US20020138870A1 - Methods for simultaneous control of lignin content and composition, and cellulose content in plants - Google Patents

Methods for simultaneous control of lignin content and composition, and cellulose content in plants Download PDF

Info

Publication number
US20020138870A1
US20020138870A1 US10/091,009 US9100902A US2002138870A1 US 20020138870 A1 US20020138870 A1 US 20020138870A1 US 9100902 A US9100902 A US 9100902A US 2002138870 A1 US2002138870 A1 US 2002138870A1
Authority
US
United States
Prior art keywords
plant
substantially similar
genes
lignin
cald5h
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/091,009
Inventor
Vincent Chiang
Laigeng Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Michigan Technological University
Original Assignee
Michigan Technological University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Michigan Technological University filed Critical Michigan Technological University
Priority to US10/091,009 priority Critical patent/US20020138870A1/en
Publication of US20020138870A1 publication Critical patent/US20020138870A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C12N15/8246Non-starch polysaccharides, e.g. cellulose, fructans, levans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8255Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving lignin biosynthesis

Definitions

  • the invention provides a method of introducing two or more genes, involved in lignin biosynthesis, into plant cells.
  • the method of the invention employs either an Agrobacterium-mediated or other appropriate plant gene delivery system by which multiple genes together with a single selectable marker gene are simultaneously transferred and inserted into the genome of plants with high frequencies.
  • Agrobacterium-mediated gene transfer and whole plant regeneration through organogenesis is a simple process and a less species-dependent system than bombardment-mediated transformation and regeneration via embryogenesis.
  • the introduction of more than one gene in a single plasmid vector via Agrobacterium may be technically troublesome and limited by the number or the size of the target genes (Chen et al., 1998).
  • Tricoli et al. (1995) reported the transfer of three target genes to squash via Agrobacterium-mediated gene transfer.
  • a binary plasmid vector containing the three target genes was incorporated into an Agrobacterium strain, which was subsequently used to infect the leaf tissue of squash.
  • Lignin a complex phenolic polymer
  • angiosperm and gymnosperm trees which, in turn, are the principal sources of fiber for making paper and cellulosic products.
  • Lignin generally constitutes about 25% of the dry weight of the wood, making it the second most abundant organic compound on earth after cellulose. Lignin provides rigidity to wood for which it is well suited due, in part, to its resistance to biochemical degradation.
  • lignin is nonetheless problematic to post-harvest, cellulose-based wood/crop processing for fiber, chemical, and energy production because it must be removed or degraded from cellulose at great expense.
  • lignin In angiosperms, lignin is composed of a mixture of guaiacyl (G) and syringyl (S) monolignols, and can be degraded at considerably less energy and chemical cost than gymnosperm lignin, which consists almost entirely of guaiacyl moieties (Freudenberg, 1965). It has been estimated that, if syringyl lignin could be genetically incorporated into gymnosperm guaiacyl lignin or into angiosperms to increase the syringyl lignin content, the annual saving in processing of such genetically engineered plants as opposed to their wild types would be in the range of $6 to $10 billion in the U.S. alone.
  • lignin in angiosperms is composed of guaiacyl (G) and syringyl (S) monomeric units, whereas gymnosperm lignin consists entirely of G units.
  • G guaiacyl
  • S syringyl
  • G guaiacyl
  • S syringyl
  • G guaiacyl
  • S syringyl
  • G guaiacyl
  • S syringyl
  • gymnosperm lignin consists entirely of G units.
  • the structural characteristics of G units in gymnosperm lignin promote monomer cross-linkages that increase lignin resistance to chemical extraction during wood pulp production.
  • the S units present in angiosperm lignin prevent such chemical resistant cross-links.
  • both a high lignin content and high S/G ratio have been sought (i.e., combining these two traits in plants).
  • lignin in the pulping liquor is normally used as a fuel source to provide energy to the pulping and bleaching operations.
  • This lignin-associated energy source which is not necessary for pulp mills using purchased fuel for energy, is essential to some pulp mills which depend upon internal sources, such as extracted lignin, to be self-sufficient in energy. Therefore, for this purpose, it may be desirable to increase lignin content in pulpwood species, and at the same time to increase the S/G ratio in these species to facilitate the extraction of more lignin to be used as fuel.
  • lignin content and/or S/G lignin ratio are desirable to provide extra sturdiness in plants to prevent the loss of socially and economically important food crops due to dislodging and due to damage to the aerial parts of the plant.
  • the plant monolignol biosynthetic pathway is set forth in FIG. 1 and will be explained in more detail hereinbelow.
  • the key lignin control sites in the monolignol biosynthetic pathway are mediated by genes encoding the enzymes 4-coumarate-CoA ligase (4CL) (Lee et al., 1997), coniferyl aldehyde 5-hydroxylase (CAld5H) (Osakabe et al., 1999) and S-adenosyl-L-methionine (SAM)-dependent 5-hydroxyconiferaldehyde O-methyltransferase (AldOMT) (Li et al., 2000), respectively, for the formation of sinapaldehyde (see, FIG.
  • coniferyl alcohol dehydrogenase (CAD) (MacKay et al., 1997) catalyzes the reaction including the substrate coniferaldehyde to coniferyl alcohol.
  • CAD coniferyl alcohol dehydrogenase
  • SAD sinapyl alcohol dehydrogenase
  • FIG. 1 See, concurrently filed, commonly owned U.S. non-provisional application entitled “Genetic Engineering of Syringyl-Enriched Lignin in Plants,” incorporated herein by reference.
  • the gene encoding the enzyme sinapyl alcohol dehydrogenase (SAD) represents the last gene that is indispensable for genetic engineering of syringyl lignin in plants.
  • AldOMTs have three conserved sequence motifs (I, II, and III) which are the binding sites of S-adenosyl-L-methionine (SAM), the co-substrate or methyl donor for the OMT reaction (Ibrahim, 1997, Trends Plant Sci., 2:249-250; Li et al., 1997, Proc. Natl. Acad. Sci. USA, 94:5461-5466; Joshi and Chiang, 1998, Plant Mol. Biol., 37:663-674).
  • SAM S-adenosyl-L-methionine
  • CADs The protein sequence alignments of plant CADs are shown in FIG. 10. It was recently proven that CADs are actually guaiacyl monolignol pathway specific (Li et al., 2001, Plant Cell, 13:1567-1585). Based on high sequence homology, the alignment program picked up CADs from angiosperms as well as gymnosperms (radiata pine, loblolly pine and spruce) which have only G-lignin. All CADs have the Zn1 binding motif and structural Zn2 consensus region, as well as a NADP binding site (Jornvall et al., 1987, Eur. J. Biochem., 167:195-201; MacKay et al., 1995, Mol. Gen.
  • CAld5H is the sole enzyme catalyzing specifically the conversion of coniferaldehyde into 5-hydroxyconiferaldehyde. All full-length CAld5Hs have the proline-rich region located from amino acid 40 to 45 which is believed to be involved in the process of correct folding of microsomal P450s and is also important in heme incorporation into P450s (Yamazaki et al. 1993, J. Biochem. 114:652-657).
  • FIG. 12 The protein sequence alignment of plant 4CLs are shown in FIG. 12.
  • 4CL catalyzes the activation of the hydroxycinnamic acids to their corresponding hydroxycinnamoyl-CoA esters.
  • 4CL has the highest activity with ⁇ -coumaric acid.
  • 4CL cDNA sequences have been reported from a number of representative angiosperms and gymnosperms, revealing two highly conserved regions, a putative AMP-binding region (SSGTTGLPKGV), and a catalytic motif (GEICIRG).
  • SSGTTGLPKGV putative AMP-binding region
  • GEICIRG catalytic motif
  • the amino acid sequences of 4CL from plants contain a total of five conserved Cys residues.
  • the invention provides a method of introducing two or more genes involved in lignin biosynthesis present in one or more independent vectors into plant cells.
  • the method of the invention suitably employs an Agrobacterium-mediated or another gene delivery system by which multiple genes together with a single selectable marker gene are simultaneously transferred and inserted into the genome of plants with high frequencies.
  • each gene of interest is present in a binary vector that has been introduced into Agrobacterium to yield an isolated Agrobacterium strain comprising the binary vector. Moreover, more than one gene of interest may be present in each binary vector.
  • Plant materials comprising plant cells e.g., plant seed, plant parts or plant tissue including explant materials such as leaf discs, from a target plant species are suitably inoculated with at least two, preferably at least three, and more preferably at least four or more, of the isolated Agrobacterium strains, each containing a different gene of interest.
  • a mixture of the strains is suitably contacted with plant cells.
  • At least one of the binary vectors in the isolated Agrobacterium strains contains a marker gene, and any marker gene encoding a trait for selecting transformed cells from non-transformed cells may be used.
  • Transformed plant cells are regenerated to yield a transgenic plant, the genome of which is augmented with DNA from at least two, preferably at least three, and more preferably at least four, and even more preferably at least five of the binary vectors.
  • the method of the invention is thus applicable to all plant species that are susceptible to the transfer of genetic information by Agrobacterium or other gene delivery system.
  • Suitable plant species useful in the method of the invention include agriculture and forage crops, as well as monocots.
  • plant species useful in the method of the invention include trees, e.g., angiosperms and gymnosperms, and more suitably a forest tree, but are not limited to the tree.
  • the method of the invention is suitably employed to enhance a desired agronomic trait by altering the expression of two or more genes.
  • Such traits include alterations in lignin biosynthesis (e.g., reduction, augmentation and/or structural changes), cellulose biosynthesis (e.g., augmentation, reduction, and/or quality including high degree of polymerization and crystallinity), growth, wood quality (e.g., high density, low juvenile wood, high mature wood, low reaction wood, desirable fiber angle), stress resistance (e.g., cold-, heat-, and salt-tolerance, pathogen-, insect- and other disease-resistance, herbicide-resistance), sterility, high grain yield (for forage and food crops), and increased nutrient level.
  • lignin biosynthesis e.g., reduction, augmentation and/or structural changes
  • cellulose biosynthesis e.g., augmentation, reduction, and/or quality including high degree of polymerization and crystallinity
  • growth wood quality (e.g.
  • the present invention advantageously provides gymnosperm and angiosperm plants with decreased lignin content, increased syringyl/guaiacyl (S/G) lignin ratio and increased cellulose content in which a single trait or multiple traits are changed.
  • the invention provides gymnosperm plants with syringyl enriched lignin and/or increased lignin content and/or increased syringyl/guaiacyl (S/G) lignin ratio.
  • the present invention also provides angiosperm plants with increased lignin content.
  • FIG. 1 is a schematic representation of plant monolignol pathways for production of coniferyl alcohol and sinapyl alcohol;
  • FIG. 2 is the SAD polynucleotide DNA sequence (SEQ ID NO: 1) and the SAD amino acid sequence (SEQ ID NO: 2) respectively FIG. 2A and 2B;
  • FIG. 3 is the CAld5H polynucleotide DNA sequence (SEQ ID NO: 3) and the CAld5H amino acid sequence (SEQ ID NO: 4) respectively FIG. 3A and 3B;
  • FIG. 4 is the AldOMT polynucleotide DNA sequence (SEQ ID NO: 5) and the AldOMT amino acid sequence (SEQ ID NO: 6) respectively FIG. 4A and 4B;
  • FIG. 5 is the 4CL polynucleotide DNA sequence (SEQ ID NO: 7) and the 4CL amino acid sequence (SEQ ID NO: 10) respectively FIG. 5A and 5B;
  • FIG. 6 is the CAD polynucleotide DNA sequence (SEQ ID NO: 8) and the CAD amino acid sequence (SEQ ID NO: 9) respectively FIG. 6A and 6B;
  • FIG. 7 is a map of the DNA construct, pBKPpt 4CL Pt 4 CL1-a, positioned in a plant transformation binary vector.
  • FIG. 8 is a map of the DNA construct, pBKPpt 4CL PtCAld5H-s, positioned in a plant transformation binary vector.
  • FIG. 9 is the protein sequence alignment of AldOMTs for representative species of plants.
  • FIG. 10 is the protein sequence alignment of CADs for representative species of plants.
  • FIG. 11 is the protein sequence alignment of CAld5Hs for representative species of plants.
  • FIG. 12 is the protein sequence alignment of 4CLs for representative species of plants.
  • the present invention provides a method and DNA constructs useful for the transformation of plant tissue for the alteration of lignin monomer composition, increased syringyl/guaiacyl (S/G) lignin ratio and increased cellulose content and transgenic plants resulting from such transformations.
  • the present invention is of particular value to the paper and pulp industries because lignin containing higher syringyl monomer content is more susceptible to chemical delignification. Woody plants transformed with the DNA constructs provided herein offer a significant advantage in the delignification process over conventional paper feedstocks.
  • modification of the lignin composition in grasses by the insertion and expression of a heterologous SAD gene offers a unique method for increasing the digestibility of grasses and is of significant potential economic benefit to the farm and agricultural industries.
  • gene refers to a nucleic acid fragment that expresses a specific protein including the regulatory sequences preceding (5′ noncoding) and following (3′ noncoding) the coding region or coding sequence (See, below). “Native” gene refers to the gene as found in nature with its own regulatory sequences.
  • Endogenous gene refers to the native gene normally found in its natural location in the genome.
  • Transgene refers to a gene that is introduced by gene transfer into the host organism.
  • Coding sequence or “Coding Region” refers to that portion of the gene that contains the information for encoding a polypeptide.
  • the boundaries of the coding sequence are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus.
  • a coding sequence can include, for example, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA, and even synthetic DNA sequences.
  • Promoter refers to a DNA sequence, in a given gene, which sequence controls the expression of the coding sequence by providing the recognition site for RNA polymerase and other factors required for proper transcription. Most genes have regions of DNA sequence that are promoter sequences which regulate gene expression. Promoter regions are typically found in the 5′ flanking DNA sequence upstream from the coding sequence in both prokaryotic and eukaryotic cells. A promoter sequence provides for regulation of transcription of the downstream gene sequence and typically includes from about 50 to about 2000 nucleotide base pairs. Promoter sequences also contain regulatory sequences such as enhancer sequences that can influence the level of gene expression.
  • Some isolated promoter sequences can provide for gene expression of heterologous DNAs, that is DNA different from the natural homologous DNA.
  • Promoter sequences are also known to be strong or weak or inducible.
  • a strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression.
  • An inducible promoter is a promoter that provides for turning on and off of gene expression in response to an exogenously added agent or to an environmental or developmental stimulus.
  • An isolated promoter sequence that is a strong promoter for heterologous DNAs is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of transformed cells, and provides for a high level of gene expression when desired.
  • a promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
  • regulatory sequence(s) refers to nucleotide sequences located upstream (5′), within, and/or downstream (3′) of a coding sequence, which control the transcription and/or expression of the coding sequences in conjunction with the protein biosynthetic apparatus of the cell. Regulatory sequences include promoters, translation leader sequences, transcription termination sequences and polyadenylation sequences.
  • Encoding and “coding” refer to the process by which a gene, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequences to produce an active enzyme. It is understood that the process of encoding a specific amino acid sequence includes DNA sequences that may involve base changes that do not cause a change in the encoded amino acid, or which involve base changes which may alter one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence. It is therefore understood that the invention encompasses more than the specific exemplary sequences.
  • a codon for the amino acid alanine, a hydrophobic amino acid may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine or isoleucine.
  • “Expression” is meant to refer to the production of a protein product encoded by a gene. “Overexpression” refers to the production of a gene product in transgenic organisms that exceed levels of production in normal or non-transformed organisms.
  • “Functional portion” or “functional fragment” or “functional equivalents” of an enzyme is that portion, fragment or equivalent section which contains the active site for binding one or more reactants or is capable of improving or regulating the rate of reaction.
  • the active site may be made up of separate portions present on one or more polypeptide chains and will generally exhibit high substrate specificity.
  • Enzyme encoded by a nucleotide sequence includes enzymes encoded by a nucleotide sequence which includes partial isolated DNA sequences.
  • Transformation refers to the transfer of a foreign gene into the genome of a host organism and its genetically stable inheritance.
  • % identity refers to the percentage of the nucleotides/amino acids of one polynucleotide/polypeptide that are identical to the nucleotides/amino acids of another sequence of polynucleotide/polypeptide as identified by a program such as GAP from Genetics Computer Group Wisconsin (GCG) package (version 9.0) (Madison, Wis.). GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. When parameters required to run the above algorithm are not specified, the default values offered by the program are contemplated.
  • GAP Genetics Computer Group Wisconsin
  • “Substantial homology” or “substantial similarity” refers to a 70% or more similarity or 70% homology wherein “% similarity” or “% homology” between two polypeptide sequences is a function of the number of similar positions shared by two sequences on the basis of the scoring matrix used divided by the number of positions compared and then multiplied by 100. This comparison is made when two sequences are aligned (by introducing gaps if needed) to determine maximum homology.
  • the PowerBlast program implemented by the National Center for Biotechnology Information, can be used to compute optimal, gapped alignments.
  • GAP program from Genetics Computer Group Wisconsin package (version 9.0) (Madison, Wis.) can also be used.
  • “Lignin monomer composition” refers to the relative ratios of guaiacyl monomer and syringyl monomer found in lignified plant tissue.
  • Plant includes whole plants and portions of plants, including plant organs (e.g., roots, stems, leaves, etc).
  • Angiosperm refers to plants that produce seeds encased in an ovary.
  • Angiosperm is Liquidambar styraciflua (L.)[sweetgum].
  • Gymnosperm refers to plants that produce naked seeds, i.e., seeds that are not encased in an ovary.
  • a specific example of a gymnosperm is Pinus taeda (L.)[loblolly pine].
  • isolated and/or purified with reference to a nucleic acid molecule or polypeptide refer to in vitro isolation of a nucleic acid or polypeptide molecule from its natural cellular environment, and from association with other components of the cell, such as nucleic acid or polypeptide, so that it can be sequenced, replicated and/or expressed.
  • An “isolated” strain of Agrobacterium refers to cells derived from a clone of Agrobacterium that is transformed in vitro with an isolated binary vector.
  • a “vector” is a recombinant nucleic acid construct, such as plasmid, phage genome, virus genome, cosmid, or artificial chromosome to which a polynucleotide in accordance with the invention may be attached.
  • the vector may bring about the replication of the attached segment, e.g., in the case of a cloning vector.
  • “Sinapyl alcohol dehydrogenase” or “SAD”, coniferyl alcohol dehydrogenase or “CAD”, coniferaldeyde 5-hydroxylase or “Cald5H”, 5-hydroxyconiferaldehyde O-methyltransferase or “AldOMT”, and 4-coumarate-CoA ligase or “4CL” refer to enzymes in the plant phenylpropanoid biosynthetic pathway.
  • the DNA sequences encoding these enzymes were identified from quaking aspen Populus tremuloides . It is understood that each sequence can be used as a probe to clone its equivalent from any plant species by techniques (EST, PCR, RT-PCR, antibodies, etc.) well known in the art.
  • FIG. 1 shows different steps in the biosynthetic pathways from 4-coumarate (1) to guaiacyl (coniferyl alcohol (6)) and syringyl (sinapyl alcohol (9)) monolignols for the formation of guaiacyl-syringyl lignin together with the enzymes responsible for catalyzing each step.
  • the enzymes indicated for each of the reaction steps are: 4-coumaric acid 3-hydroxylase (C3H) which converts 4-coumarate (1) to caffeate (2); 4-coumarate-CoA ligase (4CL) converts caffeate (2) to caffeoyl CoA (3) which in turn is converted to feruloyl CoA (4) by caffeoyl-CoA O-methyltransferase (CCoAOMT); cinnamoyl-CoA reductase (CCR) converts feruloyl CoA (4) to coniferaldehyde (5); coniferyl alcohol dehydrogenase (CAD) converts coniferaldehyde (5) to the guaiacyl monolignol coniferyl alcohol (6); at coniferaldehyde (5), the pathway splits wherein coniferaldehyde (5) can also be converted to 5-hydroxyconiferaldehyde (7) by coniferaldeyde 5-hydroxylase (Cal
  • a DNA construct which is a plant DNA having a promoter sequence, a coding region and a terminator sequence.
  • the coding region encodes a combination of enzymes essential to lignin biosynthesis, specifically, SAD, CAD, Cald5H, AldOMT, and 4CL protein sequences, substantially similar sequences, or functional fragments thereof.
  • the coding region is suitably a minimum size of 50 bases.
  • the gene promoter is positioned at the 5′-end of a transgene (e.g., 4CL alone or together with SAD, Cald5H, and AldOMT, and combinations thereof, or 4CL and CAD alone, or together with CAld5H, SAD, and AldOMT, and combinations thereof, as described hereinafter) for controlling the transgene expression, and a gene termination sequence that is located at the 3′-end of the transgene for signaling the end of the transcription of the transgene.
  • a transgene e.g., 4CL alone or together with SAD, Cald5H, and AldOMT, and combinations thereof, or 4CL and CAD alone, or together with CAld5H, SAD, and AldOMT, and combinations thereof, as described hereinafter
  • the DNA construct in accordance with the present invention can be incorporated into the genome of a plant by transformation to alter lignin biosynthesis, increase syringyl/guaiacyl (S/G) lignin ratio and increase cellulose content.
  • the DNA construct may include clones of CAld5H, SAD, AldOMT, CAD, and 4CL, and variants thereof such as are permitted by the degeneracy of the genetic code and the functional equivalents thereof.
  • the DNA constructs of the present invention may be inserted into plants to regulate production the following enzymes: CAld5H, SAD, AldOMT, CAD, and 4CL.
  • the production of the protein may be increased or decreased, either throughout or at particular stages in the life of the plant, relative to a similar control plant that does not incorporate the construct into its genome.
  • the orientation of the DNA coding sequence, promoter, and termination sequence can serve to either suppress lignin formation or amplify lignin formation.
  • the DNA is in the antisense orientation.
  • the DNA is in the sense orientation, thus to provide one or more additional copies of the DNA in the plant genome.
  • the DNA is suitably a full-length cDNA copy.
  • Constructs in accordance with the present invention may be used to transform cells of both monocotyledons and dicotyledons plants in various ways known in the art. In many cases, such plant cells may be cultured to regenerate whole plants which subsequently reproduce to give successive generations of genetically modified plants. Examples of plants that are suitably genetically modified in accordance with the present invention, include but are not limited to, trees such a aspen, poplar, pine and eucalyptus.
  • Various gene promoter sequences are well known in the art and can be used in the DNA constructs of present invention.
  • the promoter in the constructs in accordance with the present invention suitably provides for expression of the linked DNA segment.
  • the promoter can also be inducible so that gene expression can be turned on or off by an exogenously added agent. It may also be preferable to combine the desired DNA segment with a promoter that provides tissue specific expression or developmentally regulated gene expression in plants.
  • the promoter may be selected from promoters known to operate in plants, e.g., CaMV35S, GPAL2, GPAL3 and endogenous plant promoter controlling expression of the enzyme of interest.
  • a constitutive promoter such as the CaMV35S promoter (Odell et al. 1985), or CaMV 19S (Lawton et al., 1987) can be used to drive the expression of the transgenes in all tissue types in a target plant.
  • Other promoters are nos (Ebert et al.
  • tissue specific promoter permits functions to be controlled more selectively.
  • tissue-specific promoter has the advantage that the desired protein is only produced in the tissue in which its action is required.
  • tissue-specific promoters such as those would confine the expression of the transgenes in developing xylem where lignification occurs, may be used in the inventive DNA constructs.
  • a DNA segment can be combined with the promoter by standard methods as described in Sambrook et al., 2nd ed. (1982). Briefly, a plasmid containing a promoter such as the CaMV 35S promoter can be constructed as described in Jefferson (1987) or obtained from Clontech Lab, Palo Alto, Calif. (e.g., pBI121 or pBI221). Typically, these plasmids are constructed to provide for multiple cloning sites having specificity for different restriction enzymes downstream from the promoter. The DNA segment can be subcloned downstream from the promoter using restriction enzymes to ensure that the DNA is inserted in proper orientation with respect to the promoter so that the DNA can be expressed.
  • the gene termination sequence is located 3′ to the DNA sequence to be transcribed.
  • Various gene termination sequences known in the art may be used in the present inventive constructs. These include nopaline synthase (NOS) gene termination sequence (see, e.g., references cited in co-pending, commonly-owned PCT application, PCT/US/0027704, filed Oct. 6, 2000, entitled “Method of Introducing a Plurality of Genes into Plants,” incorporated herein by reference.)
  • NOS nopaline synthase
  • a marker gene may also be incorporated into the inventive DNA constructs to aid the selection of plant tissues with positive integration of the transgene.
  • Marker genes are genes that impart a distinct phenotype to cells expressing the marker gene, and thus, allow such transformed cells to be distinguished from cells that do not have the marker.
  • suitable marker genes are known to the art and can be employed in the practice of the invention, such as neomycin phosphotransferase II (NPT II) gene that confers resistance to kanamycin or hygromycin antibiotics which would kill the non-transformed plant tissues containing no NPT II gene (Bevan et al., 1983).
  • the expression cassette containing DNA sequences in accordance with the present invention can also optionally contain other DNA sequences. Transcription enhancers or duplications of enhancers can be used to increase expression from a particular promoter.
  • the promoter and control elements of corresponding genomic clones may then be localized using the techniques of molecular biology known to those of skill in the art.
  • Expression of some genes in transgenic plants will occur only under specified conditions. It is known that a large number of genes exist that respond to the environment. In some embodiments of the present invention expression of a DNA segment in a transgenic plant will occur only in a certain time period during the development of the plant. Developmental timing is frequently correlated with tissue specific gene expression.
  • leader sequence As the DNA sequence inserted between the transcription initiation site and the start of the coding sequence, i.e., the untranslated leader sequence, can influence gene expression, one can also employ a particular leader sequence.
  • Preferred leader sequence include those which comprise sequences selected to direct optimum expression of the attached gene, i.e., to include a preferred consensus leader sequence which can increase or maintain mRNA stability and prevent inappropriate initiation of translation (Joshi, 1987). Such sequences are known to those of skill in the art. Sequences that are derived from genes that are highly expressed in plants will be most preferred.
  • expression cassettes can be constructed and employed to target the gene product of the DNA segment to an intracellular compartment within plant cells or to direct a protein to the extracellular environment. This can generally be achieved by joining a DNA sequence encoding a transit or signal peptide sequence to the coding sequence of the DNA segment. Also, the DNA segment can be directed to a particular organelle, such as the chloroplast rather than to the cytoplasm.
  • the DNA fragment coding for the transit peptide may be chemically synthesized either wholly or in part from the known sequences of transit peptides such as those listed above.
  • the description of the optional sequences in the expression cassette, is commonly owned, co-pending PCT/US/0027704, filed Oct. 6, 2000, entitled “Method of Introducing a Plurality of Genes into Plants,” incorporated herein by reference.
  • Transformation of cells from plants, e.g., trees, and the subsequent production of transgenic plants using e.g., Agrobacterium-mediated transformation procedures known in the art, and further described herein, is one example of a method for introducing a foreign gene into plants.
  • Agrobacterium-mediated transformation procedures are cited as examples, herein.
  • transgenic plants may be produced by the following steps: (i) culturing Agrobacterium in low-pH induction medium at low temperature and preconditioning, i.e., coculturing bacteria with wounded tobacco leaf extract in order to induce a high level of expression of the Agrobacterium vir genes whose products are involved in the T-DNA transfer; (ii) coculturing desired plant tissue explants, including zygotic and/or somatic embryo tissues derived from cultured explants, with the incited Agrobacterium; (iii) selecting transformed callus tissue on a medium containing antibiotics; and (iv) converting the embryos into platelets.
  • Any non-tumorigenic A. tumefaciens strain harboring a disarmed Ti plasmid may be used in the method in accordance with the invention.
  • Any Agrobacterium system may be used.
  • Ti plasmid/binary vector system or a cointegrative vector system with one Ti plasmid may be used.
  • any marker gene or polynucleotide conferring the ability to select transformed cells, callus, embryos or plants and any other gene, such as for example a gene conferring resistance to a disease, or one improving lignin content or structure or cellulose content may also be used.
  • a person of ordinary skill in the art can determine which markers and genes are used depending on particular needs.
  • Agrobacterium is cultured in low-pH induction medium, i.e., any bacterium culture media with a pH value adjusted to from 4.5 to 6.0, most preferably about 5.2, and at low temperature such as for example about 19-30° C., preferably about 21-26° C.
  • the conditions of low-pH and low temperature are among the well-defined critical factors for inducing virulence activity in Agrobacterium (e.g., Altmorbe et al., 1989; Fullner et al., 1996; Fullner and Nester, 1996).
  • the bacteria is preconditioned by coculturing with wounded tobacco leaf extract (prepared according to methods known generally in the art) to induce a high level of expression of the Agrobacterium vir genes.
  • Agrobacterium cells Prior to inoculation of plant somatic embryos, Agrobacterium cells can be treated with a tobacco extract prepared from wounded leaf tissues of tobacco plants grown in vitro. To achieve optimal stimulation of the expression of Agrobacterium vir genes by wound-induced metabolites and other cellular factors, tobacco leaves can be wounded and pre-cultured overnight. Culturing of bacteria in low pH medium and at low temperature can be used to further enhance the bacteria vir gene expression and infectivity. Preconditioning with tobacco extract and the vir genes involved in the T-DNA transfer process are generally known in the art.
  • Agrobacterium treated as described above is then cocultured with a plant tissue explant, such as for example, zygotic and/or somatic embryo tissue.
  • a plant tissue explant such as for example, zygotic and/or somatic embryo tissue.
  • Non-zygotic (i.e., somatic) or zygotic tissues can be used.
  • Any plant tissue may be used as a source of explants. For example, cotyledons from seeds, young leaf tissue, root tissues, parts of stems including nodal explants, and tissues from primary somatic embryos such as the root axis may be used.
  • young tissues are a preferred source of explants.
  • assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting and PCR; “biochemical” assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant.
  • “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting and PCR
  • biochemical assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function
  • plant part assays such as leaf or root assays
  • analyzing the phenotype of the whole regenerated plant include, for example, “molecular biological” assays well known to those of skill in
  • Genomic DNA may be isolated from callus cell lines or any plant parts to determine the presence of the DNA segment through the use of techniques well known to those skilled in the art. Note that intact sequences will not always be present, presumably due to rearrangement or deletion of sequences in the cell.
  • DNA elements introduced through the methods of this invention may be determined by polymerase chain reaction (PCR). Using this technique, discreet fragments of DNA are amplified and detected by gel electrophoresis. This type of analysis permits one to determine whether a DNA segment is present in a stable transformant, but does not prove integration of the introduced DNA segment into the host cell genome. In addition, it is not possible using PCR techniques to determine whether transformants have exogenous genes introduced into different sites in the genome, i.e., whether transformants are of independent origin. It is contemplated that using PCR techniques it would be possible to clone fragments of the host genomic DNA adjacent to an introduced DNA segment.
  • PCR polymerase chain reaction
  • Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southern hybridization. Using this technique, specific DNA sequences that were introduced into the host genome and flanking host DNA sequences can be identified. Hence the Southern hybridization pattern of a given transformant serves as an identifying characteristic of that transformant. In addition, it is possible through Southern hybridization to demonstrate the presence of introduced DNA segments in high molecular weight DNA, i.e., confirm that the introduced DNA segment has been integrated into the host cell genome. The technique of Southern hybridization provides information that is obtained using PCR, e.g., the presence of a DNA segment, but also demonstrates integration into the genome and characterizes each individual transformant.
  • RNA analysis techniques may be conducted using DNA isolated from any part of a plant, RNA may only be expressed in particular cells or tissue types, and hence, it will be necessary to prepare RNA for analysis from these tissues.
  • PCR techniques may also be used for detection and quantitation of RNA produced from introduced DNA segments. In this application of PCR, it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances, PCR techniques, while useful, will not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and give information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and demonstrate only the presence or absence of an RNA species.
  • Southern blotting and PCR may be used to detect the DNA segment in question, they do not provide information as to whether the DNA segment is being expressed. Expression may be evaluated by specifically identifying the protein products of the introduced DNA segments or evaluating the phenotypic changes brought about by their expression.
  • Assays for the production and identification of specific proteins may make use of physical-chemical, structural, functional, or other properties of the proteins.
  • Unique physical-chemical or structural properties allow the proteins to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focussing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography.
  • the unique structures of individual proteins also offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as western blotting in which antibodies are used to locate individual gene products that have been separated by electrophoretic techniques. Additional techniques may be employed to absolutely confirm the identity of the product of interest such as evaluation by amino acid sequencing following purification. Although these are among the most commonly employed, other procedures may be additionally used.
  • Assay procedures may also be used to identify the expression of proteins by their functionality, especially the ability of enzymes to catalyze specific chemical reactions involving specific substrates and products. These reactions may be followed by providing and quantifying the loss of substrates or the generation of products of the reactions by physical or chemical procedures. Examples are as varied as the enzyme to be analyzed and may include assays for PAT enzymatic activity by following production of radiolabelled acetylated phosphinothricin from phosphinothricin.
  • Bioassays Very frequently the expression of a gene product is determined by evaluating the phenotypic results of its expression. These assays also may take many forms including but not limited to analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Chemical composition may be altered by expression of DNA segments encoding enzymes or storage proteins which change amino acid composition and may be detected by amino acid analysis, or by enzymes which change starch quantity which may be analyzed by near infrared reflectance spectrometry. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed treatments are evaluated under carefully controlled conditions termed bioassays.
  • pBKPpt 4CL Pt4CL1-a Aspen 4CL1 xylem specific promoter (Ppt 4CL, 1.1 kb, GenBank AF041051) was prepared and linked to aspen 4CL1 cDNA (Pt4CL1, GenBank AF041049) which was orientated in the antisense direction. Then the cassette containing aspen 4CL1 promoter and antisense aspen 4CL1 cDNA was positioned in a plant transformation binary vector, as shown in FIG. 1. (pBKPpt 4CL Pt4CL1-a construct)
  • pBKPpt 4cl PtCAld5H-s From pBKPpt 4CL Pt4CL-a construct, the antisense Pt4CL1 was replaced with PtCAld5H cDNA in a sense orientation, yielding a pBKPpt 4CL PtCAld5H-s transformation binary construct, as shown in FIG. 2.
  • the plants are transformed with a genes from the phenylpropanoid pathway (i.e., 4CL, AEOMT, CoAOMT, and CAld5H) using an operably linked to either a homologous or a heterologous and either a constitutive or tissue-specific promoter
  • Agrobacterium C58/pMP90 strain was grown in LB with selection of gentamicin at 28° C. overnight. Cells were harvested by centrifugation at 10,000 rpm for 10 minutes at 4° C. The cell pellet was washed with 0.5 volume of ice-cold 20 mM CaCl 2 , and centrifuged again. The cells were then resuspended in 0.1 volume of ice-cold 20 mM CaCl 2 in a sample tube. About 1 ⁇ g of binary vector DNA was added to 200 ⁇ L of the cell suspension and mixed by pipetting.
  • the sample tube was chilled in liquid N 2 for 5 minutes and thawed at 37° C. in a water bath for 5 minutes.
  • One mL of LB medium was added and the mixture was incubated at 28° C. for 3 hours with gentle shaking.
  • Twenty ⁇ L of the cells were spread onto a LB plate containing 25 ⁇ g/mL gentamicin and 50 ⁇ g/mL kanamycin and incubated at 28° C. for 2 days.
  • PCR amplification conditions, cycling parameters and primers are described below
  • pBKPpt 4cl Pt4CL-a and pBKPpt 4cl PtCal5H Agrobacterium clones were cultured in LB medium at 28° C. overnight separately.
  • the Agrobacterium strains were subcultured individually by a 100-fold dilution into 50 mL of LB (pH 5.4) containing 50 ⁇ g/mL kanamycin, 25 ⁇ g/mL gentamycin and 20 ⁇ M acetosyringone (in DMSO), and grown overnight at 28° C. with shaking.
  • An equal volume of the same density of individually cultured Agrobacterium strains was then mixed. Leaves excised from sterile tobacco plants were cut into pieces with a size of about 5 mm 2 and the leaf discs were then immersed in the Agrobacterium mixture for 5 minutes.
  • the treated leaf discs were placed on callus induction medium (WPM:Woody Plant Medium, BA: 6-benzyladenine +2,4-D: 2,4-dichlorophenoxyacetic acid; Tsai et al. 1994, Plant Cell Reports, 14:94-97) and cultured for 2 days. Then, the pre-cultured leaf discs were rinsed with sterile water several times to remove the Agrobacterium cells and washed in 1 mg/mL claforan and 1 mg/mL ticarcillin with shaking for 3 hours to kill Agrobacterium.
  • WPM Wood Plant Medium
  • the pre-cultured and washed leaf discs were cultured on callus induction medium containing 50 ⁇ g/mL kanamycin and 300 ⁇ g/mL claforan for selection of transformed cells.
  • callus induction medium containing 50 ⁇ g/mL kanamycin and 300 ⁇ g/mL claforan for selection of transformed cells.
  • the calli grown on the leaf discs were excised and transferred onto shoot induction medium (WPM+TDZ: N-phenyl-N′-1,2,3-thiadiazol-5-yl-urea) containing 50 ⁇ g/ml kanamycin and 300 ⁇ g/ml claforan for regenerating shoots.
  • shoots were grown to about 0.5 cm high, they excised and planted to rooting media (WPM with kanamycin and claforan). Whole plants about 7 cm high were transplanted into soil and maintained in a greenhouse for subsequent molecular characterization.
  • Genomic DNA was isolated according to Hu et al. (1998). About 100 mg of young leaves were collected from each plant growing in the greenhouse and ground in liquid N 2 to fine powder for DNA isolation using QIAGEN plant DNA isolation kit (Valencia, Calif.). Specifically, the powdered tissue was added to extract buffer containing 2% hexadecyltrimethylammonium bromide (CTAB), 100 mM Tris-HC1, pH 8.0, 20 mM EDTA, 1.4 M NaCl and 30 mM ⁇ -mercaptoethanol at 5 mL/g tissue. The extraction mixture was incubated in a tube at 60° C. for 1 hour with occasional shaking.
  • CAB hexadecyltrimethylammonium bromide
  • the pellet was dissolved in 2 mL TE buffer (10 mM Tris-HC1/0.1 mM EDTA, pH 8) and treated with 2 ⁇ g RNase A at 37° C. for 20 minutes.
  • the DNA was precipitated by addition of 2 mL of 5 M ammonia acetate and 10 mL of 95% ethanol at ⁇ 20° C. for 20 minutes. After centrifugation, the pellet was washed with 70% ethanol. After a brief drying, genomic DNA was dissolved in TE buffer.
  • PCR was used to verify the integration of the gene constructs in the genome of transgenic plants. Two specific primers were synthesized for each construct and used to PCR-amplify the corresponding construct in genome of transgenic Aspen. For the PBKPpt 4CL Pt4CL1-a construct, two specific primers were synthesized that amplify a 4CL cDNA fragment.
  • Pt4CL1 promoter sense primer (5′CAGGAATGCTCTGCACTCTG3′) (SEQ ID NO:11)
  • Pt4CL1 sense primer (5′ATGAATCCACAAGAATTCAT3′) (SEQ ID NO:12). at the translation start region.
  • Pt4CL1 promoter sense primer (5′CAGGAATGCTCTGCACTCTG3′) (SEQ ID NO:13)
  • PtCald5H antisense primer (5′TTAGAGAGGACAGAGCACACG3′) (SEQ ID NO:14) at translation stop region.
  • the PCR reaction mixture contained 100 ng genomic DNA of transformed aspen, and 0.2 ⁇ M of each primer, 100 ⁇ M of each deoxyribonucleotide triphosphate, 1 ⁇ PCR buffer and 2.5 Units of Taq DNA polymerase (Promega Madison, Wis.) in a total volume of 50 ⁇ L.
  • the cycling parameters were as follows: 94° C. for 1 minute, 56° C. for 1 minute (for 4CL and CAld5H or can vary between cDNA templates used) according to different gene checked) and 72° C. for 2 minute, for 40 cycles, with 5 minutes at 72° C. extension.
  • the PCR products were electrophoresized on a 1% agarose gel.
  • Table 4 summarizes the numerical results from simultaneous manipulating xylem-specific expression of 4CL and CAld5H in transgenic aspen.
  • Group II plants (# 32, 84, 93, and 94) harbored only sense PtCAld5H cDNA
  • Group III plants (#71, 72, 74, and 141) contained both antisense Pt4CL1 and sense PtCAld5H transgenes.
  • These transgenic trees were then further analyzed for their lignin and cellulose contents and lignin S/G ratio (Table 4). It is clear that, when compared with the control, untransformed aspen, transgenic plants (#21, 22, 23, 25, and 37) engineered for the suppression of 4CL gene with antisense Pt4CL1 transgene had drastic reductions in their lignin content, with significant increases in their cellulose content.
  • Transgenic plants (#32, 84, 93, 94, and 108) engineered for the overexpression of CAld5H with sense PtCAld5H transgene had pronounced increases in their S/G ratio, but their lignin and cellulose contents remained essentially unaffected.
  • transgenic plants (#71, 72, 74, and 141) all exhibited low lignin content, high S/G ratio and elevated cellulose quantity.
  • these results show that multiple genes carried by individual Agrobacterium strains can be integrated simultaneously into the plant genome.
  • transgenic plants with a nearly 30% increase in cellulose content and over 50% lignin quantity reduction, accompanied with a significant augmentation of the S/G ratio, can be easily produced. It is conceivable that more genes can also be efficiently transferred at one time. Only one suitable marker gene is required for this system, although a number of marker genes can also be employed. TABLE 4 Simultaneous manipulating xylem-specific expression of 4CL and CAld5H in transgenic aspen.
  • gymnosperm plants are genetically transformed with SAD, CAld5H, and AldOMT genes in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system allows. These three genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • gymnosperm plants are genetically transformed with SAD, CAld5H and AldOMT genes in the sense orientation and 4CL gene in either sense or antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • gymnosperm plants are genetically transformed with SAD, CAld5H and AldOMT genes in the sense orientation and 4CL and CAD genes in either sense or antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These five genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • gymnosperm plants are genetically transformed with 4CL gene in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system.
  • gymnosperm plants are genetically transformed with SAD, CAld5H, AldOMT, and 4CL genes in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • G syringyl/guaiacyl
  • gymnosperm plants are genetically transformed with SAD, CAld5H, AldOMT, and 4CL genes in the sense orientation and CAD gene in the antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • angiosperm plants are genetically transformed with either CAld5H, AldOMT, or SAD genes in sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These three genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • angiosperm plants are genetically transformed with either SAD, CAld5H, or AldOMT genes in the sense orientation and 4CL gene in the sense or antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • angiosperm plants are genetically transformed with either SAD, CAld5H, or AldOMT genes in the sense orientation and 4CL and CAD genes in the sense or antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These five genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • angiosperm plants are genetically transformed with 4CL gene in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system.
  • angiosperm plants are genetically transformed with 4CL in the sense orientation and either SAD, CAld5H, or AldOMT genes also in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.
  • angiosperm plants are genetically transformed with 4CL in the sense orientation and either SAD, CAld5H, or AldOMT genes also in the sense orientation and CAD in the antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Nutrition Science (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to a method of concurrently introducing multiple genes into plants and trees is provided. The method includes simultaneous transformation of plants with multiple genes from the phenylpropanoid pathways including 4CL, CAld5H, AldOMT, SAD and CAD genes and combinations thereof to produce various lines of transgenic plants displaying altered agronomic traits. The agronomic traits of the plants are regulated by the orientation of the specific genes and the selected gene combinations, which are incorporated into the plant genome.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application claims the benefit of U.S. Provisional Application No. 60/230,086, filed on Sep. 5, 2000, and is incorporated herein by reference.[0001]
  • STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
  • [0002] This invention was made with United States government support awarded by the Energy Biosciences Program, United States Department of Energy, and the United States Department of Agriculture research grant numbers USDA 99-35103-7986, USDA 01-03749, and DOE DE-FG02-01ER15179. The United States government has certain rights in this invention.
  • BACKGROUND OF THE INVENTION
  • The invention provides a method of introducing two or more genes, involved in lignin biosynthesis, into plant cells. The method of the invention employs either an Agrobacterium-mediated or other appropriate plant gene delivery system by which multiple genes together with a single selectable marker gene are simultaneously transferred and inserted into the genome of plants with high frequencies. [0003]
  • The ability to introduce foreign genes into plants is a prerequisite for engineering agronomic traits in plants. Many systems have been developed for introducing a foreign gene into plant cells, which involve mainly either Agrobacterium- or microprojectile bombardment-mediated transformation (Christou, 1996). The principle of all these systems involves the insertion of a target gene into the host plant genome together with a selectable marker gene encoding either antibiotic or herbicide resistance to aid in the selection of transgenic cells from non-transgenic cells. These systems generally are only effective for introducing a single target gene into the host plant. [0004]
  • To alter agronomic traits, which generally are polygenic in nature, multiple genes involved in complex biosynthetic pathways must be introduced and expressed in plant cells. In this context, the traditional single-gene transfer systems are essentially useless for the following two reasons: 1) it is impractical to introduce multiple genes by repetitive insertion of single genes into transgenic plants due to the time and effort required for recovery of the transgenic tissues; in particular, a repetitive single-gene approach is highly impractical for plant species such as trees which, depending upon the species, require two to three years for transgenic tissue selection and regeneration into a tree; and 2) the presence of a selectable marker gene in a transgenic line precludes the use of the same marker gene in subsequent transformations of plant material from that line. Moreover, the number of available marker genes is limited, and many plant species are recalcitrant to regeneration unless appropriate antibiotic or herbicide selection is used. [0005]
  • Chen et aL (1998) recently reported the genetic transformation of rice with multiple genes by cobombardment of several gene constructs into embryogenic suspension tissues. However, particle bombardment-mediated gene transfer into embryogenic tissues is highly species-dependent, and regeneration of whole plants from embryogenic cells cannot be achieved for a variety of plant species (Horsch et al., 1985). [0006]
  • In contrast, Agrobacterium-mediated gene transfer and whole plant regeneration through organogenesis is a simple process and a less species-dependent system than bombardment-mediated transformation and regeneration via embryogenesis. However, the introduction of more than one gene in a single plasmid vector via Agrobacterium may be technically troublesome and limited by the number or the size of the target genes (Chen et al., 1998). For example, Tricoli et al. (1995) reported the transfer of three target genes to squash via Agrobacterium-mediated gene transfer. A binary plasmid vector containing the three target genes was incorporated into an Agrobacterium strain, which was subsequently used to infect the leaf tissue of squash. As only one line was recovered from numerous infected squash tissues that contained all of the target genes, the use of a single binary vector with a number of genes appears to be a highly inefficient method to produce transgenic plants with multiple gene transfers. Therefore, it was commonly accepted that transfer of multiple genes via Agrobacterium-mediated transformation was impractical (Ebinuma et al., 1997), until success of multiple gene transfer via Agrobacterium was first reported in co-pending, commonly owned PCT application, PCT/US/0027704, filed Oct. 6, 2000, entitled “Method of Introducing a Plurality of Genes into Plants” by Chiang et al, incorporated herein by reference. However, homologous tissue-specific preparation of transgenic trees to specifically alter lignin content, increase S/G (syringyl:guaiacyl) lignin ratio and increase cellulose quantity, as compared to an untransformed plant was unsuccessful. [0007]
  • Yet, the altering of lignin content and composition in plants has been a goal of genetically engineered traits in plants. Lignin, a complex phenolic polymer, is a major part of the supportive structure of most woody plants including angiosperm and gymnosperm trees, which, in turn, are the principal sources of fiber for making paper and cellulosic products. Lignin generally constitutes about 25% of the dry weight of the wood, making it the second most abundant organic compound on earth after cellulose. Lignin provides rigidity to wood for which it is well suited due, in part, to its resistance to biochemical degradation. [0008]
  • Despite its importance to plant growth and structure, lignin is nonetheless problematic to post-harvest, cellulose-based wood/crop processing for fiber, chemical, and energy production because it must be removed or degraded from cellulose at great expense. Certain structural constituents of lignin, such as the guaiacyl (G) moiety, promote monomer cross-linkages that increase lignin resistance to degradation (Sarkanen, 1971; Chang and Sarkanen, 1973; Chiang and Funaoka, 1990). In angiosperms, lignin is composed of a mixture of guaiacyl (G) and syringyl (S) monolignols, and can be degraded at considerably less energy and chemical cost than gymnosperm lignin, which consists almost entirely of guaiacyl moieties (Freudenberg, 1965). It has been estimated that, if syringyl lignin could be genetically incorporated into gymnosperm guaiacyl lignin or into angiosperms to increase the syringyl lignin content, the annual saving in processing of such genetically engineered plants as opposed to their wild types would be in the range of $6 to $10 billion in the U.S. alone. Consequently, there has been long-standing incentive to understand the biosynthesis of syringyl monolignol to genetically engineer plants to contain more syringyl lignin, thus, facilitating wood/crop processing (Trotter, 1990; Bugos et al., 1991; Boudet et al., 1995; Hu et al., 1999). [0009]
  • Depending on the use for the plant, genetic engineering of certain traits has been attempted. For some plants, as indicated above, there has been a long-standing incentive to genetically modify lignin and cellulose to decrease lignin and increase cellulose contents. For example, it has been demonstrated that the digestibility of forage crops by ruminants is inversely proportional to lignin content in plants (Buxton and Roussel, 1988, Crop. Sci., 28, 553-558; Jung and Vogel, 1986, J. Anim., Sci., 62, 1703-1712). Therefore, decreased lignin and high cellulose plants are desirable in forage crops to increase their digestibility by ruminants, thereby providing the animal with more nutrients per unit of forage. [0010]
  • In other plants, genetically increasing the S/G ratio of the lignin has been sought. As noted above, lignin in angiosperms is composed of guaiacyl (G) and syringyl (S) monomeric units, whereas gymnosperm lignin consists entirely of G units. The structural characteristics of G units in gymnosperm lignin promote monomer cross-linkages that increase lignin resistance to chemical extraction during wood pulp production. However, the S units present in angiosperm lignin prevent such chemical resistant cross-links. Therefore, without exception, chemical extraction of G lignin in pulping of gymnosperms is more difficult and requires more chemicals, longer reaction times and higher energy levels than the extraction of G-S lignin during pulping of angiosperms (Sarkanen, K. V., 1971, in Lignins: Occurrence, Formation, Structure and Reaction, Sarkanen, K. V. & Ludwig, C. H., eds., Wiley-Interscience, New York; Chang, H. M. and Sarkanen, K. V., 1973, TAPPI, 56:132-136). As a rule, the reaction rate of extracting lignin during wood pulping is directly proportional to the quantity of the S unit in lignin (Chang, H. M. and Sarkanen, K. V., 1973, TAPPI, 56:132-136). Hence, altering lignin into more reactive G-S type in gymnosperms and into high S/G ratio in angiosperms would represent a pivotal opportunity to enhance current pulping and bleaching efficiency and to provide better, more economical, and more environmentally sound utilization of wood. [0011]
  • Recent results have indicated that high S/G ratio may also add further mechanical advantages to plants, balancing the likely loss of sturdiness of plants with severe lignin reduction (Li et al., 2001, Plant Cell, 13:1567-1585). Moreover, a high S/G lignin ratio would also improve the digestibility of forage crops by ruminants (Buxton and Roussel, 1988, Crop. Sci., 28, 553-558; Jung and Vogel, 1986, J. Anim., Sci., 62, 1703-1712). [0012]
  • In some applications, both a high lignin content and high S/G ratio have been sought (i.e., combining these two traits in plants). For example, it has been demonstrated that when lignin is extracted out from wood during chemical pulping, lignin in the pulping liquor is normally used as a fuel source to provide energy to the pulping and bleaching operations. This lignin-associated energy source, which is not necessary for pulp mills using purchased fuel for energy, is essential to some pulp mills which depend upon internal sources, such as extracted lignin, to be self-sufficient in energy. Therefore, for this purpose, it may be desirable to increase lignin content in pulpwood species, and at the same time to increase the S/G ratio in these species to facilitate the extraction of more lignin to be used as fuel. [0013]
  • Additionally, for grain production and other non-related purposes, increased lignin content and/or S/G lignin ratio are desirable to provide extra sturdiness in plants to prevent the loss of socially and economically important food crops due to dislodging and due to damage to the aerial parts of the plant. [0014]
  • The plant monolignol biosynthetic pathway is set forth in FIG. 1 and will be explained in more detail hereinbelow. The key lignin control sites in the monolignol biosynthetic pathway are mediated by genes encoding the enzymes 4-coumarate-CoA ligase (4CL) (Lee et al., 1997), coniferyl aldehyde 5-hydroxylase (CAld5H) (Osakabe et al., 1999) and S-adenosyl-L-methionine (SAM)-dependent 5-hydroxyconiferaldehyde O-methyltransferase (AldOMT) (Li et al., 2000), respectively, for the formation of sinapaldehyde (see, FIG. 1). Further, coniferyl alcohol dehydrogenase (CAD) (MacKay et al., 1997) catalyzes the reaction including the substrate coniferaldehyde to coniferyl alcohol. It has recently been discovered that sinapyl alcohol dehydrogenase (SAD) enzymatically converts sinapaldehyde into sinapyl alcohol, the syringyl monolignol, for the biosynthesis of syringyl lignin in plants (see, FIG. 1). See, concurrently filed, commonly owned U.S. non-provisional application entitled “Genetic Engineering of Syringyl-Enriched Lignin in Plants,” incorporated herein by reference. It should be noted that the gene encoding the enzyme sinapyl alcohol dehydrogenase (SAD) represents the last gene that is indispensable for genetic engineering of syringyl lignin in plants. [0015]
  • A summary of the conserved regions contained within the coding sequence of each of the above listed proteins is described below. Because SAD is a recently discovered enzyme in Aspen, sequence alignments with other representative species were unable to be performed. [0016]
  • The protein sequence alignments of plant AldOMTs are shown in FIG. 9. All AldOMTs have three conserved sequence motifs (I, II, and III) which are the binding sites of S-adenosyl-L-methionine (SAM), the co-substrate or methyl donor for the OMT reaction (Ibrahim, 1997, Trends Plant Sci., 2:249-250; Li et al., 1997, Proc. Natl. Acad. Sci. USA, 94:5461-5466; Joshi and Chiang, 1998, Plant Mol. Biol., 37:663-674). These signature sequence motifs and the high sequence homology of these proteins to PtAldOMT attest to their function as an AldOMT specific for converting 5-hydroxyconiferaldehyde into sinapaldehyde (Li et al., 2000, J. Biol. Chem., 275:6537-6545). This AldOMT, like CAld5H, also operates at the aldehyde level of the plant monolignol biosynthetic pathway. [0017]
  • The protein sequence alignments of plant CADs are shown in FIG. 10. It was recently proven that CADs are actually guaiacyl monolignol pathway specific (Li et al., 2001, Plant Cell, 13:1567-1585). Based on high sequence homology, the alignment program picked up CADs from angiosperms as well as gymnosperms (radiata pine, loblolly pine and spruce) which have only G-lignin. All CADs have the Zn1 binding motif and structural Zn2 consensus region, as well as a NADP binding site (Jornvall et al., 1987, Eur. J. Biochem., 167:195-201; MacKay et al., 1995, Mol. Gen. Genet., 247:537-545). All these sequence characteristics and high sequence homology to PtCAD attest to these CAD function as a G-monolignol specific CAD (Li et al., 2001, Plant Cell, 13:1567-1585). [0018]
  • The protein sequence alignments of plant Cald5Hs are shown in FIG. 11. Although, there are different types of 5-hydroxylases, i.e., F5H, CAld5H is the sole enzyme catalyzing specifically the conversion of coniferaldehyde into 5-hydroxyconiferaldehyde. All full-length CAld5Hs have the proline-rich region located from [0019] amino acid 40 to 45 which is believed to be involved in the process of correct folding of microsomal P450s and is also important in heme incorporation into P450s (Yamazaki et al. 1993, J. Biochem. 114:652-657). Also they all have the heme-binding domain (PFGXGXXXCXG) that is conserved in all P450 proteins Nelson et al. 1996, Pharmacogenetics, 6:1-41). These signature sequences and the high sequence homology of these proteins to PtCAld5H their function as a 5-hydroxylase that is specific for converting coniferaldehyde into 5-hydroxyconiferaldehyde (Osakabe et al., 1999, Proc. Natl. Acad. Sci. USA, 96:8955-8960).
  • The protein sequence alignment of plant 4CLs are shown in FIG. 12. In general, 4CL catalyzes the activation of the hydroxycinnamic acids to their corresponding hydroxycinnamoyl-CoA esters. 4CL has the highest activity with ρ-coumaric acid. 4CL cDNA sequences have been reported from a number of representative angiosperms and gymnosperms, revealing two highly conserved regions, a putative AMP-binding region (SSGTTGLPKGV), and a catalytic motif (GEICIRG). The amino acid sequences of 4CL from plants contain a total of five conserved Cys residues. [0020]
  • Despite recognition of these key enzymes in lignin biosynthesis, there continues to be a need to develop an improved method to simultaneously control the lignin quantity, lignin compositions, and cellulose contents in plants by introducing multiple genes into plant cells. [0021]
  • BRIEF SUMMARY OF THE INVENTION
  • The invention provides a method of introducing two or more genes involved in lignin biosynthesis present in one or more independent vectors into plant cells. The method of the invention suitably employs an Agrobacterium-mediated or another gene delivery system by which multiple genes together with a single selectable marker gene are simultaneously transferred and inserted into the genome of plants with high frequencies. [0022]
  • If an Agrobacterium-mediated gene delivery system is used, each gene of interest is present in a binary vector that has been introduced into Agrobacterium to yield an isolated Agrobacterium strain comprising the binary vector. Moreover, more than one gene of interest may be present in each binary vector. Plant materials comprising plant cells, e.g., plant seed, plant parts or plant tissue including explant materials such as leaf discs, from a target plant species are suitably inoculated with at least two, preferably at least three, and more preferably at least four or more, of the isolated Agrobacterium strains, each containing a different gene of interest. A mixture of the strains is suitably contacted with plant cells. At least one of the binary vectors in the isolated Agrobacterium strains contains a marker gene, and any marker gene encoding a trait for selecting transformed cells from non-transformed cells may be used. Transformed plant cells are regenerated to yield a transgenic plant, the genome of which is augmented with DNA from at least two, preferably at least three, and more preferably at least four, and even more preferably at least five of the binary vectors. [0023]
  • The method of the invention is thus applicable to all plant species that are susceptible to the transfer of genetic information by Agrobacterium or other gene delivery system. Suitable plant species useful in the method of the invention include agriculture and forage crops, as well as monocots. In particular, plant species useful in the method of the invention include trees, e.g., angiosperms and gymnosperms, and more suitably a forest tree, but are not limited to the tree. [0024]
  • The method of the invention is suitably employed to enhance a desired agronomic trait by altering the expression of two or more genes. Such traits include alterations in lignin biosynthesis (e.g., reduction, augmentation and/or structural changes), cellulose biosynthesis (e.g., augmentation, reduction, and/or quality including high degree of polymerization and crystallinity), growth, wood quality (e.g., high density, low juvenile wood, high mature wood, low reaction wood, desirable fiber angle), stress resistance (e.g., cold-, heat-, and salt-tolerance, pathogen-, insect- and other disease-resistance, herbicide-resistance), sterility, high grain yield (for forage and food crops), and increased nutrient level. [0025]
  • Thus, the present invention advantageously provides gymnosperm and angiosperm plants with decreased lignin content, increased syringyl/guaiacyl (S/G) lignin ratio and increased cellulose content in which a single trait or multiple traits are changed. [0026]
  • In another aspect, the invention provides gymnosperm plants with syringyl enriched lignin and/or increased lignin content and/or increased syringyl/guaiacyl (S/G) lignin ratio. [0027]
  • Similarly, the present invention also provides angiosperm plants with increased lignin content. [0028]
  • Other advantages and a fuller appreciation of specific attributes and variations of the invention will be gained upon an examination of the following detailed description of exemplary embodiments and the like in conjunction with the appended claims.[0029]
  • BRIEF DESCRIPTION OF THE DRAWING(S)
  • FIG. 1 is a schematic representation of plant monolignol pathways for production of coniferyl alcohol and sinapyl alcohol; [0030]
  • FIG. 2 is the SAD polynucleotide DNA sequence (SEQ ID NO: 1) and the SAD amino acid sequence (SEQ ID NO: 2) respectively FIG. 2A and 2B; [0031]
  • FIG. 3 is the CAld5H polynucleotide DNA sequence (SEQ ID NO: 3) and the CAld5H amino acid sequence (SEQ ID NO: 4) respectively FIG. 3A and 3B; [0032]
  • FIG. 4 is the AldOMT polynucleotide DNA sequence (SEQ ID NO: 5) and the AldOMT amino acid sequence (SEQ ID NO: 6) respectively FIG. 4A and 4B; [0033]
  • FIG. 5 is the 4CL polynucleotide DNA sequence (SEQ ID NO: 7) and the 4CL amino acid sequence (SEQ ID NO: 10) respectively FIG. 5A and 5B; [0034]
  • FIG. 6 is the CAD polynucleotide DNA sequence (SEQ ID NO: 8) and the CAD amino acid sequence (SEQ ID NO: 9) respectively FIG. 6A and 6B; [0035]
  • FIG. 7 is a map of the DNA construct, pBKPpt[0036] 4CL Pt4CL1-a, positioned in a plant transformation binary vector.
  • FIG. 8 is a map of the DNA construct, pBKPpt[0037] 4CL PtCAld5H-s, positioned in a plant transformation binary vector.
  • FIG. 9 is the protein sequence alignment of AldOMTs for representative species of plants. [0038]
  • FIG. 10 is the protein sequence alignment of CADs for representative species of plants. [0039]
  • FIG. 11 is the protein sequence alignment of CAld5Hs for representative species of plants. [0040]
  • FIG. 12 is the protein sequence alignment of 4CLs for representative species of plants. [0041]
  • It is expressly understood that the figures of the drawing are for the purposes of illustration and description only and are not intended as a definition of the limits of the invention.[0042]
  • DETAILED DESCRIPTION OF THE INVENTION
  • The present invention provides a method and DNA constructs useful for the transformation of plant tissue for the alteration of lignin monomer composition, increased syringyl/guaiacyl (S/G) lignin ratio and increased cellulose content and transgenic plants resulting from such transformations. The present invention is of particular value to the paper and pulp industries because lignin containing higher syringyl monomer content is more susceptible to chemical delignification. Woody plants transformed with the DNA constructs provided herein offer a significant advantage in the delignification process over conventional paper feedstocks. Similarly, modification of the lignin composition in grasses by the insertion and expression of a heterologous SAD gene offers a unique method for increasing the digestibility of grasses and is of significant potential economic benefit to the farm and agricultural industries. [0043]
  • The terms used in this specification generally have their ordinary meanings in the art, within the context of the invention and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the person of skill in the art in describing the compositions and methods of the invention and how to make and use them. It will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification, including examples of any terms discussed herein, is illustrative only, and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to the preferred embodiments. [0044]
  • As used herein, “gene” refers to a nucleic acid fragment that expresses a specific protein including the regulatory sequences preceding (5′ noncoding) and following (3′ noncoding) the coding region or coding sequence (See, below). “Native” gene refers to the gene as found in nature with its own regulatory sequences. [0045]
  • “Endogenous gene” refers to the native gene normally found in its natural location in the genome. [0046]
  • “Transgene” refers to a gene that is introduced by gene transfer into the host organism. [0047]
  • “Coding sequence” or “Coding Region” refers to that portion of the gene that contains the information for encoding a polypeptide. The boundaries of the coding sequence are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus. A coding sequence can include, for example, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA, and even synthetic DNA sequences. [0048]
  • “Promoter” or “Promoter Sequence” refers to a DNA sequence, in a given gene, which sequence controls the expression of the coding sequence by providing the recognition site for RNA polymerase and other factors required for proper transcription. Most genes have regions of DNA sequence that are promoter sequences which regulate gene expression. Promoter regions are typically found in the 5′ flanking DNA sequence upstream from the coding sequence in both prokaryotic and eukaryotic cells. A promoter sequence provides for regulation of transcription of the downstream gene sequence and typically includes from about 50 to about 2000 nucleotide base pairs. Promoter sequences also contain regulatory sequences such as enhancer sequences that can influence the level of gene expression. Some isolated promoter sequences can provide for gene expression of heterologous DNAs, that is DNA different from the natural homologous DNA. Promoter sequences are also known to be strong or weak or inducible. A strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression. An inducible promoter is a promoter that provides for turning on and off of gene expression in response to an exogenously added agent or to an environmental or developmental stimulus. An isolated promoter sequence that is a strong promoter for heterologous DNAs is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of transformed cells, and provides for a high level of gene expression when desired. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions. [0049]
  • “Regulatory sequence(s)” refers to nucleotide sequences located upstream (5′), within, and/or downstream (3′) of a coding sequence, which control the transcription and/or expression of the coding sequences in conjunction with the protein biosynthetic apparatus of the cell. Regulatory sequences include promoters, translation leader sequences, transcription termination sequences and polyadenylation sequences. [0050]
  • “Encoding” and “coding” refer to the process by which a gene, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequences to produce an active enzyme. It is understood that the process of encoding a specific amino acid sequence includes DNA sequences that may involve base changes that do not cause a change in the encoded amino acid, or which involve base changes which may alter one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence. It is therefore understood that the invention encompasses more than the specific exemplary sequences. Modifications to the sequences, such as deletions, insertions or substitutions in the sequence which produce silent changes that do not substantially affect the functional properties of the resulting protein molecule are also contemplated. For example, alterations in the gene sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are contemplated. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the protein molecule would also not be expected to alter the activity of the protein. In some cases, it may in fact be desirable to make mutants of the sequence to study the effect of retention of biological activity of the protein. Each of these proposed modifications is well within the routine skill in the art, as is the determination of retention of biological activity in the encoded products. Moreover, the skilled artisan recognizes that sequences encompassed by this invention are also defined by their ability to hybridize, under stringent condition, with the sequences exemplified herein. [0051]
  • “Expression” is meant to refer to the production of a protein product encoded by a gene. “Overexpression” refers to the production of a gene product in transgenic organisms that exceed levels of production in normal or non-transformed organisms. [0052]
  • “Functional portion” or “functional fragment” or “functional equivalents” of an enzyme is that portion, fragment or equivalent section which contains the active site for binding one or more reactants or is capable of improving or regulating the rate of reaction. The active site may be made up of separate portions present on one or more polypeptide chains and will generally exhibit high substrate specificity. [0053]
  • “Enzyme encoded by a nucleotide sequence” includes enzymes encoded by a nucleotide sequence which includes partial isolated DNA sequences. [0054]
  • “Transformation” refers to the transfer of a foreign gene into the genome of a host organism and its genetically stable inheritance. [0055]
  • “% identity” refers to the percentage of the nucleotides/amino acids of one polynucleotide/polypeptide that are identical to the nucleotides/amino acids of another sequence of polynucleotide/polypeptide as identified by a program such as GAP from Genetics Computer Group Wisconsin (GCG) package (version 9.0) (Madison, Wis.). GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. When parameters required to run the above algorithm are not specified, the default values offered by the program are contemplated. [0056]
  • “Substantial homology” or “substantial similarity” refers to a 70% or more similarity or 70% homology wherein “% similarity” or “% homology” between two polypeptide sequences is a function of the number of similar positions shared by two sequences on the basis of the scoring matrix used divided by the number of positions compared and then multiplied by 100. This comparison is made when two sequences are aligned (by introducing gaps if needed) to determine maximum homology. The PowerBlast program, implemented by the National Center for Biotechnology Information, can be used to compute optimal, gapped alignments. GAP program from Genetics Computer Group Wisconsin package (version 9.0) (Madison, Wis.) can also be used. [0057]
  • “Lignin monomer composition” refers to the relative ratios of guaiacyl monomer and syringyl monomer found in lignified plant tissue. [0058]
  • “Plant” includes whole plants and portions of plants, including plant organs (e.g., roots, stems, leaves, etc). [0059]
  • “Angiosperm” refers to plants that produce seeds encased in an ovary. A specific example of an angiosperm is [0060] Liquidambar styraciflua (L.)[sweetgum].
  • “Gymnosperm” refers to plants that produce naked seeds, i.e., seeds that are not encased in an ovary. A specific example of a gymnosperm is [0061] Pinus taeda (L.)[loblolly pine].
  • As used herein, the terms “isolated and/or purified” with reference to a nucleic acid molecule or polypeptide refer to in vitro isolation of a nucleic acid or polypeptide molecule from its natural cellular environment, and from association with other components of the cell, such as nucleic acid or polypeptide, so that it can be sequenced, replicated and/or expressed. [0062]
  • An “isolated” strain of Agrobacterium refers to cells derived from a clone of Agrobacterium that is transformed in vitro with an isolated binary vector. [0063]
  • A “vector” is a recombinant nucleic acid construct, such as plasmid, phage genome, virus genome, cosmid, or artificial chromosome to which a polynucleotide in accordance with the invention may be attached. In a specific embodiment, the vector may bring about the replication of the attached segment, e.g., in the case of a cloning vector. [0064]
  • “Sinapyl alcohol dehydrogenase” or “SAD”, coniferyl alcohol dehydrogenase or “CAD”, coniferaldeyde 5-hydroxylase or “Cald5H”, 5-hydroxyconiferaldehyde O-methyltransferase or “AldOMT”, and 4-coumarate-CoA ligase or “4CL” refer to enzymes in the plant phenylpropanoid biosynthetic pathway. In the illustrated embodiments of the present invention, the DNA sequences encoding these enzymes were identified from quaking aspen [0065] Populus tremuloides. It is understood that each sequence can be used as a probe to clone its equivalent from any plant species by techniques (EST, PCR, RT-PCR, antibodies, etc.) well known in the art.
  • The Phenyl Propanoid Biosynthetic Pathway [0066]
  • Reference is made to FIG. 1 which shows different steps in the biosynthetic pathways from 4-coumarate (1) to guaiacyl (coniferyl alcohol (6)) and syringyl (sinapyl alcohol (9)) monolignols for the formation of guaiacyl-syringyl lignin together with the enzymes responsible for catalyzing each step. The enzymes indicated for each of the reaction steps are: 4-coumaric acid 3-hydroxylase (C3H) which converts 4-coumarate (1) to caffeate (2); 4-coumarate-CoA ligase (4CL) converts caffeate (2) to caffeoyl CoA (3) which in turn is converted to feruloyl CoA (4) by caffeoyl-CoA O-methyltransferase (CCoAOMT); cinnamoyl-CoA reductase (CCR) converts feruloyl CoA (4) to coniferaldehyde (5); coniferyl alcohol dehydrogenase (CAD) converts coniferaldehyde (5) to the guaiacyl monolignol coniferyl alcohol (6); at coniferaldehyde (5), the pathway splits wherein coniferaldehyde (5) can also be converted to 5-hydroxyconiferaldehyde (7) by coniferaldeyde 5-hydroxylase (Cald5H); 5-hydroxyconiferaldehyde O-methyltransferase (AldOMT) converts 5-hydroxconiferaldehyde (7) to sinapaldehyde (8) which, in turn, is converted to the syringyl monolignol, sinapyl alcohol (9) by sinapyl alcohol dehydrogenase (SAD). [0067]
  • DNA Constructs [0068]
  • According to the present invention, a DNA construct is provided which is a plant DNA having a promoter sequence, a coding region and a terminator sequence. The coding region encodes a combination of enzymes essential to lignin biosynthesis, specifically, SAD, CAD, Cald5H, AldOMT, and 4CL protein sequences, substantially similar sequences, or functional fragments thereof. The coding region is suitably a minimum size of 50 bases. The gene promoter is positioned at the 5′-end of a transgene (e.g., 4CL alone or together with SAD, Cald5H, and AldOMT, and combinations thereof, or 4CL and CAD alone, or together with CAld5H, SAD, and AldOMT, and combinations thereof, as described hereinafter) for controlling the transgene expression, and a gene termination sequence that is located at the 3′-end of the transgene for signaling the end of the transcription of the transgene. [0069]
  • The DNA construct in accordance with the present invention can be incorporated into the genome of a plant by transformation to alter lignin biosynthesis, increase syringyl/guaiacyl (S/G) lignin ratio and increase cellulose content. The DNA construct may include clones of CAld5H, SAD, AldOMT, CAD, and 4CL, and variants thereof such as are permitted by the degeneracy of the genetic code and the functional equivalents thereof. [0070]
  • The DNA constructs of the present invention may be inserted into plants to regulate production the following enzymes: CAld5H, SAD, AldOMT, CAD, and 4CL. Depending on the nature of the construct, the production of the protein may be increased or decreased, either throughout or at particular stages in the life of the plant, relative to a similar control plant that does not incorporate the construct into its genome. For example, the orientation of the DNA coding sequence, promoter, and termination sequence can serve to either suppress lignin formation or amplify lignin formation. For the down-regulation of lignin synthesis, the DNA is in the antisense orientation. For the amplification of lignin biosynthesis, the DNA is in the sense orientation, thus to provide one or more additional copies of the DNA in the plant genome. In this case, the DNA is suitably a full-length cDNA copy. It is also possible to target expression of the gene to specific cell types of the plants, such as the epidermis, the xylem, the roots, etc. Constructs in accordance with the present invention may be used to transform cells of both monocotyledons and dicotyledons plants in various ways known in the art. In many cases, such plant cells may be cultured to regenerate whole plants which subsequently reproduce to give successive generations of genetically modified plants. Examples of plants that are suitably genetically modified in accordance with the present invention, include but are not limited to, trees such a aspen, poplar, pine and eucalyptus. [0071]
  • Promoters and Termination Sequences [0072]
  • Various gene promoter sequences are well known in the art and can be used in the DNA constructs of present invention. The promoter in the constructs in accordance with the present invention suitably provides for expression of the linked DNA segment. The promoter can also be inducible so that gene expression can be turned on or off by an exogenously added agent. It may also be preferable to combine the desired DNA segment with a promoter that provides tissue specific expression or developmentally regulated gene expression in plants. [0073]
  • The promoter may be selected from promoters known to operate in plants, e.g., CaMV35S, GPAL2, GPAL3 and endogenous plant promoter controlling expression of the enzyme of interest. Use of a constitutive promoter such as the CaMV35S promoter (Odell et al. 1985), or CaMV 19S (Lawton et al., 1987) can be used to drive the expression of the transgenes in all tissue types in a target plant. Other promoters are nos (Ebert et al. 1987), Adh (Walker et al., 1987), sucrose synthase (Yang et al., 1990), Δ-tubulin, ubiquitin, actin (Wang et al., 1992), cab (Sullivan et al., 1989), PEPCase (Hudspeth et al., 1989) or those associate with the R gene complex (Chandler et al., 1989). On the other hand, use of a tissue specific promoter permits functions to be controlled more selectively. The use of a tissue-specific promoter has the advantage that the desired protein is only produced in the tissue in which its action is required. Suitably, tissue-specific promoters, such as those would confine the expression of the transgenes in developing xylem where lignification occurs, may be used in the inventive DNA constructs. [0074]
  • A DNA segment can be combined with the promoter by standard methods as described in Sambrook et al., 2nd ed. (1982). Briefly, a plasmid containing a promoter such as the CaMV 35S promoter can be constructed as described in Jefferson (1987) or obtained from Clontech Lab, Palo Alto, Calif. (e.g., pBI121 or pBI221). Typically, these plasmids are constructed to provide for multiple cloning sites having specificity for different restriction enzymes downstream from the promoter. The DNA segment can be subcloned downstream from the promoter using restriction enzymes to ensure that the DNA is inserted in proper orientation with respect to the promoter so that the DNA can be expressed. [0075]
  • The gene termination sequence is located 3′ to the DNA sequence to be transcribed. Various gene termination sequences known in the art may be used in the present inventive constructs. These include nopaline synthase (NOS) gene termination sequence (see, e.g., references cited in co-pending, commonly-owned PCT application, PCT/US/0027704, filed Oct. 6, 2000, entitled “Method of Introducing a Plurality of Genes into Plants,” incorporated herein by reference.) [0076]
  • Marker Genes [0077]
  • A marker gene may also be incorporated into the inventive DNA constructs to aid the selection of plant tissues with positive integration of the transgene. “Marker genes” are genes that impart a distinct phenotype to cells expressing the marker gene, and thus, allow such transformed cells to be distinguished from cells that do not have the marker. Many examples of suitable marker genes are known to the art and can be employed in the practice of the invention, such as neomycin phosphotransferase II (NPT II) gene that confers resistance to kanamycin or hygromycin antibiotics which would kill the non-transformed plant tissues containing no NPT II gene (Bevan et al., 1983). Numerous other exemplary marker genes used in the method, in accordance with the present invention are listed in Table 1 of co-pending, commonly owned of PCT/US/0027704, filed Oct. 6, 2000, entitled “Method of Introducing a Plurality of Genes into Plants,” incorporated herein by reference. [0078]
  • Therefore, it will be understood that the following discussion is exemplary rather than exhaustive. In light of the techniques disclosed herein and the general recombinant techniques which are known in the art, the present invention renders possible the introduction of any gene, including marker genes, into a recipient cell to generate a transformed plant. [0079]
  • Optional Sequences in the Expression Cassette [0080]
  • The expression cassette containing DNA sequences in accordance with the present invention can also optionally contain other DNA sequences. Transcription enhancers or duplications of enhancers can be used to increase expression from a particular promoter. One may wish to obtain novel tissue-specific promoter sequences for use in accordance with the present invention. To achieve this, one may first isolate CDNA clones from the tissue concerned and identify those clones which are expressed specifically in that tissue, for example, using Northern blotting. Ideally, one would like to identify a gene that is not present in a high copy number, but which gene product is relatively abundant in specific tissues. The promoter and control elements of corresponding genomic clones may then be localized using the techniques of molecular biology known to those of skill in the art. [0081]
  • Expression of some genes in transgenic plants will occur only under specified conditions. It is known that a large number of genes exist that respond to the environment. In some embodiments of the present invention expression of a DNA segment in a transgenic plant will occur only in a certain time period during the development of the plant. Developmental timing is frequently correlated with tissue specific gene expression. [0082]
  • As the DNA sequence inserted between the transcription initiation site and the start of the coding sequence, i.e., the untranslated leader sequence, can influence gene expression, one can also employ a particular leader sequence. Preferred leader sequence include those which comprise sequences selected to direct optimum expression of the attached gene, i.e., to include a preferred consensus leader sequence which can increase or maintain mRNA stability and prevent inappropriate initiation of translation (Joshi, 1987). Such sequences are known to those of skill in the art. Sequences that are derived from genes that are highly expressed in plants will be most preferred. [0083]
  • Additionally, expression cassettes can be constructed and employed to target the gene product of the DNA segment to an intracellular compartment within plant cells or to direct a protein to the extracellular environment. This can generally be achieved by joining a DNA sequence encoding a transit or signal peptide sequence to the coding sequence of the DNA segment. Also, the DNA segment can be directed to a particular organelle, such as the chloroplast rather than to the cytoplasm. [0084]
  • Alternatively, the DNA fragment coding for the transit peptide may be chemically synthesized either wholly or in part from the known sequences of transit peptides such as those listed above. The description of the optional sequences in the expression cassette, is commonly owned, co-pending PCT/US/0027704, filed Oct. 6, 2000, entitled “Method of Introducing a Plurality of Genes into Plants,” incorporated herein by reference. [0085]
  • Transformation [0086]
  • Transformation of cells from plants, e.g., trees, and the subsequent production of transgenic plants using e.g., Agrobacterium-mediated transformation procedures known in the art, and further described herein, is one example of a method for introducing a foreign gene into plants. Although, the method of the invention can be performed by other modes of transformation, Agrobacterium-mediated transformation procedures are cited as examples, herein. For example, transgenic plants may be produced by the following steps: (i) culturing Agrobacterium in low-pH induction medium at low temperature and preconditioning, i.e., coculturing bacteria with wounded tobacco leaf extract in order to induce a high level of expression of the Agrobacterium vir genes whose products are involved in the T-DNA transfer; (ii) coculturing desired plant tissue explants, including zygotic and/or somatic embryo tissues derived from cultured explants, with the incited Agrobacterium; (iii) selecting transformed callus tissue on a medium containing antibiotics; and (iv) converting the embryos into platelets. [0087]
  • Any non-tumorigenic A. tumefaciens strain harboring a disarmed Ti plasmid may be used in the method in accordance with the invention. Any Agrobacterium system may be used. For example, Ti plasmid/binary vector system or a cointegrative vector system with one Ti plasmid may be used. Also, any marker gene or polynucleotide conferring the ability to select transformed cells, callus, embryos or plants and any other gene, such as for example a gene conferring resistance to a disease, or one improving lignin content or structure or cellulose content, may also be used. A person of ordinary skill in the art can determine which markers and genes are used depending on particular needs. [0088]
  • To increase the infectivity of the bacteria, Agrobacterium is cultured in low-pH induction medium, i.e., any bacterium culture media with a pH value adjusted to from 4.5 to 6.0, most preferably about 5.2, and at low temperature such as for example about 19-30° C., preferably about 21-26° C. The conditions of low-pH and low temperature are among the well-defined critical factors for inducing virulence activity in Agrobacterium (e.g., Altmorbe et al., 1989; Fullner et al., 1996; Fullner and Nester, 1996). [0089]
  • The bacteria is preconditioned by coculturing with wounded tobacco leaf extract (prepared according to methods known generally in the art) to induce a high level of expression of the Agrobacterium vir genes. Prior to inoculation of plant somatic embryos, Agrobacterium cells can be treated with a tobacco extract prepared from wounded leaf tissues of tobacco plants grown in vitro. To achieve optimal stimulation of the expression of Agrobacterium vir genes by wound-induced metabolites and other cellular factors, tobacco leaves can be wounded and pre-cultured overnight. Culturing of bacteria in low pH medium and at low temperature can be used to further enhance the bacteria vir gene expression and infectivity. Preconditioning with tobacco extract and the vir genes involved in the T-DNA transfer process are generally known in the art. [0090]
  • Agrobacterium treated as described above is then cocultured with a plant tissue explant, such as for example, zygotic and/or somatic embryo tissue. Non-zygotic (i.e., somatic) or zygotic tissues can be used. Any plant tissue may be used as a source of explants. For example, cotyledons from seeds, young leaf tissue, root tissues, parts of stems including nodal explants, and tissues from primary somatic embryos such as the root axis may be used. Generally, young tissues are a preferred source of explants. [0091]
  • The above-described transformation and regeneration protocol is readily adaptable to other plant species. Other published transformation and regeneration protocols for plant species include Danekar et al, 1987; McGranahan et al, 1988; McGranahan et al., 1990; Chen, Ph.D. Thesis, 1991; Sullivan et al, 1993; Huang et al., 1991; Wilde et al., 1992; Minocha et al., 1986; Parsons et al., 1986; Fillatti et al., 1987; Pythoud et al., 1987; De Block, 1990; Brasileiro et al., 1991; Brasileiro et al., 1992; Howe et al., 1991; Klopfenstein et al., 1991; Leple et al., 1992; and Nilsson et al., 1992. [0092]
  • Characterization [0093]
  • To confirm the presence of the DNA segment(s) or “transgene(s)” in the regenerated plants, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting and PCR; “biochemical” assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant. [0094]
  • 1. DNA Integration, RNA Expression and Inheritance [0095]
  • Genomic DNA may be isolated from callus cell lines or any plant parts to determine the presence of the DNA segment through the use of techniques well known to those skilled in the art. Note that intact sequences will not always be present, presumably due to rearrangement or deletion of sequences in the cell. [0096]
  • The presence of DNA elements introduced through the methods of this invention may be determined by polymerase chain reaction (PCR). Using this technique, discreet fragments of DNA are amplified and detected by gel electrophoresis. This type of analysis permits one to determine whether a DNA segment is present in a stable transformant, but does not prove integration of the introduced DNA segment into the host cell genome. In addition, it is not possible using PCR techniques to determine whether transformants have exogenous genes introduced into different sites in the genome, i.e., whether transformants are of independent origin. It is contemplated that using PCR techniques it would be possible to clone fragments of the host genomic DNA adjacent to an introduced DNA segment. [0097]
  • Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southern hybridization. Using this technique, specific DNA sequences that were introduced into the host genome and flanking host DNA sequences can be identified. Hence the Southern hybridization pattern of a given transformant serves as an identifying characteristic of that transformant. In addition, it is possible through Southern hybridization to demonstrate the presence of introduced DNA segments in high molecular weight DNA, i.e., confirm that the introduced DNA segment has been integrated into the host cell genome. The technique of Southern hybridization provides information that is obtained using PCR, e.g., the presence of a DNA segment, but also demonstrates integration into the genome and characterizes each individual transformant. [0098]
  • It is contemplated that by using the techniques of dot or slot blot hybridization which are modifications of Southern hybridization techniques, one could obtain the same information that is derived from PCR, e.g., the presence of a DNA segment. [0099]
  • Both PCR and Southern hybridization techniques can be used to demonstrate transmission of a DNA segment to progeny. In most instances the characteristic Southern hybridization pattern for a given transformant will segregate in progeny as one or more Mendelian genes (Spencer et al., 1992; Laursen et al.,1994) indicating stable inheritance of the gene. [0100]
  • Whereas DNA analysis techniques may be conducted using DNA isolated from any part of a plant, RNA may only be expressed in particular cells or tissue types, and hence, it will be necessary to prepare RNA for analysis from these tissues. PCR techniques may also be used for detection and quantitation of RNA produced from introduced DNA segments. In this application of PCR, it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances, PCR techniques, while useful, will not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and give information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and demonstrate only the presence or absence of an RNA species. [0101]
  • 2. Gene Expression [0102]
  • While Southern blotting and PCR may be used to detect the DNA segment in question, they do not provide information as to whether the DNA segment is being expressed. Expression may be evaluated by specifically identifying the protein products of the introduced DNA segments or evaluating the phenotypic changes brought about by their expression. [0103]
  • Assays for the production and identification of specific proteins may make use of physical-chemical, structural, functional, or other properties of the proteins. Unique physical-chemical or structural properties allow the proteins to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focussing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography. The unique structures of individual proteins also offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as western blotting in which antibodies are used to locate individual gene products that have been separated by electrophoretic techniques. Additional techniques may be employed to absolutely confirm the identity of the product of interest such as evaluation by amino acid sequencing following purification. Although these are among the most commonly employed, other procedures may be additionally used. [0104]
  • Assay procedures may also be used to identify the expression of proteins by their functionality, especially the ability of enzymes to catalyze specific chemical reactions involving specific substrates and products. These reactions may be followed by providing and quantifying the loss of substrates or the generation of products of the reactions by physical or chemical procedures. Examples are as varied as the enzyme to be analyzed and may include assays for PAT enzymatic activity by following production of radiolabelled acetylated phosphinothricin from phosphinothricin. [0105]
  • Very frequently the expression of a gene product is determined by evaluating the phenotypic results of its expression. These assays also may take many forms including but not limited to analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Chemical composition may be altered by expression of DNA segments encoding enzymes or storage proteins which change amino acid composition and may be detected by amino acid analysis, or by enzymes which change starch quantity which may be analyzed by near infrared reflectance spectrometry. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed treatments are evaluated under carefully controlled conditions termed bioassays. [0106]
  • The invention will be further described by the following non-limiting examples. [0107]
  • EXAMPLE 1 Preparation of Transgenic Aspen
  • Construction of binary vectors [0108]
  • pBKPpt[0109] 4CL Pt4CL1-a: Aspen 4CL1 xylem specific promoter (Ppt4CL, 1.1 kb, GenBank AF041051) was prepared and linked to aspen 4CL1 cDNA (Pt4CL1, GenBank AF041049) which was orientated in the antisense direction. Then the cassette containing aspen 4CL1 promoter and antisense aspen 4CL1 cDNA was positioned in a plant transformation binary vector, as shown in FIG. 1. (pBKPpt4CL Pt4CL1-a construct)
  • pBKPpt[0110] 4cl PtCAld5H-s: From pBKPpt4CL Pt4CL-a construct, the antisense Pt4CL1 was replaced with PtCAld5H cDNA in a sense orientation, yielding a pBKPpt4CL PtCAld5H-s transformation binary construct, as shown in FIG. 2.
  • Also, Example 1 of PCT application PCT/US/0027704, filed Oct. 6, 2000, entitled “Method of Introducing a Plurality of Genes into Plants,” incorporated herein by reference, describes a number of other gene constructs for preparing transgenic plants. The plants are transformed with a genes from the phenylpropanoid pathway (i.e., 4CL, AEOMT, CoAOMT, and CAld5H) using an operably linked to either a homologous or a heterologous and either a constitutive or tissue-specific promoter [0111]
  • Incorporation of binary vector into Agrobacterium [0112]
  • According to the protocol described in Tsai et al. (1994, Plant Cell Reports, 14:94-97) Agrobacterium C58/pMP90 strain was grown in LB with selection of gentamicin at 28° C. overnight. Cells were harvested by centrifugation at 10,000 rpm for 10 minutes at 4° C. The cell pellet was washed with 0.5 volume of ice-cold 20 mM CaCl[0113] 2, and centrifuged again. The cells were then resuspended in 0.1 volume of ice-cold 20 mM CaCl2 in a sample tube. About 1 μg of binary vector DNA was added to 200 μL of the cell suspension and mixed by pipetting. The sample tube was chilled in liquid N2 for 5 minutes and thawed at 37° C. in a water bath for 5 minutes. One mL of LB medium was added and the mixture was incubated at 28° C. for 3 hours with gentle shaking. Twenty μL of the cells were spread onto a LB plate containing 25 μg/mL gentamicin and 50 μg/mL kanamycin and incubated at 28° C. for 2 days. PCR (amplification conditions, cycling parameters and primers are described below) was used to verify the presence of DNA from the vector in the transformed colonies.
  • Simultaneous transformation of Aspen with multiple genes via engineered Agrobacterium strains [0114]
  • For simultaneous transformation of multiple genes, pBKPpt[0115] 4cl Pt4CL-a and pBKPpt4cl PtCal5H Agrobacterium clones were cultured in LB medium at 28° C. overnight separately. The Agrobacterium strains were subcultured individually by a 100-fold dilution into 50 mL of LB (pH 5.4) containing 50 μg/mL kanamycin, 25 μg/mL gentamycin and 20 μM acetosyringone (in DMSO), and grown overnight at 28° C. with shaking. An equal volume of the same density of individually cultured Agrobacterium strains was then mixed. Leaves excised from sterile tobacco plants were cut into pieces with a size of about 5 mm2 and the leaf discs were then immersed in the Agrobacterium mixture for 5 minutes.
  • After removing excess Agrobacterium cells, the treated leaf discs were placed on callus induction medium (WPM:Woody Plant Medium, BA: 6-[0116] benzyladenine +2,4-D: 2,4-dichlorophenoxyacetic acid; Tsai et al. 1994, Plant Cell Reports, 14:94-97) and cultured for 2 days. Then, the pre-cultured leaf discs were rinsed with sterile water several times to remove the Agrobacterium cells and washed in 1 mg/mL claforan and 1 mg/mL ticarcillin with shaking for 3 hours to kill Agrobacterium. After briefly blot-drying, the pre-cultured and washed leaf discs were cultured on callus induction medium containing 50 μg/mL kanamycin and 300 μg/mL claforan for selection of transformed cells. After 2 to 3 subcultures (10 days/subculture), the calli grown on the leaf discs were excised and transferred onto shoot induction medium (WPM+TDZ: N-phenyl-N′-1,2,3-thiadiazol-5-yl-urea) containing 50 μg/ml kanamycin and 300 μg/ml claforan for regenerating shoots. After shoots were grown to about 0.5 cm high, they excised and planted to rooting media (WPM with kanamycin and claforan). Whole plants about 7 cm high were transplanted into soil and maintained in a greenhouse for subsequent molecular characterization.
  • Genomic DNA isolation [0117]
  • Genomic DNA was isolated according to Hu et al. (1998). About 100 mg of young leaves were collected from each plant growing in the greenhouse and ground in liquid N[0118] 2 to fine powder for DNA isolation using QIAGEN plant DNA isolation kit (Valencia, Calif.). Specifically, the powdered tissue was added to extract buffer containing 2% hexadecyltrimethylammonium bromide (CTAB), 100 mM Tris-HC1, pH 8.0, 20 mM EDTA, 1.4 M NaCl and 30 mM β-mercaptoethanol at 5 mL/g tissue. The extraction mixture was incubated in a tube at 60° C. for 1 hour with occasional shaking. One volume of chloroform-isoamyl alcohol (24:1) was added and mixed gently. The two phases were separated by centrifugation at 10,000×g for 10 minutes. The aqueous phase was transferred to a new tube and extracted with chloroform in the presence of 1% CTAB and 0.7 M NaCl. The DNA was precipitated by addition of ⅔ volume of isopropanol (−20° C.) and kept at −20° C. for 20 minutes. Following the centrifugation at 10,000×g for 10 minutes, the pelleted DNA was washed with 70% ethanol-10 mM ammonia acetate. Then the pellet was dissolved in 2 mL TE buffer (10 mM Tris-HC1/0.1 mM EDTA, pH 8) and treated with 2 μg RNase A at 37° C. for 20 minutes. The DNA was precipitated by addition of 2 mL of 5 M ammonia acetate and 10 mL of 95% ethanol at −20° C. for 20 minutes. After centrifugation, the pellet was washed with 70% ethanol. After a brief drying, genomic DNA was dissolved in TE buffer.
  • PCR verification of foreign gene insertion in host plant genome [0119]
  • PCR was used to verify the integration of the gene constructs in the genome of transgenic plants. Two specific primers were synthesized for each construct and used to PCR-amplify the corresponding construct in genome of transgenic Aspen. For the PBKPpt[0120] 4CL Pt4CL1-a construct, two specific primers were synthesized that amplify a 4CL cDNA fragment. Pt4CL1 promoter sense primer (5′CAGGAATGCTCTGCACTCTG3′) (SEQ ID NO:11) and Pt4CL1 sense primer (5′ATGAATCCACAAGAATTCAT3′) (SEQ ID NO:12). at the translation start region. Primers for PCR verification of pBKPpt4CL PtCald5H-s construct are Pt4CL1 promoter sense primer (5′CAGGAATGCTCTGCACTCTG3′) (SEQ ID NO:13) and PtCald5H antisense primer (5′TTAGAGAGGACAGAGCACACG3′) (SEQ ID NO:14) at translation stop region.
  • The PCR reaction mixture contained 100 ng genomic DNA of transformed aspen, and 0.2 μM of each primer, 100 μM of each deoxyribonucleotide triphosphate, 1×PCR buffer and 2.5 Units of Taq DNA polymerase (Promega Madison, Wis.) in a total volume of 50 μL. The cycling parameters were as follows: 94° C. for 1 minute, 56° C. for 1 minute (for 4CL and CAld5H or can vary between cDNA templates used) according to different gene checked) and 72° C. for 2 minute, for 40 cycles, with 5 minutes at 72° C. extension. The PCR products were electrophoresized on a 1% agarose gel. [0121]
  • EXAMPLE 2 Preparation of other transgenic plants
  • It is important to recognize that there is a substantial percentage of sequence homology among the plant genes involved in the lignin biosynthetic pathway, discussed herein. This substantial sequence homology allows the method in accordance with the invention disclosed herein to be applicable to all plants that possess the requisite genes involved in the lignin biosynthetic pathway. To demonstrate the substantial sequence homology among plant genes, the percentage sequence homology is set forth in tabular form, for example, CAld5H genes (Table 1), AldOMT genes (Table 2), CAD genes (Table 3), and 4CL genes (See FIG. 12). Therefore, it is possible to alter lignin monomer composition, increase S/G lignin ratio, and increase cellulose content in all plants by using the method in accordance with the invention, described herein. [0122]
    TABLE 1
    Protein sequence homology (%) of plant Coniferyl Aldehyde
    5-hydroxylase (CAld5H) from 1) Aspen; 2) Poplar, AJ010324; 3)
    Sweetgum, AF139532; 4) Arabidopsis (Ferulic Acid 5-hydroxylase,
    F5H)
    1 2 3 4
    1
    2 99
    3 84 84
    4 81 83 83
  • [0123]
    TABLE 2
    Protein sequence homology (%) of plant AldOMTs from
    1) Aspen, X62096; 2) Poplar, M73431; 3) Almond, X83217;
    4) Strawberry, AF220491; 5) Alfalfa, M63853; 6) Eucalyptus, X74814;
    7) Clarkia breweri, AF006009; 8) Sweetgum, AF139533;
    9) Arabidopsis, U70424; 10) Tobacco, X74452; 11) Vitis vinifera,
    AF239740
    1 2 3 4 5 6 7 8 9 10 11
    1
    2 99
    3 92 92
    4 91 90 94
    5 90 90 89 89
    6 89 89 89 87 87
    7 88 88 89 88 87 90
    8 88 87 88 87 86 85 83
    9 84 84 85 86 82 82 82 83
    10 83 83 83 82 81 82 80 83 77
    11 80 80 78 77 78 77 78 80 76 77
  • [0124]
    TABLE 3
    Protein sequence homology (%) of plant CADs from 1) Aspen, AF217957;
    2) Cottonwood, Z19568 and 3) Udo, D13991; 4) Tobacco, X62343;
    5) Tobacco, X62344; 6) Eucalyptus, AF038561; 7) Eucalyptus, X65631;
    8) Lucerne, AF083332; 9) Lucerne, Z19573; 10) Maize, AJ005702;
    11) Maize, Y13733; 12) Sugarcane, AJ231135; 13) Radiata pine, U62394;
    14) Loblolly pine, Z37992; 15) Loblolly pine, Z37991; 16) Norway spruce, X72675.
    1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
    1
    2 97
    3 85 84
    4 82 82 84
    5 80 80 81 94
    6 81 81 82 80 78
    7 81 80 81 80 78 80
    8 79 79 80 80 79 79 79
    9 79 80 80 79 78 78 79 99
    10 78 77 79 76 74 76 77 73 73
    11 78 78 79 77 74 76 76 73 72 99
    12 77 76 78 74 73 75 74 73 73 95 96
    13 70 71 69 70 70 69 68 67 68 67 68 68
    14 69 70 69 69 69 69 68 68 68 67 67 67 99
    15 69 70 68 69 69 68 68 67 67 67 67 67 99 95
    16 69 69 70 70 69 68 68 68 67 69 69 67 95 95 94
  • To further demonstrate the versatility of this invention in transferring a variety of foreign genes and the applicability of this invention to plants other than the herbaceous species, different binary vectors were constructed and transferred into aspen ([0125] Populus tremuloides) tree. Two binary vectors, each containing a cDNA sequence and a neomycin phosphotransferase (NPT II) cDNA encoding kanamycin resistance, were constructed. Each vector was then individually mobilized into Agrobacterium strain C58 to create two isolated (engineered) Agrobacterium strains. It should be noted that about 50 transgenic tobacco plants were generated by the same technique harboring 4 different sets of foreign genes, as described in the PCT application PCTUS0027704 filed Oct. 6, 2000, entitled “Method of Introducing a Plurality of Genes into Plants,” incorporated herein by reference.
  • Table 4 summarizes the numerical results from simultaneous manipulating xylem-specific expression of 4CL and CAld5H in transgenic aspen. After DNA constructs were incorporated into plant cells by Agrobacterium mediated transformation, as set forth by the method in accordance with the invention and after PCR confirmation of transgene integration, 14 positive transgenic trees were randomly selected, representing three different trangenic groups, i.e., Groups I, II and III. Group I (plant #21, 22, 23, 25, and 37) consists of those with the integration of only antisense Pt4CL1 cDNA (Table 4). Group II plants (# 32, 84, 93, and 94) harbored only sense PtCAld5H cDNA, whereas Group III plants (#71, 72, 74, and 141) contained both antisense Pt4CL1 and sense PtCAld5H transgenes. These transgenic trees were then further analyzed for their lignin and cellulose contents and lignin S/G ratio (Table 4). It is clear that, when compared with the control, untransformed aspen, transgenic plants (#21, 22, 23, 25, and 37) engineered for the suppression of 4CL gene with antisense Pt4CL1 transgene had drastic reductions in their lignin content, with significant increases in their cellulose content. Transgenic plants (#32, 84, 93, 94, and 108) engineered for the overexpression of CAld5H with sense PtCAld5H transgene had pronounced increases in their S/G ratio, but their lignin and cellulose contents remained essentially unaffected. When engineered for the simultaneous suppression of 4CL gene and overexpression of CAld5H gene, transgenic plants (#71, 72, 74, and 141) all exhibited low lignin content, high S/G ratio and elevated cellulose quantity. In summary, these results show that multiple genes carried by individual Agrobacterium strains can be integrated simultaneously into the plant genome. [0126]
  • Moreover, it was demonstrated as shown herein below, that transgenic plants with a nearly 30% increase in cellulose content and over 50% lignin quantity reduction, accompanied with a significant augmentation of the S/G ratio, can be easily produced. It is conceivable that more genes can also be efficiently transferred at one time. Only one suitable marker gene is required for this system, although a number of marker genes can also be employed. [0127]
    TABLE 4
    Simultaneous manipulating xylem-specific expression of 4CL and CAld5H in transgenic aspen.
    Plant # Control 21 22 23 25 37 32 84 93 94 108 71 72 74 141
    Gene 4CL-a Y Y Y Y Y Y Y Y Y
    integrated CAld5H-s Y Y Y Y Y Y Y Y Y
    Lignin content (%) 22.4 16.0 15.3 14.4 13.1 14.9 22.4 21.6 21.1 20.7 19.7 13.2 13.7 12.4 10.7
    Lignin S/G ratio 2.2 2.1 2.0 2.2 2.3 2.1 4.8 4.0 5.5 4.9 3.0 3.3 3.6 3.4 2.7
    Cellulose content (%) 41.4 43.1 ND ND 47.3 ND 40.0 ND 44.7 ND ND ND 49.2 ND 53.3
  • EXAMPLE 3 Production of commercially desirable agronomic traits in transformed plants.
  • The following genetic transformations illustrate the production of commercially desirable agronomic traits in plants. [0128]
  • Gymnosperms [0129]
  • A. To produce syringyl-enriched lignin in gymnosperm plants, gymnosperm plants are genetically transformed with SAD, CAld5H, and AldOMT genes in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system allows. These three genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0130]
  • B. To produce decreased lignin content, increased syringyl/guaiacyl (S/G) lignin ratio and increased cellulose quantity in gymnosperm plants, gymnosperm plants are genetically transformed with SAD, CAld5H and AldOMT genes in the sense orientation and 4CL gene in either sense or antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0131]
  • C. To produce decreased lignin content, increased syringyl/guaiacyl (S/G) lignin ratio and increased cellulose quantity in gymnosperm plants, gymnosperm plants are genetically transformed with SAD, CAld5H and AldOMT genes in the sense orientation and 4CL and CAD genes in either sense or antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These five genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0132]
  • D. To produce increased lignin content in gymnosperm plants, gymnosperm plants are genetically transformed with 4CL gene in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. [0133]
  • E. To produce increased lignin content and increased syringyl/guaiacyl (S/G) lignin ratio in gymnosperm plants, gymnosperm plants are genetically transformed with SAD, CAld5H, AldOMT, and 4CL genes in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0134]
  • F. To produce increased lignin content, increased syringyl/guaiacyl (S/G) lignin ratio in gymnosperm plants, gymnosperm plants are genetically transformed with SAD, CAld5H, AldOMT, and 4CL genes in the sense orientation and CAD gene in the antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0135]
  • Angiosperms [0136]
  • A. To produce increased S/G lignin ratio in angiosperm plants, angiosperm plants are genetically transformed with either CAld5H, AldOMT, or SAD genes in sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These three genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0137]
  • B. To produce decreased lignin content, increased S/G lignin ratio and increased cellulose quantity in angiosperm plants, angiosperm plants are genetically transformed with either SAD, CAld5H, or AldOMT genes in the sense orientation and 4CL gene in the sense or antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0138]
  • C. To produce decreased lignin content, increased S/G lignin ratio and increased cellulose quantity in angiosperm plants, angiosperm plants are genetically transformed with either SAD, CAld5H, or AldOMT genes in the sense orientation and 4CL and CAD genes in the sense or antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These five genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0139]
  • D. To produce increased lignin content in angiosperm plants, angiosperm plants are genetically transformed with 4CL gene in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. [0140]
  • E. To produce increased lignin content and increased S/G ratio in angiosperm plants, angiosperm plants are genetically transformed with 4CL in the sense orientation and either SAD, CAld5H, or AldOMT genes also in the sense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0141]
  • F. To produce increased lignin content and increased S/G ratio in angiosperm plants, angiosperm plants are genetically transformed with 4CL in the sense orientation and either SAD, CAld5H, or AldOMT genes also in the sense orientation and CAD in the antisense orientation driven by any appropriate promoter and via any appropriate genetic transformation system. These four genes can be transferred into the host plant either simultaneously (in one or individual constructs) or sequentially (in individual constructs) in any order. [0142]
  • All publications, patents and patent applications cited herein are incorporated herein by reference. While in the foregoing specification, this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details herein may be varied considerably without departing from the basic principles of the invention. Accordingly, it is intended that the present invention be solely limited by the broadest interpretation that can be accorded the appended claims. [0143]
  • REFERENCES
  • Bugos et al., 1991, [0144] Plant Mol. Biol. 17:203.
  • Chang, H. M., and Sarkanen, K. V., 1973, [0145] Tappi 56:132.
  • Chiang, V. L., and Funaoka, M., 1990, [0146] Holzforschung 44:309.
  • Hu et al., 1999, [0147] Nature Biotech. 17:808.
  • Sarkanen, K. V., and Ludwig, C. H., eds (Wiley-Interscience, New York), 639. [0148]
  • Tsai et al., 1994, [0149] Plant Cell Report 14:94.
  • Boudet et al., 1995, [0150] New Phytol. 129:203.
  • Ibrahim, 1997, [0151] Trends Plant Sci. 2:249.
  • Li et al., 1997, [0152] Proc. Natl. Acad. Sci. USA 94:5461.
  • Joshi and Chiang, 1998, [0153] Plant Mol. Biol. 37:663.
  • Brasileiro et al., 1991, [0154] Plant Mol. Bio. 17:441.
  • Brasileiro et al., 1992, [0155] Transgenic Res. 1:133.
  • Chen et al., 1998, [0156] Nature Biotechnology 16, 11:1060.
  • Chen, Ph.D. Thesis, 1991, North Carolina State University, Raleigh, N.C. [0157]
  • Chen et al.,1999, Planta 207:597. [0158]
  • Christou, 1996, [0159] Bio/Technology 10:667.
  • Chandler et al., 1989. [0160]
  • Danekar et al., 1987, [0161] Bio/Technology 5:587.
  • De Block, 1990, [0162] Plant Physiol. 93:1110.
  • Ebinuma et al., 1997, [0163] Proceedings of the National Academic of Sciences 94:2117.
  • Ebert et al. 1987. [0164]
  • Fillatti et al., 1987, [0165] Mol. Gen. Genet. 206:192.
  • Freudenberg, 1965. [0166]
  • Horsch et al., 1985, [0167] Science 227:1229.
  • Howe et al., 1991, [0168] Woody Plant Biotech. Plenum Press, New York, 283.
  • Huang et al., 1991, [0169] In Vitro Cell Dev. Bio. 4:201.
  • Hudspeth et al., 1989, [0170] Plant Mol. Biol., 12:579.
  • Hu et al., 1998, [0171] Proc. Natl. Acad. Sci. USA 95:5407.
  • Hu et al., 1999, [0172] Nat. Biotechnol. 17:808.
  • Humphreys et al., 1999, [0173] Proc. Nat. Acad. Sci. USA 96:10045.
  • Jornvall et al., 1987, [0174] Eur. J. Biochem. 167:195.
  • Jefferson et al.,1987. [0175]
  • Klopfenstein et al., 1991, [0176] Can. J For. Res. 21:1321.
  • Lawton et al., 1987, [0177] Plant Mol. Biol. 9:31F.
  • Buxton and Roussel, 1988, [0178] Crop. Sci. 28,:553.
  • Jung and Vogel, 1986, [0179] J. Anim., Sci. 62:1703.
  • Leple et al., 1992, [0180] Plant Cell Reports 11:137.
  • Li et al., 1997, [0181] Proc. Natl. Acad. Sci. USA, 94:5461.
  • Li et al., 2001, [0182] Plant Cell, 13:1567.
  • Li et al, 1997, [0183] Proc. Natl. Acad. Sci. USA 94:5431.
  • Li et al., 1999, [0184] Plant Mol. Biol. 40:555.
  • Li et al., 2000, [0185] J. Biol. Chem. 275:6537.
  • MacKay et al., 1995, [0186] Mol. Gen. Genet. 247:537.
  • MacKay et al., 1997. [0187]
  • McGranahan et al., 1988, [0188] Bio/Technology 6:800.
  • McGranahan et al., 1990, [0189] Plant Cell Reports 8:512.
  • Minocha et al., 1986, [0190] Proc. TAPPI Research and Development Conference, TAPPI Press, Atlanta, 89.
  • Nelson et al. 1996, [0191] Pharmacogenetics 6: 1.
  • Odell et al., 1985, [0192] Nature 313:810.
  • Osakabe et al., 1999, [0193] Proc. Nati. Acad. Sci. USA 96:8955.
  • Parsons et al., 1986, [0194] Bio/Technology 4:533.
  • Pythoud et al., 1987, [0195] Bio/Technology 5:1323.
  • Sambrook et al., [0196] 2 nd ed. 1982.
  • Sullivan et al., 1993, [0197] Plant Cell Reports 12:303.
  • Sarkanen, K. V., and Hergert, H. L., 1971, [0198] Lignins: Occurrence, Formation, Structure and Reaction, K. V. Sarkanen and C. H. Ludwig, eds (New York: Wiley-Interscience), 43.
  • Trotter, P. C., 1990, [0199] Tech. Assoc. Pulp Paper Ind. J. 73:198.
  • Tsai et al., 1998, [0200] Plant Physiol. 117:101.
  • Tsai et al., [0201] Plant Cell Reports 14:94.
  • Tricoli et al., 1995. [0202]
  • Walker et al., 1987, [0203] PNAS USA 84:6624.
  • Wang et al., 1992, [0204] Mol. Cell. Biol. 12:3399.
  • Wu et al., 2000, [0205] Plant J. 22:495.
  • Yang et al., 1990, [0206] PNAS USA 87:4144.
  • Yamazaki et al., 1993, [0207] J. Biochem. 114:652.
  • Zhang, X.-H., and Chiang, V. L., 1997, [0208] Plant Physiol. 113:65.
  • 1 14 1 1446 DNA aspen populus tremuloides misc_feature SAD 1 tttttttttt tttcctagcc ttccttctcg acgatatttc tctatctgaa gcaagcacca 60 tgtccaagtc accagaagaa gaacaccctg tgaaggcctt cgggtgggct gctagggatc 120 aatctggtca tctttctccc ttcaacttct ccaggagggc aactggtgaa gaggatgtga 180 ggttcaaggt gctgtactgc gggatatgcc attctgacct tcacagtatc aagaatgact 240 ggggcttctc catgtaccct ttggttcctg ggcatgaaat tgtgggggaa gtgacagaag 300 ttgggagcaa ggtgaaaaag gttaatgtgg gagacaaagt gggcgtggga tgcttggttg 360 gtgcatgtca ctcctgtgag agttgtgcca atgatcttga aaattactgt ccaaaaatga 420 tcctgacata cgcctccatc taccatgacg gaaccatcac ttacggtggc tactcagatc 480 acatggtcgc taacgaacgc tacatcattc gattccccga taacatgccg cttgacggtg 540 gcgctcctct cctttgtgcc gggattacag tgtatagtcc cttgaaatat tttggactag 600 atgaacccgg taagcatatc ggtatcgttg gcttaggtgg acttggtcac gtggctgtca 660 aatttgccaa ggcctttgga tctaaagtga cagtaattag tacctcccct tccaagaagg 720 aggaggcttt gaagaacttc ggtgcagact catttttggt tagtcgtgac caagagcaaa 780 tgcaggctgc cgcaggaaca ttagatggca tcatcgatac agtttctgca gttcaccccc 840 ttttgccatt gtttggactg ttgaagtctc acgggaagct tatcttggtg ggtgcaccgg 900 aaaagcctct tgagctacct gccttttctt tgattgctgg aaggaagata gttgccggga 960 gtggtattgg aggcatgaag gagacacaag agatgattga ttttgcagca aaacacaaca 1020 tcacagcaga tatcgaagtt atttcaacgg actatcttaa tacggcgata gaacgtttgg 1080 ctaaaaacga tgtcagatac cgattcgtca ttgacgttgg caatactttg gcagctacga 1140 agccctaagg agaagatccc atgttctcga accctttata aaatctgata acatgtgttg 1200 atttcatgaa taaatagatt atctttggga tttttcttta ataaacgaag tgttctcgaa 1260 aacttaacat cggcaatacc ctggcagcta cgagaaacgc tttagaattg tttgtaagtt 1320 tgtttcatta gggtgatacc atgctctcga gtcctttgta agatccattt atagttgcgt 1380 gaatgctatg aacaaataat atgtttgcgg cttctcttca aaaaaaaaaa aaaaaaaaaa 1440 aaaaaa 1446 2 362 PRT aspen populus tremuloides 2 Met Ser Lys Ser Pro Glu Glu Glu His Pro Val Lys Ala Phe Gly Trp 1 5 10 15 Ala Ala Arg Asp Gln Ser Gly His Leu Ser Pro Phe Asn Phe Ser Arg 20 25 30 Arg Ala Thr Gly Glu Glu Asp Val Arg Phe Lys Val Leu Tyr Cys Gly 35 40 45 Ile Cys His Ser Asp Leu His Ser Ile Lys Asn Asp Trp Gly Phe Ser 50 55 60 Met Tyr Pro Leu Val Pro Gly His Glu Ile Val Gly Glu Val Thr Glu 65 70 75 80 Val Gly Ser Lys Val Lys Lys Val Asn Val Gly Asp Lys Val Gly Val 85 90 95 Gly Cys Leu Val Gly Ala Cys His Ser Cys Glu Ser Cys Ala Asn Asp 100 105 110 Leu Glu Asn Tyr Cys Pro Lys Met Ile Leu Thr Tyr Ala Ser Ile Tyr 115 120 125 His Asp Gly Thr Ile Thr Tyr Gly Gly Tyr Ser Asp His Met Val Ala 130 135 140 Asn Glu Arg Tyr Ile Ile Arg Phe Pro Asp Asn Met Pro Leu Asp Gly 145 150 155 160 Gly Ala Pro Leu Leu Cys Ala Gly Ile Thr Val Tyr Ser Pro Leu Lys 165 170 175 Tyr Phe Gly Leu Asp Glu Pro Gly Lys His Ile Gly Ile Val Gly Leu 180 185 190 Gly Gly Leu Gly His Val Ala Val Lys Phe Ala Lys Ala Phe Gly Ser 195 200 205 Lys Val Thr Val Ile Ser Thr Ser Pro Ser Lys Lys Glu Glu Ala Leu 210 215 220 Lys Asn Phe Gly Ala Asp Ser Phe Leu Val Ser Arg Asp Gln Glu Gln 225 230 235 240 Met Gln Ala Ala Ala Gly Thr Leu Asp Gly Ile Ile Asp Thr Val Ser 245 250 255 Ala Val His Pro Leu Leu Pro Leu Phe Gly Leu Leu Lys Ser His Gly 260 265 270 Lys Leu Ile Leu Val Gly Ala Pro Glu Lys Pro Leu Glu Leu Pro Ala 275 280 285 Phe Ser Leu Ile Ala Gly Arg Lys Ile Val Ala Gly Ser Gly Ile Gly 290 295 300 Gly Met Lys Glu Thr Gln Glu Met Ile Asp Phe Ala Ala Lys His Asn 305 310 315 320 Ile Thr Ala Asp Ile Glu Val Ile Ser Thr Asp Tyr Leu Asn Thr Ala 325 330 335 Ile Glu Arg Leu Ala Lys Asn Asp Val Arg Tyr Arg Phe Val Ile Asp 340 345 350 Val Gly Asn Thr Leu Ala Ala Thr Lys Pro 355 360 3 1764 DNA aspen populus tremuloides misc_feature CAld5H 3 taaagtcttg tggattacac aaaatacaga ctgaaaacat ccataggcac caacacataa 60 accatccatg gattctcttg tccaatcttt gcaagcttca cccatgtctc tcttcttgat 120 cgttatctct tcactcttct tcttcggtct cctctctcgc cttcgccgaa gattgccata 180 tccaccaggg cctaaagggt tgccacttgt aggtagcatg cacatgatgg accaaataac 240 tcaccgtggg ttagctaaac tagctaagca atatggtggg ctctttcata tgcgcatggg 300 gtacttgcat atggtcactg tttcatctcc tgaaatagct cgccaagttc tgcaggtcca 360 ggacaacatt ttctccaaca gaccagccaa catagccata agttacttaa cctatgatcg 420 tgcagatatg gcctttgccc actacggtcc tttctggcga cagatgcgta agctctgcgt 480 catgaagctt tttagccgga aaagggctga atcatgggag tctgtgagag atgaggtgga 540 ctcaatgctt aagacagttg aagccaatat aggcaagcct gtgaatcttg gggaattgat 600 ttttacgttg accatgaaca tcacttacag agcagctttc ggggctaaaa atgaaggaca 660 ggatgagttc atcaagattt tgcaggagtt ctctaagctt tttggagcat tcaacatgtc 720 tgatttcatt ccctggctgg gctggattga cccccaaggg ctcagcgcta gacttgtcaa 780 ggctcgcaag gctcttgata gattcatcga ctctatcatc gatgatcata tccagaaaag 840 aaaacagaat aagttctctg aagatgctga aaccgatatg gtcgatgaca tgctagcctt 900 ttatggtgaa gaagcaagga aagtagatga atcagatgat ttacaaaaag ccatcagcct 960 tactaaagac aacatcaaag ccataatcat ggatgtgatg tttggtggga cagagacggt 1020 ggcgtcggca atagagtggg tcatggcgga gctaatgaag agtccagagg atcaaaaaag 1080 agtccagcaa gagctcgcag aggtggtggg tttagagcgg cgcgtggagg aaagtgatat 1140 tgacaaactt acgttcttga aatgcgccct caaagaaacc ttaaggatgc acccaccaat 1200 cccacttctc ttacatgaaa cttctgagga tgctgaggtt gctggttatt tcattccaaa 1260 gcaaacaagg gtgatgatca atgcttatgc tattgggaga gacaagaatt catgggaaga 1320 tcctgatgct tttaagcctt caaggttttt gaaaccaggg gtgcctgatt ttaaagggaa 1380 tcactttgag tttattcctt tcgggtctgg tcggaggtct tgccccggta tgcagcttgg 1440 gttatacaca cttgatttgg ctgttgctca cttgcttcat tgttttacat gggaattgcc 1500 tgatggcatg aaaccgagtg aacttgacat gactgatatg tttggactca ccgcgccaag 1560 agcaactcga ctcgttgccg ttccgagcaa gcgtgtgctc tgtcctctct aaggaaggga 1620 aaaaggtaag ggatggaaat gaatgggatt cccttctttc gtggattcta tacagaattg 1680 aggccatggt gacaaagggt caatttgcag gttttttttt ttatatatat atatatataa 1740 ttgggttaaa aaaaaaaaaa aaaa 1764 4 514 PRT aspen populus tremuloides 4 Met Asp Ser Leu Val Gln Ser Leu Gln Ala Ser Pro Met Ser Leu Phe 1 5 10 15 Leu Ile Val Ile Ser Ser Leu Phe Phe Phe Gly Leu Leu Ser Arg Leu 20 25 30 Arg Arg Arg Leu Pro Tyr Pro Pro Gly Pro Lys Gly Leu Pro Leu Val 35 40 45 Gly Ser Met His Met Met Asp Gln Ile Thr His Arg Gly Leu Ala Lys 50 55 60 Leu Ala Lys Gln Tyr Gly Gly Leu Phe His Met Arg Met Gly Tyr Leu 65 70 75 80 His Met Val Thr Val Ser Ser Pro Glu Ile Ala Arg Gln Val Leu Gln 85 90 95 Val Gln Asp Asn Ile Phe Ser Asn Arg Pro Ala Asn Ile Ala Ile Ser 100 105 110 Tyr Leu Thr Tyr Asp Arg Ala Asp Met Ala Phe Ala His Tyr Gly Pro 115 120 125 Phe Trp Arg Gln Met Arg Lys Leu Cys Val Met Lys Leu Phe Ser Arg 130 135 140 Lys Arg Ala Glu Ser Trp Glu Ser Val Arg Asp Glu Val Asp Ser Met 145 150 155 160 Leu Lys Thr Val Glu Ala Asn Ile Gly Lys Pro Val Asn Leu Gly Glu 165 170 175 Leu Ile Phe Thr Leu Thr Met Asn Ile Thr Tyr Arg Ala Ala Phe Gly 180 185 190 Ala Lys Asn Glu Gly Gln Asp Glu Phe Ile Lys Ile Leu Gln Glu Phe 195 200 205 Ser Lys Leu Phe Gly Ala Phe Asn Met Ser Asp Phe Ile Pro Trp Leu 210 215 220 Gly Trp Ile Asp Pro Gln Gly Leu Ser Ala Arg Leu Val Lys Ala Arg 225 230 235 240 Lys Ala Leu Asp Arg Phe Ile Asp Ser Ile Ile Asp Asp His Ile Gln 245 250 255 Lys Arg Lys Gln Asn Lys Phe Ser Glu Asp Ala Glu Thr Asp Met Val 260 265 270 Asp Asp Met Leu Ala Phe Tyr Gly Glu Glu Ala Arg Lys Val Asp Glu 275 280 285 Ser Asp Asp Leu Gln Lys Ala Ile Ser Leu Thr Lys Asp Asn Ile Lys 290 295 300 Ala Ile Ile Met Asp Val Met Phe Gly Gly Thr Glu Thr Val Ala Ser 305 310 315 320 Ala Ile Glu Trp Val Met Ala Glu Leu Met Lys Ser Pro Glu Asp Gln 325 330 335 Lys Arg Val Gln Gln Glu Leu Ala Glu Val Val Gly Leu Glu Arg Arg 340 345 350 Val Glu Glu Ser Asp Ile Asp Lys Leu Thr Phe Leu Lys Cys Ala Leu 355 360 365 Lys Glu Thr Leu Arg Met His Pro Pro Ile Pro Leu Leu Leu His Glu 370 375 380 Thr Ser Glu Asp Ala Glu Val Ala Gly Tyr Phe Ile Pro Lys Gln Thr 385 390 395 400 Arg Val Met Ile Asn Ala Tyr Ala Ile Gly Arg Asp Lys Asn Ser Trp 405 410 415 Glu Asp Pro Asp Ala Phe Lys Pro Ser Arg Phe Leu Lys Pro Gly Val 420 425 430 Pro Asp Phe Lys Gly Asn His Phe Glu Phe Ile Pro Phe Gly Ser Gly 435 440 445 Arg Arg Ser Cys Pro Gly Met Gln Leu Gly Leu Tyr Thr Leu Asp Leu 450 455 460 Ala Val Ala His Leu Leu His Cys Phe Thr Trp Glu Leu Pro Asp Gly 465 470 475 480 Met Lys Pro Ser Glu Leu Asp Met Thr Asp Met Phe Gly Leu Thr Ala 485 490 495 Pro Arg Ala Thr Arg Leu Val Ala Val Pro Ser Lys Arg Val Leu Cys 500 505 510 Pro Leu 5 1503 DNA aspen populus tremuloides misc_feature AldOMT; GenBank accession number X62096 5 tcacttcctt tccttacacc ttcttcaacc ttttgtttcc ttgtagaatt caatctcgat 60 caagatgggt tcaacaggtg aaactcagat gactccaact caggtatcag atgaagaggc 120 acacctcttt gccatgcaac tagccagtgc ttcagttcta ccaatgatcc tcaaaacagc 180 cattgaactc gaccttcttg aaatcatggc taaagctggc cctggtgctt tcttgtccac 240 atctgagata gcttctcacc tccctaccaa aaaccctgat gcgcctgtca tgttagaccg 300 tatcctgcgc ctcctggcta gctactccat tcttacctgc tctctgaaag atcttcctga 360 tgggaaggtt gagagactgt atggcctcgc tcctgtttgt aaattcttga ccaagaacga 420 ggacggtgtc tctgtcagcc ctctctgtct catgaaccag gacaaggtcc tcatggaaag 480 ctggtattat ttgaaagatg caattcttga tggaggaatt ccatttaaca aggcctatgg 540 gatgactgca tttgaatatc atggcacgga tccaagattc aacaaggtct tcaacaaggg 600 aatgtctgac cactctacca ttaccatgaa gaagattctt gagacctaca aaggctttga 660 aggcctcacg tccttggtgg atgttggtgg tgggactgga gccgtcgtta acaccatcgt 720 ctctaaatac ccttcaatca agggcattaa cttcgatctg ccccacgtca ttgaggatgc 780 cccatcttat cccggagtgg agcatgttgg tggcgacatg tttgttagtg tgcccaaagc 840 agatgccgtt ttcatgaagt ggatatgcca tgattggagc gacgcccact gcttaaaatt 900 cttgaagaat tgctatgacg cgttgccgga aaacggcaag gtgatacttg ttgagtgcat 960 tcttcccgtg gctcctgaca caagccttgc caccaaggga gtcgtgcacg ttgatgtcat 1020 catgctggcg cacaaccccg gtgggaaaga gaggaccgag aaggaatttg agggcttagc 1080 taagggagct ggcttccaag gttttgaagt aatgtgctgt gcattcaaca cacatgtcat 1140 tgaattccgc aagaaggcct aaggcccatg tccaagctcc aagttacttg gggttttgca 1200 gacaacgttg ctgctgtctc tgcgtttgat gtttctgatt gctttttttt atacgaggag 1260 tagctatctc ttatgaaaca tgtaaggata agattgcgtt ttgtatgcct gattttctca 1320 aataacttca ctgcctccct caaaattctt aatacatgtg aaaagatttc ctattggcct 1380 tctgcttcaa acagtaaaga cttctgtaac ggaaaagaaa gcaattcatg atgtatgtat 1440 cttgcaagat tatgagtatt gttctaagca ttaagtgatt gttcaaaaaa aaaaaaaaaa 1500 aaa 1503 6 365 PRT aspen populus tremuloides 6 Met Gly Ser Thr Gly Glu Thr Gln Met Thr Pro Thr Gln Val Ser Asp 1 5 10 15 Glu Glu Ala His Leu Phe Ala Met Gln Leu Ala Ser Ala Ser Val Leu 20 25 30 Pro Met Ile Leu Lys Thr Ala Ile Glu Leu Asp Leu Leu Glu Ile Met 35 40 45 Ala Lys Ala Gly Pro Gly Ala Phe Leu Ser Thr Ser Glu Ile Ala Ser 50 55 60 His Leu Pro Thr Lys Asn Pro Asp Ala Pro Val Met Leu Asp Arg Ile 65 70 75 80 Leu Arg Leu Leu Ala Ser Tyr Ser Ile Leu Thr Cys Ser Leu Lys Asp 85 90 95 Leu Pro Asp Gly Lys Val Glu Arg Leu Tyr Gly Leu Ala Pro Val Cys 100 105 110 Lys Phe Leu Thr Lys Asn Glu Asp Gly Val Ser Val Ser Pro Leu Cys 115 120 125 Leu Met Asn Gln Asp Lys Val Leu Met Glu Ser Trp Tyr Tyr Leu Lys 130 135 140 Asp Ala Ile Leu Asp Gly Gly Ile Pro Phe Asn Lys Ala Tyr Gly Met 145 150 155 160 Thr Ala Phe Glu Tyr His Gly Thr Asp Pro Arg Phe Asn Lys Val Phe 165 170 175 Asn Lys Gly Met Ser Asp His Ser Thr Ile Thr Met Lys Lys Ile Leu 180 185 190 Glu Thr Tyr Lys Gly Phe Glu Gly Leu Thr Ser Leu Val Asp Val Gly 195 200 205 Gly Gly Thr Gly Ala Val Val Asn Thr Ile Val Ser Lys Tyr Pro Ser 210 215 220 Ile Lys Gly Ile Asn Phe Asp Leu Pro His Val Ile Glu Asp Ala Pro 225 230 235 240 Ser Tyr Pro Gly Val Glu His Val Gly Gly Asp Met Phe Val Ser Val 245 250 255 Pro Lys Ala Asp Ala Val Phe Met Lys Trp Ile Cys His Asp Trp Ser 260 265 270 Asp Ala His Cys Leu Lys Phe Leu Lys Asn Cys Tyr Asp Ala Leu Pro 275 280 285 Glu Asn Gly Lys Val Ile Leu Val Glu Cys Ile Leu Pro Val Ala Pro 290 295 300 Asp Thr Ser Leu Ala Thr Lys Gly Val Val His Val Asp Val Ile Met 305 310 315 320 Leu Ala His Asn Pro Gly Gly Lys Glu Arg Thr Glu Lys Glu Phe Glu 325 330 335 Gly Leu Ala Lys Gly Ala Gly Phe Gln Gly Phe Glu Val Met Cys Cys 340 345 350 Ala Phe Asn Thr His Val Ile Glu Phe Arg Lys Lys Ala 355 360 365 7 1915 DNA aspen populus tremuloides misc_feature 4CL 7 ccctcgcgaa actccgaaaa cagagagcac ctaaaactca ccatctctcc ctctgcatct 60 ttagcccgca atggacgcca caatgaatcc acaagaattc atctttcgct caaaattacc 120 agacatctac atcccgaaaa accttcccct gcattcatac gttcttgaga acttgtctaa 180 acattcatca aaaccttgcc tgataaatgg cgcgaatgga gatgtctaca cctatgctga 240 tgttgagctc acagcaagaa gagttgcttc tggtctgaac aagattggta ttcaacaagg 300 tgacgtgatc atgctcttcc taccaagttc acctgaattc gtgcttgctt tcctaggcgc 360 ttcacacaga ggtgccatga tcactgctgc caatcctttc tccacccctg cagagctagc 420 aaaacatgcc aaggcctcga gagcaaagct tctgataaca caggcttgtt actacgagaa 480 ggttaaagat tttgcccgag aaagtgatgt taaggtcatg tgcgtggact ctgccccgga 540 cggtgcttca cttttcagag ctcacacaca ggcagacgaa aatgaagtgc ctcaggtcga 600 cattagtcct gatgatgtcg tagcattgcc ttattcatca gggactacag ggttgccaaa 660 aggggtcatg ttaacgcaca aagggctaat aaccagtgtg gctcaacagg tagatggaga 720 caatcctaac ctgtattttc acagtgaaga tgtgattctg tgtgtgcttc ctatgttcca 780 tatctatgct ctgaattcaa tgatgctctg tggtctgaga gttggtgcct cgattttgat 840 aatgccaaag tttgagattg gttctttgct gggattgatt gagaagtaca aggtatctat 900 agcaccagtt gttccacctg tgatgatggc aattgctaag tcacctgatc ttgacaagca 960 tgacctgtct tctttgagga tgataaaatc tggaggggct ccattgggca aggaacttga 1020 agatactgtc agagctaagt ttcctcaggc tagacttggt cagggatatg gaatgaccga 1080 ggcaggacct gttctagcaa tgtgcttggc atttgccaag gaaccattcg acataaaacc 1140 aggtgcatgt ggaactgtag tcaggaatgc agagatgaag attgttgacc cagaaacagg 1200 ggtctctcta ccgaggaacc agcctggtga gatctgcatc cggggtgatc agatcatgaa 1260 aggatatctt aatgaccccg aggcaacctc aagaacaata gacaaagaag gatggctgca 1320 cacaggcgat atcggctaca ttgatgatga tgatgagctt ttcatcgttg acagattgaa 1380 ggaattgatc aagtataaag ggtttcaggt tgctcctact gaactcgaag ctttgttaat 1440 agcccatcca gagatatccg atgctgctgt agtaggattg aaagatgagg atgcgggaga 1500 agttcctgtt gcatttgtag tgaaatcaga aaagtctcag gccaccgaag atgaaattaa 1560 gcagtatatt tcaaaacagg tgatcttcta caagagaata aaacgagttt tcttcattga 1620 agcaattccc aaggcaccat caggcaagat cctgaggaag aatctgaaag agaagttgcc 1680 aggcatataa ctgaagatgt tactgaacat ttaaccctct gtcttatttc tttaatactt 1740 gcgaatcatt gtagtgttga accaagcatg cttggaaaag acacgtaccc aacgtaagac 1800 agttactgtt cctagtatac aagctcttta atgttcgttt tgaacttggg aaaacataag 1860 ttctcctgtc gccatatgga gtaattcaat tgaatatttt ggtttcttta atgat 1915 8 1395 DNA aspen populus tremuloides misc_feature CAD; GenBank accession number AF217957 8 aaactccatc cctctctctt agcctcgttg tttcaagaaa atgggtagcc ttgaaacaga 60 gagaaaaatt gtaggatggg cagcaacaga ctcaactggg catctcgctc cttacaccta 120 tagtctcaga gatacggggc cagaagatgt tcttatcaag gttatcagct gtggaatttg 180 ccataccgat atccaccaaa tcaaaaatga tcttggcatg tcacactatc ctatggtccc 240 tggccatgaa gtggttggtg aggttgttga ggtgggatca gatgtgacaa agttcaaagc 300 tggagatgtt gttggtgttg gagtcatcgt tggaagctgc aagaattgtc atccatgcaa 360 atcagagctt gagcaatact gcaacaagaa aatctggtct tacaatgatg tctacactga 420 tggcaaaccc acccaaggag gctttgctga atccatggtt gtcgatcaaa agtttgtggt 480 gagaattcct gatgggatgt caccagaaca agcagcgccg ctgttgtgcg ctggattgac 540 agtttacagc ccactcaaac actttggact gaaacagagt gggctaagag gagggatttt 600 aggacttgga ggagtagggc acatgggggt gaagatagca aaggcaatgg gacaccatgt 660 aactgtgatt agttcttctg acaagaagcg ggaggaggct atggaacatc ttggtgctga 720 tgaatacctg gtcagctcgg atgtggaaag catgcaaaaa gctgctgatc aacttgacta 780 tatcatcgat actgtgcctg tggttcaccc tctcgagcct tacctttctc tattgaaact 840 tgatggcaag ctgatcttga tgggtgttat taatacccca ttgcagtttg tttcgccaat 900 ggttatgctt gggagaaagt cgatcaccgg gagcttcata gggagcatga aggagacaga 960 ggagatgctt gagttctgca aggaaaaggg attggcctcc atgattgaag tgatcaaaat 1020 ggattatatc aacacagcat tcgagaggct tgagaaaaat gatgtgagat atagattcgt 1080 tgtcgatgtt gctggtagca agcttattcc ctgaacgaca ataccattca tattcgaaaa 1140 aacgcgatat acattgatac ctgtttcaga cttgacttta ttttcgagtg atgtgttttg 1200 tggttcaaat gtgacagttt gtctttgctt ttaaaataaa gaaaaagttg agttgttttt 1260 ttattttcat taatgggcat gcgttacctt gtaattgaat gcgctgcatc tggtgatctg 1320 tcccataaac taatctcttg tggcaatgaa agatgacgaa ctttctgaaa aaaaaaaaaa 1380 aaaaaaaaaa aaaaa 1395 9 357 PRT aspen populus tremuloides 9 Met Gly Ser Leu Glu Thr Glu Arg Lys Ile Val Gly Trp Ala Ala Thr 1 5 10 15 Asp Ser Thr Gly His Leu Ala Pro Tyr Thr Tyr Ser Leu Arg Asp Thr 20 25 30 Gly Pro Glu Asp Val Leu Ile Lys Val Ile Ser Cys Gly Ile Cys His 35 40 45 Thr Asp Ile His Gln Ile Lys Asn Asp Leu Gly Met Ser His Tyr Pro 50 55 60 Met Val Pro Gly His Glu Val Val Gly Glu Val Val Glu Val Gly Ser 65 70 75 80 Asp Val Thr Lys Phe Lys Ala Gly Asp Val Val Gly Val Gly Val Ile 85 90 95 Val Gly Ser Cys Lys Asn Cys His Pro Cys Lys Ser Glu Leu Glu Gln 100 105 110 Tyr Cys Asn Lys Lys Ile Trp Ser Tyr Asn Asp Val Tyr Thr Asp Gly 115 120 125 Lys Pro Thr Gln Gly Gly Phe Ala Glu Ser Met Val Val Asp Gln Lys 130 135 140 Phe Val Val Arg Ile Pro Asp Gly Met Ser Pro Glu Gln Ala Ala Pro 145 150 155 160 Leu Leu Cys Ala Gly Leu Thr Val Tyr Ser Pro Leu Lys His Phe Gly 165 170 175 Leu Lys Gln Ser Gly Leu Arg Gly Gly Ile Leu Gly Leu Gly Gly Val 180 185 190 Gly His Met Gly Val Lys Ile Ala Lys Ala Met Gly His His Val Thr 195 200 205 Val Ile Ser Ser Ser Asp Lys Lys Arg Glu Glu Ala Met Glu His Leu 210 215 220 Gly Ala Asp Glu Tyr Leu Val Ser Ser Asp Val Glu Ser Met Gln Lys 225 230 235 240 Ala Ala Asp Gln Leu Asp Tyr Ile Ile Asp Thr Val Pro Val Val His 245 250 255 Pro Leu Glu Pro Tyr Leu Ser Leu Leu Lys Leu Asp Gly Lys Leu Ile 260 265 270 Leu Met Gly Val Ile Asn Thr Pro Leu Gln Phe Val Ser Pro Met Val 275 280 285 Met Leu Gly Arg Lys Ser Ile Thr Gly Ser Phe Ile Gly Ser Met Lys 290 295 300 Glu Thr Glu Glu Met Leu Glu Phe Cys Lys Glu Lys Gly Leu Ala Ser 305 310 315 320 Met Ile Glu Val Ile Lys Met Asp Tyr Ile Asn Thr Ala Phe Glu Arg 325 330 335 Leu Glu Lys Asn Asp Val Arg Tyr Arg Phe Val Val Asp Val Ala Gly 340 345 350 Ser Lys Leu Ile Pro 355 10 535 PRT aspen populus tremuloides 10 Met Asn Pro Gln Glu Phe Ile Phe Arg Ser Lys Leu Pro Asp Ile Tyr 1 5 10 15 Ile Pro Lys Asn Leu Pro Leu His Ser Tyr Val Leu Glu Asn Leu Ser 20 25 30 Lys His Ser Ser Lys Pro Cys Leu Ile Asn Gly Ala Asn Gly Asp Val 35 40 45 Tyr Thr Tyr Ala Asp Val Glu Leu Thr Ala Arg Arg Val Ala Ser Gly 50 55 60 Leu Asn Lys Ile Gly Ile Gln Gln Gly Asp Val Ile Met Leu Phe Leu 65 70 75 80 Pro Ser Ser Pro Glu Phe Val Leu Ala Phe Leu Gly Ala Ser His Arg 85 90 95 Gly Ala Met Ile Thr Ala Ala Asn Pro Phe Ser Thr Pro Ala Glu Leu 100 105 110 Ala Lys His Ala Lys Ala Ser Arg Ala Lys Leu Leu Ile Thr Gln Ala 115 120 125 Cys Tyr Tyr Glu Lys Val Lys Asp Phe Ala Arg Glu Ser Asp Val Lys 130 135 140 Val Met Cys Val Asp Ser Ala Pro Asp Gly Ala Ser Leu Phe Arg Ala 145 150 155 160 His Thr Gln Ala Asp Glu Asn Glu Val Pro Gln Val Asp Ile Ser Pro 165 170 175 Asp Asp Val Val Ala Leu Pro Tyr Ser Ser Gly Thr Thr Gly Leu Pro 180 185 190 Lys Gly Val Met Leu Thr His Lys Gly Leu Ile Thr Ser Val Ala Gln 195 200 205 Gln Val Asp Gly Asp Asn Pro Asn Leu Tyr Phe His Ser Glu Asp Val 210 215 220 Ile Leu Cys Val Leu Pro Met Phe His Ile Tyr Ala Leu Asn Ser Met 225 230 235 240 Met Leu Cys Gly Leu Arg Val Gly Ala Ser Ile Leu Ile Met Pro Lys 245 250 255 Phe Glu Ile Gly Ser Leu Leu Gly Leu Ile Glu Lys Tyr Lys Val Ser 260 265 270 Ile Ala Pro Val Val Pro Pro Val Met Met Ala Ile Ala Lys Ser Pro 275 280 285 Asp Leu Asp Lys His Asp Leu Ser Ser Leu Arg Met Ile Lys Ser Gly 290 295 300 Gly Ala Pro Leu Gly Lys Glu Leu Glu Asp Thr Val Arg Ala Lys Phe 305 310 315 320 Pro Gln Ala Arg Leu Gly Gln Gly Tyr Gly Met Thr Glu Ala Gly Pro 325 330 335 Val Leu Ala Met Cys Leu Ala Phe Ala Lys Glu Pro Phe Asp Ile Lys 340 345 350 Pro Gly Ala Cys Gly Thr Val Val Arg Asn Ala Glu Met Lys Ile Val 355 360 365 Asp Pro Glu Thr Gly Val Ser Leu Pro Arg Asn Gln Pro Gly Glu Ile 370 375 380 Cys Ile Arg Gly Asp Gln Ile Met Lys Gly Tyr Leu Asn Asp Pro Glu 385 390 395 400 Ala Thr Ser Arg Thr Ile Asp Lys Glu Gly Trp Leu His Thr Gly Asp 405 410 415 Ile Gly Tyr Ile Asp Asp Asp Asp Glu Leu Phe Ile Val Asp Arg Leu 420 425 430 Lys Glu Leu Ile Lys Tyr Lys Gly Phe Gln Val Ala Pro Thr Glu Leu 435 440 445 Glu Ala Leu Leu Ile Ala His Pro Glu Ile Ser Asp Ala Ala Val Val 450 455 460 Gly Leu Lys Asp Glu Asp Ala Gly Glu Val Pro Val Ala Phe Val Val 465 470 475 480 Lys Ser Glu Lys Ser Gln Ala Thr Glu Asp Glu Ile Lys Gln Tyr Ile 485 490 495 Ser Lys Gln Val Ile Phe Tyr Lys Arg Ile Lys Arg Val Phe Phe Ile 500 505 510 Glu Ala Ile Pro Lys Ala Pro Ser Gly Lys Ile Leu Arg Lys Asn Leu 515 520 525 Lys Glu Lys Leu Pro Gly Ile 530 535 11 20 DNA aspen populus tremuloides misc_feature Pt4CL1 promoter sense primer 11 caggaatgct ctgcactctg 20 12 20 DNA aspen populus tremuloides misc_feature Pt4CL1 sense primer 12 atgaatccac aagaattcat 20 13 20 DNA aspen populus tremuloides misc_feature Pt4CL1 promoter sense primer 13 caggaatgct ctgcactctg 20 14 21 DNA aspen populus tremuloides misc_feature PtCal5H antisense primer 14 ttagagagga cagagcacac g 21

Claims (72)

What is claimed is:
1. A method of genetically transforming a plant simultaneously with multiple genes from the phenylpropanoid pathways, comprising incorporating into the genome of the plant a plurality of genes, the genes selected from the group consisting of 4CL, CAld5H, AldOMT, CAD, and SAD, substantially similar fragments thereof, and combinations thereof to produce plants displaying altered agronomic traits.
2. The method of claim 1 wherein the genes incorporated into the genome are CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof or combinations thereof in sense orientation, to produce increased syringyl lignin in the plant compared to a non-transformed plant.
3. The method of claim 1, wherein the genes incorporated into its genome are 4CL gene or substantially similar fragments thereof in a sense or antisense orientation and CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof or combinations thereof in sense orientation to downregulate 4CL gene expression in the plant compared to a non-transformed plant.
4. The method of claim 3 wherein the down regulation of 4CL correlates with decreased lignin content, increased syringyl/guaiacyl (S/G) lignin ratio and increased cellulose content compared to a non-transformed plant.
5. The method of claim 1, wherein the genes incorporated into its genome are 4CL and CAD genes or substantially similar fragments thereof in sense or antisense orientation and CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof or combinations thereof in sense orientation to downregulate 4CL and CAD gene expression in the plant compared to a non-transformed plant.
6. The method of claim 5 wherein the down regulation of 4CL and CAD correlates with decreased lignin content, increased S/G lignin ratio and increased cellulose content as compared to a non-transformed plant.
7. The method of claim 1 wherein the gene incorporated into the genome of the plant is 4CL gene or substantially similar fragments thereof in the sense orientation, to upregulate 4CL gene expression in the plant compared to a non-transformed plant.
8. The method of claim 7, wherein the upregulation of 4CL gene correlates to increased lignin content in the plant compared to a non-transformed plant.
9. A method of claim 1 wherein the genes incorporated into the genome of the plant are 4CL, CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof or combinations thereof in the sense orientation, to upregulate 4CL, CAld5H, AldOMT, and SAD gene expression
10. The method of claim 9 wherein the upregulation of 4CL, CAld5H, AldOMT, and SAD genes correlates to an increased lignin content and increased S/G ratio compared to a non-transformed plant.
11. The method of claim 1 wherein the genes incorporated into the genome of the plant 4CL, CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof or combinations thereof in the sense orientation and the CAD gene or substantially similar fragments thereof in the antisense orientation, to upregulate 4CL, CAld5H, AldOMT, and SAD gene expression and to downregulate CAD gene expression in the plant compared to a non-transformed plant.
12. The method of claim 11, wherein the upregulation of 4CL, CAld5H, AldOMT, and SAD gene expression and the downregulation of CAD gene expression correlate with an increased lignin content and an increased S/G ratio compared to a non-transformed plant.
13. The method of claim 2 wherein the plant is an angiosperm or a gymnosperm.
14. The method of claim 3 wherein the plant is an angiosperm or a gymnosperm.
15. The method of claim 5 wherein the plant is an angiosperm or a gymnosperm.
16. A method of preparing plant cells having in their genome a plurality of DNA constructs, the method comprising
a) incorporating into the genome of the cells a plurality of DNA constructs to yield transformed cells, each construct comprising a polynucleotide sequence encoding a protein selected from the group consisting of 4CL, CAld5H, AldOMT, CAD, and SAD, substantially similar fragments thereof, and combinations thereof, operably linked to a promoter sequence functional in the cells, and a termination sequence
b) identifying the transformed plant cells, the genome of which is augmented with DNA from the different DNA constructs.
17. The method of claim 16 wherein the expression of the protein is associated with an agronomic trait in the plant cells.
18. The method of claim 17 wherein the trait is lignin biosynthesis, cellulose biosynthesis, growth, wood quality, stress resistance, sterility, grain yield or nutritional value.
19. The method of claim 16 further comprising regenerating the identified transformed plants cells to yield a transgenic plant.
20. The method of claim 16 wherein the plant cells are regenerable.
21. The method of claim 16 wherein the plant cells are tree cells.
22. The method of claim 16 wherein the plant cells are angiosperm cells.
23. The method of claim 16 wherein the plant cells are gymnosperm cells.
24. A method of preparing transgenic plants having altered lignin and cellulose compositions, the method comprising
a) providing the genome of the plants with a plurality of DNA constructs to yield transformed plant cells, each construct comprising a polynucleotide sequence encoding a protein selected from the group consisting of 4CL, CAld5H, AldOMT, CAD, and SAD, substantially similar fragments thereof, and combinations thereof, the polynucleotide sequence operably linked to a promoter sequence functional in the plant cells, and a termination sequence;
b) regenerating the transformed plant cells to yield transgenic plants, the genome of which is augmented with DNA from different DNA constructs, and
c) expressing the DNA constructs in the cells of the transgenic plants in an amount effective to alter the lignin and cellulose composition in the plants.
25. A plant of claim 24 wherein the promoter sequence can be constitutive or tissue-specific.
26. A plant of claim 24 wherein the promoter sequence can be homologous or heterologous.
27. A plant if claim 24 wherein the promoter sequence provides for transcription in xylem.
28. A method of claim 24, wherein the plant is a plant cell, plant organ, or an entire plant.
29. A method of claim 24, wherein the plant is a plant fruit, seeds and progeny thereof.
30. The method of claim 24 wherein the plants are trees.
31. The method of claim 24 wherein the plants are angiosperms.
32. The method of claim 24 wherein the plants are gymnosperms.
33. A transgenic plant prepared by the method of claim 24.
34. A progeny plant of the transgenic plant of claim 32.
35. A method of preparing a transgenic tree comprising
a) incorporating into the genome of the tree a plurality of desired DNA constructs to produce transformed tree cells, each construct comprising a polynucleotide sequence encoding a protein selected from the group consisting of 4CL, CAld5H, AldOMT, CAD, and SAD, substantially similar fragments thereof, and combinations thereof, operably linked to a promoter sequence functional in the cells, and a termination sequence;
b) regenerating the transformed tree cells to yield transgenic trees, the genome of which is augmented with the plurality of DNA constructs; and
c) expressing the DNA construct in the cells of the transgenic tree in an amount effective to alter the lignin and cellulose composition of the tree.
36. A transgenic tree prepared by the method of claim 34.
37. The method of claim 34 wherein the transgenic tree is a Populus tremuloides.
38. A plant having incorporated into its genome a DNA construct comprising a polynucleotide sequence encoding a protein selected from the group consisting of 4CL, CAld5H, AldOMT, CAD, and SAD, substantially similar fragments thereof, and combinations thereof, operably linked to a promoter sequence, and a termination sequence.
39. A plant of claim 38 wherein the promoter sequence can be constitutive or tissue-specific.
40. A plant of claim 38 wherein the promoter sequence can be homologous or heterologous.
41. A plant of claim 38 wherein the promoter sequence provides for transcription in xylem.
42. The plant of claim 38 which is a tree.
43. A plant of claim 38 wherein the plant is a gymnosperm.
44. The plant of claim 43 wherein the nucleotide sequence encodes CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof and combinations thereof, in sense orientation, yielding increased syringyl lignin as compared to a non-transformed plant.
45. The plant of claim 43 wherein the nucleotide sequences encodes 4CL gene or substantially similar fragments thereof in sense or antisense orientation and CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof, and combinations thereof, in sense orientation, yielding decreased lignin content, increased syringyl/guaiacyl (S/G) lignin ratio and increased cellulose content as compared to a non-transformed plant.
46. The plant of claim 43 wherein the nucleotide sequences encodes 4CL and CAD genes or substantially similar fragments thereof in sense or antisense orientation and CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof, and combinations thereof, in sense orientation, yielding decreased lignin content, increased S/G lignin ratio and increased cellulose content as compared to a non-transformed plant.
47. The plant of claim 43 wherein the nucleotide sequences encodes 4CL gene or substantially similar fragments thereof in the sense orientation yielding increased lignin content as compared to a non-transformed plant.
48. The plant of claim 43 wherein the polynucleotide sequences incorporated into the genome are 4CL, CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof, and combinations thereof, in the sense orientation, yielding increased lignin content and increased S/G ratio as compared to a non-transformed plant.
49. The plant of claim 43 wherein the polynucleotide sequences encodes 4CL, CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof and combinations thereof in the sense orientation and the CAD gene, or substantially similar fragments thereof in the antisense orientation, yielding increased lignin content and increased S/G ratio as compared to a non-transformed plant.
50. A plant of claim 38 wherein the plant is an angiosperm.
51. The plant of claim 50 wherein the polynucleotide sequences encodes CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof and combinations thereof, in sense orientation, yielding increased S/G lignin ratio as compared to a non-transformed plant.
52. The plant of claim 51 wherein the polynucleotide sequences encode the 4CL gene or substantially similar fragments thereof in sense or antisense orientation, and CAld5H, AldOMT, and SAD genes, substantially similar fragment thereof, and combinations thereof in sense orientation, yielding decreased lignin content, increased S/G lignin ratio and increased cellulose content as compared to a non-transformed plant.
53. The plant of claim 50 wherein the nucleotide sequences encodes 4CL and CAD genes or substantially similar fragments thereof, and combinations thereof by sense or antisense orientation and CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof, and combinations thereof in sense orientation, yielding decreased lignin content, increased S/G lignin ratio and increased cellulose content as compared to a non-transformed plant.
54. The plant of claim 50 wherein the nucleotide sequences encodes 4CL gene or substantially similar fragment thereof, by sense orientation, yielding increased lignin content as compared to a non-transformed plant.
55. The plant of claim 50 wherein the nucleotide sequences encodes 4CL, CAld5H, AldOMT, and SAD genes, substantially similar fragment thereof, and combinations thereof, in sense orientation, yielding increased lignin content and increased S/G ratio as compared to a non-transformed plant.
56. The plant of claim 50 wherein the nucleotide sequences encode 4CL CAld5H, AldOMT, and SAD genes, substantially similar fragment thereof, and combinations thereof, in sense orientation, and CAD gene, substantially similar fragment thereof, and combinations thereof in antisense orientation, yielding increased lignin content and increased S/G ratio as compared to a non-transformed plant.
57. A plurality of DNA constructs, each construct comprising in the 5′-3′ direction:
a) a gene promoter sequence,
b) a gene termination sequence; and
c) a polynucleotide sequence encoding a protein selected from the group consisting of 4CL, CAld5H, AldOMT, CAD, and SAD, substantially similar fragments thereof, and combinations thereof involved in a lignin biosynthetic pathway, the polynucleotide sequence operably linked to the promoter and termination sequences.
58. A plurality of DNA constructs of claim 57 wherein the gene promoter sequence is a constitutive or tissue-specific promoter.
59. A plurality of DNA constructs of claim 57 wherein the gene promoter sequence is homologous or heterologous.
60. A plurality of DNA constructs of claim 57 wherein the gene promoter sequences are xylem-specific.
61. A plurality of DNA constructs incorporated into the genome of gymnosperms, the constructs comprising nucleotide sequences encoding CAld5H, AldOMT, and SAD genes, a substantially similar fragments thereof and combinations thereof, in sense orientation, to produce syringyl lignin as compared to a non-transformed plant.
62. A plurality of DNA constructs incorporated into the genome of gymnosperm, the constructs comprising 4CL gene or substantially similar fragments thereof in sense or antisense orientation and CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof and combination thereof in sense orientation to decrease lignin content, increase syringyl/guaiacyl (S/G) lignin ratio and increase cellulose content as compared to a non-transformed plant.
63. A plurality of DNA constructs incorporated into the genome of gymnosperms, the constructs comprising 4CL and CAD genes or substantially similar fragments thereof in sense or antisense orientation and CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof and combination thereof in sense orientation to decrease lignin content, increase S/G lignin ratio and increase cellulose content as compared to a non-transformed plant.
64. A DNA construct incorporated into the genome of plants, comprising 4CL gene or substantially similar fragments thereof in the sense orientation to increase lignin content compared to a non-transformed plant.
65. A DNA construct of claim 63 wherein the plant is an angiosperm or a gymnosperm.
66. A plurality of DNA constructs incorporated into the genome of plants, the constructs comprising 4CL, CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof or combination thereof, in the sense orientation, to increase lignin content and increase S/G ratio compared to a non-transformed plant.
67. A plurality of DNA constructs of claim 65 wherein the plant is an angiosperm or a gymnosperm.
68. A plurality of DNA constructs incorporated into the genome of plants, the constructs comprising 4CL, CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof and combination thereof in the sense orientation and CAD gene or substantially similar fragments thereof in the antisense orientation to increase lignin content and increase S/G ratio compared to a non-transformed plant.
69. A plurality of DNA constructs of claim 67 wherein the plant is an angiosperm or a gymnosperm.
70. A plurality of DNA constructs incorporated into the genome of angiosperms, the constructs comprising CAld5H, AldOMT, and SAD genes, substantially similar fragments thereof and combinations thereof in sense orientation to engineer high S/G lignin ratio compared to a non-transformed plant.
71. A plurality of DNA constructs incorporated incorporating into the genome of angiosperms, the constructs comprising 4CL gene or substantially similar fragment thereof in sense or antisense orientation and CAld5H, AldOMT, and SAD genes, substantially similar fragment thereof, and combinations thereof, in sense orientation, to decrease lignin content, increase S/G lignin ratio and increase cellulose content compared to a non-transformed plant.
72. A plurality of DNA constructs incorporated into the genome of angiosperms, the constructs comprising 4CL and CAD genes, substantially similar fragments thereof, and combinations thereof by sense or antisense orientation and CAld5H, AldOMT, and SAD genes, or substantially similar fragments thereof, and combinations thereof, in sense orientation, to decrease lignin content, increase S/G lignin ratio and increase cellulose content compared to a non-transformed plant.
US10/091,009 2000-09-05 2002-03-06 Methods for simultaneous control of lignin content and composition, and cellulose content in plants Abandoned US20020138870A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/091,009 US20020138870A1 (en) 2000-09-05 2002-03-06 Methods for simultaneous control of lignin content and composition, and cellulose content in plants

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US23008600P 2000-09-05 2000-09-05
US09/947,027 US6855864B2 (en) 2000-09-05 2001-09-05 Methods for simultaneous control of lignin content and composition, and cellulose content in plants
US10/091,009 US20020138870A1 (en) 2000-09-05 2002-03-06 Methods for simultaneous control of lignin content and composition, and cellulose content in plants

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/947,027 Division US6855864B2 (en) 2000-09-05 2001-09-05 Methods for simultaneous control of lignin content and composition, and cellulose content in plants

Publications (1)

Publication Number Publication Date
US20020138870A1 true US20020138870A1 (en) 2002-09-26

Family

ID=22863901

Family Applications (4)

Application Number Title Priority Date Filing Date
US09/947,150 Expired - Lifetime US6812377B2 (en) 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants
US09/947,027 Expired - Fee Related US6855864B2 (en) 2000-09-05 2001-09-05 Methods for simultaneous control of lignin content and composition, and cellulose content in plants
US10/091,009 Abandoned US20020138870A1 (en) 2000-09-05 2002-03-06 Methods for simultaneous control of lignin content and composition, and cellulose content in plants
US11/057,518 Expired - Fee Related US7514596B2 (en) 2000-09-05 2005-02-14 Methods for simultaneous control of lignin content and composition, and cellulose content in plants

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US09/947,150 Expired - Lifetime US6812377B2 (en) 2000-09-05 2001-09-05 Genetic engineering of syringyl-enriched lignin in plants
US09/947,027 Expired - Fee Related US6855864B2 (en) 2000-09-05 2001-09-05 Methods for simultaneous control of lignin content and composition, and cellulose content in plants

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/057,518 Expired - Fee Related US7514596B2 (en) 2000-09-05 2005-02-14 Methods for simultaneous control of lignin content and composition, and cellulose content in plants

Country Status (11)

Country Link
US (4) US6812377B2 (en)
EP (1) EP1320617A4 (en)
JP (2) JP4871487B2 (en)
CN (1) CN1473198A (en)
AR (2) AR030616A1 (en)
AU (3) AU2001288716A1 (en)
BR (2) BR0113699A (en)
CA (1) CA2421215A1 (en)
IL (4) IL154760A0 (en)
WO (2) WO2002020812A1 (en)
ZA (1) ZA200301785B (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004097024A1 (en) * 2003-04-28 2004-11-11 Swetree Technologies Ab Tissue specific promoters
US20060260011A1 (en) * 2005-03-28 2006-11-16 Syngenta Participations Ag Methods and genetic constructs for modification of lignin composition of corn cobs
US20060263860A1 (en) * 2005-05-02 2006-11-23 Vermerris Willem E Methods for increasing the yield of fermentable sugars from plant stover
WO2006040685A3 (en) * 2004-10-15 2006-12-28 Swetree Technologies Ab Methods for improving tree growth and wood properties
US20070006344A1 (en) * 2004-04-20 2007-01-04 Syngenta Participations Ag Regulatory sequences for expressing gene products in plant reproductive tissue
EP2045327A2 (en) 2005-03-08 2009-04-08 BASF Plant Science GmbH Expression enhancing intron sequences
US20100071092A1 (en) * 2004-04-20 2010-03-18 Syngenta Participations Ag Methods and genetic constructs for modification of lignin composition of corn cobs
US8536406B2 (en) 2008-04-28 2013-09-17 Michigan Technological University COMT1 gene fiber-specific promoter elements from poplar

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002020812A1 (en) 2000-09-05 2002-03-14 Board Of Control Of Michigan Technological University Genetic engineering of syringyl-enriched lignin in plants
US7288696B2 (en) * 2000-09-05 2007-10-30 Board Of Control Of Michigan Technological University Genetic engineering of syringyl-enriched lignin in plants
US7154027B2 (en) 2001-11-07 2006-12-26 Jeroen Demmer Compositions isolated from forage grasses and methods for their use
CN1318579C (en) * 2003-08-08 2007-05-30 浙江省农业科学院 Gene engineering method for raising plant useful secondary substance content
AU2015202444B2 (en) * 2004-04-06 2017-06-15 Fibria Celulose S/A Cambium/xylem-preferred promoters and uses thereof
PT2557165T (en) * 2004-04-06 2016-08-18 Fibria Celulose S/A Cambium/xylem-preferred promoters and uses thereof
WO2005108577A1 (en) * 2004-05-06 2005-11-17 Agriculture Victoria Services Pty Ltd Plant cad1-like genes and their use
WO2006012594A2 (en) * 2004-07-24 2006-02-02 The Samuel Roberts Noble Foundation, Inc. Modification of lignin biosynthesis
WO2006017920A2 (en) * 2004-08-18 2006-02-23 Alellyx S.A. Polynucleotides, dna constructs and methods for the alteration of plant lignin content and/or composition
US7402428B2 (en) 2004-09-22 2008-07-22 Arborgen, Llc Modification of plant lignin content
US7456338B2 (en) * 2004-09-22 2008-11-25 Arborgen Llc Modification of plant lignin content
US7799906B1 (en) 2004-09-22 2010-09-21 Arborgen, Llc Compositions and methods for modulating lignin of a plant
AU2006303843B2 (en) * 2005-10-21 2012-08-09 Fibria Celulose S/A Polynucleotides, DNA constructs and methods for the alteration of plant cellulose content
US8183432B2 (en) * 2006-02-28 2012-05-22 Japan Science And Technology Agency Plant having reduced lignin and cellulose contents without reducing glucan content, method of producing the same and utilization thereof
US20070240837A1 (en) * 2006-04-13 2007-10-18 Andritz Inc. Hardwood alkaline pulping processes and systems
US8362322B2 (en) * 2006-10-27 2013-01-29 Ceres, Inc. Modulating lignin in plants
WO2008064289A2 (en) * 2006-11-21 2008-05-29 The Samuel Roberts Noble Foundation, Inc. Biofuel production methods and compositions
CA2674564A1 (en) * 2007-02-08 2008-08-14 Basf Plant Science Gmbh Compositions and methods using rna interference of cad-like genes for control of nematodes
AU2007200824B2 (en) * 2007-02-23 2011-03-24 Fibria Celulose S/A Altering wood density
WO2008118385A2 (en) * 2007-03-23 2008-10-02 Michigan State University Lignin reduction and cellulose increase in crop biomass via genetic engineering
AU2010256356B2 (en) 2009-06-05 2015-07-16 University Of Florida Research Foundation, Inc. Isolation and targeted suppression of lignin biosynthetic genes from sugarcane
US9334505B2 (en) 2011-08-12 2016-05-10 Purdue Research Foundation Using corngrass1 to engineer poplar as a bioenergy crop
US9556420B2 (en) * 2013-06-18 2017-01-31 Brookhaven Science Associates, Llc Specialized (iso)eugenol-4-O-methyltransferases (s-IEMTs) and methods of making and using the same
CN108467898B (en) * 2017-02-23 2021-07-27 北京林业大学 A method for screening poplar wood quality traits by combined use of microRNA and its target gene SNP
KR102198787B1 (en) * 2019-09-05 2021-01-05 한국과학기술연구원 Novel feed crop comprising mutated COMT gene and uses thereof
CN116548262B (en) * 2023-04-15 2023-11-03 西藏自治区农牧科学院草业科学研究所 Planting method for mixed sowing of oat and common vetch forage grass in alpine arid region

Family Cites Families (44)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4744026A (en) * 1986-04-11 1988-05-10 American Telephone And Telegraph Company, At&T Bell Laboratories Methods and apparatus for efficient resource allocation
US5295065A (en) * 1990-06-01 1994-03-15 Motorola, Inc. Resource-lot association coordinator
WO1992003905A2 (en) * 1990-08-31 1992-03-19 Ab Volvo A method and apparatus for optimally allocating resources
GB9109063D0 (en) * 1991-04-26 1991-06-12 Ici Plc Modification of lignin synthesis in plants
JPH05250377A (en) * 1992-03-04 1993-09-28 Fujitsu Ltd Scheduling method
GB9211416D0 (en) 1992-05-29 1992-07-15 Ici Plc Expression of genes in transgenic plants
JP3551443B2 (en) * 1992-06-02 2004-08-04 王子製紙株式会社 Cinnamyl alcohol dehydrogenase gene of udo and hardwood, and hardwood into which the gene is introduced
US5630070A (en) * 1993-08-16 1997-05-13 International Business Machines Corporation Optimization of manufacturing resource planning
US5434775A (en) * 1993-11-04 1995-07-18 The General Hospital Corporation Managing an inventory of devices
FR2718460B1 (en) * 1994-04-11 1996-05-31 Centre Nat Rech Scient DNA sequence coding for cinnamoyl CoA reductase in Eucalyptus, and its applications in the field of regulation of plant lignin levels.
US6801820B1 (en) * 1994-05-27 2004-10-05 Lilly Software Associates, Inc. Method and apparatus for scheduling work orders in a manufacturing process
JP3315844B2 (en) * 1994-12-09 2002-08-19 株式会社東芝 Scheduling device and scheduling method
DE19535084A1 (en) * 1995-09-21 1997-03-27 Ibm Dynamic optimisation of business processes managed by computer system
US5922928A (en) * 1995-11-30 1999-07-13 Board Of Control Of Michigan Technological University Genetic transformation and regeneration of plants
AUPN773496A0 (en) * 1996-01-25 1996-02-15 Task Solutions Pty Ltd Task management system
US5754451A (en) * 1996-02-29 1998-05-19 Raytheon Company Preventative maintenance and diagonstic system
US5970437A (en) * 1996-10-03 1999-10-19 Gorman; Alexander J. Computerized management of plant maintenance and program therefor
US6252135B1 (en) * 1996-12-16 2001-06-26 International Paper Company Production of syringyl lignin in gymnosperms
US5995915A (en) * 1997-01-29 1999-11-30 Advanced Micro Devices, Inc. Method and apparatus for the functional verification of digital electronic systems
EP0983564A1 (en) * 1997-05-21 2000-03-08 Khimetrics, Inc. Method for controlled optimization of enterprise planning models
US6230200B1 (en) * 1997-09-08 2001-05-08 Emc Corporation Dynamic modeling for resource allocation in a file server
US6014633A (en) * 1997-09-24 2000-01-11 Deroyal Business Systems, L.L.C. Method for the analysis and standardization of bills of resources
US6096094A (en) * 1997-10-03 2000-08-01 National Instruments Corporation Configuration manager for configuring a data acquisition system
US6455762B1 (en) * 1997-11-12 2002-09-24 Board Of Control Of Michigan Technological University Methods of modifying lignin in plants by transformation with a 4-coumarate coenzyme a ligase nucleic acid
US6078912A (en) * 1998-04-15 2000-06-20 Travelhost, Inc. Computer-based system and method for resource determination and management
EP1006190A1 (en) * 1998-12-02 2000-06-07 Centrum Voor Plantenveredelings- En Reproduktieonderzoek Fruit flavour related genes and use thereof
EP1153134A1 (en) * 1999-02-01 2001-11-14 Cellfor Inc. Modification of lignin composition of gymnosperms
US6067486A (en) * 1999-02-01 2000-05-23 General Electric Company Method and system for planning repair of an aircraft engine
US6321207B1 (en) * 1999-04-15 2001-11-20 I2 Technologies Us, Inc. System and method for optimizing the allocation of a resource
US7288409B1 (en) 1999-10-08 2007-10-30 Board Of Control Of Michigan Technological University Method of introducing a plurality of genes into plants
US6691006B2 (en) * 1999-12-01 2004-02-10 Sinex Aviation Technologies Corporation Dynamic assignment of maintenance tasks to aircraft maintenance personnel
US6678716B1 (en) * 2000-06-19 2004-01-13 J. D. Edwards World Source Company System and method for managing processes
US6496814B1 (en) * 2000-07-19 2002-12-17 International Business Machines Corporation Method and system for integrating spatial analysis, and scheduling to efficiently schedule and monitor infrastructure maintenance
AU2001279224A1 (en) * 2000-08-07 2002-02-18 General Electric Company Computerized method and system for guiding service personnel to select a preferred work site for servicing transportation equipment
WO2002014497A2 (en) 2000-08-16 2002-02-21 Purdue Research Foundation Genes encoding mutant p-coumarate 3-hydroxylase (c3h) and methods of use
WO2002020812A1 (en) 2000-09-05 2002-03-14 Board Of Control Of Michigan Technological University Genetic engineering of syringyl-enriched lignin in plants
US6738748B2 (en) * 2001-04-03 2004-05-18 Accenture Llp Performing predictive maintenance on equipment
US20020072988A1 (en) * 2000-12-13 2002-06-13 Itt Manufacturing Enterprises, Inc. Supply management system
AU2001255568A1 (en) * 2000-12-29 2002-07-16 General Electric Company Method and system for identifying repeatedly malfunctioning equipment
US6735549B2 (en) * 2001-03-28 2004-05-11 Westinghouse Electric Co. Llc Predictive maintenance display system
US20020143564A1 (en) * 2001-04-03 2002-10-03 Webb Brett M. Website for household inventory and maintenance with reminder system and method
US20020156692A1 (en) * 2001-04-20 2002-10-24 Squeglia Mark R. Method and system for managing supply of replacement parts of a piece of equipment
US6985803B2 (en) * 2001-05-30 2006-01-10 General Electric Company System and method for monitoring the condition of a vehicle
US20030036939A1 (en) * 2001-07-20 2003-02-20 Flores Abelardo A. Method and system configure to manage a maintenance process

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004097024A1 (en) * 2003-04-28 2004-11-11 Swetree Technologies Ab Tissue specific promoters
US8129588B2 (en) 2004-04-20 2012-03-06 Syngenta Participations Ag Regulatory sequences for expressing gene products in plant reproductive tissue
US8597913B2 (en) 2004-04-20 2013-12-03 Syngenta Participations Ag Method of constructing an expression cassette comprising regulatory sequences of a target gene of a plant for expressing gene products
US20070006344A1 (en) * 2004-04-20 2007-01-04 Syngenta Participations Ag Regulatory sequences for expressing gene products in plant reproductive tissue
US20100071092A1 (en) * 2004-04-20 2010-03-18 Syngenta Participations Ag Methods and genetic constructs for modification of lignin composition of corn cobs
US9238818B2 (en) 2004-04-20 2016-01-19 Syngenta Participations Ag Methods and genetic constructs for modification of lignin composition of corn cobs
US8679844B2 (en) 2004-04-20 2014-03-25 Syngenta Participations Ag MADS gene regulatory sequences for expressing gene products in plant reproductive tissue
WO2006040685A3 (en) * 2004-10-15 2006-12-28 Swetree Technologies Ab Methods for improving tree growth and wood properties
EP2045327A2 (en) 2005-03-08 2009-04-08 BASF Plant Science GmbH Expression enhancing intron sequences
EP2166102A2 (en) 2005-03-08 2010-03-24 BASF Plant Science GmbH Expression enhancing intron sequences
EP2166100A2 (en) 2005-03-08 2010-03-24 BASF Plant Science GmbH Expression enhancing intron sequences
EP2166099A2 (en) 2005-03-08 2010-03-24 BASF Plant Science GmbH Expression enhancing intron sequences
EP2166101A2 (en) 2005-03-08 2010-03-24 BASF Plant Science GmbH Expression enhancing intron sequences
US20060260011A1 (en) * 2005-03-28 2006-11-16 Syngenta Participations Ag Methods and genetic constructs for modification of lignin composition of corn cobs
US7968764B2 (en) * 2005-05-02 2011-06-28 Purdue Research Foundation Methods for increasing the yield of fermentable sugars from plant stover
US20120058524A1 (en) * 2005-05-02 2012-03-08 Purdue Research Foundation Methods for increasing the yield of fermentable sugars from plant stover
US8921648B2 (en) * 2005-05-02 2014-12-30 Purdue Research Foundation Methods for increasing the yield of fermentable sugars from plant stover
US20060263860A1 (en) * 2005-05-02 2006-11-23 Vermerris Willem E Methods for increasing the yield of fermentable sugars from plant stover
US8536406B2 (en) 2008-04-28 2013-09-17 Michigan Technological University COMT1 gene fiber-specific promoter elements from poplar

Also Published As

Publication number Publication date
CN1473198A (en) 2004-02-04
IL154759A0 (en) 2003-10-31
US7514596B2 (en) 2009-04-07
ZA200301785B (en) 2004-03-04
JP4871487B2 (en) 2012-02-08
WO2002020717A2 (en) 2002-03-14
EP1320617A1 (en) 2003-06-25
CA2421215A1 (en) 2002-03-14
JP2004515224A (en) 2004-05-27
JP2004520015A (en) 2004-07-08
IL154760A0 (en) 2003-10-31
BR0113699A (en) 2004-06-08
US20020078474A1 (en) 2002-06-20
US6812377B2 (en) 2004-11-02
AU2001288716A1 (en) 2002-03-22
WO2002020717A3 (en) 2009-06-11
IL154759A (en) 2009-08-03
AU2001288765C1 (en) 2002-03-22
EP1320617A4 (en) 2005-01-19
BR0113654A (en) 2003-09-23
US20050166283A1 (en) 2005-07-28
AU2001288765B2 (en) 2006-04-27
US6855864B2 (en) 2005-02-15
IL154760A (en) 2011-01-31
AR030616A1 (en) 2003-08-27
AR030615A1 (en) 2003-08-27
WO2002020812A1 (en) 2002-03-14
AU2001288716A8 (en) 2009-07-30
AU8876501A (en) 2002-03-22
US20020124281A1 (en) 2002-09-05

Similar Documents

Publication Publication Date Title
US7514596B2 (en) Methods for simultaneous control of lignin content and composition, and cellulose content in plants
US6489538B1 (en) Method for regulation of plant lignin composition
US6610908B1 (en) Manipulation of lignin composition in plants using a tissue-specific promoter
AU2001288765A1 (en) Genetic engineering of syringyl-enriched lignin in plants
EP1034283A2 (en) Genetic engineering of lignin biosynthesis in plants
Ipekçi et al. Reduced leaf peroxidase activity is associated with reduced lignin content in transgenic poplar
US7288409B1 (en) Method of introducing a plurality of genes into plants
EP1305420B1 (en) Modification of fructan biosynthesis
WO2006021558A2 (en) A plant with reduced lignin by modulating dahps gene expression
EP2292777B1 (en) Transgenic sweet sorghum with altered lignin composition and process of preparation thereof
US7288696B2 (en) Genetic engineering of syringyl-enriched lignin in plants
AU746458B2 (en) A method for regulation of plant lignin composition
AU2005274622A1 (en) Polynucleotides, DNA constructs and methods for the alteration of plant lignin content and/or composition
MXPA98005066A (en) Method for regulating a composition of lignina vege
US20110145951A1 (en) Transgenic sweet sorghum with altered lignin composition and process of preparation thereof
GRIMA-PETTENATI et al. LIGNIFICATION GENES IN EUCALYPTUS: CHARACTERIZATION, EXPRESSION AND

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION