US10150997B2 - Genetic test for liver copper accumulation in dogs - Google Patents

Genetic test for liver copper accumulation in dogs Download PDF

Info

Publication number
US10150997B2
US10150997B2 US14/363,751 US201214363751A US10150997B2 US 10150997 B2 US10150997 B2 US 10150997B2 US 201214363751 A US201214363751 A US 201214363751A US 10150997 B2 US10150997 B2 US 10150997B2
Authority
US
United States
Prior art keywords
dog
seq
snp
polymorphisms
liver
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US14/363,751
Other languages
English (en)
Other versions
US20140351962A1 (en
Inventor
Alan James Martin
Paul Glyn Jones
Adrian Watson
Jan Rothuizen
Hille Fieten
Pieter Antonius Jozef Leegwater
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mars Inc
Original Assignee
Mars Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mars Inc filed Critical Mars Inc
Publication of US20140351962A1 publication Critical patent/US20140351962A1/en
Assigned to MARS, INCORPORATED reassignment MARS, INCORPORATED ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ROTHUIZEN, JAN, LEEGWATER, Pieter Antonius Jozef, WATSON, ADRIAN, FIETEN, Hille, JONES, PAUL GLYN, MARTIN, ALAN JAMES
Application granted granted Critical
Publication of US10150997B2 publication Critical patent/US10150997B2/en
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/02Breeding vertebrates
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • G06F19/18
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/10Ploidy or copy number detection
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/20Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/40Population genetics; Linkage disequilibrium
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the invention relates to a method of determining the susceptibility of a dog to, or the likelihood that a dog is protected from, liver copper accumulation and copper-associated liver disease.
  • Copper is an important trace mineral for a number of metabolic processes within the body and, as such, is an essential part of the diet. Once absorbed through the gut, copper is mainly stored in the liver although it can also be found in other tissues such as bone marrow, muscle and spleen. As well as storing copper, the liver plays a central role in coordinating the transport and excretion of copper via ceruloplasmin and the bile salts respectively. Generally, deficiencies of copper are a more common issue that toxicities. However, toxicities do occur and can have serious implications for an affected animal.
  • CH chronic hepatitis
  • Hepatic copper accumulation can result from increased uptake of copper, a primary metabolic defect in hepatic copper metabolism, or from altered biliary excretion of copper. In the latter case, copper toxicity is secondary to hepatic inflammation, fibrosis, and cholestasis, although it is unclear to what extent this occurs in the dog. In secondary copper storage disease, copper accumulation is mainly restricted to periportal parenchyma and hepatic copper concentrations are lower than accumulation in familial storage diseases. Whilst, the nature of the initiating factor(s) and of the sensitizing antigen is unknown, immunological abnormalities and morphologic features observed in primary biliary cirrhosis are concurrent with an immune mediated mechanism.
  • the small intestine is recognized as the main site of dietary copper absorption in mammals. Transport from the intestinal lumen into intestinal mucosa is a carrier-mediated process involving a saturable transport component. Once in mucosal cells, approximately 80% of the newly absorbed copper is in the cytosol, mainly bound to metallothioneins (MT). These are low molecular weight inducible proteins with many functions including homeostasis, storage, transport and detoxification of metals. After passage through the enterocytes, copper enters the portal circulation where it is bound to carrier proteins peptides and amino acids and is transported to the liver with lesser amounts entering the kidney. In most mammals, copper is excreted easily, and the main route of excretion of copper is the bile.
  • MT metallothioneins
  • Dogs with excessive hepatic copper accumulation are typically treated with D-penicillamine, a potent copper chelator. Ultimately however, the most successful treatment available for dogs with CH is liver transplantation.
  • WO 2009/044152 A2 discloses a method of determining the susceptibility of a dog to liver copper accumulation comprising detecting the presence or absence of (a) a polymorphism in the GOLGA5, ATP7a or UBL5 gene of the dog that is indicative of susceptibility to liver copper accumulation and/or (b) a polymorphism in linkage disequilibrium with a said polymorphism (a), and thereby determining the susceptibility of the dog to liver copper accumulation.
  • WO 2010/038032 A1 and WO 2010/116137 A1 disclose further polymorphisms for use in a method of determining the susceptibility of a dog to liver copper accumulation. They also disclose polymorphisms for use in a method of determining the likelihood that a dog is protected from liver copper accumulation.
  • the inventors have discovered a number of polymorphisms in the genome of the dog that are associated with susceptibility to liver copper accumulation. They have also discovered polymorphisms in the genome of the dog that are associated with protection from liver copper accumulation. The discovery of these polymorphisms provides the basis for a test to predict the susceptibility of a dog to, or the likelihood of protection of a dog from, liver copper accumulation by screening for the polymorphisms. The predictive power of the test can be magnified using models that involve combining the results of detecting one or more of the defined polymorphisms.
  • a genetic test which combines the results of detecting one or more polymorphisms indicative of protection from liver copper accumulation with the results of detecting one or more polymorphisms indicative of susceptibility to liver copper accumulation in dogs would be particularly informative with regards to the likelihood that a dog is at risk of liver copper accumulation.
  • the accumulation of copper in the liver of a dog may lead to one or more diseases or conditions of the liver that are attributable to high liver copper.
  • high liver copper can lead to chronic hepatitis, liver cirrhosis and ultimately liver failure.
  • the invention thus enables dogs to be identified which are at risk of developing, or are not protected from, such liver diseases or conditions that are associated with high copper.
  • dogs that are identified as not having mutations associated with susceptibility to liver copper accumulation, or that are identified as having mutations associated with protection from liver copper accumulation, are ideal for use in breeding programs with the aim of producing dogs that are less likely to suffer from liver disease or other conditions associated with high copper.
  • the invention provides a method of testing a dog to determine the susceptibility of the dog to liver copper accumulation, comprising detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from:
  • the invention also provides:
  • the invention provides a method of testing a dog to determine the likelihood that the dog is protected from liver copper accumulation, comprising detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) Chr22_3135144 (SEQ ID NO: 145) and (b) one or more polymorphisms in linkage disequilibrium with (a).
  • the invention also provides:
  • FIG. 1 depicts the average copper levels by gender and ATP7A genotype in Labrador Retrievers (data of Table 9).
  • the y-axis is dry liver weight copper (mg/kg).
  • the x-axis is ATP7A genotype: from left to right, the first three bars are for the female dogs in the study and the last two bars are for the male dogs in the study. Error bars are standard error.
  • FIG. 2 is a box-plot of copper-histological scores by gender and ATP7A genotype in Labrador Retrievers (data of Table 9).
  • the y-axis is the copper histological score values.
  • the x-axis is ATP7A genotype: from left to right, the first three are for the female dogs in the study and the last two are for the male dogs in the study.
  • the kruskal-walis p-value is 0.000396.
  • FIG. 3 shows the variable length of a coding repeat in ATP7B.
  • Top The bases and their corresponding amino acids (AA).
  • the chromosomal location of the boxed C is 3135287.
  • Bottom Ensembl, NCBI and sequencing of a Beagle and a group of Labradors reveal a different number of a CGCCCC repeat.
  • the boxed amino acids alanine (A) and proline (P) are more or less produced.
  • SEQ ID NOs: 236, 237 and 238 are polynucleotide sequences containing two, three and four repeats respectively.
  • FIG. 4 shows the location of the ATP7B CGCCCC repeat between heavy metal associated domain 3 and 4.
  • FIG. 5 shows the ATP7B 4145G>A SNP (Chr22_3167534).
  • the vertical line on the far right shows the approximate position of the mutation.
  • the G>A substitution leads to a glutamine amino acid (AA).
  • FIG. 6 shows the LD structure in the first 15 Mb of chr 22. Arrows at the top of the triangle indicate the location of the coding mutations. The line pointed at by the arrows depicts high LD of the coding mutations with several SNPs in the area.
  • FIG. 7 shows the effect of the number of risk alleles on quantitative liver copper levels.
  • the x-axis is the number of risk alleles and the y-axis is liver copper in mg/kg.
  • the horizontal line indicates normal liver copper level of 400 mg/kg.
  • FIG. 8 shows stepwise modelling of the histology copper score.
  • X1 to X17 are the factors in Table 21.
  • FIG. 9 shows stepwise modelling of the log-quantitative copper score.
  • X1 to X17 are the factors in Table 21.
  • FIG. 10 illustrates schematically embodiments of functional components arranged to carry out the present invention.
  • SEQ ID NOs: 1 to 5 show the polynucleotide sequences encompassing the SNPs used in the three region model in Example 2 and are also in Table 4.
  • SEQ ID NOs: 6 to 141 show the polynucleotide sequences encompassing further SNPs that may be used to determine the susceptibility of a dog to liver copper accumulation. These sequences are also in Tables 5 and 6.
  • SEQ ID NO: 142 is the polynucleotide sequences of the ATP7A coding region SNP that is associated with the protection of a dog from liver copper accumulation (ChrX_63338063). This sequence is also shown in Table 8.
  • SEQ ID NO: 143 is the polynucleotide sequence of a SNP (ChrX_63397393 ATP7a_Reg16_F_42) that is in linkage disequilibrium with SNP ChrX_63338063. This sequence is also shown in Table 8.
  • SEQ ID NOs: 144 to 158 show the polynucleotide sequences encompassing the SNPs of the invention. These sequences are also shown in Table 18.
  • SEQ ID NOs: 159 to 226 show the polynucleotide sequences encompassing SNPs that are in linkage disequilibrium with the SNPs in Table 18. These sequences are also shown in Table 20.
  • SEQ ID NOs: 227 to 235 are primer sequences.
  • SEQ ID NOs: 236, 237 and 238 are polynucleotides containing two, three or four CGCCCC repeats respectively for the repeat sequence at genomic location 22:3135287. These sequences are also shown in Table 12.
  • Accumulation of copper in the liver leads to liver disease in a number of dog breeds, including the Labrador Retriever, Doberman Pinscher, German Shepherd, Keeshond, Cocker Dogl, West Highland White Terrier, Bedlington Terrier, and Skye Terrier.
  • the mean copper concentration in the liver of normal dogs of any breed is 200 to 400 mg/kg on a dry weight basis, although newborns generally have higher liver copper concentrations.
  • the amount of copper in the liver of a dog may be measured by biopsy.
  • a dog that is susceptible to liver copper accumulation has a tendency to accumulate copper such that its liver copper concentration reaches a level above 400 mg/kg on a dry weight basis.
  • Determining the susceptibility of a dog to liver copper accumulation according to the invention involves determining the risk or likelihood that the dog will accumulate liver copper to a level above 400 mg/kg, for example above above 600 mg/kg, above 800 mg/kg, above 1000 mg/kg, above 1500 mg/kg, above 2000 mg/kg, above 5000 mg/kg, or above 10000 mg/kg.
  • a dog that is protected from liver copper accumulation has a low risk or likelihood of accumulating liver copper such that its liver copper concentration is less likely to reach a level above 400 mg/kg on a dry weight basis.
  • the liver copper concentration of a dog that is protected from liver copper accumulation will be below 600 mg/kg, for example below 500 mg/kg, below 400 mg/kg, or below 300 mg/kg.
  • Determining the likelihood that a dog is protected from liver copper accumulation according to the invention involves determining the likelihood that the dog will accumulate liver copper to a level below 600 mg/kg, for example below 500 mg/kg, below 400 mg/kg, or below 300 mg/kg.
  • liver copper concentration may be semiquantitatively assessed by histochemistry using the rubeanic acid staining technique for evaluation of copper distribution as previously described (Van den Ingh et al., (1988) Vet Q 10: 84-89).
  • determining the likelihood that a dog is protected from liver copper accumulation according to the invention can involve determining the likelihood that the dog would be given a score of less than or equal to 3, for example less than or equal to 2.5, 2, 1.5, or less than or equal to 1, using the grading system described in Van den Ingh et al.
  • Determining the susceptibility of a dog to liver copper accumulation according to the invention can involve determining the risk or likelihood that the dog would be given a score of greater than or equal to 2, for example greater than or equal to 2.5, 3, 3.5, or greater than or equal to 4, using the grading system described in Van den Ingh et al.
  • the likelihood of protection or susceptibility may for example be expressed as a risk factor, percentage or probability. It may be possible to determine whether or not a dog will accumulate copper to the levels described above.
  • the method of determining the susceptibility of a dog to, or the likelihood of protection of a dog from, liver copper accumulation may comprise determining whether or not a dog will accumulate copper to a level above 400 mg/kg.
  • determining whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation indicates that the dog is less likely to develop a disease or condition attributable to liver copper accumulation such as chronic hepatitis, cirrhosis and liver failure.
  • determining whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation indicates the susceptibility of the dog to such a disease or condition. Therefore, the invention provides a method of testing for the susceptibility of a dog to, or the likelihood of protection of a dog from, a disease associated with liver copper accumulation, such as chronic hepatitis, cirrhosis and liver failure.
  • the inventors have discovered a number of polymorphisms in the genome of the dog that are associated with susceptibility to liver copper accumulation.
  • the present invention therefore relates to a method of determining the susceptibility of a dog to liver copper accumulation using one or more polymorphic markers at these genomic locations.
  • the present invention therefore provides a method of testing a dog to determine the susceptibility of the dog to liver copper accumulation, comprising detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from:
  • the inventors have also discovered polymorphisms in the genome of the dog that are associated with protection from liver copper accumulation.
  • the present invention therefore relates to a method of determining the likelihood that a dog is protected from liver copper accumulation using one or more polymorphic markers at these genomic locations.
  • the invention therefore also provides a method of testing a dog to determine the likelihood that the dog is protected from liver copper accumulation, comprising detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) Chr22_3135144 (SEQ ID NO: 145) and (b) one or more polymorphisms in linkage disequilibrium with (a).
  • detecting the presence or absence of a polymorphism typically means determining whether a polymorphism is present in the genome of the dog.
  • Polymorphisms include Single Nucleotide Polymorphisms (SNPs), microsatellite or repeat polymorphisms, insertion polymorphisms and deletion polymorphisms.
  • SNPs Single Nucleotide Polymorphisms
  • microsatellite or repeat polymorphisms insertion polymorphisms
  • deletion polymorphisms Preferably the polymorphism is a SNP.
  • Detecting the presence or absence of a SNP means genotyping the SNP or typing the nucleotide(s) present in the genome of the dog for the SNP. Typically, the nucleotide present at the same position on both homologous chromosomes will be determined.
  • one or both alleles are genotyped and the identities of one or both alleles are determined based on the genotyping.
  • a dog may be determined to be homozygous for a first allele, heterozygous or homozygous for a second allele of the SNP.
  • the polymorphism is a microsatellite or repeat sequence
  • typically the method will involve determining the number of repeats.
  • Determining a phenotype of an individual is not limited to the detection of a polymorphism that is causal for the disease or condition.
  • genetic mapping studies genetic variation at a set of marker loci in a sample of individuals is tested for association with a given phenotype. If such an association is found between a particular marker locus and the phenotype, it suggests that either the variation at that marker locus affects the phenotype of interest, or that the variation at that marker locus is in linkage disequilibrium with the true phenotype-related locus, which was not genotyped.
  • a polymorphism that is not a functional susceptibility/protective polymorphism, but is in linkage disequilibrium with a functional polymorphism may act as a marker indicating the presence of the functional polymorphism.
  • a polymorphism that is in linkage disequilibrium with a polymorphism of the invention is indicative of susceptibility to, or protection from, liver copper accumulation.
  • any one of the polymorphic positions as defined herein may be typed directly, in other words by determining the nucleotide present at that position, or indirectly, for example by determining the nucleotide present at another polymorphic position that is in linkage disequilibrium with said polymorphic position.
  • Linkage disequilibrium is the non-random gametic association of alleles at different loci in a population. Polymorphisms that have a tendency to be inherited together instead of being inherited independently by random assortment are in linkage disequilibrium. Polymorphisms are randomly assorted or inherited independently of each other if the frequency of the two polymorphisms together is the product of the frequencies of the two polymorphisms individually. For example, if two polymorphisms at different polymorphic sites are present in 50% of the chromosomes in a population, then they would be said to assort randomly if the two alleles are present together on 25% of the chromosomes in the population. A higher percentage would mean that the two alleles are linked.
  • a first polymorphism is in linkage disequilibrium with a second polymorphism if the frequency of the two polymorphisms together is greater than the product of the frequencies of the two polymorphisms individually in a population.
  • a first polymorphism is in linkage disequilibrium with a second polymorphism if the frequency of the two polymorphisms together is more that 10% greater, for example more than 30%, more than 50% or more than 70% greater, than the product of the frequencies of the two polymorphisms individually.
  • Polymorphisms which are in linkage disequilibrium in dogs are typically within 5 mb, preferably within 2 mb, within 1 mb, within 700 kb, within 600 kb, within 500 kb, within 400 kb, within 200 kb, within 100 kb, within 50 kb, within 10 kb, within 5 kb, within 1 kb, within 500 bp, within 100 bp, within 50 bp or within 10 bp of the polymorphism.
  • the skilled person should genotype the candidate polymorphism and one or more of the polymorphisms defined herein in a panel of dogs.
  • the size of the panel should be adequate enough to achieve a statistically significant result.
  • samples from at least 100, preferably at least 150 or at least 200, different dogs should be genotyped.
  • the dogs in the panel may be of any breed, but typically will have the same or similar genetic breed background.
  • Haploview Analysis and visualisation of LD and haplotype maps, Barrett et al, 2005, Bioinformatics, 21 (2): 263-265
  • PLINK http://pngu.mgh.harvard.edu/purcell/plink/
  • a measure of linkage disequilibrium is D′.
  • a range of 0.5 to 1 for D′ is indicative of a pair of polymorphisms being in linkage disequilibrium, with 1 indicating the most significant linkage disequilibrium. Therefore if D′ is found to be from 0.5 to 1, preferably from 0.6 to 1, 0.7 to 1, from 0.8 to 1, from 0.85 to 1, from 0.9 to 1, from 0.95 to 1 or most preferably 1, for a candidate polymorphism and a specific polymorphism defined herein, the candidate polymorphism may be said to be predictive of the polymorphism defined herein and will thus indicate susceptibility to or protection from liver copper accumulation.
  • a polymorphism that is in linkage disequilibrium with a polymorphism defined herein is within 680 kb and on the same chromosome as the polymorphism defined herein and the calculated measure of linkage disequilibrium between the pair of polymorphisms, D′, is greater than or equal to 0.9.
  • R-squared Another measure of linkage disequilibrium is R-squared, where R is the correlation coefficient.
  • R-squared which is also known as the ‘Coefficient of determination’, is the fraction of the variance in the genotypes of the first polymorphism which is accounted for in the genotypes of the second polymorphism. Therefore an R-squared of 0.5 for a candidate polymorphism and a specific polymorphism defined herein would mean that the candidate polymorphism accounts for 50% of the variance in the specific polymorphism.
  • R-squared is producible from standard statistical packages such as Haploview. Typically, an R-squared of 0.25 or greater (R of >0.5 or ⁇ 0.5) is considered a large correlation.
  • the candidate polymorphism may be said to be predictive of the polymorphism defined herein and will thus indicate susceptibility to or protection from liver copper accumulation.
  • a polymorphism that is in linkage disequilibrium with a polymorphism defined herein is within 680 kb and on the same chromosome as the polymorphism defined herein and the calculated measure of linkage disequilibrium between the pair of polymorphisms, R-squared, is greater than or equal to 0.5.
  • any one polymorphism may have an R-squared value below 0.25.
  • two or more mutations individually having an R-squared of below 0.25 may in combination have an R-squared of greater than 0.5. Therefore, these polymorphisms may be used in combination to determine the susceptibility of the dog to, or the likelihood of protection of the dog from, liver copper accumulation.
  • the method of the invention may comprise detecting the presence or absence of two or more polymorphisms in linkage disequilibrium with a polymorphism defined herein, wherein R-squared for each of said two or more polymorphisms individually may be less than or equal to 0.25, but R-squared for the combination of said two or more polymorphisms is greater than or equal to 0.5.
  • a polymorphism has been identified as being in linkage disequilibrium and therefore correlated with a polymorphism defined herein, the skilled person can readily determine which version of the polymorphism, i.e. which allele, is associated with susceptibility to or protection from liver copper accumulation. This could be achieved by phenotyping a panel of dogs for liver copper accumulation and classifying the dogs in terms of the level of liver copper accumulation. The panel of dogs are then genotyped for the polymorphism of interest. The genotypes are then correlated with the level of liver copper in order to determine the association of the genotypes with liver copper level and thereby determine which allele is associated with susceptibility to or protection from liver copper accumulation.
  • the polymorphisms of the invention that have been found to be indicative of susceptibility of a dog to liver copper accumulation are identified in Tables 17 and 18. Specifically, they are: Chr22_3167534 (SEQ ID NO: 144), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr32_38904515 (SEQ ID NO: 156), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr8_4892743 (SEQ ID NO: 157), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr8_4880518 (SEQ ID NO: 158), Chr10_65209946
  • a microsatellite repeat in the ATP7B gene was found to be associated with susceptibility to liver copper accumulation.
  • This is a CGCCCC repeat on chromosome 22 starting at genomic location 3135287 (22:3135287).
  • the repeat sequence is illustrated in FIG. 3 (SEQ ID NOs: 236 to 238). There may be two (SEQ ID NO: 236), three (SEQ ID NO: 237), four (SEQ ID NO: 238) and potentially more repeats. Therefore the method of the invention may comprise determining the number of CGCCCC repeats in the genome of the dog.
  • the method of determining susceptibility of a dog to liver copper accumulation comprises detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from:
  • polymorphisms may be detected to carry out the invention.
  • at least 2 polymorphisms are detected.
  • the DNA of a dog may be typed at the respective positions of:
  • the method of determining the susceptibility of a dog to liver copper accumulation comprises detecting in a sample the presence or absence in the genome of the dog of:
  • the method of determining the susceptibility of a dog to liver copper accumulation of the invention may comprise determining the presence or absence of the A allele for Chr22_3167534 (SEQ ID NO: 144), the A allele for Chr20_55461150 (SEQ ID NO: 146), the C allele for ChrX_120879711 (SEQ ID NO: 147), the C allele for Chr32_38904515 (SEQ ID NO: 156), the T allele for Chr19_6078084 (SEQ ID NO: 148, the A allele for Chr15_62625262 (SEQ ID NO: 149), the G allele for Chr14_39437543 (SEQ ID NO: 150), the A allele for Chr15_62625024 (SEQ ID NO: 151), the C allele for Chr3_86838677 (SEQ ID NO: 152), the T allele for Chr8_4892743 (SEQ ID NO: 144), the A allele for Chr20_55461150 (SEQ ID NO
  • the method of determining the susceptibility of a dog to liver copper accumulation may comprise determining the number of CGCCCC repeats at chromosome location 22:3135287.
  • the presence of two or more repeats, for example three or four repeats is indicative of susceptibility to liver copper accumulation.
  • a polymorphism in linkage disequilibrium with a polymorphism (a) is a SNP.
  • the polymorphism will be indicative of susceptibility to liver copper accumulation.
  • SNPs in linkage disequilibrium with polymorphisms (a) are provided in Table 19 and the sequences surrounding the SNPs are shown in Table 20. These SNPs can either be used on their own, or in combination with one or more polymorphisms (a) and/or (c), to determine the susceptibility of a dog to liver copper accumulation.
  • the method of the invention may therefore comprise detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from the polymorphisms in Tables 19 and 20.
  • the method of determining the susceptibility of a dog to liver copper accumulation may further comprise detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from:
  • the A allele of Chr22_3135144 and the T allele of ChrX_63338063 are associated with low copper or protection from liver copper accumulation. Conversely, the G allele of Chr22_3135144 and the C allele of ChrX_63338063 are associated with high copper or susceptibility to liver copper accumulation.
  • the method of determining the susceptibility of a dog to liver copper accumulation may comprise determining the presence or absence of the A or G allele of Chr22_3135144 and/or the T or C allele of ChrX_63338063.
  • the presence of the A allele of Chr22_3135144 and/or the T allele of ChrX_63338063 indicate that the dog is likely to be protected from liver copper accumulation and the presence of the G allele of Chr22_3135144 and/or the C allele of ChrX_63338063 indicate that the dog is likely to be susceptible to liver copper accumulation.
  • the polymorphisms that have been found to be associated with protection from liver copper accumulation may be used in a method of determining the likelihood that a dog is protected from liver copper accumulation.
  • the invention provides a method of testing a dog to determine the likelihood that the dog is protected from liver copper accumulation, comprising detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) Chr22_3135144 (SEQ ID NO: 145) and (b) one or more polymorphisms in linkage disequilibrium with (a).
  • polymorphisms may be detected to carry out the invention.
  • at least two polymorphisms are detected.
  • the DNA of a dog may be typed at the respective positions of
  • the method of determining the likelihood that a dog is protected from liver copper accumulation may further comprise detecting in a sample the presence or absence in the genome of the dog of (c) ChrX_63338063 (SNP ATP7a_Reg3_F_6; SEQ ID NO: 142) and/or (d) one or more polymorphisms in linkage disequilibrium with (c).
  • An example of a polymorphism that is in linkage disequilibrium with ChrX_63338063 (SNP ATP7a_Reg3_F_6; SEQ ID NO: 142) is ChrX_63397393 (SNP ATP7a_Reg16_F_42; SEQ ID NO: 143). Further examples are provided in Tables 19 and 20.
  • the method of determining the likelihood that a dog is protected from liver copper accumulation may further comprise detecting in a sample the presence or absence in the genome of the dog of (c) ChrX_63338063 (SNP ATP7a_Reg3_F_6; SEQ ID NO: 142) and/or (d) ChrX_63397393 (SNP ATP7a_Reg16_F_42; SEQ ID NO: 143).
  • the method of determining the likelihood that a dog is protected from liver copper accumulation comprises detecting in a sample the presence or absence in the genome of the dog of:
  • Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), Chr19_6078084 (SEQ ID NO: 148), Chr3_86838677 (SEQ ID NO: 152), Chr10_65209946 (SEQ ID NO: 155) and ChrX_63338063 SEQ ID NO: 142.
  • the method of determining the likelihood that a dog is protected from liver copper accumulation may comprise determining the presence or absence of the A or G allele of Chr22_3135144 and/or the T or C allele of ChrX_63338063.
  • the presence of the A allele of Chr22_3135144 and/or the T allele of ChrX_63338063 indicate that the dog is likely to be protected from liver copper accumulation and the presence of the G allele of Chr22_3135144 and the C allele of ChrX_63338063 indicate that the dog is not likely to be protected from liver copper accumulation.
  • the polymorphisms that have been found to be associated with high liver copper or susceptibility to liver copper accumulation described herein may also be used in a method of determining the likelihood that a dog is protected from liver copper accumulation. Determining the absence of an allele that is associated with high liver copper can help to determine the likelihood that a dog is protected from liver copper accumulation.
  • the method of determining the likelihood that a dog is protected from liver copper accumulation may therefore comprise detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from:
  • polymorphisms in or in the region of the canine GOLGA5, ATP7A and UBL5 genes are indicative of susceptibility to liver copper accumulation in dogs (Examples 1 and 2). Therefore these polymorphisms could be used in combination with the polymorphisms of the invention to provide an enhanced genetic test for determining the risk or likelihood that a dog is susceptible to or protected from liver copper accumulation.
  • the method of determining the susceptibility of a dog to, or the protection of a dog from, liver copper accumulation of the invention may therefore further comprise detecting the presence or absence of (I) a polymorphism in the GOLGA5, ATP7A or UBL5 gene of the dog that is indicative of susceptibility to liver copper accumulation and/or (II) a polymorphism in linkage disequilibrium with a said polymorphism (I).
  • Any number and any combination of these polymorphisms may be detected in addition to the polymorphisms of the invention.
  • at least 2 of these further polymorphisms are detected.
  • Preferably 2 to 5, 3 to 8 or 5 to 10 polymorphisms are further detected.
  • the DNA of a dog may be further typed at the respective positions of (i) polymorphism (I) and/or (ii) one or more polymorphisms (II). Additionally, the DNA of the dog may be typed at the respective positions of:
  • each polymorphism may be in a separate one of the GOLGA5, ATP7A and UBL5 genes or in just one of those genes.
  • the polymorphisms may be in the same gene, in two of the genes or in all three genes.
  • each polymorphism may be in linkage disequilibrium with a polymorphism in a separate one of the GOLGA5, ATP7A and UBL5 genes or in just one of those genes.
  • the polymorphisms may be in linkage disequilibrium with a polymorphism in the same gene, in two of the genes or in all three genes.
  • a preferred method of the invention further comprises detecting the presence or absence of at least one polymorphism (I) in the GOLGA5, ATP7A or UBL5 gene of the dog that is indicative of susceptibility to liver copper accumulation and at least one polymorphism (II) in linkage disequilibrium with a said polymorphism (I).
  • the polymorphism (I) and/or (II) is a SNP.
  • the SNP may be any SNP in or in the region of the GOLGA5, ATP7A or UBL5 gene of the dog that is indicative of susceptibility to liver copper accumulation and/or a SNP that is in linkage disequilibrium thereof.
  • the method of the invention may, therefore, further comprise determining whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation selected from the SNPs identified in Table 4, Table 5 and Table 6.
  • each SNP is located at position 61 in the sequence.
  • the first and second alleles are provided for each SNP at that location ([first/second]).
  • the first and second alleles for each SNP are also indicated. Any number of the SNPs may be used from Tables 4, 5 and 6 and in any combination.
  • the SNPs may be combined with a different type of polymorphism.
  • the method of determining the susceptibility of a dog to, or the likelihood of protection of the dog from, liver copper accumulation further comprises detecting the presence or absence of one or more SNPs selected from the SNPs in Table 4 and Table 6 and/or one or more SNPs in linkage disequilibrium thereof.
  • the one or more SNPs are selected from BICF2P506595 (position 61 of SEQ ID NO: 1), BICF2P772765 (position 61 of SEQ ID NO:2), BICF2S2333187 (position 61 of SEQ ID NO:3), BICF2P1324008 (position 61 of SEQ ID NO:4), BICF2P591872 (position 61 of SEQ ID NO:5), ATP7a_Reg4_F_9 (position 164 of SEQ ID NO: 131), UBL5_Reg1F_16 (position 97 of SEQ ID NO: 132), golga5_Reg1_24 (position 70 of SEQ ID NO: 133), golga5_26 (position 88 of SEQ ID NO: 134), golga5_27 (position 104 of SEQ ID NO: 135), golga5_28 (position 139 of SEQ ID NO: 136), golga5_29 (position 128 of SEQ
  • any of these 16 SNPs or any SNPs that are in linkage disequilibrium with any if these 16 SNPs may be typed.
  • the method of the invention further comprises detecting the presence or absence of one or more SNPs selected from the SNPs in Table 4. Accordingly, any of these 5 SNPs or any SNPs that are in linkage disequilibrium with any of these 5 SNPs may be typed. Preferably at least 2 of these 5 SNPs or SNPs in linkage disequilibrium are typed. More preferably all 5 positions are typed. Preferably therefore, the nucleotide(s) that are typed are selected from positions equivalent to:
  • SNP 1 is located within an intron of the GOLGA5 gene.
  • SNPs 2, 3 and 4 are located in the region of the UBL5 gene.
  • SNP 5 is located in the region of the ATP7A gene.
  • the detection method of the invention therefore relates to any SNP that lies within or in the region of one or more of these genes (in coding regions or otherwise), or any other SNP that is in linkage disequilibrium.
  • Example 2 demonstrates the use of SNPs 1 to 5 to establish a Boolean model of susceptibility to copper accumulation.
  • Table 3 represents the binary conditions of alleles at three genomic locations. The binary values are indicative of a dog having alleles that are indicative of susceptibility to copper accumulation (“bad” alleles). For instance 000 represents not having any of the three bad alleles. 111 represents having all three bad alleles.
  • the A allele for SNP BICF2P506595 (SNP 1), the G allele for SNP BICF2P772765 (SNP 2), the C allele for SNP BICF2S2333187 (SNP 3), the G allele for SNP BICF2P1324008 (SNP 4) and the A allele for SNP BICF2P591872 (SNP 5) have been determined by the inventors to be indicative of susceptibility to liver copper accumulation. Dogs that are homozygous for these alleles are susceptible to liver copper accumulation.
  • a preferred method of the invention further comprises determining the presence or absence of the A allele for SNP BICF2P506595, the G allele for SNP BICF2P772765 (SNP 2), the C allele for SNP BICF2S2333187 (SNP 3), the G allele for SNP BICF2P1324008 (SNP 4) and/or the A allele for SNP BICF2P591872 (SNP 5) and thereby determining whether the genome of the dog comprises a polymorphism indicative of susceptibility to liver copper accumulation.
  • a more preferred method comprises detecting the presence or absence of the AA genotype for SNP BICF2P506595, the GG genotype for SNP BICF2P772765, the CC genotype for SNP BICF2S2333187, the GG genotype for SNP BICF2P1324008 and/or the AA or AG genotype for SNP BICF2P591872.
  • a preferred method of determining the susceptibility of a dog to, or the likelihood that a dog is protected from, liver copper accumulation further comprises detecting the presence or absence of:
  • a more preferred method comprises detecting the presence or absence of a genotype (i); a genotype (ii), (iii) and (iv); or a genotype (v).
  • An even more preferable method comprises detecting the presence or absence of all 5 genotypes (i) to (v).
  • nucleotide(s) present in the genome of the dog at a position identified in any of Tables 4, 5, 6, 8, 18 and 20 may mean that the nucleotide present at this position in a sequence corresponding exactly with the sequence identified in Tables 4, 5, 6, 8, 18 and 20 is typed.
  • SEQ ID NOs: 1 to 5 identified in Table 4 SEQ ID NOs: 6 to 130 in Table 5, SEQ ID NOs: 131 to 141 in Table 6, SEQ ID NO: 142 and SEQ ID NO: 143 in Table 8, SEQ ID NOs: 144 to 158 in Table 18 and SEQ ID NOs: 159 to 226 in Table 20 will not necessarily be present in the dog to be tested.
  • nucleotide present may therefore be at a position identified in Tables 4, 5, 6, 8, 18 and 20 or at an equivalent or corresponding position in the sequence.
  • equivalent as used herein therefore means at or at a position corresponding to that identified in Tables 4, 5, 6, 8, 18 and 20.
  • the sequence and thus the position of the SNP could for example vary because of deletions or additions of nucleotides in the genome of the dog.
  • Those skilled in the art will be able to determine a position that corresponds to or is equivalent to the relevant position in each of SEQ ID NOs: 1 to 226, using for example a computer program such as GAP, BESTFIT, COMPARE, ALIGN, PILEUP or BLAST.
  • the UWGCG Package provides programs including GAP, BESTFIT, COMPARE, ALIGN and PILEUP that can be used to calculate homology or line up sequences (for example used on their default settings).
  • the BLAST algorithm can also be used to compare or line up two sequences, typically on its default settings.
  • Software for performing a BLAST comparison of two sequences is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nm.nih.gov/). This algorithm is further described below. Similar publicly available tools for the alignment and comparison of sequences may be found on the European Bioinformatics Institute website (http://www.ebi.ac.uk), for example the ALIGN and CLUSTALW programs.
  • the candidate polymorphism is compared to a database of polymorphisms and their association with susceptibility to or protection from liver copper accumulation.
  • a database is generated by phenotyping a panel of dogs for liver copper accumulation, for example by liver biopsy, and classifying the dogs in terms of the level of copper accumulation.
  • the dogs in the panel are also genotyped for a panel of polymorphisms. It is then possible to determine the association of each genotype with the level of liver copper. Determining whether a polymorphism is indicative of either susceptibility to or protection from liver copper is therefore achieved by locating the polymorphism in the database.
  • a polymorphism of interest is not located in a database as described above, it is still possible to determine whether the polymorphism is indicative of either susceptibility to or protection from liver copper accumulation. This could be achieved by phenotyping a panel of dogs for liver copper accumulation and classifying the dogs in terms of the level of liver copper accumulation. The panel of dogs are then genotyped for the polymorphism of interest. The genotypes are then correlated with the level of liver copper in order to determine the association of the genotypes with liver copper level.
  • each polymorphism alone or in combination with other polymorphisms is indicative of the protection from, or susceptibility of the dog to, liver copper accumulation.
  • the presence of one or more alleles that are associated with high copper indicates that the dog is susceptible to liver copper accumulation.
  • the presence of one or more alleles associated with low copper indicates that the dog is likely to be protected from liver copper accumulation.
  • a preferred method of the invention therefore comprises determining the presence or absence of a A allele of the ATP7B SNP in the genome of the dog. The method may comprise determining whether the dog is homozygous or heterozygous for the A allele of the ATP7B SNP.
  • a model may be used that combines the results to provide an overall assessment of the risk or likelihood that the dog will be susceptible to, or protected from, liver copper accumulation.
  • Example 6 explains how a model can be generated using multiple polymorphisms.
  • a stepwise modelling technique is used. A simplified example of model generation is described in Example 2.
  • Table 3 sets out the different possible genotypes of the combination of 5 SNPs in the region of the GOLGA5, UBL5 and ATP7A genes and the percentage of dogs with those genotypes that have high copper (liver levels of above 600 mg/kg).
  • Example 3 to determine the susceptibility of a dog to liver copper accumulation one may genotype the 5 SNPs in the genome of the dog using a DNA sample from the dog. Once the genotypes of the SNPs have been determined, these can be converted into binary values based on the key provided in Example 2, i.e. based on the degree of association of the genotype with high copper. Then, Table 3 is used to convert the binary values into a risk factor based on the percentage of dogs that have that genotype pattern and high copper.
  • a dog may be tested by a method of the invention at any age, for example from 0 to 12, 0 to 6, 0 to 5, 0 to 4, 0 to 3, 0 to 2 or 0 to 1 years old.
  • the dog is tested at as young an age as possible, for example within the first year, first 6 months or first 3 months of its life.
  • the dog is preferably tested before copper accumulation occurs.
  • the history of the dog may or may not be known.
  • the dog may be a pup of known parents and the history of the parents with respect to copper accumulation may be known.
  • the dog may be a stray or a rescued dog with unknown parentage and history.
  • the dog to be tested by any method of the present invention may be of any breed.
  • the invention provides a method of determining whether the genome of a mixed or crossbred dog, or a mongrel or out-bred dog comprises one or more polymorphisms indicative of protection from, or susceptibility to, liver copper accumulation.
  • the dog may be one that is suspected of being susceptible to liver copper accumulation.
  • the dog may be suspected of being protected from liver copper accumulation.
  • the dog will have genetic inheritance of a breed selected from Labrador Retriever, Doberman Pinscher, German Shepherd, Keeshond, Cocker Dogl, West Highland White Terrier, Bedlington Terrier and Skye Terrier.
  • the dog may be a mixed or crossbred dog, or a mongrel or out-bred dog.
  • the dog may have at least 25%, at least 50%, or at least 100% of its genome inherited from any pure breed or more preferably from any of the breeds described herein.
  • the dog may be a pure-bred.
  • one or both parents of the dog to be tested are or were pure-bred dogs.
  • one or more grandparents are or were pure-bred dogs.
  • One, two, three or all four of the grandparents of the dog that is tested may be or may have been pure-bred dogs.
  • the dog has genetic breed inheritance of Labrador Retriever.
  • the dog may be a purebred Labrador Retriever.
  • the dog may be a mixed or crossbred dog, or an outbred dog (mongrel).
  • One or both of the parents of the dog may be a pure-bred Labrador Retriever dog.
  • One, two, three or four of the grandparents of the dog may be a pure-bred Labrador Retriever dog.
  • the dog may have at least 50% or at least 75% of the Labrador Retriever breed in its genetic background. Thus, at least 50% or at least 75% of the dog's genome may be derived from the Labrador Retriever breed.
  • the genetic breed background of a dog may be determined by assessing the allelic frequencies of genetic markers, for example SNPs or microsatellites.
  • allelic frequencies of different SNPs or microsatellites in a dog provide a signature that allows the breed of a dog or the breeds that make up a mixed breed dog to be determined.
  • Such a genetic test may be a commercially available test.
  • the dog may not need to be tested for the genetic inheritance of a particular breed because it is suspected of having a particular breed inheritance for example by the dog owner or veterinarian. This could be for example because of knowledge of the dog's ancestry or because of its appearance.
  • the predictive test of the invention may be carried out in conjunction with one or more other predictive or diagnostic tests such as determining the genetic breed background/inheritance of the dog or susceptibility to one or more other diseases.
  • the detection of polymorphisms according to the invention may comprise contacting a polynucleotide or protein in a sample from the dog with a specific binding agent for a polymorphism and determining whether the agent binds to the polynucleotide or protein, wherein binding of the agent indicates the presence of the polymorphism, and lack of binding of the agent indicates the absence of the polymorphism.
  • the method is generally carried out in vitro on a sample from the dog, where the sample contains DNA from the dog.
  • the sample typically comprises a body fluid and/or cells of the dog and may, for example, be obtained using a swab, such as a mouth swab.
  • the sample may be a blood, urine, saliva, skin, cheek cell or hair root sample.
  • the sample is typically processed before the method is carried out, for example DNA extraction may be carried out.
  • the polynucleotide or protein in the sample may be cleaved either physically or chemically, for example using a suitable enzyme.
  • the part of polynucleotide in the sample is copied or amplified, for example by cloning or using a PCR based method prior to detecting the polymorphism.
  • any one or more methods may comprise determining the presence or absence of one or more polymorphisms in the dog.
  • the polymorphism is typically detected by directly determining the presence of the polymorphic sequence in a polynucleotide or protein of the dog.
  • a polynucleotide is typically genomic DNA, mRNA or cDNA.
  • the polymorphism may be detected by any suitable method such as those mentioned below.
  • a specific binding agent is an agent that binds with preferential or high affinity to the protein or polypeptide having the polymorphism but does not bind or binds with only low affinity to other polypeptides or proteins.
  • the specific binding agent may be a probe or primer.
  • the probe may be a protein (such as an antibody) or an oligonucleotide.
  • the probe may be labelled or may be capable of being labelled indirectly.
  • the binding of the probe to the polynucleotide or protein may be used to immobilise either the probe or the polynucleotide or protein.
  • a polymorphism can be detected by determining the binding of the agent to the polymorphic polynucleotide or protein of the dog.
  • the agent is also able to bind the corresponding wild-type sequence, for example by binding the nucleotides or amino acids which flank the variant position, although the manner of binding to the wild-type sequence will be detectably different to the binding of a polynucleotide or protein containing the polymorphism.
  • the method may be based on an oligonucleotide ligation assay in which two oligonucleotide probes are used. These probes bind to adjacent areas on the polynucleotide that contains the polymorphism, allowing after binding the two probes to be ligated together by an appropriate ligase enzyme. However the presence of a single mismatch within one of the probes may disrupt binding and ligation. Thus ligated probes will only occur with a polynucleotide that contains the polymorphism, and therefore the detection of the ligated product may be used to determine the presence of the polymorphism.
  • the probe is used in a heteroduplex analysis based system.
  • a heteroduplex analysis based system when the probe is bound to a polynucleotide sequence containing the polymorphism it forms a heteroduplex at the site where the polymorphism occurs and hence does not form a double strand structure.
  • a heteroduplex structure can be detected by the use of a single or double strand specific enzyme.
  • the probe is an RNA probe
  • the heteroduplex region is cleaved using RNAase H and the polymorphism is detected by detecting the cleavage products.
  • the method may be based on fluorescent chemical cleavage mismatch analysis which is described for example in PCR Methods and Applications 3, 268-71 (1994) and Proc. Natl. Acad. Sci. 85, 4397-4401 (1998).
  • a PCR primer is used that primes a PCR reaction only if it binds a polynucleotide containing the polymorphism, for example a sequence-specific PCR system, and the presence of the polymorphism may be determined by detecting the PCR product.
  • the region of the primer that is complementary to the polymorphism is at or near the 3′ end of the primer.
  • the presence of the polymorphism may be determined using a fluorescent dye and quenching agent-based PCR assay such as the Taqman PCR detection system.
  • the specific binding agent may be capable of specifically binding the amino acid sequence encoded by a polymorphic sequence.
  • the agent may be an antibody or antibody fragment.
  • the detection method may be based on an ELISA system.
  • the method may be an RFLP based system. This can be used if the presence of the polymorphism in the polynucleotide creates or destroys a restriction site that is recognised by a restriction enzyme.
  • the presence of the polymorphism may be determined based on the change that the presence of the polymorphism makes to the mobility of the polynucleotide or protein during gel electrophoresis.
  • SSCP single-stranded conformation polymorphism
  • DDGE denaturing gradient gel electrophoresis
  • a polynucleotide comprising the polymorphic region is sequenced across the region that contains the polymorphism to determine the presence of the polymorphism.
  • the presence of the polymorphism may be detected by means of fluorescence resonance energy transfer (FRET).
  • FRET fluorescence resonance energy transfer
  • the polymorphism may be detected by means of a dual hybridisation probe system.
  • This method involves the use of two oligonucleotide probes that are located close to each other and that are complementary to an internal segment of a target polynucleotide of interest, where each of the two probes is labelled with a fluorophore.
  • Any suitable fluorescent label or dye may be used as the fluorophore, such that the emission wavelength of the fluorophore on one probe (the donor) overlaps the excitation wavelength of the fluorophore on the second probe (the acceptor).
  • a typical donor fluorophore is fluorescein (FAM), and typical acceptor fluorophores include Texas red, rhodamine, LC-640, LC-705 and cyanine 5 (Cy5).
  • each probe may be labelled with a fluorophore at one end such that the probe located upstream (5′) is labelled at its 3′ end, and the probe located downstream (3′) is labelled at its 5′ end.
  • the gap between the two probes when bound to the target sequence may be from 1 to 20 nucleotides, preferably from 1 to 17 nucleotides, more preferably from 1 to 10 nucleotides, such as a gap of 1, 2, 4, 6, 8 or 10 nucleotides.
  • the first of the two probes may be designed to bind to a conserved sequence of the gene adjacent to a polymorphism and the second probe may be designed to bind to a region including one or more polymorphisms.
  • Polymorphisms within the sequence of the gene targeted by the second probe can be detected by measuring the change in melting temperature caused by the resulting base mismatches. The extent of the change in the melting temperature will be dependent on the number and base types involved in the nucleotide polymorphisms.
  • Polymorphism typing may also be performed using a primer extension technique.
  • the target region surrounding the polymorphic site is copied or amplified for example using PCR.
  • a single base sequencing reaction is then performed using a primer that anneals one base away from the polymorphic site (allele-specific nucleotide incorporation).
  • the primer extension product is then detected to determine the nucleotide present at the polymorphic site.
  • the extension product can be detected. In one detection method for example, fluorescently labelled dideoxynucleotide terminators are used to stop the extension reaction at the polymorphic site. Alternatively, mass-modified dideoxynucleotide terminators are used and the primer extension products are detected using mass spectrometry.
  • the sequence of the extended primer, and hence the nucleotide present at the polymorphic site can be deduced. More than one reaction product can be analysed per reaction and consequently the nucleotide present on both homologous chromosomes can be determined if more than one terminator is specifically labelled.
  • the invention further provides primers or probes that may be used in the detection of any of the polymorphisms defined herein for use in the prediction of susceptibility to or protection from liver copper accumulation.
  • Polynucleotides of the invention may also be used as primers for primer extension reactions to detect the SNPs defined herein.
  • Such primers, probes and other polynucleotide fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length. Probes and fragments can be longer than 150 nucleotides in length, for example up to 200, 300, 400, 500, 600, 700 nucleotides in length, or even up to a few nucleotides, such as five or ten nucleotides, short of a full length polynucleotide sequence of the invention.
  • Primers and probes for genotyping the polymorphisms of the invention may be designed using any suitable design software known in the art using the sequences in Tables 4, 5, 6, 8, 18 and 20. Homologues of these polynucleotide sequences would also be suitable for designing primers and probes. Such homologues typically have at least 70% homology, preferably at least 80, 90%, 95%, 97% or 99% homology, for example over a region of at least 15, 20, 30, 100 more contiguous nucleotides. The homology may be calculated on the basis of nucleotide identity (sometimes referred to as “hard homology”).
  • the UWGCG Package provides the BESTFIT program that can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p 387-395).
  • the PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent or corresponding sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al (1990) J Mol Biol 215:403-10.
  • HSPs high scoring sequence pairs
  • Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787.
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two polynucleotide sequences would occur by chance.
  • P(N) the smallest sum probability
  • a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • the homologous sequence typically differs by at least 1, 2, 5, 10, 20 or more mutations, which may be substitutions, deletions or insertions of nucleotides
  • polynucleotides of the invention such as primers or probes may be present in an isolated or substantially purified form. They may be mixed with carriers or diluents that will not interfere with their intended use and still be regarded as substantially isolated. They may also be in a substantially purified form, in which case they will generally comprise at least 90%, e.g. at least 95%, 98% or 99%, of polynucleotides of the preparation.
  • a detector antibody is an antibody that is specific for one polymorphism but does not bind to any other polymorphism as described herein. Detector antibodies are for example useful in purification, isolation or screening methods involving immunoprecipitation techniques.
  • Antibodies may be raised against specific epitopes of the polypeptides of the invention.
  • An antibody, or other compound “specifically binds” to a polypeptide when it binds with preferential or high affinity to the protein for which it is specific but does substantially bind not bind or binds with only low affinity to other polypeptides.
  • a variety of protocols for competitive binding or immunoradiometric assays to determine the specific binding capability of an antibody are well known in the art (see for example Maddox et al, J. Exp. Med. 158, 1211-1226, 1993). Such immunoassays typically involve the formation of complexes between the specific protein and its antibody and the measurement of complex formation.
  • the term “antibody”, unless specified to the contrary, includes fragments that bind a polypeptide of the invention. Such fragments include Fv, F(ab′) and F(ab′) 2 fragments, as well as single chain antibodies. Furthermore, the antibodies and fragment thereof may be chimeric antibodies, CDR-grafted antibodies or humanised antibodies.
  • Antibodies may be used in a method for detecting polypeptides of the invention in a biological sample (such as any such sample mentioned herein), which method comprises:
  • Antibodies of the invention can be produced by any suitable method.
  • Means for preparing and characterising antibodies are well known in the art, see for example Harlow and Lane (1988) “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • an antibody may be produced by raising an antibody in a host animal against the whole polypeptide or a fragment thereof, for example an antigenic epitope thereof, hereinafter the “immunogen”.
  • the fragment may be any of the fragments mentioned herein (typically at least 10 or at least 15 amino acids long).
  • a method for producing a polyclonal antibody comprises immunising a suitable host animal, for example an experimental animal, with the immunogen and isolating immunoglobulins from the animal's serum. The animal may therefore be inoculated with the immunogen, blood subsequently removed from the animal and the IgG fraction purified.
  • a method for producing a monoclonal antibody comprises immortalising cells which produce the desired antibody. Hybridoma cells may be produced by fusing spleen cells from an inoculated experimental animal with tumour cells (Kohler and Milstein (1975) Nature 256, 495-497).
  • An immortalized cell producing the desired antibody may be selected by a conventional procedure.
  • the hybridomas may be grown in culture or injected intraperitoneally for formation of ascites fluid or into the blood stream of an allogenic host or immunocompromised host.
  • Human antibody may be prepared by in vitro immunisation of human lymphocytes, followed by transformation of the lymphocytes with Epstein-Barr virus.
  • the experimental animal is suitably a goat, rabbit, rat, mouse, guinea pig, chicken, sheep or horse.
  • the immunogen may be administered as a conjugate in which the immunogen is coupled, for example via a side chain of one of the amino acid residues, to a suitable carrier.
  • the carrier molecule is typically a physiologically acceptable carrier.
  • the antibody obtained may be isolated and, if desired, purified.
  • the invention also provides a kit that comprises means for typing one or more of the polymorphisms defined herein.
  • such means may include a specific binding agent, probe, primer, pair or combination of primers, or antibody, including an antibody fragment, as defined herein which is capable of detecting or aiding detection of the polymorphisms defined herein.
  • the primer or pair or combination of primers may be sequence specific primers that only cause PCR amplification of a polynucleotide sequence comprising the polymorphism to be detected, as discussed herein.
  • the primer or pair of primers may alternatively not be specific for the polymorphic nucleotide, but may be specific for the region upstream (5′) and/or downstream (3′).
  • a kit suitable for use in the primer-extension technique may specifically include labelled dideoxynucleotide triphosphates (ddNTPs). These may for example be fluorescently labelled or mass modified to enable detection of the extension product and consequently determination of the nucleotide present at the polymorphic position.
  • ddNTPs dideoxynucleotide triphosphates
  • the kit may also comprise a specific binding agent, probe, primer, pair or combination of primers, or antibody that is capable of detecting the absence of the polymorphism.
  • the kit may further comprise buffers or aqueous solutions.
  • the kit may additionally comprise one or more other reagents or instruments that enable any of the embodiments of the method mentioned above to be carried out.
  • reagents or instruments may include one or more of the following: a means to detect the binding of the agent to the polymorphism, a detectable label such as a fluorescent label, an enzyme able to act on a polynucleotide, typically a polymerase, restriction enzyme, ligase, RNAse H or an enzyme which can attach a label to a polynucleotide, suitable buffer(s) or aqueous solutions for enzyme reagents, PCR primers which bind to regions flanking the polymorphism as discussed herein, a positive and/or negative control, a gel electrophoresis apparatus, a means to isolate DNA from sample, a means to obtain a sample from the individual, such as swab or an instrument comprising a needle, or a support comprising wells on which detection reactions can be carried out.
  • the kit may be,
  • sequences of the polymorphisms may be stored in an electronic format, for example in a computer database. Accordingly, the invention provides a database comprising information relating to one or more polymorphisms selected from:
  • the database may also comprise information relating to any of the other polymorphisms described herein.
  • the database may include further information about the polymorphism, for example the degree of association of the polymorphism with the susceptibility of a dog to liver copper accumulation.
  • the invention also provides a database comprising information relating to one or more polymorphisms selected from:
  • the database may also comprise information relating to any of the other polymorphisms described herein.
  • the database may include further information about the polymorphism, for example the degree of association of the polymorphism with the protection of a dog from liver copper accumulation.
  • a database as described herein may be used to determine whether the genome of a dog comprises one or more polymorphisms indicative of protection from, or susceptibility to, liver copper accumulation. Such a determination may be carried out by electronic means, for example by using a computer system (such as a PC).
  • a computer system such as a PC
  • the determination of whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to or protection from liver copper accumulation will be carried out by inputting to a computer system genetic data from the dog to a computer system; comparing the genetic data to a database as defined herein; and on the basis of this comparison, determining whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to, or protection from, liver copper accumulation. This information can then be used to guide the management of the liver copper levels of the dog or can be used for informed breeding purposes.
  • the invention also provides a computer program comprising program code means for performing all the steps of a method of the invention when said program is run on a computer. Also provided is a computer program product comprising program code means stored on a computer readable medium for performing a method of the invention when said program is run on a computer. A computer program product comprising program code means on a carrier wave that, when executed on a computer system, instruct the computer system to perform a method of the invention is additionally provided.
  • the invention also provides an apparatus arranged to perform a method according to the invention.
  • the apparatus typically comprises a computer system, such as a PC.
  • the computer system comprises: means 20 for receiving genetic data from the dog; a module 30 for comparing the data with a database 10 comprising information relating to polymorphisms; and means 40 for determining on the basis of said comparison whether the genome of a dog comprises one or more polymorphisms indicative of protection of a dog from, or susceptibility of a dog to, liver copper accumulation.
  • Breeding value is defined as the value of an individual as a parent and is commonly used for improving desirable traits of life-stock in the farming industry.
  • the copper handling ability of the offspring of two dogs may be influenced by the genotype of the parents at the ATP7B locus.
  • the transfer of a particular variant at this locus could be beneficial to the offspring.
  • By determining the genotype at this locus it will be possible to assess the breeding value of a prospective parent and thereby make decisions as to whether a given breeding pair are appropriate.
  • the invention provides a method of selecting a dog for producing offspring protected from liver copper accumulation comprising determining whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation by a method of the invention in a candidate first dog; and thereby determining whether the candidate first dog is suitable for producing offspring protected from liver copper accumulation.
  • the method may further comprise determining whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation by a method of the invention in a second dog of the opposite sex to the first dog. If the results are that the first and/or second dog has a genotype indicative of protection from liver copper accumulation, the first dog may then be mated with the second dog in order to produce offspring protected from liver copper accumulation.
  • the method may comprise determining the presence or absence of one or more polymorphisms selected from Chr22_3135144 (SEQ ID NO: 145) and one or more polymorphisms in linkage disequilibrium thereof in the genome of the candidate first dog. More preferably the method further comprises determining the presence or absence of the SNP ChrX_63338063 (ATP7a_Reg3_F_6 SNP; SEQ ID NO: 142) or one or more polymorphisms in linkage disequilibrium with said SNP such as ChrX_63397393 (ATP7a_Reg16_F_42 SNP; SEQ ID NO:143).
  • the method of the invention may comprise determining the presence or absence of the A allele of Chr22_3135144 (SEQ ID NO: 145) and/or the T allele of ChrX_63338063 (SEQ ID NO:142).
  • the presence of one or more of these SNPs indicates that the first dog is protected from liver copper accumulation and is therefore a good candidate to be mated with a second dog. Homozygosity in either the first and/or second dog is most preferable as this increases the likelihood that the offspring will be homozygous and thereby protected from liver copper accumulation.
  • the invention also provides a method of selecting a dog for producing offspring protected from liver copper accumulation by making use of the polymorphisms of the invention that are indicative of susceptibility to copper accumulation.
  • the absence of such polymorphisms in the genome of the dog indicates that the dog is a good candidate for mating.
  • the method of the invention may therefore comprise determining whether the genome of the candidate first dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation; and thereby determining whether the candidate first dog is suitable for producing offspring protected from liver copper accumulation.
  • the method may comprise detecting the presence or absence in the genome of the candidate first dog of one or more polymorphisms selected from:
  • the method may further comprise determining whether the genome of a second dog of the opposite sex to the first dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation.
  • the method may therefore comprise detecting the presence or absence in the genome of a second dog of one or more polymorphisms selected from:
  • the first dog may then be mated with the second dog in order to produce offspring that is not susceptible to liver copper accumulation.
  • the method may further comprise detecting the presence or absence in the genome of the candidate first dog of (I) a polymorphism in the GOLGA5, ATP7A or UBL5 gene that is indicative of susceptibility to liver copper accumulation and/or (II) a polymorphism in linkage disequilibrium with a said polymorphism (I).
  • the method comprises determining the presence or absence of one or more polymorphisms selected from the SNPs identified in Tables 4 to 6 and one or more polymorphisms in linkage disequilibrium thereof in the genome of the candidate first dog. The presence of one or more of these polymorphisms indicates that the first dog is susceptible to liver copper accumulation and is therefore not a good candidate to be mated with a second dog to produce offspring protected from liver copper accumulation.
  • the candidate first dog and/or second dog may be of any breed.
  • the candidate first dog and/or second dog has genetic breed inheritance of a breed selected from Labrador Retriever, Doberman Pinscher, German Shepherd, Keeshond, Cocker Dogl, West Highland White Terrier, Bedlington Terrier and Skye Terrier. More preferably, the candidate first dog and/or second dog has genetic inheritance of the Labrador Retriever breed.
  • the dog may be a purebred Labrador Retriever.
  • the dog may be a mixed or crossbred dog, or an outbred dog (mongrel).
  • One or both of the parents of the dog may be a pure-bred Labrador Retriever dog.
  • One, two, three or four of the grandparents of the dog may be a pure-bred Labrador Retriever dog.
  • the dog may have at least 50% or at least 75% of the Labrador Retriever breed in its genetic background.
  • at least 50% or at least 75% of the dog's genome may be derived from the Labrador Retriever breed.
  • the genetic breed inheritance of a dog may be determined by assessing the allelic frequencies of genetic markers, for example SNPs or microsatellites.
  • allelic frequencies of different SNPs or microsatellites in a dog provide a signature that allows the breed of a dog or the breeds that make up a mixed breed dog to be determined.
  • Such a genetic test may be a commercially available test.
  • the dog may not need to be tested for a particular breed inheritance because it is suspected of having a particular breed inheritance for example by the dog owner or veterinarian. This could be for example because of knowledge of the dog's ancestry or because of its appearance.
  • a studbook is typically the official registry of approved dogs of a given breed kept by, for example, a breed association or kennel club. It is generally termed a “closed” studbook if dogs can only be added if their parents were both registered. Most breeds have closed studbooks, resulting in inbreeding, as genetic diversity cannot be introduced from outside the existing population. In a number of breeds recognized by kennel clubs this has resulted in high incidences of genetic diseases or disorders and other problems such as reduced litter sizes, reduced lifespan and inability to conceive naturally.
  • the genetic breed inheritance of the candidate first dog and of the candidate second dog is determined in order to determine the degree of relatedness of the two dogs.
  • the term “genetic breed inheritance” relates to the dog's genetic ancestry within a particular breed.
  • the dog's genetic breed inheritance may be determined as described herein.
  • the degree of relatedness of the candidate first dog and the candidate second dog is determined, which comprises comparing the genetic breed inheritance of the candidate first dog with the candidate second dog of the same breed.
  • the dogs are purebred dogs.
  • the genetic breed inheritance of each dog may for example be determined by identifying the presence or absence of one or more breed-specific polymorphisms in said dog.
  • the degree of relatedness may be determined from the number of breed-specific polymorphisms that the dogs have in common. For example, two dogs of the same breed may have from 0 to 100% of the breed-specific polymorphisms tested in common, for example from 10 to 90%, from 20 to 80%, from 30 to 70% or from 40 to 60%. Therefore two dogs may have at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the breed-specific polymorphisms tested in common. The percentage of tested breed-specific polymorphisms in common between two dogs may be used as a measure of their degree of relatedness. In this aspect of the invention, the two dogs would only be mated together if they are sufficiently genetically unrelated. For example, they may only be mated together if they have less than 60%, 50%, 40%, 30% or less than 20% of the breed-specific polymorphisms tested in common.
  • the invention also provides a method of selecting one or more dogs for breeding with a subject dog, the method comprising:
  • the test group may consist of at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 50, 75, 100 or 200 different dogs, for example from 2 to 100, from 5 to 70 or from 10 to 50 dogs.
  • the dogs are typically selected from the test group on the basis of being protected from liver copper accumulation.
  • the dog or dogs selected from the test group may have the same or similar genetic breed inheritance as the subject dog.
  • the subject dog and each dog in the test group may be of any breed.
  • the subject dog and/or each dog in the test group has genetic breed inheritance of a breed selected from Labrador Retriever, Doberman Pinscher, German Shepherd, Keeshond, Cocker Dogl, West Highland White Terrier, Bedlington Terrier and Skye Terrier. More preferably the dog has genetic breed inheritance of the Labrador Retriever breed.
  • the dog may be a purebred Labrador Retriever.
  • the dog may be a mixed or crossbred dog, or an outbred dog (mongrel).
  • One or both of the parents of the dog may be a pure-bred Labrador Retriever dog.
  • One, two, three or four of the grandparents of the dog may be a pure-bred Labrador Retriever dog.
  • the dog may have at least 50% or at least 75% of the Labrador Retriever breed in its genetic background.
  • at least 50% or at least 75% of the dog's genome may be derived from the Labrador Retriever breed.
  • the dog within the test group that is most likely to be protected from liver copper accumulation, based on the presence or absence of polymorphisms associated with protection from or susceptibility to liver copper accumulation, may be selected for breeding with the subject dog.
  • a number of the dogs within the test group that are likely to be protected from liver copper accumulation are selected for breeding with the subject dog. For example, at least 2, 3, 4, 5, 10, 15 or 20 dogs in the test group may be selected.
  • a further selection may then be made from the group of selected dogs based on other factors, for example geographical location, age, breeding status, medical history, disease susceptibility or physical characteristics.
  • the method may further comprise:
  • the dogs may be selected from the test group on the basis of their relatedness to the subject dog (i.e. the dog to be bred from).
  • the dog or dogs selected from the test group are the most distantly related (i.e. have the lowest degree of relatedness) within the test group of dogs.
  • the genetic breed inheritance of the subject dog and the dogs in the test group may be already known or may be determined e.g. by a commercially available breed test.
  • the invention thus provides a method of recommending one or more suitable dogs for breeding with a subject dog.
  • the recommendation may be made to the subject dog's owner or carer, a veterinarian, dog breeder, kennel club or breed registry.
  • the invention also relates to a method of breeding dogs, wherein the protection from, or susceptibility to, liver copper accumulation of at least two dogs of the opposite sex is determined, optionally within the same breed, before breeding them together.
  • the protection from, or susceptibility to, liver copper accumulation of a dog may be stored in an electronic format, for example in a computer database.
  • the invention provides a database comprising information relating to the susceptibility to, or protection from, liver copper accumulation and sex of one or more dogs.
  • the database may include further information about the dog, for example the dog's genetic breed inheritance, breeding status, age, geographical location, medical history, disease susceptibility or physical characteristics.
  • the database will typically further comprise a unique identifier for each dog, for example the dog's registered name.
  • the database may be accessed remotely, for example using the internet.
  • This Example describes the general approach that was taken to develop a genetic predictive test for copper accumulation. It also details the methodology used for a whole genome association study and the identification of regions of the genome potentially containing informative genes.
  • the general approach used to develop a genetic predictive test for copper accumulation was as follows. First, collected samples from dogs diagnosed as “affected” or “unaffected” by liver copper accumulation were run on a genotyping array with a large number of markers. This is known as a “whole genome association study”. Analysis of this data gave an indication of regions potentially containing informative genes. Informative SNPs in regions with interesting genes were then used in model generation. In parallel, the interesting genes were sequenced to look for coding mutations or other mutations that better describe the genetic effect on the disease. These mutations were then used in further model generation. In practice, this process involved loops and parallel tracks because of ongoing improvements in technology.
  • liver enzymes Alkaline phosphatase and Alanine Amino Transferase
  • bile acids and albumin.
  • An EDTA blood sample was used for DNA isolation.
  • Liver biopsies were obtained from 239 dogs by Menghini technique, ultrasound guided with a Trucut 14 Gauge needle device, collected during laparoscopy or laparotomy or taken after euthanasia (Teske et al., 1992, Vet. Rec. 131:30-32). Liver biopsies were fixed in 4% buffered formalin for 3 hours, transferred to 70% ethanol and embedded in paraffin. Five micron sections were mounted on slides and stained with Haematoxylin and Eosin (routine evaluation), von Giesson (reticulin staining) and rubeanic acid (copper staining).
  • Diagnosis was based on histological evaluation of a liver biopsy by our board certified pathologist (TSGAMvdI). Severity of copper accumulation was scored on a scale from 0 to 5 as described previously (Teske et al., 1992, Vet. Rec. 131:30-32). An additional liver biopsy was collected in a copper free container, freeze dried and quantitative copper was determined by Instrumental Neutron Activation Analysis (INAA) in dry weight liver (Bode et al., 2008, Anal. Bioanal. Chem. 390:1653-1658).
  • TGAMvdI Instrumental Neutron Activation Analysis
  • the histology score is described below:
  • Grade 1 solitary liver cells contain some copper positive granules.
  • Grade 2 small groups or area of liver cells contain small to moderate amounts of copper positive granules.
  • Grade 3 larger groups or areas of liver cells contain moderate amounts of copper positive granules, sometimes associated with copper containing macrophages.
  • Grade 4 large areas of liver cells with many copper positive granules, usually associated with copper containing macrophages.
  • Grade 5 diffuse pan-lobular presence of liver cells with many copper positive granules, usually associated with copper containing macrophages.
  • liver copper concentrations above 600 mg/kg dry weight as “affected” and below 400 mg/kg dry weight as “unaffected” (quantaff).
  • a binary phenotype for the most clear copper toxicosis cases and controls was also applied (cutox).
  • a case was defined as having a liver copper level >1200 mg/kg or copper staining >3 and histological signs of hepatitis.
  • a control was defined as having liver copper level ⁇ 400 mg/kg and staining of ⁇ 2 and no abnormalities on histology.
  • a more separated phenotype was used to increase the resolution of the genetic mapping.
  • Quantitative copper level in liver tissue was used as a quantitative phenotype (cuq) and ranged from 65 to 3870 mg/kg.
  • Genome-wide genotyping was carried out using the first generation Illumina canine genotyping array, which aims to measure approximately 22,000 SNP loci (22K chip). We ran 251 dog DNA samples on this array.
  • genetic mapping is done by genotyping selected samples on markers spread across the whole genome.
  • the samples are phenotyped for a trait such as a disease.
  • the samples are typically selected from a single sub population and selected to be as unrelated within that population as possible. This is done to reduce the risk of getting false positive hits from the population structure.
  • Partition Mapping also known as “2D mapping”.
  • the method is currently limited to binary conditions (case/control studies).
  • Complex diseases with a genetic link are generally driven by more than one gene. These genes can interact in non-linear ways, making them more difficult to map using traditional methods.
  • By working on the level of a pair of individuals it is possible to factor out the impact of multiple genes because a locus will either be contributing to the phenotype on that pair of individuals or not. The full working of this process is described below. After running this analysis it is possible to extract the risk alleles in each area and build a model to predict the phenotype using other methods.
  • the “Partition Mapping” algorithm scans through the genome stopping every 50 kilobases. At each of these points, every pair of individuals is analysed. For each pair, the genotypes for the whole chromosome are analysed comparing the likelihood of the genotypes under three possible scenarios. The first scenario is that there is a recessive mutation driving the phenotype in this pair of individuals. The second scenario is that there is a dominant mutation driving the phenotype in this pair of individuals. The third scenario is that there is no important mutation for the phenotype in the pair of dogs at this location. The likelihoods are calculated using a hidden markov model, described below.
  • the pairs of individuals are sorted in order of the Log-Bayes factors at that locus.
  • the pairs' Log-Bayes-Factors are then summed up in descending order taking a record of the cumulative weight of evidence at each percentile of the data. In most cases some Log-Bayes-Factors will be positive and some will be negative. This will give the effect of the recorded value rising for a percentage of the data and then falling. The maximum of this value gives a measure of the weight of evidence towards either the recessive or dominant models. This is referred to as the “peak-value”.
  • the algorithm has bias towards particularly homozygous areas of the genome or areas with a high density of polymorphisms.
  • This effect is quantified by running the process with every pair permuted across the four possible case/control states (case-case, case-control, control-case, control-control). For any locus, one subtracts the peak-value under the permuted model from the normal peak-value, and this gives a corrected peak-value. It is then possible to compare the corrected peak-values across the genome giving regions of interest.
  • This method has been used to map a number of locations associated with copper loading in the liver. These locations are marked by haplotype patterns indicative of a trait-linked gene. The locations were then investigated for likely genes.
  • Regions identified in the whole genome association study were then analysed for likely genes.
  • the process involved identifying the informative region boundaries; identifying all genes in the region in Ensembl; looking for relevant protein domains related to copper or liver function; looking for membership of pathways linked to copper; and looking for genes expressed in relevant tissues. Based on this information, genes were then prioritised by likelihood of involvement with the disease.
  • a number of candidate genes associated with copper accumulation or liver disease were identified by this process.
  • a newer SNP chip than the 22K chip described above became available which has 172,115 markers from more varied sources (170K chip). This chip contains on average more than 70 markers per Mb. We ran the same and further DNA samples on this array as were run on the 22K chip.
  • Genetic kinship was estimated based on autosomal genotype information. Heritability for three traits (copper toxicosis, rubeanic acid stain score and quantitative liver copper in mg/kg) was estimated by a polygenic model (Aulchenko et al., 2007, Genetics, 177: 577-585) in which population sub-structuring was accounted for by calculating the genetic kinship matrix. Age and sex were modeled as covariates. Population stratification was checked by a multidimensional scaling plot. Correction for stratification was performed by performing a score test on residuals of the estimates of the polygenic model and genomic control.
  • This Example describes the generation of a three-region model for determining susceptibility to liver copper accumulation. This work is also described in WO 2009/044152 A2, WO 2010/038032 A1 and WO 2010/116137 A1.
  • SNPs in and around the genes prioritised in the region analysis described in Example 1 were extracted from the dataset. These were analysed singly and in haplotypes looking for informative allele patterns associated with liver copper level.
  • Table 3 shows the result of the three-region model for predicting copper accumulation. Each region uses either a single SNP or a group of SNPs. The model shows a clear difference in risk of disease depending on the genotype of the dog using this simple model of SNPs in three genomic regions.
  • Genomic location Chromosome 8 CFA8
  • Genomic location Chromosome 32 CFA32
  • 0 if there is a GG at BICF2P591872
  • Table 3 represents the binary conditions of alleles at three genomic locations. At genomic location CFA8, one SNP was used (SNP 1). At genomic location CFA32 three SNPs were used (SNPs 2, 3 and 4). At genomic location CFAX one SNP was used (SNP 5). The binary values are indicative of a dog having alleles that are indicative of susceptibility to copper accumulation (“bad” alleles). For instance 000 represents not having any of the three bad alleles. 111 represents having all three bad alleles.
  • Table 4 shows the position and sequence of the SNPs used for the results in Table 3.
  • results implicated three genomic locations (in and around the GOLGA5, UBL5 and ATP7A genes) associated with susceptibility to copper accumulation. Further SNPs in these regions that are indicative of susceptibility to copper accumulation are provided in Table 5.
  • SNP [first allele/second allele] BICF2P506595 1 8 4886813 GOLGA5 CTCAGAACTAGATAGGCTAATAAGTGATAGGCCTTGTGTTTTC (SNP 1) CTAGAGTGTGCTTTAAA[A/G]GTTTCTTAAGCTAAAAAATTA CATTCGTGAGAAAATTGAAATAAAAGGAAAACAGTCATG BICF2P772765 2 32 39278300 UBL5 TCTCAGATACTTGATAGCCAGCATTTCCCCCCATTTTCTTCCA (SNP 2) AGAGCACGAAAGCATAG[A/G]AATGATATTACATCTCGTATG GTGAATGTGACACAGCCGTCAGTTGCGTTAGCTCTGCTT BICF2S233
  • This Example describes the identification of further SNPs associated with susceptibility to liver copper accumulation and also some protective SNPs in the ATP7A gene. This work is also described in WO 2010/038032 A1 and WO 2010/116137 A1.
  • Example 2 The three genes identified in Example 2 were investigated to identify further SNPs associated with susceptibility to liver copper accumulation. Thirty-three amplicons covering every exon of the three identified genes were chosen. These were amplified in 72 samples of genomic DNA from dogs of the Labrador Retriever breed. The samples were taken from dogs with either high copper (liver levels of copper above 600 mg/kg) or normal copper liver levels (below 400 mg/kg). The amplified product was sequenced in both directions by the Sanger method. The software ‘Seqman 4.0’ supplied by DNASTAR was used to assemble the sequence in each amplicon. The assembly was then examined to find single base variations (SNPs). These variations were then genotyped by examining the base-intensity at the SNP in the sequence from both directions. If the genotypes of a SNP from the two directions disagreed in more than 10 samples the SNP was classed as an artefact and ignored. The identified susceptibility SNPs are set out in Table 6.
  • FIG. 1 illustrates the data from Table 9 graphically.
  • FIG. 2 illustrates the same data as copper-histological scores. The p-value (0.000396) was determined from a Kruskal-Wallis test on the histological score with gender-genotype as the groups. It is clear from the data that the presence of the T allele is indicative of a dog being protected from high liver copper.
  • the results may explain the female bias of chronic hepatitis.
  • Male dogs have only one copy of the X chromosome and so are hemizygous at the ATP7A locus.
  • An X-linked recessive gene-effect is more likely to be seen in males than females because of the hemizygous state of the male X chromosome.
  • the protective effect here is recessive so we see more cases in the female population.
  • the protective SNP results in a change of a Threonine to Isoleucine at amino acid 328 of ATP7A leading to a decrease in the number of potential hydrogen bonds from 3 to 0 and an increase in hydrophobicity, potentially altering the shape of the protein.
  • the Threonine at this position is conserved across many mammals, including horse, human, chimpanzee and dolphin, indicating the importance of this amino acid in the function of the protein.
  • This Example describes an investigation into breed and geographic diversity of the ATP7A protective coding region SNP.
  • the ATP7A coding region SNP (ATP7A Reg3_F_6; ChrX_63338063) was genotyped in samples of DNA from dogs of other breeds in addition to Labrador Retriever to determine whether the SNP is present in other breeds. Table 10 shows the results, with the number of dogs of each genotype.
  • the ‘T’ column refers to homozygote females (TT) and hemizygote males (T).
  • TT homozygote females
  • T hemizygote males
  • the results demonstrate that the SNP is present in diverse dog breeds and therefore may be used as in indicator of protection from copper accumulation in a wide variety of different breeds, mixed bred dogs and mongrels.
  • the T allele of the SNP has also been found in US and Japanese Labrador populations, demonstrating that geographical location of the dog is not a hindrance to the utility of the SNP.
  • SNP name ID Sequence to the First Second Sequence to Right (SNP no.) NO: Left of the SNP Allele Allele of the SNP ATP7a_Reg4_F_9 131 CTCTCATTTTGTGTATTGATTTGAG A C CCTTAGTTCCCAAGTTCCTATCTTG (SNP 131) GACTCTGTCCTTTTTGTTCTCTTAG TTTACCTCATGATCACATTTTAATA GTGTTTTGTAACCATTTTTGTGGTT TCAATGAAATTTGTAGGAAAACAGC CTTGCCACAAAAGGCCTTATGAAGT AGAAGGAAAGATATAAGGTTACTAT CCTGCATATGAGTGATGTGCAGGAC TCTCTATGGACCTTGGTTG AACTTTGACTTTCTGACAGCCAGTT TTTGTGTTTTGTT UBL5_Reg1F_16 132 TTGCAGATTATATGATAAATATAGT T C ACTTAACTAGGTAGGCCACAGA
  • This Example describes the sequencing of ATP7B (cDNA and gDNA) and the elucidation of mutations associated with copper accumulation.
  • Primers were developed with Perl Primer and checked for specificity using NCBI Primer Blast. Primers needed to be designed that were specific for the active ATP7B, rather than the pseudogene of ATP7B (a 1106 bp fragment at genomic position (4:38596510-38597615). The primers (Table 11) were secured by developing primers that mismatch the pseudogene of ATP7B. According to the NCBI database the fragment of main focus was located in exon 2 of ATP7B. However, Ensemble states this fragment is both exon 2 (ENSCAFE0000004665) and exon 3 (ENSCAFE00000046071) with a 33 base pair intron in between.
  • PCR Polymerase chain reaction
  • NCBI online genome databases
  • Ensembl states that these 1237 bp are two exons, namely exon 2 (971 bp), intron 2-3 (33 bp) and exon 3 (233 bp).
  • Our sequencing results show that exon two is indeed 1237 base pairs long and there is no intronic sequence.
  • CGCCCC repeat (two, 500 bp three or four 500 bp upstream repeats) downstream tcagcacccaggag CGCCCCCGCCCC; aagaaccccggcacc gcagtcatcactta CGCCCCCGCCCCC gggcaggtgcgatac ccagccttatctta GCCCC; tgtgatgccgccatt ttcaaccccaggac or gtgggcatgacctgt ctcagggaccatgt CGCCCCCGCCCCCCC gcatcctgcgtccag aaacgacatggggt GCCCC tgatcgaaggcctga ttgaagctgtcatc CGCCCC tctcccagagggaagaagaacagagtggc
  • Approximately 144 bp upstream of the repeat we found a non-synonymous mutation (ATP7B 790 G>A).
  • This SNP is also located in exon 2 on chromosomal position 3135144. It is a G>A substitution and as a consequence the amino acid alanine is substituted by threonine.
  • the SNP is located in the third heavy metal associated domain.
  • Resequencing (Sanger) of ATP7B was performed by Beckmann Coulter in 98 dogs from which complete phenotypic data was available. Exons and exon-intron boundaries were sequenced.
  • Results of the sequencing were analyzed using SeqMan (DNAstar8.1). Results were compared with NCBI (Build2.1) and Ensembl (CanFam 2.0 May 2005, database version 62.2r). The Labrador pedigrees were checked for Mendelian inconsistencies.
  • the ATP7B 4145G>A SNP is located at the end of ATP7B, approximately 154 bp upstream of the stop codon (exon 21, chromosomal position 3167534). It is a non-synonymous mutation in which a G>A substitution leads to the amino acid glutamine instead of arginine ( FIG. 5 ).
  • SNP790G>A and SNP4145G>A Two interesting SNPs (SNP790G>A and SNP4145G>A) and a repeat found in ATP7B were further analyzed in a larger subset of Labrador retrievers.
  • SNP790G>A 267 Labradors and 1 Beagle (control) were typed and for SNP4145G>A a total of 242 Labradors were typed by SNaPshot.
  • 216 dogs were typed by Genescan. The protocols used for typing the mutations are described in more detail below.
  • Genescan was performed to type the DNA fragment length polymorphism in ATP7B using a 3-primer protocol.
  • the Pfx polymerase was used for PCR amplification of the amplicon because Platinum Taq polymerase is not able to detect shot tandem GC-repeats.
  • the same primers as used for sequencing were also used for the Genescan, except that there was a M13-tail added to the forward primer. Primer sequences are listed in Table 13.
  • SNaPshot was performed for a precise SNP analysis in an extended group of Labrador retrievers.
  • PCR primers for SNP 4145G>A were developed with Perl Primer and checked with NCBI Primer Blast. These primers were specific for the functional ATP7B gene because an intronic sequence was also incorporated.
  • a SNaPshot primer was designed. The primer sequences are provided in Table 14.
  • the SNaPshot protocol was the same for both SNPs, except for the PCR step.
  • the template of SNP 4145G>A was created using standard Platinum Taq polymerase.
  • the template of SNP 790G>A was created using the Pfx polymerase, which is able to amplify GC-rich stretches more accurately.
  • Results were analyzed with the Applied Biosystems GeneMapper Software Version 4.0. Focus was on the different colors, with each color representing another base, and on the heterozygosity or homozygosity of the individuals. Peaks were compared with each other and with the size standard to determine reliability of a peak.
  • the coding mutations in ATP7B were typed in an extended set of Labradors and a linear model was used to determine the magnitude and direction of effect of a mutation (beta) and the significance of association (p-value) for the single mutations and with all mutations in the same model. For 211 Labradors all three mutations in ATP7B and the mutation in ATP7A were typed. In this set, the number of risk alleles of each dog was determined and the effect of the number of risk alleles on liver copper based on RA staining was calculated.
  • FIG. 7 shows the effect of the number of risk alleles on quantitative liver copper levels.
  • This Example describes genotyping of SNPs and model generation.
  • SNPs were identified by SOLID sequencing (using the SOLID 3 sequencing platform) of CACH-phenotyped DNA samples.
  • SNPs from previous work and sequencing of the ATP7A, COMMD1, ATOX1 and ATP7B genes were included in the analysis.
  • SNPs were genotyped by GeneSeek on all available phenotyped DNA samples. SNPs were analysed with a collection of chi-squared tests. A two degrees of freedom test was used with a null hypothesis of independence between phenotype and genotype. Phenotypes used were:
  • a correlation co-efficient test was applied against quantitative copper and histology score.
  • the test was performed in MATLAB using the corrcoef function producing a p-value and a correlation coefficient.
  • Loci were then ranked by p-value to prioritise further investigation. Genomic regions beyond a significance of 0.001 were investigated for potential candidate genes as described in the section headed “Region gene analysis” in Example 1.
  • Genotypes were then inspected for the selected SNPs. Because the corrcoef function can sometimes provide false positives in ordinal data (like genotypes) with low membership of groups the SNPs were filtered for only those that contain ten or more samples in at least two groups that have a difference in the phenotype. The remaining SNPs were used in model generation.
  • the final data consists of 386 SNPs genotyped on 260 samples. Analysis identified many SNPs that are significantly associated with susceptibility to, or protection from, liver copper accumulation. This analysis is shown in Table 17. Further information on the SNPs, including the surrounding sequences, is provided in Table 18.
  • SNPs in linkage disequilibrium with the SNPs and which are therefore also associated with susceptibility to, or protection from, liver copper accumulation are provided in Tables 19 and 20.
  • the mutations identified in Tables 17 to 20 can be used on their own to determine susceptibility to, or protection from, liver copper accumulation. However, a more accurate method of assessing susceptibility to, or protection from, liver copper accumulation may be achieved through the use of models involving combinations of mutations.
  • the mutations in Tables 17 and 18 were used in model generation as described below.
  • the variables chosen were all the mutations identified in the Geneseek genotyping as well as gender coded as 0 for male 1 for female. Genotypes were coded in ordinal form as 0, 1 or 2 (count of second allele).
  • FIGS. 8 and 9 illustrate the predictive functions shown in FIGS. 8 and 9 .
  • FIG. 8 illustrates stepwise modelling of the histology copper score.
  • FIG. 9 illustrates stepwise modelling of the log-quantitative copper score.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Evolutionary Biology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Theoretical Computer Science (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Medical Informatics (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Ecology (AREA)
  • Physiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
US14/363,751 2011-12-06 2012-12-06 Genetic test for liver copper accumulation in dogs Active 2033-04-11 US10150997B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GB1120989.7 2011-12-06
GBGB1120989.7A GB201120989D0 (en) 2011-12-06 2011-12-06 Genetic test
PCT/GB2012/053038 WO2013083988A2 (en) 2011-12-06 2012-12-06 Genetic test for liver copper accumulation in dogs

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2012/053038 A-371-Of-International WO2013083988A2 (en) 2011-12-06 2012-12-06 Genetic test for liver copper accumulation in dogs

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/181,516 Division US20190062839A1 (en) 2011-12-06 2018-11-06 Genetic test for liver copper accumulation in dogs

Publications (2)

Publication Number Publication Date
US20140351962A1 US20140351962A1 (en) 2014-11-27
US10150997B2 true US10150997B2 (en) 2018-12-11

Family

ID=45541307

Family Applications (3)

Application Number Title Priority Date Filing Date
US14/363,751 Active 2033-04-11 US10150997B2 (en) 2011-12-06 2012-12-06 Genetic test for liver copper accumulation in dogs
US16/181,516 Abandoned US20190062839A1 (en) 2011-12-06 2018-11-06 Genetic test for liver copper accumulation in dogs
US17/360,692 Pending US20220389506A1 (en) 2011-12-06 2021-06-28 Genetic test for liver copper accumulation in dogs

Family Applications After (2)

Application Number Title Priority Date Filing Date
US16/181,516 Abandoned US20190062839A1 (en) 2011-12-06 2018-11-06 Genetic test for liver copper accumulation in dogs
US17/360,692 Pending US20220389506A1 (en) 2011-12-06 2021-06-28 Genetic test for liver copper accumulation in dogs

Country Status (8)

Country Link
US (3) US10150997B2 (ru)
EP (4) EP4250298A3 (ru)
JP (4) JP6231490B2 (ru)
CN (3) CN114085898A (ru)
AU (3) AU2012349841B2 (ru)
GB (1) GB201120989D0 (ru)
RU (3) RU2662660C2 (ru)
WO (1) WO2013083988A2 (ru)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9827314B2 (en) 2003-12-08 2017-11-28 Mars, Incorporated Edible compositions which are adapted for use by a companion animal
GB201818627D0 (en) * 2018-11-15 2019-01-02 Mars Inc Analytical systems
CN113080136B (zh) * 2021-02-24 2022-05-17 厦门大学 一种腹膜后肉瘤小鼠原位异种移植动物模型的建立方法

Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995008641A1 (en) 1993-09-21 1995-03-30 Hsc Research And Development Limited Partnership Wilson disease gene
WO1997031011A1 (en) 1996-02-22 1997-08-28 The Regents Of The University Of Michigan Microsatellite markers for identifying canine genetic diseases or traits
DE19703252A1 (de) 1996-11-07 1998-05-14 Wolfgang Heinz Richard P Pries Nahrungsmittel mit Mineralsalz und Verfahren zu dessen Herstellung
WO1999048384A2 (en) 1998-03-25 1999-09-30 Mars Uk Limited Food containing biotin and other b vitamins
WO2000032206A1 (en) 1998-12-03 2000-06-08 Heritage Technologies, Llc. Vitamin compatible micronutrient supplement
US6156355A (en) 1998-11-02 2000-12-05 Star-Kist Foods, Inc. Breed-specific canine food formulations
WO2002056703A1 (en) 2001-01-18 2002-07-25 The Ohio State University Method of making microalgal-based animal foodstuff supplements, microalgal-supplemented animal foodstuffs and method of animal nutrition
WO2003033734A2 (en) 2001-10-19 2003-04-24 Mars Uk Limited Diagnostic tests for the diagnosis of copper storage disease
US20030092019A1 (en) * 2001-01-09 2003-05-15 Millennium Pharmaceuticals, Inc. Methods and compositions for diagnosing and treating neuropsychiatric disorders such as schizophrenia
WO2004113570A2 (en) 2003-06-16 2004-12-29 Mars, Incorporated Genotype test for dogs
US20050123585A1 (en) 2003-12-08 2005-06-09 The Iams Company Edible compositions which are adapted for use by a companion animal
US6911224B1 (en) 1996-08-06 2005-06-28 Nestec S.A. Multi-layered canned pet food
US20060147962A1 (en) 2003-06-16 2006-07-06 Mars, Inc. Genotype test
EP1698232A1 (en) 2003-12-26 2006-09-06 Kao Corporation Pet food
US20070009899A1 (en) 2003-10-02 2007-01-11 Mounts William M Nucleic acid arrays for detecting gene expression in animal models of inflammatory diseases
US20080226766A1 (en) 2005-09-16 2008-09-18 Mars Incorporated Dog Periodontitis
WO2009044152A2 (en) 2007-10-03 2009-04-09 Mars, Incorporated Genetic test for liver copper accumulation in dogs and low copper pet diet
US20090170111A1 (en) 2004-02-27 2009-07-02 Celera Corporation Genetic polymorphisms associated with stroke, methods of detection and uses thereof
US20090308324A1 (en) 2006-08-01 2009-12-17 Mars Incorporated Diabetes tests
WO2010038032A1 (en) 2008-10-03 2010-04-08 Mars, Incorporated Genetic test for liver copper accumulation in dogs and low copper pet diet
US20100196400A1 (en) 2005-10-26 2010-08-05 Celera Corporation Genetic polymorphisms associated with alzheimer's disease, methods of detection and uses thereof
US7912650B2 (en) 2001-05-25 2011-03-22 Hitachi, Ltd. Information processing system using nucleotide sequence-related information
US20110117545A1 (en) 2007-03-26 2011-05-19 Decode Genetics Ehf Genetic variants on chr2 and chr16 as markers for use in breast cancer risk assessment, diagnosis, prognosis and treatment
US20120021928A1 (en) * 2010-06-18 2012-01-26 Kerstin Lindblad-Toh Genetic risk assessment for shar-pei fever

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2126675C1 (ru) * 1998-01-05 1999-02-27 Уральский государственный институт ветеринарной медицины Способ диагностики заболеваний печени у собак

Patent Citations (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995008641A1 (en) 1993-09-21 1995-03-30 Hsc Research And Development Limited Partnership Wilson disease gene
WO1997031011A1 (en) 1996-02-22 1997-08-28 The Regents Of The University Of Michigan Microsatellite markers for identifying canine genetic diseases or traits
US6911224B1 (en) 1996-08-06 2005-06-28 Nestec S.A. Multi-layered canned pet food
DE19703252A1 (de) 1996-11-07 1998-05-14 Wolfgang Heinz Richard P Pries Nahrungsmittel mit Mineralsalz und Verfahren zu dessen Herstellung
WO1999048384A2 (en) 1998-03-25 1999-09-30 Mars Uk Limited Food containing biotin and other b vitamins
US6156355A (en) 1998-11-02 2000-12-05 Star-Kist Foods, Inc. Breed-specific canine food formulations
WO2000032206A1 (en) 1998-12-03 2000-06-08 Heritage Technologies, Llc. Vitamin compatible micronutrient supplement
US20030092019A1 (en) * 2001-01-09 2003-05-15 Millennium Pharmaceuticals, Inc. Methods and compositions for diagnosing and treating neuropsychiatric disorders such as schizophrenia
WO2002056703A1 (en) 2001-01-18 2002-07-25 The Ohio State University Method of making microalgal-based animal foodstuff supplements, microalgal-supplemented animal foodstuffs and method of animal nutrition
US7912650B2 (en) 2001-05-25 2011-03-22 Hitachi, Ltd. Information processing system using nucleotide sequence-related information
WO2003033734A2 (en) 2001-10-19 2003-04-24 Mars Uk Limited Diagnostic tests for the diagnosis of copper storage disease
WO2004113570A2 (en) 2003-06-16 2004-12-29 Mars, Incorporated Genotype test for dogs
US20060147962A1 (en) 2003-06-16 2006-07-06 Mars, Inc. Genotype test
US20070009899A1 (en) 2003-10-02 2007-01-11 Mounts William M Nucleic acid arrays for detecting gene expression in animal models of inflammatory diseases
US20050123585A1 (en) 2003-12-08 2005-06-09 The Iams Company Edible compositions which are adapted for use by a companion animal
WO2005055739A1 (en) 2003-12-08 2005-06-23 The Iams Company Edible compositions which are adapted for use by a companion animal
EP1698232A1 (en) 2003-12-26 2006-09-06 Kao Corporation Pet food
US20090170111A1 (en) 2004-02-27 2009-07-02 Celera Corporation Genetic polymorphisms associated with stroke, methods of detection and uses thereof
US20080226766A1 (en) 2005-09-16 2008-09-18 Mars Incorporated Dog Periodontitis
US20100196400A1 (en) 2005-10-26 2010-08-05 Celera Corporation Genetic polymorphisms associated with alzheimer's disease, methods of detection and uses thereof
US20090308324A1 (en) 2006-08-01 2009-12-17 Mars Incorporated Diabetes tests
US20110117545A1 (en) 2007-03-26 2011-05-19 Decode Genetics Ehf Genetic variants on chr2 and chr16 as markers for use in breast cancer risk assessment, diagnosis, prognosis and treatment
WO2009044152A2 (en) 2007-10-03 2009-04-09 Mars, Incorporated Genetic test for liver copper accumulation in dogs and low copper pet diet
WO2010038032A1 (en) 2008-10-03 2010-04-08 Mars, Incorporated Genetic test for liver copper accumulation in dogs and low copper pet diet
WO2010116137A1 (en) * 2009-04-08 2010-10-14 Mars, Incorporated Genetic test for liver copper accumulation in dogs and low copper pet diet
US9415067B2 (en) 2009-04-08 2016-08-16 Mars, Incorporated Genetic test for liver copper accumulation in dogs and low copper pet diet
US20120021928A1 (en) * 2010-06-18 2012-01-26 Kerstin Lindblad-Toh Genetic risk assessment for shar-pei fever

Non-Patent Citations (119)

* Cited by examiner, † Cited by third party
Title
"English Translation of Japanese Office Action dated Sep. 2, 2014, JP Appl. No. 2012-504068".
"Health and Related Issues", Internet <URL: http://homepages.rootsweb.ancestry.com/_oldmill/chelseaBB/HealthPage.htm>.
"Nutrient Analysis", Hill's Pet Nutrition, Inc., Jan. 19, 1999.
"Premium Nutrition for Dogs, Nature's Recipe Large Breed Recipe, Product Description" Del Monte: Nature's Recipe®, 2007, available online at http://www.naturesrecipe.com/DogProductDisplay.aspx?p=Dogs/Breed _ LargeBreed.
"Premium Nutrition for Dogs, Terrier Dogs Canine Recipe Product Description" Del Monte: Nature's Recipe®, available online at http://www.naturesrecipe.com/dogproductdisplay.aspx?p=Dogs/Breed_dryTerrier, 2006.
"Prescription Diet Canine l/d (liver disease)", Hills Pet Nutrition, available online at http://www.hillspet.com/media/WEURG/product/prodkeyPDF/en.pdf, accessed Jan. 30, 2008.
"Prescription Diet Canine lid (liver disease)," Hills Pet Nutrition, available online at http://www.hillspet.com/media/WEURG/product/prodkeyPDF /en/PD K9 D d ld _ o _ 0 _ n o WEURG_prodkey_en.pdf, accessed Jan. 30, 2008.
"Regenerative and Fibrotic Pathways in Canine Liver Disease", Faculty of Veterinary Medicine, 2006.
"Small Animal Clinical Nutrition", Mark Morris Institute, 2000, Ed. 4th.
"The Best Foods for Dogs With Chronic Active Hepatitis", A Dog's Life Photography & Art [online], Jun. 29, 2010, [retrieved on Aug. 21, 2013], Internet <URL: http://phoenixdogphotography.com/2010/06/the-best-foods-for-dogs-with-chronic-active-hepatitis/>.
"The Hill's Key to Clinical Nutrition", Hill's Pet Nutrition, Inc., 1999.
"Trophy Pet Foods: Trophy Premium Hypo-Allergenic food," Trophy Pet Foods, available online at http://www.trophypetfoods.co.uk/products/premiumdog.htrn, accessed Jan. 30, 2008.
"University study shows dogs have a lot to gain when they lose weight", GoodNewsforPets.com, recorded on May 12, 2007, Internet Archive Wayback Machine, searched http://goodnewsforpets.com/news/archive/Research/041300_weight_study.htm, Internet <URL:http://web.archive.org/web/20070512095423/http://www.goodnewsforpets.com/news/archive/research/041300_weight_study.htm>.
"Whole Dog Journal's Food List", Little Dog & Girl on the Prairie, Jun. 27, 2007, Internet <URL: http://blog.livedoor.jp/urea/archives/51627947.html>.
Acland, et al., "A Novel Retinal Degeneration Locus Identified by Linkage and Comparative Mapping of Canine Early Retinal Degeneration", Genomics, 59, 134-142 (Aug. 1999).
Acland, et al., "Linkage Analysis and Comparative Mapping of Canine Progressive Rod-Cone Degeneration (prcd) Establishes Potential Locus Homology with Retinitis Pigmentosa (RP17) in Humans", Proc. Natl. Acad. Sci. USA, vol. 95, pp. 3048-3053, Mar. 1998.
Allen et al., "Tetramine cupruretic agens: A comparison in dogs," Am. J. Vet. Res., 1987, vol. 48, Issue 1, pp. 28-30.
Altschul, "A Protein Alignment Scoring System Sensitive at All Evolutionary Distances", J. Mo. Evol., 1993, 36, pp. 290-300.
Altschul, et al., "Basic Local Alignment Search Tool", J. Mol. Biol., 1990, 215, 403-410.
Barrett, et al., "Haploview: Analysis and Visualization of LD and Haplotype Maps", Bioinformatics vol. 21 No. 2 2005, pp. 263-265, Aug. 5, 2004.
Bergstrom et al., "The Pharmacokinetics of Penicillamine in a Female Mongrel Dog"; Journal of Pharmacokinetics and Biopharmaceutics; Feb. 6, 1981; pp. 603-621; vol. 9, No. 5; Plenum Publishing Corporation.
Bode, "Instrumental neutron activation analysis in a routine way", Journal of trace and microprobe techniques, 1990, vol. 8, No. 1-2, 139-154 (Abstract Only).
Breen, et al., "Chromosome specific single locus FISH probes allow anchorage of a 1800 marker integrated radiation-hydrid/linkage map of the domestic dog genome to all chromosomes", Genome Res., Oct. 2001, 11(10):1784-1795.
Burns, "Bums: Developed by a Veterinary Surgeon. The Holistic Approach to Health & Nutrition," Bums Pet Nutrition Ltd., product brochure, available online at http://www.burns-petnutrition. co.uk/colour_brochure2006_small.pdf, accessed Jan. 30, 2008.
Chinese Search Report dated Mar. 8, 2013, issued during prosecution of China Patent Application No. 2010800254455.
Copper Content in Dog Foods (http:rottndobie.tripod.com/coppercontent.html, Nov. 2004).
Coronado et al. (The Veterinary Journal, vol. 177, pp. 293-296, 2008). *
Coronado et al., "Polymorphisms in canine A TP7B: candidate modifier of copper toxicosis in the Bedlington terrier", Veterinary Journal, 2008, vol. 177, Issue 2, pp. 293-296.
Coronado, et al.—New Haplotypes in the Bedlington Terrier Indicate Complexity in Copper Toxicosis—2003, pp. 481-491 vol. 14. Mammalian Genome.
DATABASE EMBL 1 January 1900 (1900-01-01), DEBENHAM S L: "CANIS FAMILIARIS MICROSATELLITE, CLONE 50E1/13", XP002248980, Database accession no. AJ299437
DATABASE EMBL 1 January 1900 (1900-01-01), DIAS NETO E.,ET AL: "MR0-BN0115-101000-012-C08 BN0115 HOMO SAPIENS CDNA, MRNA SEQUENCE", XP002248981, Database accession no. BF749428
DATABASE EMBL 1 January 1900 (1900-01-01), DUNN D,ET AL: "1M0551N24F MOUSE 10KB PLASMID UUGC1M LIBRARY MUS MUSCULUS GENOMIC CLONE UUGC1M0551N24 F, DNA SEQUENCE", XP002248979, Database accession no. AZ759124
DATABASE EMBL 1 January 1900 (1900-01-01), YUSBASIYAN-GURKAN V, ET AL: "CANIS FAMILIARIS STS MICROSATELLITE MARKER (REPEAT MOTIF IN REFERENCE CLONE (GT) 7 (A3T)N) DNA, SEQUENCE TAGGED SITE", XP002248976, Database accession no. L77549
DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; 2 February 2005 (2005-02-02), ANONYMOUS: "dbSNP SHORT GENETIC VARIATIONS", XP002696928
Database Medline, "dbSNP Short Genetic Variations", US National Library of Medicine (NLM), 2005, XP002696928, Bethesda, MD.
Debenham, "Physical and Linkage Mapping of the Canine Phosphate Carrier (SLC25A3) and Apoptotic Activating Tactor (APAF1) Genes to Canine Chromosome 15", Canis familiaris microsatellite, Nov. 24, 2000, retrieved from EBI Dtabase Accession No. AJ299437, Abstract XP002248980, 1 pg.
Devereux, et al., "A Comprehensive Set of Sequence Analysis Programs for the VAX", Nucleic Acids Research, 1984, 12, pp. 387-395.
Dias Neto, et al., "Shotgun Sequencing of the Human Transcriptome with ORF Expressed Sequence Tags", Homo sapien cDNA mRNA sequence, Jan. 12, 2001, retrieved from EBI Database accession No. BF49428, Abstract No. XP002248981, 1 pg.
Dias Neto, et al., "Shotgun Sequencing of the Human Transcriptome with ORF Expressed Sequence Tags", Homo sapien cDNA mRNA sequence, Jan. 12, 2001, retrieved from EBI Database accession No. BF49428, Abstract No. XP002248981, 2 pgs.
Dietary Survey Study Jun. 5, 2010; Utrecht University.
Dumin, et al., "High Efficiency Breeding and Disease Control of Dogs", China Agriculture Press, 1st Edition, p. 103, Oct. 31, 2003.
Dunn, et al., "Mouse Whole Genome Scaffolding with Paired End Reads from 10kb Plasmid Inserts", Mouse Library Mus Musculus Genomic Clone, Feb. 18, 2001, retrieved from EBI Database Accession No. Az759124, XP002248979 Abstract, 1 pg.
Fieten et al. (Disease Models and Mechanisms, vol. 9, pp. 25-38, 2016). *
Fieten et al. (Disease Models and Mechanisms, vol. 9, pp. 25-38, 2016). (Year: 2016). *
Fieten, et al., "Dietary Management of Labrador Retrievers with Subclinical Hepatic Copper Accumulation", J. Vet. Intern. Med. 2015; 29:822-827, Mar. 16, 2015.
Flint River Ranch Super Premium Dry Water Kibble Dog Food, product sheet, Downloaded 2014.
Force Dog Food—Gluten Free, The Honest Kitchen, product Sheet, downloaded 2014.
Friedman et al., "Isolation of a ubiquitin-like (UBL5) gene from a screen identifying highly expressed and conserved iris genes", Genomics, 2001, vol. 71, Issue 2, pp. 252-255.
Fuentealba et al., "Animal models of copper-associates liver disease", Comparative Hepatology, Apr. 3, 2003, vol. 2, No. 1, p. 5.
Great life Grain/Potato Free Dog Food as evidenced by Great life Rubicon (www.healthyplanetrx.com/Great-Life-Rubicon-for-dogs-p, Jul. 5, 2006).
Groot, et al., "Identification of Fragments of Human Transcripts from a Defined Chromosomal Region: Representational Difference Analysis of Somatic Cell Hybrids", Nucleic Acids Research, Oct. 1998, vol. 26, No. 19, pp. 4476-4481.
Han, et al., "Construction of a BAC Contig Map of Chromosome 16q by Two-Dimensional Overgo Hybridization", Genome Res., 10, pp. 714-721 (May 2000).
Hardy, et al., "Chronic Progressive Hepatitis in Bedlington Terriers Associates with Elevated Copper Concentrations", Minn. Vet., 15:13-24, 1975.
Harlow, et al., "Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988, 2 pgs."
Haywood et al., "Copper toxicosts in the bedlington terrier: a diagnostic dilemma," Journal of Small Animal Practice, 2001, vol. 42, Issue 4, pp. 181-185.
Henikoff, et al., "Amino Acid Substitution Matrices from Protein Blocks", Proc. Natl. Acad. Sci. USA vol. 89, pp. 10915-10919, Nov. 1992.
Hirschhorn et al. (Genetics in Medicine. vol. 4, No. 2, pp. 45-61, Mar. 2002). *
Hoffmann et al., "Copper-associated chronic hepatitis in Labrador retrievers", Journal of Veterinary Internal Medicine, 2006, vol. 20, Issue 4, pp. 856-861.
Hoffmann, et al., "Heritabilities of Copper-Accumulating Traits in Labrador Retrievers", Animal Genetics, vol. 39, No. 4, p. 454, Aug. 31, 2008.
Hyun, et al.—Evaluation of Haplotypes Associated With Copper Toxicosis in Bedlington Terriers in Australia—AJVR, vol. 65, Nov. 2004—pp. 1573-1579, 1452, 1453.
Illumina (Canine HD Bead Chip, 170K Chip, Data Sheet: DNA Genotyping, 2010). *
Ioannidis (Nature Genetics, vol. 29, pp. 306-309, Nov. 2001). *
Johnson, et al., "Inheritance of Copper Toxicosis in Bedlington Terriers", Am. J. Vet. Res., vol. 41, No. 11, pp. 1865-1866, Nov. 1980.
Jonasdottir, et al., "Genetic Mapping of a Naturally Occurring Hereditary Renal Cancer Syndrome in Dogs", Proc. Natl. Acad. Sci. USA 97, 4132 (Apr. 2000).
Karlin, et al., "Applications and Statistics for Multiple High-Scoring Segments in Molecular Sequences", Proc. Natl. Acad. Sci. USA vol. 90 pp. 5873-5877, Jun. 1993.
Kobayashi, et al., Mite Clinical, Japanese Journal of Small Animal Practice, 26(4), 2007, 232-234.
Kohler, et al., "Continuous Cultures of Fused Cells Secreting Antibody of Predefined Specificity", Journal of Immunology, Nature vol. 256 (5517): 495-497, Aug. 1975.
Korstanje, et al., "Mapping of Rabbit Chromosome 1 Markers Generated from a Microsatellite-Enriched Chromosome-Specific Library", Animal Genetics, 32, pp. 308-312, Feb. 2001.
Li, et al., "Construction and Characterization of an Eightfold Redundant Dog Genomic Bacterial Artificial Chromosome Library", Genomics, 58, 9 (Jan. 1999).
Lin, et al., "The Sleep Disorder Canine Narcolepsy is Caused by a Mutation in the Hypocretin (Orexin) Receptor 2 Gene", Cell, vol. 98, 365-376, Aug. 6, 1999.
Lingaas, et al., "Genetic Markers Linked to Neuronal Ceroid Lipofuscinosis in English Setter Dogs", Animal Genetics, Jun. 1998, 29, pp. 371-376.
Maddox, et al., "Elevated Serum Levels in Human Pregnancy of a Molecule Immunochemically Similar to Eosinophil Granule Major Basic Protein", J. Exp. Med. The Rockefeller University Press vol. 158, pp. 1211-1226, Oct. 1983.
Madsen et al., "Zebrafish mutants calamity and catastrophe define critical pathways of genenutrient interactions in developmental copper metabolism", PLOS Genetics, 2008, vol. 4, Issue 11, pp. 1-11.
Muller, "Endemic Tyrolean Infantile Cirrhosis: An Ecogenetic Disorder", Lancet 347, 877 (Mar. 1996).
Murphy et al. (Genbank Accession No. AY011436, Feb. 7, 2001 ).
Nabetani, et al., "Mouse U2af1-rs1 Is a Neomorphic Imprinted Gene", Molecular and Cellular Biology, Feb. 1997, vol. 17., No. 2. p. 789-798.
Noaker, et al., JAVMA, vol. 214, No. 10, pp. 1502-1506, 1999.
Ostrander, et al., "Canine Genetics Comes of Age", Trends Genet., 16, 117-24 (Mar. 2000).
Ostrander, et al., "Insights From Model Systems: Semper Fidelis: What Man's Best Friend can Teach Us about Human Biology and Disease", Am. J. Hum. Genet., 61:475-480, Jun. 1997.
Ostrander, et al., "Unleashing the Canine Genome", Genome Research, 10, 1271-4 (Sep. 2000).
PCT International Report on Patentability issued in International Application No. PCT/GB2008/003351, dated Apr. 7, 2010.
PCT International Report on Patentability issued in International Application No. PCT/GB2009/002355, dated Apr. 14, 2011.
PCT International Report on Patentability issued in International Application No. PCT/GB2010/000703, dated Jun. 16, 2010.
PCT International Search Report and Written Opinion issued in International Application No. PCT/GB2008/003351, dated May 27, 2009.
PCT International Search Report and Written Opinion issued in International Application No. PCT/GB2010/000703, dated Jun. 16, 2010.
PCT International Search Report issued in International Application No. PCT/GB2009/002355, dated Nov. 26, 2009.
Pena, et al., "A Delicate Balance: Homeostatic Control of Copper Uptake and Distribution", J. Nutr. 129, 1251-1260 (May 1999).
Poulsen, et al.—X-Linked Recessive Menkes Disease: Carrier Detection in the Case of a Partial Gene Deletion—2002, Denmark—Clinical Genetics—pp. 440-448.
Proschowsky, et al., "Microsatellite Marker C04107 as a Diagnostic Marker for Copper Toxicosis in the Danish Population of Bedlington Terriers", Acta. Vet. Scand., 2000: 41(4):345-50.
Rothuizen, et al., "Diagnostic Value of a Microsatellite DNA Marker for Copper Toxicosis in West-European Bedlington Terriers and Incidence of the Disease", Animal Genetics, Jan. 1999, 30, pp. 190-194.
Rothuizen, et al., "Tijdschr Diergeneeskd, Apr. 15, 1998 123(8): 246-52 (Abstract Only)."
Search Report issued in United Kingdom Application No. GB1120989.7, dated Mar. 30, 2012, 5 pgs.
Search Report issued in United Kingdom Application No. GB1120989.7, dated Mar. 30, 2012.
Shih et al., "Chronic hepatitis in Labrador retrievers: clinical presentation and prognostic factors", Journal of Veterinary Internal Medicine, 2007, vol. 21, Issue 1, pp. 33-39.
Shimizu et al., "Treatment and management of Wilson's disease", Pediatrics International, 1999, vol. 41, pp. 419-422.
Spee et al., "Copper metabolism and oxidative stress in chronic inflammatory and cholestatic liver disease in dogs", Journal of Veterinary Internal Medicine, 2006, vol. 20, Issue 5, pp. 1085-1092.
Spee, et al.—Differential Expression of Copper-Associated and Oxidative Stress Related Proteins in a New Variant of Copper Toxicosis in Doberman Pinschers—Comparitive Hepatology—Mar. 24, 2005—pp. 1-13.
Stuehler et al., "Analysis of the human homologue of the canine copper toxicosis gene MURR1 in Wilson disease patients", Journal of Molecular Medicine (Berlin), 2004, 82, p. 629-634.
Sutherland, "Copper Toxicosis in Sheep", JAVMA, vol. 180, No. 9, p. 984, Feb. 1982.
Sutter, et al., "Extensive and Breed-Specific Linkage disequilibrium in Canis Familiaris", Genome Res. 2004 14: 2388-2396.
Tanner, "Role of Copper in Indian Childhood Cirrhosis", Am. J. Clin. Nutr. 67, 1074S-1081S (May 1998).
Teske, et al., "Cytological detection of copper for the diagnosis of inherited copper toxicosis in Bedlington terriers, The Veterinary Record (1992), 131, 30-32."
Thornburg, "A Perspective on Copper and Liver Disease in the Dog", J. Vet. Diagn. Invest, Dec. 31, 2000, vol. 12, pp. 101-110.
Twedt, et al., "Clinical, Morphologic, and Chemical Studies on Copper Toxicosis of Bedlington Terriers", JAVMA, Aug. 1979, vol. 175, No. 3, pp. 269-275.
Van De Sluis, "Identification of a new copper metabolism gene by positional cloning in a purebred dog population," Human Molecular Genetics, 2002, vol. 11, No. 2, pp. 165-173.
Van De Sluis, et al., "Genetic Mapping of the Copper Toxicosis Locus in Bedlington Terriers to Dog Chromosome 10, in a Region Syntenic to Human Chromosome Region 2p13-p16", Human Molecular Genetics, 1999, vol. 8, No. 3, pp. 501-507.
Van De Sluis, et al., "Genetic Mapping of the Copper Toxicosis Locus in BedlingtonTerriers to Dog Chromosome 10, in a Region Syntenic to Human Chromosome Region 2P13-P16", Human Molecular Genetics, Oxford University Press, Surrey, GB, vol. 8, No. 3, Mar. 1999, 501-507.
Van De Sluis, et al., "Refined Genetic and Comparative Physical Mapping of the Canine Copper Toxicosis Locus", Mammalian Genome, 11, 455-460 (2000).
Van Den Ingh, et al., "Chronic Active Hepatitis with cirrhosis in the Dober Pinscher", The Veterinary Quarterly, vol. 10(2), 1998, 84-89.
Van Den Ingh, et al., "Possible Nutritionally Induced Copper-associated Chronic Hepatitis in Two Dogs", The Veterinary Record, Nov. 24, 2007, vol. 161, 728-9.
Wijmenga, et al., "Molecular regulation of copper excretion in the liver", Proceedings of the Nutrition Society, 63 (2004), pp. 31-39.
Wu, et al., "Canin Models for Copper Homeostasis Disorders", International Journal of Molecular Sciences, 2016, vol. 17, No. 196, 14 pgs.
Xia, "High-Quality Dog Breeding Manual", Hebei Science & Technology Press, 1st Ed. Jan. 31, 2009 (1 page).
Xiaoqing et al., English Abstract "Application of D13S301 Label in Diagnosis of Wilson Disease", Journal of Clinical Pediatrics, Oct. 20, 2002, vol. 20, No. 10, pp. 614-616.
Yuxin et al., "Preliminary Study on Mutations of Copper Transporting P-Type ATPase Gene in the Chinese", Journal of Fudan University (Natural Science), Oct. 1997, vol. 36, No. 5., pp. 517-523.
Yuzbasiyan-Gurkan, et al., "Microsatellite Markers for the Canine Genome", Canis familiaris STS microsatellite marker, Apr. 14, 1996, retrieved from EBI Database accession No. L7759, XP002248976 Abstract, 1 pg.
Yuzbasiyan-Gurkan, et al., "Linkage of Microsatellite Marker to the Canine Copper Toxicosis Locus in Bedlington Terriers", Am. J. Vet. Res. 58:23-27 (1996).
Zhao, "Human BAC Ends", Nucleic Acids Research, 2000, vol. 28, No. 1, pp. 129-132.
Zhi-Ying, et al., "Mutation analysis of 218 Chinese patients with Wilson disease revealed no correlation between the canine copper toxicosis gene MURR1 and Wilson disease", J. Mol. Med., 84(2006), pp. 438-442.

Also Published As

Publication number Publication date
AU2017251791A1 (en) 2017-11-16
AU2012349841A1 (en) 2014-07-10
EP2788502B1 (en) 2017-04-26
WO2013083988A2 (en) 2013-06-13
EP3653732B1 (en) 2023-05-24
RU2014127522A (ru) 2016-01-27
GB201120989D0 (en) 2012-01-18
JP2020171298A (ja) 2020-10-22
JP2015502152A (ja) 2015-01-22
JP6527205B2 (ja) 2019-06-05
CN103958700B (zh) 2017-03-08
EP2788502A2 (en) 2014-10-15
RU2018122073A (ru) 2019-03-06
US20220389506A1 (en) 2022-12-08
AU2020200211A1 (en) 2020-02-06
AU2020200211B2 (en) 2022-05-05
CN114085898A (zh) 2022-02-25
CN106957907A (zh) 2017-07-18
JP7057394B2 (ja) 2022-04-19
EP3216876B1 (en) 2019-11-06
JP2019165735A (ja) 2019-10-03
RU2746093C1 (ru) 2021-04-06
JP6231490B2 (ja) 2017-11-15
CN103958700A (zh) 2014-07-30
EP3216876A1 (en) 2017-09-13
EP3653732A1 (en) 2020-05-20
RU2707814C2 (ru) 2019-11-29
US20190062839A1 (en) 2019-02-28
EP4250298A3 (en) 2023-12-06
AU2012349841B2 (en) 2017-07-27
RU2018122073A3 (ru) 2019-03-28
EP4250298A2 (en) 2023-09-27
CN106957907B (zh) 2021-10-15
JP2018033464A (ja) 2018-03-08
RU2662660C2 (ru) 2018-07-26
US20140351962A1 (en) 2014-11-27
JP6728442B2 (ja) 2020-07-22
WO2013083988A3 (en) 2013-08-01

Similar Documents

Publication Publication Date Title
Pausch et al. Homozygous haplotype deficiency reveals deleterious mutations compromising reproductive and rearing success in cattle
US20220389506A1 (en) Genetic test for liver copper accumulation in dogs
US20080268436A1 (en) Schizophrenia, Schizoaffective Disorder and Bipolar Disorder Susceptibility Gene Mutation and Applications to Their Diagnosis and Treatment
US10829818B2 (en) Genetic test
WO2009060210A2 (en) Predictive test for adult dog body size
US10745757B2 (en) Compositions and methods for determining likelihood of an increased susceptibility to contracting Johne&#39;s disease
SE2330442A1 (en) Biomarkers for pyometra in dogs

Legal Events

Date Code Title Description
AS Assignment

Owner name: MARS, INCORPORATED, VIRGINIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MARTIN, ALAN JAMES;JONES, PAUL GLYN;WATSON, ADRIAN;AND OTHERS;SIGNING DATES FROM 20140728 TO 20170909;REEL/FRAME:044162/0193

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4