WO2006021558A2

WO2006021558A2 - A plant with reduced lignin by modulating dahps gene expression

Info

Publication number: WO2006021558A2
Application number: PCT/EP2005/054129
Authority: WO
Inventors: Anders Jensen Boegh
Original assignee: Poalis A/S
Priority date: 2004-08-26
Filing date: 2005-08-23
Publication date: 2006-03-02
Also published as: WO2006021558A3; EP1802768A2

Abstract

A plant or plant cell that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue of the plant. The plant may have reduced amount of lignin.

Description

TITLE: A plant with reduced lignin by modulating DAHPS gene expression.

FIELD OF THE INVENTION:

The invention relates to a plant or plant cell that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue of the plant. The plant may have reduced amount of lignin.

BACKGROUND OF THE INVENTION:

The most important constraint on the digestion of plant cell walls is lignin. Lignification of forage tissues limits the amount of digestible energy available to livestock, resulting in an incomplete utilization of cellulose and hemicellulose by ruminant animals.

Lignins are complex phenolic polymers present in all vascular plants. They provide rigidity to conducting xylem elements and fiber cells. Lignins are composed Of C₆C₃ units, principally p- hydroxyphenyl (H), guaiacyl (G), and syringyl (S) units, and are present in various proportions according to botanical, physiological, andcytological criteria. Throughout the plant kingdom, grass lignins appear to be particularly specialized because they contain not only H, G, and S units, but also additionalp-hydroxycinnamic units such as/7-coumaric and ferulic acids. Ferulic acid may be ester linked to wall polysaccharides and/or ether linked to G units, thereby forming bridges between lignins and polysaccharides, whereas />-coumaric acid is primarily ester linked to S lignin units in lignified walls.

In order to obtain a monocotyledonous plant of the grass family with reduced amount of lignin, the art describes transgenic grass plants, wherein the transgenic plant (by use of anti-sense (AS) technology) expressed lower amount of enzymes that catalyzes the last steps in the biosynthesis of lignin. Examples of such enzymes are caffeic acid O-methyltransferase (COMT) and cinnamyl alcohol dehydrogenase (CAD). For illustration see figure 1 herein. For instance (Chen L. et al, Plant Biotechnology Journal (2003) 1, pp. 437^449) describes a transgenic forage grass (tall fescue) with reduced CAD activity and with decreased lignin content. The transgenic grass has a 7.2 to 9.5 increased dry matter digestibility. The article (Piquemal J. et al, Plant Physiol, December 2002, Vol. 130, pp. 1675-1685) describes transgenic maize with reduced COMT activity and with decreased lignin content.

Compared to the monocotyledonous grass family plants, lignification in dicotyledons has been more extensively studied and most of the known lignin biosynthetic genes have been employed in genetic engineering experiments. For review, see (Grima-Pettenati J, Goffner D (1999) Lignin genetic engineering revisited. Plant Sci 145: 51-65). Although lignification in grass species is likely to share a high degree of similarity to other angiosperms, the aforementioned structural specificity of grass cell walls may also involve a certain degree of grass-specific regulatory mechanisms. Different studied dicot plant species include tobacco, tomato, potato and Arabidopsis thaliana.

The enzyme 3-deoxy-7-phosphoheptulonate (DAHP) synthase (EC 2.5.1.54) (Formerly EC 4.1.2.15) is the first enzyme of the Shikimate pathway leading to biosynthesis of the aromatic amino acids. The Shikimate pathway relates to the ability to synthesize aromatic amino acids de novo in bacteria, fungi, and plants (see figure 1 herein). In plants, the aromatic amino acids Phenylalanine (Phe), Tyrosine (Tyr) and Tryptophan (Trp) are not only building blocks for protein synthesis but are also precursors for phenylpropanoid and indole derivatives. These secondary compounds include hormones like indole acetic acid, pigments like anthocyanins, antimicrobial compounds like phytoalexins, and lignin, which play a vital role in plant defense, wound healing and maintaince of structural integrity and water transport capacity.

The fact that physical wounding may induce some DAHP genes has been investigated in the dicot plants, tomato (Gorlach, J. et al, PNAS (1995) pp. 3166-3170) and Arabidopsis thaliana (Keith, B., PNAS (1991), pp. 8821-8825). These articles also explain that these dicot plants comprise two different DAHP genes. One is inducible by wounding and one is not inducible (constitutive expressed). The article (Jones, J. et al, Plant Physiol. (1995) 108: 1413-1421) describes transgenic potato (dicot) plants with reduced level of DAHP synthase. The plants are made by use of anti-sense (AS) technology. Some of the potato plants with the anti-sense construct had reduced stem lignification. Figure 2, page 1415 of the article shows that untransformed (UT) plants had the same steady-state levels of DAHP synthase mRNA in shoot and stem vegetative tissues. In other words, the article indicates that there is no significant change in the DAHP synthase mRNA levels between different vegetative tissues.

In summary, for dicot plants such as tomato and potato is has been demonstrated that these plants comprise physical wounding inducible DAHP genes. However, it has not been described that specific DAHP synthases are expressed in significantly higher amounts in stem tissue in plants grown under normal natural conditions.

Further, in monocot plants such as plants of the grass family, there has not been published relevant information with respect to herein relevant effects of down regulating DAHP synthases and with respect to preparing grass plants with reduced lignin. However, numerous publications describe strategies oriented towards enzymes that catalyze the last steps in the biosynthesis of lignin, such as caffeic acid O-methyltransferase (COMT) and cinnamyl alcohol dehydrogenase

(CAD).

SUMMARY OF THE INVENTION:

The problem to be solved by the present invention is to provide a transgenic plant that may have reduced lignin production.

The solution is based on that the present inventors have analysed plants in details and found that different tissues of plants expressed different amounts of specific DAHP synthases. Further, it was identified that some specific DAHP synthases were expressed in significantly higher amounts in stem tissue, when the plant were grown under normal natural conditions (e.g. without specific physical wounding). See working examples herein. Plant stem tissue is known to be a tissue with particular high amount of lignin. Identification of specific DAHP synthases that are expressed in significantly higher amounts in stem tissue may be done in a number of ways. A suitable way is to first identify different DAHP synthase DNA sequences of a plant of interest and then measure expressed mRNA levels in different tissues (e.g. root and stem tissues). Based on this one can determine one or more DAHP synthases that are expressed in significantly higher amounts in stem tissue. Determination of mRNA levels may e.g. be performed by Northern Blotting or quantitative PCR. See e.g. working examples herein for an illustrative example in the forage grass tall fescue.

Based on this information, it is possible to create a transgenic plant that may have reduced amount of lignin by making a transgenic plant, wherein the amount of a DAHP synthase, expressed in high amounts in stem tissue, is reduced. This may e.g. be done by anti-sense technology, wherein a DNA construct expressing a specific gene for the DAHP gene in anti- sense orientation is introduced into the plant. Alternatively, specific deletions in the relevant DAHP gene may be made to obtain a plant that does not express the relevant DAHP gene. The specific way of doing it is not essential and it may also be done in other ways as further discussed herein.

As illustrated in figure 1 herein the solution of the present invention, which relates to down regulation of specific DAHP synthases that are relatively highly expressed in stem tissue, is significantly different from the prior art solutions. In order to obtain e.g. a grass plants with reduced lignin, the prior art strategies have focussed on down regulating enzymes that catalyzes the last steps in the biosynthesis of lignin, such as COMT and CAD.

Contrary, to these earlier strategies, the present invention is based on a strategy that is focussed on decreasing the quantity of basis material (aromatic amino acids) for lignin production in specific relevant tissue (in particular stem and leaf tissue). A further advantage of decreasing the amount of specific DAHP synthases is that the amount of digestible sugar could subsequently increase in the plant. See figure 1 for an illustration.

Accordingly, a first aspect of the invention relates to a method for identifying a 3-deoxy-7- phosphoheptulonate (DAHP) synthase that is expressed in relatively high amounts in stem tissue of a plant comprising the following steps: (i): identifying DNA encoding sequences of two or more different DAHP synthase genes of the plant;

(ϋ): isolating stem tissue of the plant wherein the tissue is isolated during the elongation growth stage of the plant and where the plant is grown under normal natural growth conditions of the plant;

(ϋi): measuring the mRNA level of the DAHP synthases in the stem tissue; (iv): comparing the mRNA levels of the DAHP synthases and identify a DAHP synthase wherein the mRNA level of the DAHP synthase in the stem tissue is higher than the mRNA level of a different DAHP synthase of the same plant.

In short, in the broadest interpretation of this method, one may identify a DAHP synthase gene that in stem tissue is higher expressed compared to at least one other DAHP synthase gene of the same plant. As described below, if one identifies three, four or more different DAHP synthase gene one may identify a DAHP synthase gene that is the relatively highest expressed in stem tissue.

The term "DNA encoding sequences" of step (i) may be fragments of the DAHP synthase genes. As understood by the skilled person one needs not to have the complete gene to perform the method. Fragments would be enough if the fragments are sufficient long to e.g. form basis for making adequate probes or primers to measure the mRNA level as described in the method.

The term "elongation growth stage of the plant" relates to a growth phase of the plant where the plant elongates and makes a relatively high amount of lignin in order to make the relevant structures and tissues of the plant such as the stem tissue. This growth phase is discussed further below and it is within the general skills of the skilled person to identify when a relevant plant is in this growth phase.

The term "where the plant is grown under normal natural growth conditions of the plant" relates to an objective of the invention, which is to identify DAHP genes, which are specifically high expressed in stem tissue under such natural growth conditions of the plant (e.g. without specific physical wounding of the plant). Natural growth conditions relates to temperature, humidity and etc that give a normal natural growth of the plant, such as conditions that correspond to conditions for industrial (e.g. agricultural) relevant growth of the plant. It is within the skilled person general knowledge to identify such natural growth conditions.

Once having identified a DAHP synthase that is expressed in relatively high amounts in stem tissue it is within the skilled person's common knowledge to make a plant cell wherein expression of the identified DAHP is decreased.

Accordingly, a second aspect of the invention relates to a process for making a plant cell that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue of the plant comprising:

(i): modifying the genome of the cell in a way that, after regeneration of the cell to get a plant, causes a stable reduction in the amount of mRNA level of the DAHP synthase, wherein the DAHP synthase is identifiable by a method for identifying a DAHP synthase that is expressed in relatively high amounts in stem tissue of a plant of the first aspect of the invention and as further described herein; and (ϋ) isolating the cell with the stable modification of the genome.

The term "stable modification of the genome" relates to that the genomic modification is stably maintained for generations of the plant cell and also maintained in a plant regenerated from the plant cell.

The term "identifiable" in relation to DAHP synthase that is expressed in relatively high amounts in stem tissue shall be understood in accordance with the normal literal meaning of the word "identifiable". In other words, a DAHP synthase is a DAHP synthase that is expressed in relatively high amounts in stem tissue if the DAHP synthase fulfils the screening criteria of the method for identifying a DAHP synthase of the first aspect of the invention and as further described herein. One may identify the DAHP synthase in another way. However, if tested positive in accordance with the method for identifying a DAHP synthase as described herein it is a herein understood that it is a DAHP synthase that is expressed in relatively high amounts in stem tissue. As explained above, in the broadest interpretation of the method of the first aspect, one may identify a DAHP synthase gene that in stem tissue is higher expressed compared to at least one other DAHP synthase gene of the same plant. Said in another way, a DAHP synthase identifiable by the method of the first aspect can not be the DAHP synthase of the plant that has the lowest expression in the stem tissue, but it may be a DAHP synthase that has the second lowest expression in the stem tissue. For instance, if three different DAHP synthase genes are identified in the plant it may be the second lowest expressed DAHP synthase gene. Besides modifying the genome to get the stable reduction in the amount of mRNA level of the DAHP synthase that is expressed in relatively high amounts in stem tissue one may also modify the genome to affect expression of other DAHP synthase genes of the plant, including all DAHP synthase genes of the plant.

A third aspect of the invention relates to a plant cell that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue obtainable by a process for making such a plant cell of the second aspect of the invention and as further described herein.

A plant cell of the third aspect that is obtainable by a process for making such a plant cell of the second aspect of the invention will have the described stable genomic modification as a structural characteristic that differentiates it from e.g. the corresponding natural cell. Accordingly, as a product the plant cell as such may be seen as a non-natural cell that is genetically modified and thereby different from e.g. the corresponding natural cell.

Once having made the plant cell it is routine work to use this cell to regenerate the plant as such.

Accordingly a fourth aspect of the invention relates to a process for obtaining a plant that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue comprising regeneration of the plant from the plant cell of the third aspect of the invention and as further described herein to obtain the plant. A fifth aspect of the invention relates to a plant that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue of the plant obtainable by a process for obtaining a plant of the fourth aspect of the invention and as further described herein.

As for the plant cell of the third aspect the regenerated plant as such, of the fifth aspect, will have the described stable genomic modification as a structural characteristic that differentiates it from e.g. the corresponding natural plant. Accordingly, as a product the plant as such may be seen as a non-natural plant that is genetically modified and thereby different from e.g. the corresponding natural plant.

As described above, the genetically modified plant as described herein may comprise less lignin as compared to the same plant without the stable modification of the genome and this is a an advantage with respect to e.g. improved digestibility of the plant when e.g. used as a feed for an animal.

Accordingly, a sixth aspect of the invention relates to use of the plant of the fifth aspect of the invention and as further described herein as a feed for an animal.

Depending on the specific type of the plant the precise way of using it as animal feed may vary.

For instance, if the plant is e.g. a forage grass such as tall fescue the forage grass plant may simply be growth on a field where e.g. ruminant animal are present. If the plant is e.g. maize, it may be preferred that the maize plant first is grown and then harvested to be used to make an ensilage like feed. Ensilage feed is generally understood as fodder harvested while green and kept succulent by partial fermentation in some way and then used as a concentrated feed source e.g. as tablets.

DEFINITIONS: Prior to a discussion of the detailed embodiments of the invention is provided a definition of specific terms related to the main aspects and embodiments of the invention. All terms are defined in accordance with the skilled person's normal understanding of the terms.

The term a "chimeric DNA construct" refers to a DNA construct comprising heterogeneous regulatory and coding sequences of a gene.

The term "DAHP synthase" refers to the enzyme 3-deoxy-7-phosphoheptulonate (DAHP) synthase (EC 2.5.1.54) (Formerly EC 4.1.2.15). It is the first enzyme of the Shikimate pathway. The first seven steps of the Shikimate pathway may also be termed the prechorismate pathway. The Shikimate pathway relates to the ability to synthesize aromatic amino acids de novo in bacteria, fungi, and plants (see figure 1 herein). DAHP synthase catalyzes the reaction:

Phosphoenolpyruvate + D-erythrose 4-phosphate + H₂O

<=>

3 -deoxy-D-erythro-hept-2-ulosonate 7-phosphate + phosphate

The activity of the enzyme may be determined according to the art as described in (Jones, J. et al, Plant Physiol. (1995) 108: 1413-1421) page 1414, column 2, last paragraph under section "Protein Extraction, DAHP synthase Enzyme Activity...".

The term "dicot" refers to plants in which the developing plant has two seed leaves or cotyledons.

The term "elongation growth stage of the plant" denotes the stage during which culm or stem elongation occurs and is often referred to as jointing. Sub-stages of the elongation stage are defined by the number of nodes that have become either palpable or visible as the result stem elongation. The elongation stage ceases when the inflorescence is enclosed in the uppermost leaf sheath, which is commonly referred to as boot stage. The elongation stage is followed by the reproductive stage, which begins with emergence of the inflorescence and continues through anthesis and fertilization. For further details reference is made to the review article (Moore KJ. et al, "Describing and quantifying growth stages of perennial forage grasses", Agron. J. 83:1073- 5 1077 (1991)).

The term an "endogenous gene" refers to the native gene normally found in its natural location in the genome.

0 The terms "encoding" and "coding" refer to the process by which a gene, through the mechanisms of transcription provides the information to a cell from which an mRNA may be transcribed. The mRNA may then in some cases, by the mechanism of translation, be translated into a specific amino acid sequence to produce a protein such as an enzyme. However, it is not always the case. For instance, if the mRNA is anti-sense mRNA there is generally no translation 5 into a protein.

The term "Gene" refers to a nucleic acid fragment that can be transcribed into a mRNA, including regulatory sequences preceding (5' non-coding) and following (3' non-coding) the coding region. 0

The term "forages" denotes food for animals especially when taken by browsing or grazing.

The term "lignin" refers to hydroxyphenyl (H), guaiacyl(G) and syringyl(S) units found in lignified plant tissue. 5

The term "monocot" refers to plants in which the developing plant has only one seed-leaf or cotyledon.

The term "operable linked" refers to nucleic acid sequences on a single nucleic acid molecule 0 which are associated so that the function of one is affected by the other. The term "plant" includes whole plants, portions of plants or plant organs (e. g., roots, stems, leaves, etc.).

The term "plant cell" denotes a cell, which after proper regeneration (growing) may give rise to a plant.

The term "promoter" refers to a DNA sequence in a gene, usually upstream (5¹) to its coding sequence, which controls the expression of the coding sequence by providing the recognition site for RNA polymerase and other factors required for proper transcription. A promoter may also contain DNA sequences that are involved in the binding of protein factors, which control the effectiveness of transcription initiation in response to physiological or developmental conditions.

The term "regulatory sequences" refer to nucleotide sequences located upstream (5¹), within, and/or downstream (3¹) of a coding sequence, which control the transcription and/or expression of the coding sequences in conjunction with the protein biosynthetic apparatus of the cell. These regulatory sequences include promoters, translation leader sequences, transcription termination sequences, and polyadenylation sequences.

The term "Transgene" or "foreign gene" refers to a gene not normally found in the host organism but one that is introduced by gene transfer. The transgene may be a natural gene from another species than the host or e.g. be a non-natural gene sequence such as e.g. a specifically constructed anti-sense sequence.

The term "Transgenic plant" or "Transgenic plant cell" denote a plant or a plant cell, which in its genome comprise a transgene.

The term "Transformation" refers to the transfer of a foreign gene into the genome of a host organism and its genetically stable inheritance. Examples of methods of plant transformation include Agrobacterium-mediated transformation and particle-accelerated or "gene gun" transformation technology. See below for further details.

Embodiment(s) of the present invention is described below, by way of example(s) only DRAWINGS

Figure 1: Illustration of prior art methods to obtain a monocotyledonous plant of the grass family with reduced amount of lignin, where the art describes transgenic grass plants, wherein the transgenic plant (by use of anti-sense (AS) technology) expressed lower amount of enzymes that catalyzes the last steps in the biosynthesis of lignin. Examples of such enzymes are caffeic acid O-methyltransferase (COMT) and cinnamyl alcohol dehydrogenase (CAD). As shown in the figure, contrary to these earlier strategies, the present invention is based on a strategy that is focussed on decreasing the quantity of basis material (aromatic amino acids) for lignin production in specific relevant tissue (in particular stem and leaf tissue). A further advantage of decreasing the amount of specific DAHP synthases is that the amount of digestible sugar could subsequently increase in the plant.

Figure 2: Characterization of total DAHP synthases expression levels in different tissue of tall fescue. The results demonstrated that DAHP synthase mRNA only accumulates to very low levels in tall fescue root tissue whereas slightly higher levels were observed in young and old leaves. In contrast, DAHP synthase mRNA accumulates to a much higher levels stem tissue suggesting that higher amounts of aromatic amino acids are produced in stem tissue. For further details see working example 2 herein.

Figure 3: Characterization of specific DAHP synthases expression profiles in different tissue of tall fescue. The results demonstrate that the DAHP synthase 5 accumulates to nearly similar levels in two and six weeks old leaves and in stem tissue. In contrast, only a very week accumulation could be detected in two weeks old roots. A similar expression pattern was observed for DAHP synthase 6 except a significantly lover mRNA accumulation was detected in stem and roots as compared to DAHP synthase 5. Interestingly, DAHP synthase 4 mRNA accumulated to much higher levels in stem tissue of tall fescue than in young leaves and roots where only a very week accumulation could be observed by increasing the number of PCR cycles from 28 cycles for DAHP synthase 4 and 5 to 32 PCR cycles used for comparing expression levels of DAHP synthase 4 and 6. For further details see working example 3 herein. DETAILED DESCRIPTION OF THE INVENTION:

A method for identifying a DAHP synthase relatively highly expressed in stem tissue

As explained above, the objective of this method is to identify a DAHP synthase relatively highly expressed in stem tissue. In this context the term "relatively" shall be seen in relation to at least one another DAHP synthase of the plant.

Accordingly, the method requires identification of at least two different DAHP synthases of the plant. Based on common knowledge and for instance the fact that numerous DAHP synthases DNA sequences are known to the skilled person it is routine work for the skilled person to identify different DAHP synthase gene sequences in a plant of interest.

Isolation of stem tissue and other relevant tissue, during the elongation growth stage of the plant, is routine work for the skilled person.

Determination of mRNA levels may e.g. be done by RNA gel blot assays or quantitative PCR. This is routine work for the skilled person. See e.g. working examples herein for an illustrative example in the forage grass tall fescue.

A final step of the method relates to comparing the mRNA levels of the DAHP synthases and identify a DAHP synthase wherein the mRNA level of the DAHP synthase in the stem tissue is higher than the mRNA level of a different DAHP synthase of the same plant.

This is routine work for the skilled person and may be done quantitatively. See e.g. working examples herein. Accordingly, an embodiment of the invention relates to step (iv) of the method of the first aspect of the invention, wherein the mRNA level of the DAHP synthase in the stem tissue is at least 1.5 times higher than the mRNA level of a different DAHP synthase of the same plant, more preferably, wherein the mRNA level of the DAHP synthase in the stem tissue is at least 2 times higher than the mRNA level of a different DAHP synthase of the same plant and even more preferably, wherein the mRNA level of the DAHP synthase in the stem tissue is at least 3 times higher than the mRNA level of a different DAHP synthase of the same plant.

In a preferred embodiment there is also isolated root tissue from the plant. This root tissue is used in the method and a preferred DAHP synthase is a DAHP that is expressed in relatively high amounts in stem tissue but not expressed in comparative higher amount in the root tissue.

Accordingly, a preferred embodiment of the invention is, wherein in step (ii) there is also isolated root tissue during the elongation growth stage of the plant, in step (iii) the mRNA level of the DAHP synthases are measured in both tissues and the identified DAHP synthase that is expressed in relatively high amounts in stem tissue, of step (iv), has a mRNA level in root tissue that is not higher than the different DAHP synthase(s) used for comparison of the mRNA level in stem tissue; and/or a preferred embodiment of the invention is, wherein in step (ii) there is also isolated root tissue during the elongation growth stage of the plant, in step (iii) the mRNA level of the DAHP synthases are measured in both tissues and the identified DAHP synthase that is expressed in relatively high amounts in stem tissue, of step (iv), is a DAHP synthase wherein the amount of mRNA of the DAHP synthase in the stem tissue is at least 10% higher than in the root tissue. More preferably, the amount of mRNA of the DAHP synthase in the stem tissue is at least 25% higher than in the root tissue, even more preferably the amount of mRNA of the DAHP synthase in the stem tissue is at least 75% higher than in the root tissue and most preferably the amount of mRNA of the DAHP synthase in the stem tissue is at least 200% higher than in the root tissue. This is preferably analyzed by quantitative PCR as known to the skilled person.

As described above the method requires identification of at least two different DAHP synthase genes. However, one may of coerce identify more different DAHP genes and then use all of these to identify the ones that are expressed to highest levels in stem tissue.

Accordingly, a preferred embodiment of the invention is, wherein there in step (i) is identified three, four, five, six or more different DAHP synthase genes and the identified DAHP synthase with high mRNA level in the stem tissue is the DAHP synthase with highest mRNA level in the stem tissue. A further embodiment is, wherein the identified DAHP synthase with high mRNA level in the stem tissue has a mRNA level in root tissue that is not higher than any of the different DAHP synthase used for comparison of the mRNA level in stem tissue.

Plant or plant cell

The plant or plant cell may in principle be any plant including trees.

The plant may be a dicotyledons (dicot) plant from the family Magnoliopsida. A preferred dicot plant is a dicot plant selected from the group consisting of tobacco, tomato, potato, lucerne, lettuce, cotton, cabbage, mustard and Arabidopsis thaliana.

Within this list, a most preferred dicot plant is a dicot plant selected from the group consisting of tomato, potato and lucerne.

In a preferred embodiment, the plant is a tree. A preferred tree is a plant selected from the family Magnoliopsida such as, the family Liliopsida such as palm trees or from the group of cornifers such as pine and spruce trees.

A more preferred plant is a monocotyledonous plant, wherein a most preferred plant is a plant or a plant cell of the grass family.

The term "Grass family" should herein be understood according to the art. It denotes a plant family (Poaceae, formerly Graminaeae) of monocotyledonous mostly herbaceous plants with jointed stems, slender sheathing leaves, and flowers borne in spikelets of bracts. The grass family includes plants such as a grass (e.g. a forage grass such as tall fescue), the cereals such as maize, wheat, oats, barley, rye, corn, sorghum, rice, triticale or millet and bamboo.

Preferably, the plant or plant cell of the grass family, is a plant or plant cell selected from the group consisting of: a grass of the family Poaceae (e.g. a forage grass such tall fescue), and a cereal such as a maize, a wheat, an oat, a barley, a rye, a corn, a sorghum, a rice, a triticale and a millet.

Within this group, a preferred plant is maize or rice and a particular preferred plant is a forage grass such as in particular the forage grass tall fescue (Festuca arundinaced).

Preferred grass species include a ryegrass (Lolium species) or fescue (Festuca species).

Preferred rice species include the genus Oryza. Preferred wheat species include the genus Triticum

Preferred oat species include the genus Avena.

Preferred maize species include the genus Zea.

A process for making a plant cell with a genome modification:

An essential step of the process for making a plant cell with a genome modification of the second aspect of the invention is step (i) that relates to: modifying the genome of the cell in a way that, after regeneration of the cell to get a plant, causes a stable reduction in the amount of mRNA level of the DAHP synthase, wherein the DAHP synthase is identifiable by a method for identifying a DAHP synthase that is expressed in relatively high amounts in stem tissue of a plant of the first aspect and as further described herein.

The herein described DAHP synthase that is specifically expressed in the lignin producing stem tissue may also be relatively highly expressed in other tissue such as preferably in leaf, spikelts, in the husk surrounding the seed or in the ear of maize.

The genome modification may be done in different ways as known to the skilled person.

A preferred way is by use of the so-called anti-sense technology or or RNA interference technology. Accordingly, a preferred embodiment of the invention is, wherein the modification of the genome is done by anti-sense technology comprising incorporation of a chimeric DNA construct into the genome, wherein the chimeric DNA construct comprises a heterogeneous regulatory sequence operable linked in anti-sense orientation to a coding sequence of the DAHP gene making the cell capable of translating an anti-sense mRNA fragment that within the cell can hybridize to the mRNA of the DAHP synthase. 5

The anti-sense technology is well described in the art and is also further described herein.

An alternative strategy is, wherein the modification of the genome is done by making a deletion or other modification within the DAHP gene. As a convenient tool for creating such deletions,

10 insertional mutagenesis by transposable elements or T-DNA tagging has been used successfully. In forward genetic screens, the DNA causing gene disruption marks the respective locus and subsequently can be used as a molecular probe to isolate a defined gene. Transposable elements, such as Mu, AdDs and En/Spm of Zea mays, Tarn of Antirrhinum majus, and dTph of Petunia hybrida, have been applied for gene tagging in their native hosts, and AdDs and En/Spm also

15 were engineered to function in heterologous hosts. For reverse genetics, gene disruption systems based on Mu or T-DNA has been developed, and PCR-based strategies have been used for the identification of insertion alleles of particular gene loci.

For further details reference is made to (Proc. Natl. Acad. Sci. USA, (1998), 13:95(21:12432- 12437).

20 A recent developed alternative strategy is, wherein the modification of the genome is done by introducing single mutations within the DAHP synthase. This strategy is designated Targeting induced local lesions in genomes (TILLING), which is a general reverse-genetic approach that provides an allelic series of induced point mutations in genes of interest (Till et al 2003, Genome Research 13:524-530). Tilling is a method combining random chemical mutagenesis with PCR-

25 based screening to identify point mutations in regions of interest. In such a way, inactivation of DAHP synthase gene might be identified by mutaginizing seeds followed by amplification of the progeny. Subsequently, DNA isolation from the plants followed by PCR-based analysis could lead to identification of inactivated the same DAHP synthase genes as the ones which will be down regulated by the described antisense of RNAi technology. (Plant Physiol, June 2000, Vol.

30 123, pp. 439-442). When there herein is referred a "stable reduction in the amount of mRNA level of the DAHP synthase that is expressed in relatively high amounts in stem tissue" there is preferably referred to the reduction of the amount of mRNA level in leaf and/or stem tissue.

Said in another way, the DAHP synthase that is expressed in relatively higher amount in the stem tissue is preferably down regulated in the leaf and stem tissue. The DAHP may be present in normal amount in other tissues of the plant such as root, flower etc.

Such a specific down regulation in leaf and/or stem tissue may be achieved by use of adequate regulatory sequences that directs transcription preferably to lignifying leaf and stem tissue. Such regulatory sequences are known in the art and suitable examples are the Adhi promoter from maize, which directs expression to the vascular tissues and lignifying sclerenchyma (Piquemal et al 2002. Plant Physiol. 130, 1675-1685), the CCR promoter from Lolium perenne (patent WO 02/50294 Al) or the 4CL, OMT and CAD promoters from Lolium perenne (Patent WO 01/95702 Al).

In a preferred embodiment, the genomic modification causes a stable at least 2 times reduction in the amount of mRNA level of the DAHP synthase that is expressed in relatively high amounts in stem tissue as compared the corresponding regenerated plant without the genomic modification, more preferably the genomic modification causes a stable at least 4 times reduction, even more preferably a stable at least 6 time reduction and most preferably the genomic modification causes a stable at least 10 times reduction in the amount of mRNA level of the DAHP synthase that is expressed in relatively high amounts in stem tissue as compared the corresponding regenerated plant without the genomic modification.

In a further embodiment, DAHP synthase specifically expressed in the lignin producing stem tissue as described herein is a DAHP synthase wherein the amount of mRNA of the DAHP synthase in the stem tissue is at least 10% higher than in the root tissue. More preferably, the amount of mRNA of the DAHP synthase in the stem tissue is at least 25% higher than in the root tissue, even more preferably the amount of mRNA of the DAHP synthase in the stem tissue is at least 75% higher than in the root tissue and most preferably the amount of mRNA of the DAHP synthase in the stem tissue is at least 200% higher than in the root tissue. This is preferably analyzed by quantitative PCR as known to the skilled person. One advantage of targeting a DAHP synthase specifically expressed in the lignin producing stem tissue as described herein is that one may get a plant where this DAHP is mainly targeted and other DAHP synthases of the plant functions in a general normal way.

Accordingly, a preferred embodiment of the invention is, wherein the genomic modification does not significantly affect the natural mRNA expression level of at least one other DAHP synthase of the regenerated plant. In such a case it may be preferred to use a constitutive promoter to drive the expression of e.g. the antisense sequence specific for the DAHP synthase of interest.

In an even more preferred embodiment, the genomic modification essentially only affect the mRNA expression level of the DAHP synthase that is expressed in relatively high amounts in stem tissue as described herein.

An advantage of mainly down regulating the specific DAHP that are highly expressed in stem tissue is that other DAHP genes of the plants functions in a normal way. If one down regulates all DAHP genes of the plant there is a greater risk to get a negative unwanted influence on the e.g. growth and development of the plant.

Alternatively, one may make a genomic modification that decrease expression of essential all DAHP synthase genes of the plant. In such a case it may be preferred to use a tissue specific promoter mainly active in only lignifying tissue. If antisense technology, one could here use a sequence common to all DAHP synthase genes one wants to affect.

Making such targeted reduction of mRNA expression levels of specific genes is routine work for the skilled person. A suitable strategy is RNA interference anti-sense technology where short (around 15-35 base pairs) anti-sense sequences are used. The short anti-sense sequences are highly specific and hybridize only to a specific target mRNA of interest. This technology is further described in working examples herein.

As described in working examples herein, was identified ten different DAHP synthase that is expressed in relatively high amounts in stem tissue of a tall fescue plant. Herein they are termed DAHPSl to 6. The corresponding SEQ ID Numbers are given below.

SEQ ID NO 1 is genomic DNA sequence of DAHPSl (termed "DAHPS 1-gDNA");

SEQ ID NO 2 is translated amino acid sequence of DAHPSl (termed "DAHPS 1-aa"); SEQ ID NO 3 is genomic DNA sequence of DAHPS2 (termed "DAHPS2-gDNA");

SEQ ID NO 4 is translated amino acid sequence of DAHPS2 (termed "DAHPS2-aa");

SEQ ID NO 5 is genomic DNA sequence of DAHPS3 (termed "DAHPS3-gDNA");

SEQ ID NO 6 is translated amino acid sequence of DAHPS3 (termed "DAHPS3-aa");

SEQ ID NO 7 is cDNA sequence of DAHPS4 (termed "DAHPS4-cDNA"); SEQ ID NO 8 is translated amino acid sequence of DAHPS4 (termed "DAHPS5-aa");

SEQ ID NO 9 is cDNA sequence of DAHPS5 (termed "DAHPS5-cDNA");

SEQ ID NO 10 is translated amino acid sequence of DAHPS5 (termed "DAHPS5-aa");

SEQ ID NO 11 is cDNA sequence of DAHPS6 (termed "DAHPS6-cDNA");

SEQ ID NO 12 is translated amino acid sequence of DAHPS6 (termed "DAHPS6-aa"); SEQ ID NO 13 is cDNA sequence of DAHPS7 (termed "DAHPS7-cDNA");

SEQ ID NO 14 is translated amino acid sequence of DAHPS7 (termed "DAHPS7-aa");

SEQ ID NO 15 is cDNA sequence of DAHPS8 (termed "DAHPS8-cDNA");

SEQ ID NO 16 is translated amino acid sequence of DAHPS8 (termed "DAHPS8-aa");

SEQ ID NO 17 is cDNA sequence of DAHPS9 (termed "DAHPS9-cDNA"); SEQ ID NO 18 is translated amino acid sequence of DAHPS9 (termed "DAHPS9-aa");

SEQ ID NO 19 is cDNA sequence of DAHPSlO (termed "DAHPS 10-cDNA");

SEQ ID NO 20 is translated amino acid sequence of DAHPSlO (termed "DAHPS 10-aa");

Consequently, in a preferred embodiment a DAHP synthase that is expressed in relatively high amounts in stem tissue of a plant, as described herein, is a DAHP synthase gene comprising a DNA sequence selected from at least one of the ten groups of DNA sequences consisting of:

/: a DNA sequence, wherein the DNA sequence is selected from the group consisting of: (a) the DNA sequence shown in positions 1-3075 in SEQ ID NO 1 (termed "DAHPS 1-gDNA"); (b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 337 of SEQ ID NO 2 (termed "DAHPSl-aa"); (c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

(d) a DNA sequence which hybridizes at high stringency with a double-stranded DNA probe comprising the DNA sequence of (a); and

(e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a);

//: a DNA sequence, wherein the DNA sequence is selected from the group consisting of: (a) the DNA sequence shown in positions 1-2989 in SEQ ID NO 3 (termed "DAHPS2-gDNA"); (b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 337 of SEQ ID NO 4 (termed "DAHPS2-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

///: a DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-2988 in SEQ ID NO 5 (termed "DAHPS3-gDNA");

(b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 337 of SEQ ID NO 6 (termed "DAHPS3-aa"); (c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

IV: a DNA sequence, wherein the DNA sequence is selected from the group consisting of: (a) the DNA sequence shown in positions 1-1011 in SEQ ID NO 7 (termed "DAHPS4-cDNA");

(b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 337 of SEQ ID NO 8 (termed "DAHPS4-aa"); (c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

V: a DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1011 in SEQ ID NO 9 (termed "DAHPS5-cDNA");

(b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1-

337 of SEQ ID NO 10 (termed "DAHPS5-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

(d) a DNA sequence which hybridizes at high stringency with a double-stranded DNA probe comprising the DNA sequence of (a); and (e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a); and

VI: a DNA sequence, wherein the DNA sequence is selected from the group consisting of: (a) the DNA sequence shown in positions 1-1011 in SEQ ID NO 11 (termed "DAHPS6- cDNA");

(b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having

DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1-

337 of SEQ ID NO 12 (termed "DAHPS6-aa"); (c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

(d) a DNA sequence which hybridizes at high stringency with a double-stranded DNA probe comprising the DNA sequence of (a); and (e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a).

5 VII: a DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1470 (preferably positions 1-1185) in SEQ ID NO 13 (termed "DAHPS7-CDNA");

10 394 of SEQ ID NO 14 (termed "DAHPS7-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

(e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) 15 but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a).

VIII: a DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1504 (preferably positions 1-1185) in SEQ ID NO 20 15 (termed "DAHPS8-CDNA");

(b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 394 of SEQ ID NO 16 (termed "DAHPS8-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

25 (d) a DNA sequence which hybridizes at high stringency with a double-stranded DNA probe comprising the DNA sequence of (a); and

(e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a). 30

Villi: a DNA sequence, wherein the DNA sequence is selected from the group consisting of: (a) the DNA sequence shown in positions 1-1466 (preferably positions 1-1185) in SEQ ID NO 17 (termed "DAHPS9-CDNA");

5 394 of SEQ ID NO 18 (termed "DAHPS9-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

(e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) 10 but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a).

X: a DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1476 (preferably positions 1-1185) in SEQ ID NO 15 19 (termed "DAHPS 10-cDNA");

(b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 394 of SEQ ID NO 20 (termed "DAHPS 10-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

20 (d) a DNA sequence which hybridizes at high stringency with a double-stranded DNA probe comprising the DNA sequence of (a); and

(e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a). 25

Within the ten groups above is preferred group IV relating to DAHPS4.

A DNA sequence that encodes a polypeptide of (b) of group / is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 2, more preferably at least 30 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 2. A DNA sequence that encodes a polypeptide of (b) of group // is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 4, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 4.

A DNA sequence that encodes a polypeptide of (b) of group /// is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 6, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 6.

A DNA sequence that encodes a polypeptide of (b) of group IV is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 8, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 8.

A DNA sequence that encodes a polypeptide of (b) of group V is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 10, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 10.

A DNA sequence that encodes a polypeptide of (b) of group VI is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 12, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 12. A DNA sequence that encodes a polypeptide of (b) of group VII is preferably at least 95% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 14, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 14.

A DNA sequence that encodes a polypeptide of (b) of group VIII is preferably at least 95% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 16, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 16.

A DNA sequence that encodes a polypeptide of (b) of group Villi is preferably at least 95% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 18, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 18.

A DNA sequence that encodes a polypeptide of (b) of group X is preferably at least 95% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 20, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 20.

For all groups, a DNA sequence of (c) is preferably at least 95% identical to the DNA sequence of (a), more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence of (c) is preferably at least 99% identical to the to the DNA sequence of (a).

For all groups it is preferred that the hybridization of (d) is done at very high stringency. This embodiment, with respect of the ten groups of DNA sequences above, is particular relevant, wherein the plant cell is a forage grass cell, in particular a tall fescue cell.

The final step (ii) of this process relates to isolating the cell with the stable modification of the genome. This shall be understood broadly in the sense that one gets an isolated clone of the cell that may be stored adequately and can be used to regenerate a plant as such when required.

Novel isolated DAHP synthases sequences

The ten different DAHP synthase DNA sequences (termed DAHPSl to 10) described above are all novel DNA sequences that hitherto not have been isolated (cloned).

Accordingly, ten separate independent aspects of the invention relate to below described ten independent groups of novel isolated DNA sequences. These separate independent aspects of the invention relate to the isolated DNA sequences as such.

/: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-3075 in SEQ ID NO 1 (termed "DAHPS 1-gDNA"); (b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 337 of SEQ ID NO 2 (termed "DAHPSl-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

(e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a).

//: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of: (a) the DNA sequence shown in positions 1-2989 in SEQ ID NO 3 (termed "DAHPS2-gDNA"); (b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 337 of SEQ ID NO 4 (termed "DAHPS2-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a); (d) a DNA sequence which hybridizes at high stringency with a double-stranded DNA probe comprising the DNA sequence of (a); and

///: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of:

337 of SEQ ID NO 6 (termed "DAHPS3-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

IV: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1011 in SEQ ID NO 7 (termed "DAHPS4-cDNA");

5 V: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of:

10 337 of SEQ ID NO 10 (termed "DAHPS5-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

(e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) 15 but which codes for a polypeptide having exactly the same amino acid sequence as the polypeptide encoded by the DNA sequence of (a); and

VI: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of: 20 (a) the DNA sequence shown in positions 1-1011 in SEQ ID NO 11 (termed "DAHPS6- cDNA");

337 of SEQ ID NO 12 (termed "DAHPS6-aa"); 25 (c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

(e) a DNA sequence which, because of the degeneracy of the genetic code is different from (a) but which codes for a polypeptide having exactly the same amino acid sequence as the

30 polypeptide encoded by the DNA sequence of (a). VII: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1470 (preferably positions 1-1185) in SEQ ID NO 13 (termed "DAHPS7-CDNA"); (b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 394 of SEQ ID NO 14 (termed "DAHPS7-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

VIII: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1504 (preferably positions 1-1185) in SEQ ID NO 15 (termed "DAHPS8-CDNA");

394 of SEQ ID NO 16 (termed "DAHPS8-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

Villi: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1466 (preferably positions 1-1185) in SEQ ID NO 17 (termed "DAHPS9-CDNA"); (b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having DAHPS activity, that is at least 90% identical to the polypeptide sequence shown in positions 1- 394 of SEQ ID NO 18 (termed "DAHPS9-aa");

X: An isolated DNA sequence, wherein the DNA sequence is selected from the group consisting of:

(a) the DNA sequence shown in positions 1-1476 (preferably positions 1-1185) in SEQ ID NO

19 (termed "DAHPS 10-cDNA"); (b) a DNA sequence that encodes a polypeptide, comprised within a longer polypeptide having

394 of SEQ ID NO 20 (termed "DAHPS 10-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

Within the ten groups above is preferred group IV relating to DAHPS4.

The term "An isolated DNA sequence", refers to a DNA sequence isolated (cloned) in accordance with standard cloning procedures used in genetic engineering to relocate a segment of DNA from its natural location to a different site where it will be reproduced. The cloning process involves excision and isolation of the desired DNA segment, insertion of the piece of DNA into the vector molecule and incorporation of the recombinant vector into a cell where multiple copies or clones of the DNA segment will be replicated. A DNA sequence that encodes a polypeptide of (b) of group / is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 2, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 2.

A DNA sequence that encodes a polypeptide of (b) of group // is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 4, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 4.

A DNA sequence that encodes a polypeptide of (b) of group V is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 10, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 10. A DNA sequence that encodes a polypeptide of (b) of group VI is preferably at least 95% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 12, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-337 of SEQ ID NO 12.

A DNA sequence that encodes a polypeptide of (b) of group VII is preferably at least 95% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 14, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 14.

A DNA sequence that encodes a polypeptide of (b) of group Villi is preferably at least 95% identical to the polypeptide sequence shown in positions 1 -394 of SEQ ID NO 18, more preferably at least 97% identical, even more preferably at least 98% identical and most preferably a DNA sequence that encodes a polypeptide of (b) is preferably at least 99% identical to the polypeptide sequence shown in positions 1-394 of SEQ ID NO 18.

For all groups it is preferred that the hybridization of (d) is done at very high stringency.

A plant obtainable by use of the genomic modified plant cell:

Once having made and isolated the genomic modified plant cell as described herein it is routine to use this cell to regenerate the plant from the plant cell to obtain the plant as such.

Regeneration relates essentially to adequate growth of the plant cell to get the plant as such.

As explained above, an advantage of reducing the amount of the stem tissue specific DAHP as described herein is that the plant comprises less lignin.

Accordingly, an embodiment of the invention relates to, wherein the plant during the elongation growth stage comprises less lignin as compared to the same plant without the stable modification of the genome that causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue.

Preferably, is the amount of lignin determined by use of the so-called Klason method. This is described in details in the reference (Knudsen, Animal Feed Science Technology 67 (1997) 319- 338).

Preferably the amount of lignin is determined by taking stem tissues from 10 individual plants during the elongation growth stage. The amount of lignin is measured and the amount of lignin in the stem tissue is then understood to be the average amount of the 10 individual plants.

Measurements of improved digestibility of the plant could be analysed as described in the references (Weisbjerg, M.R. & Hvelplund, T. 1993. Bestemmelse af nettoenergiindhold (FE_K) i ravarer og kraftfoderblandinger. Forskningsrapport nr. 3, Statens Husdyrbrugsforsøg. 39 pp. and Søegaard, K., Weisbjerg, M.R., Thøgersen, R. & Mikkelsen, M. 2001. Laboratoriemetoder til bestemmelse af fordøjelighed i grovfoder til kvasg med sasrlig vasgt pa stivelsesholdige helsasdsafgrøder. DJF Rapport Nr. 34, Husdyrbrug. 28pp).

Preferably, measured in the same way a transgenic plant of the invention as described herein also comprises less lignin in the leave tissues.

As described above, the genetically modified plant as described herein may be used as a feed for an animal.

Preferably, the animal is a ruminant animal such as a cattle, cow, goat or horse.

Below are commented on some general known matters with respect to cloning foreign genes into plant in order to make a modification of the genome of the plant. The discussion below may not be considered in any way as exhaustive with respect to the very detailed knowledge currently available to the skilled person within this field.

Construction of Chimeric Genes for the Expression in Plants.

The expression of foreign genes in plants is well-established (De Blaere et al. (1987) Meth. Enzymol. 143:277-291). The expression at an appropriate level may require the use of different chimeric DNA constructs utilizing different promoters. The origin of the promoter chosen to drive the expression of the coding sequence is not critical as long as it has sufficient transcriptional activity to accomplish the invention by expressing translatable mRNA for the gene in the desired host tissue. Preferred promoters are discussed below.

Expression (transformation) of Genes in Plants

Various methods of introducing a DNA sequence (i.e., of transforming) into eukaryotic cells of higher plants are available to those skilled in the art (see EPO publications 0 295 959 A2 and 0 138 341 Al). Such methods include those based on transformation vectors based on the Ti and Ri plasmids of Agrobacterium spp. It is particularly preferred to use the binary type of these vectors. Ti-derived vectors transform a wide variety of higher plants, including monocotyledonous and dicotyledonous plants. Other transformation methods are available to those skilled in the art, such as direct uptake of foreign DNA constructs [see EPO publication 0 295 959 A2], techniques of electroporation [see Fromm et al. (1986) Nature (London) 319:791] or high- velocity ballistic bombardment with metal particles coated with the nucleic acid constructs (see Kline et al., Nature (London) 327:70 (1987), and see U.S. Pat. No. 4,945,050). Once transformed, the cells can be regenerated by those skilled in the art.

To confirm the presence of the DNA segment(s) or "transgene(s)" in the regenerated plants, a variety of assays may be performed. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting and PCR; "biochemical" assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant. For further details see e.g. US2002/0138870A1 sections [0093] - [0107].

Promoters and Termination Sequences

Various gene promoter sequences are well known in the art and can be used in a DNA constructs of interest, such a chimeric DNA construct of interest. The promoter in the constructs suitably provides for expression of the linked DNA segment. The promoter can also be inducible so that gene expression can be turned on or off by an exogenously added agent. It may also be preferable to combine the desired DNA segment with a promoter that provides tissue specific expression or developmentally regulated gene expression in plants. The promoter may be selected from promoters known to operate in plants. Suitable examples are described in US2002/0138870A1 section [0074] and include e.g., CaMV35S, GPAL2, GPAL3 and endogenous plant promoter controlling expression of the enzyme of interest. Use of a constitutive promoter such as the CaMV35S promoter, or CaMV 19S can be used to drive the expression of the transgenes in all tissue types in a target plant. Other promoters are nos, Adh, sucrose synthase, Δ-tubulin, ubiquitin, actin, cab, PEPCase or those associate with the R gene complex. On the other hand, use of a tissue specific promoter permits functions to be controlled more selectively. The use of a tissue-specific promoter has the advantage that the desired protein is only produced in the tissue in which its action is required. Suitably, tissue-specific promoters, such as those would confine the expression of the transgenes in developing xylem and sclerenchyma where lignification occurs, may be used in the DNA constructs. Suitable examples of lignification-associated tissue specific promoters are described in US2004/0049802 and include the therein described bean PAL2 promoter. The gene termination sequence is located 3' to the DNA sequence to be transcribed. Various gene termination sequences known in the art may be used in the present inventive constructs.

Marker gene:

A marker gene may also be incorporated into the DNA constructs to aid the selection of plant tissues with positive integration of the transgene. "Marker genes" are genes that impart a distinct phenotype to cells expressing the marker gene, and thus, allow such transformed cells to be distinguished from cells that do not have the marker. Many examples of suitable marker genes are known to the art and can be employed in the practice of the invention, such as neomycin phosphotransferase II (NPT II) gene that confers resistance to kanamycin or hygromycin antibiotics which would kill the non-transformed plant tissues containing no NPT II gene. Other suitable selectable markers include, a bar gene which codes for bialaphos resistance; a gene which encodes an altered EPSP synthase protein thus conferring glyphosate resistance; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance tobromoxynil. Screenable markers that may be employed include a β-glucuronidase or uidA gene (GUS) which encodes an enzyme for which various chromogenic substrates are known; a β-lactamase gene, which encodes an enzyme for which various chromogenic substrates are known. Examples of other selectable or screenable markers may be found e.g. in table 1 of WOO 1/27241.

Identity of DNA sequences:

The DNA sequence identity referred to herein is determined as the degree of identity between two sequences indicating a deviation of the first sequence from the second.

At the filing date of the present invention, the National Center for Biotechnology Information (NCBI) offered at the Internet site (http://www.ncbi.nlm.iiih.gov/) allows the possibility of making a standard BLAST computer sequence homology search. BLAST program is described in [Altschul et al (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402].

In the present context, a preferred computer homology search program is a "Standard nucleotide-nucleotide BLAST [blastn]" search as specified, at the filing date of the present application, at the NCBI Internet site with setting filter: Low complexity; Expect: 10, Word Size: 11.

The reference sequence is introduced into the program and the program identifies fragments of another sequence (e.g. a published sequence) together with the identity percentage to a corresponding fragment of the reference sequence.

According to the common understanding of the skilled person, when there herein is discussed an identity to a specific reference sequence (e.g. DNA sequence 1-1011 in SEQ ID NO 7 - termed "DAHPS4-cDNA") to another sequence, said another sequence should have a length which is comparable to the reference sequence. For instance, if the length of the reference sequence is 1000 bp a comparable length of the other sequence could e.g. be from 800 - 1200 bp. The same applies for identity of amino acid sequences and "identity" analyzed via hybridization as described herein.

Identity to amino acid sequences

Similar to the nucleotide homology analysis, in the present context, a preferred computer homology search program is a "Standard protein-protein BLAST [blastp]" search as specified, at the filing date of the present application, at the NCBI Internet site with settings Composition- based statistics: yes, filter: Low complexity; Expect: 10, Word Size: 3, Matrix: BLOSUM 62, Gap Costs: Existence 11 Extension 1.

Hybridization

The hybridization referred to above is intended to comprise an analogous DNA sequence which hybridizes to a double-stranded DNA probe. Suitable experimental conditions for determining hybridization at low, medium, or high stringency between a nucleotide probe and a homologous DNA or RNA sequence involve presoaking of the filter containing the DNA fragments or RNA to hybridize in 5 x SSC (Sodium chloride/Sodium citrate, Sambrook et al. 1989) for 10 min, and prehybridization of the filter in a solution of 5 x SSC, 5 x Denhardt's solution (Sambrook et al. 5 1989), 0.5 % SDS and 100 mu g/ml of denatured sonicated salmon sperm DNA (Sambrook et al. 1989), followed by hybridization in the same solution containing 10 ng/ml of a random- primed (Feinberg, A. P. and Vogelstein, B. (1983) Anal. Biochem. 132:6-13), P-dCTP-labeled (specific activity > 1 x 10 cpm/ mu g ) probe for 12 hours at 45°C.The filter is then washed twice for 30 minutes in 2 x SSC, 0.5 % SDS at a temperature of at least 55°C (low stringency), more 0 preferably at least 60⁰C (medium stringency), still more preferably at least 65°C (medium/high stringency), even more preferably at least 70⁰C (high stringency), even more preferably at least 75°C (very high stringency).

Molecules to which the oligonucleotide probe hybridizes under these conditions are detected 5 using an X-ray film.

EXAMPLES:

General molecular biology methods 0

Unless otherwise mentioned the DNA manipulations and transformations were performed using standard methods of molecular biology (Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, F. M. et al. (eds.) "Current protocols in Molecular Biology". John Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. 5 M.

Enzymes for DNA manipulations were used according to the specifications of the suppliers.

Example 1 : Isolation of Tall fescue DAHP synthase genes 0

To isolate DAHP synthase genes from Tall fescue total RNA was prepared from plants grown in a green house at a temperature of 21⁰C with 12 hrs of daylight. Tissue was harvested from two weeks old roots, from two weeks old leaves, from 6 weeks old leaves and from 6 weeks old stem tissue and RNA was isolated using the "Total RNA Isolation System" from Promega. DAHP synthases from rice and Arabidopsis was extracted from public databases and aligned using the program AlignX from the Vector NTI suite 9.0 software packaged (Infomax). 5 Subsequently, sets of degenerate primers were synthesized based on DNA motifs showing the highest degree of identity. Next, reverse transcription was performed either using a polyT primer ABJ51 (_{TTTTTTTTTTTTTTTTTT}) (_SEQ ID 21) or a degenerate primer ABJ49 (GTSACGTTCTGSCCSGTCATYT) (SEQ ID 21) where S is either G or C and Y is either C or T. The reverse transcription reaction was carried out on 0,8 μg Total RNA containing 4

10 μl reverse transcription Buffer, 1 μl 30 pmol primer, 2 μl 10 mM dNTP 5 units Transcriptor Reverse Transcriptase (Roche) and 20 units Proctector RNase inhibitor (Roche) in a total of 20 μl. When using primer ABJ51 the reaction was incubated at 30⁰C for 10 min followed by 30 min at 55°C before the enzyme reaction was heat inactivation for 5 min at 85°C. PCR was performed on 2 μl the reverse transcription samples using primers AB J49 in combination with primer

15 ABJ32 (CAGGGCGGCGACTGCGCCGAG) (SEQ ID 23) or primer ABJ53 (CAR GGS GGS GAC TGC GCC GAR AG) (SEQ ID 24) where S is either G or C and R is either A or G. The PCR reaction was carried out in a total of 50 μl by preparing a master mix from the following stocks

20 10 X PCR buffer 5 μl dNTP mix (10 mM of each nucleotide) 1 μl

Primer A (30 pmol/ 1) 1 μl

Primer B (30 pmol/ 1) 1 μl

Pwo polymerase (Roche) 0,5 μl

25 water 39,5 μl

Where A and B were combinations of ABJ49 + ABJ53 or ABJ49 + ABJ32 respectively. The PCR reactions were purified using the High Pure PCR Product Purification Kit (Roche) and 3 μl of the purified reactions were used for TOPO Blunt Cloning into the pCR-Bluntll-TOPO 30 plasmid. The resulting colonies were sequenced and sequence analysis revealed that three different partial DAHPS synthase genes had been isolated. These genes were designated DAHPS4, DAHPS5 and DAHPS6. The PCR reactions were heated to 94°C for 2 min and run for 30 cycles at 94°C for 30 sec, 60⁰C for 30 sec followed by 72°C for 60 sec.

To isolate genomic DNA fragments encoding DAHP synthase genes from Tall fescue Long genomic DNA was prepared from two weeks old leaves of soil grown plants by using a Roche Plant DNA Isolation Kit. Next Long Range PCR were performed on 1 μg of genomic DNA using the Expand Long Template PCR System from Roche with primer sets ABJ49 + ABJ53 and ABJ49 + ABJ32 according to the instructions by the manufacture. The PCR reactions were purified using the High Pure PCR Product Purification Kit (Roche) and 3 μl of the purified reactions were used for TOPO TA Cloning into the pCR2.1-TOPO plasmid. The resulting colonies were sequenced and sequence analysis revealed that three different partial DAHPS synthase genes had been isolated. These genes were designated DAHPSl, DAHPS2 and DAHPS3.

Example 2: Characterization of total DAHP synthases expression levels in different tissue of tallfescue

To investigate whether tall fescue DAHP synthases accumulate to different levels in different tissue of tall fescue a RNA gel blot analysis was performed. First, total RNA was isolated from two weeks old roots, from two weeks old leaves, from 6 weeks old leaves and from 6 weeks old stem tissue using a "Total RNA Isolation System" from Promega. Next, 20 μg total RNA was fractionated on a 1% formaldehyde denaturing agarose gel and transferred onto a nylon Hybond N membrane from Amersham Biosience according to the instructions of the manufacturer. Then, DNA fragments of DAHP synthases 4, 5, 6, 7, 8, 9 and 10 were isolated by liberating the inserts using EcoRI restriction enzyme digestion followed by gel purification. The purified DNA fragments were mixed in equal amounts and hybridization and probes were labelled with Oc³²P- dCTP using a Random primed DNA Labelling Kit from Roche. As a control a 258 bp fragment of the 5.8 rRNA were isolated by PCR according to the procedure described by Lϋcher et al 2000. Plant Physiol. VoI 124, 1217-1227.

These results demonstrated that DAHP synthase mRNA only accumulates to very low levels in tall fescue root tissue whereas slightly higher levels were observed in young and old leaves. In contrast, DAHP synthase mRNA accumulates to much higher levels stem tissue suggesting that higher amounts of aromatic amino acids are produced in stem tissue.

Example 3 Characterization of specific DAHP synthases expression profiles in different tissue 5 oftallfescue

To test the relative expression levels between Tall fescue DAHP synthase 4, 5 and 6 RT-PCR was performed. First the DNA sequences of the isolated DAHP synthase genes 4, 5 and 6 were aligned. Regions in which most differences were observed were subsequently used for designing

10 specific primers such that Tall fescue DAHP synthase 4 could be pair wise compared to either DAHP synthase 5 or 6 by generating fragments of different sizes. Next, semi-quantitative RT- PCR were run on RNA isolated from two weeks old roots, from two weeks old leaves, from 6 weeks old leaves and from 6 weeks old stem tissue. For comparing the relative expression levels of DAHP synthase genes 4 and 5 the RNA was reverse transcribed as described above using

15 primer AB J51. Next PCR were performed on the reverse transcription reactions using two primer sets. One set specific for DAHP synthase 4 ABJ60 (CCAGATGCCCGTCCTCAAGGTT) (SEQ ID 25) and ABJ61

(GGTTAGAGCTTGCTCGTAGGGT) (SEQ ID 26) generating a DNA fragment of 442 bp and one set specific for DAHP synthase 5 ABJ64 (ACAGGTCCCCGTCGTCAAGGTG) (SEQ ID

20 27) and ABJ78 (TCTCCCTGCTCGTTGTGGTCC) (SEQ ID 28) generating a DNA fragment of 294 bp. The PCR reactions were performed on 2 μl of the reverse transcription samples and contained 5 μl 10 X PCR buffer, 1 μl dNTP mix (10 mM of each nucleotide), 1 μl each of Primer A, B, C and (30 pmol/μl) 5 units Pwo polymerase and 39,5 μl of water. The PCR reactions were heated to 94°C for 2 min and run for 28 cycles at 94°C for 30 sec followed by

25 60⁰C for 30 sec and 72°C for 60 sec.

Amplified DNA fragments, 15 μl were mixed with 3 μl loading buffer and separated on a 1% agarose gel before quantifying the relative expression levels by image analysis.

30 The relative expression levels of DAHP synthase 4 and 6 were performed exactly as described above except that the PCR reaction consisted of primers ABJ60, ABJ61 and the DAHP synthase 6 specific primers ABJ62 (GCAGATGCCCATCATCAAGGTA) (SEQ ID 29) and ABJ79 (TCACCCTGTTCACTTTTCTCT) (SEQ ID 30) also generating a band of 294 bp.

As a control, primes able to amplify a 258 bp fragment of the 5.8 rRNA according to the procedure described by Lucher et al 2000. Plant Physiol. VoI 124, 1217-1227.

The results above demonstrate that the DAHP synthase 5 accumulates to nearly similar levels in two and six weeks old leaves and in stem tissue. In contrast, only a very week accumulation could be detected in two weeks old roots. A similar expression pattern was observed for DAHP synthase 6 except a significantly lover mRNA accumulation was detected in stem and roots as compared to DAHP synthase 5. Interestingly, DAHP synthase 4 mRNA accumulated to much higher levels in stem tissue of tall fescue than in young leaves and roots where only a very week accumulation could be observed by increasing the number of PCR cycles from 28 cycles for DAHP synthase 4 and 5 to 32 PCR cycles used for comparing expression levels of DAHP synthase 4 and 6.

In addition, quantification of the expression profiles revealed that DAHP synthase 4 was expressed to 2.5 fold higher levels than DAHP synthase 5 and to 4 fold higher levels than DAHP synthase 6 in 6 weeks old tall fescue stem tissue.

Example 4: Sequence alignment of DAHP synthase genes (selectable expressed in stem tissue delete this)

Sequence alignments of the DNA sequences and the corresponding protein sequences revealed that the identity between DAHP synthase 4, 5 and 6 calculated using the Vector NTI Suite 9.0 program were 83 and 77% respectively and the sequence identity between DAHP synthase 5 and 6 were 76%. This could suggest that DAHP synthase 4 and 5 which both accumulate in stem tissue show a higher degree of identity than for DAHP synthase 6, which only accumulates to very low levels in stem tissue. Alignment of the corresponding translated protein sequences revealed the same degree (88%) of identity between DAHP synthase 4, 5 and 6. In addition, sequence alignment was used to identify the regions conferring most sequence diversity between DAHPS synthase 4,5 and 6. Subsequently, fragments spanning these regions were chemically synthesized and used for preparing antisense vector constructs.

Example 5: Construction of transformation vectors for down regulation of DAHP synthases

Different strategies are used for down regulation of DAHP synthases expression and activity in transgenic tall fescue.

First, to obtain a general decrease in DAHP synthase activity the strong constitutive maize ubiqutin promoter including it's first intron followed by the pea terminator signal E9 is inserted into the EcoRI-BamHI sites of the plant transformation vector pCAMBIA1300. This vector is designated pCAMBIA-ubi-E9. Next DAHP synthase 4, 5 and 6 will be liberated from then- respective plasmid vectors by restriction enzyme digestion by BamHI+Xbal and inserted into the pCAMBIA-ubi-E9 vector digested by the same enzymes such that DAHP synthase 4, 5 and 6 are placed in their antisense orientation. After transformation into tall fescue, maize and rice such vectors result in down regulation of all DAHP synthases in tissue wherein the ubiqutin promoter is active.

Secondly, to achieve down regulation of all DAHP synthases in specific cells undergoing lignification the maize Adhl promoter that is active in vascular tissue and lignifying sclerenchyma (Piquemal J. et al, Plant Physiol, December 2002, Vol. 130, pp. 1675-1685) is used to drive antisense expression of DAHP synthase 4, 5 and 6. Exchanging the ubiqutin promoter in pCAMBLA-ubi-E9 for the Adhl promoter by restriction enzyme digestion with EcoRI+BamHI makes this vector, designated pC AMBIA- Adhl-E9. Then, DAHP synthase 4, 5 and 6 is liberated from their respective plasmid vectors by restriction enzyme digestion with BamHI+Xbal and inserted into the pCAMBIA-AdhI-E9 vector digested by the same enzymes such that DAHP synthase 4, 5 and 6 are placed in their antisense orientation. After transformation into tall fescue, maize and rice such vectors result in down regulation of all DAHP synthases in specific tissue undergoing lignification wherein the Adhl promoter is active. Thirdly, as an alternative to the maize Adhl promoter the ryegrass OMT promoter described in patent WO 01/95702 Al will be chemical synthesized and exchanged with the Adhl promoter of plasmid pCAMBIA-AdhI-E9 resulting in the plasmid designated pCAMBIA-OMT-E9. Then, DAHP synthase 4, 5 and 6 is liberated from their respective plasmid vectors by restriction enzyme digestion with BamHI+Xbal and inserted into plasmid pCAMBIA-OMT-E9. Since the OMT gene is a key step in production of precursors for lignin biosynthesis these constructs result in down regulation of all DAHP synthases in tissue undergoing lignification.

The above-described method generally results in a broad variation of the efficiency in down regulation, depending on where in the genome the DNA integrates and the promoter used for driving the antisense fragment. Another approach resulting in more efficient down regulation of plant genes is called RNA interference or RNAi. This method consist of that double-stranded RNAs (dsRNAs; typically >100 nt) can be used to silence the expression of target genes in a variety of organisms and cell types (e.g., worms, fruit flies, and plants). Upon introduction, the long dsRNAs enter a cellular pathway that is commonly referred to as the RNA interference (RNAi) pathway. First, the dsRNAs get processed into 20-25 nucleotide (nt) small interfering RNAs (siRNAs). Then, the siRNAs assemble into endoribonuclease-containing complexes known as RNA-induced silencing complexes (RISCs). The siRNA strands subsequently guide the RISCs to complementary RNA molecules, where they cleave and destroy the cognate RNA, resulting in destruction of the transcribed RNA ensuring that no protein is synthesized. This technology is especially efficient in plants when the double-stranded RNAs are separated by an intron sequence. In addition, this technology is very well suited for down regulation of specific members of gene families showing a high degree of sequence identity.

Since we have identified specific DAHP synthases, like DAHP synthase 4, that are expressed in tissue undergoing lignification such DAHP synthases can be specifically down regulated by the use of the RNAi technology. To this end, short RNAi fragments of 100-200 bp sequences corresponding to DAHP synthases, specifically expressed in root and leaf tissue undergoing lignification, are chemically synthesized with and intervening intron like sequence as spacer. The resulting DNA fragments are inserted into plant transformation vectors such as pC AMBIA- ubi-E9, pCAMBIA-AdhI-E9 and pCAMBIA-OMT-E9 thereby creating expression cassettes driven by promoter sequences that either constitutively down regulates specific DAHP synthases or which directs the down regulation to specific cells undergoing lignification. Such a RNAi strategy, which is based on down regulating specific DAHP synthase, ensures that DAHP synthase necessary for production of aromatic amino acids in cells not undergoing lignification is still normally active. Thereby, negative effects of down regulating DAHP synthases can be avoided such that plants with normal growth and yield will be obtained.

The constructs described above are designed such that they can be directly used for transformation of all plants by agrobacterium mediated transformation techniques. They can also be used directly for transformation by particle bombardment or DNA fragments containing the promoter-antisense cassettes can be isolated from the corresponding plasmids and used alone or in combination with other DNA fragments carrying selectable markers for subsequent identification of the transgenic plants.

Based on the above description were made follwing antisense contracts.

Based on the above description the following three antisense constructs were prepared. First, a basic expression cassette was constructed by amplifying the E9 termination region from the pea ribulose bisphosphate carboxylase gene from plasmid pINDEX3 (accession number AF294982) using primers E9-for 5'-CTGCGGATCCTCTAGCTAGAGCTTTCGTTC-S' (SEQ ID 31) and E9-rev 5'-GATAAGCTTGGCTGCAGATTGATGCATGTTGTCAATC-S' (SEQ ID 32) using standard PCR conditions. The resulting DNA fragment was digested with BamHI and HindIII and inserted into the pBluescript vector pBS(SK^") digested with the same enzymes.

Next, Promoter regions from the CCR gene from Lolium perenne (patent WO 02/50294 Al) and from the maize ubiquitin gene were amplified by PCR using primers CCR-for 5'- GCGGCCGCCCCTCCCCACAGAAAAGACATCCC-S' (SEQ ID 33) and CCR-rev 5'- CGCGGATCCGAATTCGTTTAAACTGTCGCTCTTACGGTACTACTG-S' (SEQ ID 34) Ubil-for 5'-GTGGCGGCCGCTAATGAGCATTGCATGTCTAAG-S' (SEQ ID 35) and Ubil- rev 5'- TTCGTTTAAACCATTGAAGCGGAGGTGCCGACGGG-S' (SEQ ID 36). The resulting DNA fragment of the CCR promoter was digested with Notl and BamHI and inserted into the pBS(SK^") plasmid carrying the E9 terminator, designated pBS(SK^")CCR-E9. The pBS(SK^")CCR-E9 vector was digested with Notl and Pmel and the PCR fragment of the maize ubiquitin promoter was inserted into this vector after it had been digested with the same enzymes thereby creating the pBS(SK^")Ubil-E9 plasmid.

To create an antisense construct which specifically down regulates DAHPS4 (seq ID NO 7) or highly homologous genes, the region showing the lowest level of sequence conservation was amplified from DAHPS4 by PCR using primers DAHPS4-for 5'-

CGCGGATCCCTCAGGGGTGTTGCTAACCCTC-3' (SEQ ID 37) and DAHPS4-rev 5'- CCGGAATTCGTC ACGTTCTGGCCGGTCATC-3' (SEQ ID 38) by standard PCR conditions. The resulting DNA fragment was digested with EcoRI and BamHI and inserted into pBS(SK^" )Ubil -E9 thereby creating the pBS(SIC)Ubil -antiDAHPS4-E9.

To create antisense cassettes, which down regulate a range of DAHPS genes either constitutively or in specific cell types the following two constructs were prepared. First, regions covering nucleotide positions 776 to 926 of DAHPS4, 5 and 6 (seq ID NO 7, 9 and 11) were chemically synthesised in their antisense orientation in the following order DAHPS4, 5 and 6. In addition, EcoRI and BamHI restriction enzymes sites were included in the synthesis of this DNA fragment to facilitate its sub-cloning into the pBS(SK^")Ubil-E9 and pBS(SK^")CCR-E9 vectors. In this way pBS(SK-)Ubil-antiDAHPSall-E9 and pBS(SK-)CCR-antiDAHPSall-E9 were constructed.

Before plasmid pBS(SIC)Ubil-antiDAHPS4-E9, pBS(SK-)Ubil-antiDAHPSall-E9 and pBS(SK^" )CCR-antiDAHPSall-E9 were transform into Tall fescue, linear fragments of the promoter- DAHPS-terminator cassette were generated by digestion the plasmids with Notl and Kpnl followed by gel purification to isolate the pure DNA fragments. Afterwards, these fragments were inserted into the pGreenll vector digested with the same enzymes. Tall fescue transformation was subsequently, performed both with linear plasmid free DNA fragments only containing the Ubil-antiDAHPS4-E9, Ubil-antiDAHPSall-E9 and the CCR-antiDAHPSall-E9 antisense expression cassettes and with the T-DNA plasmids pGreenII-Ubil-antiDAHPS4-E9 pGreenII-Ubil-antiDAHPSall-E9 and the pGreenII-CCR-antiDAHPSall-E9.

Example 6: Generation of transgenic tall fescue plants Generation of transgenic tall fescue plants is performed as described by Bai and Qu International Turfgrass Society, Research Journal Volume 9, 2001, p 129-136. Briefly, cell suspension cultures is obtained from sterilized seeds of tall fescue Kentuckey-31 which are used as explants to induce callus. Embryogenic calluses derived from single seeds (representing individual genotypes) are individually transferred to a liquid culture medium to establish single genotype suspension cultures. Cell clusters from the embryogeneic suspension lines are used as directs targets for biolistic transformation to generate transgenic plants. The use of single genotype- derived cell suspensions allows the generation of transformants from the same genotype and limits genotypic effects in the regenerants. The transformation experiments are performed using a helium driven particle delivery system. DNA constructs are coated onto 1.0 μm gold particles and delivered into the suspension cells. Selection of stable transformed colonies are performed by transferring bombarded cells onto a solid subculture medium followed by transfer to selection medium after 2 weeks before regeneration of transgenic plantlets. Regenerated shoots are transferred to rooting medium for four to six weeks before the rooted plants are transferred to soil.

Alternatively, six to seven weeks old cell tall fescue suspension cultures is subcultured and used for to five days later for agrobacterium mediated transformation as described by Bettany et al 2003. VoI, 21 437-444. Briefly, the cell suspension culture is pelleted by centrifugation, resuspended in transformation medium and mixed with equal amounts of agrobacterium cells harbouring the plasmid, which is to be inserted into the tall fescue genome. After co-cultivation of the suspension cells and agrobacterium cells for 3 days the agrobacterium cells are removed by adding selection medium toxic for the agrobacterium cells. Next, the suspension cells will be centrifuged and plated onto selective medium for regeneration of transgenic tall fescue cells for seven weeks. Regenerating embryogeneic colonies is transferred to regeneration medium and left to establish shoots and roots. SEQUENCE LISTING

<110> Poalis A/S

<120> A plant with reduced lignin by modulating DAHPS gene expression

<130> P540PC00 <150> EP04104096.5

<151> 2004-08-26

<160> 20

<170> Patentln version 3.3

<210> 1

<211> 3075

<212> DNA

<213> Festuca arundinacea

<220>

<221> exon

<222> (D •• (123)

<223>

<220>

<221> Intron

<222> (124) .. (228)

<223>

<220>

<221> exon

<222> (229) .. (506)

<223>

<220>

<221> Intron

<222> (507) .. (1053)

<223>

<220> <221> exon <222> (1054) .. (1330) <223> <220>

<221> Intron <222> (1331) .. (1420) <223> <220>

<221> exon

<222> (1421) .. (1666)

<223>

<220> <221> Intron

<222> (1667) .. (2986) <223>

<220>

<221> exon <222> (2987) .. (3075) <223>

<400> 1 cag ggc ggc gac tgt gcc gag age ttc aag gag ttc aac ggc aac aac 48

GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn

1 5 10 15 ate cgc gac ace ttc cgc gtc etc etc cag atg tec gcc gtc etc ace 96 lie Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser Ala VaI Leu Thr 20 25 30 ttc ggc ggc cag atg ccc gtc gtc aag gtacgcgtgc tcacctcgaa 143 Phe GIy GIy GIn Met Pro VaI VaI Lys 35 40 ctcaaatccc acctccctcc cccgcgcaaa cctcccttgt aatctgggga tctaattttt 203 gttgattggg taataataat aatag gtt ggg aga atg gcc ggc cag ttc gca 255

VaI GIy Arg Met Ala GIy GIn Phe Ala 45 50 aag ccg agg teg gac aac ttc gag gtg aag gac gga gtg aag eta ccc 303 Lys Pro Arg Ser Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys Leu Pro

55 60 65 age tac aga ggg gac aac ate aac gga gat gca ttc aac gag aag age 351 Ser Tyr Arg GIy Asp Asn lie Asn GIy Asp Ala Phe Asn GIu Lys Ser 70 75 80 cgc ate ccc gat cct cag agg atg ate agg gca tac ace cag teg get 399 Arg lie Pro Asp Pro GIn Arg Met lie Arg Ala Tyr Thr GIn Ser Ala 85 90 95 gee acg etc aac etc etc cgc get ttc gee atg gga ggg tat get gee 447 Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr Ala Ala 100 105 110 atg cag egg gtc ace cag tgg aac etc gat ttc act gaa aac age gag 495 Met GIn Arg VaI Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn Ser GIu 115 120 125 130 cag ggt gac ag gtgaaaacat cttctatgca ctttctgtgt tttctttttt 546 GIn GIy Asp Arg

gtgcatattt tggtgattat gctagtcgtt tagttatata tgctgcaaaa aaaattgagt 606 taaaactatc atattatttg attgtatgca attatcatcg tctcattgaa tgctacaaag 666 caacctattt gatgggagtg cacacctata cacatcctct tatcattacc tttcagtagt 726 tctgtttctt gggaactcag acattatagg atgggccatg ttaacctttt ctgaagtcat 786 tcagtgtcag tttcgtgcag aagtcataca attatctgat gtcgttgcac tccactgaat 846 aactcttcca ccccaacata tattggttta tggtgtaaca acatgatcta atattgctat 906 tcaataacag ctcgaatgtt tagagtttgt aattattaaa tattttctga ttattttgat 966 ggaaataata taaattgttg tcctcttggc caatcaagaa gtattctact gtagtactgt 1026 ctaattattg tggggatgct tcgttag g tac cgc gaa ttg gca cac agg gtt 1078

Tyr Arg GIu Leu Ala His Arg VaI 135 140 gat gaa gcc ctt ggc ttc atg tct gca get ggg eta aca ttg gac cac 1126 Asp GIu Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr Leu Asp His 145 150 155 ccg gtt atg tea agt act gaa ttc tgg ace tct cat gag tgc ctg etc 1174 Pro VaI Met Ser Ser Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu 160 165 170 eta ccc tac gag caa get eta ace cgt cag gac tea ace tct ggt ctt 1222 Leu Pro Tyr GIu GIn Ala Leu Thr Arg GIn Asp Ser Thr Ser GIy Leu 175 180 185 190 ttc tac gac tgt tct gcc cac atg etc tgg gtc ggt gaa cgc act cgc 1270

Phe Tyr Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg 195 200 205 cag ctt gac ggt get cat gtt gaa ttc etc agg ggt gtt get aac cct 1318 GIn Leu Asp GIy Ala His VaI GIu Phe Leu Arg GIy VaI Ala Asn Pro 210 215 220 ctt ggc ate aag gtttcttttt agactaactt catgttgaaa acgtaaaaat 1370 Leu GIy lie Lys 225 acacatgtgt atgccgagct aaacatccaa ttgtaaaatg tggatttcag gtg agt 1426 VaI Ser

gac aaa atg aac ccc age gac ttg gtg aag ctg att gag ata ttg aac 1474 Asp Lys Met Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn 230 235 240 cca aca aac aaa get ggg aga att ace ate att aca aga atg ggg gca 1522 Pro Thr Asn Lys Ala GIy Arg lie Thr lie lie Thr Arg Met GIy Ala 245 250 255 260 gag aac atg agg gtc aaa tta cct cat ctt ate cgt get gtc cgc aat 1570 GIu Asn Met Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn 265 270 275 tct ggt caa att gtc ace tgg ate act gat ccc atg cac ggg aac ace 1618

Ser GIy GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr

280 285 290 ate aag get cct tgt ggt eta aag aca cgc ccc ttt gac tct att ctg 1666 lie Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu 295 300 305 gtatgtgcta tttttcctac ttcatccatc gtgttgcttc actagaatga tgcaagcctt 1726 tgtggccttg tgggcaatct gcacatcaca tatgctaccc ccatcaacct aaaaatcgtg 1786 ataaaagcag aaatagatgt taagccatat gctcactgct gctatagatg aaaacagagg 1846 taatattggg gcccattttc tggtgaataa ccaaataagc taattagctg atgaagcttc 1906 aaagtagaca acagtatgat gtataatgta cgtagatcca actagattca aaaataaaac 1966 gatgaaaaga tgcttgcctt ttcattaact atgcaagaag agtttcttga ttgcataaat 2026 cataatgagg aacttctatt gcaattttag tcattaacta attggtcaat agccttgagc 2086 aatagttggt gactggtcag tgtaatatca attttgtatg ctatgaacgt gtctagaccc 2146 ccaaaaaaac atttatcata gatgtgtgtt agcctgttag gtatgatgag gacatccgcc 2206 atatgtttca tgggatggtg gttgttggac tggtccagag atatagtcac catcatggat 2266 ggtcacacag tgtcaattaa atgattttag tgaagtgggt ccagcgatta caatggaagt 2326 gggtctaact agtatgatgg gagtagatct acttaattta tttgctgcta aattgattgc 2386 tcggagtatt ggagaagtat tggagattga accatctgat tgtttaagaa tgttttgttt 2446 gtgtgcccta ggcatgcact ccagttgcaa aaatcgtgcg acggtcgcac cgtttgcagc 2506 acatgctgtc tcttaatata acatttactt tttttttgcg ggggatataa catttacttt 2566 aactgactgg tactcaagtg ctggtctctt gtactaagga ttagatgtaa ttatgtactg 2626 aacaaagcag caccaggcca tcttgctgtt aattatcagc tactgttcga agttgctagc 2686 aatactaatc ttaagttgca agaagagttc tgcatcttgg aaagtgaaag ggtgatattt 2746 ggtcaccgta ttagatagat tagtagattt tactagtaat aactacagtc atttgttaac 2806 tgcagattta agaaataagt acagaaaaca ttagactttt gtttttttca tttgattgaa 2866 gtgtgcattt gagttcattg gctaggataa ggtgttcatg tttgtttcat tgatactgta 2926 ttcttcgctg aagtctttgc agtcatggcc ccaaactaat caggaacttt tctctaatag 2986 get gag gtc agg gca ttc ttc gat gtt cat gag caa gaa ggg age cac 3034 Ala GIu VaI Arg Ala Phe Phe Asp VaI His GIu GIn GIu GIy Ser His 310 315 320 gca gga ggt gtc cac etc gaa atg acg ggg cag aac gtg ac 3075 Ala GIy GIy VaI His Leu GIu Met Thr GIy GIn Asn VaI 325 330 335

<210> 2

<211> 337 <212> PRT <213> Festuca arundinacea

<400> 2 GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn 1 5 10 15

lie Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser Ala VaI Leu Thr 20 25 30

Phe GIy GIy GIn Met Pro VaI VaI Lys VaI GIy Arg Met Ala GIy GIn 35 40 45

Phe Ala Lys Pro Arg Ser Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys 50 55 60

Leu Pro Ser Tyr Arg GIy Asp Asn lie Asn GIy Asp Ala Phe Asn GIu 65 70 75 80

Lys Ser Arg lie Pro Asp Pro GIn Arg Met lie Arg Ala Tyr Thr GIn

85 90 95

Ser Ala Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr 100 105 110

Ala Ala Met GIn Arg VaI Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn 115 120 125

Ser GIu GIn GIy Asp Arg Tyr Arg GIu Leu Ala His Arg VaI Asp GIu 130 135 140

Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr Leu Asp His Pro VaI 145 150 155 160 Met Ser Ser Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro 165 170 175

Tyr GIu GIn Ala Leu Thr Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr 180 185 190

Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu 195 200 205

Asp GIy Ala His VaI GIu Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy 210 215 220

He Lys VaI Ser Asp Lys Met Asn Pro Ser Asp Leu VaI Lys Leu He 225 230 235 240

GIu He Leu Asn Pro Thr Asn Lys Ala GIy Arg He Thr He He Thr 245 250 255

Arg Met GIy Ala GIu Asn Met Arg VaI Lys Leu Pro His Leu He Arg 260 265 270

Ala VaI Arg Asn Ser GIy GIn He VaI Thr Trp He Thr Asp Pro Met 275 280 285

His GIy Asn Thr He Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe 290 295 300

Asp Ser He Leu Ala GIu VaI Arg Ala Phe Phe Asp VaI His GIu GIn 305 310 315 320

GIu GIy Ser His Ala GIy GIy VaI His Leu GIu Met Thr GIy GIn Asn 325 330 335

VaI

<210> 3

<211> 2989

<212> DNA <213> Festuca arundinacea

<220> <221> exon

<222> (1) .. (123) <223>

<220>

<221> Intron

<222> (124) .. (240)

<223> <220>

<221> exon

<222> (241) .. (518)

<223>

<220> <221> Intron

<222> (519) .. (1057)

<223>

<220>

<221> exon <222> (1058) . . (1334)

<223>

<220>

<221> Intron

<222> (1335) . . (1425)

<223> <220>

<221> exon <222> (1426) . . (1671)

<223>

<220>

<221> Intron

<222> (1672) . . (2900) <223>

<220>

<221> exon

<222> (2901) . . (2989) <223>

<400> 3 cag ggc ggc gac tgc gcc gag age ttc aag gag ttc aac ggc aac aac 48

GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn 1 5 10 15 ate cgc gac ace ttc cgc gtc etc etc cag atg tec gcc gtc etc ace 96 lie Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser Ala VaI Leu Thr 20 25 30 ttc ggc ggc cag atg ccc gtc gtc aag gtacgcgcgc tcacctccaa 143

Phe GIy GIy GIn Met Pro VaI VaI Lys 35 40 ctcaaatccc acctccctcc tccgcgcaaa cctcccttgt aatctgggga tctaattttt 203 gttgattggg taataataat aataataata ataatag gtt ggg aga atg gcc ggc 258 VaI GIy Arg Met Ala GIy

45 cag ttc gca aag ccg agg teg gat aac ttc gag gta aag gac gga gtg 306 GIn Phe Ala Lys Pro Arg Ser Asp Asn Phe GIu VaI Lys Asp GIy VaI 50 55 60 aag eta ccc ggc tac aga ggg gac aac ate aac gga gat gca ttc aac 354 Lys Leu Pro GIy Tyr Arg GIy Asp Asn lie Asn GIy Asp Ala Phe Asn 65 70 75 gag aag age cgc ate ccc gat ccc cag agg atg ate agg gcg tac ace 402

GIu Lys Ser Arg lie Pro Asp Pro GIn Arg Met lie Arg Ala Tyr Thr 80 85 90 95 cag teg get gcc acg etc aac etc etc cgc get ttc gcc atg gga ggg 450 GIn Ser Ala Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Met GIy GIy 100 105 110 tat get gcc atg cag egg gtc ace cag tgg aac etc gat ttc act gaa 498 Tyr Ala Ala Met GIn Arg VaI Thr GIn Trp Asn Leu Asp Phe Thr GIu 115 120 125 aac age gag cag ggt gac ag gtgaaaacat cttctatgca ctttctgtgt 548 Asn Ser GIu GIn GIy Asp Arg 130 tttctttttt gtgcatattt tggtgattat gctaatcgtt tagttatata tgctgcaaaa 608 aaaattgagt taaaactatc atattatttg attgtatgca attatcatcg tctcattgaa 668 tgctacaaag caacctattt gatgggagtg cacacctata cacatcctct tatcattacc 728 tttcagtagt tctgtttctt gggaactcag acattatagg atgggccatg ttaacctttt 788 ctgaagtcat tcagtgtcag tttcgtgcag aagtcataca attatgtgat gtcgttgcac 848 tccactgaat aactcttcca ccccaacata tattggttta tggtgtaaca acatgatcta 908 atattgctat tcaataacag ctcgaatgtt tagagtttgt aattattaaa tattttctga 968 ttattttgat ggaaataata taaactgttg tcttcttggc caatcaagaa gtattctact 1028 gtctaattat tgtggggatg cttcgctag g tac cgc gaa ttg gca cac agg gtt 1082 Tyr Arg GIu Leu Ala His Arg VaI 135 140 gat gaa gcc ctt ggc ttc atg tct gca get ggg eta aca ttg gac cac 1130 Asp GIu Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr Leu Asp His 145 150 155 ccg gtt atg tea agt act gaa ttc tgg ace tct cat gag tgc ctg etc 1178 Pro VaI Met Ser Ser Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu 160 165 170 eta cca tac gag caa get eta ace cgt cag gac tea ace tct ggt ctt 1226 Leu Pro Tyr GIu GIn Ala Leu Thr Arg GIn Asp Ser Thr Ser GIy Leu 175 180 185 190 ttc tac gac tgt tct gcc cac atg etc tgg gtc ggt gaa cgc act cgc 1274

Phe Tyr Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg 195 200 205 cag ctt gac ggt get cat gtt gaa ttc etc agg ggt gtt get aac ccc 1322 GIn Leu Asp GIy Ala His VaI GIu Phe Leu Arg GIy VaI Ala Asn Pro 210 215 220 ctt ggc ate aag gtttcttttt agactaactt ttattttgat aatgtaaaat 1374 Leu GIy lie Lys 225 gcacatgtgt atgctgagct aaacatccaa ttgtaaaatg tggatttcga g gtg agt 1431

VaI Ser

gac aaa atg aac ccc agt gac ttg gtg aag ctg att gaa ata ttg aac 1479 Asp Lys Met Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn 230 235 240 cca aca aac aaa get ggg aga att ace ate att aca aga atg ggg gca 1527

Pro Thr Asn Lys Ala GIy Arg lie Thr lie lie Thr Arg Met GIy Ala 245 250 255 260 gag aac atg agg gtc aaa tta cct cat ctt ate cgt get gtc cgc aat 1575 GIu Asn Met Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn 265 270 275 tct ggt caa att gtc ace tgg ate act gat ccc atg cac ggg aac ace 1623 Ser GIy GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr 280 285 290 ate aag get cct tgt ggt eta aag aca cgc ccc ttt gac tct att ctg 1671 lie Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu 295 300 305 gtatgtgcca tttttcctac ttcatccatt gtgttgcttc actagaatga tgcagccttt 1731 gtggccttgt gggcaatctg cacatcacat atgctacccc catcaaccta aaaaacgtga 1791 taaaggcaga aatagatgtt aagccatatg ctcactgctg ctatagatga aaacagaggt 1851 aatattgggc cccattttct ggtgaataac caaataagct aattagctga tgaagcttca 1911 aggtagacaa caatatgatg tataatgtac gtagtaccaa ctagattcga aaataaaacg 1971 atgaaaagat gcttgccttt tcattaatta tgcaagaaga gtttcttgat tgcataaatc 2031 ataatgagga actgctattg caattttagt cattaactaa ttggtcaata accttgagta 2091 atagttggtg actggtcagt gtaatatcaa ttttgtatgc tatgaacgtg tctagacccc 2151 caaaaaaaca tttatcatag atgtgtgtta gcctgttagg tatgatgagg acatccacca 2211 tatgtttcat gggatggtgg ttgttggact ggtccagaga tatagtcacc atcatggatg 2271 gtcacacagt gtcaattaaa tgattttagt gaagtgggtc cagtgattac aatggaagtg 2331 ggtctaacta gtatgatggg agtagatcta ctataattga ttgctcggag tattggagaa 2391 gtattggaga ttgaaccatc tgattgttta agaatgtttt gtttgtgtgc cctaggcatg 2451 cactccagtt gcaaatcgtg tgacggtcgc accgtttgca gcacatgctg tctcttaata 2511 taacatttta cttgaactga ctggtactga agtgctggtc tcttgtacca aggattagat 2571 gtaattatgt actgaacaaa gcagcaccat gccatcttgc tgttaattat cagctactgt 2631 gcgaagttaa gagttctgca tcttggaaag tgaaaggggg atatttgatc accgtattag 2691 atagattagt agattttact aataataact acagacattt tttttaactg cagatttaag 2751 aagtacaaaa aacagtagac ttttcttttc tcatttgatt agagtgtcca tttgagatca 2811 ttggctagga tagtttcatt gatactgtat tcttcactga agtctttgca gtcatggccc 2871 caaactaatc aggaactttt ctctaatag get gag gtc agg gca ttc ttc gat 2924 Ala GIu VaI Arg Ala Phe Phe Asp

310 315 gtt cat gag caa gaa ggg age cac gca gga ggt gtc cac etc gaa atg 2972 VaI His GIu GIn GIu GIy Ser His Ala GIy GIy VaI His Leu GIu Met 320 325 330 acg ggc cag aac gtg ac 2989 Thr GIy GIn Asn VaI 335

<210> 4

<211> 337 <212> PRT

<213> Festuca arundinacea

<400> 4

GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn 1 5 10 15

He Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser Ala VaI Leu Thr 20 25 30

Phe GIy GIy GIn Met Pro VaI VaI Lys VaI GIy Arg Met Ala GIy GIn 35 40 45 Phe Ala Lys Pro Arg Ser Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys 50 55 60

Leu Pro GIy Tyr Arg GIy Asp Asn lie Asn GIy Asp Ala Phe Asn GIu 65 70 75 80

Lys Ser Arg lie Pro Asp Pro GIn Arg Met lie Arg Ala Tyr Thr GIn 85 90 95

Ser Ala Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr 100 105 110

Ala Ala Met GIn Arg VaI Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn 115 120 125

Ser GIu GIn GIy Asp Arg Tyr Arg GIu Leu Ala His Arg VaI Asp GIu 130 135 140

Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr Leu Asp His Pro VaI 145 150 155 160

Met Ser Ser Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro 165 170 175

Tyr GIu GIn Ala Leu Thr Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr 180 185 190

Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu 195 200 205

Asp GIy Ala His VaI GIu Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy 210 215 220

He Lys VaI Ser Asp Lys Met Asn Pro Ser Asp Leu VaI Lys Leu He 225 230 235 240

GIu He Leu Asn Pro Thr Asn Lys Ala GIy Arg He Thr He He Thr 245 250 255

Arg Met GIy Ala GIu Asn Met Arg VaI Lys Leu Pro His Leu He Arg 260 265 270

Ala VaI Arg Asn Ser GIy GIn He VaI Thr Trp He Thr Asp Pro Met 275 280 285

His GIy Asn Thr He Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe 290 295 300

Asp Ser lie Leu Ala GIu VaI Arg Ala Phe Phe Asp VaI His GIu GIn 305 310 315 320

GIu GIy Ser His Ala GIy GIy VaI His Leu GIu Met Thr GIy GIn Asn 325 330 335

VaI

<210> 5

<211> 2988

<212> DNA

<213> Festuca arundinacea

<220> <221> exon

<222> (D •• (123)

<223>

<220>

<221> Intron <222> (124) .. (228)

<223> <220>

<221> exon

<222> (229) .. (506)

<223>

<220>

<221> Intron <222> (507) .. (1047)

<223>

<220>

<221> exon

<222> (1048) .. (1324) <223> <220>

<221> Intron <222> (1325) .. (1413) <223> <220> <221> exon <222> (1414) .. (1659) <223> <220>

<221> Intron

<222> (1660) .. (2899)

<223> <220>

<221> exon

<222> (2900) .. (2988)

<223>

<400> 5 cag ggc ggc gac tgc gcc gag age ttc aag gag ttc aac ggc aac aac 48

GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn

1 5 10 15 ate cgc gac ace ttc cgc gtc etc etc cag atg tec gcc gtc etc ace 96 lie Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser Ala VaI Leu Thr 20 25 30 ttc ggc ggc cag atg ccc gtc gtc aag gtacgcgcgc tcacctcgaa 143 Phe GIy GIy GIn Met Pro VaI VaI Lys 35 40 ctcaaatccc acctccctcc tccgcgcaaa cctcccttgt aatctgggga tctaattttt 203 gttgattggg taataataat aatag gtt ggg aga atg gcc ggc cag ttc gca 255

VaI GIy Arg Met Ala GIy GIn Phe Ala 45 50 aag ccg agg teg gat aac ttc gag gta aag gac gga gtg aag eta ccc 303 Lys Pro Arg Ser Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys Leu Pro

55 60 65 age tac aga ggg gac aac ate aac gga gat gca ttc aac gag aag age 351 Ser Tyr Arg GIy Asp Asn lie Asn GIy Asp Ala Phe Asn GIu Lys Ser 70 75 80 cgc ate ccc gat ccc cag agg atg ate agg gca tac ace cag teg get 399 Arg lie Pro Asp Pro GIn Arg Met lie Arg Ala Tyr Thr GIn Ser Ala 85 90 95 gcc acg etc aac etc etc cgc get ttc gee atg gga ggc tat get gee 447 Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr Ala Ala 100 105 110 atg cag egg gtc ace cag tgg aac etc gat ttc act gaa aac age gag 495 Met GIn Arg VaI Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn Ser GIu 115 120 125 130 cag ggt gac ag gtgaaaacat cttctatgca ctttctgtgt tttctttttt 546 GIn GIy Asp Arg

gtgcatattt tggtgattat gctaatcgtt tagttgtata tgctgcaaaa aaaattgagt 606 taaaactatc atattatttg attgtatgca attatcatcg tctcattgaa tgctacaaag 666 caacctattt gatgggagtg cacacctata cacatcctct tatcattacc tttcagtagt 726 tctgtttctt gggaacttag acattatagg atgggccatg ttaacctttt ctgaagtcat 786 ccaatccagt gtcagtttcc tgcagaagtc atgcaattat ctgctgctgt actccactga 846 ataactcttc caccccaaca tatattggtt tatggtgtaa caacatgatc taatattgct 906 attcaataac agctcgaatg tttagagttt gtaattatta aatattttct gattattttg 966 atggaaataa tataaactgt tgtcttcttg gccaatcaag aagtattcta ctgtctaatt 1026 attgtgggga tgcttcgtta g g tac cgc gaa ttg gca cac agg gtt gat gaa 1078

Tyr Arg GIu Leu Ala His Arg VaI Asp GIu 135 140 gcc ctt ggc ttc atg tct gca get ggg eta aca ttg gac cac ccg gtt 1126 Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr Leu Asp His Pro VaI 145 150 155 160 atg tea agt act gaa ttc tgg ace tct cat gag tgc ctg etc eta ccc 1174 Met Ser Ser Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro

165 170 175 tac gag caa get eta ace cgt cag gac tea ace tct ggt ctt ttc tat 1222 Tyr GIu GIn Ala Leu Thr Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr 180 185 190 gac tgt tct gcc cac atg etc tgg gtc ggt gaa cgc act cgc cag ctt 1270 Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu 195 200 205 gac ggt get cat gtt gaa ttc etc egg ggt gtt get aac ccc ctt ggc 1318 Asp GIy Ala His VaI GIu Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy 210 215 220 ate aag gttttttttt agactaactt tatgttgata atgtaaaata cacatgtgta 1374 lie Lys 225 tgctcagcta aacatccaat tgtaaaatgt ggatttcag gtg agt gac aaa atg 1428 VaI Ser Asp Lys Met

230 aac ccc age gac ttg gtg aag ctg att gag ata ttg aac cca aca aac 1476 Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn Pro Thr Asn 235 240 245 aaa get ggg gga att ace ate att aca aga atg ggg gca gag aac atg 1524 Lys Ala GIy GIy lie Thr lie lie Thr Arg Met GIy Ala GIu Asn Met 250 255 260 agg gtc aaa tta cct cat ctt ate cgt get gtc cgc aat tct ggt caa 1572 Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn Ser GIy GIn 265 270 275 att gtt ace tgg ate act gat ccc atg cac ggg aac ace ate aag get 1620 lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys Ala 280 285 290 295 cct tgt ggt eta aag aca cgc ccc ttt gac tct att ctg gtatgtgcta 1669 Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu 300 305 tttttcctac ttcattcatc ttgttgcttt agtagaatga tgcagacttt gtgggcaatc 1729 tgcacatctt atatgctacc cccatcaacc ttaaaaacat gataaaagca gaaatagatg 1789 ttaagccata tgctcactgc tgttatagat ggaaacagag gtaatattgg ggcccatttt 1849 ctggtgaata gccaaataag ctaattagct gatgaagctt caaagtagac aacagtaaga 1909 tgtataatgt acgtagttcc aactagattc gaaaataaaa cgatgaaaag atgcttgcct 1969 tttcattaat tatgcaagaa gagtttcttg attgcataaa tcataatgag gaactgctat 2029 tgcaatttta gtcattaact aattggtcaa tagccttgag taatagttgg tgactggtca 2089 gtgtaatatc aattttgaat gctatgaacg tgtctagacc ccccaaaaaa catttatcat 2149 agatgtgtgt tagcctgtta ggtatgatga ggacatccgc catatgttag atggtggttg 2209 ttggactggt ccagagatat agtcaccatc atggatggtc acacagtgtc aattaaatga 2269 ttttagtgaa gtgggtccag cgattacaat ggaagtgggt ctaactagta tgatgggagt 2329 agatctactt aattgatttg ctgctaaatt gattgcttgg agtattggag aagtattgga 2389 gattgaacca tctgattgtt taagaatgtt ttgtttgtgt gccctaggca tgcactccag 2449 ttacaaatcg tgcgacggtc gcaccgtttg cagcacatgc tgtctcttaa tataacattt 2509 acttgaactg actggtactg aagtgctggt ctcttgtacc aaggattaga tgtaattatg 2569 tactgaacaa agcagcacca tgccatcttg ctgtaaaatc ttaagttgca agaagagttc 2629 tgcatcttgg aaagtgaaag ggtgatattt ggtcaccgta ctagatagat tagtacattt 2689 tactagtaat aaccccagtc atttgttaac tgcagattta agaaataagt acagaaaaca 2749 ttagactttt gtttttttca tttgattgaa gtgtgcattt gagatcattg gctaggataa 2809 ggtgttcatg tttgtttcat tgatactgta ttcttcactg aagtctttgc agtcatggcc 2869 ccaaactaat caggaacttt tctctattag get gag gtc agg gca ttc ttc gat 2923

Ala GIu VaI Arg Ala Phe Phe Asp 310 315 gtt cat gag caa gaa ggg age cac gca gga ggt gtc cac etc gag atg 2971 VaI His GIu GIn GIu GIy Ser His Ala GIy GIy VaI His Leu GIu Met 320 325 330 ace ggc cag aac gtg ac 2988

Thr GIy GIn Asn VaI 335

<210> 6 <211> 337 <212> PRT

<213> Festuca arundinacea

<400> 6

GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn 1 5 10 15

He Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser Ala VaI Leu Thr 20 25 30

Phe GIy GIy GIn Met Pro VaI VaI Lys VaI GIy Arg Met Ala GIy GIn 35 40 45

Phe Ala Lys Pro Arg Ser Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys 50 55 60

Leu Pro Ser Tyr Arg GIy Asp Asn He Asn GIy Asp Ala Phe Asn GIu 65 70 75 80

Lys Ser Arg He Pro Asp Pro GIn Arg Met He Arg Ala Tyr Thr GIn 85 90 95

Ser Ala Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr 100 105 HO

Ala Ala Met GIn Arg VaI Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn 115 120 125

Ser GIu GIn GIy Asp Arg Tyr Arg GIu Leu Ala His Arg VaI Asp GIu 130 135 140

Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr Leu Asp His Pro VaI 145 150 155 160

Met Ser Ser Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro 165 170 175 Tyr GIu GIn Ala Leu Thr Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr 180 185 190

Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu 195 200 205

Asp GIy Ala His VaI GIu Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy 210 215 220

He Lys VaI Ser Asp Lys Met Asn Pro Ser Asp Leu VaI Lys Leu He 225 230 235 240

GIu He Leu Asn Pro Thr Asn Lys Ala GIy GIy He Thr He He Thr 245 250 255

Arg Met GIy Ala GIu Asn Met Arg VaI Lys Leu Pro His Leu He Arg 260 265 270

Ala VaI Arg Asn Ser GIy GIn He VaI Thr Trp He Thr Asp Pro Met 275 280 285

His GIy Asn Thr He Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe 290 295 300

Asp Ser He Leu Ala GIu VaI Arg Ala Phe Phe Asp VaI His GIu GIn 305 310 315 320

GIu GIy Ser His Ala GIy GIy VaI His Leu GIu Met Thr GIy GIn Asn 325 330 335

VaI

<210> 7 <211> 1011

<212> DNA

<213> Festuca arundinacea

<220> <221> CDS

<222> (1) .. (1011) <223> <400> 7 cag ggc ggc gac tgc gcc gag age ttc aag gag ttc aac ggc aac aac 48

GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn 1 5 10 15 ate cgc gac ace ttc cgc gtc etc etc cag atg tec gcc gta etc ace 96 lie Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser Ala VaI Leu Thr 20 25 30 ttc ggc ggc cag atg ccc gtc etc aag gtt ggg agg atg gcc ggc cag 144 Phe GIy GIy GIn Met Pro VaI Leu Lys VaI GIy Arg Met Ala GIy GIn 35 40 45 ttc gcg aag ccg agg teg gac aac ttc gag gtc aag gac gga gtg aag 192 Phe Ala Lys Pro Arg Ser Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys

50 55 60 ctg ccc age tac aga ggg gac aac ate aac ggg gac gca ttc aac gag 240 Leu Pro Ser Tyr Arg GIy Asp Asn lie Asn GIy Asp Ala Phe Asn GIu 65 70 75 80 aag agt cgc ate ccc gat cct cag agg atg ate agg gca tac ace cag 288 Lys Ser Arg lie Pro Asp Pro GIn Arg Met lie Arg Ala Tyr Thr GIn 85 90 95 tec get gcc acg etc aac etc etc cgc gcg ttc gcc atg gga ggc tat 336 Ser Ala Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr 100 105 110 get gcc atg cag egg gtc acg cag tgg aac etc gat ttc act gaa aac 384 Ala Ala Met GIn Arg VaI Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn 115 120 125 age gag cag ggc gac agg tac cgc gaa ttg gca cac agg gtt gat gaa 432 Ser GIu GIn GIy Asp Arg Tyr Arg GIu Leu Ala His Arg VaI Asp GIu

130 135 140 gcc ctt ggc ttc atg tct get get ggg eta aca ttg gac cac ccg gtt 480 Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr Leu Asp His Pro VaI 145 150 155 160 atg tea agt act gaa ttc tgg ace tct cat gag tgc ctg etc eta ccc 528 Met Ser Ser Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro 165 170 175 tac gag caa get eta ace cgt cag gac tea ace tct ggt ctt ttc tac 576 Tyr GIu GIn Ala Leu Thr Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr 180 185 190 gac tgt tct gcc cat atg etc tgg gtc ggt gaa cgc act cgc cag ctt 624 Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu 195 200 205 gat ggt get cat gtt gaa ttc etc agg ggt gtt get aac cct ctt ggc 672 Asp GIy Ala His VaI GIu Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy 210 215 220 ate aag gtg agt gac aaa atg aac ccc age gac ttg gtg aag ctg att 720 lie Lys VaI Ser Asp Lys Met Asn Pro Ser Asp Leu VaI Lys Leu lie

225 230 235 240 gag ata ttg aac cca aca aac aaa get ggg aga att ace ate att aca 768 GIu lie Leu Asn Pro Thr Asn Lys Ala GIy Arg lie Thr lie lie Thr 245 250 255

5 aga atg ggg gca gag aac atg agg gtc aaa tta cct cat ctt ate cgt 816

Arg Met GIy Ala GIu Asn Met Arg VaI Lys Leu Pro His Leu lie Arg

260 265 270

10 get gtc cgc aat tct ggt caa att gtt ace tgg ate act gat ccc atg 864 Ala VaI Arg Asn Ser GIy GIn lie VaI Thr Trp lie Thr Asp Pro Met 275 280 285 cat ggg aac ace ate aag get cct tgt ggt eta aag aca cgc ccc ttt 912 15 His GIy Asn Thr lie Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe 290 295 300 gac tct att ctg get gag gtc agg gca ttc ttc gat gtt cat gag caa 960 Asp Ser lie Leu Ala GIu VaI Arg Ala Phe Phe Asp VaI His GIu GIn 20 305 310 315 320 gaa ggg age cac gca gga ggt gtc cac etc gag atg ace ggc cag aac 1008 GIu GIy Ser His Ala GIy GIy VaI His Leu GIu Met Thr GIy GIn Asn 325 330 335

25 gtg 1011

VaI

30

<210> 8

<211> 337

35 <212> PRT

<213> Festuca arundinacea

40

<400> 8

GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn 1 5 10 15

45

He Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser Ala VaI Leu Thr 20 25 30

50

Phe GIy GIy GIn Met Pro VaI Leu Lys VaI GIy Arg Met Ala GIy GIn 35 40 45

55 Phe Ala Lys Pro Arg Ser Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys 50 55 60

Leu Pro Ser Tyr Arg GIy Asp Asn He Asn GIy Asp Ala Phe Asn GIu 60 65 70 75 80

Lys Ser Arg He Pro Asp Pro GIn Arg Met He Arg Ala Tyr Thr GIn 85 90 95

Ser Ala Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr 100 105 110

Ala Ala Met GIn Arg VaI Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn 115 120 125

Ser GIu GIn GIy Asp Arg Tyr Arg GIu Leu Ala His Arg VaI Asp GIu 130 135 140

Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr Leu Asp His Pro VaI 145 150 155 160

Met Ser Ser Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro

165 170 175

Tyr GIu GIn Ala Leu Thr Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr 180 185 190

Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu 195 200 205

Asp GIy Ala His VaI GIu Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy 210 215 220

lie Lys VaI Ser Asp Lys Met Asn Pro Ser Asp Leu VaI Lys Leu lie 225 230 235 240

GIu lie Leu Asn Pro Thr Asn Lys Ala GIy Arg lie Thr lie lie Thr

245 250 255

Arg Met GIy Ala GIu Asn Met Arg VaI Lys Leu Pro His Leu lie Arg 260 265 270

Ala VaI Arg Asn Ser GIy GIn lie VaI Thr Trp lie Thr Asp Pro Met 275 280 285

His GIy Asn Thr lie Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe 290 295 300

Asp Ser lie Leu Ala GIu VaI Arg Ala Phe Phe Asp VaI His GIu GIn 305 310 315 320

GIu GIy Ser His Ala GIy GIy VaI His Leu GIu Met Thr GIy GIn Asn

325 330 335 VaI

<210> 9

<211> 1011

<212> DNA <213> Festuca arundinacea

<220>

<221> CDS

<222> (1) .. (1011) <223>

<400> 9 cag ggc ggc gac tgc gcc gag age ttc aag gag ttc aac gcc aac aac 48 GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn Ala Asn Asn 1 5 10 15 ate cgc gac ace ttc cgc gtc ctg eta cag atg ggc gcc gtc etc atg 96 lie Arg Asp Thr Phe Arg VaI Leu Leu GIn Met GIy Ala VaI Leu Met 20 25 30 ttc ggc gga cag gtc ccc gtc gtc aag gtg ggg agg atg gcg ggc cag 144 Phe GIy GIy GIn VaI Pro VaI VaI Lys VaI GIy Arg Met Ala GIy GIn 35 40 45 ttc gcc aag ccc agg teg ggc aac ttc gag gag aag gac ggg gtc aag 192 Phe Ala Lys Pro Arg Ser GIy Asn Phe GIu GIu Lys Asp GIy VaI Lys 50 55 60 ctg ccc age tac agg ggc gac aac ate aac ggc gac gcc ttc gac gtc 240 Leu Pro Ser Tyr Arg GIy Asp Asn lie Asn GIy Asp Ala Phe Asp VaI 65 70 75 80 aag age cgc acg ccg gac ccg gag agg atg ate agg gcg tac gcg cag 288

Lys Ser Arg Thr Pro Asp Pro GIu Arg Met lie Arg Ala Tyr Ala GIn 85 90 95 tec gtc gcc acg etc aac ttg etc cgc gcc ttc gcc ace gga gga tac 336 Ser VaI Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Thr GIy GIy Tyr 100 105 110 gcc gcg atg cag egg gtc ate cag tgg aac etc gat ttc atg gac cac 384 Ala Ala Met GIn Arg VaI lie GIn Trp Asn Leu Asp Phe Met Asp His 115 120 125 aac gag cag gga gac agg tac cgc gag ttg gca cat agg gtg gat gag 432 Asn GIu GIn GIy Asp Arg Tyr Arg GIu Leu Ala His Arg VaI Asp GIu 130 135 140 get ctt ggc ttc atg act gca get ggg ctg ggg att gac cat ccg ata 480 Ala Leu GIy Phe Met Thr Ala Ala GIy Leu GIy lie Asp His Pro lie 145 150 155 160 atg aca act ace gac ttc tgg aca tec cac gag tgt etc etc ttg ccc 528 Met Thr Thr Thr Asp Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro 165 170 175 tat gag cag get ctt ace cgt gag gat tec aca agt ggc ctt ttc tat 576 Tyr GIu GIn Ala Leu Thr Arg GIu Asp Ser Thr Ser GIy Leu Phe Tyr 180 185 190 gac tgc tea get cac atg ctg tgg gtt ggt gag cgc act cgt caa etc 624 Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu 195 200 205 gat ggg get cat gtt gaa ttc etc cgt ggt att gee aac ccc ctt ggc 672 Asp GIy Ala His VaI GIu Phe Leu Arg GIy lie Ala Asn Pro Leu GIy 210 215 220 ata aag gtg age gac aaa atg gac ccc get gaa ttg gtg aag ctg att 720 lie Lys VaI Ser Asp Lys Met Asp Pro Ala GIu Leu VaI Lys Leu lie 225 230 235 240 gac att ttg aac cca tea aac aag ccg gga agg ate ace ata att aca 768 Asp lie Leu Asn Pro Ser Asn Lys Pro GIy Arg lie Thr lie lie Thr 245 250 255 agg atg gga get gag aac atg agg gtg aag ttg cct cat etc ate tgc 816 Arg Met GIy Ala GIu Asn Met Arg VaI Lys Leu Pro His Leu lie Cys 260 265 270 gca gtc cgc aat tct gga cag att gtt aca tgg att act gat ccc atg 864

Ala VaI Arg Asn Ser GIy GIn lie VaI Thr Trp lie Thr Asp Pro Met 275 280 285 cac gga aac aca ate aag gcg cca tgt ggt ctt aag act cgt cca ttc 912 His GIy Asn Thr lie Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe 290 295 300 gac tec att atg aac gag gtg cga gca ttc ttc gac gtg cac gat caa 960 Asp Ser lie Met Asn GIu VaI Arg Ala Phe Phe Asp VaI His Asp GIn 305 310 315 320 gaa gga age cac cca gga ggt ate cac ctt gaa atg ace ggg cag aac 1008 GIu GIy Ser His Pro GIy GIy lie His Leu GIu Met Thr GIy GIn Asn 325 330 335 gtg 1011 VaI

<210> 10

<211> 337 <212> PRT

<213> Festuca arundinacea

<400> 10 GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn Ala Asn Asn

1 5 10 15

lie Arg Asp Thr Phe Arg VaI Leu Leu GIn Met GIy Ala VaI Leu Met 20 25 30

Phe GIy GIy GIn VaI Pro VaI VaI Lys VaI GIy Arg Met Ala GIy GIn 35 40 45

Phe Ala Lys Pro Arg Ser GIy Asn Phe GIu GIu Lys Asp GIy VaI Lys 50 55 60

Leu Pro Ser Tyr Arg GIy Asp Asn lie Asn GIy Asp Ala Phe Asp VaI 65 70 75 80

Lys Ser Arg Thr Pro Asp Pro GIu Arg Met lie Arg Ala Tyr Ala GIn 85 90 95

Ser VaI Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Thr GIy GIy Tyr 100 105 110

Ala Ala Met GIn Arg VaI lie GIn Trp Asn Leu Asp Phe Met Asp His 115 120 125

Asn GIu GIn GIy Asp Arg Tyr Arg GIu Leu Ala His Arg VaI Asp GIu 130 135 140

Ala Leu GIy Phe Met Thr Ala Ala GIy Leu GIy lie Asp His Pro lie 145 150 155 160

Met Thr Thr Thr Asp Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro 165 170 175

Tyr GIu GIn Ala Leu Thr Arg GIu Asp Ser Thr Ser GIy Leu Phe Tyr 180 185 190

Asp Cys Ser Ala His Met Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu 195 200 205

Asp GIy Ala His VaI GIu Phe Leu Arg GIy lie Ala Asn Pro Leu GIy 210 215 220

He Lys VaI Ser Asp Lys Met Asp Pro Ala GIu Leu VaI Lys Leu He 225 230 235 240

Asp He Leu Asn Pro Ser Asn Lys Pro GIy Arg He Thr He He Thr 245 250 255 Arg Met GIy Ala GIu Asn Met Arg VaI Lys Leu Pro His Leu lie Cys 260 265 270

Ala VaI Arg Asn Ser GIy GIn lie VaI Thr Trp lie Thr Asp Pro Met 275 280 285

His GIy Asn Thr lie Lys Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe 290 295 300

Asp Ser lie Met Asn GIu VaI Arg Ala Phe Phe Asp VaI His Asp GIn 305 310 315 320

GIu GIy Ser His Pro GIy GIy lie His Leu GIu Met Thr GIy GIn Asn

325 330 335

VaI

<210> 11

<211> 1011 <212> DNA

<213> Festuca arundinacea

<220> <221> CDS <222> (1) .. (1011) <223>

<400> 11 cag ggc ggc gac tgc gcc gag age ttc aag gag ttc aac gcc aac aac 48 GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn Ala Asn Asn 1 5 10 15 ate egg gac ace ttc cgc gtc etc eta cag atg tec gtc gtg etc atg 96 lie Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser VaI VaI Leu Met 20 25 30 ttc ggt ggg cag atg ccc ate ate aag gta gga aga atg gca ggt caa 144 Phe GIy GIy GIn Met Pro lie lie Lys VaI GIy Arg Met Ala GIy GIn 35 40 45 ttt gca aag cca aga tea gat ggc ttt gaa gag agg gat gga gtg aag 192 Phe Ala Lys Pro Arg Ser Asp GIy Phe GIu GIu Arg Asp GIy VaI Lys 50 55 60 ttg cct age tac aga gga gac aac att aat ggg gat gta ttt gat gag 240 Leu Pro Ser Tyr Arg GIy Asp Asn lie Asn GIy Asp VaI Phe Asp GIu 65 70 75 80 aag tea aga gtg cca gat cca caa cgc atg ate agg gcg tac tea cag 288 Lys Ser Arg VaI Pro Asp Pro GIn Arg Met lie Arg Ala Tyr Ser GIn

85 90 95 tea gca gca aca ctg aat ttg etc cga gcg ttt get act gga ggt tat 336 Ser Ala Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Thr GIy GIy Tyr 100 105 110 gcc gcc atg cag agg gta aca egg tgg aat ctt gac ttc aca gag aaa 384 Ala Ala Met GIn Arg VaI Thr Arg Trp Asn Leu Asp Phe Thr GIu Lys 115 120 125 agt gaa cag ggt gat egg tac atg gag ctg get cat cga gtt gac gag 432 Ser GIu GIn GIy Asp Arg Tyr Met GIu Leu Ala His Arg VaI Asp GIu 130 135 140 get ttg ggg ttc atg tea get get ggg etc act gta gat cac cct ata 480 Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr VaI Asp His Pro lie 145 150 155 160 atg aga acg aca gaa ttc tgg aca tea cat gaa tgt ctt ctt ctt ccc 528 Met Arg Thr Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro

165 170 175 tat gag cag gca ctt act cgt gag gat tec ace tct ggc etc tat tat 576 Tyr GIu GIn Ala Leu Thr Arg GIu Asp Ser Thr Ser GIy Leu Tyr Tyr 180 185 190 gac tgt tct gcc cac ttc ctg tgg get gga gag cgt act cgc cag ctt 624 Asp Cys Ser Ala His Phe Leu Trp Ala GIy GIu Arg Thr Arg GIn Leu 195 200 205 gat ggc gcc cat gtg gag ttt etc aga ggc att gcc aac ccc ctg ggt 672 Asp GIy Ala His VaI GIu Phe Leu Arg GIy lie Ala Asn Pro Leu GIy 210 215 220 ate aag gtc age gac aaa atg gac ccc gaa gaa ctt gtg aag ttg att 720 lie Lys VaI Ser Asp Lys Met Asp Pro GIu GIu Leu VaI Lys Leu lie 225 230 235 240 gat ate tta aac cct gaa aac agg ccg gga aga ata act ate ate acg 768 Asp lie Leu Asn Pro GIu Asn Arg Pro GIy Arg lie Thr lie lie Thr

245 250 255 aga atg gga cct gag aac atg aga gtc aaa etc ccc cac etc ate cgt 816 Arg Met GIy Pro GIu Asn Met Arg VaI Lys Leu Pro His Leu lie Arg 260 265 270 get gtt cgt ggt get ggc cag ata gta aca tgg gtg act gac cca atg 864 Ala VaI Arg GIy Ala GIy GIn lie VaI Thr Trp VaI Thr Asp Pro Met 275 280 285 cat ggg aac aca atg aaa gcc cct tgt ggc ctg aag acg cgc tec ttc 912

His GIy Asn Thr Met Lys Ala Pro Cys GIy Leu Lys Thr Arg Ser Phe 290 295 300 gac aga att ttg get gag gtg cgt gca ttc ttt gat gtc cat gag caa 960 Asp Arg lie Leu Ala GIu VaI Arg Ala Phe Phe Asp VaI His GIu GIn 305 310 315 320 gaa ggg age cac ccg ggg gga gtt cat ctg gag atg ace ggg cag aac 1008 GIu GIy Ser His Pro GIy GIy VaI His Leu GIu Met Thr GIy GIn Asn 325 330 335 gtg 1011 VaI

<210> 12

<211> 337

<212> PRT <213> Festuca arundinacea

<400> 12

GIn GIy GIy Asp Cys Ala GIu Ser Phe Lys GIu Phe Asn Ala Asn Asn 1 5 10 15

He Arg Asp Thr Phe Arg VaI Leu Leu GIn Met Ser VaI VaI Leu Met 20 25 30

Phe GIy GIy GIn Met Pro He He Lys VaI GIy Arg Met Ala GIy GIn 35 40 45

Phe Ala Lys Pro Arg Ser Asp GIy Phe GIu GIu Arg Asp GIy VaI Lys 50 55 60

Leu Pro Ser Tyr Arg GIy Asp Asn He Asn GIy Asp VaI Phe Asp GIu 65 70 75 80

Lys Ser Arg VaI Pro Asp Pro GIn Arg Met He Arg Ala Tyr Ser GIn 85 90 95

Ser Ala Ala Thr Leu Asn Leu Leu Arg Ala Phe Ala Thr GIy GIy Tyr 100 105 HO

Ala Ala Met GIn Arg VaI Thr Arg Trp Asn Leu Asp Phe Thr GIu Lys 115 120 125

Ser GIu GIn GIy Asp Arg Tyr Met GIu Leu Ala His Arg VaI Asp GIu 130 135 140

Ala Leu GIy Phe Met Ser Ala Ala GIy Leu Thr VaI Asp His Pro He 145 150 155 160

Met Arg Thr Thr GIu Phe Trp Thr Ser His GIu Cys Leu Leu Leu Pro 165 170 175 Tyr GIu GIn Ala Leu Thr Arg GIu Asp Ser Thr Ser GIy Leu Tyr Tyr 180 185 190

Asp Cys Ser Ala His Phe Leu Trp Ala GIy GIu Arg Thr Arg GIn Leu 195 200 205

Asp GIy Ala His VaI GIu Phe Leu Arg GIy lie Ala Asn Pro Leu GIy 210 215 220

lie Lys VaI Ser Asp Lys Met Asp Pro GIu GIu Leu VaI Lys Leu lie 225 230 235 240

Asp lie Leu Asn Pro GIu Asn Arg Pro GIy Arg lie Thr lie lie Thr 245 250 255

Arg Met GIy Pro GIu Asn Met Arg VaI Lys Leu Pro His Leu lie Arg 260 265 270

Ala VaI Arg GIy Ala GIy GIn lie VaI Thr Trp VaI Thr Asp Pro Met 275 280 285

His GIy Asn Thr Met Lys Ala Pro Cys GIy Leu Lys Thr Arg Ser Phe 290 295 300

Asp Arg lie Leu Ala GIu VaI Arg Ala Phe Phe Asp VaI His GIu GIn 305 310 315 320

GIu GIy Ser His Pro GIy GIy VaI His Leu GIu Met Thr GIy GIn Asn 325 330 335

VaI

<210> 13

<211> 1470

<212> DNA

<213> Festuca arundinacea

<220>

<221> CDS

<222> (1) .. (1185)

<400> 13 gag age ttc aag gag ttc aac ggc aac aac ate cgc gac ace ttc cgc 48

GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn lie Arg Asp Thr Phe Arg 1 5 10 15 gtc etc etc cag atg tec gee gta etc ace ttc ggc ggc cag atg ccc 96 VaI Leu Leu GIn Met Ser Ala VaI Leu Thr Phe GIy GIy GIn Met Pro 20 25 30 gtc ate aag gtt ggg agg atg gcc ggc cag ttc gcg aag ccg agg teg 144

VaI lie Lys VaI GIy Arg Met Ala GIy GIn Phe Ala Lys Pro Arg Ser 35 40 45 gac aac ttc gag gtc aag gac gga gtg aag ctg ccc age tac aga ggg 192

Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys Leu Pro Ser Tyr Arg GIy 50 55 60 gac aac ate aac ggg gac gca ttc aac gag aag agt cgc ate ccc gat 240

Asp Asn lie Asn GIy Asp Ala Phe Asn GIu Lys Ser Arg lie Pro Asp

65 70 75 80 cct cag agg atg ate agg gca tac ace cag tec get gcc acg etc aac 288 Pro GIn Arg Met lie Arg Ala Tyr Thr GIn Ser Ala Ala Thr Leu Asn

85 90 95 etc etc cgc gcg ttc gcc atg gga ggc tat get gcc atg cag egg gtc 336

Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr Ala Ala Met GIn Arg VaI 100 105 110 acg cag tgg aac etc gat ttc act gaa aac age gag cag ggc gac agg 384

Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn Ser GIu GIn GIy Asp Arg 115 120 125 tac cgc gaa ttg gca cac agg gtt gat gaa gcc ctt ggc ttc atg tct 432

Tyr Arg GIu Leu Ala His Arg VaI Asp GIu Ala Leu GIy Phe Met Ser 130 135 140 get get ggg eta aca ttg gac cac ccg gtt atg tea agt act gaa ttc 480

Ala Ala GIy Leu Thr Leu Asp His Pro VaI Met Ser Ser Thr GIu Phe

145 150 155 160 tgg ace tct cat gag tgc ctg etc eta ccc tac gag caa get eta ace 528 Trp Thr Ser His GIu Cys Leu Leu Leu Pro Tyr GIu GIn Ala Leu Thr

165 170 175 cgt cag gac tea ace tct ggt ctt ttc tac gac tgt tct gcc cac atg 576

Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr Asp Cys Ser Ala His Met 180 185 190 etc tgg gtc ggt gaa cgc act cgc cag ctt gac ggt get cat gtt gaa 624

Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu Asp GIy Ala His VaI GIu 195 200 205 ttc etc agg ggt gtt get aac cct ctt ggc ate aag gtg age gac aaa 672

Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy lie Lys VaI Ser Asp Lys 210 215 220 atg aac ccc age gac ttg gtg aag ctg att gag ata ttg aac cca aca 720

Met Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn Pro Thr

225 230 235 240 aac aaa get ggg aga att ace ate att ata aga atg ggg gca gag aac 768 Asn Lys Ala GIy Arg lie Thr lie lie lie Arg Met GIy Ala GIu Asn

245 250 255 atg agg gtc aaa tta cct cat etc ate cgt get gtc cgc aat tct ggt 816

Met Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn Ser GIy 260 265 270 caa att gtt ace tgg ate act gat ccc atg cac ggg aac ace ate aag 864

GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys 275 280 285 get ect tgt ggt eta aag aca cgc cec ttt gac tet att ctg get gag 912 Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu Ala GIu 290 295 300 gtc agg gca ttc ttc gat gtt cat gag caa gaa ggg agt cac gca gga 960 VaI Arg Ala Phe Phe Asp VaI His GIu GIn GIu GIy Ser His Ala GIy 305 310 315 320 ggt gtc cac etc gag atg act ggg cag aac gtg aca gag tgc ate ggt 1008

GIy VaI His Leu GIu Met Thr GIy GIn Asn VaI Thr GIu Cys lie GIy 325 330 335 gga tea cga act gtg ace ttt gac gac ctg gcc gac cgc tac cac aca 1056 GIy Ser Arg Thr VaI Thr Phe Asp Asp Leu Ala Asp Arg Tyr His Thr 340 345 350 cac tgc gac ccg agg ctg aac gcg tec caa tct ctg gag ctt gcc ttc 1104 His Cys Asp Pro Arg Leu Asn Ala Ser GIn Ser Leu GIu Leu Ala Phe 355 360 365 ate att get gag agg ctg agg aag agg agg ace egg tea teg aag ctt 1152 lie lie Ala GIu Arg Leu Arg Lys Arg Arg Thr Arg Ser Ser Lys Leu 370 375 380 aac age gtc ttg cca ttg cca tct ggt ttc tga aacgcctagc cagaaatgga 1205 Asn Ser VaI Leu Pro Leu Pro Ser GIy Phe 385 390 acaggcggag tagatagttg cagcagcgtt tgatgcgtat tccttttgtt ggtgggtgat 1265 cttgataaaa actgtatact actcgtgagc tttctgtgtg aggggagggg ggagggatct 1325 ctaatgttta tgttggtcta tactgtgccg tgcactttta tgtaaggttt caaaatcgtt 1385 tctatttatg tcttctatat ataagagaat aataatacaa gacagaaggc ttcggggtaa 1445 aaaaaaaaaa aaaaaaaaag gatcc 1470

<210> 14

<211> 394

<212> PRT <213> Festuca arundinacea

<400> 14

GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn lie Arg Asp Thr Phe Arg 1 5 10 15

VaI Leu Leu GIn Met Ser Ala VaI Leu Thr Phe GIy GIy GIn Met Pro 20 25 30

VaI lie Lys VaI GIy Arg Met Ala GIy GIn Phe Ala Lys Pro Arg Ser 35 40 45

Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys Leu Pro Ser Tyr Arg GIy 50 55 60 Asp Asn lie Asn GIy Asp Ala Phe Asn GIu Lys Ser Arg lie Pro Asp 65 70 75 80

Pro GIn Arg Met lie Arg Ala Tyr Thr GIn Ser Ala Ala Thr Leu Asn 85 90 95

Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr Ala Ala Met GIn Arg VaI 100 105 110

Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn Ser GIu GIn GIy Asp Arg 115 120 125

Tyr Arg GIu Leu Ala His Arg VaI Asp GIu Ala Leu GIy Phe Met Ser 130 135 140

Ala Ala GIy Leu Thr Leu Asp His Pro VaI Met Ser Ser Thr GIu Phe 145 150 155 160

Trp Thr Ser His GIu Cys Leu Leu Leu Pro Tyr GIu GIn Ala Leu Thr 165 170 175

Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr Asp Cys Ser Ala His Met 180 185 190

Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu Asp GIy Ala His VaI GIu 195 200 205

Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy lie Lys VaI Ser Asp Lys

210 215 220

Met Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn Pro Thr 225 230 235 240

Asn Lys Ala GIy Arg lie Thr lie lie lie Arg Met GIy Ala GIu Asn 245 250 255

Met Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn Ser GIy 260 265 270

GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys 275 280 285

Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu Ala GIu 290 295 300

VaI Arg Ala Phe Phe Asp VaI His GIu GIn GIu GIy Ser His Ala GIy 305 310 315 320 GIy VaI His Leu GIu Met Thr GIy GIn Asn VaI Thr GIu Cys lie GIy 325 330 335

GIy Ser Arg Thr VaI Thr Phe Asp Asp Leu Ala Asp Arg Tyr His Thr 340 345 350

His Cys Asp Pro Arg Leu Asn Ala Ser GIn Ser Leu GIu Leu Ala Phe 355 360 365

He He Ala GIu Arg Leu Arg Lys Arg Arg Thr Arg Ser Ser Lys Leu 370 375 380

Asn Ser VaI Leu Pro Leu Pro Ser GIy Phe 385 390

<210> 15

<211> 1504 <212> DNA

<213> Festuca arundinacea

<220> <221> CDS

<222> (1) .. (1185)

<400> 15 gag age ttc aag gag ttc aac ggc aac aac ate cgc gac ace ttc cgc 48 GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn He Arg Asp Thr Phe Arg

1 5 10 15 gtc etc etc cag atg tec gee gta etc ace ttc ggc ggc cag atg ccc 96 VaI Leu Leu GIn Met Ser Ala VaI Leu Thr Phe GIy GIy GIn Met Pro 20 25 30 gtc ate aag gtt ggg agg atg gcc ggc cag ttc gcg aag ccg agg teg 144 VaI He Lys VaI GIy Arg Met Ala GIy GIn Phe Ala Lys Pro Arg Ser 35 40 45 gac aac ttc gag gtc aag gac gga gtg aag ctg ccc age tac agg ggc 192 Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys Leu Pro Ser Tyr Arg GIy 50 55 60 gac aac ate aac ggc gac gcc ttc gac gtc aag age cgc acg ccg gac 240 Asp Asn He Asn GIy Asp Ala Phe Asp VaI Lys Ser Arg Thr Pro Asp 65 70 75 80 ccg gag agg atg ate agg gcg tac gcg cag tec gtc gcc acg etc aac 288 Pro GIu Arg Met He Arg Ala Tyr Ala GIn Ser VaI Ala Thr Leu Asn

85 90 95 ttg etc cgc gcc ttc gcc ace gga gga tac gcc gcg atg cag egg gtc 336 Leu Leu Arg Ala Phe Ala Thr GIy GIy Tyr Ala Ala Met GIn Arg VaI 100 105 HO ate cag tgg aac etc gat ttc atg gac cac aac gag cag gga gac agg 384 He GIn Trp Asn Leu Asp Phe Met Asp His Asn GIu GIn GIy Asp Arg 115 120 125 tac cgc gag ttg gca cat agg gtg gat gag get ctt ggc ttc atg act 432 Tyr Arg GIu Leu Ala His Arg VaI Asp GIu Ala Leu GIy Phe Met Thr 130 135 140 gca get ggg ctg ggg att gac cat ccg ata atg aca act ace gac ttc 480 Ala Ala GIy Leu GIy lie Asp His Pro lie Met Thr Thr Thr Asp Phe 145 150 155 160 tgg aca tec cac gag tgt etc etc ttg ccc tat gag cag get ctt ace 528 Trp Thr Ser His GIu Cys Leu Leu Leu Pro Tyr GIu GIn Ala Leu Thr 165 170 175 cgt gag gat tec aca agt ggc ctt ttc tac gac tgt tct gcc cac atg 576 Arg GIu Asp Ser Thr Ser GIy Leu Phe Tyr Asp Cys Ser Ala His Met 180 185 190 etc tgg gtc ggt gaa cgc act cgc cag ctt gac ggt get cat gtt gaa 624 Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu Asp GIy Ala His VaI GIu 195 200 205 ttc etc agg ggt gtt get aac cct ctt ggc ate aag gtg age gac aaa 672 Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy lie Lys VaI Ser Asp Lys 210 215 220 atg aac ccc age gac ttg gtg aag ctg att gag ata ttg aac cca aca 720 Met Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn Pro Thr 225 230 235 240 aac aaa get ggg aga att ace ate att aca aga atg ggg gca gag aac 768

Asn Lys Ala GIy Arg lie Thr lie lie Thr Arg Met GIy Ala GIu Asn 245 250 255 atg agg gtc aaa tta cct cat etc ate cgt get gcc cgc aat tct ggt 816 Met Arg VaI Lys Leu Pro His Leu lie Arg Ala Ala Arg Asn Ser GIy 260 265 270 caa att gtt ace tgg ate act gat ccc atg cac ggg aac ace ate aag 864 GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys 275 280 285 get cct tgt ggt eta aag aca cgc ccc ttt gac tct att ctg get gag 912 Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu Ala GIu 290 295 300 gtc agg gca ttc ttc gat gtt cat gag caa gaa ggg agt cac gca gga 960 VaI Arg Ala Phe Phe Asp VaI His GIu GIn GIu GIy Ser His Ala GIy 305 310 315 320 ggt gtc cac etc gag atg act ggg cag aac gtg aca gag tgc ate ggt 1008

GIy VaI His Leu GIu Met Thr GIy GIn Asn VaI Thr GIu Cys lie GIy 325 330 335 gga tea cga act gtg ace ttt gac gac ctg gcc gac cgc tac cac aca 1056 GIy Ser Arg Thr VaI Thr Phe Asp Asp Leu Ala Asp Arg Tyr His Thr 340 345 350 cat tgc gac ccg agg ctg aac gcg tec caa tct ctg gag ctt gcc ttc 1104 His Cys Asp Pro Arg Leu Asn Ala Ser GIn Ser Leu GIu Leu Ala Phe 355 360 365 ate att get gag agg ttg agg aag agg agg ace egg tea teg aag ctt 1152 He He Ala GIu Arg Leu Arg Lys Arg Arg Thr Arg Ser Ser Lys Leu 370 375 380 aac age gtc ttg cca ttg cca tct ggt ttc tga aacgcctagc cagaaatgga 1205 Asn Ser VaI Leu Pro Leu Pro Ser GIy Phe 385 390 acaggcggag tagatagttg cagcagcgtt tgatgcgtat tccttttgtt ggtgggtgat 1265 cttgataaaa actgtatact actcgtgagc tttctgtgtg aggggagggg ggagggatct 1325 ctaatgttta tgttggtcta tactgtgccg tgcactttta tgtaaggttt caaaatcgtt 1385 tctatttatg tcttctatat ataagagaat aataatacaa gtcagaaggc ttcggggctt 1445 caagtacttg gcaattgctc cttttttgtc caaaaaaaaa aaaaaaaaaa aaaggatcc 1504

<210> 16 <211> 394

<212> PRT

<213> Festuca arundinacea

<400> 16

GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn He Arg Asp Thr Phe Arg 1 5 10 15

VaI Leu Leu GIn Met Ser Ala VaI Leu Thr Phe GIy GIy GIn Met Pro 20 25 30

VaI He Lys VaI GIy Arg Met Ala GIy GIn Phe Ala Lys Pro Arg Ser 35 40 45

Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys Leu Pro Ser Tyr Arg GIy 50 55 60

Asp Asn He Asn GIy Asp Ala Phe Asp VaI Lys Ser Arg Thr Pro Asp 65 70 75 80

Pro GIu Arg Met He Arg Ala Tyr Ala GIn Ser VaI Ala Thr Leu Asn 85 90 95

Leu Leu Arg Ala Phe Ala Thr GIy GIy Tyr Ala Ala Met GIn Arg VaI 100 105 HO

He GIn Trp Asn Leu Asp Phe Met Asp His Asn GIu GIn GIy Asp Arg 115 120 125

Tyr Arg GIu Leu Ala His Arg VaI Asp GIu Ala Leu GIy Phe Met Thr 130 135 140

Ala Ala GIy Leu GIy He Asp His Pro He Met Thr Thr Thr Asp Phe 145 150 155 160 Trp Thr Ser His GIu Cys Leu Leu Leu Pro Tyr GIu GIn Ala Leu Thr 165 170 175

Arg GIu Asp Ser Thr Ser GIy Leu Phe Tyr Asp Cys Ser Ala His Met 180 185 190

10

Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu Asp GIy Ala His VaI GIu 195 200 205

15 Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy lie Lys VaI Ser Asp Lys 210 215 220

Met Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn Pro Thr 20 225 230 235 240

Asn Lys Ala GIy Arg lie Thr lie lie Thr Arg Met GIy Ala GIu Asn 245 250 255

25

Met Arg VaI Lys Leu Pro His Leu lie Arg Ala Ala Arg Asn Ser GIy 260 265 270

30

GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys 275 280 285

35 Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu Ala GIu 290 295 300

VaI Arg Ala Phe Phe Asp VaI His GIu GIn GIu GIy Ser His Ala GIy 40 305 310 315 320

GIy VaI His Leu GIu Met Thr GIy GIn Asn VaI Thr GIu Cys lie GIy 325 330 335

45

GIy Ser Arg Thr VaI Thr Phe Asp Asp Leu Ala Asp Arg Tyr His Thr 340 345 350

50

His Cys Asp Pro Arg Leu Asn Ala Ser GIn Ser Leu GIu Leu Ala Phe 355 360 365

55 He He Ala GIu Arg Leu Arg Lys Arg Arg Thr Arg Ser Ser Lys Leu 370 375 380

Asn Ser VaI Leu Pro Leu Pro Ser GIy Phe 60 385 390

<210> 17 <211> 1466

<212> DNA

<213> Festuca arundinacea

<220>

<221> CDS

<222> (1) .. (1185) <400> 17 gag age ttc aag gag ttc aac ggc aac aac ate cgc gac ace ttc cgc 48

GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn lie Arg Asp Thr Phe Arg 1 5 10 15 gtc etc etc cag atg tec gee gtc etc ace ttc ggc ggc cag atg cec 96 VaI Leu Leu GIn Met Ser Ala VaI Leu Thr Phe GIy GIy GIn Met Pro 20 25 30 gtc ate aag gtt ggg aga atg gee ggc cag ttc gcg aag ccg agg teg 144 VaI lie Lys VaI GIy Arg Met Ala GIy GIn Phe Ala Lys Pro Arg Ser 35 40 45 gac aac ttc gag gtc aag gac gga gtg aag eta ccc age tac aga ggg 192 Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys Leu Pro Ser Tyr Arg GIy 50 55 60 gac aac ate aac gga gac gca ttc aac gag aag age cgc ate ccc gat 240 Asp Asn lie Asn GIy Asp Ala Phe Asn GIu Lys Ser Arg lie Pro Asp 65 70 75 80 cct cag agg atg ate agg gee tac ace cag tec get gee acg etc aac 288

Pro GIn Arg Met lie Arg Ala Tyr Thr GIn Ser Ala Ala Thr Leu Asn 85 90 95 etc etc cgc get ttc gee atg gga ggc tat get gee atg cag egg gtc 336 Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr Ala Ala Met GIn Arg VaI 100 105 110 ace cag tgg aac etc gat ttc ace gaa aac age gag cag ggt gac agg 384 Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn Ser GIu GIn GIy Asp Arg 115 120 125 tac cgt gaa ttg gca cac agg gtt gat gaa gcc ctt ggc ttc atg tct 432 Tyr Arg GIu Leu Ala His Arg VaI Asp GIu Ala Leu GIy Phe Met Ser 130 135 140 get get ggg eta aca ttg gac cac ccg gtt atg tea agt act gaa ttc 480 Ala Ala GIy Leu Thr Leu Asp His Pro VaI Met Ser Ser Thr GIu Phe 145 150 155 160 tgg ace tct cat gag tgc ctg etc eta ccc tac gag caa get eta ace 528 Trp Thr Ser His GIu Cys Leu Leu Leu Pro Tyr GIu GIn Ala Leu Thr 165 170 175 cgt cag gac tea ace tct ggt ctt ttc tac gac tgt tct gcc cat atg 576 Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr Asp Cys Ser Ala His Met 180 185 190 etc tgg gtc ggt gaa cgc act cgc cag ctt gat ggt get cat gtt gaa 624 Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu Asp GIy Ala His VaI GIu 195 200 205 ttc etc agg ggt gtt get aac cct ctt ggc ate aag gtg agt gac aaa 672 Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy lie Lys VaI Ser Asp Lys 210 215 220 atg aac ccc age gac ttg gtg aag ctg att gag ata ttg aac cca aca 720 Met Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn Pro Thr 225 230 235 240 aac aaa get ggg aga att ace ate att aca aga atg ggg gca gag aac 768 Asn Lys Ala GIy Arg lie Thr lie lie Thr Arg Met GIy Ala GIu Asn 245 250 255 atg agg gtc aaa tta cct cat ctt ate cgt get gtc cgc aat tct ggt 816 Met Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn Ser GIy 260 265 270 caa att gtt ace tgg ate act gat ccc atg cat ggg aac ace ate aag 864

GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys

275 280 285 get cct tgt ggt eta aag aca cgc ccc ttt gac tct att ctg get gag 912 Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu Ala GIu 290 295 300 gtc agg gca ttc ttc gat gtt cat gag caa gaa ggg age cac gca gga 960 VaI Arg Ala Phe Phe Asp VaI His GIu GIn GIu GIy Ser His Ala GIy 305 310 315 320 ggt gtc cac etc gag atg act ggg cag aac gtg aca gag tgc ate ggt 1008 GIy VaI His Leu GIu Met Thr GIy GIn Asn VaI Thr GIu Cys lie GIy 325 330 335 gga teg cga act gtg ace ttt gac gac ctg gcc gac cgc tac cac aca 1056 GIy Ser Arg Thr VaI Thr Phe Asp Asp Leu Ala Asp Arg Tyr His Thr 340 345 350 cac tgc gac ccg agg ctg aac gcg tec cag tct ctg gag ctt gcc ttc 1104 His Cys Asp Pro Arg Leu Asn Ala Ser GIn Ser Leu GIu Leu Ala Phe 355 360 365 ate att get gag agg ctg agg aag agg agg ace egg tct teg aag ctt 1152 lie lie Ala GIu Arg Leu Arg Lys Arg Arg Thr Arg Ser Ser Lys Leu 370 375 380 aac age gtc ttg cca ttg cca tct ggt ttc tga aacgcctagc caggaatgga 1205 Asn Ser VaI Leu Pro Leu Pro Ser GIy Phe 385 390 acaggcggag tagatagttg cagcagcgtt tgatgcgtat tccttttgtt ggtgggtgaa 1265 aaactgtata ctactcgtga gctttctgtg tgaggggagg ggggagggat atctaatgtt 1325 tatgttggtc tatactgtgc cgtgcacttt tatgtaaggt ttcaaaaccg tttctattta 1385 tgtcttctat atataagaga ataataatac aagacagaag gcttcggggc tgcaaaaaaa 1445 aaaaaaaaaa aaaaaggatc c 1466

<210> 18 <211> 394

<212> PRT

<213> Festuca arundinacea <400> 18

GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn lie Arg Asp Thr Phe Arg 1 5 10 15

5

VaI Leu Leu GIn Met Ser Ala VaI Leu Thr Phe GIy GIy GIn Met Pro 20 25 30

10

VaI lie Lys VaI GIy Arg Met Ala GIy GIn Phe Ala Lys Pro Arg Ser 35 40 45

15 Asp Asn Phe GIu VaI Lys Asp GIy VaI Lys Leu Pro Ser Tyr Arg GIy 50 55 60

Asp Asn lie Asn GIy Asp Ala Phe Asn GIu Lys Ser Arg lie Pro Asp 20 65 70 75 80

Pro GIn Arg Met lie Arg Ala Tyr Thr GIn Ser Ala Ala Thr Leu Asn 85 90 95

25

Leu Leu Arg Ala Phe Ala Met GIy GIy Tyr Ala Ala Met GIn Arg VaI 100 105 110

30

Thr GIn Trp Asn Leu Asp Phe Thr GIu Asn Ser GIu GIn GIy Asp Arg 115 120 125

35 Tyr Arg GIu Leu Ala His Arg VaI Asp GIu Ala Leu GIy Phe Met Ser 130 135 140

Ala Ala GIy Leu Thr Leu Asp His Pro VaI Met Ser Ser Thr GIu Phe 40 145 150 155 160

Trp Thr Ser His GIu Cys Leu Leu Leu Pro Tyr GIu GIn Ala Leu Thr 165 170 175

45

Arg GIn Asp Ser Thr Ser GIy Leu Phe Tyr Asp Cys Ser Ala His Met 180 185 190

50

Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu Asp GIy Ala His VaI GIu 195 200 205

55 Phe Leu Arg GIy VaI Ala Asn Pro Leu GIy lie Lys VaI Ser Asp Lys 210 215 220

Met Asn Pro Ser Asp Leu VaI Lys Leu lie GIu lie Leu Asn Pro Thr 60 225 230 235 240

Asn Lys Ala GIy Arg lie Thr lie lie Thr Arg Met GIy Ala GIu Asn 245 250 255

Met Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn Ser GIy 260 265 270

GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys 275 280 285

Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Leu Ala GIu 290 295 300

VaI Arg Ala Phe Phe Asp VaI His GIu GIn GIu GIy Ser His Ala GIy 305 310 315 320

GIy VaI His Leu GIu Met Thr GIy GIn Asn VaI Thr GIu Cys lie GIy

325 330 335

GIy Ser Arg Thr VaI Thr Phe Asp Asp Leu Ala Asp Arg Tyr His Thr 340 345 350

His Cys Asp Pro Arg Leu Asn Ala Ser GIn Ser Leu GIu Leu Ala Phe 355 360 365

He He Ala GIu Arg Leu Arg Lys Arg Arg Thr Arg Ser Ser Lys Leu 370 375 380

Asn Ser VaI Leu Pro Leu Pro Ser GIy Phe 385 390

<210> 19

<211> 1476

<212> DNA

<213> Festuca arundinacea

<220>

<221> CDS

<222> (1) .. (1185) <400> 19 gag age ttc aag gag ttc aac ggc aac aac ate cgc gac ace ttc cgc 48

GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn He Arg Asp Thr Phe Arg 1 5 10 15 gtc ctg eta cag atg ggc gcc gtc etc atg ttc ggc gga cag gtc ccc 96 VaI Leu Leu GIn Met GIy Ala VaI Leu Met Phe GIy GIy GIn VaI Pro 20 25 30 gtc gtc aag gtg ggg agg atg gcg ggc cag ttc gcc aag ccc agg teg 144 VaI VaI Lys VaI GIy Arg Met Ala GIy GIn Phe Ala Lys Pro Arg Ser 35 40 45 ggc aac ttc gag gag aag gac ggg gtc aag ctg ccc age tac agg ggc 192 GIy Asn Phe GIu GIu Lys Asp GIy VaI Lys Leu Pro Ser Tyr Arg GIy 50 55 60 gac aac ate aac ggc gac gcc ttc gac gtc aag age cgc acg ccg gac 240 Asp Asn lie Asn GIy Asp Ala Phe Asp VaI Lys Ser Arg Thr Pro Asp 65 70 75 80 ccg gag agg atg ate agg gcg tac gcg cag tec gtc gcc acg etc aac 288 Pro GIu Arg Met lie Arg Ala Tyr Ala GIn Ser VaI Ala Thr Leu Asn 85 90 95 ttg etc cgc gcc ttc gcc ace gga gga tac gcc gcg atg cag egg gtc 336 Leu Leu Arg Ala Phe Ala Thr GIy GIy Tyr Ala Ala Met GIn Arg VaI 100 105 110 ate cag tgg aac etc gat ttc atg gac cac aac gag cag gga gac agg 384 lie GIn Trp Asn Leu Asp Phe Met Asp His Asn GIu GIn GIy Asp Arg 115 120 125 tac cgc gag ttg gca cat agg gtg gat gag get ctt ggc ttc atg act 432 Tyr Arg GIu Leu Ala His Arg VaI Asp GIu Ala Leu GIy Phe Met Thr 130 135 140 gca get ggg ctg ggg att gac cat ccg ata atg aca act ace gac ttc 480 Ala Ala GIy Leu GIy lie Asp His Pro lie Met Thr Thr Thr Asp Phe 145 150 155 160 tgg aca tec cac gag tgt etc etc ttg ccc tat gag cag get ctt ace 528 Trp Thr Ser His GIu Cys Leu Leu Leu Pro Tyr GIu GIn Ala Leu Thr 165 170 175 cgt gag gat tec aca agt ggc ctt ttc tat gac tgc tea get cac atg 576 Arg GIu Asp Ser Thr Ser GIy Leu Phe Tyr Asp Cys Ser Ala His Met 180 185 190 ctg tgg gtt ggt gag cgc act cgt caa etc gat ggg get cat gtt gaa 624 Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu Asp GIy Ala His VaI GIu 195 200 205 ttc etc cgt ggt att gcc aac ccc ctt ggc ata aaa gtg age gac aaa 672 Phe Leu Arg GIy lie Ala Asn Pro Leu GIy lie Lys VaI Ser Asp Lys 210 215 220 atg gac ccc get gaa ttg gtg aag ctg att gac att ttg aac cca tea 720 Met Asp Pro Ala GIu Leu VaI Lys Leu lie Asp lie Leu Asn Pro Ser 225 230 235 240 aac aag ccg gga agg ate ace ata att aca agg atg gga get gag aac 768 Asn Lys Pro GIy Arg lie Thr lie lie Thr Arg Met GIy Ala GIu Asn 245 250 255 atg agg gtg aag ttg cct cat etc ate cgc gca gtc cgc aat tct gga 816 Met Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn Ser GIy 260 265 270 cag att gtt aca tgg att act gat ccc atg cac gga aac aca ate aag 864

GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys

275 280 285 gcg cca tgt ggt ctt aag act cgt cca ttc gac tec att atg aac gag 912 Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Met Asn GIu 290 295 300 gtg cga gca ttc ttc gac gtg cac gat caa gaa gga age cac cca gga 960 VaI Arg Ala Phe Phe Asp VaI His Asp GIn GIu GIy Ser His Pro GIy 305 310 315 320 ggt ate cac ctt gaa atg act gga cag aac gta ace gag tgc ate ggt 1008 GIy lie His Leu GIu Met Thr GIy GIn Asn VaI Thr GIu Cys lie GIy 325 330 335 gga tea egg ace gtg ace ttc gac gac ctg ggt gac cgc tac cac ace 1056 GIy Ser Arg Thr VaI Thr Phe Asp Asp Leu GIy Asp Arg Tyr His Thr 340 345 350 cac tgc gac cca agg ctg aac gcc tec caa tct ctg gag ctt gcc ttc 1104 His Cys Asp Pro Arg Leu Asn Ala Ser GIn Ser Leu GIu Leu Ala Phe 355 360 365 ate ata gcc gag aga etc agg aag agg agg atg caa tea ggg etc aca 1152 lie lie Ala GIu Arg Leu Arg Lys Arg Arg Met GIn Ser GIy Leu Thr

370 375 380 aac aac ctg cca ctg cct cca ctg gcc ttc taa accctaagca ggggagtagc 1205 Asn Asn Leu Pro Leu Pro Pro Leu Ala Phe 385 390 agggaggagg ggttagatag tttcaatttg caaccggtgg ccgatgcgca ttcaattgag 1265 tttgtatggt gggtgctctt ttgcacaagc tgtaagatta tgagatattt gtacttgtcg 1325 agtacagtag catactcgtg gtactatact atgttttgct ttttttggtt ctatttttga 1385 atgtttgttc tgctttagct tttggtgact ggagataata aagatgagtg cccttggtga 1445 attaaaaaaa aaaaaaaaaa aaaaaggatc c 1476

<210> 20

<211> 394

<212> PRT

<213> Festuca arundinacea

<400> 20

GIu Ser Phe Lys GIu Phe Asn GIy Asn Asn lie Arg Asp Thr Phe Arg 1 5 10 15

VaI Leu Leu GIn Met GIy Ala VaI Leu Met Phe GIy GIy GIn VaI Pro 20 25 30

VaI VaI Lys VaI GIy Arg Met Ala GIy GIn Phe Ala Lys Pro Arg Ser 35 40 45

GIy Asn Phe GIu GIu Lys Asp GIy VaI Lys Leu Pro Ser Tyr Arg GIy 50 55 60

Asp Asn lie Asn GIy Asp Ala Phe Asp VaI Lys Ser Arg Thr Pro Asp 65 70 75 80

Pro GIu Arg Met lie Arg Ala Tyr Ala GIn Ser VaI Ala Thr Leu Asn 85 90 95

Leu Leu Arg Ala Phe Ala Thr GIy GIy Tyr Ala Ala Met GIn Arg VaI 100 105 110

lie GIn Trp Asn Leu Asp Phe Met Asp His Asn GIu GIn GIy Asp Arg 115 120 125

Tyr Arg GIu Leu Ala His Arg VaI Asp GIu Ala Leu GIy Phe Met Thr 130 135 140

Ala Ala GIy Leu GIy lie Asp His Pro lie Met Thr Thr Thr Asp Phe 145 150 155 160

Trp Thr Ser His GIu Cys Leu Leu Leu Pro Tyr GIu GIn Ala Leu Thr

165 170 175

Arg GIu Asp Ser Thr Ser GIy Leu Phe Tyr Asp Cys Ser Ala His Met 180 185 190

Leu Trp VaI GIy GIu Arg Thr Arg GIn Leu Asp GIy Ala His VaI GIu 195 200 205

Phe Leu Arg GIy lie Ala Asn Pro Leu GIy lie Lys VaI Ser Asp Lys 210 215 220

Met Asp Pro Ala GIu Leu VaI Lys Leu lie Asp lie Leu Asn Pro Ser 225 230 235 240

Asn Lys Pro GIy Arg lie Thr lie lie Thr Arg Met GIy Ala GIu Asn

245 250 255

Met Arg VaI Lys Leu Pro His Leu lie Arg Ala VaI Arg Asn Ser GIy 260 265 270

GIn lie VaI Thr Trp lie Thr Asp Pro Met His GIy Asn Thr lie Lys 275 280 285

Ala Pro Cys GIy Leu Lys Thr Arg Pro Phe Asp Ser lie Met Asn GIu 290 295 300

VaI Arg Ala Phe Phe Asp VaI His Asp GIn GIu GIy Ser His Pro GIy 305 310 315 320

GIy lie His Leu GIu Met Thr GIy GIn Asn VaI Thr GIu Cys lie GIy

325 330 335 GIy Ser Arg Thr VaI Thr Phe Asp Asp Leu GIy Asp Arg Tyr His Thr 340 345 350

His Cys Asp Pro Arg Leu Asn Ala Ser GIn Ser Leu GIu Leu Ala Phe 355 360 365

lie lie Ala GIu Arg Leu Arg Lys Arg Arg Met GIn Ser GIy Leu Thr 370 375 380

Asn Asn Leu Pro Leu Pro Pro Leu Ala Phe 385 390

<210> 21

<211> 18

<212> DNA <213> Artificial

<220>

<223> PCR Primer <400> 21 tttttttttt tttttttt 18

<210> 22 <211> 22

<212> DNA

<213> Artificial

<220> <223> PCR Primer

<400> 22 gtsacgttct gsccsgtcat yt 22

<210> 23

<211> 21

<212> DNA

<213> Artificial

<220>

<223> PCR Primer

<400> 23 cagggcggcg actgcgccga g 21

<210> 24

<211> 23 <212> DNA

<213> Artificial

<220>

<223> PCR primer

<400> 24 carggsggsg actgcgccga rag 23 <210> 25

<211> 22

<212> DNA <213> Artificial

<220>

<223> PCR primer <400> 25 ccagatgccc gtcctcaagg tt 22

<210> 26 <211> 22

<212> DNA

<213> Artificial

<220> <223> PCR primer

<400> 26 ggttagagct tgctcgtagg gt 22

<210> 27

<211> 22

<212> DNA

<213> Artificial

<220>

<223> PCR primer

<400> 27 acaggtcccc gtcgtcaagg tg 22

<210> 28

<211> 21 <212> DNA

<213> Artificial

<220>

<223> PCR primer

<400> 28 tctccctgct cgttgtggtc c 21

<210> 29

<211> 22

<212> DNA

<213> Artificial <220>

<223> PCR primer

<400> 29 gcagatgccc atcatcaagg ta 22

<210> 30 <211> 21 <212> DNA

<213> Artificial

<220> <223> PCR primer

<400> 30 tcaccctgtt cacttttctc t 21

<210> 31

<211> 30

<212> DNA

<213> Artificial

<220>

<223> PCR primer

<400> 31 ctgcggatcc tctagctaga gctttcgttc 30

<210> 32

<211> 37 <212> DNA

<213> Artificial

<220>

<223> PCR primer

<400> 32 gataagcttg gctgcagatt gatgcatgtt gtcaatc 37

<210> 33

<211> 32

<212> DNA

<213> Artificial <220>

<223> PCR primer

<400> 33 gcggccgccc ctccccacag aaaagacatc cc 32

<210> 34

<211> 45

<212> DNA <213> Artificial

<220>

<223> PCR primer <400> 34 cgcggatccg aattcgttta aactgtcgct cttacggtac tactg 45

<210> 35 <211> 33

<212> DNA

<213> Artificial <220>

<223> PCR primer

<400> 35 gtggcggccg ctaatgagca ttgcatgtct aag 33

<210> 36

<211> 35 <212> DNA

<213> Artificial

<220>

<223> PCR primer

<400> 36 ttcgtttaaa ccattgaagc ggaggtgccg acggg 35

<210> 37

<211> 31

<212> DNA

<213> Artificial <220>

<223> PCR primer

<400> 37 cgcggatccc tcaggggtgt tgctaaccct c 31

<210> 38

<211> 30

<212> DNA <213> Artificial

<220>

<223> PCR primer <400> 38 ccggaattcg tcacgttctg gccggtcatc 30

Claims

1. A method for identifying a 3-deoxy-7-phosphoheptulonate (DAHP) synthase that is expressed in relatively high amounts in stem tissue of a plant comprising the following steps: (i): identifying DNA encoding sequences of two or more different DAHP synthase genes of the plant;

(ϋ): isolating stem tissue of the plant wherein the tissue is isolated during the elongation growth stage of the plant where the plant is grown under normal natural growth conditions of the plant; (ϋi): measuring the mRNA level of the DAHP synthases in the stem tissue; (iv): comparing the mRNA levels of the DAHP synthases and identify a DAHP synthase wherein the mRNA level of the DAHP synthase in the stem tissue is higher than the mRNA level of a different DAHP synthase of the same plant.

2. The method of claims 1, wherein there in step (i) is identified three, four, five, six or more different DAHP synthase genes and the identified DAHP synthase, of step (iv), with high mRNA level in the stem tissue is the DAHP synthase with highest mRNA level in the stem tissue.

3. The method of claim 1 or 2, wherein in step (ϋ) there is also isolated root tissue during the elongation growth stage of the plant, in step (iii) the mRNA level of the DAHP synthases are measured in both tissues and the identified DAHP synthase that is expressed in relatively high amounts in stem tissue is a DAHP synthase wherein the amount of mRNA of the DAHP synthase in the stem tissue is at least 25% higher than in the root tissue.

4. The method of any of the preceding claims, wherein the plant is a plant of the grass family, more preferably a plant of the grass family selected from the group consisting of: a grass of the iamily Poaceae (e.g. a forage grass such tall fescue), and a cereal such as a maize, a wheat, an oat, a barley, a rye, a corn, a sorghum, a rice, a triticale and a millet.

5. A process for making a plant cell that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue of the plant comprising: (i): modifying the genome of the cell in a way that, after regeneration of the cell to get a plant, causes a stable reduction in the amount of mRNA level of the DAHP synthase, wherein the DAHP synthase is identifiable by a method for identifying a DAHP synthase that is expressed in relatively high amounts in stem tissue of a plant of the grass family of any of claims 1 to 4; and (ϋ) isolating the cell with the stable modification of the genome.

6. The process for making a plant cell of claim 5, wherein the plant cell is a plant cell of the grass iamily, more preferably is a plant cell of the grass family selected from the group consisting of: a grass of the iamily Poaceae (e.g. a forage grass such tall fescue), and a cereal such as a maize, a wheat, an oat, a barley, a rye, a corn, a sorghum, a rice, a triticale and a millet.

7. The process for making a plant cell of claim 6, wherein the plant cell is a forage grass cell, in particular a tall fescue cell.

8. The process for making a plant cell of any of claims 5 to 7, wherein the DAHP synthase is a DAHP synthase gene comprising a DNA sequence, wherein the DNA sequence is selected from the group consisting of:

337 of SEQ ID NO 8 (termed "DAHPS4-aa");

(c) a DNA sequence which is at least 90% identical to the DNA sequence of (a);

9. The process for making a plant cell of any of claims 5 to 8, wherein the modification of the genome is done by anti-sense or RNA interference technology comprising incorporation of a chimeric DNA construct into the genome, wherein the chimeric DNA construct comprises a heterogeneous regulatory sequence operable linked in anti-sense orientation to a coding sequence of the DAHP gene making the cell capable of translating an anti-sense mRNA fragment that within the cell can hybridize to the mRNA of the DAHP synthase.

10. The process for making a plant cell of any of claims 5 to 8, wherein the modification of the 5 genome is done by making a deletion or other modification within the DAHP gene.

11. The process for making a plant cell of any of claims 5 to 10, wherein the genomic modification does not significantly affect the natural mRNA expression level of at least one other DAHP synthase of the regenerated plant.

10

12. The process for making a plant cell of claim 11, wherein the genomic modification essentially only affect the mRNA expression level of the DAHP synthase that is expressed in relatively high amounts in stem tissue as described herein.

15 13. A plant cell that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue obtainable by a process for making such a plant cell of any of claim 5 to 12.

20 14. A process for obtaining a plant that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue comprising regenerating the plant from the plant cell of claims 13 to obtain the plant.

25 15. A plant that comprises a stable modification of the genome, wherein the genome modification causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue of the plant obtainable by a process for obtaining a plant of claim 14.

30 16. The plant of claim 15, wherein the plant during the elongation growth stage comprises less lignin as compared to the same plant without the stable modification of the genome that causes a stable reduction in the amount of mRNA level of a DAHP synthase that is expressed in relatively high amounts in stem tissue.

17. The plant of claims 15 or 16, wherein the plant cell of the grass family, is a plant cell selected from the group consisting of: a grass of the iamily Poaceae (e.g. a forage grass such tall fescue), and a cereal such as a maize, a wheat, an oat, a barley, a rye, a corn, a sorghum, a rice, a triticale and a millet.

18. The plant of claim 17, wherein the plant cell is a forage grass cell, in particular a tall fescue cell.

19. The plant of claim 17, wherein the plant cell is a maize.

20. Use of the plant of any the claims 15 to 19 as a feed for an animal.

21. The use of claim 20, wherein the plant is forage grass, in particular a tall fescue and the animal is a ruminant animal such as a cattle.

22. The use of claim 20, wherein the plant is maize and the feed in provided in the form of ensilage.