JP2000069969A - PRIMER DNA AND DETECTION OF mRNA WHICH CODES FOR PROSTATE-SPECIFIC ANTIGEN USING THE SAME - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain primer DNA which is selected from specific base sequences, consists of serial specific nucleotides, has excellent sensitivity and specificity in detection, and is useful for the diagnoses of prostatic cancer and so on. SOLUTION: This primer DNA is selected from base sequences shown by formula I-IV, consists of serial 10 nucleotides or more, and has a conservative 3' end. It is preferable to detect mRNA which codes for prostate-specific antigen by labelling the primer DNA with a labelling substance (e.g. biotin), synthesizing cDNA using mRNA which codes for a prostate-specific antigen in a specimen as the first template, followed by carrying out the polymerase chain reaction using the synthesized cDNA as the second template and one of the primer DNAs.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a primer DNA used for detecting mRNA encoding a prostate-specific antigen used as a specific marker for prostate cancer in the field of diagnosis in medicine, and a prostate-specific DNA using the same. The present invention relates to a method for detecting mRNA encoding an antigen.

[0002]

2. Description of the Related Art A prostate-specific antigen is a protein that is specifically present in prostate tissues and is not present in other normal tissues or other tumor cells.

[0003] Prostate-specific antigens are elevated in blood in patients with prostate cancer, but not in other malignant tumors. For this reason, measurement of the blood concentration of the prostate-specific antigen is considered to be useful for understanding the condition of prostate cancer, judging the therapeutic effect, and detecting recurrence early.

[0004] Kits based on immunoassays utilizing an antigen-antibody reaction such as a radioimmunoassay method and a sandwich EIA method for measuring prostate specific antigen itself in serum or plasma are commercially available, for screening prostate cancer and the like. Widely used. However, the measurement based on the immunological assay using the antigen-antibody reaction described above was not always satisfactory in terms of detection sensitivity.

On the other hand, as a detection method with higher detection sensitivity, cDNA is synthesized using mRNA encoding a prostate specific antigen in serum as a template, and further, two types of primer DNA and heat-resistant Method for synthesizing and amplifying double-stranded DNA sandwiched between two types of primer DNAs by performing a polymerase chain reaction using a polymerase, and detecting the presence of mRNA encoding a prostate-specific antigen from the amplified product "Aaron et al., Eurology, Vol. 43, 765-77
5, 1994 (Aaron E. Katz et.al., Urology, Vol. 4
3, p.765-775, (1994)).

[0006] However, the prostate-specific antigen is an antigen belonging to kallikrein-like protein. There are several types of kallikrein-like proteins,
Moreover, the nucleotide sequences of the mRNAs encoding the prostate-specific antigen and the kallikrein-like protein are very similar. Therefore, mR encoding the prostate-specific antigen in the serum
Methods for detecting the presence of NA have not always been satisfactory in terms of detection specificity.

[0007] In the detection of mRNA encoding a prostate-specific antigen, a highly reliable primer DNA that enables more specific and highly sensitive detection and a detection method with higher detection sensitivity using the same are desired.

[0008]

The invention according to claims 1 and 2 is a primer DNA for realizing a polymerase chain reaction capable of specifically detecting an mRNA encoding a prostate-specific antigen, which is specific for prostate cancer. The present invention provides a primer DNA suitable for accurate detection. The invention according to claims 3 and 4 provides the effect of the invention according to claims 1 and 2 and a primer D for realizing a polymerase chain reaction capable of specifically detecting a prostate-specific antigen with higher sensitivity.
NA provides primer DNA suitable for highly sensitive and specific detection of mRNA encoding a prostate specific antigen.

A fifth aspect of the present invention provides a polymerase chain reaction capable of detecting mRNA encoding a prostate-specific antigen more easily and with high sensitivity, in addition to the effects of the first aspect of the present invention. It provides a primer DNA for realizing the above. The invention according to claims 6 to 9 provides a method for detecting mRNA encoding a prostate-specific antigen, which is particularly excellent in detection sensitivity and specificity in detection using the polymerase chain reaction.

[0010]

Means for Solving the Problems The present invention provides the following (1) to
Regarding (9). (1) selected from the sequence represented by SEQ ID NO: 1 or 2,
Primer DNA comprising a continuous base sequence of at least 10 bases or more. (2) selected from the sequence represented by SEQ ID NO: 3 or 4,
Primer DNA comprising a continuous base sequence of at least 10 bases or more. (3) The primer DNA according to the above (1) or (2), wherein the 3 'end is preserved. (4) a primer DNA having a sequence represented by any one of SEQ ID NOs: 1 to 4; (5) The primer DNA according to any one of the above (1) to (4), which is labeled with a labeling substance.

(6) cDNA is synthesized by using mRNA encoding a prostate-specific antigen in a sample as a first template,
Next, using the synthesized cDNA as a second template,
A method for detecting mRNA encoding a prostate-specific antigen, comprising performing a polymerase chain reaction using any one of the primer DNAs described in (1) and one of the primer DNAs described in (2). (7) cDNA synthesis is performed using the mRNA encoding the prostate specific antigen in the sample as a first template, and then selected from the sequence represented by SEQ ID NO: 2 using the synthesized cDNA as a second template. Performing a polymerase chain reaction using a primer DNA consisting of a continuous base sequence of at least 10 bases or more and a primer DNA consisting of a base sequence of at least 10 bases or more selected from the sequence represented by SEQ ID NO: 4 A method for detecting mRNA encoding a prostate-specific antigen, characterized in that:

(8) cDNA synthesis is performed using mRNA encoding a prostate-specific antigen in a sample as a first template, and then using the synthesized cDNA as a second template, the primer DNA described in (1) above. A polymerase chain reaction is carried out using any one of the primer DNAs described in the above (2), and the DNA as an amplification product in the reaction solution of the polymerase chain reaction is subjected to a third reaction.
As a template, any one of the primer DNAs according to the above (1) having a DNA sequence capable of binding complementarily to DNA as an amplification product in the reaction solution of the polymerase chain reaction, A polymerase chain reaction is carried out using any one of the primer DNAs according to the above (2) having a DNA sequence capable of complementary binding to DNA as an amplification product. Detection method.

(9) cDNA synthesis is performed using mRNA encoding a prostate-specific antigen in a sample as a first template, and then using the synthesized cDNA as a second template, the sequence represented by SEQ ID NO: 1 Primer DNA consisting of selected and consecutive nucleotide sequences of at least 10 bases or more
And a polymerase chain reaction is performed using primer DNA selected from the sequence represented by SEQ ID NO: 3 and having a base sequence of at least 10 or more bases, and further, amplification products in a reaction solution of the polymerase chain reaction are used. Using a certain DNA as a third template, the primer is selected from the sequence represented by SEQ ID NO: 2 and selected from the sequence represented by SEQ ID NO: 4 and the primer DNA consisting of at least 10 or more consecutive nucleotides, A method for detecting mRNA encoding a prostate-specific antigen, comprising performing a polymerase chain reaction using a primer DNA having a base sequence of 10 or more bases.

[0014]

BEST MODE FOR CARRYING OUT THE INVENTION In the present invention, the nucleotide sequence represented by SEQ ID NO: 1 or 2 is a prostate specific antigen (Prostate specific antigen) as a specific marker for prostate cancer.
n; hereinafter, abbreviated as PSA)
DNA corresponding to a part of SEQ ID NO: 5 which is an RNA sequence
Is an array.

[0015] The DNA base sequence represented by SEQ ID NO: 1
18 to 172 of the mRNA sequence shown in SEQ ID NO: 5
It is a DNA sequence corresponding to the ninth position. The DNA base sequence represented by SEQ ID NO: 2 is a DNA sequence corresponding to positions 578 to 595 of the mRNA sequence shown in SEQ ID NO: 5.

In the present invention, the nucleotide sequence represented by SEQ ID NO: 3 or 4 corresponds to the mR encoding PSA protein.
DNA complementary to a part of SEQ ID NO: 5, which is the sequence of NA
Is an array. The DNA base sequence represented by SEQ ID NO: 3 is
85 to 834 of the mRNA sequence shown in SEQ ID NO: 5
It is a DNA sequence complementary to the sequence corresponding to the first.

The DNA base sequence represented by SEQ ID NO: 4
784 to 784 of the mRNA sequence shown in SEQ ID NO: 5
It is a DNA sequence complementary to the sequence corresponding to the second. The number of bases (length) of the primer DNA selected from the sequence represented by any one of SEQ ID NOs: 1 to 4 is at least 10 bases, preferably at least 12 bases, more preferably from the viewpoint of specificity. 15 bases or more, more preferably,
It is the number of bases of any one of the sequences represented by SEQ ID NOs: 1 to 4. When the number of bases of the primer DNA selected from the sequence represented by any one of SEQ ID NOs: 1 to 4 is less than 10 bases, the specificity of detection of mRNA encoding PSA tends to decrease, and a positive This is not preferable because the probability of false positive determination increases.

The primer DNA sequence selected from the sequences represented by any one of SEQ ID NOs: 1 to 4 may be a 3'-terminal nucleotide sequence from the viewpoint of the sensitivity of detecting PSA-encoding mRNA. Is preferably selected as a conserved sequence. In addition, m that codes the PSA
From the viewpoints of sensitivity and specificity of RNA detection, SEQ ID NOs.
As a primer DNA selected from the sequence represented by any one of SEQ ID NOs: 1 and 4, it is more preferable that the 3 'end is conserved and that the nucleotide sequence is a nucleotide sequence having 10 or more nucleotides. More preferably, the sequence itself is represented by

The above primer DNA for detecting the mRNA encoding the PSA of the present invention can be selected from the original sequences represented by SEQ ID NOs: 1 to 4, and can be used. The combination used as a primer in this case is selected from the sequences represented by SEQ ID NOS: 1 and 2 and one of primer DNAs consisting of a continuous base sequence of at least 10 bases or more and SEQ ID NO: 3 or 4 Is used in combination with any one of the primer DNAs having a continuous base sequence of at least 10 bases or more selected from the sequence represented by

If the primer DNAs selected from the sequences represented by SEQ ID NOs are included in one group, the combinations can be classified into four types as combinations of primer DNA groups that can be used in the present invention. In the primer DNA of the present invention, the constituent DNA is replaced with the primer DNA of the present invention.
RNA, ie, a nucleotide sequence in which thymine is substituted for uracil as a base and deoxyribose is substituted for ribose as a sugar, can also be used as the primer of the present invention.

In the primer DNA of the present invention, a DNA having any other base sequence not exceeding 20 bases can be added to the 5 'end of the primer DNA sequence. However, at this time, if the length of the additional DNA is long, detection sensitivity and specificity are impaired, so that the length is preferably 10 bases or less.

The above-mentioned primer DNA can be easily synthesized according to its base sequence using a commercially available DNA synthesizer by the β-cyanoethyl-phosphoramidite method or the like. For example, as a DNA synthesizer, “DNA synthesizer Model 394” sold by Perkin Elmer and the like can be used. The synthesized primer DNA can be quickly prepared using an oligonucleotide purification cartridge or the like.
Can be purified to high purity.

Further, in the primer DNA of the present invention, the above primer DNA can be labeled with a label. By labeling the primer DNA with a label,
Detection can be easily performed using the label as an index, and the detection sensitivity can be improved. Preferred labeling substances include, for example, chemicals such as biotin, avidin, streptoavidin, and digoxigenin, and alkaline phosphatase (Alkaline phospase).
sphatase), luciferase (Luciferase), peroxidase (Peroxidase), β-galactosidase (β-
Enzymes such as galactosidase, fluorescein (Fluoresce
in), (γ- ³² P) dATP, (α-
³⁵ S) dCTP and other radioisotopes.

As a method for labeling biotin on the primer DNA, a well-known method can be adopted. For example, the method is described in “M.A.
PCR Experiment Manual, (HBJ Publishing Agency) (1991) "
It is described in. Alternatively, an oligonucleotide biotin labeling kit (available from Amersham) can be used.

For labeling digoxigenin on the primer DNA, for example, a DIG oligonucleotide 5'-end labeling kit [Boehringer Mannheim (Boehner)
ringer Mannheim). Alkaline phosphatase labeling of primer DNA can be performed, for example, using the OligoLink ^™ Derivatization Kit for Pho
sphorylated Oligonucleotides (sold by Pierce) and Ol
It can be performed using igo Link ^™ Alkaline Phoshatase Conjugation Kit (sold by Pierce).

As a method for labeling the primer DNA with peroxidase, a well-known method can be employed. For example, the method is described in “M.A. Innis et al., Edited by PCR Experiment Manual, (published by HBJ Publishing Bureau). ) (1991). Fluorescein labeling of primer DNA can be performed, for example, using
It can be performed using a 5'-oligolabelling Kit (available from Amersham). Also, for example, Amine-VN ^TM Phosp
Horamidite (Clontech, Toyobo Co., Ltd. sold) with, at the time of the primer DNA synthesis, or introduce an amino group at the 5 'end of the primer DNA, its C ₆ -
Thiol groups can be similarly introduced using ThiolModifier ^™ . The above-mentioned label can be labeled using these active groups.

When a radioisotope is used as a label, for example, (γ- ³² P) dATP is added to the primer DNA of the present invention in the presence of T4 polynucleotide kinase. General techniques for labeling radioisotopes are described in the document "Molecular Cloning". T4 polynucleotide kinase from Toyobo Co., Ltd., (γ- ³² P)
dATP can be purchased from Amersham or the like.

Hereinafter, a method for detecting mRNA encoding PSA using the primer DNA of the present invention will be described. In the detection of mRNA encoding PSA of the present invention, the sample to be detected is not limited as long as it is a sample in which it is thought that mRNA encoding PSA is present in the field of medical diagnosis.
Examples include peripheral blood, serum, plasma, biopsied cells, cultured cells, and the like.

In the detection of the mRNA encoding the PSA of the present invention, a sample which is thought to contain the mRNA encoding the PSA to be used is subjected to appropriate mRNA extraction or mRNA extraction.
Pretreatment such as extraction of total RNA including RNA is performed. For example, a sample suspected of containing mRNA encoding PSA can be used after extracting and purifying total RNA by a conventional method such as the guanidine thiocyanate-phenol chloroform method. A commercially available RNA extraction kit [trade name: TRIZOL, Gibco BRL (GI)
BCO BRL), etc. to extract and purify the total RNA. Since mRNA is easily degraded in a sample, it is preferable to extract and purify the sample immediately after collecting the sample, or to store it in a freezer at −80 ° C., preferably in liquid nitrogen immediately after collecting the sample.

Further, mRN extracted and purified as described above
CDNA is synthesized using A as a first template. cDN
A well-known method can be used for the synthesis of A. For example, a conventional reaction solution (0.05 M Tris-HCl buffer pH 7.6 containing 0.07 M potassium chloride, pH 7.6) can be used.
At a final concentration of 1 mM dNTP, 10 mM magnesium chloride, 4 mM dithiothreotyl, 0.5
unit / μl RNAse inhibitor, 0.2 mg / ml oli
go (dT) _12-18 primer, 8 units / μl reverse transcriptase) and RNA are added to perform a cDNA synthesis reaction. The total volume of the reaction solution is usually 10 to 100 μl, and cDNA can be synthesized by treating the reaction solution at 37 ° C. for 1 hour. A commercially available cDNA synthesis kit [trade name: RT-
PCR (AMV) first strand cDNA synthesis kit, Boehringer Mannheim]
DNA can also be synthesized. It is preferable that a sample presumed to contain the mRNA encoding PSA to be used is subjected to the above-mentioned pretreatment such as appropriate mRNA extraction and the like, and appropriate cDNA synthesis treatment and the like.

The method for detecting mRNA encoding PSA of the present invention is performed as follows. First, a sample presumed to contain mRNA encoding PSA is subjected to cDNA synthesis using, as a first template, mRNA that has been subjected to appropriate pretreatment such as extraction. Then, the synthesized c
Using DNA as a second template, SEQ ID NO: 1 or 2 of the present invention
Selected from the sequence represented by
Except for using any one of the primer DNAs having a base sequence of at least 10 bases or more and selected from the sequence represented by SEQ ID NO: 3 or 4 Performs a known PCR, that is, a polymerase chain reaction which is a DNA amplification reaction. By this polymerase chain reaction, a DNA sequence flanked by two types of primer DNAs is amplified. Next, the result of the amplification of the DNA sequence is detected as the presence or absence of DNA having a constant chain length determined by the two selected primer DNAs (hereinafter, referred to as a first detection method).

Further, a method for detecting the mRNA encoding PSA of the present invention, which is an improved method of the first detection method, with higher sensitivity is performed as follows. First, the first
In the same manner as the detection method, an appropriate cDNA synthesis is performed using a sample to be detected, which is thought to contain mRNA encoding PSA, as a first template, which has been subjected to appropriate pretreatment such as extraction. This synthesized cDNA is
As a template, any one of the primer DNAs comprising at least 10 or more consecutive nucleotide sequences of the sequence represented by SEQ ID NO: 1 or 2 of the present invention and SEQ ID NO: 3 or 4
The first polymerase chain reaction is carried out using any one of the primer DNAs having a base sequence of at least 10 bases or more of the sequence represented by Next, the DNA of the present invention, which has a sequence capable of complementary binding to the DNA as the amplification product in the reaction solution of the polymerase chain reaction, using the DNA as the amplification product in the reaction solution of the polymerase chain reaction as a third template, Any one of primer DNAs consisting of at least 10 continuous nucleotide sequences of the sequence represented by SEQ ID NO: 1 or 2 and SEQ ID NO: 3
Alternatively, the second polymerase chain reaction is performed using any one of the primer DNAs having a base sequence of at least 10 bases or more of the sequence represented by 4. By this polymerase chain reaction, two types of primer DNA
The DNA sequence flanked by is amplified. Then, the result of the amplification of the DNA sequence was compared with the two selected primer DNAs.
(Hereinafter, referred to as a second detection method).

In the selection of the primer DNAs used in the first and second detection methods of the present invention, the combination of the primer DNAs that can be used in the first polymerase chain reaction of the first detection method and the second detection method includes SEQ ID NO: Selected from a sequence represented by any of the primer DNAs of 1 or 2, selected from a sequence represented by any one of a continuous base sequence of at least 10 bases or more and any of the primer DNAs of SEQ ID NO: 3 or 4, It is a kind of combination of consecutive base sequences of at least 10 bases or more. However, in the selection of the primer DNA used for the second polymerase chain reaction in the second detection method, the DNA which is the amplification product in the reaction solution of the first polymerase chain reaction is used.
A sequence selected from the sequences represented by any one of SEQ ID NOS: 1 and 2 of the present invention having a sequence capable of binding complementary to At least one contiguous sequence selected from the sequences represented by 3 or 4
It must be a combination with any one of the primer DNAs having a base sequence of 0 or more bases.

Specifically, the mRN shown in SEQ ID NO: 5 used in the second polymerase chain reaction of the second detection method
The primer DNA having a sequence corresponding to a part of the sequence A is more than the primer DNA having a sequence corresponding to a part of the mRNA sequence shown in SEQ ID NO: 5 used in the first polymerase chain reaction. Any one of the primer DNAs selected from the sequences represented by SEQ ID NOS: 1 or 2 having a sequence corresponding to a part of the mRNA sequence in the 3 'terminal direction and comprising a continuous base sequence of at least 10 bases or more And the second
Another primer DNA having a sequence complementary to a part of the mRNA sequence shown in SEQ ID NO: 5 used in the second polymerase chain reaction of the detection method was used in the first polymerase chain reaction. SEQ ID NO: 3 having the same sequence as a part of the DNA sequence complementary to the mRNA sequence at the 5 ′ end of SEQ ID NO: 5 from the primer DNA having a sequence complementary to a part of the mRNA sequence shown in SEQ ID NO: 5 Or selected from the sequence represented by 4,
From the viewpoint of specificity, it is preferable to use any one kind of primer DNA having a continuous base sequence of at least 10 bases or more.

As a preferable combination of the second detection method of the present invention, more specifically, a detection method described in the above (8) or (9) as means for solving the problem is mentioned. Preferred combinations include the combinations of the primer DNAs described in the detection methods (8) and (9).

For the specific operation of the polymerase chain reaction in the first detection method and the second detection method, a well-known method can be adopted, for example, a normal reaction solution (final concentration of 20%). Containing ~ 50 mM potassium chloride
50 mM Tris-HCl buffer pH 8.0-9.0, each with a final concentration of 20-400 μM dNTP, 0.5-
5 mM magnesium chloride, 0.1 to 1.0 μM of two kinds of primer DNA, 0.5 to 5 U / 100 μl of thermostable DNA polymerase) and a DNA sample. The total volume of the reaction solution is preferably from 10 to 100 μl, and a mineral oil or the like is overlaid to prevent evaporation during the reaction.

As the thermostable DNA polymerase, Taq
DNA polymerase, Pfu DNA polymerase, VentD
There are NA polymerase and the like, and any of them can be used. The reaction solution was heated at 92 ° C to 98 ° C for 10 seconds to 2 minutes at 40 ° C.
10 seconds to 3 minutes at ~ 65 ° C, 15 seconds to 3 at 65 ° C to 80 ° C
This is repeated for 15 to 45 times in this order to amplify the DNA sequence sandwiched between the two types of primer DNA. In addition, in order to ensure the annealing of the primer DNA, immediately before starting this heat-retention cycle, the temperature was set to 92 ° C. to 9 ° C.
By treating at 8 ° C. for 30 seconds to 10 minutes, the DNA in the sample can be sufficiently denatured.

After completion of the reaction, 6 hours after the completion of the reaction to ensure that the DNA amplified by the polymerase chain reaction becomes double-stranded.
The temperature can be kept at 5 ° C to 80 ° C for 1 minute to 10 minutes. In the second detection method, the volume of the DNA sample which is a reaction product of the first polymerase chain reaction and is subjected to the second polymerase chain reaction is the total volume of the reaction solution of the second polymerase chain reaction. 1/10000 to 1/1
It is preferably 0, more preferably 1/1000 to 1/100. If the volume of the sample to be subjected to the second polymerase chain reaction is less than 1 / 10,000 of the total volume of the reaction solution of the second polymerase chain reaction, the detection sensitivity is reduced. It tends to interfere with the second polymerase chain reaction.

As described above, in the detection of PSA-encoding mRNA by the first detection method or the second detection method, when a sample contains PSA-encoding mRNA and a cDNA complementary thereto is synthesized. Contains a DNA having a constant chain length determined by the selected two types of primer DNAs, and the mA encoding PSA is contained in the sample.
When RNA is not contained, there is no DNA having a constant chain length determined by the selected two kinds of primer DNAs, and thus the amplified DNA having a constant chain length is contained in the reaction solution after the reaction. Using the presence or absence as an index, the presence of mRNA encoding PSA in the sample can be detected.

For example, two kinds of selected primers DN
Agarose gel electrophoresis is performed on the basis of the presence of DNA having a constant chain length determined by A as an index, and DNA is separated for each chain length, and combined with a method such as ethidium bromide staining under ultraviolet irradiation. , The presence of DNA of a certain length can be detected. In order to easily detect the presence of DNA with high sensitivity, it is also possible to use the primer DNA of the present invention, which is previously labeled with a label such as a chemical substance, an enzyme, a fluorescent substance, or a radioisotope. .

Further, the labeled primer DN of the present invention
In the case of using A, as long as the amplified DNA having a constant chain length and the unreacted labeled primer DNA of the present invention are separated, D for each chain length by agarose gel electrophoresis or the like can be used.
Not only separation into NA and ethidium bromide staining, etc., but also labeling can be detected as an index. A well-known method can be employed as an operation method of the agarose electrophoresis, and examples thereof include a method described in “Molecular Cloning”. An appropriate agarose gel concentration is 1.0 to 2.0%. Buffers used for agarose gel electrophoresis are TBE, TAE, TPE
And the like. Ethidium bromide staining was 0.
The agarose gel after electrophoresis is immersed in a 5 μg / ml ethidium bromide aqueous solution for 15 minutes to 1 hour, or ethidium bromide is previously dissolved at a concentration of 0.5 μg / ml in a buffer and an agarose gel used for electrophoresis. It can be carried out by adding them.

In the method for detecting mRNA encoding PSA of the present invention, the length of the obtained DNA having a constant chain length is as follows:
It is determined by the combination of the selected primer DNAs of the present invention used in the polymerase chain reaction. Primer D consisting of a continuous base sequence of at least 10 bases or more
Depending on the sequence difference from NA, D
Although the length of NA is strictly slightly different, for example,
When the polymerase chain reaction was performed using a combination of the primer DNAs having the sequences represented by SEQ ID NOs: 1 and 2 and SEQ ID NOs: 3 and 4, the chain length (bp) of the amplified DNA was as shown in Table 1. It has a chain length of 681 bp to 205 bp.

[0043]

[Table 1]

[0044]

EXAMPLES Synthesis of Primer DNA The primer DNAs of SEQ ID NOS: 1 to 4 were synthesized according to the base sequence using a DNA synthesizer Model 394 (manufactured by Perkin Elmer) by the β-cyanoethyl-phosphoramidite method, Purification was carried out using a purification cartridge (trade name; OPC, manufactured by Perkin Elmer). Thereafter, this synthesized DNA was used as a primer DNA in a polymerase chain reaction.

Example 1 Detection of PSA mRNA from Cultured Cell Line by Second Detection Method The following cell lines (1) to (5) were cultured and used as specimens. (1) Prostate cell line producing PSA: LNCap cell line (2) Prostate cell line not producing PSA: PC-3 cell line, D
U145 cell line (3) Kidney cancer cell line: SMKT-R3, SMKT-R4,
TOS-1, TOS-2, ACHN (4) Bladder cancer cell line: YTS-1, KK47 (5) Testicular tumor cell line: NEC8, NEC14 The cultured cell line was physically peeled from the flask using a cell spatula, and RNA A total RNA was extracted using an extraction kit (trade name: TRIZOL, manufactured by GIBCO BRL), and a cDNA synthesis kit (trade name: First-strand cDNA synthesis kit for RT-PCR (AMV)) , Boehringer Mannheim).

5 μl of the cDNA solution and 1.25 U of TaqD
NA polymerase (manufactured by Gibco BRL) and 0.5 μM (final concentration) of primer DN of SEQ ID NO: 1
A and a reaction solution containing primer DNA of SEQ ID NO: 3 (20
mM Tris-HCl, 50 mM KCl, 1.5 mM
gCl ₂ , 0.2 mM dNTP mixture).
A second polymerase chain reaction was performed. The reaction was performed using a thermal cycler (trade name: Gene Amp PCR System 240).
0, manufactured by Perkin-Elmer Co., Ltd.), after heat denaturation at 94 ° C. for 5 minutes, three cycles of 94 ° C. for 1 minute, 55 ° C. for 1 minute, and 72 ° C. for 2 minutes for 40 cycles, followed by 72 ° C. At 1
A 1/0 step was performed. 1 μl of this reaction solution and 0.5
After heat denaturation at 94 ° C. for 5 minutes using a similar reaction solution containing μM of the primer DNA of SEQ ID NO: 2 and the primer DNA of SEQ ID NO: 4, 1 minute at 94 ° C., 1 minute at 58 ° C.
After performing 31 steps of 3 min steps at 72 ° C,
The second polymerase chain reaction was performed under the conditions of 1/10 step.

1 μl per 5 μl of polymerase chain reaction product
Was added (0.25% bromophenol blue, 30% glycerol aqueous solution) and electrophoresed on a 1.5% agarose gel. The cells were stained with a 0.5 μg / ml aqueous solution of ethidium bromide for 30 minutes, and observed under ultraviolet irradiation. Tables 2 and 3 show the detection results. In Tables 2 and 3, the result of detection of the polymerase chain reaction product is shown as +, and the result of no detection of the polymerase chain reaction is shown as-.

[0048]

[Table 2]

[0049]

[Table 3]

Prostate cell line PC-, in which PSA production cannot be detected by immunostaining of PSA with a monoclonal antibody
3. Amplification products by polymerase chain reaction were confirmed in all prostate culture cells including DU-145. On the other hand, no amplified product was detected from other cancer cells or tumor-derived cultured cell lines.

Example 2 Detection of PSA mRNA from peripheral blood by the second detection method White blood cells were collected from 10 ml of peripheral blood collected from healthy persons and prostate cancer patients, and used as a specimen. Total RNA was extracted from the sample using an RNA extraction kit (trade name; TRIZOL, manufactured by GIBCO BRL), and a cDNA synthesis kit [trade name; RT-PCR]
(AMV) first strand cDNA synthesis kit, Boehringer Mannheim].

5 μl of the synthesized cDNA solution and 1.25 U
A reaction solution containing Taq DNA polymerase (manufactured by Gibco BRL) and 0.5 μM (final concentration) of the primer DNA of SEQ ID NO: 1 and the primer DNA of SEQ ID NO: 3 (20 mM Tris-HCl, 50 mM KCl, 1.
5 mM MgCl ₂ , 0.2 mM dNTP mixture) 50 μ
1 performed the first polymerase chain reaction. The reaction was performed using a thermal cycler (trade name; Gene Amp PCR System)
2400, manufactured by Perkin Elmer Co.)
After heat denaturation at 94 ° C. for 1 minute, 55 ° C. for 1 minute, 7
After 40 cycles of 3/2 steps at 2 ° C, 72
One tenth step was performed at ° C. Using a similar reaction solution containing 1 μl of this reaction solution and 0.5 μM of the primer DNA of SEQ ID NO: 2 and the primer DNA of SEQ ID NO: 4, 9
After heat denaturation at 4 ° C for 5 minutes, 94 ° C for 1 minute and 58 ° C for 1 minute
After 31 cycles of 3 steps of 1 minute at 72 ° C., a second polymerase chain reaction was performed at 72 ° C. under the condition of 1/10 step.

1 μl per 5 μl of polymerase chain reaction product
Was added (0.25% bromophenol blue, 30% glycerol aqueous solution) and electrophoresed on a 1.5% agarose gel. The cells were stained with a 0.5 μg / ml aqueous solution of ethidium bromide for 30 minutes, and observed under ultraviolet irradiation. Table 4 shows the detection results. In Table 4, the result of detection of the polymerase chain reaction product is shown as +, and the result of no detection is shown as-. The PSA value (ng / ml) was determined using a serum from a healthy subject and a patient with prostate cancer as a sample, and measuring the concentration of PSA in the serum using a radioimmunoassay kit (trade name: Tandem PSA, manufactured by Hybritech, Yamasa Shoyu Co., Ltd.) (Company sales).

[0054]

[Table 4]

For samples in which no product was detected by the polymerase chain reaction, the PSA value was also lower than the kit detection limit (0.2
ng / ml). Further, in the sample from which the PSA value could be measured, a product by the polymerase chain reaction could be detected. In some samples, products by the polymerase chain reaction could be detected even though the PSA value was negative below the detection limit of the kit. In such a specimen, PSA was very small, so that PSA could not be detected by the conventional antigen-antibody method, but can be detected by the present method.

[0056]

The primer DNA according to claim 1 or 2
Is a primer DN for realizing a polymerase chain reaction capable of specifically detecting mRNA encoding PSA.
A, which is suitable for specific detection of prostate cancer. The primer DNA according to claims 3 and 4 is the same as the primer DNA according to claims 1 and 2
In addition to the effects of the described invention, it is a primer DNA for realizing a polymerase chain reaction capable of specifically detecting PSA with higher sensitivity, and is suitable for highly sensitive and specific detection of mRNA encoding PSA. The primer DNA according to claim 5 can realize the polymerase chain reaction that can detect the mRNA encoding PSA more easily and with high sensitivity, in addition to the effect of the invention according to any one of claims 1 to 4. The method for detecting mRNA encoding PSA according to claims 6 to 9 is particularly excellent in detection sensitivity and specificity in detection using the polymerase chain reaction.

[0057]

[Sequence list] SEQ ID NO: 1 Sequence length: 18 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Sequence: CTCTCGTGGC AGGGCAGT

SEQ ID NO: 2 Sequence length: 18 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Sequence: ATTTCCAATG ACGTGTGT

SEQ ID NO: 3 Sequence length: 18 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Sequence: AATAGGGGGT TGATAGGG

SEQ ID NO: 4 Sequence length: 19 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Sequence: CCACCTTGGT GTACAGGGA

SEQ ID NO: 5 Sequence length: 1466 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: mRNA Sequence: AGCCCCAAGC UUACCCACCUG CACCCGGAGA GCU
GUGUGUC ACCAUGUGGG UCCCGGUUGU 60 CUUCCUCACC CUGUCGUGA CGUGGAUUGG UGC
UGCACCC CUCAUCCUGU CUCGGAUUGU 120 GGGAGGCUGG GAGUGCGAGA AGCAAUUCCCCA ACC
CUGGCAG GUGCUUGUGG CCUCUCGUGG 180 CAGGGCAGUC UGCGGGGGUG UUCUGGUGCA CCC
CCAGUGG GUCUCACAG CUGCCACACUG 240 CAUCAGGAAC AAAAGCGGUGA UCUGUGUGGG UCG
GCACAGC CUGUUCAUC CUGAAGACAC 300 AGGCCAGGUA UUUCAGGUCA GCCACAGCUU CCC
ACACCCG CUCUACGAUA UGACCCUCU 360 GAAGAAUCGA UUCCUCAGGC CAGGUGAUGA CUC
CAGCCCAC GACCUCAUGC UGCUCCGCCU 420 GUCAGACCU GCCGAGCUCA CGGAUGCUGU GAA
GGUCAUG GACCUGCCCA CCCAGGAGGC 480 AGCACUGGGGG ACACCUGCU ACGCCUCAGG CUG
GGGCAGC AUUGAACCAG AGGAGUUCUU 540 GACCCCAAAG AAACUUCAGU GUGUGGACCCU CCA
UGUAUUU UCCAAUGACG UGUGUGCGCA 600 AGUUCACCCU CAGAAGGUGA CCAAGUUCAU GCU
GUGUGCU GGACGCUGGA CAGGGGGCAA 660 AAGCACCUGC UCGGGUGAUU CUGGGGGCCC ACU
UGUCUGU AAUUGUGUGC UUCAAGGUAU 720 CACGUCAUGG GGCAGUGAAC CAUGUGCCCU GCC
CGAAAGG CCUUCCCUGU ACACCAAGGU 780 GGUGCAUUAC CGGAAGUGGA UCAAGGACAC CAU
CGUGGGCC AACCCCUGAG CACCCCUAUC 840 AACCCCCUAU UGUAGUAAAC UUGGAACCCUU GGA
AAUUGACC AGGCCAAGAC UCAAGCCUCC 900 CCAGUCUCAC UGACCUUUGU CCUUAGGUGU GAG
GUCCAGGG GUUGCUAGGA AAAGAAAUCA 960 GCAGACACAG GUGUAGACCA GAGUGUUUCU UAA
AUGGUGU AAUUUUGUCC UCUCUGUGUC 1020 CUGGGGAAUA CUGGCCAUGC CUGGAGACAAU AUC
ACUCAAU UUCUCGAGGACACAGAAUAG 1080 GAUGGGGUGU CUGUGUUAUU UGUGGGGUAC AGA
GAUGAAAA GAGGGGUGGG AUCACACACUG 1140 AGAGAGUGGA GAGUGACAUG UGCUGGACAC UGU
CCAUGAA GCACUGAGCA GAAGCUGGAG 1200 GCACAACGCA CCAGACACUC ACAGCAAGGA UGG
AGCUGAA AACAUAACCC ACUCUGUCUCU 1260 GGAGGCACUG GGAAGCCUAG AGAAGGCUGU GAG
CCAAGGA GGGAGGGUCU UCCUUUGGCA 1320 UGGGAUGGGGG AUGAAGUAAG GAGAGGGACU GGA
CCCCCUG GAAGCUGAU CACUAUUGGGGG 1380 GGAGGUGUAU UGAAGUCUC CAGACAACCC UCA
GAUUUGA UGAUUUCCUA GUAGAACUCA 1440 CAGAAAUAAA GAGCUGUAUAU ACUGUG

Claims (9)

[Claims] 1. A primer DNA selected from the sequence represented by SEQ ID NO: 1 or 2 and comprising a continuous base sequence of at least 10 bases or more. 2. A primer DNA selected from the sequence represented by SEQ ID NO: 3 or 4 and comprising a continuous base sequence of at least 10 bases or more. 3. The primer DNA according to claim 1, wherein the 3 ′ end is conserved. 4. A primer DNA having a sequence represented by any one of SEQ ID NOs: 1 to 4. 5. The primer DNA according to claim 1, which is labeled with a labeling substance. 6. The m encoding a prostate-specific antigen in a sample
A cDNA is synthesized using RNA as a first template, and then any one of the primer DNAs according to claim 1 and the synthesized cDNA is used as a second template.
A method for detecting mRNA encoding a prostate-specific antigen, comprising performing a polymerase chain reaction using any one of the primer DNAs described above. 7. A m-encoding prostate-specific antigen in a sample
Using the RNA as a first template, cDNA synthesis is performed, and then using the synthesized cDNA as a second template, selected from the sequence represented by SEQ ID NO: 2 and consisting of a continuous base sequence of at least 10 bases or more. Primer D selected from the primer DNA and the sequence represented by SEQ ID NO: 4 and comprising a continuous base sequence of at least 10 bases or more
A method for detecting mRNA encoding a prostate-specific antigen, comprising performing a polymerase chain reaction using NA. 8. A m-type encoding a prostate-specific antigen in a sample
A cDNA is synthesized using RNA as a first template, and then any one of the primer DNAs according to claim 1 and the synthesized cDNA is used as a second template.
A polymerase chain reaction is carried out using any one of the primer DNAs described above, and the DNA which is an amplification product in the reaction solution of the polymerase chain reaction is used as a third template, and the DNA in the reaction solution of the polymerase chain reaction is used as a third template. 2. A DNA sequence capable of complementary binding to any one of the primer DNAs according to claim 1 having a DNA sequence capable of complementary binding to DNA as an amplification product and the DNA as an amplification product in a reaction solution of the polymerase chain reaction. 3. A method for detecting mRNA encoding a prostate-specific antigen, comprising performing a polymerase chain reaction using any one of the primer DNAs according to claim 2. 9. A prostate-specific antigen encoding m in a sample
CDNA is synthesized using RNA as a first template, and then, using the synthesized cDNA as a second template, a primer selected from the sequence represented by SEQ ID NO: 1 and comprising a continuous base sequence of at least 10 bases or more A primer D selected from DNA and the sequence represented by SEQ ID NO: 3 and comprising a continuous base sequence of at least 10 bases or more
Perform a polymerase chain reaction using NA,
The amplification product D in the reaction solution of the polymerase chain reaction
Using NA as a third template, it is selected from the sequence represented by SEQ ID NO: 2 and selected from the sequence represented by SEQ ID NO: 4 and a primer DNA consisting of at least 10 consecutive nucleotides or more. A method for detecting mRNA encoding a prostate-specific antigen, comprising performing a polymerase chain reaction using a primer DNA having a base sequence of bases or more.