TWI793312B - Uses of liposomes encapsulating rice bran oil - Google Patents

Abstract

The invention provides a use of rice bran oil and liposome containing rice bran oil Use for a method for efficiently obtaining anti-aging skin effects. The invention is an anti-aging external skin composition containing rice bran oil (preferably a liposome containing rice bran oil).

Description

Uses of liposomes encapsulating rice bran oil

The present invention relates to a use of rice bran oil and a liposome containing rice bran oil and the like.

In recent years, especially in the field of cosmetics, there has been an increasing demand for compositions for external use that achieve anti-aging effects on the skin. Among them, the interest in suppressing wrinkles or sagging of the skin is very high.

As one cause of the formation of wrinkles or sagging in the skin, irradiation of the skin with light (ultraviolet rays, particularly long-wave ultraviolet rays (Ultraviolet A, UVA)) can be cited. It is believed that ultraviolet rays (especially UVA) in light reach the dermis, damage tissues through the generation of reactive oxygen species (Reactive Oxygen Species, ROS), and cause skin aging (such as hypertrophy of the epidermis, formation of deep and large wrinkles, or relaxation ) (Non-Patent Document 1). Therefore, it is expected that a component that has an antioxidant effect in the skin suppresses the generation of ROS, thereby suppressing skin aging.

In addition, the breakdown and reduction of dermal elastic or collagen fibers is associated with skin photoaging. Moreover, it is known that matrix metalloproteinase (Matrix Metalloproteinase, MMP) is associated with the decomposition of dermal structural components, especially MMP-1, MMP-2, and MMP-9, etc. make the type IV collagen constituting the basement membrane or the collagen constituting the dermis Elastin, collagen type I, and collagen type III break down. The above-mentioned MMP-2 and MMP-9 decompose dermal collagen or basement membrane, and the skin structure becomes unmaintainable, so that the skin is largely sunken, leading to the formation of deep wrinkles. In particular, it is also considered that MMP-2 or MMP-9 is derived from keratinocytes or fibroblasts by UV irradiation or ROS exposure (Non-Patent Document 1). In addition, it is also reported that MMP-1 is highly active in both naturally aged skin and photoaged skin, and is particularly active in photoaged skin (Non-Patent Document 2). Therefore, it is expected that among components that inhibit the generation of ROS, components that can also inhibit the derivative of MMP are particularly effective in anti-aging of the skin. [Prior art literature]

[Patent Document] [Patent Document 1] Japanese Patent Laid-Open No. 2007-246436

[Non-patent literature] [Non-Patent Document 1]: Shikoku Medical Journal, Vol. 63, Vol. 5, No. 6, No. 219-223, December 20, 2007 [Non-Patent Document 2]: Chung JH, Seo JY, Choi HR et al.: "Modulation of skin collagen metabolism in aged and photoaged human skin in vivo". J Invest Dermatol 117; 1218-1224: 2001

[Problem to be Solved by the Invention] An object of the present invention is to provide a method for efficiently obtaining an anti-aging effect on the skin. [Technical means to solve the problem]

The inventors of the present invention have found that rice bran oil is an excellent anti-aging raw material capable of suppressing not only ROS production but also MMP derivatives, and found that by encapsulating rice bran oil in liposomes (liposomes) for use, It is possible to obtain a more excellent anti-aging effect on the skin, and further improvements were made to complete the present invention.

The present invention includes, for example, the subjects described in the following items. Item 1. An anti-aging skin composition for external use, which includes liposomes wrapped with rice bran oil. Item 2. The composition according to item 1, wherein skin aging is wrinkles or sagging. Item 3. The composition according to item 1 or item 2, wherein skin aging is skin aging caused by light. Item 4. The composition according to any one of items 1 to 3, wherein the content of the rice bran oil contained in the liposome relative to the composition is 0.005% by mass or more and less than 1% by mass. Item 5. The composition according to any one of items 1 to 4, which is a cosmetic composition. [Effect of the invention]

According to the present invention, there is provided an external composition capable of achieving an excellent anti-aging skin effect.

Hereinafter, each embodiment of the present invention will be described in more detail.

The anti-aging skin composition included in the present invention is a composition for external use containing rice bran oil (preferably a composition for external use containing liposomes encapsulating rice bran oil). Hereinafter, the composition may be referred to as the anti-skin aging external composition of the present invention.

Liposomes are lipid vesicles having bimolecular membranes formed by hydrating lipids mainly composed of phospholipids with a large amount of water. Liposomes are classified according to the number of lipid molecular membrane layers, specifically, they are classified into multi-membrane liposomes (Multilamellar Vesicles, MLV) and single-membrane liposomes (Unilamellar Vesicles, ULVs). )). In addition, unilamellar liposomes are sometimes further classified according to the size of lipid vesicles. Specifically, they are classified into small unilamellar vesicles (Small Unilamellar Vesicle, SUV) and large unilamellar vesicles in ascending order. Large Unilamellar Vesicle (LUV), Giant Unilamellar Vesicle (GUV). In the present invention, liposomes may be any of them. MLVs are preferred. In the present invention, the size of liposomes is not particularly limited, but the average particle size is, for example, preferably 30 nm to 1000 nm, more preferably 30 nm to 600 nm, even more preferably 50 nm to 300 nm.

The rice bran oil is not particularly limited as long as it is obtained from rice bran. In the production of rice bran oil, a method of extracting rice bran with a solvent (for example, n-hexane) (solvent extraction method), a method of pressing rice bran with a pressing method (pressing method), and the like can be used. In the present invention, either solvent-extracted rice bran oil or pressed rice bran oil may be used, and pressed rice bran oil is particularly preferably used. The method of pressing treatment is well known, for example, it can be listed: using a low-temperature continuous pressing machine (for example, Miracle Chamber (Miracle Chamber) sold by Sigma Technology (Techno Sigma) Co., Ltd.) A method of pressing rice bran at about 115°C. The present invention is not limited thereto, and well-known pressing methods can be applied. The degree of pressing is not particularly limited, but the lipid in the pressed defatted rice bran becomes 5 wt% (weight percentage) to 15 wt%, preferably 5 wt% to 14 wt%, more preferably 5 wt% to 12 wt% %Degree.

In addition, a commercial item can also be used for rice bran oil. Examples of commercially available products include: Yanji Rice Bran Oil, Rice Oil Refined Oil, COME-YU (above, Sanwa Oils), Rice Bran Extract (Ricetrienol), Defatted Rice Bran (Riceterol Ester), Rice bran salad oil (above, Tsukino Foods), rice bran oil, rice oil (above, Oryza oil), etc.

In addition, it is known that γ-oryzanol is contained in rice bran oil. Usually, about 0.1 mass % - about 3 mass % of γ-oryzanol is contained in rice bran oil. The rice bran oil used in the present invention preferably contains about 0.1% by mass to 3% by mass of γ-oryzanol, more preferably contains 0.2% by mass to 2.5% by mass of γ-oryzanol, and still more preferably contains 0.3% by mass % to about 2% by mass of γ-oryzanol, and more preferably about 0.5% to 1.5% by mass of γ-oryzanol.

In the external composition containing liposomes containing rice bran oil, the amount of rice bran oil contained in liposomes is not particularly limited, but for example, relative to liposome membrane components (preferably phospholipids contained in liposomes) 10 parts by mass, for example, 0.4 to 6 parts by mass, about 1 to 5 parts by mass, or about 2 to 4 parts by mass.

In addition, in the anti-skin aging external composition of the present invention, it is preferable that the composition contains, for example, 0.005% by mass to less than 1% by mass, about 0.01% by mass to 0.8% by mass, 0.02% by mass to 0.5% by mass About, or about 0.05% by mass to 0.3% by mass of rice bran oil. Also, for example, about 0.005% to 0.05% by mass of rice bran oil is preferably contained, and especially when γ-oryzanol is contained in a state not encapsulated in liposomes, it is preferably contained at about 0.005% by mass to 0.05% by mass. The upper limit of the range may also be 0.01 mass%, 0.02 mass%, 0.03 mass%, or 0.04 mass%.

In addition, when the composition is an external composition containing liposomes containing rice bran oil, the content of the rice bran oil contained in the liposomes relative to the composition is preferably, for example, 0.005% by mass or more. At least 1% by mass, about 0.01% by mass to 0.8% by mass, about 0.02% by mass to 0.5% by mass, or about 0.05% by mass to 0.3% by mass. In addition, it is preferable that the rice bran oil contained in the composition is contained in, for example, 80% to 100% by mass, 90% to 100% by mass, or substantially 100% by mass of liposomes enclosing rice bran oil. . In addition, the fact that substantially 100% by mass of the rice bran oil contained in the composition is contained in rice bran oil-encapsulating liposomes means that when the composition is produced so that all of the rice bran oil is contained in liposomes, The case where rice bran oil is inevitably present outside the liposome is also included.

As a method for including rice bran oil in liposomes, a known method or a method that can be easily conceived from a known method can be used, and liposomes are usually obtained as a liposome dispersion in an aqueous solution, that is, a liposome suspension. The method for producing the liposome suspension is not particularly limited, and examples thereof include the following methods. (1) A method in which liposomes are formed by homogeneously mixing phospholipids, components contained in liposomes (including oryzanol; the same below), and other antioxidants if necessary, and then hydrating them (described in Hydration is preferably performed with an aqueous solution containing a pH adjuster, polyol, sugar, and the like). (2) Dissolving phospholipids, components encapsulated in liposomes, and other antioxidants as necessary in alcohols, polyols, etc., and hydrating with an aqueous solution containing pH adjusters, polyols, sugars, etc., and Methods of making liposomes. (3) A method of preparing liposomes by complexing phospholipids, components contained in liposomes, and other antioxidants as necessary in water using ultrasonic waves, a French press, or a homogenizer . (4) Mix and dissolve phospholipids, components contained in liposomes, and other antioxidants as needed in ethanol, add this ethanol solution to potassium chloride aqueous solution, remove ethanol, and prepare liposomes method. Rice bran oil can be used as it is, or after being dissolved in a small amount of solvent such as water or an aqueous solvent beforehand.

The phospholipids used are not particularly limited, but examples include soybean lecithin, rapeseed lecithin, corn lecithin, cottonseed oil lecithin, sunflower lecithin, egg yolk lecithin, protein lecithin, peanut lecithin, and the like. Lecithin, also known as phosphatidylcholine or 1,2-diacylglycerol-3-phosphocholine, usually has fatty acids bonded to the 1- and 2-positions of glycerol. In the present invention, for example, it is preferable to use lecithin having an unsaturated fatty acid with 12 to 24 carbon atoms bonded to both or one of the 1-position and 2-position, and it is more preferable to use lecithin having 12-24 carbon atoms bonded to the 1-position. 24 saturated fatty acids, and lecithin in which unsaturated fatty acids with 12 to 24 carbon atoms are bonded at the 2-position. Here, saturated fatty acid and unsaturated fatty acid may be either linear or branched. In addition, a lecithin derivative may be used instead of or in addition to lecithin. Examples of lecithin derivatives include hydrogenated lecithin and compounds obtained by introducing polyethylene glycol, amino polysaccharides, and the like into phospholipids in the above-exemplified lecithin. Among them, soybean lecithin, egg yolk lecithin, hydrogenated soybean lecithin, and hydrogenated egg yolk lecithin are preferred, and soybean lecithin and egg yolk lecithin are particularly preferred. In addition, lecithin can also be preferably used to improve the purity of phospholipids (such as phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylglycerol, sphingomyelin, etc.) Refined lecithin. These lecithins or lecithin derivatives may be used alone or in combination of two or more. The lecithin used in the present invention can also be commercially obtained from, for example, SLP-PC35 (phosphatidylcholine (hereinafter sometimes abbreviated as PC) content of 35%), SLP-PC70 (PC content of 70%), SLP-White Lyso (Lysolecithin) (above, manufactured by Tsuji Oil Co., Ltd.); egg yolk lecithin LPL-20S, LPL-20W (lysophospholipid content about 20%), egg yolk lecithin PL-30S (phosphatidylcholine content about 30%) (above, manufactured by Kewpie (stock)); soybean lecithin, egg yolk lecithin, phosphatidylcholine, phosphatidylserine, glycerophosphocholine (above, H. Holstein ( H.Holstein)); Lecigran (powder lecithin), Metarin (fractionated lecithin), Lecimulthin (powder lysolecithin) (above, Cargill ) company); Lecion P (Lecion P) (phospholipid content is more than 90%), Lecion LP-1 (lecithin content is about 70%), Lecimale (enzymatically decomposes lecithin, phospholipid content 50%) (above, manufactured by Riken Vitamin); Nichiyu PS25 (Nichiyu PS25) (phosphatidylserine content about 25%), Nichiyu PS50 (phosphatidylserine content about 50%); mulberry lecithin A-1 (San lecithin A-1) (enzymatically decomposed soybean lecithin, the content of lecithin is about 30%) and so on.

The anti-skin aging external composition of the present invention has an effect on skin aging, especially skin wrinkles or sagging, and can be preferably used for suppressing skin wrinkles or sagging. In addition, it can also be used for the purpose of suppressing skin aging caused by aging, but it can be used preferably for the purpose of suppressing skin aging caused by light. It can be preferably used for suppressing skin aging caused by irradiation of ultraviolet rays (especially UVA) in light.

In addition, the anti-skin aging external composition of the present invention can be preferably used as a composition for suppressing generation of active oxygen (ROS) and/or a composition for suppressing generation of matrix metalloproteinase (MMP). Among MMPs, MMP-1, MMP-2, and MMP-9 can be favorably exhibited MMP production inhibitory effect.

When the anti-skin aging external composition of the present invention is an external composition comprising liposomes encapsulating rice bran oil, the MMP production inhibitory effect on MMP-2 and MMP-9 can be exhibited particularly favorably. In addition, when the anti-skin aging external composition of the present invention is an external composition containing rice bran oil not encapsulated in liposomes, the MMP production inhibitory effect on MMP-1 can be exhibited particularly well.

For example, other components may be added to rice bran oil to be used as the anti-skin aging external composition of the present invention. In addition, for example, as the anti-skin aging external composition of the present invention, the liposome suspension may be used as it is, or may be used by adding other components to the liposome suspension.

As other components, for example, polymers, proteins and their hydrolyzates, mucopolysaccharides, and the like can be formulated. Examples of polymers include carboxyvinyl polymers, xanthan gum, sodium alginate, and the like, but are not limited to these polymers. Preferred are carboxyvinyl polymers, xanthan gum, particularly preferred are carboxyvinyl polymers. These polymers and the like can be used alone or in combination of two or more. The blending amount of the polymer is not particularly limited, but is 0.001% to 20%, preferably 0.005% to 10%, particularly preferably 0.01% to 5%. Examples of protein and its hydrolyzate include collagen, elastin, keratin, casein, their hydrolyzate, salt of hydrolyzate, ester of hydrolyzate, or those obtained by enzymatic treatment, and collagen is particularly preferable. The blending amount of protein and its hydrolyzate is not particularly limited, but is 0.001% to 5%, preferably 0.01% to 1%. Examples of mucopolysaccharides include chondroitin sulfate, hyaluronic acid, dermatan sulfate, heparan sulfate, mucoitin sulfate, heparin and its derivatives, and these salts etc., particularly preferably chondroitin sulfate, hyaluronic acid and their sodium salts. The compounded amount of mucopolysaccharide is not particularly limited, but is 0.0005% to 5%, preferably 0.001% to 1%.

In addition, well-known components (included in the continuous phase of the liposome dispersion liquid) that are usually used in external compositions can also be formulated within the range that does not impair the effects of the present invention. Examples of such components include humectants, water-soluble polymers, oil components, colorants, antioxidants, metal chelating agents, preservatives, pH adjusters, cooling agents, fragrances, ultraviolet absorbers and scatterers, antioxidants, medicinal ingredients, etc.

In addition, when the anti-skin aging external composition of the present invention contains liposomes containing rice bran oil, in the preparation process of liposomes, within the range that does not impair the effect of the present invention, it is also possible to use liposomes usually contained in liposomes. ingredients in. For example, antioxidants such as ascorbic acid, organic acids such as lactic acid and citric acid, lipids such as phosphatidylglycerol and phosphatidylethanolamine, natural polymers such as chitosan, fucoidan and hyaluronic acid, poly Synthetic polymers such as ethylene glycol and carboxyvinyl polymers, sugars such as trehalose, lactulose, and maltitol, polyalcohols such as glycerin, etc.

The composition for external use of the present invention is preferably used as a composition especially suitable for skin. As the composition for external use, for example, a pharmaceutical composition, a quasi drug composition, and a cosmetic composition are exemplified. The dosage form is not particularly limited, and examples thereof include facial masks, creams, ointments, creams, gels, lotions, lotions, lotions, lotions, sprays, and the like.

The target of application of the anti-skin aging external composition of the present invention is not particularly limited, but is preferably a person who desires anti-aging skin (in particular, suppression of wrinkles or sagging).

As described above, the anti-aging external composition of the present invention achieves the effect of inhibiting (especially reducing) reactive oxygen species (ROS) and/or inhibiting matrix metalloproteinase (Matrix Metalloproteinase, MMP) by enhancing the expression of antioxidant genes , thus play an anti-aging skin. Therefore, the present invention also includes: an external composition for enhancing antioxidant gene expression containing rice bran oil (preferably liposome containing rice bran oil), and an MMP inhibitor containing rice bran oil (preferably liposome containing rice bran oil) Composition for external use.

Examples of antioxidant genes include Nrf2 (NFE2 related factor 2), Nqo1 (NAD(P)H quinone oxidoreductase 1), HO-1 (heme oxygenase-1), and SOD1 (superoxide dismutase 1). Preferably at least one antioxidant gene selected from the group consisting of Nrf2, Nqo1, HO-1, and SOD1, particularly preferably Nrf2 gene and/or Nqo1 gene.

In addition, MMP-1, MMP-2, and MMP-9 are particularly preferably mentioned as the suppressed MMP.

In addition, Nrf2 is a transcription factor that is activated by active oxygen and the like, and controls the adaptive response to oxidative stress in higher animals collectively. Nrf2 enhances gene expression of glutathione S-transferase (GST) which is a detoxification enzyme of electrophilic substances, foreign body metabolizing enzymes such as Nqo1, glutathione synthase, etc. Detoxify. Heme oxygenase 1 (HO-1) is known to be derived from various acute stresses including oxidative stress, and is also one of Nrf2-targeted genes. Superoxide dismutase (Superoxide dismutase, SOD) is an enzyme that decomposes active oxygen that has been produced in cells. There are three types of SOD in mammals, and SOD1 exists in the cytoplasm.

In addition, in this specification, the term "comprising" also includes "consisting essentially of" and "consisting of" (The term "comprising" includes "consisting essentially of" and "consisting of."). Example

Hereinafter, although this invention is demonstrated more concretely, this invention is not limited to the following example. In addition, hereinafter, unless otherwise specified, % representing the proportion of components contained in the composition represents mass % (w/w %). The % of _CO2 concentration is v/v %. In addition, all the cells, medium, and medium-related reagents were purchased from commercial products and used.

Research on the Effect of Active Oxygen Generation by Ultraviolet Irradiation The effect of rice bran oil on the production of reactive oxygen species (hereinafter ROS) generated when fibroblasts were irradiated with ultraviolet rays (UVA) was evaluated.

<Materials used> ・Human skin fibroblasts from a 53-year-old woman (high density fiberboard (HDF) 53 below) ・Medium for HDF53: Minimum Essential Medium Eagle (Sigma-Aldrich (Sigma Aldrich), M4655) was prepared by adding 10 ^{% Fetal Bovine Serum (FBS) and 1% antibiotic substance (Gibco TM ,} 15240062). Hereinafter, it is also referred to as MEM (+). Phosphate Buffered Saline (PBS) (Sigma-Aldrich, D8537) Hank's Balanced Salt Solution (HBSS) (Sigma-Aldrich, H8264) 2',7'-di Chlorodihydrofluorescein Diacetate (2',7'-Dichlorodihydrofluorescein Diacetate, DCFH-DA) (Sigma-Aldrich) In addition, the DCFH-DA probe is dispersed in the cell and deacetylated by intracellular esterase Acylated to become non-fluorescent 2',7'-dichlorodihydrofluorescein (DCFH), and then rapidly oxidized by ROS, and changed into strongly fluorescent dichlorodihydrofluorescein (DCFH) DCF). Thus, the amount of ROS in the cells can be measured by the fluorescence intensity. Premix WST-1 (Premix WST-1) Cell Proliferation Assay System (TaKaRa Bio, MK400) (hereinafter WST-1) In addition, WST-1 is used for Reagent for the quantification of cell viability by chromogenic assay. Based on the conversion of tetrazolium salt (WST-1) to formazan dye by mitochondrial dehydrogenase in living cells, the total amount of mitochondrial dehydrogenase in the sample increases when the number of living cells increases. An increase in the activity of the enzyme leads to an increase in the production of formazan dye, and thus the formazan dye shows a linear correlation with the number of metabolically active cells in the culture medium.

<Experimental operation> HDF53 was inoculated in a 48-well plate at 1.2×10 ⁴ cells/well, and cultured in a 37°C, CO ₂ 5% incubator (incubator) for 3 days (use medium: MEM (+)) until it became until blended. After 3 days, MEM (+) was removed and washed once with HBSS, and then 300 μl of new HBSS was added to each well. The HDF53 was irradiated with UVA at 6000 mJ/cm ² . The HBSS was removed by suction and washed once with new PBS. 500 µl of MEM (+) containing 100 µg/ml of rice bran oil ("Yanhime Rice Bran Oil" manufactured by Sanwa Oil & Fat Co., Ltd. or manufactured by Tsukino Foods) was added to each well. Add 3 μl of 5 mM DCFH-DA (bis(acetylmethyl ester)(6-carboxy-2',7'-dichlorodihydrofluorescein diacetate)) to each well (final at a concentration of 30 μM). Incubate in a 37°C, CO ₂ 5% incubator for 30 minutes. The medium was removed by aspiration and washed once with PBS. Add 300 μl of fresh PBS to each well. Fluorescent intensity was measured at excitation 488 nm/emission 530 nm wavelengths using GEMINI XPS (Molecular Devices). Thereafter, the PBS was removed by suction, and 500 μl of MEM (+) containing 10-fold diluted WST-1 was added to each well, followed by incubation in a 37° C., CO ₂ 5% incubator for 2 hours. Absorbance at 450 nm was measured using an xMark Microplate Spectrophotometer (BIO RAD). This experiment was performed with N=3. In addition, MEM (+) not containing rice bran oil was used as a control (control).

The measured fluorescence intensity is shown in FIG. 1 . However, the fluorescence intensity shown in FIG. 1 is a value obtained by dividing the fluorescence intensity measured by GEMINI XPS by the cell viability and correcting it. In the study using WST-1, the cell viability was calculated by dividing the absorbance of each well measured by xMark by the average absorbance of the control not irradiated with UVA. In addition, the survival rate in the control substance not irradiated with UVA was set to "1". In addition, in FIG. 1 , + indicates p<0.1, * indicates p<0.05, and ** indicates p<0.01 (all by T-test).

Research on the effect of MMP-1 production caused by ultraviolet irradiation The effect of rice bran oil on the production of MMP-1 when fibroblasts were irradiated with ultraviolet rays (UVA) was evaluated.

<Materials used> ・Human skin fibroblasts from a 53-year-old woman (hereafter HDF53) ・Medium for HDF53: 10% FBS and 1% antibiotic (Gibco ^TM , 15240062) to prepare. Hereinafter, it is also referred to as MEM (+).・PBS (Sigma-Aldrich, D8537) ・HBSS (Sigma-Aldrich, H8264) ・Premix WST-1 Cell Proliferation Detection System (Bao Bioengineering, MK400) (hereinafter WST-1) ・Human Total Matrix Metalloproteinase-1 (Human Total MMP-1) (R&D systems (R&D systems), DY901B) *Enzyme Linked Immunosorbent Assay (ELISA) Kit for MMP-1 Detection ・DuoSet Ancillary Reagent Kit 2 (DuoSet Ancillary Reagent Kit2) (R&D System, DY008)

<Experimental operation> HDF53 was seeded in a 48-well plate at 1.2×10 ⁴ cells/well, and cultured in a 37°C, CO ₂ 5% incubator for 3 days (used medium: MEM (+)) until it became confluent. After 3 days, MEM (+) was removed and washed once with HBSS, and then 200 μl of new HBSS was added to each well. The HDF53 was irradiated with UVA at 8000 mJ/cm ² . HBSS was removed by suction and washed once with PBS. Add 500 μl of MEM (+) containing 50 μg/ml rice bran oil (manufactured by Sanwa Oil & Fat Co., Ltd. or _Tsukino Foods) to each well. Incubate for 72 hours. After 72 hours, the medium was recovered and centrifuged at 12000 rpm for 1 minute, and then stored at -30°C until the supernatant was recovered and used. In addition, the remaining medium in each well was removed by suction, and washed once with new PBS. 300 μl of MEM (+) containing 10-fold diluted WST-1 was added to each well, followed by incubation at 37° C. in a CO ₂ 5% incubator for 2 hours. After incubation, the absorbance at 450 nm was measured using an xMark microplate spectrophotometer (Bio-Rad). In addition, the concentration of MMP-1 in the culture supernatant obtained by centrifugation was determined according to the experimental operation procedure attached to the ELISA kit. In the determination of ELISA, the absorbance was measured at 450 nm by using an xMark microplate spectrophotometer (Bio-Rad).

This experiment was performed with N=3. In addition, MEM (+) not containing rice bran oil was used as a control.

The determined concentrations of MMP-1 are shown in FIG. 2 . However, the concentrations shown in FIG. 2 are values obtained by dividing the absorbance measured by xMark by the cell viability in the ELISA measurement and correcting it. In the study using WST-1, the cell viability was calculated by dividing the absorbance of each well measured by xMark by the average absorbance of the control not irradiated with UVA. In addition, the survival rate in the control substance not irradiated with UVA was set to "1". In addition, in Fig. 2, * means p<0.05, and ** means p<0.01 (both by T test).

Study on Antioxidant Gene Expression Using Normal Human Epidermal Keratinocytes (NHEK) (normal human epidermal keratinocytes; from newborns), whether the expression of antioxidant genes is due to γ-oryzanol contained in rice bran oil as an antioxidant Factors change for research. In addition, it was examined whether the expression of antioxidant genes was changed by liposomes containing γ-oryzanol or liposomes containing rice bran oil. In addition, all commercially available products (Kurabo Boshoku Co., Ltd. or Sigma-Aldrich) were purchased and used for cells, media, and media-related reagents.

＜Proliferation medium preparation method＞ Add 0.5 ml of insulin, 0.5 ml of human epidermal growth factor (human Epidermal Growth Factor, hEGF), 0.5 ml of hydrocortisol, Bovine Pituitary Extract (BPE) 2 ml, gentamicin/amphotericin B 0.5 ml (antibacterial agent). After mixing it slowly, it was stored at 4°C.

<How to thaw frozen NHEK cells and replace the medium> Thaw the ampoules containing the frozen NHEK cells in two vials in a thermostat at 37°C. After thawing, the cell solution was mixed in 6 ml of Humedia-KG2 medium at 4°C previously dispensed into a 15 ml tube. Transfer 39 ml of Humedia-KG2 medium previously thermostatted to 37°C into 13 ml of each of the three flasks. 2 ml of the mixed cell solution was transferred to an adherent cell culture flask (SUMILON, 250 mL), mixed so that the cells became uniform, and then allowed to stand temporarily. Culture was carried out in a 37°C, 5% _CO2 incubator. After the next day, the medium was replaced once a day until the cell density reached 80%.

<Method for subculture of NHEK cells> Aspirate the proliferation medium, add 5 mL of 4-hydroxyethylpiperazineethanesulfonic acid (HEPES) buffer solution thermostated at 37°C, and gently wash the cell layer. Aspirate the HEPES buffer, add 2 mL of 0.25% trypsin solution, and let stand in a 37°C, 5% CO _incubator for 3 minutes. Thereafter, the cells adhered to the bottom of the flask were peeled off (tap the edge of the flask to peel off the cells). 4 mL of a trypsin neutralizing solution thermostated at 37° C. was added thereto to stop the trypsin reaction. The cell suspension was recovered into a 50 ml falcon tube and centrifuged (RT, 1,000 rpm, 5 min). The supernatant was aspirated and mixed into 10 ml of Humedia-KG2 medium, and the number of cells was counted with a hemocytometer. Thereafter, the adherent cells were seeded in a 24-well plate so that the amount of the medium was 950 μL and the number of cells became 1.33×10 ⁵ . The next day, a medium change was performed.

＜How to add sample＞ The proliferation medium was aspirated, washed with 1 ml of PBS, and the sample (γ-oryzanol or bovine serum albumin (Bovine Serum Albumin, BSA)) mixed in 1 ml of Humedia-KB2 medium was added, and Incubate for 24 hours. In addition, γ-oryzanol was added so that the final concentration of γ-oryzanol in the medium became 10 μg/ml, 50 μg/ml, or 100 μg/ml. BSA was added so that the final concentration would be about 0.14%. γ-Oryzanol was purchased from Aoli Zhan Oil Chemical Co., Ltd. for use.

＜Cell recovery method＞ Aspirate the Humedia-KB2 medium and wash with 1 ml of PBS. PBS was aspirated, 350 μl of RLT (cell lysate) was added, and shaken for 3 minutes with a plate shaker. The 24-well plate was covered with vinyl tape and stored at -80°C.

＜Creation of complementary deoxyribonucleic acid (cDNA)＞ The 24-well plate was taken out from -80°C and thawed using a constant temperature bath. Add 350 μl of 70% ethanol (EtOH), and shake with a plate shaker for 3 minutes. Total ribonucleic acid (Ribonucleic acid, RNA) samples were extracted using RNeasy Mini Kit (Qiagen). The RNA concentration was measured using a NANODROP 2000 spectrophotometer (Thermo SCIENTIFIC), and the PrimeScript RT reagent Kit (PrimeScript RT reagent Kit) (Bao Biological Engineering Co., Ltd. ), make cDNA from about 500 ng of total RNA.

＜Real-time PCR＞ Add the primer (primer), ROX dye II and RNA-free water to 10 μl of Primix Ex Taq (Bao Bioengineering Co., Ltd.) to prepare 18 μl of the mixture, then add 2 μl (about 50 ng) of cDNA sample, for each primer Prepare samples for real-time PCR assays. As an endogenous control, select β-actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and as targeted antioxidant genes, select Nrf2, Nqo1, HO-1 , and SOD1. Expression analysis (relative quantification) of targeted genes was performed using real-time PCR standard 7500 (Applied Biosystems). The analysis results by the calibration curve method are shown in FIG. 3 . In addition, the results in Fig. 3 are the results of analysis using β-actin as an endogenous control. In addition, FIG. 3 shows the gene expression level ratio in each medium when the gene expression level in the BSA-added medium is set to 1. In addition, in Figure 3, +, ﹡, ﹡﹡, ﹡﹡﹡ respectively represent significant differences compared with the control (with BSA added) (+: P<0.1, ﹡: P<0.05, ﹡﹡: P< 0.01, ﹡﹡﹡: P<0.001)

In addition, the base sequence of each primer used for PCR is shown below. (F: forward primer, R: reverse primer) β-actin F: TTGTTACAGGAAGTCCCTTGCC R: ATGCTATCACCCTCCCCTGTGTG GAPDH F: GCACCGTCAAGGCTGAGAAC R: TGGTGAAGACGCCAGTGGA Nrf2 F: CTTGGCCTCAGTGATTCTGAAGTG R: CCTGAGATGGTGACAAGGGTTGTA Qo1 F: GGATTGGACCGAGCTGGAA R: AATTGCAGTGAAGATGAAGGCAAC HO-1 F: AAGACTGCGTTCCTGCTCAAC R:AAAGCCCTACAGCAACTGTCG SOD1 F: AGTGCAGGGCATCATCAATTTC R: CCATGCAGGCCTTCAGTCAG

＜Preparation of liposomes＞ The raw materials were mixed so as to become the composition (100% in total) shown in Table 1, and a high-pressure emulsifier (Starburst Mini HJP-25001: manufactured by Sugino Machine Co., Ltd.) was used at 200 Mpa to pass through five The following conditions were used to prepare liposome suspension (containing liposomes encapsulating γ-oryzanol). In addition, γ-oryzanol was purchased from Aoli Zhan Oil Chemical Co., Ltd. and used. As lecithin, soybean lecithin was purchased from NOF Co., Ltd. and used. Rice bran oil is purchased from Sanwa Oil & Fat Co., Ltd. "Yanji Rice Bran Oil" for use. In addition, the presence of the prepared liposome was confirmed by a transmission electron microscope HT7700 (HITACHI).

[Table 1] γ-Oryzanol rice bran oil Lecithin Propylene Glycol ethanol ion exchange water empty liposome - 4% 12% 7% Remnant Liposomes with gamma-oryzanol inside 0.5% - 4% 12% 7% Remnant Liposomes Encapsulated with Rice Bran Oil - 1% 4% 12% 7% Remnant

In the following studies, the obtained liposome suspensions (liposome suspension with 0.5% gamma oryzanol, liposome suspension with 1% rice bran oil, and empty liposome suspension) were used . In addition, liposome suspension containing 0.1% rice bran oil was prepared by diluting 1% rice bran oil liposome suspension 10 times with ion-exchanged water, which was also used in the following studies.

<Three-dimensional culture of cells> Three-dimensional skin models were produced using Epiderm 200X kit and EPI-100MM medium (both from Kurashiki Textile Co., Ltd.), which are tools for making three-dimensional (3D) skin models. Specifically, it was prepared using the Epiderm 200X kit by the following procedure. Add 500 μl of EPI-100MM thermostated to 37°C in advance to the 24-well plate of adherent cells. Move the insert cup with the three-dimensional skin model into the 24-well plate of adherent cells in such a way that air bubbles do not enter. Incubate in a 37°C, 5% CO ₂ incubator for 2 to 3 hours to make a 3D skin model.

＜Gene expression research＞ The sample (liposome suspension with 0.5% gamma oryzanol, liposome suspension with 1% rice bran oil, liposome suspension with 0.1% rice bran oil, or empty liposome suspension) 40 μl was added to the upper part of the 3D skin model and incubated for 24 hours. Thereafter, the medium was aspirated, taking care not to collapse the tissue, and at the same time, the upper part of the 3D skin model was washed three times with PBS. Cut out the 3D skin model and film from the built-in cup with a scalpel, and then peel off the film from the 3D skin model. The 3D skin model was placed in a cell storage tube, frozen with liquid nitrogen and stored at -80°C. Thereafter, RNA was extracted in the same manner as the method described above to prepare cDNA, and real-time PCR was performed to analyze gene (Nrf2 and Nqo1) expression. The analysis results obtained by the computer tomography (Computed tomography, Ct) method are shown in FIG. 4 . In addition, the results in Fig. 4 are the results of analysis using GAPDH as an endogenous control. In addition, in Fig. 4, + and * respectively represent significant differences compared with the control (empty liposome) (+: P<0.1, *: P<0.05).

＜Microarray Analysis＞ The expression of MMP-2 gene, MMP-9 gene and MMP-10 gene was studied by DNA microarray analysis using RNA of 3D skin model cells prepared as described above. As the DNA microarray, a DNA chip Genopal skin chip (Mitsubishi Chemical Co., Ltd.) was used. Table 2 shows the expression levels of RNA in 3D skin model cells cultured with addition of each sample when the correction value of the reference sample (ie, RNA of 3D skin model cells cultured with empty liposomes) was set to 1. The * on the upper right of the value in Table 2 indicates a significant difference (P<0.05) compared with the control (empty liposome).

[Table 2] MMP2 MMP9 MMP10 empty liposome 1 1 1 Liposomes with 0.5% gamma oryzanol inside 0.68 0.78 0.69 Liposomes encapsulated with 0.1% rice bran oil 0.50 ^﹡ 0.57 0.48 ^* Liposomes encapsulated with 1% rice bran oil 0.75 0.68 0.60

none

FIG. 1 shows the results of evaluating the effect of rice bran oil on the generation of reactive oxygen species (ROS) generated when fibroblasts were irradiated with ultraviolet rays (UVA). FIG. 2 shows the results of evaluating the effect of rice bran oil on the production of MMP-1 when fibroblasts were irradiated with ultraviolet rays (UVA). Figure 3 shows the use of real-time polymerase chain reaction (Polymerase Chain Reaction, PCR) to pass γ-Oryzanol to activate antioxidant genes (Nuclear Factor Erythroid 2 Related Factor 2, Nrf2), nicotinic acid Amine adenine dinucleotide phosphate: quinone oxidoreductase 1 (Nicotinamide Adenine Dinucleotide Phosphate quinone oxidoreductase 1, Nqo1), heme oxygenase-1 (Heme Oxygenase-1, HO-1), and superoxide dismutase 1 (Superoxide Dismutase 1, SOD1)) The results of the analysis of how the expression level changes. Fig. 4 shows the results of analyzing how the expression levels of antioxidant genes (Nrf2 and Nqo1) are changed by liposomes containing γ-oryzanol and liposomes containing rice bran oil by real-time PCR.

Claims (5)

A use of a liposome containing rice bran oil, which is used to manufacture an external composition for anti-aging skin, the content of the rice bran oil contained in the liposome relative to the external composition is 0.02% by mass~ 0.5% by mass. A use of a liposome containing rice bran oil, which is used to manufacture and inhibit the production of active oxygen in the skin, the production of matrix metalloproteinase-1, the production of matrix metalloproteinase-2 and/or the inhibition of matrix metalloproteinase-2 In the external use composition produced in 9, the content of the rice bran oil encapsulated in the liposome is 0.02% by mass to 0.5% by mass relative to the external use composition. The use of the liposome containing rice bran oil as described in item 1 of the scope of the patent application, wherein the skin aging is wrinkles or sagging. The use of liposomes enclosing rice bran oil as described in item 1 of the scope of the patent application, wherein skin aging is skin aging caused by light. The use of liposomes encapsulating rice bran oil as described in item 1 or item 2 of the patent application, wherein the composition for external use is a cosmetic composition.

Images