolayers of 911 cells that survive better under superimposed agar, as required for plaque assays for increased amplification of suppressed vectors in El. Also, unlike 293 cells that are transfected with cut adenoviral DNA, 911 cells are transfected using a defined construct. Tranefection efficiencies of 911 cells are comparable to those of 293.

New packaging constructions Source of adenoviriis sequence The adenovirus sequences ee are derived from pAd5. SalB. that contains nt. 80-9460 of human adenovirus type 5 (Bernards et al, (1983) Virology 127: 45-53) or wild-type DNA Ad5. PAd5.SalB is digested with Sali and Xhol and the large fragment is ligated again and this new clone is called pAd5.X / S. The pTN construct (constructed by Dr. R. Vogele, IntroGene, Paíeee Bajos) is used as a source for the human PGK promoter and the NEO gene.

Human PGK promoter and NE0R gene The transcription of the ElA sequence in the new packaging packages is activated by the human PGK promoter (Michelson et al, (1983) Pro. Nati Acad. Sci. USA 80: 472-476); Singer-Sam et al, (1984) Gene 32: 409-417), derived from the plaemido pTN (an obeequio of Dr. R. Vogele), which uses pUC 119 (Vieira et al, (1987) pp. 3-11 : Methods in Enzymology, Acad. Preee Inc.) as a main structure. This plasmid is also used as a source for the NEO gene fused with the polyadenylation signal of the hepatitis B virus (HBV).

Fusion of the PGK promoter to the El genes (figure 1) In order to substitute the El5 sequences of Ad5 (ITR, origin of replication and packaging signal) for heterologous sequences, we have amplified the El (nt.459 to nt.960) sequences of Ad5 by PCR, using primers Eal and Ea2 (see Table 1). The resulting PCR product is digested with Clal and binds in Bluescript (Stratagene), predigested with Clal and EcoKV, resulting in the pBS connection. PCRI. The vector pTN ee digests with restriction enzymes EcoRI (partially) and Scal, and the DNA fragment containing the PGK promoter sequences in PBS is ligated. PCRI and digested with Scal and EcoRI. The resulting construction PBS.PGK.PCRI contains the human PGK promoter operably linked to the sequence Ad5 from nt.459 to nt.916.

Construction of pIG.ElA.ElB (figure 2) pIG.ElA.ElB.X contains the sequences coding for ElA and ElB under the direction of the PGK promoter. As the Ad5 sequences from nt.459 to nt.5788 are present in this construct, also the adenovirus pIX protein is encoded by this plasmid. PIG.ElA.ElB.X is produced by replacing the Scal-BspEI fragment of pAT-X / S with the fragment corresponding to PBS.PGK.PCRI (containing the PGK promoter linked to the ElA sequence).

Construction of pIG.ElA.NEO (figure 3) In order to introduce the complete ElB promoter and fuse this promoter in such a way that the AUG codon of 21 kD ElB functions exactly as the NEOR codon AUG, the EIB promoter is amplified using Ea3 and Ep2 primers, wherein the Ep2 primer introduces an Ncol site in the PCR fragment. The resulting PCR fragment, called PCRII, is digested with Hpal and Ncol and ligated with pAT-X / S, which is previously digested with Hpal and with Ncol. The resulting plasmid is called pAT-X / S-PCR2. The Ncol-Stul fragment of pT ?, which contains the NEO gene and part of the polyadenylation signal of the hepatitis B virus (HBV) is cloned into pAT-X / SPCR2 which has been digested with Ncol and NruI). The resulting construction is pAT. PCR2.NEO. The polyadenylation signal is completed by replacing the Scal-SalI fragment of pAT.PCR2.NEO with the corresponding fragment of pTN, which results in pAT.PCR2.NE0.p (A). Scal-Xfoal from pAT is replaced. PCR2.NEO .p (A) with the corresponding fragment from pIG.ElA.ElB-X, which contains the PGK promoter linked to the ElA genes. The re-constructing construction is called pIG.ElA.NEO, and therefore contains Sa & aaígg ¡a¡MAa «« a > A sequences The Ad5 (nt.459 to nt.1713) under the control of the human PGK promoter.

Construction of pI.G.ElA.ElB (figure 4) pIG.ElA.ElB contains nt.459 to nt.3510 of Ad5, which codes for the ElA and ElB proteins. Sequences ElB end at the splice acceptor at nt.3511. No pIX eequences are present in this connection. It is elaborated as follows pIG.ElA.ElB: the sequences coding for the amino acids of the N-terminal part of ElB of 55 kD are amplified using primers Ebl and Eb2 which introduce an Xhol site. The resulting PCR fragment is digested with BgrlII and cloned into BglII / NruI of pAT-X / S, whereby pAT-PCR3 is obtained. The HBV poly (A) sequence of pIG.ElA.NEO is introduced to end 31 of the ElB sequences of pAT-PCR3 by exchange of the Xba-Sali fragment from pIG.ElA.NEO and the Xbal Xhol fragment from pAT.PCR3 .

Construction of pIG.NEO (figure 5) This construction is of use when transfecting established cells with constructions EIA.E1B and ee requires NEO selection. Because the expression of NEO is directed by the ElB promoter, the cells are expected to Resietentes to NEO are coexpresen. ElA, which is advantageous for maintaining high levels of ElA expression during long-term cell culture. PIG.NEO is generated by cloning the Hpal-Sca fragment from pIG.ElA.NEO, which contains the NEO gene under the control of the ElB promoter of Ad5, in pBS digested with EcoRV and Scal.

Testing in constructions The integrity of the pIG.ElA.NEO, pIG.ElA.ElB.X and pIG.ElA.ElB constructs were determined by restriction enzyme mapping; In addition, the parts of the constructions obtained by PCR analysis were confirmed by sequence analysis. No changes were found in the nucleotide sequences. The constructs were transfected into primary BRK cells (baby rat kidney) and tested to determine their ability to immortalize (pIG.ElA.NEO) or to completely transform (pAd5.XhoIC, pIG.ElA.ElB.X and pIG.ElA .ElB) in these cells. Kidneys were isolated from WAG-Rij rats, 6 days old, homogenized and trypsinized. Subconfluent containers (5 cm in diameter) of cell culture BRK were treated with 1 to 5 μg of pIG.NEO, pIG.ElA.NEO, pIG.ElA.ElB, pIG / ElA. ElB .X, pAd5XhiIC, or with pIG.ElA.NEO together with PDC26 (Eleen et al, (1983) Virology -ujj M teí ?? ~ ** ia * ¿- ** > * - ^ 128: 377-390), which presents the Ad5.ElB gene under the control of the SV40 early promoter. Three weeks after the tranefection, when the foci were visible, the boxes are fixed, they are stained with Giemea and the centers are counted. A review of the generated adenovirue packaging constructions, and their ability to transform BRK is presented in Figure 6. The results indicate that the pIG.ElA.ElB and pIG.ElA.ElB.X constructs are capable of transforming BRK cells from a way dependent on the dosie. The transformation efficiency is similar for both constructions and is comparable to that found with the construction used to produce 911 cells, specifically pAd5.XhoIC. As expected, pIG.ElA.NEO is hardly able to immortalize BRK. However, cotransfection of an ElB expression construct (PDC26) re-emerged in a significant increase in the number of transformants (18 compared to 1), indicating that ElA encoded by pIG.ElA.NEO is functional. Therefore, we conclude that the newly generated packaging constructions are suitable for the generation of new adenovirus packaging lines.

Generation of cell lines with new packaging construction cell lines and cell culture Human A549 bronchial carcinoma cells are grown (Shapiro et al, (1978) Biochem Biophys, Acta 530: 197-207), human embryonic retinoblast (HER), human embryonic kidney (HEK) cells transformed with Ad5-El. (293; Graham et al., (1977) J. Gen. Virol. 36: 59-72) and HER cells transformed with Ad5 (911; Fallaux et al., (1996) .HUJTJ.

Ther. 7: 215-222) as well as PER cells, in Eagle's medium modified by Duibecco (DMEM) supplemented with fetal bovine serum (FCS) 10% and antibiotics in an atmosphere of C02 5% at 37 ° C. The cell culture media, reagents and sera are purchased from Gibco Laboratories (Grand Island, NY). Loe pláeticoe of the crop are purchased from Greiner (Nürtingen, Germany) and Corning (Cooring, NY).

Virue and tecnica viralee The construction of recombinant adenoviral vectors IG.Ad.MLP.nle. lacZ, IG.Ad.NILP.luc, IG.Ad.MLP.TK and IG.Ad.CW.TK is described in detail in the patent application EP 95202213. The recombinant adenoviral vector IG.Ad.MIP.nls.lacZ contains the lacZ gene of E. coli, which encodes ß-galactosidase, under the control of the promoter «^ RihT ^ flflfra-rfbfr major late (MLP) Ad2, IG.Ad.MLP.luc contains the gene for firefly luciferase activated by Ad2 MLP, and the venoree adenoviralee IG.Ad.NLP.TK and IG.Ad.CMV .TK contains the gene for thymidine kinase (TK) of herpes simplex virus under the control of Ad2 MLP and the cytomegalovirus extender / promoter (CMV) respectively.

Transfections All transfections were performed by precipitation of DNA with calcium foefate (Graham et al, (1973) Virology 52: 456-467) with the GIBCO calcium phosphate transfection system (GEBCO BRL Life Technologies, Inc., Gaithersburg, USA), according to the manufacturer's protocol.

Western blotting test The subconfluent cultures of the exponentially growing cells 293, 911 and A549 transformed with Ad5-El and PER cells are washed with PBS and scraped into Fos-RIPA buffer (10 mM Trie (pH 7.5), 150 mM NaCl, NP401%, sodium dodecyl sulfate (SDS) 0.01%> Na-DOC 1%, phenylmethylsulfonyl fluoride (PMSF), 0.5 irnn, 0.5 pvM trypsin inhibitor, 50 mM NaF and 1 mM sodium vanadate). After 10 min at room temperature, the lysates are clarified by centrifugation. Protein concentrations are measured with the BioRad protein assay kit and 25 μg of total cell protein is loaded onto a 12.5% SDS-PAA gel. After electrophoresis, the proteins are transferred to nitrocellulose (lh at 300 mA). The previously stained standards (Sigma, Estadoe Unidoe) are run in parallel. The filters are blocked with 1% bovine serum albumin (BSA) in TBST (10 mM Tris, pH 8.15 mM NaCl and 0.05% Tween-20) for 1 hour. The first antibodies were mouse monoclonal antibodies against Ad5-ElB-55-kDa A1C6 (Zantema et al, unpublished), the rat monoclonal antibody against Ad5-ElB-221-kDa ClGll (Zantema et al, (1985) Virology 142 : 44-58). The second antibody is a goat anti-mouse antibody labeled with horseradish peroxidase (Promega). They are published by increased chemiluminescence (Amersham Corp. UK).

Análisie Southern blot DNA of high molecular weight is added and 10 μg is digested to completion and fractionated on 0.7% agarose gel. Southern blot is transferred to Hybond N + (Amersham, UK) and carried out with a 0.4 M NaOH transfer solution, 0.6 M NaCl (Church and Gilbert, 1984). Hybridization is carried out with an SspI-HindlII 2463 -nt fragment from pAd5. SalB (Bernards et al, (1983) Virology 127: 45-53). This fragment consists of Ad5 bp 342-2805. The fragment is radiolabelled with "32P = dCTP with the use of random hexane nucleotide primers and Klenow DNA polymerase." Southern blots are exposed to a Kodak XAR-5 film at -80 ° C and a Phosphor-Imager screen which is analyzed by the software programming element of B & L eyeteme Molecular Dynamice.

A549 Human A549 bronchial carcinoma cell lines are transformed with Ad5-El by transfection by pIG.ElA.NEO and selected for resistance to G418. Thirty-one clones resistant to G418 are established. Co-transfection with pIG.ElA.ElB with pIG.NEO provides seven cell lines that are re-present to G418.

PER Human embryonic retina cells (HER) transformed with Ad5-El are generated by transfection of primary HER cells with the pIG.ElA.ElB plasmid. Transformed cell lines are established from well separated focoe. We were able to establish seven clonal cell lines, which are called PER.C1, PER.C3, PER.C4, PER.C5, PER.C6, PER.C8 and PER.C9. One of the PER clones, specifically PER.C6, has been deposited in ECACC under the number 96022940.

Expression of Ad5 genes ElA and ElB in transformed A549 and PER cells The expression of Ad5 ElA and the 55-kDa and 21 kDa proteins of ElB in the cell A549 and PER eetablecidae was measured, by means of the Weetern blotting test, with the monoclonal antibody (mAb). mAb M73 recognizes the ElA products, whereas the Mab AIC6 and ClGII are directed against the ElB proteins of 55-kDa and 21 kDa, respectively. The antibody does not recognize proteine in extracts from parental A549 or primary HER cells (data not shown). None of the A549 clones that were generated by cotransfection of pIG.NEO and pIG.ElA.ElB express detectable levels of the ElA or ElB protein (not moetradae). Some of the A549 clones that were generated by transfection with pIG.ElA.NEO expresses laeprotein Ad5 ElA (figure 7), but the levels are much lower than those detected in protein latents of 293 cells. Stable steady state levels of ElA in protein extracts from PER cells were higher than that detected in extracts of cells derived from A549. All PER cell lines expressed similar levels of ElA proteins ^ a ^ (figure 7). The expression of ElB proteins, particularly in the case of ElB 55 kDa, is more variable. Compared to 911 and 293, most of the PER clones express levee of ElB of 55 kDa and 2 kDa. The level in eetable eetable of ElB of 21 kDa ee the highest in PER.C3. None of the PER clones lose the expression of the Ad5 genes by serial passage of the cells (data not shown). We found that the level of expression of El in PER cells remains stable for at least 100 population duplications. We decided to characterize the clones of PER in greater detail.

Southern analysis of cloning PER To study the arrangement of sequences encoding Ad5-El in PER clones, we performed Southern analysis. Cell DNA is extracted from enteroela clonee PER, and from 293 and 911 cells. DNA is digested with HindlII, which is cut once into the Ad5 El region. Southern hybridization in DNA digested with HindIII using a probe specific for Ad5-El radiolabel shows the presence of several integrated copies of pIG.ElA.ElB in the genome of the PER clones. Figure 8 shows the distribution pattern of the El sequences in the high molecular weight DNA of the different cell lines PER. Lae copies are concentrated in a single band, what * < ££ JßéSB & á? L ¡ÉttÉ ^^ tffÉß which suggests that they are integrated as repeated sequences in battery. In the case of PER.C3, C5, C6 and C9, we found additional low molecular weight hybridizing bands that indicate the presence of truncated copies of pIG.ElA.ElB. The number of copies is determined with the use of Phosphor-Imager. We estimate that PER.C1, C3, C4, C5, C6, C8 and C9 contain 2, 88, 5, 4, 5, 5, and 3 copies of the region encoding Ad5 El respectively, and that cells 911 and 293 they contain 1 and 4 copiae of the sequences Ad5 El, respectively.

Tranefection efficiency The recombinant adenovectors are generated by cotransfection of the plasmids adapted in the large Clal fragment of Ad5 in cells 293 (application EP 95202213). The recombinant viral DNA is formed by homologous recombination between the homologous viralee sequences that are present in the plasmid and the adenovirue DNA. The effectiveness of this method, as well as that of alternative strategies, depends to a large extent on the transfection capacity of the auxiliary cells and cells. Therefore, we compared the transfection efficiencies of some of the PER clones with the 911 cells, using the LacZ gene coding for E. coli β-galactosidase as an indicator (Figure 9).

Production of recombinant adenoviruses Table II shows the yields of recombinant adenoviruses that are obtained after inoculation 5 of 293, 911, PER.C3, PER.C5 and PERC. C6 with different adenoviral vectors. The results indicate that the yields of recombinant adenovirus vector obtained with PER cells are at least as high as those obtained with exoetee cell lines. In addition, the performance of the novel adenoviral vector IG.Ad.MLPI.TK is similar to or greater than the yields obtained for other viral vectors in all the cell lines tested.

Generation of new adenoviral vectors (figure 10) The recombinant adenoviral vectors used (see patent application EP 95202213) are deleted for sequences El from 459 to nt. 3328. Since the connection pElA.ElB contains the sequences Ad5 459 to nt.3510, there is a sequence overlap of 183 nt. between the ElB sequences in the packaging construct pIG.ElA.ElB and the recombinant adenoviruses, such as for example IG.Ad.MLP.TK. The overlapping sequences of loe are suppressed new adenoviral vectors. In addition, the sequences do not *? * w * - * ° &? M -f? Tiíibibitit ^? I aK ^ z ^ itái & iu *. .

Codes derived from LacZ that are present in the original constructions are also deleted. This is obtained (see Figure 10) by PCR amplification of the SV40 poly (A) sequences from pMLP.TK using primers SV40-1 (introducing a BamHI site) and SV40-2 (introducing a BgeZlI site). ). In addition, the sequences Ad5 presente in this construction are amplified from nt. 2496 (Ad5-1, enter a BgelII site) to nt. 2779 (Ad5-2). Both PCR fragments are digested with BgelII and ligated. The ligation product is amplified by PCR using primers SV40-1 and Ad5-2. The resulting PCR product is cut with BamHl and AflII and ligated into pMLP.TK predigested with the same enzymes. The resulting construct, called pMLPI.TK, contains a deletion in the Adenovirue sequence from nt.459 to nt.3510.

Packaging system Figure 11 shows the combination of the new packaging construction pIG.ElA.ElB and the recombinant adenovirus pMLPI.TK, which do not have any overlapping sequence. In this figure the original situation is also presented, where ee indicates the euperpoeition of sequence. The absence of sequence overlap between pIG.ElA.ElB and pMLPI.TK (figure lia) eliminates the possibility of homologous recombination between the packaging construct and the recombinant virue, and therefore there is an eignificant improvement for the production of recombinant adenovirue in comparison with the original situation. 5 In Figure llb, the situation for pIG.ElA.NEO and IG.Ad.MLPI .TK is shown. When pIG.ElA.NEO is transfected into established cells, it is expected that it will be efficient to eoepthe propagation of recombinant adenovirue euprimido in El. This combination has no superposition of sequence, which prevents the generation of RCA by homologous recombination. In addition, this convenient packaging method allows the propagation of recombinant adenoviruee that is eupremidae only for the ElA sequence and not for the ElB sequences. 15 Recombinant adenoviruses expressing ElB in the absence of ElA are attractive, since the ElB protein, in particular ElB of 19 kD, is capable of preventing the lysis of human cells infected with tumor necrosis factor (TNF) Gooding et al, (1991) J. Virol. 65: 3083-3094). 20 Generation of recombinant adenovirus derived from pMLPI.TK Recombinant adenovirus is generated by cotranefection of 293 cells with DNA for pMLPI.TK linearized with Sali and DNA & ái r ^. * & * of Ad5 wt linearized with Clal. The procedure is shown schematically in Figure 12.

Example 2 Plasmid-based system for RCA-free rapid generation of recombinant adenoviral vectors _ Construction of adenovirus clones pBr / Ad.Bam-rITR (ECACC deposit P970821212 In order to facilitate blunt end cloning of the ITR sequences, human wild type adenovirus type 5 (Ad5) DNA is treated with Klenow enzyme in the presence of excess dNTP. After inactivation of the Klenow enzyme and purification by extraction with phenol / chloroform followed by ethanol precipitation, the DNA is digested with Ba Hl. This DNA preparation is used without further purification in a ligation reaction with pBr322 derived from vector DNA prepared as follows: DNA from pBr322 is digested with EcoRV and BamHI, dephosphorylated by treatment with TSAP enzyme (Life Technologies) and purified in gel of agarose LNP (SeaPlaque GTG). After transformation into competent E. coli DH5a (Life Techn.) And colony analysis resistant to ampicillin, ee selects a clone that moves a digethion pattern as expected for an insert extending from the BamHl site in Ad5 to ITR on the right. The sequence analysis of the border cloning in ITR on the right shows that most of the 3 'G residue of ITR has been lost, it is found that the rest of the ITR is correct. Such lost residue G is complemented by the other ITR during replication. pBr / Ad.Sal-rITR (ECACC deposit P97082119) PBr / Ad.Bam-rITR is digested with BamHl and Sali. The vector fragment includes the adenovirus insert and is isolated on LMP agarose (SeaPlaque GTG) and ligated to a 4.8 kb Sal / BamHI fragment of wt Ad5 DNA and purified with the Geneclean II kit (Bio 101, Inc. ). A clone is chosen and the integrity of the Ad5 sequences is determined by analysis of restriction enzymes. The clone pBr / Ad.Sal-rITR contains 5 adeque type adeno of the site type Sali in bp 16746 up, and that includes rITR (which has lost most of the 3'G residue). pBr / Ad.Cla-Bam (ECACC deposit P97082117) DNA type 5 Adeno wt is digested with Clal and Ba Hl, and the 20.6 kb fragment is isolated from the gel by electroelution. PBr322 is digested with the same enzymes and purified from ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Of agarose gel by Geneclean Both fragments are ligated and transformed into competent DH5a. The resulting clone pBr / Ad.Cla-Bam is analyzed by ingestion with restriction enzymes and shown to contain an insert with adenovirus sequences of bp 919 to 21566. pBr / Ad.AflI-Bam (deposit ECACC P97082114) The clone pBr / Ad.Cla-Bam with BcsRI becomes linear (in pBr322) and is partially digested with AflII. After heat inactivation of AflII for 20 minutes at 65 ° C, the ends of the fragment are filled with Klenow enzyme. The DNA is then ligated to a blunt double-stranded oligo-linker containing a PacI site (5 '-AATTGTCTTAATTAACCGCTTAA-3'). This linker is manufactured by reapplication of the following two oligonotides: 5 '-AATTGTCTTAATTAACCGC-3' and 5'-AATTGCGGTTAATTAAGAC-3 followed by formation of a blunt end with Klenow enzyme. After precipitation of the DNA bound to the exchange buffer, the ligations are digested with an excess of Paci enzyme to remove the concatamers of the oligo. The 22016 bp partial fragment containing the Ad5 sequences of bp 3534 to 21566 and the vector sequences, are isolated on LMP agarose (SeaPlaque GTG), re-ligated and transformed into competent DH5a. It is found that a clone contains the Pací site and that it has retained the adeno fragment l? t ^ t ^ - ^^ ií..áí & í.- 2. large one which is selected and sequenced at the 5 'end to verify the correct insertion of the Paci linker at the AflII site (lost). pBr / Ad.Bam-rITRpac # 2 (deposit ECACC P97082120) and pBr / Ad.Bam-rITR # 8 (deposit ECACC P97082121) To allow insertion of a PacI site near Ad5 ITR in clone pBr / Ad.Bam-rITR ee remove approximately 190 notides between the Clal site in the main structure pBr322 and the start of the ITR sequences. This is done as follows: pBr / Ad.Bam-rITR is digested with Clal and treated with Bal31 nase during variable time intervals (2 A 5 A 10 'and 15'). The extent of removal of notides are followed by separate reactions in pBr322 DNA (also digested in the Clal eitio), using amortiguadoree and identical conditions. The Bal31 enzyme is inactivated by incubation at 75 ° C for 10 minutes, the DNA is precipitated and resuspended in a smaller volume of TE buffer. For To ensure that there are blunt ends, the DNAs are further treated with T4 DNA polymerase in the presence of excess dNTP. After the digestion of the pBr322 DNA (control) with Sali, it eats well-known degradation ("150 bp) in the sample treated for 10 minutes or 15 minutes. of the plasmid treated for 10 minutes or 15 minutes after The PacI linkers with blunt ends described above are linked (see pBr / Ad.AflII-Bam). The ligations are purified by precipitation, they are digested with an excess of Paci and separated from the linkers in an LMP agarose gel. Deepuée of the religation, the DNAs are transformed into competent DH5a and the colonies are analyzed. 10 clones are selected which show a suppression of approximately the desired length and are further analyzed by T-track sequencing (T7 sequencing equipment, Pharmacia Biotech). Two clones are found with the Pací linker inserted just downstream of RITR. After digestion with Pací, clone # 2 has 28 bp and clone # 8 has 27 bp attached to the ITR. pWE / Ad.AflII-rITR (ECACC deposit P97082116) The cosmid vector pWE15 (Clontech) is used to clone larger Ad5 ineertions. First, a linker containing a unique PacI site is inserted into the EcoRI sites of pWE15 creating pWE.pac. For this purpose, the double-stranded PacI oligonucleotide as prescribed for pBr / Ad.AfIII-BamHl is used, but now with its EC? RI ends outstanding. The following fragments are subsequently isolated by electroelution from agarose gel: pWE.pac digested with Pací, pBr / AfilII-Bam digested with Ba Hl and pBr / Ad.Bam-rITR # 2 digested with BamHl and Pací. These fragments are listed together and packaged using phage packed extracts? (Stratagene) according to the manufacturers protocol. After infection in host bacteria, colonies are grown on plates and analyzed for the presence of the complete insert. pWE / Ad.AflII-rlTR contains all the adenovirus type 5 sequences, from bp 3534 (eitio AflII) haeta, and including the right ITR (which has lost most of the 3'G residue). pBr / Ad.IITR-Sal (9.4) (ECACC deposit P97082115: Adeno 5 wt DNA is treated with Klenow enzyme in the presence of excess dNTPs and subsequently digested with Sali. Two of the fragmentae reeultantee, called left ITR-Sal (9.4) and Sal (16.7) -RIT right, respectively, are isolated in LMP agarose (Seaplaque GTG). The pBr322 DNA is digested with EcoRV and Sali and treated with foefataea (Life Technologies). The vector fragment is isolated using the Geneclean method (BIO 101, Inc.) and ligated to the SalI fragments of Ad5. Only ligation with the 9.4 kb fragment provides colonies with an insert. After analysis and sequencing of the cloning limit, a clone containing the entire ITR sequence is chosen, and extended to the SalI site at pb 9462. pBr / Ad.HTR-Sal (16.7) (ECACC deposit P97082118) PBr / AdlITR-Sal (9.4) is digested with Salí and ee deefoeforila (TSAP, Life Technologiee). To extend eeta clone haeta the third eitio Salí in Ad5, pBr / Ad.Cla-Bam is linearized with BamHl and partially digested with Salí. A 7.3 kb SalI fragment containing adenovirue sequence from 9462-16746 is isolated on an LMP agarose gel and ligated to the vector fragment pBr / Ad. IITR-Sal (9.4) digested with Salí. pWE / Ad.AflII-EcoRI PWE.pac is digested with Clal and the 5'-superfluous ends filled using the Klenow enzyme. The DNA is then digested with Pací and isolated from agaroea gel. PWE / Af111-rITR is digested with EcoRI and after treatment with Klenow enzyme is digested with PacI. The large 24 kb fragment containing the adenoviral sequences is isolated from agarose gel and ligated to the vector pWE.pac digested with Clal and blunt-ended, using the Ligation ExpressMR equipment from Clontech. After transformation of Ultracompetent XLIO-Gold cells from Stratagene, the clones containing the expected insertion are identified. pWE / AfHl-EcoRI contains the Ad5 sequences of bp 3534-27336.

B. Construction of new adapter plasmids The absence of sequence overlap between the recombinant adenovirus and the El sequences in the packaging cell line is essential for a safe and free generation of RCA, as well as a propagation of new recombinant viruses. The plamido adapter pMLPI.TK (Figure 10) is an example of an adapter plaemide designed for use in accordance with the invention in combination with the improved packaged cell lines of the invention. This plamidoid is used as the starting material to make a new vector in which nucleic acid molecules comprising specific promoter and gene sequences can be readily exchanged. First, a fragment is generated by PCR from template DNA pZip? Mo + PyFlOl (N ") (described in PCT / NL96 / 00195) with the following primers: LTR-1: 5'-CTGTAC GTA CCA GTG CAC TGG CCT AGG CAT GGA AAA ATA CAT AAC TG-3 and LTR-2: 5 '-GCG GAT CCT TCG AAC CAT GGT AAG CTT GGT ACC GCT AGC GTT AAC CGG GCG ACT CAG TCA ATC G-3' Polymerase is used of Pwo DNA (Boehringer Mannheim) according to the manufacturer's protocol with the following temperature cycloe: once 5 minutes at 95 ° C, 3 minutes at 55 ° C, and 1 minute at 72 ° C, and 30 cycles of 1 minute at 95 ° C, 1 minute at 60 ° C, 1 minute at 72 ° C, followed once for 10 minutes at 72 ° C. fae --- *? -i * ^ i ^ ¿kz¡ &e. & S2 E &r 'after digested with BamHl and ligated into a pMLPlO vector (Levrero et al, (1991) Gene 101: 195-202) digested with PvuII and BamHl, whereby the pLTRlO vector is generated. This vector contains adenoviral sequences of lpb up to 454 bp followed by a promoter that includes part of Mo-MuLV LTR in which the wild-type elongation sequences are replaced by an extender of a mutant polyoma virus (PyFlOl). The promoter fragment is called L420. Afterwards, the coding region of the murine HSA gene is inserted. PLTRlO is digested with BstBI followed by Klenow treatment and digestion with Ncol. The HSA gene is obtained by PCR amplification in pUC18-HSA (Kay et al, (1990) J. Immunol. 145: 1952-1959) using the following primers: HSAl, 5 * -GCG CCA CGA TGG GCA GAG CGA TGG TGG C-3 'and HSA2.5 * -GTT AGA TCT AAG CTT GTC GAC ATC GAT CTA CTA ACA GTA GAG ATG TAG AA-3 A The 269 bp amplified fragment is subcloned into a launcher vector using the Ncol and BgrlII sites. Sequencing confirms the incorporation of the correct coding sequence of the HSA gene, but with an additional TAG insert directly after the TAG stop codon. The coding region of the HSA gene, which includes the TAG duplication afterwards, is cut as an Ncol (sticky) -Sali (blunt) fragment and is cloned into the 3.5 kb Ncol (sticky) / BstBI (blunt) fragment of pLTRlO, resulting in pLTR-HSAlO. ^^ tti iiii Finally, pLTR-HSAlO is digested with EcoRI and Ba Hl after which the fragment containing the left ITR, the packaging signal, the L420 promoter and the HSA gene is inserted into the vector pMLPI.TK digested with the same enzymes, so the promoter and the sequence of the gene are replaced. This results in a new adapter plasmid pAd / L420-HAS (FIG. 21) which contains convenient recognition sites for various restriction enzymes around the promoter sequence and the gene. SnaBI and Avrll can be combined with Hpal, Nhel, Kpnl, HindIII to exchange promoter sequences, whereas these last sites can be combined with the 3 'Clal or Ba Hl sites of the HSA coding region to generate gene in the eetation. Another adapter plasmid that is designed to allow easy exchange of nucleic acid molecules is made by substituting the promoter sequences of the gene and poly A in pAd / L420-HSA with the CMV promoter, a multiple cloning site, an intron and a signal polyA. For this purpose, pAd / L420-HSA is digested with Avrll and BgrlII, followed by treatment with Klenow to obtain blunt ends. The 5.1 kb fragment with the pBr322 vector and the adenoviral sequences is isolated and ligated to the 1570 bp blunt fragment of pcDNAl / amp (Invitrogen) obtained by digestion with Hhal and Avrll followed by treatment with T4 DNA polymerase. This adapter plasmid is called pCLIP (Figure 22). j ^^ «« ^^^ fi ^^^ »¿e¡ ^ ^ ¿^^ ijí C. Generation of recombinant adenoviruses Recombinant adenovirus deleted in El with the wt E3 sequences To generate recombinant adenovirus deleted in El with the new plasmid-based system, the following constructs are prepared: an adapter construct containing the expression cassette with the gene of interest linearized with a restriction enzyme that cuts on the 3 'side of the fragment of superimposed adenoviral genome, preferably containing no vector sequence of pBr322; and a complementary adenoviral genome construct pWE / Ad.AflII-rITR digested with Pací. The two DNA molecules are further purified by phenol / chloroform and precipitation with ETOH. The cotransfection of estoe plaemidoe in an adenovirus packaging cell line, preferably a cell line according to the invention, generates a recombinant adenovirus deficient in replication by a step of homologous recombination between the adapter and the complementary construct (FIG. ). Alternatively, instead of pWE / Ad.AflII-rITR, other fragments can be used, for example pBr / Ad.Cla-Bam digested with EcoRI and BamHl or pBr / Ad.AfIII-BamHl digested with Pací and BamHl which can be combined with pBr / Ad.Sal-rITR digested with Salí. The recombinant adenovirus can be produced after the introduction of the plasmids into the cell. Must beIt should be understood by those skilled in the art that other combinations of adapter and complementary plasmids can be used, without departing from the present invention. A general protocol as indicated below and with the meaning as a non-limiting example of the present The invention has been made to produce several recombinant adenoviruses using several adaptive plasmids and the Ad.Af111-rITR fragment. Adenovirus packaging cells (PER.C6) are seeded in flasks "25 cm2 and the next day when they are at" 80% confluence, they are treated with a mixture of DNA and lipofectamine agent (Life Techn.) As prescribed by the manufacturer. Typically, 40 μl of lipofectamine, 4 μg of adapter plamidid and 4 μg of the adenovirue genome fragment complementary to AflII-rITR are used (or 2 μg of all of the two plasmids for the double homologous recombination). Under these conditions, efficiencies of transient conditions of "50% (48 hours before tranefection) are obtained, determined with controlled control using a pAd / CMV-LacZ adapter, and the cells are passed to flasks of "80 cm2 and are further cultivated. ra,. ^ M = SSÉferf Approximately at five (for homologous recombination euphlus) to eleven days (for double homologous recombination) the cytopathic effect (CPE) can be observed, indicating that the functional adenovirus has formed. The 5 cells and the medium are harvested under complete CPE and recombinant virus is released by lyophilization. An additional stage of amplification in a 80 cm2 flask is done in a usual way to increase the yield since in the initial stage it is found that the titles are variable pee to the full CPE preeentation. Once the amplification is complete, the viruses are collected and purified in plaque in cells PER.C6. Individual plates are tested for viruses with transgenes activae. They have been produced using this four protocol recombinant adenovirue differentiae containing the human interleukin-3 gene (see figure 1, WO88 / 04691), the human endothelial nitric oxide gene (Janseene et al, (1992) J. Biol. Chem. 267: 14519-14522), the TclA transposase gene (Vos et al, (1993) Genes Dev. 7: 1244-1253), or the bacterial LacZ gene (Kalderon et al, (1984) Cell 39: 499-509). In all cases, a functional adenovirus is formed in all the isolated plates containing viruses with an active transgene. ^ - ^ - -iMtffttim ii - r- '- ^ IÍ ^ ¡¡¡^^ Recombinant adenovirus deleted in El with modifications in the E3 or E4 regions In addition to substitutions in the El region it is possible to suppress the E3 region or substitute part of the E3 region in the adenovirue because the E3 functions are not necessary for the replication, packaging and infection of a recombinant virus. This will generate an opportunity to use a larger or lesser insertion of a gene and exceed the maximum packed size (approximately 105% of the length of the genome). This can be done, for example, by removing part of the E3 region in the clone pBr / Ad.Bam-rITR by digethion with Xbal and religation. This removes the sequence Ad5 wt 28592-30470 including all coding regions E3 known. Another example is the precise substitution of the coding region of gpl9K in the E3 region with a polylinker allowing the insertion of new sequences. This leaves all other coding regions intact, eliminates the need for a heterologous promoter since the transgene is activated by the promoter sequences E3 and pA, leaving more space for coding sequences and results in a very high transgene expression, at least as good as in the euetitución vector Control. For this purpose, the BcoRI fragment of 2.7 kb of wt Ad5 containing the 5 'part of the E3 region is cloned on the site __á _? _ g_ ¿_ ^ _ ^ _ ^ í_j _ ^ _ s_ BcoRI of pBluescript (KS ") (Stratagene)., the HindIII site is removed in the polylinker by digestion with EcoRV and HincII and subsequent religation. The resulting clone pBS.Eco-Eco / ad5? HIII to suppress the gpl9K coding region. The primers 1 (5 '-GGG TAT TAG GCC AA AGG CGC A-3') and 2 (5 '-GAT CCC ATG GAA GCT TGG GTG GCG ACC CCA GCG-3') are used to amplify a sequence of pBS. -Eco / ad5? HIII corresponding to sequences 28511 to 28734 in the DNA of wt Ad5. The primers 3 (5 '-GAT CCC ATG GGG ATC CTT TAC TAA GTT ACA AAG CTA-3') and 4 (5'-GTC GCT GTA GTT GGA CTG G-3 ') are used in the same DNA to amplify the sequences. Ad5 from 29217 to 29476. The two resulting PCR fragments are ligated together under the newly introduced Ncol site and subseque digested with Xbal and Muñí. This fragment is then ligated into a pBS.EcoEco / ad5? HIII vector that has been partially digested with Xbal and Muñí, which generates pBS. Ecoco / ad5? HIII. ? gpl9K. To allow the insertion of foreign genes into the HindIII and BamHl site, an Xbal deletion is performed in pBS. Eco-Eco / ad5? HIII.? Gpl9K to remove the BamH1 sites in the Blueecript polylinker. The reproduced plaemido pBS.Eco-Eco / ad5? HIII. ? gpl9K? XbaI, which contains eitioe uniquee HindIII and Ba Hl corresponding to the eecuenciae 28733 (HindIII) and 29218 (BamHl) in Ad5. After the introduction of a foreign gene into these sites, either the deleted Xbal fragment is reintroduced, or the insert is recloned in pBS.Eco- aa feg¿ -a - MátJ & ^ W ^ & u ^ - Eco / ad5? HIII.? gpl9K using HindIII and, for example,? funl. By using this procedure, we have generated plasmids expressing HSV-TK (McKnight (1980) Nuci, Acid Res. 8: 5949-5964 and Vincent et al (1996) Hum Gene 7: 197-205), hIL-la (Esandi et al, (1998) Gene Therapy 5 -. 118 - 188), rat IL-3β (Eeandi et al (1998) Gene 211 (1): 151-158:), luciferaea (De Wit et al. al, (1987) Mol. Cell Biol. 7: 725-737) or LacZ. Loe eitioe solee Srll and Notl in the plasmid pBS.Eco-Eco / ad5? HIII.? Gpl9K (with or without a gene of inert interest) are used to transfer the region containing the gene of interest within the corresponding region of pBr /Ad.Bam-rITR, which provides the connection pBr / Ad.Bam-rITR? Gpl9K (with or without an inert gene). Eeta construct is used as described supra to produce recombinant adenoviruses. In the viral context, the expression of the inserted genes is activated by the adenovirus E3 promoter. Recombinant viruses that are deleted in both El and E3 are generated by a double homologous recombination procedure as described above for the El substitution vectors using a plasmid-labeled seventh which includes: an adapter plasmid for the substitution of El. according to the invention, with or without the insertion of a first gene of interest, the pWE / Ad-AflII-EcoRI fragment, and the plasmid pBr / Ad.Bam-rITR? gpl9K with or without the insertion of a second gene of interest. __ ^ _ nffr ^ - t - - 11 | ¡^ ^^ In a non-limiting example we describe the generation and functionality of a recombinant adenovirus containing the murine HSA gene in the El region and the firefly luciferase gene in the region gpl9K. The luciferase gene is cut from 5 pAd / MLP-Luc (described in EP 0707071) as a HindIII-BamHI construct and cloned into the HindIII-BamHI site of pBS.Eco-Eco / ad5? HIII.? Gpl9K? XbaI. Then, the fragment Mscl-Mu.nl containing the luciferase gene is cloned into the corresponding sites of pBS. Eco-Eco / ad5? Gpl9K which generates pBS. Eco-Eco / ad5? Gpl9K.luc. This resets the Eco-Eco fragment, but now with the luciferase gene instead of gpl9K. To further simplify the manipulation, the internal EcoRI eitioe in the luciferase insert ee mutan ein making change to the amino acid sequence of the luciferaea gene.

One EcoRI eitio flanked with the HindIII eitium in the 5 'non-coding region of the luciferaea inertion and the other ee located 588 bp 3' of the initial ATG. A PCR product of 695 bp is generated with the following primers: 5 '-CGA TAA GCT TAA TTC CTT TGT GTT T-3' and 5 '-CTT AGG TAA CCC AGT AGA TCC AGA GGA GTT CAT-3 'and are digested with HindIII and BstBII. This fragment is then ligated to HindIII-BstEII to pBS.Eco-Eco / ad5? Gpl9K.luc, substituting the corresponding insert into this vector. The resulting construction is called pBS.EcoEco / ad5? Gpl9K.luc2. The luciferase gene and part of the E3 region are then cut from this clone with Srfl and Notl and IFIJÉJÍÍÉÉl. Then, introduce the corresponding pBr / Ad.Bam-rITR sites into the corresponding sites, generating the clone pBr / Ad.Bam-rITR? Gpl9K / luc2. The adapter plasmid pAd5 / SI1800HSA used for El substitution in the double insertion virus contains the murine HSA gene activated by a retrovirue promoter coated in LTR. This adapter plasmid is generated from the pAd5 / L420-HSA construct described infra by substitution of the promoter sequence. First, a PCR product is generated in a retroviral vector on the MGF-S vector described in W095 / 34669 using the same primers as for the amplification of the L420 promoter fragment (described infra). This amplifies by PCR the sequence corresponding to lob 453-877 in the vector MFG-S. The L420 promoter in pAd5 / L420-HSA (Figure 21) is then exchanged for the PCR fragment using unique sites Avrll and Hmdl II. The resulting construct, pAd5 / S430-HSA, is then digested with Nhel and Scal and the 4504 bp fragment containing the HSA gene is isolated, the pA sequence is sequenced, the Ad5 sequence is sequenced and the Scal vector vector sequences are isolated in the ampicillin The pAd5 / S430-HSA connection is also digested with Xbal and Scal, and a 1252 bp fragment (containing the rest of the ampicillin gene, the left ITR and the adenovirus packaging signal and the 5 'part of the S430 promoter) is isolated. A third 1576 bp fragment of the retroviral vector was isolated on MFG-S after digestion with Xbal and containing the sequences of MFG-S corresponding to bp 695-2271. The pAd5 / S1800-HSA adapter plasmid is constructed by ligating the three isolated fragments. A double insertion of virule Ad5 / S1800-HSA.E31uc (as described above) is generated by tranefection of the following DNA fragment in PERe.C6 cell: pAd5 / S1800-HSA digested with EcoRI and SalI (2 μg) + pWE / Ad.AflII.EcoRI (2 μg) digested with Pací and BcoRI + pBr / Ad.Bam-rITR? Gpl9klac2 digested with Salí. Before the CPE preeentation, the virus is collected and amplified by serial paecations in PER.C6 cells. The activity of eete virue HSA-Luc is compared to the simple insertion E1 viruses containing either S1800-HSA or the CMV-Luc transcription units in the El region. A549 cells are seeded at 2 x 10 cells / well and they are infected 5 h later with different amounts of the virus. Two days later the expression of the transgene is measured. The luciferase activity is measured using a luciferase assay system (Promega) and expression of the murine HSA gene is measured with an α-HSA antibody (Ml / 69, Pharmigen). The results are presented in Table III. This experiment shows that using the plasmid-based recombination sevenm, double-insertion viruses can be made and that both inserts are functional. In addition, the luciferase activity of double-insertion virus is comparable with the activity of luciferase activated by CMV jfc ^; ^ fate »afc ^ lá ^ frá ^ of the control virus. Therefore, we conclude that the E3 promoter is highly active in A549 cells, even in the absence of ElA proteins. In addition to manipulation in the E3 region, changes of (parts of) the E4 region can be easily carried out in pBr / Ad.Bam-rITR. The generation and propagation of such a virus, however, in some cases demand in trans complementation.

Example 3 Demonstration of the competence of a synthetic DNA sequence that is capable of forming a hairpin structure, to serve as a primer for reverse chain synthesis for the generation of double-stranded DNA molecules in cells that contain and express adenovirus genes Conventional name of plasmids used: p plasmid I ITR (inverted terminal repeat sequence of adenovirus) C Combination of cytomegalovirus extender / promoter (CMV) L Sequence coding for firefly luciferaea hac, haw potential fork that can be formed after digethion with the restriction endonuclease Asp718 in both correct and inverse orientation, respectively (Figure 15). The so-called convention is exemplified as follows. pICLhaw is a plasmid containing the adenovirus ITR followed by the gene of luciferaea activated by CMV and the hairpin Aep718 in the inverea orientation (non-functional). Loe plaemidoe pICLhac, pICLhaw, pICLI and pICL were generated using standard techniques. In figure 16-19 the schematic representation of estoe pláemidos is shown. Plasmid pICL is derived from the following plasmids: nt. 1 457 pMLP (Levrero et al (1991) / Gene 101: 195-202) nt. 458 1218 pCMVß (Clontech, EMBL Bank No. U02451) nt. 1219 3016 pMLP.luc (IntroGene, unpublished) nt. 3017 5620 pBLCAT5 (Stein et al, (1989) Mol Cell Biol. 9: 4531-4). The plamidmid has been constructed as follows: The plasmid tet gene pMLPlO has been inactivated by eupreation of the BamHl-Salí fragment, to generate pBLPlO? SB.

Using the primed primer PCR / MLP1 and PCR / MLP3, a 210 bp fragment containing Ad5-ITR, flanked by the Salit synthetic reitiation eitium is amplified using pMLP10 DNA as the template. The PCR product is digested with the BcoRI and SgrAI enzymes to generate a 196 bp fragment. Plasmid pMLPlO? SB is digested with EcoRI and SgrrAI to remove the ITR. This fragment is synthesized by the PCR fragment treated with EcoRI-SgrAI to generate pMLP / SAL. Plasmid pCMV-Luc is digested with PvuII until complete and recirculated to remove the polyadenylation signal derived from SV40 and the Ad5 sequence with the exception of the left terminal part of Ad5. In the re-emerging plaemido, pCMV-Luc? Ad, Ad5 ITR is replaced by ITR flanked by the PLMP / SAL plasmid site when exchanging the XmnI-SacII fragment. The resulting plasmid, pCMV-Luc? Ad / SAL, the left terminal part of Ad5 and the CMV-activated luciferase gene are isolated as a SalI-SamI fragment and are inerted in the plamid pBLCATS digested with Sali and Hpal to form the plamid pICL. Plasmid pICL is represented in figure 19; its sequence is represented in figure 20. Plasmid pICL contains the following characteristics: nt. 1-457 Left terminal part Ad5 (sequence 1-457 of human adenovirus type 5) ~ á * M ~ a ^ ** Ji v. lllrt ?? íl ?? fTíffriffiíÍÍÉ nt. 458-969 Human cytomegalovirus extender and immediate early promoter (Boshart et al, (1985) Cell 41: 521-530) (from plasmid pCMVß, Clontech, Palo Alto, United States) nt. 970-1204 Exon 19S of SV40 and truncated intron 16 / 19S (of plasmid pCMVβ) nt. 1218-2987 Firefly luciferase gene (from pMLP.luc) nt.3018-3131 SV40 battery polyadenylation signals of the late transcript, derived from the plasmid pBLCATS) nt. 3132-5620 Main structure of pUC12 (derived from plasmid pBLCAT5) nt. 4337-5191 Gene for ß-lactamase (resistance gene to Amp, reverse orientation) PICLhac and pICLhaw plasmids The plasmids pICLhac and pICLhaw ee are derived from the plasmid pICL by digestion of pICL with the restriction enzyme Aep7l8. Linearized plaemid is treated with beef intestine alkaline foefatase to remove the phosphate group 51. The partially complementary synthetic single chain oligonucleotide Hp / aspl and Hp / asp2 are reacted and phosphorylated at their 5 'ends using T4-polynucleotide kinase. The double-chain phosphorylated oligomers are mixed with the deefoephorylated pICL fragment and ligated. Lae clones containing a single copy of the synthetic oligonucleotide inserted into the plasmid are isolated and characterized restriction enzyme digests. Insertion of the oligonucleotide at the Asp718 site, at one junction, will re-create an Asp718 recognition site, while the other binding at the recognition site will be interrupted. The orientation and integrity of the oligonucleotide inserted in the selected clone is verified by means of sequence analysis. A clone containing the oligonucleotide in the correct orientation (the Asp718 site near the BcoRI site 3205) is indicated as pICLhac. A clone with the oligonucleotide in the inverea orientation (the Asp7l8 site near the polyadenylation signal derived from SV40) is termed pICLhaw. Plasmids pICLhac and pICLhaw are depicted in Figures 16 and 17. Plasmid pICLI is generated from plasmid pICL by insertion of the SalI -SgrAI fragment from pICL, which contains Ad5-ITR at the Asp718 site of pICL. The 194 bp SalI-SgrAI fragment is isolated from pICL, and the cohesive ends are blunt-ended using DNA polymerase I from E. coli (Klenow fragment) and dNTP. The cohesive ends of Asp718 are converted to blunt ends by treatment with mungbean nuclease. By ligation, clones containing the ITR are generated in the Asp718 site of the plaemido pICL. A clone containing the ITR fragment in the correct orientation is called pICLI (Figure 18). Adenovirus generation Ad-CMV-hcTK. Recombinant adenovirus is constructed according to the method described for patent application 95202213. Two components are required to generate a recombinant adenovirus. First, an adapter plamid containing the left terminal part of the adenovirue genome that contains the ITR and the packaging signal, an expression cassette with the gene of interest, and a portion of the adenovirus genome which can be used for homologous recombination. In addition, adenoviral DNA is needed for recombination with the adapter plasmid mentioned above. In the case of Ad-CMV-hcTK, ee uses the plamido PCMV.TK as a baee. Eete pláemido contains nt.1-455 of the genome of adenovirue type 5, nt. 456-1204 PCMVß deivate (Clontech, the PstI-Stul fragment containing the CMV extension promoter and the 16S / 19S intron of simian virus 40), the gene for herpes simplex virus thymidine kinase (described in the patent application) EP 95202213.5), the polyadenylation signal derived from SV40, (nt 2533-2668 of the SV40 sequence), followed by the BglII-Scal fragment of Ad5 (nt 3328-6092 of the Ad5 sequence). These fragments are present in a main structure derived from pMLPlO (Levrero et al, (1991) Gene 101: 195-202). To generate the plasmid pAD-CNWhc-TK, the plaemid PCMV.TK is digested with Clal (the only Clal eitium is located just towards the 5 'end of the open reading frame of TK) and dephosphorylated with alkaline phosphatase from bovine intestine. . To generate a hairpin structure, the synthetic oligonucleotides are annealed HP / cla2 and HP / cla2 and ee are foephorylated in 5'-OH groups with T4-polynucleotide kinase and ATP. The double-stranded oligonucleotide is ligated with the linearized vector fragment and used to transform E. coli strain "Sure". The insertion of the oligonucleotide at the Clal site will interrupt the Clal recognition site. The oligonucleotide contains a new Clal eitium near its terminal part. After the selected clones, the orientation and integrity of the inserted oligonucleotide is verified by sequence analysis. A clone containing the oligonucleotide in the correct orientation (the Clal eitium in the ITR site) is called pAd-CMV-hcTK. This plasmid is co-infected with DNA of type 5 adenovirus type eilvestre digested with Clal in 911 cells. A recombinant adenovirue in which the expiration cation CMV-hcTK becomes the eequencee is isolated and propagated using standard procedures.

To study whether the fork that can be used as a primer for the reverse chain synthesis in the displaced chain after replication has been started in the ITR, the plasmid pICLhac is introduced into the 911 cells, that is, 5 human embryonic retinoblastoe transformed with the El adenovirue region. Plasmid plCUiacw, serves as a control: it contains the HP / asp 1 and 2 oligonucleotide pair in the reverse orientation but otherwise is completely identical to the pICLhac plasmid. They are also included in eetoe eetudios the plasmids pICLI and pICL. In pICLI plasmid, the hairpin is replaced by adenovirus ITR. Plasmid pICL does not contain a hairpin or an ITR sequence. These plasmids serve as controls to determine replication efficiency by virtue of the terminal fork structure.

In order to provide the viral product different from the El protein (produced by lae 9e cells) required for DNA replication, the cultures are infected with viral IG.Ad.MLPI.TK after transfection. Divereoe parameters are used to determine the appropriate replication of the transfected DNA molecules. First, the DNA extracted from the cultures of cells transfected with the plasmids mentioned above and infected with the virule IG.Ad.MLPI .TK ee analyzed by Southern blotting to determine the presence of the intermediates of viralee replications, as well as for the presence of duplicate genomes. Further, tMMÉHa ^^ from populations of cells infected with the plasmid IG.Ad.hMPI.TK and transfected, the virus is isolated without being able to transfer a luciferase marker gene into luciferase negative cells and express it. The plasmid DNA of the plasmids pICLhac, pCLhaw, pICLI and PICL are digested with the SalI restriction endonuclease and treated with mungbean nuclease to remove the extension of 4 single-stranded nucleotides of the resulting DNA fragment. In this way, a terminal part of ITR 5 'of natural adenovirue is generated in the DNA fragment. Subsequently, both pICLhac and pICLhaw plasmids are digested with restriction endonuclease Asp718 to generate the terminal part capable of forming a hairpin structure. The digested plasmids are introduced into the 911 cells, using the standard technique of coprecipitation with calcium phosphate, four containers for each plasmid. During the transfection, for each plasmid, they infect doe of the culture with the virule IG.Ad.MLPI .TK using 5 particles and infeccioeae IG.Ad.MLPI .TK per cell. Twenty hours after transfection and forty hours post-transfection, a culture infected with Ad.tk-virus and one non-infected culture is used to isolate low molecular DNA using the procedure mentioned by Hirt (as described in Einerhand et al. al, (1995) Gene Therapy 2: 336-343). The aliquots of the isolated DNA are used for Southern analysis. After tt ^ agtfj £ jjj? digestion of EcoRI restriction endonuclease samples using the luciferase gene as a probe, a hybridizing fragment of about 2.6 kb is detected only in the samples from cells infected with adenovirus 5 transfected with the pICLhac plasmid. The size of this fragment is related to the anticipated duplication of the luciferase marker gene. This supports the conclusion that the infected fork is capable of serving as a primer for chain linkage. The hybrid fragment eetá aueente, if the virue IG.Ad.MLPI .TK is omitted, or if the fork oligonucleotide is inserted in the inverea orientation. The restriction endonucleaea Dpnl recognizes the sequence of tetranucleotide 5 '-GATC-31, but only for Methylated DNA, (eeto ee, only plamidid DNA propagated in, and derived from E. coli, not DNA that has been replicated in mammalian cells). The restriction endonucleaea Mbol recognizes lae miemae sequences, but separates only unmethylated DNA (specifically, DNA propagated in mammalian cells). The DNA samples from the transfected cells are incubated with Mbol and Dpnl and analyzed with Southern blot. These results show that only the cells tranefected with the plamid and pICLhac and pICLI have present fragments re-labeled to Dpnl and that they are absent in the samples. treated with Mbol. These data show only after * * - * & The transfection of the pICLI and pICLhac plasmids can be introduced into the replication and duplication of the fragments. This data shows that the linear DNA fragment of adenovirus-infected cells that have in one of the terminal parts an inverted terminal repeat sequence (ITR) derived from adenovirus and the other terminal part a nucleotide sequence that can be reassociated at a frequency in the cell. chain, when it is present in the form of a simple chain so that it generates a fork structure, and that they will convert into structures that have repeated terminal sequences inverted in the middle. The resulting DNA molecules will replicate by the same mechanism in the wild-type adenovirus genomes.

Example 4 Demonstration that DNA molecules containing the luciferase marker gene, a single copy of the ITR, the encapsulation signal and a synthetic DNA sequence, which is capable of forming a hairpin structure, are sufficient to generate DNA molecules that can be encapsulated in virions To demonstrate that the DNA molecules generated in Example 3, which contain two copies of the CMV-Luc marker gene _____________ that can be encapsulated in virions, viruses are harvested from two remaining cultures by means of three grinding cycles by lyophilization and used to infect murine fibroblasts. At 48 hours after infection, the infected cells are assayed for luciferase activity. To exclude the possibility that luciferase activity has been induced by free DNA transfer, instead of being made by virus particles, virus concentrates are treated with DNase to remove contaminants. of DNA. In addition, as an additional control, aliquots of the virus concentrates are incubated for 60 minutes at 56 ° C. The heat treatment does not affect the contaminating DNA, but inactivates the virus. Eignificant luciferaea activity is found only in cells after infection with virus concentrates derived from cells infected with IG.Ad.MLPI .TK transfected with the pICLhc and PICLI plasmids. None of the non-infected cells or the infected cells and transfected with pIGLhw and pICL showed significant luciferase activity. Inactivation by heat, but The treatment of DNasal does not completely eliminate luciferase expression, demonstrating that adenovirus particles, and not free DNA fragments (contaminants) are responsible for the transfer of the luciferase reporter gene.

"^^^^» - M BS »« ¿... ^ a ^ A * »» »* -» _ These results demonstrate that these small viral genomes can be encapsulated in adenovirus particles and suggest that the ITR and the Encapsulation signal are efficient for encapsulation of linear DNA fragments in 5 adenovirus particles.These adenovirus particles can be used for efficient gene transparency.When they are introduced into cells that contain and express at least part of the adenovirue genes ( specifically El, E2, E4 and L, and VA), the recombinant DNA molecules that include At least one ITR, at least part of the encapsulation signal as well as a synthetic DNA sequence that is capable of forming a hairpin structure, have the intrinsic ability to autonomously generate recombinant genomes which can be encapsulated in virions.

Such genomes and vector matrices can be used for gene transparency. twenty A 'Example 5 Demonstration of the DNA molecules which contain the nucleotides 3510-35953 (specifically the 9.7-100 may units) of the adenovirus type 5 genome (thus lacking the coding regions for the El protein, the right-side ITR and encapsulation sequences) and a terminal DNA sequence that is complementary to a portion of the same strand of the DNA molecule when it is present in a single-stranded form other than the ITR, and as a result is capable of forming a structure of hairpin, can be replicated in 911 cells In order to develop a replicating DNA molecule that can provide the adenovirus products required to allow the aforementioned ICLhac vector genome and minimal living adenovectors to be encapsulated in adenovirus particles by helper cells, the adenoviral vector is developed. Between the lengthening / promoter region of CMV and the gene for thymidine cinnaea, the annealed oligonucleotide pair (table 1) HP / cla 1 and 2 is inserted. The Ad-CMV-hcTK vector is propagated and produced in 911 cells using standard procedures . This vector is grown and propagated exclusively as a source of DNA used for transfection. AdCMV-hcTK adenovirus DNA is isolated from virus particles that have been purified b.et * '»S) &S5 using density gradient centrifugation with CsCl by standard techniques. Viral DNA is digested with Clal restriction endonuclease. The digested DNA is fractionated by size in 0.7% agarose gel and a large fragment is isolated and used for later experiments. The 911 cell cultures are transfected with the large Clal DNA fragment of Ad-CMV-hcTK using standard calcium phosphate coprecipitation techniques. Much like in previous experiments with the pICLhac plasmid, Ad-CMV-hc replicates starting at the right-side ITR. Once the chain I ee has been displaced, it can form a fork in the left end part of the fragment. This facilitates the elongation of DNA polymerase from the chain to the right side. This process proceeds until the displaced chain is completely converted into its double-stranded form. Finally, the right-sided ITR is regenerated, and in this position, replication-initiation and elongation of the normal adenovirus occurs. The polymerase reads through the fork, so it duplicates the molecule. The introduced 33250 bp DNA molecule, which has on one side an ITR sequence of adenovirus and on the other side a DNA sequence having the ability to form a hairpin structure is doubled so that both ends contain an ITR sequence. The resulting DNA molecule consists of a palindromic structure of approximately 66500 bp.

This structure is detected in low molecular weight DNA extracted in transfected cells using Southern analysis. The palindromic nature of the DNA fragment can be demonstrated by digestion of the low molecular weight DNA with suitable restriction endonucleases by Southern blotting with the HSV-TK gene as the probe. This molecule can replicate itself in transfected cells by virtue of the products of the adenovirus gene which are present in the cells. In part, the genes of adenovirue ee report templates that are integrated into the target cell genome (specifically, the El gene products), the other genes reside in the replicating DNA fragment itself. This linear DNA fragment can not be encapsulated in virions. Not only does it lack all the DNA sequences required for encapsulation, but also the size is too large to be encapsulated. twenty Example 6 Demonstration of the DNA molecules which contain nucleotides 3503-35953 (for example 9.7-100 map units) of the adenovirus type 5 genome (which therefore lacks the coding regions for the El protein, the ITR on the side right and the encapsulation sequences) and a terminal DNA sequence that is complementary to a portion of the same strand of the DNA molecule different from the ITR, and which as a result is capable of forming a hairpin structure, can replicate in cells 911 and can provide the auxiliary functions required to encapsulate the DNA fragments derived from pICLI and pICLhac The purpose of the following series of experiments is to demonstrate that the DNA molecule described in Example 5 can be used to encapsulate the minimal adenovectors described in Examples 3 and 4. The large fragment after the digestion by the DNA Claon endonucleaea of Ad-CW-hcTK is introduced into 911 cells (as described in Example 5) together with the SalI endonuclease, the mungbean nuclease, the plasmid pICLhac treated with the endonuclease Asp718, or as a control treated similarly with the plasmid pICLhaw. After 48 hours, the virus is isolated by trituration by lyophilization of the population of transfected cells. The preparation of the virus ... ... ,, ^,. :. ^^ is treated with ADNasal to remove the contaminant-free DNA. The virus is subsequently used to infect Rat2 fibroblasts. At 48 hours post infection, the cells are assayed for luciferase activity. Only in the cells infected with virus from the cell tranefected with the plasmid pICLhac, and not with the plasmid pICLhaw, is significant luciferase activity demonstrated. Heat inactivation of the virus prior to infection completely suppresses the luciferase activity, indicating that the luciferase gene was tranefected by a viral particle. The infection of lae 9e cells with the virus concentrate does not result in any cytopathological effect, which shows that pICLhac is produced without any infectious auxiliary virus that spreads in 911 cells. These results show that the propotect method can be used to produce Concentrates of minimal adenoviral vectors, and completely lacking infectious helper viruses that may be capable of autonomous replication in trano-transformed cells with adenovirue or in human cells not transformed with adenovirus.

Example 7 Construction of plasmids for the generation and production of minimal adenoviral vectors The minimal adenovirus vector contains as components operably linked the cis-derived elements of adenovirus for replication and packaging, with and without foreign nucleic acid molecules to be transferred. Recently, the lower limit for efficient packaging of adenoviral vectors at 75% of the length of the genome has been determined (Parks and Graham, 1997 [appointment required] To allow the flexible incorporation of various lengths of filled fragments, a site is introduced. Multiple cloning (MCS) in a minimal adenoviral vector To obtain a minimal adenoviral vector according to the invention, the following are elaborated: ee digests pAd / L420-HSA (Figure 21) with BglII and SalI and isolates the fragment containing the vector. This fragment contains the left ITR and the Ad5 packaging signal and the murine HSA gene activated by modified retroviral LTR. The right ITR of adenovirue is amplified by PCR in a template pBr / Ad. BamHl-rITR DNA using the following primers: PolyL-ITR: 5 '-AAC-TGC-AGA-TCT-ATCGAT-ACT-AGT-CAA-TTG-CTC-GAG-TCT-AGA-CTA-CGT-CAC-CCG -CCC-CGT-TCC-3 'and ITRABSNj.5' -CGG-GAT-CCG-TCG-ACG-CGG-CCG-CAT-CAT-CAA-TAA-TAT-ACC3 '. The amplified fragment is digested with PstI and BamHl and cloned into pUC119 digested with the same enzymes. After confirmation of the correct amplification of the ITR and the MCS, a BgelII-SalI fragment is isolated and cloned into the pAd / L420-HSA fragment digested with BgrIIII-SalI described above. The resulting clone is designated pAd / L420-HSA.ITR. To be able to manipulate constructions of lengths exceeding 30 kb, the minimal adenoviral vector pAd / L420HSA. ITR is subcloned into a cosmid vector background. For this purpose, the cosmid vector pWE15 is modified to remove the restriction sites in the main structure of pWE15 and digested with PstI, and 4 kb and 2.36 kb fragments of the agaroea gel are isolated and ligated together. The resulting clone, purified from the SV40 ori / early promoter and the sequence coding for neomycin resistance, are referred to as pWE20. Then pWE20 is digested with Clal and HindIII and the sticky ends are filled with Klenow enzyme. A blunt fragment of 6354 bp is ligated to a phosphorylated Nsil linker with the following frequency: 5'- CGATGCATCG-3 '. The AD? ligated ee extracted with phenol / chloroform, precipitated with EtOH to change buffers and digested with excess Nsil. The AD? digested and separated from the linkers by electrophoresis, is isolated and re-ligated. The resulting clone is called pWE25. The correct insertion of the Nsil linker is confirmed by digestion with restriction enzymes and sequenced. To construct the minimum adenoviral vector, pAd / L420-HSA is digested. ITR with Scal and Notl and the 2 kb fragment containing part of the ampicillin gene and the adeno ITRs are cloned into pWE25 digested with Scal and Notl. The resulting clone is designated pMV / L420H (Figure 24). This clone it allows easy manipulation to exchange the promoter and / or gene, and also allows the insertion of DNA fragments of lengths that are not easily cloned into normal plasmidic structures. Plasmid pMV / CMV-LacZ is produced by exchange of the L420-HSA fragment (SnaBI-BamHl) by a fragment of pcDNA3-nlsLacZ (NruI-BamHl) containing the CMV promoter and coding sequences for LacZ. PcD? A3-nlsLacZ is constructed by insertion of an índ-BamHl fragment obtained after PCR amplification of the nlsLacZ coding sequences in pcD? A3 (Invitrogen) digested with KpnI and BamHl. The reaction by PCR is carried out in AD? of template pMLP.nlsLacZ using the primers 1: 5 '-GGG-GTG-GCC-AGG-GTA-CCT-CTA-GGC-TTT-TGC-AA-3' and 2: 5 • -GGG-GGG-ATC-CAT -AAA-CAA-GTT-CAG-AAT-CC-3. The correct amplification and cloning are confirmed by β-galactosidase expression assay in a transient transfection experiment in 911 cells. The vector pAd / MLPnlsLacZ is produced as follows: pMLPlO is digested (Levrero et al, (1991) Gene 101 : 195-202) with HipdlII and BamHl and ligated, in a three-part ligation, to a 3.3 kb AvrlI-Ba HI fragment from L7RHß-gal (Kalderon et al, (1984) Cell 499-509) and a synthetic linker with HindIII and a hanging part Xbal. The linker is produced by annealing two oligonucleotides of sequence 5 '-AGC TTG AAT TCC CGG GTA CCT-3' and 5 '-CTA GAG GTA CCC GGG AAT TCA-3'.

The resulting clone is named pMLP.nlsLacZ7 / -Ad. Then, pMLP.nlsLacZ / -Ad is digested with Ba Hl and NruI, and the vector containing the fragment is ligated to a 2766 bp Bgrlll-Scal fragment from pAd5SalB (Bernards et al, (1982) Virology 120: 422 -432). This results in the adapter plasmid pMLP.nlsLacZ (described in EP 0 707 071). The propagation of a minimal adenoviral vector can only be obtained by expiation of the adenovirus gene product. The expression of adenovirus gene products, at a level which is eminently high for the production of large numbers of viruses, requires the replication of the nucleic acid coding molecule. Therefore, replication of helper viruses is usually used to complement the minimal adenoviral vectors. However, the present invention provides packaging systems for minimal adenoviral vectors without the use of helper viruses. One of the methods of the invention makes use of a molecule of AD? replicant containing 5'-ITR and all adenoviral sequences between bp 3510 and 35938, ie the complete adenoviral genome except for the El region and the packaging signal. The pWE / Ad. 5 'construct (FIG. 25) is an example of a replicating molecule according to the invention containing two adenoviral .pWE / Ad.? 5' ITRs. It has been manufactured in a cosmid vector background from three fragments. First, the 5 'ITR of Ad5 is amplified using the following primers: ITR-EPH: 5' -CGG-AAT-TCT-TA -TTA-AGT-TAA-CAT-CAT-CAA-TAA-TAT-ACC1- 3 'and ITR-pIX; 5 '-ACG-GCG-CGC-CTT-AAG-CCA-CGC-CCA-CAC-ATT-TCA-GTA-CGT-ACT-AGT-CTA-CGT-CAC-CCG-CCC-CGT-TCC-31. The resulting PCR fragment is digested with EcoRI and AscI and cloned into the vector pNEB193 (New England Biolabe) digested with the same enzymes. The resulting construction is called pNEB / ITR-pIX. The sequence confirms the correct amplification of the sequence Ad5 in the left ITR (Ad5, sequences 1 to 103) bound to the pIX promoter (Ad5, sequence 3511 to 3538) except for a very poor match with the sequence according to GenBank (Access No .: M73260 / M29978), that is, an additional C residue is found just towards the 5 'end of the AflII site. This ITR-pIX fragment is isolated with EcoRI and AflII and ligated to an EcoRI-AflII vector fragment containing the sequences Ad53539-21567. This last fragment is obtained by digethion of pBr / Ad.Cla-Bam (supra) with EcoRI and partially with AflII. The resulting clone is designated pAd / LITR (? 5 ') -Ba Hl. The final construct pWE / Ad.? 5 * ee produced by ligating the vector encoded pWE15.Pac (supra) digested with Pací to pAd / LITR (? 5 ') -BamHl digested with Pací-BamHl and pBr / Ad.Bam-rITR .pac # 2 (eupra) digested with Pací / BamHl (figure 25).

An alternative method to produce packaging systems for minimal adenoviral vectors without the use of helper virus according to the invention is to use a replicating DNA molecule that contains the complete adenoviral genome except for the El region and the packaging signal and in which one of the ITR is replaced by a fragment containing a DNA sequence complementary to a portion of the same chain different from the ITR and which is therefore capable of forming a hairpin structure (Figure 10). In a non-limiting example, the DNA sequence complementary to a portion of the same chain different from that of ITR is derived from the repeated sequence (AAV) adeno-associated virus. Such a replicating DNA molecule is made following the same cloning strategy as described for pWE / Ad.? 5 ', but not starting with the repeated AAV terminal sequence linked to a part of the adenoviral pIX promoter. For this purpose, the adenoviral ITR sequences between the Hpal and Spel sites in the pNEB / ITR-pIX construct are exchanged for the AAV JTR by introducing the PvuII / Xbal fragment from psub201 (+) containing the AAV ITR (Samulski et al. al, (1989) J. Virol. 63: 3822-3828). This results in the construction pWE / AAV.? 5 'which replicates in a cell line complementing El. Another alternative packaging system for minimal adenoviral vectors is described infra and makes use of the SV40 replication system. A functional auxiliary molecule according to this method contains at least the adenoviral sequences necessary to sustain the packaging of a minimal construct but not the El sequences and the packaging signal, and preferably also lacks the ITRs. Eeta 5 entity derived from adenovirus must be present in a vector that contains, in addition to the sequences necessary for propagation in bacteriae, an origin of replication from the SV40 virus. The transfection of such a molecule together with the minimal adenoviral vector, described supra in a cell line of packaging (e.g. PER.C6) which, in addition to lae proteine El, exhibits large T antigen proteins derived from SV40, results in a large T-dependent replication of the auxiliary construct derived from adenovirus. This replication leads to high levels of adenoviral proteins needed for replication of the minimal adenoviral vector and packaged in virus particle. In this way, there is no overlapping sequence leading to homologous recombination between the construction of the minimal adenoviral vector and the auxiliary molecule. In addition, there is no sequence that overlaps and that leads to a homologous recombination between the auxiliary molecule and the minimal adenoviral vector, on the one hand, and the El sequence in the packaging cell, on the other hand. The replication of a 40 kb adenoviral construct was investigated in cells expressing large T proteins of SV40. Here, 2 x 10 6 Cos-1 cells are transfected in a s? H% s & amp; | j g ^^? A ^^^^^^^^^^ T25 flask with the following constructions forming complexes with the lipofectamine reagent (Life techn.): the 8 kb cosmid vector pWE.pac, the 40.5 kb pWE / Ad construct. AflII-rITR and the three clones (# 1, # 5 and # 9) of the construction of 40.6 kb pWE / Ad.? 5 '(described below). Control transfections are carried out with the pWE.pac and pWE / Ad.AflII-rITR constructs digested with the PacI enzyme and with the CMV-LacZ expression vector without the SV40 ori sequence. The transfection efficiency is 50% determined by a separate transfection using the CMV-LacZ vector and the X-gal stain after 48 h. All cells were harvested at 48 h after tranefection and the DNA was extracted according to the Hirt procedure (as described in Einharnd et al, (1995) Gene Therapy 2: 336-343). The sediment The final ones are resuspended in 50 μl of TE + RNase (20 μg / ml) and digest dyeetrae of 10 μl with Mbol (35 units overnight at 37 ° C). The undigested samples (5 μl) and the samples digested with Mbol are run on a 0.8% agarose gel transferred to a nylon filter (Amersham) and hybridized to radioactive probes according to standard procedures. A probe is derived from a 887 bp Dpnl fragment of the cosmid vector pWE.pac and an ee derived from a 1864 bp BsrGI-BamH1 fragment of adenoviral sequences. These probes hybridize with a band of 887 bp and 1416 bp, respectively, in material digested with Mbol. The entry of DNA of bacterial origin is JfaAai ^^^ methylated and therefore not digested with Mbol. In this way it is possible to specifically detect DNA that is replicated in eukaryotic cells. Figure 26a shows a schematic presentation of the pWE / Ad.? 5 'construct and the constructs of the SV40 origin of replication, the pWE-derived probe and the adenovirus-derived probe. The lower part shows the autoradiograms of the Southern blot test hybridized to the adenovirus probe (B) and the pWE probe (C). See the legends for explanation of the sample load. These experiments show that all lanes containing material from Cos-1 cells that are transfected with plasmids harboring SV40 ori contain DNA seleable to Mbol and show a specific band of the eeperated length. Lae bands specifying for replication in the lane with Cos-1 cells transfected with Paci-digested material (lanes B 17/18 and C 15-18) probably result from incomplete digestion of Pací. From these experiments, it can be concluded that it is possible to replicate large fragments of DNA with the LargeT / op SV40 system in eukaryotic cells.

Ejenflo 8 A functional adenovirus helper molecule lacking the ITR sequences is constructed starting with the clone pWE / Ad.D5 'described supra. It digests Pwe / aD.d5 'with * m fe¡kie, _...-: Bstll07I and the fragment containing the 17.5 kb vector is ligated again to provide pWE / Ad.D5 '-Bstll07I. This clone is then used to amplify the 3 'part of the adenovirus genome sequences without the right ITR. A PCR fragment of 2645 bp is generated using the primers Ad3 '/ Forw: 5' -CGG AAT TCA TCA GGA TAG GGC GGT GG-3 'and Ad3' / Rev: 5 '-CGG GAT CCT ATC GAT ATT TAA ATG TTT TAG GGC GGA GTA ACT TG-3 '. The amplified protein is digested with EcoRI and BamHI and eubclone in pBr322 digested with the same enzymes. After Confirming the correct amplification by sequencing, the 2558 bp fragment treated with Sbíl-Clal from this clone is re-cloned into pWE / Ad.D5 '-Bstll071 digested with the same enzymes. The resulting construction lacks the right ITR and is called pWE /? Rl-Bstll07I. Then, in this clone, the ITR left is replaced by a linker with a protruding Paci and AflII constituted by reassociation of the following primers: PA-pIXl 5 '-TAA GCC ACT AGT ACG TAC TGA AAT GTG TGG GCG TGG C-3' and PA-pIX2 5 ' -TTA AGC CAC GCC CAC ACA TTT CAG TAC GTA CTA GTG GCT TAAT-3 '. This removes the left ITR and restores the correct sequence of the pIX promoter. The clone is called pWE /? LTRBstll07I. The correct insertion of the double-stranded linker is confirmed by sequencing. The deleted Bstll07I fragment is then cloned back into pWE /? LTR-Bstll07I and the correct orientation is verified by digestion of restriction. The resulting clone is called pWE / Ad-H. i * a * * i * m? á .- «i-cs-üi * ifiliirtr i iftéa-iiiiiiiiti i mi f After the transfection of this DNA molecule into packaging cells that express protein The adenovirals and the large antigen T of SV40, the replication of this molecule takes place, which results in high levels of adenoviral proteins encoded by the adenoviral entity of that molecule.

Example 9 Additional modifications of the adapters To allow removal of the vector sequences of the left ITR in pAd5 / Clip (described in Example 2B), this plasmid is partially digested with EcoRI and the linear fragment is isolated. An oligonucleotide of the 5 'sequence TTAAGTCGAC-3' is annealed to itself, resulting in a linker with a Sali site and an outstanding EcoRI part. The linker is ligated to vector pAd5 / Clip and clones having the linker inserted in the EcoRI site 23 bp are selected towards the 5 'end of the left adenoviral ITR in pAd5 / Clip which results in pAd5 / Clipeal. Similarly, the EcoRI site in pAd5 / Clip was changed to a PacI site by inserting a linker of the sequence 5 '-AATTGTCTTAATTAACCGCAATT-3' (as described in example 2). The pAd5 / Clip is partially digested with EcoRI, dephosphorylated and ligated to the PacI linker with the overhanging EcoRI part.

The ligation mixture is digested with Pací to remove the concatamers, isolated on agarose gel and then religated. The resulting vector is called pAd5 / Clippac. These changes allow more flexibility to release the left ITR from the 5 sequences of the plasmid vector. The vector pAd5 / L420-HSA is also modified to create a SalI or PacI site towards the 5 'end of the left ITR. Now, pAd5 / L420-HSA is digested with EcoRI and ligated to the Paci linker described above. The ligation mixture is digests with Pací and binds again after linear DNA excision from agarose gel to remove concatamerized linkers. This results in a pAd5 / L420-HSApac adapter plasmid. This construct is used to generate pAd5 / L420-HSAsal as follows: digested pAd5 / L420-15 HSApac with Scal and BerGI and binds the vector fragment to the 0.3 kb fragment isolated after digethion of pAd5 / Clipeal with lae miemas enzimae.

Generation of AdMire and AdApt 20 adapter plasmids To create an adapter plamid that only contains a polylinker sequence without promoter sequence or polyA, it is digested with Avrll and BglII. The vector fragment is ligated to a linker oligonucleotide digested with the same restriction enzymes. The linker is manufactured by annealing oligonucleotides of the following sequence: PLL-1: 5'-GCC ATC CCT AGG AAG CTT GGT ACC GGT GAA TTC GCT AGC GTT AAC GGA TCC TCT AGA CGA GAT CTG G-3 'and PLL-2: 5 '- CCA GAT CTC GTC TAG AGG ATC CGT TAA CGC TAG CGA ATT CAC CGG TAC CAA GCT TCC TAG GGA TGG C-3'. The reassociated linkers are digested with Avrll and BglII and separated from the small ends by column purification (Qiaquick nucleotide removal equipment) according to the manufacturer's recommendations. The linker is then ligated to the pAd5 / L420-HSApac fragment digested with AvrlI / BglII. A clone is selected, called AdMire, which has the incorporated linker and its sequence is determined to verify the integrity of the insertion. The AdMire adapter plasmid allows easy insertion of complete expression cassettes. An adapter plasmid containing the human CMV promoter which mediates high expression levels in human cells is connected as follows. PAd5 / L420-HSApac is digested with Avrll and the 5'-super-expensive ends are filled using the Klenow enzyme. A second digestion with HindIII results in the removal of the eequencee promoter of L420. The vector fragment is isolated and ligated to a PCR fragment containing the CMV promoter sequence. This PCR fragment is obtained after amplification of the sequence ja.HfcCfefaS CMV from pCMVLací (Stratagene) with the following primers: CMVplus: 5 '-GATCGGTACCACTGCAGTGGTCAATATTGGCCATTAGCC-3' and CMVminA: 5 '-GATCAAGCTTCCAATGCACCGTTCCCGGC-3'. The PCR fragment is first digested with PstI (underlined in CMVplus) after which the 3 'over-elevations are removed by treatment with polymerase T4 DNA. Deepuée DNA is digested with HindIII (underlined in CMVminA) and ligated into the vector fragment pAd5 / L420-HSApac described above, digested with Avrll and HindIII. The resulting plasmid is called pAd5 / CMV-HSApac. This plasmid is then digested with HindIII and BamHI and the vector fragment is isolated and ligated to the polylinker sequence obtained after digethion of AdMire with HindIII and BglII. The resulting plaemidoid is called AdApt. The AdApt adapter plasmid contains nucleotides -735 to +95 of the human CMV promoter (Boshart et al., 1985, M. Boehart, F. Weber, G. Jahn, K. Dorsch-Hasler, B. Fleckenetein and W. Schaffner. second date of this adapter plasmid containing a site I left instead of the Pací site to the The 5 'end of the left ITR is manufactured by inserting the 0.7 kb Scal-BerGI fragment from pClipsal into AdApt digested with Scal and partially digested with BsrGI. Eeta clone was called AdApt. Salt .

Example 10 Modifications of the adenoviral plasmids Generation of pWE / Ad.AflII-rITR? E2A: The suppression of the sequence coding for E2A has been carried out as follows from pWE / Ad.Af111-rITR (ECACC deposit P97082116). Lae adenoviral sequences flanking the region coding for E2A on the left and at the right site are amplified from the plasmid pBr / Ad.SalrITR (ECACC deposit P97082119) in a PCR reaction with the PCR system Expand (Boehringer ) according to the manufacturer's protocol. The following primers were used: Right flanking sequences (corresponding to nucleotides Ad5 24033 to 25180): ? E2A.SnaBI: 5 '-GGC GTA CGT AGC CCT GTC GAA AG-3'? E2A.DBP-start: 5 '-CCA ATG CAT TCG AAG TAC TTC CTT CTC CTA TAG GC-3' The amplified DNA fragment was digest with SnaBI and Nsil (the Nsil site is generated in the primer? E2A.DBP-start, underlined).

Sequence flanking left (corresponding to the peptides Ad5 21557 to 22442):? E2A.DB-alt ?: 5-CCA ATG CAT ACG GCG CAG ACG G-3 *? E2A.BamHI: 5-GAG GTG GAT CCC ATG GAC GAG -3 'The amplified DNA is digested with BamHl and Nsil (an Nsil site is generated in the primer? E2A.DBP-high, underlined). Subsequently, the digested DNA fragments are ligated into pBr / Ad.Sal-rITR digested with SnaBI / BamHl. Sequencing confirms the exact replacement of the coding region for DBP with a unique Nsil eitium in the plasmid pBr / Ad.SalorRI® E2A. The unique Nsil site can be used to introduce an expression cassette for a gene that is to be transduced by the recombinant vector. The deletion of the sequences coding for E2A is performed so that the eitial splicing vectors of the L4 gene coding for 100K at position 24048 in the upper chain are left intact. In addition, the polyadenylation signals of RNA for E2A and RNA for original L3 at the site to the left of the sequences encoding E2A ee leave intact. This ensures proper expression of the L3 genes and the gene encoding the large 100K L4 protein the adenovirus life cycle. Afterwards, the plaemido pWE / Ad.Aflll-rlTR? E2A is generated. Plasmid pBrAd.Sal-rITR? E2A is digested with BamHl and Spel. The 3.9 kb fragment is isolated in which the region is which codes for E2A by the unique Nsil site. PWE / Ad.AflII-rITR is digested with BamHl and Spel. The 35 kb DNA fragment is isolated, from which the BamHI / Spel fragment containing the sequence coding for E2A is removed. Fragments are ligated and packaged using phage packed extracts? according to the manufacturer's protocol (Stratagene), which provides the pWE / Ad.AfIII-rITR? E2A plasmid. This cosmid clone can be used to generate adenoviral vectors that are deleted for E2A by co-transfection of PacI-digested DNA together with digested adapter plasmids in packaging cells that express the functional E2A gene product. The examples of complementary E2A cell lines are described below.

Generation of pWE / Ad.AflII-rITRsp The 3 'ITR in the pWE / Ad.AflII-rITR vector does not include the terminal G nucleotide. In addition, the Pací site is located almost 30 bp from the right of ITR. Both characteristics can reduce the efficiency of virus generation due to an inefficient ITR 3 'replication initiation. Note that during the generation of the virus, the left ITR in the adapter plasmid is intact and allows replication of the viral DNA after homologous recombination.

To improve the efficiency of replication initiation in the 3 'ITR, pWE / Ad.Af111-rITR is modified as follows: first the pBr / Ad.Bam-rITRpac # 2 is digested with Pací and deepuée partially digested with Avrll and the fragment containing the 17.8 kb vector is eelated, and ee is phosphorylated using the SAP enzyme (Boehringer Mannheim). This fragment lacks the adenotons of the nucleotide 35464 to ITR3 '. Using the DNA of pWE / Ad.Af111-rITR as a template and the ITR-EPH primers: 5 '-CGG AAT TCT TAA TTA AGT TAA CAT CAT CAA TAA TAT ACC-3' and AdlOl: 5 '-TGA TTC ACA TCG GTC AGT GC-3 'generates a fragment of 630 bp of PCR that corresponds to the sequences Ad5 3'. This PCR fragment is sub-sequently cloned into the pCR2 vector. l (Invitrogen) and sequencing and cloning the clones containing the PCR fragment to verify the correct amplification of the DNA. The PCR clone is then digested with Pací and Avrll and the 0.5 kb adeno-insertion is ligated to the fragment pBr / Ad.Bam-rITRpac # 2 digested with partial Pacl / Avrll, generating pBr / Ad.Bam-rITRsp. Then, this construct is used to generate a cosmid clone (as described in example 2) having an insert corresponding to the adenos sequences 3534 to 35938. This clone is called pWE / Af111-rITRep. .-jstoft »Generation of adenovirus template clones lacking DNA that codes for fiber Adenovirus infection mediated by two capsid, fiber and penton proteins. The union of the virus of the cells is obtained by interaction of the super-high fiber protein with a receptor on the cellular surface. Internalization follows the interaction of the penton protein with integrins on the cell surface. It has been shown that at least part of the adenovirue of subgroup C and B use a different receptor for cell binding and therefore have different infection efficiencies in different cell types. Therefore, it is possible to change the spectrum of adenovirus infection by changing the fiber in the capsid. The sequence coding for adenovirus fiber serotype 5 is located between nucleotides 31042 and 32787. To remove serotype 5 adenovirus DNA coding for fiber, we start with the construction pBr / Ad.Bam-rITR. First, a Ndel site is removed from this construction. For this purpose, the plasmid DNA of pBr322 is digested with Ndel from which the ends are expanded and filled using the enzyme Klenow. This is plamid pBr322 after which it is ligated again, it is digested with Ndel and transformed into E. coli DH5a. The pBr /? NdeI plasmid obtained is digested with ScaI and SalI and the vector fragment resulting 3198 bp fragment ligated to the 15349 bp ScaI t-Sall derived from pBr / Ad.BamrITR, resulting in pláemido pBr / Ad.Bam-rITR? Ndel which, therefore, contains a unique Ndel site. Then, PCR was performed with oligonucleotides NY-up: 5 '- CGA CAT ATG TAG ATG CAT TAG TTT GTG TTA TGT TTC AAC GTG-3' and Ny-down: 5'-GGA GAC CAC TGC CAT GTT-3 * During amplification, both Ndel (bold) and a Neil restriction site (outlined) are introduced to facilitate the cloning of the amplified fiber DNA. The amplification consists of 25 cycles, each 45 sec at 94 ° C, 1 min at 60 ° C and 45 sec at 72 ° C. The PCR reaction contains 25 pmol of NY-up or NY-down oligonucleotides, 2 mM dNTP, PCR buffer with 1.5 mM MgCl2 and 1 unit of Elongase thermostable polymerase (Gibco, The Netherlands). One-tenth of the PCR product is run on an agarose gel, which means that the enervated DNA fragment of ± 2200 bp is amplified. This PCR fragment is subsequently purified using the Geneclean equipment system (BiolOl Inc.). Afterwards, both the pBr / Ad.Bam-rITR? Ndel connection and the PCR product are digested with Ndel and Sbfl restriction enzymes. The PCR fragment is subsequently cloned ^^^ ^^ ^^ ^ .. ^ aA-aiÉgA .¿j ^ using T4 ligase enzyme into pBr / Ad.Bam-rITR? NdeI digested with Ndel and Sbfl, generating pBr / Ad.BamR? Fib. This plasmid allows the insertion of any fiber amplified by PCR through the unique Ndel and Neil sites that are inert instead of the removed fiber sequences. Viruses can be generated by a double homologous recombination in packaging cells described infra using of an adapter plasmid, pBr the / construccionn Ad.Af111-EcoRI digested with PacI and EcoRI and a construction pBr / Ad.BamR? Fib in which they have been inserted heterologous sequences for fibers. To increase the efficiency of virus generation, the pBr / Ad.BamR? Fib connection is modified to generate a Pací eitio that flanks the right ITR. Deepuée, ee digested pBr / Ad.BamR? Fib with AvrII and the 5 kb adenofragment ee isolated and introduced into the pBr / Ad.Bam-rITR.pac # 8 vector (described in example 2) corresponding AvrII fragment replacing. The resulting construction is called pBr / Ad.BamR? Fib.pac. Once a heterologous fiber sequence in pBr / Ad.BamR? Fib.pac, the cloned Adenovirus fiber modified right hand side can be introduced into a large cosmid clone as described for pWE / Ad.Af111- it is introduced rITR in example 2. Such a large cosmid clone allows the generation of adenovirus by only a homologous recombination making the process extremely efficient.

Generation of adenovirue clones that lack the DNA that codes for the exon A major limitation for gene therapy approaches using recombinant adenoviruses based on adenovirus type 5 is the presence of neutralizing antibodies in human serum. An amount of up to 80-90% of individuals have neutralizing immunity for Ad5. Most of the neutralizing antibody is directed to the exon protein. The exon proteins of different serotypes show highly variable regions present in the rhizoe that are predicted to be exposed outside the virus (Athappilly et al., 1994, J. Mol. Biol. 242, 430-455). Most of the type-specific epitopes have been mapped for these highly variable regions (Toogood et al., 1989; J. Gen Virol., 70, 3203-3214). Therefore, replacing (part of) the exon sequences with the corresponding sequences of a different serotype is an effective strategy for dodging neutralizing (pre-existing) antibodies to Ad5. The sequences encoding exon adenovirue serotype 5 are located between nucleotides 18841 and 21697. To facilitate easy exchange of sequences encoding exon serotype of alternative adenovirus in the serotype 5 adenovirus backbone, first a shuttle vector is generated . This subclone, encoded as pBr / Ad.Eco-Pmel ee generates as when first digesting the pEMB232 pBr322 with EcoRI and EcoRV and inserting the 14 kb Pmel-EcoRI fragment from pWE / Ad.AflII-Eco. In this shuttle vector, deletion of the SanDI fragment of 1430 bp is performed by cleavage with SanDI and religation to provide pBr / Ad.Eco-Pmel? SanDI. The fragment removed contains unique Spel and Muñí sites. From pBr / Ad.Eco-Pmel? SanDI. The fragment removed contains unique Spel and Munl sites. From pBr / Ad.Eco-Pmel? SanDI the serotype 5 adenovirus DNA encoding the exon is deleted. Therefore, the sequences flanking the exon are amplified by PCR and they join together, generating single restriction sites that substitute the coding region of the exon. For eetae reaction of PCR, four different oligonucleotides are required:? Hexl-? Hex4. ? hexl: 5'- CCT GGT GCT GCC AAC AGC-3 '? hex2: 5'- CCG GAT CCA CTA GTG GAA AGC GGG CGC GCG-3'? hex3: 5'- CCG GAT CCA ATT GAG AAG CAA GCA ACA TCA ACA AC-3 ' ? hex4: 5 * -GAG AAG GGC ATG GAG GCT G-3 'The amplified DNA product of ± 1100 bp obtained with the oligonucleotide, hexl and? hex2 is digested with BamHI and Fsel. The amplified DNA product of ± 1600 bp obtained with the oligonucleotide? Hex3 and hex hex4 is digested with BamHi and Sbfl. These PCR fragments digested subsequently are purified from agarose gel and in a three part ligation reaction using the T4 ligase enzyme bound to pBr / Ad.Eco-Pmel? SanDI digested with Fsel and Sbfl. The resulting construction is called pBr / Ad.Eco-Pme? Hexon. This construction was partly in order to confirm the correct nucleotide sequence and the presence of unique Muñí 5 and Spel restriction sites. The pBr / Ad.Eco-Pme? Hexon plasmid serves as a shuttle vector to introduce heterologous exon sequences amplified from the viral DNA of different serotypes using primers that introduce the restriction sites unique Muñí and Spel at the 5 'and 3' ends of the exon sequence, respectively. The exon modified sequences are subsequently introduced into the pWE / Ad.AfIII-rlTR construct by exchange of the AscI fragment, generating pWE / Ad.AflII-rITRHexXX where the XX strands for the serotype are used to amplify exon sequencing.

Generation of adenoviral clones lacking penton-encoding DNA The adenovirus type 5 penton gene is located between sequences 14156 and 15869. The penton cell is the adenovirus capsid protein that mediates the internalization of the virue within the target cell. It has been demonstrated that at least some serotypes (type C and B) obtain this by interaction of a RGD sequence in the penton with integrins on the cell surface. However, F-type adenoviruses do not have an RGD sequence and for most of group A and D viruses, the penton sequence is not known. For this, the pentone may be involved in the specificity of the target cell. In addition, as a capsid protein, the penton protein is involved in the immunogenicity of the adenovirus. Individuals, which include patients who are candidates for gene therapy approaches, may have preexisting antibodies directed toward the proteins of pentone in your serum. The replacement of Ad5 penton sequences with penton sequences from other serotypes different to them will affect the specificity of infection as well as the immunogenicity of the virus. To be able to introduce heterologous eecuenciae of pentona in Ad5, we make use of the plasmid-based system described infra. First, a shuttle vector for penton sequencing is produced by inerting the 7.2 kb Nhel-EcoRV fragment of the pWE / Ad.AflII-EcoRI construct (described in Example 2) in pBr322 digested with the same enzymes. The re-emerging vector ee denominates pBr / XN. From the time of Ad5 plastid, the penton sequences are suppressed and replaced by unique restriction sites which are then used to introduce new pentyne sequences from other serotypes. Therefore, the left flanking sequences of penton in pBr / XN are applied by PCR using the following primers: DP5-F: 5'- CTG TTG CTG CTG CTA ATA GC-3 'and DP5-R: 5'- CGC GGA TCC TGT ACA ACT AAG GGG AAT ACA AG-31 DP5-R has a BamHl site (underlined) for ligation to the right flanking sequence and also introduces a unique BsrGI site (negrillae) at the 5 'end of the anterior Ad5 penton region. The right flanking sequence is amplified using: DP3-F: 5 'CGC GGA TCC CTT AAG GCA AGC ATG TCC ATC CTT-3' and DP3-3R: 5'- AAA ACA CGT TTT ACG CGT CGA CCT TTC-3 'DP3- F has a BamHl site (underlined) for ligation to the left flanking sequence and also introduces a unique AflII (bold) site at the 3 'end of the anterior Ad5 penton region. The two ree PCR fragments are digested with BamHI and ligated together. After this ligation mixture, it is digested with April and BglII. pBr / XN, Avrll and BglII are also digested and the vector fragment ligated to the digested ligated PCR fragments. The resulting clone is called pBr / Ad.? pentone Sequences coding for penton from loe eerotypee other than Ad5 are amplified by PCR so that the 5 'and 3' ends contain the BsrGI and Aflll sites, respectively. The introduction of these heterologous penton sequences in pBr / Ad. ? pentona generates constructs called pBr / Ad .pentonaXX where XX represents the serotype number corresponding to the serotype H ^ ^ H ^ used to amplify inserted penton sequences. Subsequently, new pentone sequences are introduced into the pWE / Ad.Af111-rITR construct by changing the common Fsel fragment. Importantly, instead of 5 pWE / Ad.AflII-rITR it is also possible to insert the Feel fragment from pBr / Ad.pentonaXX into a pWE / Ad.AfllII-rITR vector having a modified sequence of exona and / or of fiber. In this way, the plasmid-based system for generating adenovirus allows a flexible design of any adenovirus 10 with any desired characteristic with respect to the efficiency and specificity of infection of the target cell as well as immunogenicity.

Ejepflo 11 15 Generation of virue replicants The plasmid-based system for generating recombinant adenovirus described infra is also suitable for generating replicating viruses. Replicating viruses can also be used for gene therapy solutions aimed at eradicating tumor cells. For example, suicide gene therapy methods using replicating adenoviruses that express the gene for herpes simplex virus thymidine kinase-1 (HSV-tk) may have improved efficacy due to a increased dissemination of the vector. Safety is ensured by the possibility of blocking replication at any time by administering ganciclovir. The virue replicants that express HSV-tk or a marker gene have been generated with a double homologous recombination system described in example 2. Therefore, the following constructions are transfected into packaging cells: - pBr / Ad.UTR-SalI (9.4), digested with EcoRI and Sali to release the adeno insertion of the vector sequences. - pWE / Ad.AflII-EcoRI digested with Pací and EcoRI pBr / Ad.Bam-rITR? gpl9K / luc2 or pBr / Ad.Bam-rITR? gpl9K / TK digested with Salí, so the third construct is a derivative of the construction pBr / Ad.Bam-rITR that is made by replacing the region coding for gpl9K with either a marker gene (luciferase) or with the HSV-tk gene as described in the example 2 for viruses deleted in El with changes in the region E3. Instead of pBr / Ad.Bam-rITR, the modification of the E3 region can also be entered in pBr / Ad.Bam-rITRpac # 2 or # 8, or in pBr / Ad.Bam-rITRsp. This allows the release of the right RTI of the vector sequences by digethion with Paci and increases the efficiency by which the viruses are generated.

Ejepflo 12 Generation of recombinant virue using the system based on plaemido, which is extremely efficient and reliable Several methods for the generation of recombinant adenovirus have been previously described. One of these methods makes use of a large circular adenoviral plasmid that is cotransfected in packaging cells with a linearized adapter plasmid (Bett et al., 1994). The efficiency of this method is low due to the fact that the ITRs are joined head-to-head in the large adenoviral plasmid. Other methods make use of a recombination step in specialized bacteria that leads to a recombinant viral DNA clone (Chartier et al., 1996; Crouzet et al., 1997; He et al., 1998). After processing the restriction analysis of the clones and selecting the correct recombinants, a different strain of bacteria must be transformed to produce a large batch of the DNA. After, linearized fragments are transfected into packaging cells and the recombinant virus appears within a week after transfection. The plasmid system described infra differs from the methods described above. The system combines the manipulation easy plasmids small adapters in standard vectors "^ ~ With an efficient homologous recombination in packaging cells due to large linearized adenoviral plasmids. The high efficiency of the homologous recombination in packaging cells that complement the ee exemplifies by the experiment described below. A 96-well microtiter tissue culture plate (plate 1) (Greiner, Paísee Bajoe, catalog # 6555180) is first coated with poly-L-lieine (PLL, 0.1 mg / ml) (Sigma), dissolved in eterile water by incubation of each well for 20-120 minutes at room temperature. Alternatively, pre-coated 96-well plates (Becton and Dickinson) can be used. After incubation with PLL, each well is washed twice with 100 μl of sterile water and dried at room temperature for at least two hours. The day before the transfection, PER.C6 cells are harvested using trypsin-EDTA and counted. The cells are then diluted to a suspension of 45,000 cells per 100 μl followed by plating of 100 μl per well of 96-well plates coated with PLL. The next day, 2.6 μl of pAd / CMV-LacZ linearized with Sal I and 2.6 μl of plasmid DNA pWE-Ad.Af111-rITR linearized with Pací (both at 1 μg / μl) and 95 μl of Eagle's medium modified by Duibecco (DMEM) serum-free is mixed with 25.6 μl of lipofectamine diluted in 74.4 μl of serum-free DMEM by adding lipofectamine to the DNA mixture. The DNA / lipofectamine mixture is left at room temperature 3r a, ^. ^. ^. «... be for 30 minutes, after which 1.3 ml of serum-free medium is added. This last mixture is then added (30 μl per well) to wells seeded with PER.C6 which are washed with 200 μl of DMEM before transfection. After 3 hours in a C02 incubator and humidified (37 ° C, 10% C02), 200 μl of DMEM is added with 10% fetal bovine serum, 10 mM MgCl2, added to each well and the plates are returned to the incubator. C02 humidified. The next day, the medium of each well is replaced with 200 μl of DMEM, 10% FCS, 10 mM MgCl 2. The plaque is then left in the humidified C02 incubator for three additional days after which the well is lyophilized at -20 ° C for at least 1 hour followed by reheating and resuspension by repeated pipetting. The transfection efficiency is determined using lacZ staining in additional plates and found to be approximately 40% for each tranexfected cell well PER.C6. An aliquot of 100 μl of transfected frozen / reheated cells is transferred to each well of a plate with new PER.C6 cells seeded as described above, without plates coated with PLL (plate 2). The second 96-well plate with PER.C6 cells incubated with frozen / reheated cell lysate from the first transfected plate is checked for CPE. At least 5% of the wells show free CPE after 2 days. Four days after infection with the plate 1 lysate, the plate is subjected to a freeze-reheat cycle and 10 μl of each well lysed is added to the wells of a plate seeded with A549 cells (1 x 104 cells per well seeded in 100 μl DMEM, 10% FCS the previous day). Two days after infection, the wells are stained for 5 lacZ activity. Of the infected wells, 96% become infected and stain blue. All dye wells and a large number of wells show 100% blue staining and therefore the transfection of all cells with adenoviral vector presenting lacZ. Extrapolated from the MOI experiments in flasks of tissue culture, the adenoviral titre of those produced in well ee of approximately 106-107 infectious units per ml. From the high percentage of wells containing LacZ virus, we conclude that the system based on plaemids for the generation of adenovirus described infra ee very efficient. In addition to being highly efficient, the system is also very reliable. Using the usual procedure for virus generation as described in example 2 (section C) we obtain a T80 flask with cells infected with adenovirue showing complete CPE. Different virus concentrates obtained after cotranefection with adaptive plamidids that present different transgenes (luciferase, LacZ, ratIL-3, humanLLla, HSV1-TK, ceNOS, hgplOO) and different promoters (MLP, CMV, E3 or retroviral LTR) in a total of 16 transfections, undergo plate purification and plates Separate are tested for expression of the transgene. Of the total of 145 plates, it is found that only two are negative. When the positive plaques of the first plaque purification are subjected to a second round of plaque purification, all plates tested are found to be positive (144 of 144 tested). This clearly shows that the plasmid-based system of the invention is very reliable.

Ejepflo 13 Generation of minimal adenoidal vectoree with large ineercionee e Examples 7 and 8 describe methods for the production of minimal adenoviral vectors in packaging cells expressing El. The minimum vectors described herein only contain one expression cassette for a gene of interest and the adenovirus ITRs and the packaging sequences.

Efficient packaging of adenoviruses requires a length of > 27 kb (Parks and Graham, 1997, J. Virol 71, 3293-3298). For this, in order to be able to produce minimum adenovirue elevae titres, it is necessary to include DNA filled in the vectors to reach the optimum packing size. In case one designs a gene correction vector, it is possible or necessary to include a large DNA fragment £ 3? ^ S ^ ¿^ ^ μ! ^? > & > , ^. genomic homolog to the genome site to which it is directed. In other cases, the gene of interest may not be large enough to meet the packing size and a filling must be included. Here we describe the construction of larger minimum vectors with filler DNA and a method to produce vector talee. The Vector vector pMV / L420H (Figure 24) and pMV / CMV-LacZ ee modify first to create a second Notl site flanking the left ITR. For this, pMV / LR20H is partially digested with EcoRI and the linear fragment is isolated. This fragment is ligated to a double-chain linker that is obtained by annealing an oligonucleotide of the sequence 5'-AATTGCGGCCGC-3 '. A clone is selected which has the Notl linker in the correct EcoRI site. This clone is called pMV / L420H.nn. Next, pMV / CMV-LacZ is digested with Scal and BsrGI and the 7 kbp fragment lacking part of the Amp gene and the adenovirus ITR are isolated. This fragment is then ligated to the 0.7 kbp Scal-BsrGI fragment of pMV / L420H.nn. This results in pMV / CMV-LacZ .nn. In both minimal vectors, pMV / L420H.nn and pMV / CMV-LacZ .nn, the ITRs are flanked by a NotI site. Since the principal structure of the vector is a cosmid vector based on pWE15, clones can be used to insert large fragments of filler DNA. Fill inserts can be any piece of DNA that does not contain regions of ^ t ^^^ tejp ifa? ^ MÉifc active transcription. Alternatively, the minimum vectors described can be used to insert a large fragment of genomic DNA. In case a marker gene is not required, the insertion may be such that the expression cassette for the HSA gene or the LacZ gene is replaced by the genomic fragment by making use of the Avrll SnaBI site at the 5 'end of the expression cassette and unique sites at the 3 'end. An example of a suitable filler DNA is a part of the 44th intron of the human dystrophin genomic DNA (access code Genbank: M86524). The generation of large cosmid clones containing the minimal adenoviral vectors described above and 31.7 kb of the dystrophin intron sequence are described below. Here, the dietrofine sequence is digested with Xhol and BstBI, and the 31.7 kb fragment is isolated. Part of the fragment is left with the ends sticky, part is filled with Klenow. Next, pMV / L420H.nn is digested with Xhol and Clal and ligated to the dietrofine fragment with the sticky ends. PMV / CMV-LacZ .nn is digested with XhoI, blunted with Klenow enzyme and ligated to the dystrophin fragment that has become blunt. Both ligations are packaged as described above. Large clones generated in this manner tend to be unstable in bacteria probably due to the large insertion in the presence of two repeated eequencee and inverted adenovirus terminals. An improved method to generate these vectors large minimums are described below. This method makes use of : ___________ i i'Hffirfillri 1 ^ '* powerful homologous recombination system in packaging cells for the generation of recombinant virus.

Generation of minimal adenoviral vectoree by homologous recombination in packed cells PMV / CMV-LacZ.nn is digested with Xhol and Nsil, and the ends are blunted with T4 DNA polymerase. The linear fragment is isolated and ligated to approximately 17.5 kbp of the Xhol / Kpnl fragment from the dystrophin intron and blunted with T4 DNA polymerase. Clones containing the dystrophin fragment are selected in the 5 'to 3' direction. Eeta clone, designated pMV / CMV-LacZ. Dye5 'contains the left ITR and the adenovirue packaging signal in addition to the LacZ expression cassette and the 5' part of the dystrophin insert. A second clone is then made by digestion of pMV / CMV-LacZ .nn with BglII. The linear fragment is then partially digested with Ntol and the 6.4 kb vector fragment blunted with Klenow and isolated. This fragment is then ligated to the 18.8 kb PvuI-BstBI dystrophin fragment and becomes blunt with DNA polymerase T4. Clones containing the dystrophin fragment are selected in the 5 'to 3' direction. This clone, designated pMV / Dys3 '-ITR contains a dystrophin insert having an overlap of 4.5 kb with the dystrophin fragment in pMV / CMV-LacZ.Dye5'. -__ ^ ¡___ IJlBMfttA ^ Kifc ttrft. »Minimum adenoviral vectors containing the full length of the 31.7 kb XhoI-BstBI fragment are produced by cotransfection of adenovirus packaging cells (eg PER.C6) with pMV / CMV -LacZ .Dys5 'and pMV / Dye3' with an adenoviral auxiliary plamid as described in this invention, for example pWE / Ad.D5 'or pWE / AdH and an expression construct SV40 LargeT (see examples 7 and 8). For this, the pMV / CMV-LacZ .Dys5 'construct is digested with Notl and BetBI, and pMV / Dys3' is digested with Notl and Pvul to release the ITRs from the vector sequences to minimize the amount of vector DNA bound to the vector. the inertiation of dietrofina reason why recombination and homologous replication is enabled.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Connections of pBS. PGK PCRI. pBS.PGK.PCRI encodes the human cinaea foefoglycerate (PGK) promoter operably linked to the adenovirue El oligonucleotide 459-916 (Ad5). To construct this plasmid, the nucleotides 459-916 of Ad5 are amplified by PCR with primers Ea-1 and Ea-2, and digested with Cia I and ee clone in the loci Cía I -EcoR V of pBluescript (Stratagene). which results in pBS. PCRI. The PGK promoter is cut from pTN by complete digestion with Sea I and partial digestion with EcoR I and cloned into the corresponding sites of pBS.PCRI, resulting in pBS. PGK PCRI. Figure 2. Construction of pIG.ElA.ElB.X. pIG.ElA.ElB.X codes for nucleotides 459-5788 of Ad5 (ElA and ElB regions) operably linked to the human pGK promoter. pIG.ElA.ElB.X also codes for the p5 protein of Ad5. pIG.ElA.ElB.X is constructed by substituting the Sea I-BspE fragment of pAT-X / S with the corresponding fragment of pBS.PGK.PCRI. Figure 3. Connecting pIG.ElA.NEO. IG.ElA.NEO codes for Ad5 nucleotides 459-1713 operatively linked to the human PGK promoter. The ElB promoter functionally linked to the neomyeloma resistance gene (NeoR) and the poly (A) signal from the hepatitic virus B (HBV) are also encoded. In this construct, the AUG codon of the 21 kDa ElB protein functions as the NeoR start codon. To construct this plasmid, the ElB promoter and the start codon (ATG) of the 21 kDa ElB protein are amplified by PCR with primers Ea-3 and Ep-2, where Ep-2 introduces a Neo I site (5 ' -CCATGG) at the start codon of the 21 kDa protein. The PCR product (PCII) is digested with Hpa I and Ncol and ligated into the corresponding sites of pAt-X / S, producing pAT-X / S-PCR2. The Ncol -Stul fragment of pTN, containing NeoR and a portion of the poly (A) site of HBV is ligated into the Neo i-Nru I sites of pAT-X / S-PCR2, which produces pAT-PCR2-NEO. The HBV poly (A) signal is completed by replacing the Sea I-Sal I fragment of pAT-PCR2-NEO with the corresponding fragment of pTN, producing pAT.PCR2.NEO.p (A), and replacing the Sea I fragment. -Xba I of pAT.PCR2.NEO.p (A) with the corresponding fragment of pIG.ElA.ElB.X, which produces pIG.ElA.NEO. Figure 4. Construction of pIG.ElA.ElB. pIG.ElA.ElB contains nucleotides 459-3510 of Ad5 (proteins ElA and ElB) operably linked to the PGK promoter and the poly (A) signal of HBV. This plasmid is constructed by PCR amplification of the N-terminal amino acids of the 55 kD ElB protein with primers Eb-1 and Eb-2, which introduce an Xho I eitium, digested with Bgl II and cloned in the Bgl II sites. -Nru I of pAt-X / S, producing pAT-PCR3. The Xba I-Xho I fragment from pAT-PCR3 is replaced by the Xba I-Sal I fragment (containing the poly (A) of HBV) from pIG.ElA.NEO to produce pIG.ElA.ElB. Figure 5. PIG.NEO connection. pIG.NEO contains NE0R operatively linked to the ElB promoter. pIG.NEO is constructed by ligating the Hpa I-Sea I fragment from pIG.ElA.NEO which contains the ElB promoter and NeoR at the EcoR V-Sca I sites of pBS. Figure 6. Transformation of primary baby rat kidney (BRK) cells by adenovirue packaging. Subconfluent receptacles of BRK cells are transfected with 1 or 5 μg of either pIG.NEO, pIG.ElA.NEO, pIG.ElA.ElB, pIG.ElA.ElB.X, pAd5XhoIC, or pIG.ElA.NEO plus pDC26, which express the ElB gene of Ad5 under the control of the SV40 early promoter. Three weeks after transfection, the foci are visible, the cells are fixed, stained by Giemsa and the foci are counted. The results shown are the average number of outbreaks per 5 duplicates of containers. Figure 7. Western blot analysis of transfected A549 clones with pIG.ElA.NEO in embryonic retinoblasts human (HER cells) transfected with pIG.ElA.ElB (clone PER). The expression of the 55 kD and 21 kD ElA and ElB proteins of Ad5 in transfected A549 cells and PER cells is determined by Western blot with mouse monoclonal antibodies (Mab) M73 which recognize the products of the ElA and Mab AIC6 gene and ClGII, which recognize the ElB proteins of 55 kDa and 21 kDa, respectively. Mab binding is visualized using goat anti-mouse antibody labeled with horseradish peroxidase and increased chemiluminescence. Cells 293 and 911 serve as controls. 20 Figure 8. Southern blot analysis of cell lines 293, 911 and PER. The cellular DNA is extracted, digested with Hind III, subjected to electrophoresis and traneffered to Hybond N + membranes (Amersham). The membranes are hybridized to radiolabeled probes generated by random priming of the í M | ^ g | Ssp I -Hind III fragment from pAdS.SalB (nucleotides 342-2805 of Ad5). Figure 9. Transfection efficiency of PER.C3, PER.C5, PER.C6 and 911 cells. Cells are cultured in 5 6 well plates and transfected in duplicate with 5 μg of pRSV.lacZ by coprecipitation with calcium phosphate. Forty-eight hours after transfection, the cells are stained with X-Gal and the blue cells counted. The results shown are the average percentage of blue cells per well. 10 Figure 10. Construction of the adenovirue vector, pMLPI.TK. It is given to pMLPI.TK so as not to have superposed sequences with the packaging construction pIG.ElA.ElB. PMLPI.TK is derived from pMLP.TK by euphression of the sequence overlay region with pIG.ElA.ElB and deletion of the non-coding sequences derived from LacZ. The SV40 poly (A) sequences of pMLP.TK are amplified by PCR with primers SV40-1, which introduces a BamH I and SV40-2 site, which introduces a Bgl II site. The sequences 2496 to 2779 of pMLP.TK Ad5 are amplified by PCR with the primers Ad5-1, which introduces a Bgl II and Ad5-2 site. Both PCR products are digested with Bgel II, ligated and amplified by PCR with primers SV40-1 and Ad5-2. This third PCR product is digested with BamH I and Afl III and ligated into the corresponding sites of pMLP.TK, producing PMLPI.TK.

^^ Kl, -A -, 'í Figure 11A-B. The new adenovirus packaging constructs do not have sequence overlapping with new adenovirus vectors. The regions of sequence overlap between the packaging construct, pAdSXhoIC 5 expressed in 911 cells and adenovirus vector, pMLP.TK that can result in homologous recombination and the formation of adenovirus capable of replicating ee show (panel A). In contrast, there are no sequence regions that overlap between the new packaging construction, pIG.ElA.ElB, expressed in PER.C6 cells and the new adenovirus vector pMLPI.TK (panel A) or between the new packaging construct pIG.ElA.NEO and the new adenovirus vector pMLPI.TK (panel B) that may result in homologous recombination and the formation of adenovirus capable of replication. 15 Figure 12. Generation of recombinant adenovirus, The recombinant adenovirus IG.Ad.MLPI .TK is generated by co-transfection of 293 cells with Sal I linearized with PMLPJ.TK, and the right arm of Ad5 DNA of the wild type digested with Co. I. The homologous recombination between pMLPI.TK linearized and the DNA of Ad5 type eilvestre produces DNA IG.Ad.MLPI .TK, which contains a deletion of nucleotides 459-3510. The 293 trane cells complement the deleted Ad5 genome, therefore, they permit the replication of the DNA IG.Ad.MLPI .TK and its packaging in the virulence particles.

Figure 13. Reasoning for the design of recombinant DNA molecules derived from adenovirus that duplicate and replicate in cells expressing adenovirus replication proteins. A diagram of the adenovirus double-stranded DNA genome is shown indicating the approximate positions of El, E2, E3, E4 and L. The terminal polypeptide (TP) attached to the 5 'terminal part is indicated by black circles. The right arm of the adenovirus genome can be purified by removal of the left arm by digestion with restriction enzymes.

After the tranefection of the right arm in 293 or 911 cells, the adenoviral DNA polymerase (white arrow) codes on the right arm, and will produce only single chain forms. No double-stranded or single-stranded DNA can replicate because they lack an ITR in one part terminal. By providing the single stranded DNA with a sequence that can form a hairpin structure at the 3 'end portion, which can serve as a substrate for the DNA polymerase, which will extend the hairpin structure along the entire length of the molecule. This molecule can also serve as a stratum for a DNA polymerase, but the product is a duplicated molecule with the ITRs in both terminal parts that can be replicated in the presence of adenoviral proteins. Figure 14. Replication of the adenoviral genome. He adenoviral genome is shown in the upper left.

Sle-a ^? AiMac.

The origins of replication are located within the left and right ITR at the ends of the genome. DNA replication occurs in two stages. Replication proceeds from an ITR that generates a daughter duplex chain and a displaced parental single strand which is coated with an adenoviral DNA binding protein (DBP, white circles) and that can form a pan handle structure by re-association of the ITR sequences in both terminal parts. The pan handle is a substrate for DNA polymerase (Pol: white arrows) to produce a double-stranded genomic DNA. Alternatively, the replication comes from both ITRs, generating two daughter molecules, so the requirement for a pan handle structure is eliminated. Figure 15. Potential hairpin conformation of a single-stranded DNA molecule containing the HP / asp sequence. Digestion with Asp718 I of pICLha, containing the cloned oligonucleotides, HP / aspl and HP / asp2, provides a linear double-stranded DNA with an Ad5 ITR in one terminal part and the HP / asp sequence in the other terminal part. In the cells, which express the E2 region of adenovirus, a single-stranded DNA is produced with an ITR in Ad5 in the 5 '-terminal part and the hairpin conformation in the 3' -terminal part. Once formed, the hairpin can serve as a primer for cellular DNA and / or adenoviral DNA polymerase to convert single-stranded DNA to double-stranded DNA.

Figure 16. Diagram of pICLhac. pICLhac contains all the elements of pICL (Figure 19) but also contains in the Aeplld site the HP / asp sequence in an orientation that will produce the hairpin structure shown in Figure 15, after linearization by digestion with Asp7l8 and transfection in cells expressing adenovirus E2 proteins. Figure 17. pICLhaw diagram. pICLhaw is identical to pICLhac (figure 16) with the exception that the inserted HP / asp sequence is in the opyeeta orientation. Figure 18. Schematic representation of pICLI. pICLI contains all the elements of pICL (figure 19) but also contains the site Asp718, an ITR Ad5. Figure 19. Diagram of pICL. pICL is derived from the following: (i) nucleotides 1-457, nucleotides Ad5 1-457 which include the left ITR, (ii) nucleotides 458-969, human CMV extender and immediate early promoter, (iii) nucleotides 970-1204, exon 19S of SV40 and intron 16 / 19S truncated, (iv) nucleotides 1218-2987, firefly luciferase gene, (v) nucleotides 3018-3131, polyadenylation signals in battery SV40 of late transcript, (vi) nucleotides 3132-5620, eecuenciae pCU12 including an eitio Asp718, and (vii) gene of ampicillin resistance in reverse orientation. Figure 20: Shows a schematic review of adenovirus fragments cloned in vectors derived from pBr322 (plasmid) or pWE15 (cosmid). The upper line shows the complete adenovirus genome flanked by its ITRs (black rectangles) and with some re-entry sites indicated. The numbers after the restriction sites indicate the approximate digestion sites (in kb) in the Ad5 genome. Figure 21: Drawing of adapter plasmid pAd / L420-HSA Figure 22: Drawing of the adapter plasmid pAd / Clip Figure 23: Schematic presentation of the generation of recombinant adenovirus using the plasmid-based system. In the upper part, the organization of the Ad5 genome is provided with the rectangles negroe represented by the different transcription regions, early and late and the flanking ITRs. The middle part represents the two DNAs used for simple homologous recombination and, after transfection in packaging cells, which carry the recombinant virus (represented in the lower part). Figure 24: Drawing of the minimal adenoviral vector pMY / L420H Figure 25: Schematic representation of the cloning steps for the generation of the auxiliary construction PWE / Ad? 5 •. Figure 26: Evidence of SV40-LargeT / ori mediated replication of large adenoviral constructs in Cos-1 cells. A Schematic representation of the construction pWE / Ad.? 5 'and the position of the SV40 ori sequence and the fragments used to prepare the probe. B) Autoradiogram of Southern blot hybridized to the adenovirue probe. C) Autoradiogram of Southern blot hybridized to the pWE eonda. 5 Lane 1, marker lane; DNA? digested with EcoRI and HindIII. Lane 4, empty. Lane 2, 5, 7, 9, 11, 13, 15 and 17 contain undigested DNA and lanes 3, 6, 8, 10, 12, 14, 16 and 18 contain DNA digested with Mbol. All lanes contain DNA from Cos-l cells as described in the text, transfected with pWE.pac (lanes 2 and 3), connection pWE7Ad.?5 '# 1 (lane 5 and 6), # 5 (lane 7 and 8) and # 9 (lanes 9 and 10), pWE / Ad.AfIII-rITR (lanes 11 and 12), pMV / CMV-LacZ (lanes 13 and 14), pWE.pac digested with Paci (lanes 15 and 16) or pWE / Ad.AfIII-rITR digested with Pací (lanes 17 and 18). The arrows point to the eeperated poetry signal of 1416 bp (B) and 887 bp (C). All publications and patents mentioned in this specification are indicative of the level of skill for those skilled in the art to which the invention pertains. invention. All publications and patent applications are incorporated herein by reference to the same extent as if each individual publication or patent application had been specifically and individually indicated as incorporated by reference. ^^^^. ^ 4 ^^, ^^^^^^, ^. ^, ... ^^ ..., > . . .

The invention has now been fully described, it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.

TABLE I Amplifiers used for PCR amplification of DNA fragments used for generation of constructions described in eeta patent application Ea-1 CGTGTAGTGTATTTATACCCG PCR amplification of Ad5 nt.459? Ea-2 TCGTCACTGGGTGGAAAGCCA PCR amplification Ad5 nt.960 -Ea-3 TACCCGCCGTCCTAAAATGGC nt. 1284-1304 of Ad5 genome Ea-5 TGGACTTGAGCTGTAAACGC nt. 1514-1533 genome of Ad5 oo or Ep-2 GCCTCCATGGAGGTCAGATGT nt. 1721-1702 of Ad5; introduction of the Ncol site 'Eb-1 GCTTGAGCCCGAGACATGTC nt. 3269-3289 of Ad5 genome Eb-2 CCCCTCGAGCTCAATCTGTATCTT nt. 3508-3496 of Ad5 genome; introduction of the site Xhol SV40-1 GGGGGATCCGAACTTGTTTATTGCAGC introduction of the BamHl site (nt.2182-2199 of pMLP.TK) adaptation of recombinant adenovirus SV40-2 GGGAGATCTAGACATGATAAGATAC introduction of the BglII site (nt .2312-2297 of pMLP.TK) Ad5-1 GGGAGATCTGTACTGAAATGTGTGGGC introduction of the BglII site (nt. 2496-2514 from pMLP.TK) Ad5-2 GGAGGCTGCAGTCTCCAACGGCGT nt. 2779-2756 from pMLP.TK ITR1 GGGGGATCCTCAAATCGTCACTTCCGT nt .35737-35757 of Ad5 (introduction of the eitio of BamHl) ITR2 GGGGTCTAGACATCATCAATAATATAC nt .35935-35919 of Ad5 (introduction of the Xbal site) TABLE I (continued) Set of PCR primers to be used to create the Sali and Asp 718 sites juxtaposed with the ITR sequences. PCR / MLP1 GGCGAATTCGTCGACATCATCAATAATATACC (Ad5 nt.10-18) i PCR / MLP2 GGCGAATTCGGTACCATCATCAATAATATACC (Ad5 nt.10-18) 8 PCR / MLP3 CTGTGTACACCGGCGCA (Ad5 nt.200-184) ' A synthetic oligonucleotide pair used to generate a synthetic fork, recreates an Asp718 site in one of the terminal parts if it is inserted into the Asp718 site: HP / aepl 5 * -GTACACTGACCTAGTGCCGCCCGGGAAAGCCCGGGCGGCACTAGGTCAG HP / aep2 5 * -GTACCTGACCTAGTGCCGCCCGGGCTTTGCCCGGGCGGCACTAGGTCAGT Synthetic oligonucleotide pair used to generate a synthetic fork, which contains the Clal recognition site that is to be used for hairpin formation.

HP / clal 5 '-GTACATTGACCTAGTGCCGCCCGGGCAAAGCCCGGGCGGCACTAGGTCAATCGAT HP / cla2 5' -GTACATCGATTGACCTAGTGCCGCCCGGGTTTGCCCGGGCGGCACTAGGTCAAT oo TABLE II Production of recombinant adenoviral vector from different packaging, cell lines 00 LO NOTE: The yields are the average of two different experiments. IG.Ad.CMV. lacZ and IG.Ad.CMV.TK are described in patent application EP 95 20 2213. The construction of IG.Ad.MLPI .TK is described in this patent application. The virus yields for the T80 flask are determined by plaque assay in 911 cells, as described (Fallaux etr al (1996) Hum Gene Gene 7: 215-222). # 1493). 00 TABLE III Virus with double insertion with different transgenes constituting Lae and E3 / gpl9K regions that express both transgenee in human A549 cells 00 NOTE: All virus preparations were cleared of crude cell lysates (ccl). A crude cell lysate is manufactured by collecting cells with medium at full CPE followed by three cycles of freezing / reheating. pAd / S1800-HSA is not titled. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. 00 O

Claims (58)

1. Having described the invention as above, the claim contained in the following claims is claimed as property: 1. A method for generating an adenoviral vector characterized in that it comprises joining two nucleic acid molecules so that the molecules comprise sequences that are partially replicated by the combination of between it, which allows the generation of a physically bound nucleic acid comprising at least two functional adenoviral inverted terminal repeat sequences, a functional encapsulation signal and a nucleic acid of interest or functional parts, derivatives and / or analogs thereof.
2. 2. A method for generating an adenoviral vector, characterized in that it comprises joining through homologous recombination two nucleic acid molecules, characterized in that it comprises partially superimposing sequences in which the overlapping sequences allow that essentially only a homologous recombination which leads to the generation of a physically linked nucleic acid comprising at least two functional adenoviral inverted terminal repeat sequences, a functional encapsulation signal and an acid ^ t ^^ n ^ -H Nucleic of interest or functional parts, derivatives and / or analogs thereof.
3. 3. The method according to claim 1 or claim 2, characterized in that both nucleic acid molecules comprise only an inverted adenoviral terminal repeat sequence or a functional part, derivative and / or analogue thereof.
4. 4. The method according to any of claims 1 to 3, characterized in that the connection is made in a cell or a functional part, derivative and / or analogue thereof.
5. 5. The method according to claim 4, characterized in that the cell is a mammalian cell.
6. 6. The method according to claim 5, characterized in that the nucleic acid molecules are not capable of replicating in the mammalian cell before they are joined.
7. 7. The method according to any of claims 1 to 6, characterized in that one of the Nucleic acid molecules is relatively small and the other is relatively large.
8. 8. The method according to any of claims 1 to 7, characterized in that at least one of the nucleic acid molecules that is provided to the cell comprises an inverted terminal adenoviral repeat sequence which on one side is essentially free of another nucleic acid .
9. 9. The method according to claim 8, characterized in that the repeated adenoviral sequence is produced essentially free of another nucleic acid on one side using a restriction enzyme.
10. 10. The method according to claim 9, characterized in that the restriction enzyme acts at a site which is not present in the nucleic acid of the adenovirue vector in the nucleic acid molecule.
11. 11. The method according to any of claims 4 to 10, characterized in that the nucleic acids present in the cell do not comprise overlapping sequences that can lead to the formation of adenovirus capable of replicating.
12. 12. The method according to any of claims 4 to 11, characterized in that the chromosomal nucleic acid in the cell comprises at least one functional part of an adenoviral region, or a functional derivative and / or analogue thereof.
13. 13. The method according to any of claims 4 to 12, characterized in that the cell is a PER.C6 cell (deposit number ECACC 96022940) or a functional derivative and / or analogue thereof.
14. 14. The method according to any of claims 4 to 13, characterized in that the nucleic acid in the cell further comprises a nucleic acid encoding a protein of the E2 region of adenovirus and / or a protein of the E4 region of adenovirus.
15. 15. The method according to any of claims 1 to 14, characterized in that at least one of the nucleic acid molecules is linear.
16. 16. The method according to any of claims 1 to 15, characterized in that at least one of the molecules comprises a nucleic acid encoding the adenoviral capeid protein derived from two different adenovirus serotypes.
17. 17. The method according to any of claims 1 to 16, characterized in that the binding of the nucleic acid molecules leads to the generation of physically bound nucleic acid comprising at least two inverted adenoviral inverted terminal repeat sequences, a functional encapsulation signal , a nucleic acid encoding at least one protein from the adenoviral region, at least one protein encoding the adenoviral E2 region and / or at least one protein encoding the adenoviral E4 region and one nucleic acid from the adenoviral region. interest or functional parts, derivative and / or analogous thereof and wherein at least one of the proteins encoded by the El region is under the transcriptional control of a conditionally active promoter.
18. 18. A recombinant nucleic acid, characterized in that it has been deposited in the ECACC under the number P97082122, No. P97082119, No. P97082117, No. P97082114, No. P97082120, No. P97082121, No. P97082116, No. P97082115 or No. P97082118 or a functional portion, derivative and / or analogue thereof.
19. 19. A recombinant nucleic acid pWE / Ad.AflII-EcoRI, pAd5 / CLIP, p Ad 5 / L 420-HAS, pBS. Eco-Eco / ad5? HIH? Gpl9K? XbaI, pMV / L420-H, pMV / CMV-LacZ , pWE / Ad.? 5 ', pWE / AAV.? 5', pWE / Ad-H.
20. 20. A recombinant nucleic acid, characterized in that it comprises: adenovirue derived from nucleotides 1-454 and adenovirus nucleotides 3511-6095 shown in figures 21 and 22.
21. 21. A recombinant nucleic acid, characterized in that it comprises: a supreeion in the E3 region of a recombinant nucleic acid deposited with the ECACC under No. P97082122, No. P97082119, No. P97082120, No. P97082116.
22. 22. A recombinant nucleic acid according to claim 21, characterized in that the supreeion comprises a gpl9K region.
23. 23. A recombinant nucleic acid, characterized in that it comprises: a nucleotide sequence in or derived from an adenovirus, wherein the nucleotide sequence comprises fe3áft »fe -« «iw *.« 8aa¡ «a? 8a > N * - * »» «•, i ^ | ¡|| gg¡i sufficient adenovirus sequences necessary for replication and genetic expression of the capsid, wherein the nucleotide sequence comprises a deletion of at least the and the adenovirus encapsulation signal.
24. 24. A recombinant nucleic acid, characterized in that it comprises: a nucleotide sequence based on or derived from an adenovirus, wherein the nucleotide sequence comprises sequences of adenovirue eficientee neceeariae for replication and expreation of the gene of the capsid, and a sequence complementary to a part towards the 5 'end of the nucleic acid chain moiety, wherein the complementary sequence may be paired in bases with the part towards the 5' end so as to function as a starting site for a nucleic acid polymerase, wherein the nucleotide sequence comprises a deletion of an inverted terminal repeat sequence, the El region and the adenovirue encapsulation signal.
25. 25. A recombinant nucleic acid, characterized in that it comprises: a nucleotide sequence based on or derived from an adenovirus, wherein the nucleotide sequence comprises a sequence for adenovirus-independent replication, and __yi! __ ^ _ ^ __ ^ __ ^ __ ^ __ ^ __ ^ _ sufficient adenovirus sequences necessary for replication, wherein the nucleotide sequence comprises at least one deletion of the El region and one adenovirus encapsulation signal.
26. 26. The recombinant nucleic acid according to claim 25, characterized in that the nucleotide sequence further comprises a deletion of at least one of the inverted terminal repeat sequences of the adenovirus.
27. 27. The recombinant nucleic acid according to claim 25 or claim 26, characterized in that the sequence for the adenovirus-independent replication comprises an SV40 origin of replication.
28. 28. The recombinant nucleic acid, according to any of Claims 18 to 27, the nucleotide sequence does not comprise eequence that allows homologous recombination leading to a virus capable of replicating in a cell in which the recombinant nucleic acid is transferred.
29. 29. An adapter plasmid, characterized in that it comprises: a nucleotide sequence based on or derived from an adenovirus, wherein the nucleotide sequence comprises an operable configuration, at least one functional inverted terminal repeat sequence, a functional encapsulation signal and adenoviral sequences which allow homologous recombination and the generation of a recombinant adenovirus genome defective in replication.
30. 30. The adapter plasmid, in accordance with 10 claim 29, characterized in that it does not comprise sequences which allow homologous recombination leading to a virus capable of replicating in a cell in which the adapter plasmid is transferred.
31. 31. The adapter plasmid according to claim 30, characterized in that it has no sequences of the El region.
32. 32. The adapter plasmid, according to any of claims 29 to 31, characterized in that it further comprises a nucleic acid of interest such as a multiple cloning site and / or a transgene.
33. 33. The recombinant nucleic acid according to any one of claims 18 to 28 or a plasmid m ^ i ^ jj ^^ t ^ adapter, according to any of claim 29 to 32, characterized in that the transgene is operably linked to an E3 promoter.
34. 34. A method for the generation of recombinant adenovirus, which has an eupressure of El and an eupressure of gpl9K, the method is characterized in that it comprises the steps of: growing a cell comprising complementary adenoviral sequences transfected with i) an adapter plasmid comprising a first nucleotide sequence based on, or derived from an adenovirus, wherein the nucleotide sequence comprises in operable configuration a functional inverted terminal repeat sequence, a functional encapsulation signal and adenoviral sequences which allow homologous recombination leading to the generation of a genome of recombinant adenovirus, replication defective, in a cell into which the adapter plamidid is transferred and which has no sequences from the El region, and ii) a recombinant nucleic acid comprising at least a second nucleotide sequence in, or derived from an adenovirus, where at least The second nucleotide sequence comprises an inverted terminal repeat sequence and adenoviral sequences which are efficient for replication and a partial overlap of the adapter plasmid, wherein at least a second nucleotide sequence comprises a deletion of at least the El region, encapsulation signal and sequences. gpl9K; wherein the complementary sequences, the first nucleotide sequence and at least the second nucleotide sequence do not have overlapping sequences which allow homologous recombination leading to replication of competent virus, under conditions whereby the recombinant adenovirus having 10 a suppression in El and a supremption in gpl9K is generated.
35. 35. The method according to claim 34, characterized in that the adapter plasmid further comprises a first heterologous nucleotide sequence 15 inserted into the deletion of the El region and the recombinant nucleic acid further comprises a second heterologous nucleotide sequence inserted in the gpl9K region.
36. 36. A method for the generation of recombinant adenovirus 20, characterized in that it comprises the steps of: growing a cell comprising complementary and adenoviral tranefectadae with i) a first recombinant nucleic acid comprising a first nucleotide sequence balanced on, or 25 derived from an adenovirus, where the first sequence ^^^^^^^^^^^^^^ S ^^ g ^^ j > nucleotide comprises a functional encapsulation signal and two functional inverted terminal repeat sequences or functional fragments or derivatives thereof, and wherein the first recombinant nucleic acid does not have functional adenoviral genes, and ii) a second recombinant nucleic acid comprising a second sequence nucleotide based on, or derived from, an adenovirus, wherein the second nucleotide sequence comprises adenoviral sequences sufficient for replication, wherein the second nucleotide sequence comprises a deletion of at least the El region and an adenovirus encapsulation signal; wherein in the complementary sequences, the first nucleotide sequence and the second nucleotide sequence have no overlapping sequences which allow homologous recombination leading to competent virulence replication; under conditions by which a recombinant adenovirus is generated.
37. 37. A method for the generation of recombinant adenovirus, characterized in that it comprises the steps of: growing a cell comprising adenoviral complementary sequences transfected with tóg? ^^ gi) a first recombinant nucleic acid comprising a first nucleotide sequence based on, or derived from an adenovirus, wherein the first nucleotide sequence comprises a functional encapsulation signal and two functional inverted terminal repeat sequences or functional fragments or derivatives thereof, and wherein the first recombinant nucleic acid does not have functional adenoviral genes, and ii) a second recombinant nucleic acid comprising a second nucleotide sequence based on, or derived from an adenovirus, wherein the second nucleotide sequence comprises a sequence for adenovirus-independent replication, and sufficient adenoviral sequences neceeariae for replication, wherein the second nucleotide sequence comprises at least a deletion of the El region and the adenovirus encapsulation signal; wherein, the complementary sequences, the first nucleotide sequence and the second nucleotide sequence have no overlapping sequences which allow homologous recombination leading to the replication of a competent virus, under conditions whereby a recombinant adenovirus is generated.
38. 38. The method according to claim 37, characterized in that the cell comprises at least one nucleic acid molecule by which the cell expresses SV40 Large T antigen protein or functional fragment of the myelin.
39. 39. The method according to claim 37 or claim 38, characterized in that the second recombinant nucleic acid molecule is replicated.
40. 40. An adenovirus defective in its replication, characterized in that it comprises: a genome based on, or derived from an adenovirus, wherein the genome comprises at least one signal functionally encapsulated and sequentially repeated functional inverted terminals or functional fragments or derivatives thereof and wherein the genome does not comprise functional adenoviral genes and has no overlapping sequences which allow homologous recombination leading to replication of competent virus in a cell in which adenovirue is defective in replication.
41. 41. An adenovirus defective in its replication, according to claim 40, characterized in that it also comprises: ^^ ¿^^^^? ^. -TO. i one or more nucleic acids of interest.
42. 42. A non-human cell, characterized in that it comprises a genome of an adenovirus defective in its replication, according to claim 40 or claim 41.
43. 43. A non-human cell, according to claim 42, characterized in that the cell is a mammalian cell.
44. 44. A method for transducing a cell, characterized in that it comprises the step of: contacting the cell with an adenovirus defective in its replication, according to claim 40 or claim 41, under conditions whereby the cell is subjected to traneduction.
45. 45. A non-human cell, characterized in that it is produced according to the method of claim 44, characterized in that the cell is a mammalian cell.
46. 46. A method for generating recombinant adenovirus, characterized in that it comprises the steps of: growing a cell comprising complementary adenoviral sequences, and i) a first recombinant nucleic acid comprising a first nucleotide sequence based on or derived from an adenovirus, wherein the first sequence nucleotide comprises a signal of functional encapsulation and two repeating sequences of functional inverted terminals or functional fragments or derivatives thereof, and wherein the first recombinant nucleic acid has no functioning adenoviral genes, and ii) a second recombinant nucleic acid characterized in that it comprises a second nucleic acid. nucleotide sequence based on or derived from an adenovirus, wherein the nucleotide sequence comprises at least all of the adenoviral sequences, or functional or lae miee derivative fragments, necessary for replication and expression of the capsid gene, and a complementary sequence one part to the 5 'end of the same nucleic acid strand, wherein the complementary sequence may be paired at its bases with the part toward the 5' end so as to function as a start site for a nucleic acid polymerase, wherein the second nucleotide sequence comprises a suprelation of the inverted terminal repeat sequence, the El region and the adenovirus encapsulation signal; fe¡fc, "Aa¿fc f faith. .i *? ' < L ~ ^ ~ a, .-. ^? wherein the complementary sequences, the first nucleotide sequence and the second nucleotide sequence do not have eukaryotic sequences which allow homologous recombination leading to replication of competent virus, under conditions whereby a recombinant adenovirus is generated.
47. 47. A cell, characterized in that it comprises the nucleic acid according to any one of claim 18 to 28, 33 or an adenoviral vector defective in its replication, according to any of claims 40, 41, 55 or 56, and / or a plamid adapter, according to any of claims 29 to 32.
48. 48. A method for the replacement of a defective gene in a host cell genome, characterized in that it comprises the step of: growing the host cell with a recombinant nucleic acid molecule derived from an adenovirus defective in its replication, comprising a functional version or part of it of the defective gene under conditions by which at least one allele of the defective gene is replaced in the genome of the host cell. ÍS?
49. 49. The method according to claim 44, characterized in that the adenovirue defective in the replication does not express adenoviral genes.
50. 50. The method according to claim 44, characterized in that the defective gene is a defective, tumor suppressor gene.
51. 51. An isolated cell, characterized in that it comprises a genome of an adenovirus defective in replication, according to any of claims 40, 41, 55 or 46.
52. 52. An isolated cell, according to claim 51, characterized in that the cell is a human cell.
53. 53. A recombinant nucleic acid according to any of claims 18 to 28, characterized 20 because the deletion in the E3 region is replaced with a transgene.
54. 54. The method according to claim 34 or claim 35, characterized in that at least A second nucleotide sequence comprises a first and »? second molecules wherein the first molecule has a partial overlap with the adapter plasmid at the 3 'end and the second molecule comprises the inverted terminal repeat sequence and the region includes a eupreesion of the sequence eequence of gpl9K.
55. 55. A replication-defective adenovirus, characterized in that it comprises: a genome coiled in, or derived from an adenovirue, wherein the genome comprises a first eupression in an El region and a second deletion in a gpl9K region.
56. 56. An adenovirus defective in replication, according to claim 55, characterized in that transcription of the transgene is directed by an E3 promoter.
57. 57. An air cell, characterized in that it comprises: a recombinant nucleic acid, according to any of claims 18-28, 33 or an adenoviral vector defective in replication, in accordance with jtf ^ B ^ t ^ Mi'ferifrfiihfji any of claims 40, 41, 55 or 56, and / or an adapter plasmid according to any of claims 29 to 32.
58. 58. An air cell according to claim 57, characterized in that the cell is a human cell. ! a £ ¿J s? =