New! View global litigation for patent families

US20020012931A1 - High specificity marker detection - Google Patents

High specificity marker detection Download PDF

Info

Publication number
US20020012931A1
US20020012931A1 US09820215 US82021501A US2002012931A1 US 20020012931 A1 US20020012931 A1 US 20020012931A1 US 09820215 US09820215 US 09820215 US 82021501 A US82021501 A US 82021501A US 2002012931 A1 US2002012931 A1 US 2002012931A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
cells
cell
marker
pcr
mrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09820215
Inventor
Scott Waldman
Tracy Fava
Rodwige Desnoyers
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Thomas Jefferson University
Original Assignee
Thomas Jefferson University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6871Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting an enzyme
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K51/00Preparations containing radioactive substances for use in therapy or testing in vivo
    • A61K51/02Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
    • A61K51/04Organic compounds
    • A61K51/08Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
    • A61K51/10Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody or an immunoglobulin, or a fragment thereof, e.g. a camelised human single domain antibody, or the Fc fragment of an antibody
    • A61K51/1003Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody or an immunoglobulin, or a fragment thereof, e.g. a camelised human single domain antibody, or the Fc fragment of an antibody not used, see subgroups
    • A61K51/1075Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody or an immunoglobulin, or a fragment thereof, e.g. a camelised human single domain antibody, or the Fc fragment of an antibody not used, see subgroups the antibody being against an enzyme
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Liposomes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3046Stomach, Intestines
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6883Hybridisation probes for diseases caused by alterations of genetic material
    • C12Q1/6886Hybridisation probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by the preceding groups
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay
    • G01N33/574Immunoassay; Biospecific binding assay for cancer
    • G01N33/57407Specifically defined cancers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by the preceding groups
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay
    • G01N33/574Immunoassay; Biospecific binding assay for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57419Specifically defined cancers of colon
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by the preceding groups
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay
    • G01N33/574Immunoassay; Biospecific binding assay for cancer
    • G01N33/57407Specifically defined cancers
    • G01N33/57446Specifically defined cancers of stomach or intestine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/988Lyases (4.), e.g. aldolases, heparinase, enolases, fumarase

Abstract

This invention provides methods of detecting the presence of a disseminated cell marker in a sample by eliminating illegitimate transcription-positive cells from the sample and detecting the presence of mRNA that encodes the marker. This invention also provides methods of detecting disseminated cancer cells.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • [0001]
    This application is related to U.S. Provisional patent application Serial No. 60/192,229 filed Mar. 27, 2000, which is incorporated herein, in its entirety, by reference.
  • FIELD OF THE INVENTION
  • [0002]
    The present invention relates to methods of detecting tumor cells and evidence of cancer in samples.
  • BACKGROUND OF THE INVENTION
  • [0003]
    Rare circulating tumor cells in blood may be detected by amplifying mRNA of tumor- or tissue-specific markers utilizing RT-PCR. While RT-PCR can magnify target-specific nucleic acids up to 1020-fold (Waldman et al., 1998, Dis. Colon Rectum, 41:310-5; Cagir et al., 1999, Ann. Intern. Med., 131:805-811; each of which is incorporated herein by reference), enhanced detection is associated with a high false positive rate (Burchill et al., 1995, Br. J. Cancer, 71:278-281; Battaglia et al., 1998, Bone Marrow Transpl., 22:693-698; Krismann et al., 1995, J. Clin. Oncol., 13:2769-2775; each of which is incorporated herein by reference). This has been especially true in RT-PCR studies examining the ability to detect rare tumor cells in blood employing epithelial cell markers (Burchill et al., 1995, supra; Battaglia et al., 1998, supra; Krismann et al., 1995, supra; Lopez-Guerrero et al., 1997, Clin. Chim. Acta, 263:105-116; each of which is incorporated herein by reference). The high false positive rates appear to arise from illegitimate transcription of epithelial cell markers (Krismann et al., 1995, supra; Lopez-Guerrero et al., 1997, supra; Bostick et al., 1998, J. Clin. Oncol., 16:2632-2640; Traweek et al., 1993, Am. J. Pathol., 142:1111-1118; Hoon et al., 1995, Cancer, 76:533-534; Pelkey et al., 1996, Clin. Chem., 42:1369-1381; Jung et al., 1999, Br. J. Cancer, 81:870-873; each of which is incorporated herein by reference).
  • [0004]
    Illegitimate transcription (or ectopic transcription) is a general phenomenon of basal, very low level, transcription of any gene in any cell type, and has been well documented in many tissue-specific genes (Chelley et al., 1991, J. Clin. Invest., 88:1161-1166; Chelley et al., 1989, Proc. Natl. Acad. Sci. USA, 86:2671-2621; each of which is incorporated herein by reference). Importantly, detection techniques which first amplify transcription of spliced mRNA by such means as PCR are able to detect the expression of a tissue-specific gene from very minute amounts of mRNA present in a “non-expressing” cell sample. Therefore, illegitimate transcription is particularly problematic when using such techniques if the assay is sensitive enough to detect the illegitimate transcription product.
  • [0005]
    The extremely high sensitivity of RT-PCR has revealed that cells in the blood illegitimately transcribe genes that were previously considered markers of specific epithelia (Sarkar & Sommer, 1989, Science, 244:331-334; Chelley et al., 1989, supra; Negrier et al., 1998, Br. J. Haematol., 100:33-39; Gala et al., 1998, Clin. Chem., 44:472-481; Champelovier et al., 1999, Anti-Cancer Res., 19:2073-2078; each of which is incorporated herein by reference). Transcripts for PSA and PSM (prostate cancer), CK-19 and CK-20 (gastric, colon, and breast cancer), CEA (colorectal cancer), CK-18 (breast cancer), CK-8 (breast cancer), MUC-1 (breast, ovary, colon, and lung cancer), and GA733.2, (breast cancer) have been detected in peripheral blood from healthy volunteers (Burchill et al., 1995, supra; Lopez-Guerrero et al., 1997, supra; Bostick et al., 1998, supra; Traweek et al., 1993, supra; Hoon et al., 1995, supra; Gala et al., 1998, supra; Champelovier et al., 1999, supra). Illegitimate transcription and background mRNA expression in normal blood limit the sensitivity of detecting circulating cancer cells employing PSM, CEA, and CK-18 (Zippelius et al., 1997, J. Clin. Oncol., 15:2701-2708, which is incorporated herein by reference). Whether every cell has the ability to generate ectopic transcripts, and if ectopic transcripts have a biological role is unknown (Cooper et al., 1994, Ann. Med., 26:9-14; Sommer & Sarkar, 1989, Science, 245:261; each of which is incorporated herein by reference). Since illegitimately transcribed mRNA levels are extremely low, it is unlikely that a biological role would involve protein synthesis. Illegitimate transcription may represent the cost to cells of completely inactivating the transcription of thousands of “leaky” genes (Cooper et al., 1994, supra).
  • [0006]
    Colorectal cancer is the third leading cause of cancer and cancer-related mortality worldwide (Pihl et al., 1981, J. Surg. Oncol., 16:333-341; Toribara & Sleisenger, 1995, New Eng. J. Med., 332:861-7; Larson et al., 1986, Arch. Surgery, 121:535-40; Silverberg et al., 1990, Cancer Statistics, 40:9-26; Greenwald, 1992, Cancer 70(Suppl. 5):1206-1215; Cresanta, 1992, Prim. Care, 19:419-441; Jessup et al., 1996, Cancer, 78:918-926; each of which is incorporated herein by reference). Forty percent of patients believed to be cured by surgery suffer disease recurrence within 3 years. At present, there are no effective blood-based methods to detect post-operative disease recurrence and reduce cancer-related mortality. Thus, clinical outcomes in patients with colorectal cancer could be substantially improved by the availability of more sensitive and specific diagnostic markers for post-operative surveillance (Shapiro, 1992, Cancer, 75(Suppl. 5):1252-1258; Smart, 1992, Cancer, 75(Suppl. 5):1246-1251; each of which is incorporated herein by reference).
  • [0007]
    Guanylyl cyclase C (GC-C) (also known as the ST or E. coli heat-stable enterotoxin receptor) is a cell surface receptor which mediates fluid and electrolyte secretion, with expression restricted to brush border membranes of intestinal mucosa cells from the duodenum to the rectum, and which is not expressed by extra-intestinal tissues (Gyles, 1971, Ann. N.Y. Acad. Sci., 176:314-322; Dejonge, 1975, FEBS Lett., 53:237-242; Guarino et al., 1987, Dig. Dis. Sci., 32:1017-1026; Almenoff et al., 1993, Mol. Microbiol., 8:865-873; Guerrant et al., 1980, J. Infect. Dis., 142:220-228; Carrithers et al., 1994, Gastroenterology, 107: 1653-1661; Krause et al., 1994, Gut, 35:1250-1257; Cohen et al., 1988, Gastroenterology, 94:367-373; Guarino et al., 1987, Pediatric. Res., 21:551-555; each of which is incorporated herein by reference). GC-C expression persists after intestinal mucosal cells undergo neoplastic transformation and is expressed by primary and metastatic colorectal tumors regardless of their anatomical location (Huott et al., 1988, J. Clin. Invest., 82:514-523; Guarino et al., 1987, Am. J. Physiol., 253:G775-G780; Cohen et al., 1993, J. Cell. Physiol., 156:138-144; Mann et al., 1993, Am. J. Physiol., 264:G172-G178; each of which is incorporated herein by reference). GC-C is not expressed by tumors originating from outside the alimentary/gastrointestinal tract (Guerrant et al., supra; Carrithers et al., 1994, Gastroenterology, supra; Krause et al., supra; Cohen et al., supra, Guarino et al., 1987, Pediatric Res., supra.; Carrithers et al., 1996, Proc. Natl. Acad. Sci. USA, 93:14827-14832; each of which is incorporated herein by reference). These data suggest that GC-C may be a unique marker for detecting metastatic colorectal cancer cells in blood during post-operative surveillance (Waldman et al., 1998, Dis. Colon Rectum, supra; Cagir et al., 1999, supra.; Carrithers et al., 1996, Dis. Colon Rectum, 39:171-181, which is incorporated herein by reference).
  • [0008]
    Previous studies in colorectal cancer patients have demonstrated that GC-C can identify micrometastatic foci in lymph nodes evaluated as free of disease by standard histopathology. Importantly, detection of micrometastases by GC-C RT-PCR was associated with a greatly enhanced risk of colorectal cancer-related mortality. GC-C analysis may be a sensitive and specific method for detecting clinically significant colorectal cancer micrometastases in lymph nodes, and could improve the accuracy of staging.
  • [0009]
    Similarly, analyzing GC-C expression in blood to detect rare circulating colorectal tumor cells could improve the early detection of disease recurrence in patients undergoing post-operative surveillance. Current surveillance paradigms have not improved the overall survival of patients with recurrent colorectal cancer, in part, reflecting their inability to detect recurrence at a point amenable to intervention (Virgo et al., 1995, JAMA, 273: 837-1841; Wade et al., 1996, J. Am. Coll. Surg., 182:353-361; Moertel et al., 1993, JAMA, 270:943-947; Schiessel et al., 1986, Brit. J. Surg., 73:342-344; Bohm et al., 1993, Dis. Colon Rectum, 36:280-286; Nelson, 1995, Sem. Oncol., 22:488-493; each of which is incorporated herein by reference). Development of a more effective surveillance marker would have significant impact on the management and outcome of colorectal cancer. Preliminary studies detected GC-C mRNA in blood from colorectal cancer patients, although there was no obvious correlation between the detection of this transcript and disease stage (Carrithers et al., 1996, Proc. Natl. Acad. Sci. USA, supra; Bustin et al., 1999, Br. J. Cancer, 79:1813-1820, which is incorporated herein by reference). In addition, GC-C mRNA was detected in the blood of some healthy volunteers (Bustin et al., 1999, supra). Like other epithelial cell markers, GC-C may undergo illegitimate transcription in blood that may undermine its utility for post-operative surveillance.
  • [0010]
    Most paradigms for post-operative colon cancer surveillance include repeated measurements of serum carcino-embryonic antigen (CEA) (Wamego et al., 1978, Ann. Surg., 188:481-493; Sugarbaker et al., 1976, Cancer, 38:2310-2315; Boey et al., 1984, World J. Surg., 8:279-286; Northover, 1986, Gut, 27:117-121; each of which is incorporated herein by reference). Analysis of expression of GC-C by RT-PCR may be more sensitive and specific than CEA as a marker for metastatic colorectal cancer in blood. Whereas CEA is produced by <80% of colorectal tumors, GC-C has been detected in all primary and metastatic colorectal tumors examined. While CEA is expressed by some extra-intestinal tumors, GC-C is expressed only by colorectal tumors. CEA is expressed by tissues other than intestine that are involved in non-neoplastic conditions while GC-C has been identified only in colorectal cancer cells outside the intestine. In a retrospective analysis, GC-C was identified in lymph nodes of all patients who were node-negative by histopathology and who developed recurrent disease whereas CEA was identified in lymph nodes of only one of those patients (Cagir et al., 1999, supra).
  • [0011]
    There is a need for improved methods of detecting the presence of metastasized cancers, including colon cancer. There is a need for methods of reducing the background signals caused by illegitimate transcription of cell markers used for the detection of cells that have migrated from their normal location in the body, including metastatic cancer cells. In particular there is a need to improve the accuracy and to decrease false-positive signals in highly sensitive, mRNA detection assays.
  • SUMMARY OF THE INVENTION
  • [0012]
    This invention provides methods of detecting the presence of a disseminated cell marker in a sample comprising the steps of eliminating illegitimate transcription-positive cells from the sample, and detecting the presence of mRNA that encodes the marker. The invention also provides methods of diagnosing metastatic cancer comprising detecting the presence of a disseminated cell marker for cancer cells identified as from the primary cancer in a sample that does not normally express said marker, comprising the steps of eliminating illegitimate transcription-positive cells from the sample, and detecting the presence of mRNA that encodes the marker. The invention also provides methods of detecting the presence of a tissue-specific marker in a sample not associated with the expression of the tissue-specific marker, comprising the steps of eliminating CD34+cells from the sample, and detecting the presence of mRNA encoding the tissue-specific marker. The invention also provides methods of detecting the presence of a disseminated cell in a sample, comprising the steps of eliminating CD34+cells from the sample, and detecting the presence of mRNA that encodes a marker associated with the disseminated cell. The invention further provides kits for detecting the presence of a disseminated cell marker in a sample and kits for detecting the presence of a disseminated cell marker for metastatic cancer cells, comprising an affinity column; and primers for detecting the presence of mRNA encoding the marker.
  • [0013]
    These and other aspects of the invention are described more fully below.
  • [0014]
    All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • [0015]
    [0015]FIG. 1 is a photograph of an ethidium bromide-stained gel containing the products of nested RT-PCR analysis of GC-C expression in blood mononuclear cells from representative samples of healthy volunteers (n=20) and Dukes' stage D patients (n=24). Total RNA (1 μg) extracted from mononuclear cells of healthy volunteers and Dukes' stage D patients was subjected to nested RT-PCR employing GC-C-specific primers. T84 colorectal carcinoma cells served as a positive control for GC-C expression. H2O (negative control) indicates no input RNA. Molecular weight markers are shown in the left-most lane of the gel; sizes are shown to the left of the gel. The arrow at the right indicates the size of the human GC-C RT-PCR product (˜250 bp) predicted from the defined sequence.
  • [0016]
    [0016]FIGS. 2A and 2B present photographs of ethidium bromide-stained gels showing nested RT-PCR products, representing expression of GC-C transcripts in purified blood mononuclear cells. Total RNA (1 μg) extracted from (FIG. 2A) plasma, granulocytes, erythrocytes, platelets, and mononuclear cells, or (FIG. 2B) purified monocytes, T cells, NK cells, B cells, and CD34+progenitor cells, and analyzed by nested RT-PCR employing GC-C specific primers. T84 cells served as a positive control for GC-C expression. H2O (negative control) indicates no input RNA. Molecular weight markers and their sizes are indecated the left-most lanes of each gel. The arrows at the right of each gel indicate the size of the human GC-C RT-PCR product (˜250 bp) predicted from the defined sequence.
  • [0017]
    [0017]FIG. 3 is a photograph of an ethidium bromide-stained gel showing nested RT-PCR products, representing the expression of GC-C mRNA in peripheral blood mononuclear cells enriched in CD34+cells from a patient undergoing peripheral blood progenitor cell harvest following treatment with Neupogen. For PBPC mobilization in preparation for bone marrow ablation and autologous transplantation, a patient with breast cancer received 10 μg/Kg/day (total daily dose of 600 μg) of Neupogen™ (G-CSF; Amgen; Thousand Oaks, Calif.) as an IV bolus for 3 consecutive days. Leukaphoresis was performed on days 3 and 6 following the first dose of Neupogen™. Total RNA (1 μg) extracted from the mononuclear cells obtained on days 3 and 6 was subjected to RT-PCR employing GC-C-specific primers. The patient had a leukocyte count of 107,000/μl on day 3 and 17,000/μl on day 6. T84 cells served as a positive control for GC-C expression. H2O (negative control) indicates no input RNA. Molecular weight markers and their sizes are indicated in the left lane. The arrow at the right indicates the size of the human GC-C RT-PCR product (˜250 bp) predicted from the defined sequence.
  • [0018]
    [0018]FIG. 4 is a photograph of an ethidium bromide-stained gel showing nested RT-PCR products, representing the expression of GC-C transcripts following depletion of CD34+progenitor cells from peripheral blood mononuclear cells. Mononuclear cells were depleted of CD34+progenitor cells as described in Example 1. Total RNA was extracted from mononuclear cells before and after depletion of CD34+progenitor cells, and 1 μg was subjected to nested RT-PCR employing GC-C specific primers. T84 cells served as a positive control for GC-C expression. H2O (negative control) indicates no input RNA. Molecular weight markers and their sizes are indicated in the right lane. The arrow indicates the predicted size of the human GC-C RT-PCR product (˜250 bp).
  • [0019]
    [0019]FIGS. 5A and 5B present photographs of ethidium bromide-stained gels showing nested RT-PCR products, representing the expression of epithelial cell biomarkers in CD34+progenitor cells. Total RNA (1 μg) extracted from 106 CD34+progenitor cells was subjected to nested RT-PCR analysis employing epithelial cell marker-specific primers. In FIG. 5A, the arrows indicate the defined sequence-predicted sizes of the RT-PCR products for human PSA (˜335 bp), PSM (˜200 bp), GC-C (˜250 bp), and CEA (˜162 bp) and GC-C (˜250 bp). In FIG. 5B, the arrows indicated the defined sequence-predicted sizes of the RT-PCR products for human MUC-1 (˜350 bp), CK-19 (˜460 bp), CK-20 (˜370 bp), GA733.2 (˜700 bp) and CEA (˜162 bp). Total RNA extracted from prostate was employed as a positive control for PSA and PSM RT-PCR analysis (gel to left of FIG. 5A). T84 cells served as a positive control for expression of the other epithelial biomarkers. H2O (negative control) indicates no input RNA. Molecular weight markers appear in the left-most lanes of the gels, and their sizes are indicated to the left of the gels.
  • [0020]
    [0020]FIG. 6 presents photographs of two ethidium bromide-stained gels showing nested RT-PCR products, representing the expression of epithelial cell biomarkers in mononuclear cells depleted of CD34+progenitor cells. Mononuclear cells were depleted of CD34+progenitor cells by column chromatography as described in Example 1. Total RNA (1 μg) was extracted from pre-column (pre MNC) and post-column (post MNC) (depleted of CD34+progenitor cells) mononuclear cells, and was subjected to nested RT-PCR, employing primers specific for β-actin, GC-C, CEA, CK-19, CK-20, and MUC-1. T84 cell RNA provided the positive controls. Molecular weight markers and their sizes are indicated in the left lanes.
  • [0021]
    [0021]FIG. 7 presents photographs of two ethidium bromide-stained gels showing nested RT-PCR products, representing the expression of illegitimate transcripts of GC-C and CEA in the blood of healthy volunteers. Total RNA extracted from mononuclear cells of healthy subjects (n=20) was serially diluted and subjected to nested RT-PCR employing both GC-C- and CEA-specific primers. Quantities of input RNA are indicated along the top of the gels. The arrows indicate the sizes of the RT-PCR products of human GC-C (˜250 bp) and CEA (˜162 bp), predicted from their defined sequences. T84 cells served as a positive control for CEA and GC-C expression. H2O (negative control) indicates no input RNA. Molecular weight markers and their sizes are indicated in the left lanes of the gels. These data are representative of samples examined from 20 healthy volunteers.
  • [0022]
    [0022]FIG. 8A presents photographs of ethidium bromide-stained gels showing the threshold for detecting transcripts of GC-C and CEA in blood from Dukes' Stage D patients. Total RNA, extracted from mononuclear cells of Dukes' stage D patients, was serially diluted and subjected to nested RT-PCR employing both GC-C- and CEA-specific primers. The RT-PCR products presented in the gels of FIG. 8A are representative of the results with samples from the 24 Dukes' stage D patients examined. T84 cells served as a positive control for CEA and GC-C expression. H2O (negative control) indicates no input RNA. Quantities of input RNA are indicated along the tops of the gels. The arrows indicate the sizes of the RT-PCR products for human GC-C (˜250 bp) and CEA (˜162 bp) predicted from their defined sequences. Molecular weight markers and their sizes are indicated in the left lanes of the gels. FIG. 8B presents a graph comparing the sensitivity of RT-PCR employing GC-C- and CEA-specific primers to detect circulating tumor cells in Dukes' stage D patients. Total RNA was extracted from mononuclear cells of Dukes' stage D patients, and was serially diluted and subjected to nested RT-PCR employing both GC-C- and CEA-specific primers, as for FIG. 8A. The percentage of samples (patients) which yielded GC-C- or CEA-specific amplicons was calculated for each quantity of total RNA analyzed.
  • [0023]
    [0023]FIG. 9 presents photographs of two ethidium bromide-stained gels showing the sensitivity of nested RT-PCR employing GC-C-specific primers to detect human colorectal cancer cells in blood. Total RNA was extracted from the indicated numbers of mononuclear blood cells spiked with a single T84 cell (˜200 copies of GC-C mRNA) or a single Caco2 cell (˜20 copies of GC-C mRNA). Total RNA (0.5 μg) was subjected to nested RT-PCR analysis employing GC-C-specific primers. T84 and Caco2 cells served as respective positive controls for GC-C expression. H2O (negative control) indicates no input RNA. Molecular weight markers and their sizes are indicated in the left lanes of the gels. The arrows indicate the size of the RT-PCR product for human GC-C (˜250 bp) predicted from the defined sequence.
  • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • [0024]
    Nucleic acid-based diagnostic testing has been plagued by the presence of background levels of the disease marker of interest. Since these levels are low and often spurious, it has been referred to as “illegitimate transcription,” with the inference that all cells have leaky transcription and small levels of all transcripts are produced constitutively. It has been discovered that this low level transcription may be ascribed to distinct populations of stem cells, producing discrete levels of transcript per cell. One such cell type (a hematopoeitic stem cell expressing the surface glycoprotein CD34; CD34+stem cells (Kronenwett et al., 2000, Stem Cells, 18:320-330, which is incorporated herein by reference)) has been demonstrated to be the source of this background for a number of markers.
  • [0025]
    The present invention arises out of the discovery that CD34+progenitor cells illegitimately transcribe a variety of epithelial cell-specific markers including GC-C, prostate-specific antigen (PSA), prostate-specific membrane antigen (PSM), carcinoembryonic antigen (CEA), cytokeratin-19 (CK-19), cytokeratin-20 (CK-20), mucin 1 (MUC-1), and gastrointestinal-associated antigen (GA733.2). CD34+cells are the source of the high false positive rate generally observed when epithelial cell-specific markers are employed to detect rare circulating metastatic cancer cells by RT-PCR. Background signals reflect low-level transcription of these markers in CD34+cells, and depletion of CD34+cells or limiting the quantity of RNA analyzed can reliably eliminate false positive results.
  • [0026]
    The removal, destruction, or modification of CD34+cells will improve assays for markers based on analysis of any human or veterinary tissue. The limitations to the utility of epithelial cell markers for detecting rare circulating tumor cells can be alleviated either by separating CD34+and tumor cells (positive or negative purification) prior to RNA extraction or limiting the amount of total RNA analyzed to that below the limit of detection of illegitimate transcripts, prior to RT-PCR.
  • [0027]
    GC-C undergoes illegitimate transcription by blood mononuclear cells producing a high false positive rate in healthy volunteers. Illegitimate transcription of GC-C was localized specifically to CD34+progenitor cells, which were the source of false positive signals for seven other epithelial cell markers. The illegitimately transcribed GC-C in CD34+cells falls below the minimum threshold for expression of functional receptors on the cell surface (Waldman et al., 1998, Cancer Epid. Bio. Prev., 7:505-514, which is incorporated herein by reference). Background signals reflect low-level transcription of these markers and depletion of CD34+cells or limiting the quantity of RNA analyzed can reliably eliminate false positive results. Employing this technique, GC-C expression was detected in the circulation of all patients with metastatic colorectal cancer, but not in any healthy volunteer examined. Thus, analysis of GC-C expression by RT-PCR is a sensitive and specific diagnostic tool for early detection of disease recurrence in patients who have undergone resection for colorectal cancer. Similarly, other epithelial cell markers can be useful for detecting rare circulating tumor cells following elimination of signals reflecting illegitimate transcription by separating CD34+cells from tumor cells or limiting the quantity of RNA analyzed.
  • [0028]
    CEA expression was specifically detected in blood of <30% of patients with metastatic colorectal cancer compared to GC-C, which was detected in blood from all of those patients. In addition, GC-C in blood from patients with metastatic colorectal cancer was detected by RT-PCR employing quantities of total RNA as low as 0.08 μg while CEA was detected with no less than 0.5 μg of RNA. These data suggest that GC-C is more frequently expressed and more abundant than CEA in colorectal cancer cells. As a result, GC-C may be a more sensitive and specific biomarker than CEA for detection of rare metastatic colorectal cancer cells in blood.
  • [0029]
    The practice of the present invention employs, unless otherwise indicated, conventional methods of immunology, microbiology, molecular biology and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al., eds., Molecular Cloning: A Laboratory Manual (2nd ed.) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al., eds., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y. (2000); Glover, ed., DNA Cloning: A Practical Approach, Vols. I & II; Colowick & Kaplan, eds., Methods in Enzymology, Academic Press; Weir & Blackwell, eds., Handbook of Experimental Immunology, Vols. I-IV, Blackwell Scientific Pubs. (1986); Coligan et al., eds., Current Protocols in Immunology, John Wiley & Sons, New York, N.Y. (2000), each of which is incorporated herein by reference.
  • [0030]
    Various definitions are made throughout this document. Most words have the meaning that would be attributed to those words by one skilled in the art. Words specifically defined either below or elsewhere in this document have the meaning provided in the context of the present invention as a whole and as typically understood by those skilled in the art.
  • [0031]
    As used herein, the term “disseminated” in reference to a cell means a cell that is found in a location in the body that is different from its site of origin or normal location in the body. By way of non-limiting example, a malignant melanoma cell found in the peripheral blood of an individual would be a disseminated cell because its site of origin or normal location is the skin and it has been found in different site, in this case, the blood. A colon cancer cell found in the bone marrow of an individual is disseminated from its site of origin, the colon. Cancer cells that have metastasized are, by definition, disseminated cells because they have spread from their site or tissue of origin to a different site in the body. A disseminated cell can also be a cell that has begun to inappropriately express proteins, which may be indicative of a disease state.
  • [0032]
    As used herein, the term “disseminated cell marker” refers to a gene product associated with a particular cell or tissue type that may serve as an indication that a cell has become disseminated from its site of origin or normal location in the body. Any cell- or tissue-specific marker (also called differentiation specific antigens) can be a “disseminated cell marker” if that marker is found in a region or site of the body where that cell- or tissue-specific marker is not typically expected to be found. The presence of a disseminated cell marker is indicative of the presence of a disseminated cell. Depending upon the sample examined, many cell or tissue type markers can serve as disseminated cell markers. If the sample examined is the blood, then any cell or tissue type marker that is not expressed by cells that are normally to be found in the blood, can serve as a disseminated cell marker. Examples of markers that can be used as disseminated cell markers include, but are not limited to, guanylyl cyclase C (GC-C), Cdx-1, Cdx-2, sucrase isomaltase, lactase, carbonic anhydrase, prostate specific antigen (PSA), prostate specific membrane antigen (PSM), cytokeratin 18 (CK-18), cytokeratin 19 (CK-19), cytokeratin 20 (CK-20), carcinoembryonic antigen (CEA), ErbB2, Erb-B3, epithelial mucin-1 (MUC-1), epithelial mucin-18 (MUC-18), gastrointestinal tumor associated antigen 733.2 (GA 733.2), desmoplakin I (DPL I), epithelial glycoprotein 40 (EGP-40), tyrosinase, thyroglobulin (TGB), tyrosine hydroxylase, and neuron-specific glycoprotein (NPGP 9.5).
  • [0033]
    In one aspect of the invention, the disseminated cell is a cancer cell and the disseminated cell marker is a differentiation specific antigen associated with the tissue of origin of the tumor cell. The presence of such differentiation specific antigens in samples of tissue or body fluids, that are distinct from the tissue of origin of the tumor, is indicative of the presence of disseminated cells of the tumor in that tissue or body fluid. Methods related to the detection of rare cancer cells, in particular cancer cells that have become disseminated from their site of origin, are described in Doeberitz & Lacroix, 1999, Cancer Metastasis Rev., 18:43-64, which is incorporated by reference in its entirety; the references cited therein are incorporated by reference in their entirety.
  • [0034]
    The eliminating step can be accomplished by the removal, destruction, or modification of the cells that are positive for illegitimate transcription.
  • [0035]
    As used herein, the term “illegitimate transcription-positive” in reference to a cell, refers to a cell that inappropriately expresses a gene, generating some low level amount of mRNA transcript encoding a particular protein product. A cell inappropriately expresses a gene when that cell is not of the type of cell normally associated with the expression of that gene. For example, cells in the blood do not normally express the gene for tyrosinase, which is an enzyme specifically expressed in melanocytes or in tumor cells derived from melanocytes (meloanoma). If a blood cell was expressing the tyrosinase gene and generating mRNA transcript encoding tryrosinase, it would be an illegitimate transcription-positive cell. Cells that are illegitimate transcription-positive for a particular marker are cells that do not normally express the marker protein, i.e., cells which are not identified with such marker expression. It has been discovered that CD34+cells are illegitimate transcription-positive for many differentiation specific markers associated with other cell types. In preferred embodiments of the invention, illegitimate transcription-positive cells are CD34+cells.
  • [0036]
    As used herein, the term “sample” includes any material, such as bodily fluids or portions of tissue, collected from an individual. The sample can be any tissue or body fluid. By way of non-limiting example, samples may include any of the following tissues or fluids: blood, bone marrow, sputum, semen, stool, gastric fluid, gastric juices, alimentary canal juices, saliva, urethral secretions, vaginal secretions, lung, peritoneal or pericardial lavage, urine, lymph, and cerebro-spinal fluid (CSF).
  • [0037]
    Samples comprise illegitimate transcription-positive cells, particularly CD34+cells. Examples of such preferred samples include blood and bone marrow. Those skilled in the art will appreciate that the methods of the invention are particularly applicable to samples that comprise illegitimate transcription-positive cells, particularly cells that are CD34+.
  • [0038]
    As used herein, the term “detecting” in reference to mRNA that encodes a marker includes any method of analysis that demonstrates the presence of mRNA encoding the marker of interest. The detecting step can be accomplished by any method that identifies the presence of a mRNA transcript. Thus, detection of a mRNA transcript that encodes a disseminated cell marker can be accomplished by, for example, PCR, RT-PCR, or antibody-based methods following the translation of the mRNA transcript. Detecting includes direct detection of the presence of a particular mRNA, and indirect detection of a particular mRNA by detection of a cDNA product or a protein product of that mRNA. Detecting includes the use of PCR-based methods for demonstrating the presence of mRNA transcripts, including but not limited to, direct PCR analysis of mRNA extracts and RT-PCR, using marker-specific oligonucleotide primers. Detecting also includes immunologically-based techniques to demonstrate the presence of the protein product of the mRNA of interest, following in vitro translation.
  • [0039]
    As used herein, a “CD34+cell” can be any cell that expresses a part of the CD34 glycoprotein. CD34 is a 115 kD glycosylated Type I transmembrane protein, mainly expressed in precursors of hematopoietic cells and in the vascular endothelium. CD34 expression has been found in 1-4% of adult bone marrow mononuclear cells (including marrow-repopulating cells, all multipotent and committed myeloid progenitors, B and T lymphoid precursors, osteoclast precursors, and most likely the precursors for stromal cells), and in less than 1% of peripheral blood mononuclear cells. In non-lymphohemopoietic tissues its expression is has been identified in endothelial cells and in some cells of the skin (Silvestri et al., 1992, Haematologica, 77:265-273, which is herein incorporated by reference).
  • [0040]
    CD34+cells can be removed, modified or destroyed by a variety of methods, which include affinity technologies, physical separation technologies or chemical technologies. Some examples of physical separation technologies would be ultrasound based acoustic levitation, field flow fractionation and separations based on charge, rigidity, aggregation, density or sensitivity to electromagnetic radiation. Affinity technologies can be based on molecules such as antibodies, partial antibodies, antibody fragments, modified antibodies, bacteria or viruses displaying peptides or proteins with affinity to CD34+cells, carbohydrates, peptides, nucleic acids or lipids with affinity for CD34+cells. Chemical technologies would involve methods that either destroy or modify the ability of CD34+cells to produce or contain background levels of markers used in diagnostic tests. These technologies can be comprised of treatment of the cells with chemical or biological substances or treatment of the cells with physical, chemical or biological methods such that the chemistry of the cell is modified. This modification would serve to remove the background level of diagnostic markers either by adjusting their levels or by removing them.
  • [0041]
    In preferred embodiments, CD34+cells are removed from a blood sample using an antibody based affinity process.
  • [0042]
    As used in this specification and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the content clearly dictates otherwise. Thus, for example, reference to “a cell” includes a mixture of two or more cells.
  • [0043]
    The present invention relates to method of detecting a disseminated cell marker in a sample. In one aspect of the present invention, a disseminated cell marker is indicative of a metastatic cancer cell, i.e., a cell from a tumor that has traveled to a site in the body that is distinct from its site of origin. Such a cell can be detected in a site that is distinct from its site of origin because of its expression of genes reflecting its particular tissue type or state of differentiation. The invention provides methods of detecting cancer cells, in particular cancer cells that have spread from their site of origin to other sites of the body, by examination of samples taken from sites in the body that are distinct from the original site of the tumor.
  • [0044]
    A variety of cancers that have disseminated from their site of origin can be detected by identifying transcripts for differentiation specific antigens associated with the tissue type of origin or oncofetal antigens inappropriately expressed by the cancer cell. A disseminated cancer cell can be identified by detecting the presence of mRNA transcripts for any protein that is associated with the cancer cell but that would not be expected to be expressed in the site of the sample being tested. Differentiation specific antigens and oncofetal antigens represent possible disseminated cell markers for identifying disseminated cancer cells. Such markers include, but are not limited to, PSA and PSM (prostate cancer), CK-19 and CK-20 (gastric, colon, and breast cancer), CEA (colorectal cancer), CK-18 (breast cancer), CK-8 (breast cancer), MUC-1 (breast, ovary, colon, lung, and thyroid cancer), and GA733.2, (breast cancer), thyroglobulin (thyroid cancer), tyrosinase (melanoma (skin cancer)), β-HCG (testicular cancer), alpha-feto protein (AFP) (hepatocellular carcinoma (liver cancer)), Cdx1 and Cdx2 (colon, esophageal, and stomach cancer), and sucrase-isomaltase (colon, esophageal, and stomach cancer).
  • [0045]
    Those of skill in the art will recognize that the methods of the present invention are applicable to the detection of that detection of any disseminated cancer cells where a marker can be assigned to the cancer cell that would not be expected to be seen in a tested sample. The samples that are examined for evidence of disseminated cells can be from any tissue or body fluid. As the methods are directed to finding disseminated cells, appropriate sources for a sample will be prescribed by what is known about the site of origin of the disseminated cell of interest. By way of non-limiting example the sample may be from such tissues and fluids as blood, bone marrow, sputum, semen, stool, gastric, vaginal, lung, peritoneal or pericardial lavage, urine, lymph, cerebro-spinal fluid (CSF).
  • [0046]
    The present invention relates to methods of detecting a disseminated cell marker in a sample by eliminating cells which illegitimately transcribe genes. The elimination of illegitimate transcription-positive cells will improve the accuracy of assays designed to identify the presence of mRNA for a disseminated marker, by eliminating the cells which are not actually disseminated, but give false-positive signals of expression of the marker. Elimination of illegitimate transcription-positive cells will improve the reliability of these assays, so that detection of the presence of mRNA encoding a disseminated cell marker in a sample is truly reflective of the presence of a disseminated cell.
  • [0047]
    In one embodiment of the invention, illegitimate transcription-positive cells are eliminated by the removal of CD34+cells from the sample. A preferred means of removal of CD34+cells is by use of affinity column chromatography, for example, the CD34 Progenitor Cell Isolation Kit™ (Miltenyi Biotec; Bergisch Gladbach, Germany) can be used to selectively remove CD34+cells from a sample.
  • [0048]
    Another aspect of the present invention includes various methods of determining whether a sample contains disseminated cells by determining whether the sample contains mRNA that encodes a disseminated cell marker. Detection of the presence of the mRNA is carried out by use of nucleotide sequence-based molecular analysis. Several different methods are available for doing so including those using Polymerase Chain Reaction (PCR) technology, branched chain oligonucleotide hybridization technology, Northern blot technology, oligonucleotide hybridization technology, and in situ hybridization technology. The invention relates to oligonucleotide probes and primers used in the methods of identifying mRNA that encodes a disseminated cell marker. The mRNA sequence-based methods for determining whether a sample contains mRNA encoding a disseminated cell marker include but are not limited to polymerase chain reaction technology, branched chain oligonucleotide hybridization technology, Northern and Southern blot technology, in situ hybridization technology and oligonucleotide hybridization technology.
  • [0049]
    The methods described herein are meant to exemplify how the present invention may be practiced and are not meant to limit the scope of invention. It is contemplated that other sequence-based methodology for detecting the presence of specific mRNA that encodes a disseminated cell marker in samples may be employed according to the invention.
  • [0050]
    A preferred method for detecting mRNA that encodes a disseminated cell marker in genetic material derived from samples that do not normally express the disseminated cell marker uses PCR technology. PCR assays are useful for detecting mRNA encoding a disseminated cell marker in homogenized tissue samples and in body fluid samples.
  • [0051]
    PCR technology is practiced routinely by those having ordinary skill in the art and its uses in diagnostics are well known and accepted. Methods for practicing PCR technology are disclosed in “PCR Protocols: A Guide to Methods and Applications”, Innis, M. A. et al., eds., Academic Press, Inc., San Diego, Calif. (1990), which is incorporated herein by reference. Applications of PCR technology are disclosed in “Polymerase Chain Reaction” Erlich, H. A. et al., eds. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), which is incorporated herein by reference. U.S. Pat. No. 4,683,202, U.S. Pat. No. 4,683,195, U.S. Pat. No. 4,965,188, and U.S. Pat. No. 5,075,216, which are each incorporated herein by reference, describe methods of performing PCR. PCR may be routinely practiced using, for example, the GeneAmp® Gold RNA PCR Reagent Kit from PE Biosystems (Foster City, Calif.).
  • [0052]
    PCR technology including RT-PCR allows for the rapid generation of multiple copies of DNA sequences by providing sets of primers that hybridize to sequences present in an RNA or DNA molecule, and further by providing free nucleotides and an enzyme that fills in the complementary bases to the nucleotide sequence adjacent to and thereby between the primers with the free nucleotides to produce complementary strands of DNA. The enzyme will fill in the complementary sequences adjacent to the primers. If both of the primers hybridize to nucleotide sequences on the same small fragment of nucleic acid, exponential amplification of a specific double-stranded size product results. If only a single primer hybridizes to the nucleic acid fragment, linear amplification produces single-stranded products of variable length.
  • [0053]
    PCR primers can be designed routinely by those having ordinary skill in the art using sequence information. Many nucleotide sequences encoding a wide variety of tissue-specific markers which may serve as disseminated cell markers have been identified and can be found in the scientific literature and in such databases as GenBank.
  • [0054]
    The following are non-limiting examples of disseminated cell markers and their cognate nucleotide sequence entries in GenBank, which are incorporated herein by reference:
    Marker GenBank Accession No.
    GC-C U20230; P25092; AAC50381
    Cdx1 U51095; NM001804; U15212; P47902; AAC50237;
    AAB40602
    Cdx2 U51096; NM001265; Y13709; CAA74038; AAB40603
    sucrase- NM001041; AAA60551; M22616; NP004659
    isomaltase
    PSA XM008995
    PSM XM012114
    CEA NM001712; XM012777
    MUC-1 AJ006206; AJ006205
    GA733.2 NM002354
    β-HCG J00117; M38559; M54963
    AFP XM003498
  • [0055]
    The nucleotide sequences for a given disseminated cell marker of interest may be used to design primers that specifically amplify mRNA that encodes that disseminated cell marker. To perform this method, RNA is recovered from a sample, by standard extraction
  • [0056]
    techniques, and tested or used to make cDNA using well known methods and readily available starting materials. The RNA may be contained within the cells of the sample or may be in the non-cellular portion. The mRNA encoding a disseminated cell marker may be found in the extracellular portion of a sample, where, for example, necrosis results in the lysis of disseminated cells and the subsequent release of cell contents, including mRNA. Detection of the released mRNA would be indicative of the presence of disseminated cells in the sample.
  • [0057]
    Those having ordinary skill in the art can readily prepare PCR primers. A set of primers generally contains two primers. When performing PCR on extracted mRNA or cDNA generated therefrom, if the mRNA or cDNA encoding the disseminated cell marker is present, multiple copies of the mRNA or cDNA will be made. If it is not present, PCR will not generate a discrete detectable product. Primers are generally 8-50 nucleotides, preferably about 15-35 nucleotides, more preferably 18-28 nucleotides, that are identical or complementary to and therefor hybridize to the mRNA or cDNA generated therefrom which encodes a disseminated cell marker. In preferred embodiments, the primers are each 15-35 nucleotide fragments, more preferably 18-28 nucleotide fragments of the nucleic acid molecule that comprises the nucleotide sequence encoding a disseminated cell marker. The primer must hybridize to the sequence to be amplified. Typical primers are 18-28 nucleotides in length and generally have 50% to 60% G+C composition. The entire primer is preferably complementary to the sequence it must hybridize to. Preferably, primers generate PCR products 100 base pairs to 2000 base pairs. However, it is possible to generate products of 5 kb to 10 kb and more. If mRNA is used as a template, the primers must hybridize to mRNA sequences. If cDNA is used as a template, the primers must hybridize to cDNA sequences.
  • [0058]
    The mRNA or cDNA is combined with the primers, free nucleotides and enzyme following standard PCR protocols. The mixture undergoes a series of temperature changes. If the mRNA or cDNA encoding the disseminated cell marker of interest is present, that is, if both primers hybridize to sequences, the molecule comprising the primers and the intervening complementary sequences will be exponentially amplified. The amplified DNA can be easily detected by a variety of well known means. If no mRNA or cDNA that encodes the disseminated cell marker of interest is present, no PCR product will be exponentially amplified. The PCR technology therefore provides an extremely easy, straightforward and reliable method of detecting mRNA encoding a disseminated cell marker in a sample.
  • [0059]
    PCR products may be detected by several well known means. The preferred method for detecting the presence of amplified DNA is to separate the PCR reaction material by gel electrophoresis and stain the gel with ethidium bromide in order to visual the amplified DNA if present. A size standard of the expected size of the amplified DNA is preferably run on the gel as a control.
  • [0060]
    In some instances, such as when unusually small amounts of RNA are recovered and only small amounts of cDNA are generated therefrom, it is desirable or necessary to perform a PCR reaction on the first PCR reaction product. That is, if difficult to detect quantities of amplified DNA are produced by the first reaction, a second PCR can be performed to make multiple copies of DNA sequences of the first amplified DNA. A nested set of primers are used in the second PCR reaction. The nested set of primers hybridizes between sequences hybridized by the first set of primers.
  • [0061]
    Another method of determining whether a sample contains cells expressing a disseminated cell marker is by branched chain oligonucleotide hybridization analysis of mRNA extracted from a sample. Branched chain oligonucleotide hybridization may be performed as described in U.S. Pat. No. 5,597,909, U.S. Pat. No. 5,437,977, and U.S. Pat. No. 5,430,138, which are each incorporated herein by reference. Reagents may be designed following the teachings of those patents and sequence information for a given disseminated cell marker.
  • [0062]
    Another method of determining whether a sample contains cells expressing mRNA encoding a disseminated cell marker is by Northern Blot analysis of mRNA extracted from a sample. The techniques for performing Northern blot analyses are well known by those having ordinary skill in the art and are described in Sambrook, J. et al., (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. mRNA extraction, electrophoretic separation of the mRNA, blotting, probe preparation and hybridization are all well known techniques that can be routinely performed using readily available starting material.
  • [0063]
    The mRNA is extracted using poly dT columns and the material is separated by electrophoresis and, for example, transferred to nitrocellulose paper. Labeled probes made from an isolated specific fragment or fragments can be used to visualize the presence of a complementary fragment fixed to the paper. Probes useful to identify mRNA in a Northern Blot have a nucleotide sequence that is complementary to mRNA transcribed from the gene that encodes a given disseminated cell marker. Those having ordinary skill in the art could design such probes or isolate and clone a given disseminated cell marker gene or cDNA which can be used as a probe.
  • [0064]
    Northern blot analysis is useful for detecting mRNA encoding a disseminated cell marker in homogenized tissue samples and cells in body fluid samples. It is contemplated that Northern Blot analysis of mRNA extracted from a tissue or body fluid sample could be used to detect mRNA encoding a disseminated cell marker.
  • [0065]
    Another method of detecting the presence of mRNA encoding disseminated cell marker is by oligonucleotide hybridization technology. Oligonucleotide hybridization technology is well known to those having ordinary skill in the art. Briefly, detectable probes which contain a specific nucleotide sequence that will hybridize to nucleotide sequence of mRNA encoding a given disseminated cell marker. RNA or cDNA made from RNA from a sample is fixed, usually to filter paper or the like. The probes are added and maintained under conditions that permit hybridization only if the probes fully complement the fixed genetic material. The conditions are sufficiently stringent to wash off probes in which only a portion of the probe hybridizes to the fixed material. Detection of the probe on the washed filter indicate complementary sequences.
  • [0066]
    One having ordinary skill in the art can design probes that are fully complementary to disseminated cell marker mRNA sequences but not to genomic DNA. Hybridization conditions can be routinely optimized to minimize background signal by non-fully complementary hybridization.
  • [0067]
    Oligonucleotide hybridization techniques are useful for detecting mRNA encoding a disseminated cell marker in homogenized tissue samples and cells in body fluid samples. It is contemplated that oligonucleotide hybridization analysis of mRNA extracted from a tissue or body fluid sample could be used to detect mRNA encoding a disseminated cell marker.
  • [0068]
    The presence of mRNA that encodes a disseminated cell marker or cDNA generated therefrom can be determined using techniques such as in situ hybridization. In situ hybridization technology is well known by those having ordinary skill in the art. Briefly, cells are fixed and detectable probes which contain a specific nucleotide sequence are added to the fixed cells. If the cells contain complementary nucleotide sequences, the probes, which can be detected, will hybridize to them.
  • [0069]
    One having ordinary skill in the art can design probes useful in in situ hybridization technology to identify cells that express mRNA that encodes a disseminated cell marker. The probes should be designed to be fully complementary to mRNA sequences but not to genomic sequences for the marker gene of interest. Hybridization conditions can be routinely optimized to minimize background signal by non-fully complementary hybridization. The probes are fully complementary and do not hybridize well to partially complementary sequences. The probes may be detected by fluorescence. A common procedure is to label the probe with a biotin-modified nucleotide, and then detect the probe with fluorescently tagged avidin. Cells are fixed and the probes are added to the genetic material. Probes will hybridize to the complementary nucleic acid sequences present in the sample. Using a fluorescent microscope, the probes can be visualized by their fluorescent markers. The probes may also be labeled for direct detection by incorporating radiolabeled nucleotides or nucleotides having detectable non-radioactive labels. Such probe detection systems are well known to those of skill in the art.
  • [0070]
    The presence of mRNA encoding a disseminated marker in a sample can be indirectly assayed by translation of the mRNA present in the sample, followed by detection of disseminated marker protein product using immunological assays with protein-specific antibodies. Such immunological assays include, but are not limited to, immunoprecipitation, immunoblotting, and immunohistochemistry. The antibodies can be visualized through a variety of detection techniques well known to the art. The antibodies are detectably labeled or detected using a labeled second antibody or protein A.
  • [0071]
    Other embodiments of the invention will be readily understood by those of skill in the art.
  • [0072]
    The invention is further illustrated by way of the following examples, which are intended to elaborate several embodiments of the invention. These examples are not intended to, nor are they to be construed to, limit the scope of the invention. It will be clear that the invention may be practiced otherwise than as particularly described herein. Numerous modifications and variations of the present invention are possible in view of the teachings herein and, therefore, are within the scope of the invention.
  • EXAMPLES Example 1: Materials and Methods Clinical Specimens
  • [0073]
    Blood and tissue specimens were obtained from the hematology/oncology clinic under an Institutional Review Board-approved protocol (Control #98.0614) at Thomas Jefferson University Hospital (Philadelphia, Pa.) and the Cooperative Human Tissue Network (Philadelphia). Healthy volunteers and Dukes' Stage D patients were informed about the study and asked to participate. After informed consent was obtained, each participant received a unique identification number that was recorded on blood samples and any acquisition forms. Blood (˜16 cc) collected into Vacutainer® CPT™ tubes containing sodium heparin was centrifuged at 25° C. for 15 minutes at 1700 rpm and the resulting mononuclear cell, red blood cell, and granulocytes fractions recovered for RNA extraction. In some experiments, whole blood was centrifuged at 1300 rpm at 4° C. for 10 minutes, the resulting supernatant containing the platelet-rich plasma was centrifuged at 3000 rpm at 4° C. for 10 minutes, and the platelet pellet was recovered for RNA extraction.
  • Isolation and Purification of Platelets
  • [0074]
    In order to isolate and purify platelets, whole blood was spun at 1300 rpm at 4° C. for 10 minutes. The supernatant was transferred into a new 15 ml conical tube. This platelet-rich plasma was centrifuged at 3000 rpm at 4° C. for 10 minutes and the supernatant was discarded. The platelet pellet was resuspended in Tris Buffer pH 7.6/protease inhibitor solution. Pellet preps were then freeze thawed in liquid nitrogen and placed in a water bath (37° C.) for 10 minutes. Platelets were homogenized and spun in an ultracentrifuge at 30,000 rpm at 4° C. for 1 hour. The supernatant was discarded and the pellet was resuspended in Tris buffer pH 7.6 and aliquoted into Eppendorf tubes until analysis.
  • Peripheral Blood Progenitor Cell (PBPC) Mobilization
  • [0075]
    G-CSF increases the quantity of CD34+stem cells in the peripheral circulation. To examine the relationship between the quantity of circulating CD34+stem cells and the level of illegitimate transcription of epithelial cell markers, blood was obtained from a patient with breast cancer undergoing PBPC mobilization in preparation for autologous transplantation. The patient received 10 μg/Kg/day (total daily dose of 600 μg) of G-CSF (Neupogen™; Amgen; Thousand Oaks, Calif.) as an IV bolus for 3 consecutive days. Leukaphoresis was performed on days 3 and 6 following the first dose of G-CSF.
  • Cell Culture
  • [0076]
    T84 and Caco2 human colon carcinoma cells, obtained from the American Type Culture Collection (Manassas, Va.), were grown to confluence and used as positive controls for GC-C mRNA in RT-PCR analyses (10). T84 and Caco2 cells were grown in media containing DMEM/F12 with 10% FBS and 1% Pen/Strep. Adherent cell lines were routinely passaged by trypsinization every 3 to 4 days.
  • Nucleic Acid Extraction
  • [0077]
    Total RNA was extracted with a modified version of the acid guanidinium thiocyanate/phenol/chloroform method employing TRI-REAGENT™ (MRC; Cincinnati, Ohio). The concentration, purity, and amount of total RNA were determined by ultraviolet spectrophotometery. Only samples exhibiting intact 28S and 18S ribosomal RNA were subjected to RT-PCR. All RNA preparations were stored in RNase-free water (Promega; Madison, Wis.) at −70° C. until analysis.
  • RT-PCR
  • [0078]
    The expression of epithelial cell markers in blood cells was examined by RT-PCR employing transcript-specific primer sets (Table 1). Reverse transcription of total RNA (≦1 μg) was performed with 0.25 units/ul of AMV reverse transcriptase (Panvera; Madison, Wis.) and buffer containing 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 4 mM MgCl2, 1 mM each of dATP, dCTP, dGTP, and dTTP, 1 unit/μl RNase inhibitor (Panvera; Madison, Wis.), and 1 μM of the appropriate antisense primer in a total volume of 20 μl. Thermal cycling proceeded for 1 cycle at 50° C. for 30 minutes, 99° C. for 5 minutes (to inactivate reverse transcriptase), and 4° C. for 5 minutes. The resultant cDNA was subjected to PCR in the same reaction tube and included 2.5 units of TaKaRa Taq polymerase (Panvera; Madison, Wis.) in 10 μl of: 10 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl2, and 0.2 μM of the appropriate sense primer. Incubation and thermal cycling conditions were: 95° C. for 2 minutes, 1 cycle; 94° C. for 30 seconds, 58° C. for 30 second, 72° C. for 90 seconds, 35 cycles; 72° C. for 5 minutes, 1 cycle. Following RT-PCR, samples were stored at −4° C.? until analysis. Nested PCR (70 cycles) was performed employing 5% of the PCR product (DNA) and 2.5 units of TaKaRa Taq polymerase (Panvera; Madison, Wis.) in 100 μl of: 10 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl2, and 0.2 μM of the appropriate sense primer. Incubation and thermal cycling conditions were: 95° C. for 2 minutes, 1 cycle; 94° C. for 30 seconds, 58° C. for 30 seconds, 72° C. for 90 seconds, 35 cycles; 72° C. for 5 minutes, 1 cycle. Amplicons were separated by 4% Nusieve 3:1 agarose (FMC Bioproducts; Rockland, Me.) and visualized by ethidium bromide. Amplicon identity was confirmed at least once by DNA sequencing. RT-PCR was performed utilizing primers for β-actin on all samples to confirm the integrity of RNA. RNA extracted from T84 human colon carcinoma cells was employed as a positive control for GC-C mRNA. Negative controls included RT-PCR incubations that omitted RNA template. Primers employed for GC-C amplification span predicted intron-exon junctions, reducing the probability that amplification products reflect contaminating DNA templates.
    TABLE 1
    Primer Sequences for RT-PCR Amplifications
    SEQ Amplicon
    Transcript ID Size
    (Reference) Primers 5′→3′ NO: (bp)
    β-actin TGC-CATCCTAAAAGC-CACa  1
    220
    (1) GGAGACCAAAAGC-CTTCATACb  2
    GC-C GTTTCCTATTTCTCCCACGAACTCa  3
    530
    (1-3) TTTCTTGGTGTCCACAGAGGTAb  4
    GC-C GGACCACAACAGGAAAAGCAA-  5
    Nested TGa
    262
    (2,3) AGGCAAGACGAAAGTCTCGTTTb  6
    CEA TCTGGAACTTCTCCTGGTCTCT-  7
    CAGCTGGa
    220
    (4) TGTAGCTGTTGCAAATGCTTTA-  8
    AGGAAGAAGCb
    CEA Nested GGGCCACTGTCGGCATCATGAT  9 160
    (4)
    CK-19 AGGTGGATTCCGCTCCGGGCAa 10
    460
    (4) ATCTTCCTGTCCCTCGAGCAb 11
    CK-20 CAGACACACGGTGAACTATGGa 12
    370
    (4,5) GATCAGCTTCCACTGTTAGACGb 13
    MUC-1 CGTCGTGGACATTGATGGTACCa 14
    288
    (4) GGTACCTCTCACCTCCTCCAAb 15
    PSA TACCCACTGCATCAGGAACAa 16
    455
    (6) CCTTGAAGCACACCATTACAb 17
    PSA Nested ACACAGGCCAGGTATTTCAGa 18 335
    (6) GTCCAGCGTCCAGCACACAGb 19
    PSM GAATGCCAGAGGGCGATCTAa 20
    441
    (6) TTCTAGGAGCTTCTGTGCATCA- 21
    TAGTATCCb
    PSM Nested AGGGGCCAAAGGAGTCATTCTC- 22
    (6) TACTCCGAa
    186
    CTCTGCAATTCCACGCCTATb 23
    GA733.2 CTACAAGCTGGCCGTAAACTa 24
    700
    (4) GTCCTTGTCTGTTCTTCTGAb 25
  • Isolation of Purified Cell Components from Blood Mononuclear Cells
  • [0079]
    Monocytes, NK cells, T cells, CD19+B cells, and CD34+progenitor cells were obtained commercially (Bio-Whittaker; Charlotte, N.C.). Purified NK and T cells were generously provided by Dr. Bice Perussia, Kimmel Cancer Institute, Thomas Jefferson University. CD34+progenitor cells were isolated from peripheral blood with the CD34 Progenitor Cell Isolation Kit™ (Miltenyi Biotec; Bergisch Gladbach, Germany). Similarly, populations of mononuclear cells were depleted of CD34+cells by use of this kit. CD34+progenitor cells were indirectly magnetically labeled using hapten-conjugated primary monoclonal antibody directed to CD34 and an anti-hapten antibody, coupled to MACS™ microbeads (Bio-Whittaker, Charlotte, N.C.). Magnetically labeled cells were purified and recovered in the magnetic field of a MACS™ separator (Bio-Whittaker, Charlotte, N.C.).
  • Miscellaneous
  • [0080]
    All reagents were of analytical reagent grade. Results are representative of at least three experiments. Values representing the mean±SD were calculated using Microsoft Excel™.
  • Example 2: Subject Characteristics
  • [0081]
    Volunteer ages ranged from 20 to 51 years of age (y) (32.9±2.4 y), and patient ages ranged from 33 to 79 y (59.4±2.7 y). There is an inverse relationship between age and the quantity of circulating CD34+stem cells (36), suggesting that those cells contributed less to results obtained with patients compared to volunteers. There were no significant differences between the ages of female (range=23-51 y; 30.7±3.3 y) and male (range=20-48 y; 35.1±3.8 y) volunteers, or female (range=33-79 y; 57.8±2.7 and male (range=40-78 y; 61.1±3.0 y) patients. Four female and one male patient were African American; all other patients were Caucasian. One female and three male volunteers were African American; all other volunteers were Caucasian. Disease characteristics of patients are outlined in Table 2. Twenty one of 24 patients had hepatic metastases, no patient had pulmonary metastases, and 5 patients had bone metastases. All patients were receiving chemotherapy that included 5′-fluorouracil and leucovorin during this study.
    TABLE 2
    Patient Characteristics.
    Age/Race/ Overall
    Patient Sexa Metastasesb Survivalc Chemotherapyd
     1 79BF H 36 FU/Lv/CPT-11
     2 55WM H/Bn 34 FU/Lv/CPT-11/Ox
     3 59WM H 36 FU/Lv/CPT-11/Ox
     4 69WM H 60 FU/Lv/CPT-11/Ox
     5 58WM H/Bn 12 FU/Lv/CPT-11/Ox
     6 61BF H 36 FU/Lv/CPT-11/Ox
     7 66WM H/Spleen 24 FU/Lv/CPT-11/Ox
     8 78WM Bn 60 FU/Lv/CPT-11
     9 70WF H/Lung 72 FU/Lv/CPT-11
    10 55WM H 36 FU/Lv
    11 41WF Lung 24 FU/Lv/CPT-11
    12 64WM H 60 FU/Lv/CPT-11
    13 49WF H 24 FU/Lv/CPT-11/Ox
    14 52WM H 36 FU/Lv/CPT-11/Ox
    15 71WM H/Lung 60 FU/Lv/CPT-11/Ox
    16 33WF H 36 FU/Lv
    17 78WF H 92 FU/Lv/CPT-11/Ox
    18 55WF H/Lung 48 FU/Lv/CPT-11/Ox
    19 71WF H/Lung 48 FU/Lv/CPT-11/Ox
    20 66BF H/Lung 36 FU/Lv/CPT-11
    21 66WM H/Bn/Lung 24 FU/Lv/CPT-11/Ox
    22 50BF H/Lung 48 FU/Lv/CPT-11/Ox
    23 41WF H/Lung/Bn 60 FU/Lv/CPT-11/Ox
    24 40WM Lung 24 FU/Lv/CPT-11/Ox
  • Example 3: Nested RT-PCR Detects GC-C Expression in Mononuclear Cells from Volunteers and Patients
  • [0082]
    Total RNA (1 μg) extracted from mononuclear cells of 20 healthy volunteers and 24 Dukes' stage D patients was subjected to nested RT-PCR employing GC-C specific primers (FIG. 1). Mononuclear cells were employed because preliminary studies confirmed that human colorectal cancer cells, like other epithelial tumor cells, co-segregate with mononuclear cells rather than with red cells, granulocytes, or platelets (data not shown). GC-C mRNA was detected in mononuclear cells from all 24 patients. However, identical results were obtained with mononuclear cells from all 20 volunteers, yielding a false positive rate of 100%.
  • Example 4: Identification of the Source of GC-C mRNA in Blood from Healthy Volunteers
  • [0083]
    Blood from volunteers was separated into plasma, granulocytes, erythrocytes, platelets, and mononuclear cells, and 1 μg of total RNA from each of these components was analyzed by nested RT-PCR employing GC-C-specific primers (FIG. 2A). GC-C mRNA was detected specifically in mononuclear cells, but not in other components of blood. To determine which cell population in the mononuclear cell fraction expressed GC-C transcripts, 1 μg of total RNA was extracted from purified monocytes, T cells, NK cells, B cells, and CD34+cells (Bio-Whittaker; Charlotte, N.C.) and analyzed by nested RT-PCR employing GC-C-specific primers (FIG. 2B). GC-C mRNA was detected specifically in CD34+cells, but not in other purified cells.
  • Example 5: Analysis of Mononuclear Cells from a Breast Cancer Patient Undergoing Treatment with G-CSF
  • [0084]
    Mononuclear cells were isolated from blood obtained on days 3 and 6 from a patient with breast cancer treated with 600 μg of G-CSF (Neupogen™ Amgen; Thousand Oaks, Calif.) on days 1 to 3. G-CSF stimulates the production of CD34+progenitor cells and their mobilization from sites of hematopoiesis to the peripheral circulation, and is employed in stem cell harvests in preparation for bone marrow ablation and autologous transplantation. The leukocyte count for this patient was 107,000/μl on day 3 (final day of treatment with G-CSF) and 17,000/μl on day six (3 days following the last dose of G-CSF). Total RNA (1 μg) extracted from mononuclear cells was subjected to RT-PCR, without nesting, employing GC-C specific primers (FIG. 3). GC-C mRNA was detected in mononuclear cells obtained on day 3, when the concentration of CD34+stem cells was maximal. In contrast, GC-C mRNA was not detected in mononuclear cells obtained on day 6, when the concentration of CD34+stem cells had returned to baseline.
  • Example 6: Detection of GC-C mRNA Following Depletion of CD34+Cells from Mononuclear Cells
  • [0085]
    To further examine whether CD34+progenitor cells were the source of GC-C mRNA in blood from healthy volunteers, mononuclear cells from these subjects were depleted of CD34+cells and GC-C expression examined by nested RT-PCR. Total RNA (1 μg) extracted from mononuclear cells, CD34+-depleted mononuclear cells, and purified CD34+cells was subjected to nested RT-PCR employing GC-C specific primers (FIG. 4). GC-C mRNA was detected employing RNA from mononuclear cells and purified CD34+ cells, but not RNA from CD34+-depleted mononuclear cells.
  • Example 7: Expression of Epithelial Cell Markers in CD34+ Cells
  • [0086]
    The utility of epithelial cell markers to detect rare circulating tumor cells in peripheral blood has been limited by high false positive rates reflecting illegitimate transcription in unknown blood components (12-20). The present studies demonstrate that CD34+ progenitor cells are the source of GC-C mRNA in the blood of healthy volunteers. These data suggest that CD34+ cells also may be the source of other illegitimately transcribed epithelial cell markers in blood. Thus, the expression of epithelial cell-specific transcripts, including CEA, PSA, PSM, CK-19, CK-20, MUC-1, and GA733.2 was examined in purified CD34+ cells (FIG. 5). Total RNA (1 μg) extracted from purified CD34+ cells was subjected to nested RT-PCR employing primers specific for those epithelial cell markers (see Table 1). All epithelial cell-specific transcripts were expressed in RNA from CD34+ progenitor cells. As with GC-C, the expression of other epithelial cell markers was virtually eliminated by depleting mononuclear cells of CD34+ cells (FIG. 6).
  • [0087]
    Example 8: Threshold for Detecting Illegitimate Transcripts of GC-C and CEA in Blood
  • [0088]
    Total RNA from mononuclear cells of volunteers was serially diluted to define the threshold quantity of total RNA required to detect illegitimate transcripts of GC-C and CEA employing nested RT-PCR (FIG. 7). GC-C and CEA transcripts were not detected employing <1 μg of RNA in any sample obtained from healthy volunteers (n=20). In contrast, GC-C mRNA was detected employing 0.1 μg of RNA and CEA amplicons were detected employing 0.5 μg of RNA from samples obtained from all Dukes' stage D patients (n=24) (FIG. 8A). These data establish a threshold of total mononuclear cell RNA in RT-PCR reactions of ≧1 μg for detecting GCC and CEA transcripts arising from illegitimate transcription in CD34+ cells. Similarly, these data demonstrate that GC-C and CEA amplicons obtained in RT-PCR reactions employing ≦0.8 μg of total mononuclear cell RNA reflect the presence of circulating metastatic colorectal cancer cells.
  • Example 9: Sensitivity of Detecting Circulating Metastatic Colorectal Cancer Cells Employing GC-C Compared to CEA
  • [0089]
    Total RNA from mononuclear cells obtained from Dukes' stage D patients was serially diluted and analyzed by RT-PCR employing GC-C- and CEA-specific primers (FIG. 8B). As demonstrated above, GC-C and CEA transcripts detected employing ≦1 μg of RNA reflect circulating tumor cells in blood. CEA amplicons were detected in 7/24 (˜30%) and 5/24 (˜21%) Dukes' stage D patients employing 0.8 μg or 0.5 μg of RNA, respectively. In contrast, all (n=24) stage D patients yielded GC-C transcripts employing ≧0.1 μg of RNA.
  • Example 10: Sensitivity of Nested RT-PCR Employing GC-C-Specific Primers for Detecting Circulating Tumor Cells
  • [0090]
    T84 or Caco2 human colon carcinoma cells (≈200 and 20 GC-C transcripts per cell, respectively) were serially diluted employing excess mononuclear cells, as indicated (FIG. 9). Total RNA extracted from these samples (0.5 μg) was employed for nested RT-PCR employing GC-C-specific primers. A single T84 cell was detected in 107 mononuclear cells while one Caco2 cell was detected in 106 mononuclear cells. This level of sensitivity for detecting human colorectal cancer cells by RT-PCR employing GC-C-specific primers was highly reproducible and yielded identical results when ten sequential analyses were performed.
  • Example 11: Disease Markers Associated with “Illegitimate Transcription”
  • [0091]
    The scientific literature describes a wide variety of diagnostic tests for disease markers whose diagnostic potential is compromised by background levels of “illegitimate transcription” in normal volunteers (Table 3). Most of these tests have either been abandoned as clinically useless or are considered less useful because of an inability to distinguish the background level from a true signal due to disease in patients. The tests for the markers described in Table 3 can be improved by removal, destruction or modification of CD34+ cells and/or other cells found to be the source of the background transcription.
  • [0092]
    Table 3. Disease markers with documented levels of “illegitimate transcription.”
    TABLE 3
    Disease markers with documented levels of “illegitimate transcription.”
    False
    Marker Positives Source Reference
    PSA (Prostate Specific Antigen)  4% Blood  1
     19% Blood  2
     35% Bone marrow  3
    SM (Prostate-specific membrane  96% Blood  4
    antigen)
     44% Bone Marrow 10
    CK 18 (Cytokeratin 18)  71% Bone Marrow 10
    100% Blood 13
    CK 19 (Cytokeratin 19)  23% Blood  4
     4-85% Blood  5
     71% Blood  6
     51% Blood  7
     60% Bone Marrow  7
    100% Lymph nodes  8
     64% Blood  9
     67% Bone marrow  9
     47% Mononucleated  9
    blood cells
     85% Peripheral  9
    blood stem
    cells
    CK 20 (Cytokeratin 20)  50% Blood 14
     72% Blood 15
     6% Bone Marrow 16
    CEA (Carcinoembryonic  26% Bone Marrow 10
    antigen)
     31% Lymph nodes 11
     33% Blood 12
    Erb-B2  71% Bone Marrow 10
    Erb-B3  86% Bone Marrow 10
    MUC-1 (Epithelial mucin-1)  46% Blood  5
     44% Lymph nodes 17
    100% Lymph nodes  5
    MUC-18 (Epithelial mucin-18)  5% Blood 17
    GA 733.2 (gastrointestinal  54% Blood  5
    tumor-associated antigen
    733.2)
    100% Lymph nodes  5
    DPL-I (desmoplakin I) 100% Bone Marrow  5
    EGP-40 (Epithelial 100% Bone marrow 5
    glycoprotein 40)
    Tyrosinase  50% Lymph nodes 18
    TGB (Thyroglobuhin)  10% Blood 19
    Tyrosine Hydroxylase  14% Blood 20
     57% Bone Marrow 20
    NPGP 9.5 (Neuron-specific  57% Blood 21
    glycoprotein)
  • [0093]
    [0093]
  • 1 25 1 18 DNA Artificial Sequence misc_feature Novel Sequence 1 tgccatccta aaagccac 18 2 21 DNA Artificial Sequence misc_feature Novel Sequence 2 ggagaccaaa agccttcata c 21 3 24 DNA Artificial Sequence misc_feature Novel Sequence 3 gtttcctatt tctcccacga actc 24 4 22 DNA Artificial Sequence misc_feature Novel Sequence 4 tttcttggtg tccacagagg ta 22 5 23 DNA Artificial Sequence misc_feature Novel Sequence 5 ggaccacaac aggaaaagca atg 23 6 22 DNA Artificial Sequence misc_feature Novel Sequence 6 aggcaagacg aaagtctcgt tt 22 7 29 DNA Artificial Sequence misc_feature Novel Sequence 7 tctggaactt ctcctggtct ctcagctgg 29 8 32 DNA Artificial Sequence misc_feature Novel Sequence 8 tgtagctgtt gcaaatgctt taaggaagaa gc 32 9 22 DNA Artificial Sequence misc_feature Novel Sequence 9 gggccactgt cggcatcatg at 22 10 21 DNA Artificial Sequence misc_feature Novel Sequence 10 aggtggattc cgctccgggc a 21 11 20 DNA Artificial Sequence misc_feature Novel Sequence 11 atcttcctgt ccctcgagca 20 12 21 DNA Artificial Sequence misc_feature Novel Sequence 12 cagacacacg gtgaactatg g 21 13 22 DNA Artificial Sequence misc_feature Novel Sequence 13 gatcagcttc cactgttaga cg 22 14 22 DNA Artificial Sequence misc_feature Novel Sequence 14 cgtcgtggac attgatggta cc 22 15 21 DNA Artificial Sequence misc_feature Novel Sequence 15 ggtacctctc acctcctcca a 21 16 20 DNA Artificial Sequence misc_feature Novel Sequence 16 tacccactgc atcaggaaca 20 17 20 DNA Artificial Sequence misc_feature Novel Sequence 17 ccttgaagca caccattaca 20 18 20 DNA Artificial Sequence misc_feature Novel Sequence 18 acacaggcca ggtatttcag 20 19 20 DNA Artificial Sequence misc_feature Novel Sequence 19 gtccagcgtc cagcacacag 20 20 20 DNA Artificial Sequence misc_feature Novel Sequence 20 gaatgccaga gggcgatcta 20 21 30 DNA Artificial Sequence misc_feature Novel Sequence 21 ttctaggagc ttctgtgcat catagtatcc 30 22 30 DNA Artificial Sequence misc_feature Novel Sequence 22 aggggccaaa ggagtcattc tctactccga 30 23 20 DNA Artificial Sequence misc_feature Novel Sequence 23 ctctgcaatt ccacgcctat 20 24 20 DNA Artificial Sequence misc_feature Novel Sequence 24 ctacaagctg gccgtaaact 20 25 20 DNA Artificial Sequence misc_feature Novel Sequence 25 gtccttgtct gttcttctga 20

Claims (36)

    We claim:
  1. 1. A method of detecting the presence of a disseminated cell marker in a sample comprising the steps of
    a) eliminating illegitimate transcription-positive cells from the sample; and
    b) detecting the presence of mRNA that encodes the marker.
  2. 2. The method of claim 1, wherein the disseminated cell marker is a tissue-specific marker.
  3. 3. The method of claim 2, wherein the tissue is selected from the group consisting of colon, lung, prostate, testis, breast, liver, and skin.
  4. 4. The method of claim 1, wherein the disseminated cell marker is selected from the group consisting of guanylyl cyclase C, Cdx-1, Cdx-2, sucrase isomaltase, lactase, carbonic anhydrase, prostate specific antigen, prostate specific membrane antigen, cytokeratin 18, cytokeratin 19, cytokeratin 20, carcinoembryonic antigen, ErbB2, Erb-B3, epithelial mucin-1, epithelial mucin-18, gastrointestinal tumor associated antigen 733.2, desmoplakin I, epithelial glycoprotein 40, tyrosinase, thyroglobulin, tyrosine hydroxylase, and neuron-specific glycoprotein.
  5. 5. The method of claim 1, wherein the eliminating step is performed by removing CD34+ cells from the sample.
  6. 6. The method of claim 5, wherein the CD34+ cells are removed by column chromatography.
  7. 7. The method of claim 1, wherein the sample is tissue or bodily fluid.
  8. 8. The method of claim 1, wherein the sample is selected from the group consisting of blood, lymph tissue, and bone marrow.
  9. 9. The method of claim 1, wherein the mRNA is detected a polymerase chain reaction (PCR)-based method.
  10. 10. The method of claim 1, wherein the mRNA is detected by reverse transcriptase (RT)-PCR.
  11. 11. The method of claim 1, wherein the mRNA is detected by nested RT-PCR.
  12. 12. The method of claim 1, wherein the disseminated cell marker is an epithelial cell marker.
  13. 13. The method of claim 1, wherein the marker is selected from the group consisting of guanylyl cyclase-C (GC-C), prostate-specific antigen (PSA), prostate-specific membrane antigen (PSM), carcinoembryonic antigen (CEA), cytokeratin-19 (CK-19), cytokeratin-20 (CK-20), mucin 1 (MUC-1), and gastrointestinal-associated antigen (GA733.2).
  14. 14. The method of claim 1, wherein the marker is GC-C.
  15. 15. The method of claim 1, wherein the disseminated cell is a metastatic colon cancer cell.
  16. 16. A method of diagnosing metastatic cancer comprising detecting the presence of a disseminated cell marker for cancer cells identified as from the primary cancer in a sample that does not normally express said marker, said method comprising the steps of
    a) eliminating illegitimate transcription-positive cells from the sample; and
    b) detecting the presence of mRNA that encodes the marker.
  17. 17. The method of claim 16, wherein the disseminated cell marker is a tissue-specific marker.
  18. 18. The method of claim 17, wherein the tissue is selected from the group consisting of colon, lung, prostate, testis, breast, liver, and skin.
  19. 19. The method of claim 16, wherein the disseminated cell marker is selected from the group consisting of guanylyl cyclase C, Cdx-1, Cdx-2, sucrase isomaltase, lactase, carbonic anhydrase, prostate specific antigen, prostate specific membrane antigen, cytokeratin 18, cytokeratin 19, cytokeratin 20, carcinoembryonic antigen, ErbB2, Erb-B3, epithelial mucin-1, epithelial mucin-18, gastrointestinal tumor associated antigen 733.2, desmoplakin I, epithelial glycoprotein 40, tyrosinase, thyroglobulin, tyrosine hydroxylase, and neuron-specific glycoprotein.
  20. 20. The method of claim 16, wherein the eliminating step is performed by removing CD34+ cells from the sample.
  21. 21. The method of claim 20, wherein the CD34+ cells are removed by column chromatography.
  22. 22. The method of claim 16, wherein the sample is tissue or bodily fluid.
  23. 23. The method of claim 16, wherein the sample is selected from the group consisting of blood, lymph tissue, and bone marrow.
  24. 24. The method of claim 16, wherein the mRNA is detected a polymerase chain reaction (PCR)-based method.
  25. 25. The method of claim 16, wherein the mRNA is detected by reverse transcriptase (RT)-PCR.
  26. 26. The method of claim 16, wherein the mRNA is detected by nested RT-PCR.
  27. 27. The method of claim 16, wherein the disseminated cell marker is an epithelial cell marker.
  28. 28. The method of claim 16, wherein the marker is selected from the group consisting of guanylyl cyclase-C (GC-C), prostate-specific antigen (PSA), prostate-specific membrane antigen (PSM), carcinoembryonic antigen (CEA), cytokeratin-19 (CK-19), cytokeratin-20 (CK-20), mucin 1 (MUC-1), and gastrointestinal-associated antigen (GA733.2).
  29. 29. The method of claim 16, wherein the marker is GC-C.
  30. 30. The method of claim 16, wherein the disseminated cell is a metastatic colon cancer cell.
  31. 31. A method of detecting the presence of a tissue-specific marker in a sample not associated with the expression of the tissue-specific marker comprising the steps of
    a) eliminating CD34+ cells from the sample; and
    b) detecting the presence of mRNA encoding the tissue-specific marker.
  32. 32. A method of detecting the presence of a disseminated cell in a sample comprising the steps of
    a) eliminating CD34+ cells from the sample; and
    b) detecting the presence of mRNA that encodes a marker associated with the disseminated cell.
  33. 33. A kit for detecting the presence of a disseminated cell marker in a sample comprising
    a) an affinity column; and
    b) primers for detecting the presence of mRNA encoding the marker.
  34. 34. The kit of claim 33, further comprising one or more of the following: instructions, pictures of results, positive controls, negative controls, and size markers.
  35. 35. A kit for detecting the presence of a disseminated cell marker for cancer cells identified as from the primary cancer in a sample that does not normally express said marker comprising
    a) an affinity column; and
    b) primers for detecting the presence of mRNA encoding the marker.
  36. 36. The kit of claim 35, further comprising one or more of the following: instructions, pictures of results, positive controls, negative controls, and size markers.
US09820215 2000-03-27 2001-03-27 High specificity marker detection Abandoned US20020012931A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US19222900 true 2000-03-27 2000-03-27
US09820215 US20020012931A1 (en) 2000-03-27 2001-03-27 High specificity marker detection

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US09820215 US20020012931A1 (en) 2000-03-27 2001-03-27 High specificity marker detection

Publications (1)

Publication Number Publication Date
US20020012931A1 true true US20020012931A1 (en) 2002-01-31

Family

ID=22708782

Family Applications (20)

Application Number Title Priority Date Filing Date
US09819247 Abandoned US20010036635A1 (en) 2000-03-27 2001-03-27 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US09819254 Abandoned US20010029020A1 (en) 2000-03-27 2001-03-27 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US09819249 Active US6767704B2 (en) 2000-03-27 2001-03-27 Methods of screening and diagnosing esophageal cancer by determining guanylin cyclase C expression
US09819248 Abandoned US20010039016A1 (en) 2000-03-27 2001-03-27 Use of expression profiling for identifying molecular markers useful for diagnosis of metastatic cancer
US09820215 Abandoned US20020012931A1 (en) 2000-03-27 2001-03-27 High specificity marker detection
US09819252 Expired - Fee Related US6844153B2 (en) 2000-03-27 2001-03-27 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US10428225 Abandoned US20040033520A1 (en) 2000-03-27 2003-05-02 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US10611533 Expired - Fee Related US7745114B2 (en) 2000-03-27 2003-06-30 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US10866951 Active 2023-04-05 US7854933B2 (en) 2000-03-27 2004-06-14 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US11036875 Expired - Fee Related US7479376B2 (en) 2000-03-27 2005-01-14 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US11058778 Expired - Fee Related US7485422B2 (en) 2000-03-27 2005-02-16 Detection of CDX2 expression
US12036875 Abandoned US20080241064A1 (en) 2000-03-27 2008-02-25 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US12272593 Active US7785817B2 (en) 2000-03-27 2008-11-17 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US12554572 Abandoned US20100015167A1 (en) 2000-03-27 2009-09-04 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US12824897 Abandoned US20110250228A1 (en) 2000-03-27 2010-06-28 Compositions and Methods for Identifying and Targeting Cancer Cells of Alimentary Canal Origin
US12860835 Abandoned US20110086064A1 (en) 2000-03-27 2010-08-20 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US12961373 Active US8067007B2 (en) 2000-03-27 2010-12-06 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US13277612 Active US8946168B2 (en) 1997-03-12 2011-10-20 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US14520962 Active US9429576B2 (en) 1997-03-12 2014-10-22 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US15249291 Pending US20170049869A1 (en) 1997-03-12 2016-08-26 Compositions and Methods for Identifying and Targeting Cancer Cells of Alimentary Canal Origin

Family Applications Before (4)

Application Number Title Priority Date Filing Date
US09819247 Abandoned US20010036635A1 (en) 2000-03-27 2001-03-27 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US09819254 Abandoned US20010029020A1 (en) 2000-03-27 2001-03-27 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US09819249 Active US6767704B2 (en) 2000-03-27 2001-03-27 Methods of screening and diagnosing esophageal cancer by determining guanylin cyclase C expression
US09819248 Abandoned US20010039016A1 (en) 2000-03-27 2001-03-27 Use of expression profiling for identifying molecular markers useful for diagnosis of metastatic cancer

Family Applications After (15)

Application Number Title Priority Date Filing Date
US09819252 Expired - Fee Related US6844153B2 (en) 2000-03-27 2001-03-27 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US10428225 Abandoned US20040033520A1 (en) 2000-03-27 2003-05-02 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US10611533 Expired - Fee Related US7745114B2 (en) 2000-03-27 2003-06-30 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US10866951 Active 2023-04-05 US7854933B2 (en) 2000-03-27 2004-06-14 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US11036875 Expired - Fee Related US7479376B2 (en) 2000-03-27 2005-01-14 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US11058778 Expired - Fee Related US7485422B2 (en) 2000-03-27 2005-02-16 Detection of CDX2 expression
US12036875 Abandoned US20080241064A1 (en) 2000-03-27 2008-02-25 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US12272593 Active US7785817B2 (en) 2000-03-27 2008-11-17 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US12554572 Abandoned US20100015167A1 (en) 2000-03-27 2009-09-04 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US12824897 Abandoned US20110250228A1 (en) 2000-03-27 2010-06-28 Compositions and Methods for Identifying and Targeting Cancer Cells of Alimentary Canal Origin
US12860835 Abandoned US20110086064A1 (en) 2000-03-27 2010-08-20 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US12961373 Active US8067007B2 (en) 2000-03-27 2010-12-06 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US13277612 Active US8946168B2 (en) 1997-03-12 2011-10-20 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US14520962 Active US9429576B2 (en) 1997-03-12 2014-10-22 Compositions and methods for identifying and targeting cancer cells of alimentary canal origin
US15249291 Pending US20170049869A1 (en) 1997-03-12 2016-08-26 Compositions and Methods for Identifying and Targeting Cancer Cells of Alimentary Canal Origin

Country Status (7)

Country Link
US (20) US20010036635A1 (en)
EP (5) EP2949762A1 (en)
JP (3) JP2003528628A (en)
CA (3) CA2404428A1 (en)
DE (2) DE60142228D1 (en)
ES (2) ES2346637T3 (en)
WO (3) WO2001073131A1 (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004056978A1 (en) * 2002-12-19 2004-07-08 Ivonex Gmbh Method for the separation of cell fractions
US20040166555A1 (en) * 1999-11-10 2004-08-26 Rebecca Braff Cell sorting apparatus and methods for manipulating cells using the same
US20040171091A1 (en) * 2003-02-27 2004-09-02 Cell Work, Inc. Standardized evaluation of therapeutic efficacy based on cellular biomarkers
US20050266433A1 (en) * 2004-03-03 2005-12-01 Ravi Kapur Magnetic device for isolation of cells and biomolecules in a microfluidic environment
US20060134599A1 (en) * 2002-09-27 2006-06-22 Mehmet Toner Microfluidic device for cell separation and uses thereof
US20070026415A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026416A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026381A1 (en) * 2005-04-05 2007-02-01 Huang Lotien R Devices and methods for enrichment and alteration of cells and other particles
US20070026417A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026469A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026414A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026413A1 (en) * 2005-07-29 2007-02-01 Mehmet Toner Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070059781A1 (en) * 2005-09-15 2007-03-15 Ravi Kapur System for size based separation and analysis
US20070059774A1 (en) * 2005-09-15 2007-03-15 Michael Grisham Kits for Prenatal Testing
US20070059683A1 (en) * 2005-09-15 2007-03-15 Tom Barber Veterinary diagnostic system
US20070059680A1 (en) * 2005-09-15 2007-03-15 Ravi Kapur System for cell enrichment
US20070160503A1 (en) * 2003-06-13 2007-07-12 Palaniappan Sethu Microfluidic systems for size based removal of red blood cells and platelets from blood
US20080050739A1 (en) * 2006-06-14 2008-02-28 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
WO2008029251A3 (en) * 2006-09-07 2008-05-22 Universitatsklinikum Hamburg E Method for the detection of cancerous epithelial cells using released cytokeratins as markers for said cells
US20090136946A1 (en) * 2007-11-27 2009-05-28 Mark Carle Connelly Automated Enumeration and Characterization of Circulating Melanoma Cells in Blood
US20090181421A1 (en) * 2005-07-29 2009-07-16 Ravi Kapur Diagnosis of fetal abnormalities using nucleated red blood cells
US20100112575A1 (en) * 2008-09-20 2010-05-06 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US20100240037A1 (en) * 2004-07-09 2010-09-23 Godfrey Tony E Identification of markers in esophageal cancer, colon cancer, head and neck cancer, and melanoma
US20100291572A1 (en) * 2006-06-14 2010-11-18 Artemis Health, Inc. Fetal aneuploidy detection by sequencing
US20110151610A1 (en) * 2009-12-23 2011-06-23 Varian Semiconductor Equipment Associates, Inc. Workpiece patterning with plasma sheath modulation
US8137912B2 (en) 2006-06-14 2012-03-20 The General Hospital Corporation Methods for the diagnosis of fetal abnormalities
US8168389B2 (en) 2006-06-14 2012-05-01 The General Hospital Corporation Fetal cell analysis using sample splitting
US20140133733A1 (en) * 2012-11-15 2014-05-15 Siemens Corporation Cell Feature-Based Automatic Circulating Tumor Cell Detection
US9797905B2 (en) 2012-06-27 2017-10-24 Berg Llc Use of markers in the diagnosis and treatment of prostate cancer

Families Citing this family (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5879656A (en) * 1993-10-26 1999-03-09 Thomas Jefferson University Methods of treating metastatic colorectal cancer with ST receptor binding compounds
US7097839B1 (en) * 1993-10-26 2006-08-29 Thomas Jefferson University ST receptor binding compounds and methods of using the same
CA2404428A1 (en) * 2000-03-27 2001-10-04 Thomas Jefferson University High specificity marker detection
WO2002022885A1 (en) * 2000-09-18 2002-03-21 Thomas Jefferson University Compositions and methods for identifying and targeting stomach and esophageal cancer cells
US20030148295A1 (en) * 2001-03-20 2003-08-07 Wan Jackson Shek-Lam Expression profiles and methods of use
WO2004044178A3 (en) * 2002-11-13 2005-09-22 Genentech Inc Methods and compositions for diagnosing dysplasia
US7422865B2 (en) * 2003-01-13 2008-09-09 Agilent Technologies, Inc. Method of identifying peptides in a proteomic sample
EP1599165A4 (en) * 2003-02-10 2010-09-08 Univ Jefferson The use of gcc ligands
US20050221339A1 (en) * 2004-03-31 2005-10-06 Medical Research Council Harvard University Compartmentalised screening by microfluidic control
GB0307428D0 (en) * 2003-03-31 2003-05-07 Medical Res Council Compartmentalised combinatorial chemistry
GB0307403D0 (en) 2003-03-31 2003-05-07 Medical Res Council Selection by compartmentalised screening
CA2526284C (en) 2003-06-25 2014-11-18 Crucell Holland B.V. Binding molecules for the treatment of myeloid cell malignancies
CA2531281A1 (en) * 2003-07-03 2005-01-27 Gentron, Llc Methods and systems for diagnosis of non-central nervous system (cns) diseases in cns samples
CA2539116C (en) * 2003-09-15 2014-11-18 Research Development Foundation Cripto antagonism of activin and tgf-b signaling
WO2005040163A1 (en) * 2003-10-28 2005-05-06 Dr. Reddy's Laboratories Ltd Heterocyclic compounds that block the effects of advanced glycation end products (age)
EP1781339B1 (en) 2004-06-25 2013-12-25 Thomas Jefferson University Guanylyl cyclase C ligands
US7968287B2 (en) 2004-10-08 2011-06-28 Medical Research Council Harvard University In vitro evolution in microfluidic systems
US20060078893A1 (en) 2004-10-12 2006-04-13 Medical Research Council Compartmentalised combinatorial chemistry by microfluidic control
US8535914B2 (en) * 2005-01-21 2013-09-17 Canon Kabushiki Kaisha Probe, probe set and information acquisition method using the same
WO2007030473A3 (en) * 2005-09-06 2007-08-09 Univ Stanford Luciferases and methods for making and using the same
CA2633520A1 (en) * 2005-12-22 2007-07-05 Pacific Biosciences Of California, Inc. Protein engineering strategies to optimize activity of surface attached proteins
EP1963530B1 (en) * 2005-12-22 2011-07-27 Pacific Biosciences of California, Inc. Active surface coupled polymerases
US8921086B2 (en) * 2005-12-22 2014-12-30 Pacific Biosciences Of California, Inc. Polymerases for nucleotide analogue incorporation
EP2363205A3 (en) 2006-01-11 2014-06-04 Raindance Technologies, Inc. Microfluidic Devices And Methods Of Use In The Formation And Control Of Nanoreactors
JP2007215412A (en) * 2006-02-14 2007-08-30 Shizuoka Prefecture Method for judging malignant metastatic stomach cancer
US20070207467A1 (en) * 2006-03-01 2007-09-06 Ming Xu Detection of lymph node metastasis from gastric carcinoma
US20080014589A1 (en) 2006-05-11 2008-01-17 Link Darren R Microfluidic devices and methods of use thereof
US9562837B2 (en) 2006-05-11 2017-02-07 Raindance Technologies, Inc. Systems for handling microfludic droplets
EP2767595A1 (en) * 2006-05-22 2014-08-20 Clinical Genomics Pty Ltd Detection method for characterising the anatomical origin of a cell
WO2008021123A1 (en) 2006-08-07 2008-02-21 President And Fellows Of Harvard College Fluorocarbon emulsion stabilizing surfactants
US8343746B2 (en) * 2006-10-23 2013-01-01 Pacific Biosciences Of California, Inc. Polymerase enzymes and reagents for enhanced nucleic acid sequencing
WO2008097559A3 (en) 2007-02-06 2008-10-09 Univ Brandeis Manipulation of fluids and reactions in microfluidic systems
WO2008130623A1 (en) 2007-04-19 2008-10-30 Brandeis University Manipulation of fluids, fluid components and reactions in microfluidic systems
US8679759B2 (en) * 2007-08-01 2014-03-25 The Johns Hopkins University Esophageal cancer markers
CA2760050A1 (en) * 2008-05-13 2009-11-19 Thomas Jefferson University Guanylyl cyclase c qrt-pcr
WO2010009365A1 (en) * 2008-07-18 2010-01-21 Raindance Technologies, Inc. Droplet libraries
US8968210B2 (en) 2008-10-01 2015-03-03 Covidien LLP Device for needle biopsy with integrated needle protection
US9186128B2 (en) * 2008-10-01 2015-11-17 Covidien Lp Needle biopsy device
US9782565B2 (en) 2008-10-01 2017-10-10 Covidien Lp Endoscopic ultrasound-guided biliary access system
US9332973B2 (en) 2008-10-01 2016-05-10 Covidien Lp Needle biopsy device with exchangeable needle and integrated needle protection
WO2010096929A1 (en) 2009-02-25 2010-09-02 Diagnocure Inc. Method for detecting metastasis of gi cancer
EP2411148B1 (en) 2009-03-23 2018-02-21 Raindance Technologies, Inc. Manipulation of microfluidic droplets
KR20170123723A (en) 2009-10-23 2017-11-08 밀레니엄 파머슈티컬스 인코퍼레이티드 Anti-gcc antibody molecules and related compositions and methods
EP2496299A4 (en) * 2009-11-05 2014-08-27 Sequent Medical Inc Multiple layer filamentary devices or treatment of vascular defects
GB0920014D0 (en) * 2009-11-13 2009-12-30 Medical Res Council Cell sampling device
US9217032B2 (en) * 2010-01-08 2015-12-22 Les Laboratoires Servier Methods for treating colorectal cancer
US9399797B2 (en) 2010-02-12 2016-07-26 Raindance Technologies, Inc. Digital analyte analysis
US9366632B2 (en) 2010-02-12 2016-06-14 Raindance Technologies, Inc. Digital analyte analysis
JP5934657B2 (en) 2010-02-12 2016-06-15 レインダンス テクノロジーズ, インコーポレイテッド Digital sample analysis
WO2011126053A1 (en) 2010-04-06 2011-10-13 国立大学法人鹿児島大学 Method for examining digestive cancer using n-binding sugar chains
EP2622103A4 (en) 2010-09-30 2014-04-23 Raindance Technologies Inc Sandwich assays in droplets
US9364803B2 (en) 2011-02-11 2016-06-14 Raindance Technologies, Inc. Methods for forming mixed droplets
US9150852B2 (en) 2011-02-18 2015-10-06 Raindance Technologies, Inc. Compositions and methods for molecular labeling
CN102311458A (en) * 2011-05-31 2012-01-11 江苏省原子医学研究所 <99m>TcO-nucleus-labeled chlorambucil complex as well as preparing and separating and purifying methods and application thereof
US8841071B2 (en) 2011-06-02 2014-09-23 Raindance Technologies, Inc. Sample multiplexing
US8658430B2 (en) 2011-07-20 2014-02-25 Raindance Technologies, Inc. Manipulating droplet size
JPWO2013031756A1 (en) * 2011-08-29 2015-03-23 東レ株式会社 Detection markers and examination method for colon cancer or esophageal cancer
JP2013083490A (en) 2011-10-06 2013-05-09 Kagoshima Univ Marker for diagnosing gastrointestinal cancer, and method for inspecting gastrointestinal cancer
US9156915B2 (en) 2012-04-26 2015-10-13 Thomas Jefferson University Anti-GCC antibody molecules
US9000129B2 (en) 2012-04-27 2015-04-07 Millennium Pharmaceuticals, Inc. Anti-GCC antibody molecules and methods for use of same
CN105142664A (en) * 2013-02-28 2015-12-09 米伦纽姆医药公司 Administration of an anti-GCC antibody-drug conjugate and a DNA damaging agent in the treatment of cancer
US9567643B2 (en) 2013-10-04 2017-02-14 Aptose Biosciences Inc. Compositions and methods for treating cancers
US20170067912A1 (en) * 2014-03-13 2017-03-09 The Penn State Research Foundation Compositions and methods for diagnosing barrett's esophagus stages
CN106124764B (en) * 2016-08-12 2018-03-09 上海市嘉定区中心医院 In hoxb9 pbx1 and stomach cancer detection kit, and application of biomarkers

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5075216A (en) * 1988-09-23 1991-12-24 Cetus Corporation Methods for dna sequencing with thermus aquaticus dna polymerase
US5430138A (en) * 1990-07-27 1995-07-04 Chiron Corporation Hydroxyl-protecting groups attached to cytidine nucleotide compounds which are orthogonally removable
US5437977A (en) * 1990-04-03 1995-08-01 David Segev DNA probe signal amplification
US5597909A (en) * 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5601990A (en) * 1994-09-13 1997-02-11 Thomas Jefferson University Methods of diagnosing colorectal tumors and metastasis thereof
US5874266A (en) * 1997-03-27 1999-02-23 Palsson; Bernhard O. Targeted system for removing tumor cells from cell populations
US5879656A (en) * 1993-10-26 1999-03-09 Thomas Jefferson University Methods of treating metastatic colorectal cancer with ST receptor binding compounds
US5885574A (en) * 1994-07-26 1999-03-23 Amgen Inc. Antibodies which activate an erythropoietin receptor
US5962237A (en) * 1996-04-05 1999-10-05 The Johns Hopkins University School Of Medicine Method of enriching rare cells
US6130043A (en) * 1997-05-02 2000-10-10 Abbott Laboratories Reagents and methods useful for detecting diseases of the prostate
US20020098535A1 (en) * 1999-02-10 2002-07-25 Zheng-Pin Wang Class characterization of circulating cancer cells isolated from body fluids and methods of use

Family Cites Families (78)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3130883A (en) * 1962-03-01 1964-04-28 Lewis J Mackool Hatchet scabbard
US4375414A (en) 1971-05-20 1983-03-01 Meir Strahilevitz Immunological methods for removing species from the blood circulatory system and devices therefor
US4022878A (en) 1972-05-15 1977-05-10 Biological Developments, Inc. Methods and compounds for producing specific antibodies
US4329281A (en) 1978-06-05 1982-05-11 Hoffmann-La Roche Inc. Hapten compositions
US4264024A (en) * 1978-12-21 1981-04-28 Harris Jr Ellsworth L Smoking pipe sling
US4526716A (en) 1981-11-20 1985-07-02 The Ohio State University Antigenic modification of polypeptides
US4341763A (en) 1981-03-10 1982-07-27 Smithkline-Rit Methods of vaccinating humans against rotavirus infection
US4873191A (en) 1981-06-12 1989-10-10 Ohio University Genetic transformation of zygotes
US4584268A (en) 1981-10-13 1986-04-22 Ceriani Roberto Luis Method and compositions for carcinoma diagnosis
US4867973A (en) 1984-08-31 1989-09-19 Cytogen Corporation Antibody-therapeutic agent conjugates
GB8328918D0 (en) 1983-10-28 1983-11-30 Unilever Plc Alkaline phosphatase
US4729893A (en) 1984-12-26 1988-03-08 Robert L. Letcher Enteric encapsulation of ancrod for oral administration
US4601896A (en) 1984-03-21 1986-07-22 Mark Nugent Pharmaceutical capsule compositions and structures for gastric sensitive materials
US4736866B1 (en) 1984-06-22 1988-04-12 Transgenic non-human mammals
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
GB8508845D0 (en) 1985-04-04 1985-05-09 Hoffmann La Roche Vaccinia dna
US5160723A (en) 1985-04-19 1992-11-03 Sloan-Kettering Institute For Cancer Research Method of imaging colorectal carcinoma lesion and composition for use therein
GB8519457D0 (en) 1985-08-02 1985-09-11 Faulk Ward Page Tumour imaging agents
JPH0584467B2 (en) 1986-01-10 1993-12-02 Sadao Shiosaka
US4849227A (en) 1986-03-21 1989-07-18 Eurasiam Laboratories, Inc. Pharmaceutical compositions
WO1988000837A3 (en) 1986-08-07 1988-03-10 Battelle Memorial Institute Advanced anticancer therapy and cytotoxic medicaments for its implementation
US5166320A (en) 1987-04-22 1992-11-24 University Of Connecticut Carrier system and method for the introduction of genes into mammalian cells
US5399347A (en) 1987-06-24 1995-03-21 Autoimmune, Inc. Method of treating rheumatoid arthritis with type II collagen
US5217869A (en) 1987-10-13 1993-06-08 Terrapin Technologies, Inc. Method to produce immunodiagnostic reagents
US5340474A (en) 1988-03-24 1994-08-23 Terrapin Technologies, Inc. Panels of analyte-binding ligands
US5133866A (en) 1988-03-24 1992-07-28 Terrapin Technologies, Inc. Method to identify analyte-bending ligands
US4963263A (en) 1988-03-24 1990-10-16 Terrapin Technologies, Inc. Method of identity analyte-binding peptides
US5350741A (en) 1988-07-30 1994-09-27 Kanji Takada Enteric formulations of physiologically active peptides and proteins
US4923949A (en) 1988-08-03 1990-05-08 Kanegafuchi Chemical Industry Co., Ltd. Ethynylene-disilanylene copolymers and method of preparing same
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5049656A (en) 1988-12-21 1991-09-17 Board Of Regents Of The University Of Nebraska Sequential peptide and oligonucleotide syntheses using immunoaffinity techniques
CA2357538A1 (en) 1989-03-21 1990-10-04 Wisconsin Alumni Research Foundation Expression of exogenous polynucleotide sequences in a vertebrate
US5424186A (en) 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
US5143854A (en) 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
US5443816A (en) 1990-08-08 1995-08-22 Rhomed Incorporated Peptide-metal ion pharmaceutical preparation and method
US5271961A (en) 1989-11-06 1993-12-21 Alkermes Controlled Therapeutics, Inc. Method for producing protein microspheres
US5252743A (en) 1989-11-13 1993-10-12 Affymax Technologies N.V. Spatially-addressable immobilization of anti-ligands on surfaces
US5366862A (en) 1990-02-14 1994-11-22 Receptor Laboratories, Inc. Method for generating and screening useful peptides
US5237051A (en) 1990-12-06 1993-08-17 Vanderbilt University Purified enterotoxin receptor protein
US5352775A (en) 1991-01-16 1994-10-04 The Johns Hopkins Univ. APC gene and nucleic acid probes derived therefrom
WO1992014470A1 (en) 1991-02-21 1992-09-03 Smithkline Beecham Corporation Treatment of esophageal cancer
US5330892A (en) 1991-03-13 1994-07-19 The Johns Hopkins University MCC gene (mutated in colorectal cancer) used for diagnosis of cancer in humans
CA2072314C (en) 1991-06-26 2007-07-31 Mark R. Green Methods for detection of carcinoma metastases by nucleic acid amplification
US5140102A (en) * 1991-09-23 1992-08-18 Monsanto Company Pentadecapeptide, guanylin, which stimulates intestinal guanylate cyclase
US5270170A (en) 1991-10-16 1993-12-14 Affymax Technologies N.V. Peptide library and screening method
US5384261A (en) 1991-11-22 1995-01-24 Affymax Technologies N.V. Very large scale immobilized polymer synthesis using mechanically directed flow paths
US5395750A (en) 1992-02-28 1995-03-07 Hoffmann-La Roche Inc. Methods for producing proteins which bind to predetermined antigens
US5420328A (en) 1992-09-11 1995-05-30 Affymax Technologies, N.V. Methods for the synthesis of phosphonate esters
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
US5969097A (en) * 1992-06-23 1999-10-19 G. D. Searle & Co. Human guanylin
US5585479A (en) 1992-07-24 1996-12-17 The United States Of America As Represented By The Secretary Of The Navy Antisense oligonucleotides directed against human ELAM-I RNA
US5288514A (en) 1992-09-14 1994-02-22 The Regents Of The University Of California Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support
US5324483B1 (en) 1992-10-08 1996-09-24 Warner Lambert Co Apparatus for multiple simultaneous synthesis
US5397639A (en) 1992-11-25 1995-03-14 Tollini; Dennis R. Securing tape
US5595739A (en) 1993-05-07 1997-01-21 Abbott Laboratories Hepatitis B virus mutants, reagents and methods for detection
US5518888A (en) 1993-10-26 1996-05-21 Thomas Jefferson University ST receptor binding compounds and methods of using the same
US5962220A (en) 1993-10-26 1999-10-05 Thomas Jefferson University Compositions that specifically bind to colorectal cells and methods of using the same
DE69433564T2 (en) 1993-10-26 2004-12-23 Thomas Jefferson University Compounds that bind specifically colorectal cancer cells, and methods for their use
US5489670A (en) * 1993-10-29 1996-02-06 G. D. Searle & Co. Human uroguanylin
US5858011A (en) 1995-08-02 1999-01-12 The Procter & Gamble Company Disposable absorbent article having a resilient member
DE69733629D1 (en) * 1996-04-16 2005-08-04 Kishimoto Tadamitsu A method for detecting solid cancer cells and histological heterotopias and methods for testing tissues for bone marrow transplantation and the transplantation of peripheral blood stem cells
US6602659B1 (en) * 1996-05-03 2003-08-05 Thomas Jefferson University Methods of and kits and compositions for diagnosing colorectal tumors and metastasis thereof
EP0951475B1 (en) 1996-05-03 2003-07-16 Thomas Jefferson University Metastatic colorectal cancer vaccine
US5914238A (en) * 1996-06-05 1999-06-22 Matritech, Inc. Materials and methods for detection of breast cancer
WO1998009510A1 (en) * 1996-09-04 1998-03-12 Howard Florey Institute Of Experimental Physiology And Medicine Methods of diagnosing and treating cancer
FI971124A0 (en) * 1997-03-18 1997-03-18 Locus Genex Oy Method Foer diagnostisering of magcancer
US6120995A (en) * 1997-08-07 2000-09-19 Thomas Jefferson University Compositions that specifically bind to colorectal cancer cells and methods of using the same
JP2002526760A (en) 1998-10-02 2002-08-20 ダイアデクスアス・インコーポレーテッド Diagnosing gastrointestinal cancer, monitoring, staging, novel methods of imaging and therapy
WO2000073479A1 (en) * 1999-05-28 2000-12-07 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services A combined growth factor-deleted and thymidine kinase-deleted vaccinia virus vector
CA2404428A1 (en) 2000-03-27 2001-10-04 Thomas Jefferson University High specificity marker detection
US6652378B2 (en) 2001-06-01 2003-11-25 Igt Gaming machines and systems offering simultaneous play of multiple games and methods of gaming
WO2004021275A8 (en) * 2002-08-30 2005-03-17 Koninkl Philips Electronics Nv Embedding fingerprint data for media content identification
EP1599165A4 (en) * 2003-02-10 2010-09-08 Univ Jefferson The use of gcc ligands
EP1781339B1 (en) * 2004-06-25 2013-12-25 Thomas Jefferson University Guanylyl cyclase C ligands
DE102005041131B4 (en) 2005-08-30 2008-01-31 Phoenix Contact Gmbh & Co. Kg exchangers
US9001515B2 (en) 2012-04-20 2015-04-07 Cisco Technology, Inc. Universal pull tab release for modules including fiber optic and cable accessibilities
US9707467B2 (en) 2013-10-18 2017-07-18 Under Armour, Inc. Athletic glove
US9707565B2 (en) 2014-04-09 2017-07-18 Burdette Lyne II Lyman Screen assembly for shredding machine

Patent Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) * 1985-03-28 1990-11-27 Cetus Corp
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (en) * 1986-01-30 1990-11-27 Cetus Corp
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US5075216A (en) * 1988-09-23 1991-12-24 Cetus Corporation Methods for dna sequencing with thermus aquaticus dna polymerase
US5437977A (en) * 1990-04-03 1995-08-01 David Segev DNA probe signal amplification
US5430138A (en) * 1990-07-27 1995-07-04 Chiron Corporation Hydroxyl-protecting groups attached to cytidine nucleotide compounds which are orthogonally removable
US5879656A (en) * 1993-10-26 1999-03-09 Thomas Jefferson University Methods of treating metastatic colorectal cancer with ST receptor binding compounds
US5885574A (en) * 1994-07-26 1999-03-23 Amgen Inc. Antibodies which activate an erythropoietin receptor
US5597909A (en) * 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5601990A (en) * 1994-09-13 1997-02-11 Thomas Jefferson University Methods of diagnosing colorectal tumors and metastasis thereof
US5962237A (en) * 1996-04-05 1999-10-05 The Johns Hopkins University School Of Medicine Method of enriching rare cells
US5874266A (en) * 1997-03-27 1999-02-23 Palsson; Bernhard O. Targeted system for removing tumor cells from cell populations
US6130043A (en) * 1997-05-02 2000-10-10 Abbott Laboratories Reagents and methods useful for detecting diseases of the prostate
US20020098535A1 (en) * 1999-02-10 2002-07-25 Zheng-Pin Wang Class characterization of circulating cancer cells isolated from body fluids and methods of use

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040166555A1 (en) * 1999-11-10 2004-08-26 Rebecca Braff Cell sorting apparatus and methods for manipulating cells using the same
US8986966B2 (en) 2002-09-27 2015-03-24 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US20070259424A1 (en) * 2002-09-27 2007-11-08 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US20060134599A1 (en) * 2002-09-27 2006-06-22 Mehmet Toner Microfluidic device for cell separation and uses thereof
US8895298B2 (en) 2002-09-27 2014-11-25 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US8304230B2 (en) 2002-09-27 2012-11-06 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
US8372579B2 (en) 2002-09-27 2013-02-12 The General Hospital Corporation Microfluidic device for cell separation and uses thereof
WO2004056978A1 (en) * 2002-12-19 2004-07-08 Ivonex Gmbh Method for the separation of cell fractions
US20040171091A1 (en) * 2003-02-27 2004-09-02 Cell Work, Inc. Standardized evaluation of therapeutic efficacy based on cellular biomarkers
US20070160503A1 (en) * 2003-06-13 2007-07-12 Palaniappan Sethu Microfluidic systems for size based removal of red blood cells and platelets from blood
US20050266433A1 (en) * 2004-03-03 2005-12-01 Ravi Kapur Magnetic device for isolation of cells and biomolecules in a microfluidic environment
US20100240037A1 (en) * 2004-07-09 2010-09-23 Godfrey Tony E Identification of markers in esophageal cancer, colon cancer, head and neck cancer, and melanoma
EP2287329A3 (en) * 2004-07-09 2011-08-03 University of Pittsburgh of the Commonwealth System of Higher Education Identification of markers in esophageal cancer
US8585971B2 (en) 2005-04-05 2013-11-19 The General Hospital Corporation Devices and method for enrichment and alteration of cells and other particles
US8021614B2 (en) 2005-04-05 2011-09-20 The General Hospital Corporation Devices and methods for enrichment and alteration of cells and other particles
US20070026381A1 (en) * 2005-04-05 2007-02-01 Huang Lotien R Devices and methods for enrichment and alteration of cells and other particles
US9174222B2 (en) 2005-04-05 2015-11-03 The General Hospital Corporation Devices and method for enrichment and alteration of cells and other particles
US20070026413A1 (en) * 2005-07-29 2007-02-01 Mehmet Toner Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026414A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026417A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026415A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20090181421A1 (en) * 2005-07-29 2009-07-16 Ravi Kapur Diagnosis of fetal abnormalities using nucleated red blood cells
US20070026469A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070026416A1 (en) * 2005-07-29 2007-02-01 Martin Fuchs Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US8921102B2 (en) 2005-07-29 2014-12-30 Gpb Scientific, Llc Devices and methods for enrichment and alteration of circulating tumor cells and other particles
US20070059774A1 (en) * 2005-09-15 2007-03-15 Michael Grisham Kits for Prenatal Testing
US20070059781A1 (en) * 2005-09-15 2007-03-15 Ravi Kapur System for size based separation and analysis
US20070059683A1 (en) * 2005-09-15 2007-03-15 Tom Barber Veterinary diagnostic system
US20070059680A1 (en) * 2005-09-15 2007-03-15 Ravi Kapur System for cell enrichment
US9017942B2 (en) 2006-06-14 2015-04-28 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US8137912B2 (en) 2006-06-14 2012-03-20 The General Hospital Corporation Methods for the diagnosis of fetal abnormalities
US8168389B2 (en) 2006-06-14 2012-05-01 The General Hospital Corporation Fetal cell analysis using sample splitting
US20090280492A1 (en) * 2006-06-14 2009-11-12 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US9347100B2 (en) 2006-06-14 2016-05-24 Gpb Scientific, Llc Rare cell analysis using sample splitting and DNA tags
US20080050739A1 (en) * 2006-06-14 2008-02-28 Roland Stoughton Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats
US9273355B2 (en) 2006-06-14 2016-03-01 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US8372584B2 (en) 2006-06-14 2013-02-12 The General Hospital Corporation Rare cell analysis using sample splitting and DNA tags
US20100291572A1 (en) * 2006-06-14 2010-11-18 Artemis Health, Inc. Fetal aneuploidy detection by sequencing
US8524493B2 (en) 2006-09-07 2013-09-03 Centre Hospitalier Universitaire De Montpellier Released cytokeratins as markers for epithelial cells
WO2008029251A3 (en) * 2006-09-07 2008-05-22 Universitatsklinikum Hamburg E Method for the detection of cancerous epithelial cells using released cytokeratins as markers for said cells
US20100184083A1 (en) * 2006-09-07 2010-07-22 Universitatsklinikum Hamburg-Eppendorf Released cytokeratins as markers for epithelial cells
US20090136946A1 (en) * 2007-11-27 2009-05-28 Mark Carle Connelly Automated Enumeration and Characterization of Circulating Melanoma Cells in Blood
US9353414B2 (en) 2008-09-20 2016-05-31 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US8296076B2 (en) 2008-09-20 2012-10-23 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuoploidy by sequencing
US8195415B2 (en) 2008-09-20 2012-06-05 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US20100112575A1 (en) * 2008-09-20 2010-05-06 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive Diagnosis of Fetal Aneuploidy by Sequencing
US9404157B2 (en) 2008-09-20 2016-08-02 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US8682594B2 (en) 2008-09-20 2014-03-25 The Board Of Trustees Of The Leland Stanford Junior University Noninvasive diagnosis of fetal aneuploidy by sequencing
US20110151610A1 (en) * 2009-12-23 2011-06-23 Varian Semiconductor Equipment Associates, Inc. Workpiece patterning with plasma sheath modulation
US9797905B2 (en) 2012-06-27 2017-10-24 Berg Llc Use of markers in the diagnosis and treatment of prostate cancer
US20140133733A1 (en) * 2012-11-15 2014-05-15 Siemens Corporation Cell Feature-Based Automatic Circulating Tumor Cell Detection
US9396532B2 (en) * 2012-11-15 2016-07-19 Siemens Healthcare Diagnostics, Inc. Cell feature-based automatic circulating tumor cell detection

Also Published As

Publication number Publication date Type
CA2404432A1 (en) 2001-10-04 application
CA2404431C (en) 2011-06-07 grant
US7785817B2 (en) 2010-08-31 grant
US6844153B2 (en) 2005-01-18 grant
DE60140865D1 (en) 2010-02-04 grant
US20010029020A1 (en) 2001-10-11 application
US20050196793A1 (en) 2005-09-08 application
EP1272665A1 (en) 2003-01-08 application
EP2949762A1 (en) 2015-12-02 application
EP1268854A4 (en) 2003-05-02 application
US7745114B2 (en) 2010-06-29 grant
EP1272665B1 (en) 2010-05-26 grant
US20040033520A1 (en) 2004-02-19 application
JP2003535580A (en) 2003-12-02 application
ES2548381T3 (en) 2015-10-16 grant
JP5122713B2 (en) 2013-01-16 grant
US8946168B2 (en) 2015-02-03 grant
US20050164267A1 (en) 2005-07-28 application
US20110086064A1 (en) 2011-04-14 application
JP2003532389A (en) 2003-11-05 application
CA2404428A1 (en) 2001-10-04 application
US20010029019A1 (en) 2001-10-11 application
US20170049869A1 (en) 2017-02-23 application
US20010039016A1 (en) 2001-11-08 application
US20110250228A1 (en) 2011-10-13 application
US7854933B2 (en) 2010-12-21 grant
WO2001073132A1 (en) 2001-10-04 application
DE60142228D1 (en) 2010-07-08 grant
US20050059008A1 (en) 2005-03-17 application
US20120321552A1 (en) 2012-12-20 application
EP1272665A4 (en) 2005-01-12 application
US20010039017A1 (en) 2001-11-08 application
JP2003528628A (en) 2003-09-30 application
US20110104050A1 (en) 2011-05-05 application
US20090215089A1 (en) 2009-08-27 application
ES2346637T3 (en) 2010-10-19 grant
EP1274861B1 (en) 2009-12-23 grant
EP1274861A4 (en) 2005-09-28 application
US20040224355A1 (en) 2004-11-11 application
EP2230320B1 (en) 2015-07-01 grant
US7485422B2 (en) 2009-02-03 grant
US9429576B2 (en) 2016-08-30 grant
EP1274861A1 (en) 2003-01-15 application
US20080241064A1 (en) 2008-10-02 application
US6767704B2 (en) 2004-07-27 grant
EP2230320A1 (en) 2010-09-22 application
CA2404431A1 (en) 2001-10-04 application
WO2001073133A9 (en) 2003-06-12 application
US20010036635A1 (en) 2001-11-01 application
WO2001073131A1 (en) 2001-10-04 application
US7479376B2 (en) 2009-01-20 grant
US20100015167A1 (en) 2010-01-21 application
WO2001073133A1 (en) 2001-10-04 application
US8067007B2 (en) 2011-11-29 grant
EP1268854A1 (en) 2003-01-02 application
US20150104382A1 (en) 2015-04-16 application

Similar Documents

Publication Publication Date Title
Powell et al. Molecular diagnosis of familial adenomatous polyposis
Mattano et al. Sensitive detection of rare circulating neuroblastoma cells by the reverse transcriptase-polymerase chain reaction
US5766888A (en) Detection of carcinoma metastases by nucleic acid amplification
Pan et al. Overexpression of osteopontin is associated with intrahepatic metastasis, early recurrence, and poorer prognosis of surgically resected hepatocellular carcinoma
Burchill et al. Neuroblastoma cell detection by reverse transcriptase‐polymerase chain reaction (RT‐PCR) for tyrosine hydroxylase mRNA
Andreopoulou et al. Comparison of assay methods for detection of circulating tumor cells in metastatic breast cancer: AdnaGen AdnaTest BreastCancer Select/Detect™ versus Veridex CellSearch™ system
Wilentz et al. K‐ras mutations in the duodenal fluid of patients with pancreatic carcinoma
Van der Auwera et al. Circulating tumour cell detection: a direct comparison between the CellSearch System, the AdnaTest and CK-19/mammaglobin RT–PCR in patients with metastatic breast cancer
Soeth et al. Comparative analysis of bone marrow and venous blood isolates from gastrointestinal cancer patients for the detection of disseminated tumor cells using reverse transcription PCR
Bilchik et al. Molecular staging of early colon cancer on the basis of sentinel node analysis: a multicenter phase II trial
Curry et al. Polymerase chain reaction detection of melanoma cells in the circulation: relation to clinical stage, surgical treatment, and recurrence from melanoma.
US5688649A (en) Methods of detecting micrometastasis of prostate cancer
US6225051B1 (en) Method of detecting solid cancer cells and tissue atypia and method of testing tissues for use in bone marrow transplantation and peripheral blood stem cell transplantation
US20060127902A1 (en) Brain endothelial cell expression patterns
Urban et al. Detection of c-Ki-ras mutation by PCR/RFLP analysis and diagnosis of pancreatic adenocarcinomas
Bozionellou et al. Trastuzumab administration can effectively target chemotherapy-resistant cytokeratin-19 messenger RNA–positive tumor cells in the peripheral blood and bone marrow of patients with breast cancer
Pantel et al. Circulating tumour cells in cancer patients: challenges and perspectives
Kerst et al. Concurrent detection of minimal residual disease (MRD) in childhood acute lymphoblastic leukaemia by flow cytometry and real‐time PCR
Gilbey et al. The detection of circulating breast cancer cells in blood
West et al. Detection of circulating tumor cells in patients with Ewing's sarcoma and peripheral primitive neuroectodermal tumor.
US20090029372A1 (en) Adam12 as a biomarker for bladder cancer
Guadagni et al. Detection of blood-borne cells in colorectal cancer patients by nested reverse transcription-polymerase chain reaction for carcinoembryonic antigen messenger RNA: longitudinal analyses and demonstration of its potential importance as an adjunct to multiple serum markers
Oberthuer et al. The tumor-associated antigen PRAME is universally expressed in high-stage neuroblastoma and associated with poor outcome
Hoorens et al. Undifferentiated carcinoma of the pancreas: analysis of intermediate filament profile and Ki-ras mutations provides evidence of a ductal origin
Inagaki et al. API2-MALT1 fusion transcripts involved in mucosa-associated lymphoid tissue lymphoma: multiplex RT-PCR detection using formalin-fixed paraffin-embedded specimens

Legal Events

Date Code Title Description
AS Assignment

Owner name: THOMAS JEFFERSON UNIVERSITY, PENNSYLVANIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DESNOYERS, RODWIGE;WALDMAN, SCOTT A.;FAVA, TRACY A.;REEL/FRAME:012425/0288;SIGNING DATES FROM 20010824 TO 20010829