TWI729787B - Method for the discrimination of antrodia cinnamomea strains - Google Patents

Abstract

The present invention discloses a method for identifying Antrodia cinnamomea strains. The method comprises: providing a DNA fragment containing the RPB2 gene of an Antrodia cinnamomea strain; and using the DNA fragment to perform SNP gene with the RPB2 gene of an Antrodia cinnamomea strain for comparison Typing to detect the base differences at the SNP site of the RPB2 gene of the Antrodia cinnamomea strains. If there is at least one base difference at the SNP site, it means that the Antrodia cinnamomea strains are separate from each other. Strain.

Description

Method for identifying Antrodia cinnamomea strains

The present invention relates to a method for identifying Antrodia cinnamomea strains. The method comprises: providing a DNA fragment containing the RPB2 gene of an Antrodia cinnamomea strain; and using the DNA fragment for comparison with an Antrodia cinnamomea strain Single nucleotide polymorphism (SNP) genotyping [single nucleotide polymorphism (SNP) genotyping] for the RPB2 gene of the strains to detect the base differences at the SNP site of the RPB2 gene of the Antrodia If there is a base difference in at least one SNP site, it means that the Antrodia cinnamomea strains are different isolates from each other.

Antrodia cinnamomea (Antrodia cinnamomea) (Chinese aliases are Antrodia camphora, Antrodia camphorata, Antrodia camphora, Antrodia camphora, Antrodia camphora, Cinnamomum camphora and Antrodia camphora; the synonym of Taiwanofungus camphoratus, Antrodia camphorata, and Ganoderma comphoratum ) is a porous fungus A fungus of the Antrodia family (Polyporaceae). The fruit body (fruit body) has variable morphology (including plate-like and horseshoe-like). It is bright red when it is born, and gradually becomes reddish brown, light brown or light yellow Brown, mainly grown on the high-altitude camphor tree ( Cinnamomum kanehirai ) in Taiwan. Studies have pointed out that the fruiting bodies and mycelium of Antrodia cinnamomea are rich in polysaccharides, triterpenoids and alkaloids and other active ingredients, and they have been revealed to have antioxidants. , Antitumor, antiviral, antibacterial, and anti-inflammation biological activity, which has attracted much attention in the biomedical industry and food industry.

Since different isolates may have considerable differences in the type and intensity of biological activity, relevant researchers in the field are dedicated to isolating and screening isolates with desired activities. In order to identify whether the Antrodia cinnamomea strain obtained is a novel isolate, or to verify whether the purchased Antrodia cinnamomea product is indeed the isolate claimed by the industry, how to accurately identify the Antrodia cinnamomea strain has become an important research and development topic. Traditionally, the identification of Antrodia cinnamomea is mostly based on morphological observation, followed by identification of physiological or biochemical characteristics as a supplement. However, Antrodia cinnamomea may affect its appearance characteristics due to the difference in culture environment or conditions, so that the reliability and accuracy of the analysis results obtained when using traditional methods to identify Antrodia cinnamomea are not high.

Generally speaking, the genomic DNA sequence of fungi contains highly conserved and highly variable DNA sequences, which may be available for genus-specific and species-specific (species-specific) or isolate-specific (isolate-specific) identification or identification. Studies have shown that ribosomal RNA genes (ribosomal RNA genes) have internal transcribed spacers (ITS), intergenic spacers (IGS), and nuclear ribosomal large subunits (nrLSU). ) Has a high degree of variability among species of fungi, so it can be used to analyze the phylogenetic relationships of fungi to distinguish different species (White TJ et al. (1990), PCR Protocols: A Guide to Methods and Applications , 315-322; Vilgalys R. and Hester M. (1990), J. Bacteriol ., 172: 4238-4246).

DNA-directed RNA polymerase II subunit (RPB2) is a nuclear gene encoding the second largest subunit of RNA polymerase II (the second largest subunit of RNA polymerase II). ), the 12 highly conserved regions it contains have more than 85% identity between fungi. Therefore, there have been studies on applying the RPB2 gene to the identification of fungi. For example, in Sung GH et al . (2007), Stud. Mycol ., 57: 5-59, Sung GH et al. used RPB2, RPB1, nrLSU, nuclear ribosomal small subunit (nrSSU), Elongation factor 1-α (elongation factor 1-α, EF1-α), β-tubulin (β-tubulin), and mitochondrial ATP6 (mitochondrial ATP6, atp6) have 5 to 7 genes to target Cordyceps) to analyze genetic relationship with ergot (Clavicipitaceae), which will take Cordyceps segment and reclassified into the following four genera: Cordyceps (Cordyceps), deer Cordyceps (Elaphocordyceps), different Cordyceps ( Metacordyceps and Ophiocordyceps ; and reclassification and division of Clavicepsaceae into the following three families: Clavicipitaceae, Ophiocordycipitaceae and Cordycipitaceae .

For Antrodia cinnamomea, studies have tried to use ITS to identify Antrodia cinnamomea strains. For example, TW 200912001 A discloses a method for identifying Antrodia cinnamomea strains, which mainly uses restriction enzyme Bvb I to cut the amplified product of the ITS gene of a strain, and judge whether it is an Antrodia cinnamomea strain by whether it can be cut or not. , Or other strains of the same genus and different species. In the example of this patent application, it was also discovered that the restriction enzyme Sap I was used to cut the amplified product of the ITS gene, and the ability to cut the amplified product of the ITS gene could not be used to distinguish 6 Antrodia cinnamomea strains from different sources.

Although the above-mentioned literature reports have existed, as far as the applicant knows, there is no literature or patent precedent that has disclosed that the RPB2 gene can be used to identify strains of Antrodia cinnamomea species. Therefore, in the present invention, the applicant unexpectedly discovered that by comparing the base differences in the RPB2 gene of Antrodia cinnamomea strains [ie, single nucleotide polymorphism (single nucleotide polymorphism, SNP)], the Antrodia cinnamomea strains Genotyping can effectively identify different Antrodia cinnamomea isolates.

Summary of the invention

Therefore, the present invention provides a method for identifying Antrodia cinnamomea strains. The method comprises: providing a DNA fragment containing the RPB2 gene of an Antrodia cinnamomea strain; and performing comparison between the DNA fragment and the RPB2 gene of an Antrodia cinnamomea strain for comparison. SNP genotyping is used to detect the base differences in the SNP site of the RPB2 gene of the Antrodia cinnamomea strains. If there is at least one base difference in the SNP site, it means that the Antrodia cinnamomea strains are different from each other Of isolates.

The above and other objects, features and advantages of the present invention will become apparent with reference to the following detailed description and preferred embodiments.

Detailed description of the invention

It should be understood that if any previous case publication is quoted here, the previous case publication does not constitute a recognition: in Taiwan or any other country, the previous case publication forms a common general in the art. Part of knowledge.

For the purpose of this specification, it will be clearly understood that the word "comprising" means "including but not limited to", and the word "comprises" has a corresponding meaning.

Unless otherwise defined, all technical and scientific terms used in this article have meanings commonly understood by those familiar with the art of the present invention. A person familiar with the art will recognize that many methods and materials similar or equivalent to those described herein can be used to implement the present invention. Of course, the present invention is by no means restricted by the described methods and materials. For clarity, the following definitions are used in this article.

As used herein, terms such as "nucleic acid", "nucleic acid sequence" or "nucleotide sequence" mean deoxyribonucleotides sequences or ribonucleotides in single-stranded or double-stranded form. ) Sequence, which contains known naturally occurring nucleotides or artificial chemical mimics. As used herein, the term "nucleic acid" can be used interchangeably with "gene", "DNA", "cDNA", "mRNA", "oligonucleotide" and "polynucleotide".

As used herein, the terms "DNA fragment" and "nucleic acid fragment" are used interchangeably and mean a DNA polymer that is in the form of a separate segment Or as a component of a larger DNA construct, which can be derived from isolated DNA or chemically modified by methods well known in the art. Or the synthesis of enzymes.

Unless otherwise specified, in addition to the specific sequences disclosed herein, a nucleotide sequence also encompasses its complementary sequences, as well as their conservative analogs, and related naturally occurring structural variations. Body and/or synthetic non-naturally occurring analogues.

As used herein, the term "single nucleotide polymorphism (SNP)" can be used with "SNP site", "SNP position" and "SNP locus". locus" is used interchangeably, and means a single nucleotide (A, T, C, or G) in the genome that exists between different isolates of Antrodia cinnamomea (DNA sequence variation). . The variation of the DNA sequence may be caused by the substitution (including transition and transformation), insertion or deletion of the single nucleotide.

Traditionally, morphological observations are used to identify Antrodia cinnamomea species. However, the appearance characteristics of Antrodia cinnamomea are easily affected by the culture environment or conditions, so that the analysis results obtained have inaccurate problems. Therefore, how to accurately identify Antrodia cinnamomea strains has become an important research and development topic. Molecular biology methods [such as polymerase chain reaction (PCR)] have the advantages of fast speed, high reliability and accuracy of analysis results, therefore, the applicant is committed to the development of identification methods in this area, and Try to find a single nucleotide polymorphism (SNP) site from the nucleotide sequence of the DNA-directed RNA polymerase II subunit (RPB2) gene for identification purposes.

In the present invention, the applicant used 16 Antrodia cinnamomea strains from different sources as test strains, and then sequenced the RPB2 genes of these test strains. The nucleotide sequences of the RPB2 genes of the 16 test strains obtained by sequencing were found by SNP genotyping: the SNP in the RPB2 gene can be effectively used to distinguish different Antrodia cinnamomea isolates.

Therefore, the present invention provides a method for identifying Antrodia cinnamomea strains, the method comprising: Provide a DNA fragment containing the RPB2 gene of an Antrodia cinnamomea strain; and The DNA fragment was used for SNP genotyping with the RPB2 gene of an Antrodia cinnamomea strain for comparison, so as to detect the base differences at the SNP site of the RPB2 gene of the Antrodia cinnamomea strains. Wherein, if there is a base difference in at least one SNP site, it means that the Antrodia cinnamomea strains are different isolates from each other.

According to the present invention, the bases at the SNP site of the RPB2 gene of the Antrodia cinnamomea strain for comparison can be known (for example, disclosed in any published literature or database) or detected in advance. Alternatively, the bases at the SNP site of the RPB2 gene of the Antrodia cinnamomea strains can be detected at the same time.

Preferably, the Antrodia cinnamomea strains for comparison are selected from the group consisting of: BCRC 35396, BCRC 35398, BCRC 37609, BCRC 37941, and combinations thereof.

According to the present invention, the SNP genotyping can be performed by using at least one of the following methodologies: sequencing [such as pyrosequencing and next generation sequencing (NGS)], restriction Fragment length polymorphism analysis (restriction fragment length polymorphism, RFLP), oligonucleotide ligation assay (OLA), molecular beacon, 5'-nuclease assay (5'-nuclease assay) , Dynamic allele-specific hybridization (DASH), SNP microarray (SNP microarray), DNA-DNA hybridization (DNA-DNA hybridization), and denaturing gradient gel electrophoresis (DGGE) ).

Preferably, the SNP genotyping is performed by sequencing.

According to the present invention, the amplification reaction of the RPB2 gene and/or the extraction of genomic DNA can be carried out before the sequencing, and the operating procedures and parameter conditions of these treatments are based on the professionalism and quality of those who are familiar with this technology. Within the scope of routine technology. According to the present invention, the amplification reaction of the RPB2 gene can be performed by using any known or self-designed primer pair that can be used to amplify the RPB2 gene. In a preferred embodiment of the present invention, the primer pair includes a forward primer with a nucleotide sequence as shown in the sequence identification number: 1 and a nucleoside with a nucleotide sequence as shown in the sequence identification number: 2 Reverse primer for acid sequence.

According to the present invention, the base difference at the at least one SNP site may have a nucleotide residue position selected from the following RPB2 genes: 16, 21, 22, 25, 31, 34, 40, 76, 79 , 80, 81, 82, 83, 85, 91, 93, 100, 101, 107, 113, 114, 115, 175, 244, 253, 256, 295, 337, 349, 403, 409, 418, 424, 440 , 463, 475, 481, 484, 508, 541, 547, 661, 673, 682, 685, 725, 727, 754, 775, 796, 799, 832, 844, 877, 922, 1066, 1078, 1085, 1089 , 1096, 1102, 1105, 1108, 1113, and combinations thereof.

Preferably, the base difference at the at least one SNP site is the presence of a nucleotide residue position selected from the following RPB2 genes: 16, 25, 31, 34, 76, 79, 80, 81, 82 , 83, 93, 100, 101, 107, 113, 114, 115, 295, 349, 409, 418, 463, 475, 484, 508, 661, 673, 685, 725, 727, 754, 775, 796, 799 , 922, 1066, 1078, 1105, and combinations thereof.

According to the present invention, the nucleotide residue positions of the above-mentioned RPB2 gene may vary with the nucleotide sequence variation [for example, insertion, deletion or truncation] of the RPB2 gene of different Antrodia cinnamomea strains. . As used herein, the nucleotide residue positions of the RPB2 gene are based on the nucleotide sequence of the RPB2 gene of Antrodia cinnamomea BCRC 35396 (Sequence ID: 7).

According to the present invention, the RPB2 gene used for SNP genotyping can be full-length, essentially full-length, or partial, as long as it is sufficient to confirm whether the RPB2 gene is at least A base difference at a SNP site. Specifically, the DNA fragment containing part of the RPB2 gene can be first detected to detect whether there is a base difference at the SNP site, and preferably, the nucleotide residue position of the following RPB2 gene can be detected first To detect one or more fragments of: 16, 25, 31, 295, 349, 418, 463, 475, and 1105 (for example, a fragment containing nucleotide residue positions 16 to 475). In a preferred embodiment of the present invention, the following nucleotide residue positions of the RPB2 gene can be detected first: 16, 25, 31, 295, 349, 418, and 1105. In another preferred embodiment of the present invention, the following nucleotide residue positions of the RPB2 gene can be detected first: 16, 25, 31, 295, 349, 463, and 1105. In yet another preferred embodiment of the present invention, the following nucleotide residue positions of the RPB2 gene can be detected first: 16, 25, 31, 295, 349, 475, and 1105. If no base difference at any SNP site is detected, the length of the detected RPB2 gene fragment can be gradually increased until the full length of the RPB2 gene is detected.

The method according to the present invention can be used in combination with traditional Antrodia cinnamomea identification techniques [for example, morphological observation, index component analysis, and gene alignment, etc.], or with other genotyping techniques for different target genes [for example, Microsatellite genotyping (microsatellite genotyping), RFLP, OLA, DASH, SNP microarray, and DGGE, etc.] are used in combination, and the target genes that can be used include, but are not limited to: internal transcribed spacer (ITS), nucleus Nuclear ribosomal large subunit (nrLSU), and elongation factor 1-α (EF1-α). Detailed description of the preferred embodiment

The present invention will be further described with respect to the following embodiments, but it should be understood that these embodiments are for illustrative purposes only, and should not be construed as limitations on the implementation of the present invention. EXAMPLES Example 1. Antrodia (Antrodia cinnamomea) of different SNP target gene to assess the ability to identify the strain of Antrodia

In order to evaluate the DNA-directed RNA polymerase II subunit (RPB2), internal transcribed spacer (ITS) and nuclear ribosomal large subunit (nrLSU) of Antrodia cinnamomea The SNP of) is useful for identifying Antrodia cinnamomea strains from different sources, and the following experiment was carried out. Experimental materials: 1. The fruit bodies of the 13 Antrodia cinnamomea strains used in the following experiments were obtained from the biological resource preservation and research of the Food Industry Research and Development Institute (FIRDI) in Taiwan Center (Biosource Collection and Research Center, BCRC) (300, No.331 Food Road, Hsinchu City, Taiwan), these strains include: Antrodia cinnamomea BCRC 35396, 35398, 35716, 36401, 36795, 36799, 37609, 37616, 37848, 37889, 37893, 37941 and MU30118. 2. The fruit bodies of the three Antrodia cinnamomea strains BCRC 38806, 13M0049 and 13M0052 used in the following experiments were collected from the mountainous areas of Zhongli, Taitung and Hualien, respectively. 3. The 3 sets of primer pairs RPB2-5F/RPB2-7.1R, V9G/LR1 and LROR/LR5 used in the following experiments are based on the sequences of RPB2, ITS and nrLSU of Antrodia cinnamomea as the target genes and refer to Liu YJ et al. . (1999), Mol. Biol. Evol ., 16: 1799-1808, Matheny PB (2005), Mol. Phylogenet. Evol. , 35: 1-20, AHG Gerrits van den Ende and GS de Hoog (1999), Stud. Mycol ., 43:151-162 and Vilgalys R. and Hester M. (1990), J. Bacteriol ., 172:4238-4246 were designed and entrusted to Youhe Trading Co., Ltd. The company will do it for synthesis. For clarity, relevant information about these primer pairs (including: nucleotide sequence, size of amplified PCR product, and references) has been integrated in Table 1 below. Table 1. Primers used to detect Antrodia cinnamomea strains and their references Target gene Nucleotide sequence (5'→3') PCR product size (bp) references RPB2 Forward primer RPB2-5F gaygaymgwgatcayttygg (Sequence ID: 1) 1,123 Liu YJ et al . (1999) (same as above) Reverse primer RPB2-7.1R cccatrgcytgyttmcccatdgc (Sequence ID: 2) Matheny PB (2005) (same as above) ITS Forward primer V9G ttacgtccctgccctttgta (Sequence ID: 3) 794 AHG Gerrits van den Ende and GS de Hoog (1999) (same as above) Reverse primer LR1 ggttggtttcttttcct (Sequence ID: 4) Vilgalys R. and Hester M. (1990) (same as above) nrLSU Forward primer LROR acccgctgaacttaagc (Sequence ID: 5) 925 Vilgalys R. and Hester M. (1990) (same as above) Reverse primer LR5 tcctgagggaaacttcg (Sequence ID: 6) Vilgalys R. and Hester M. (1990) (same as above) Note: For the nucleotide sequence of primer pair RPB2-5F/RPB2-7.1R, the symbol y represents t/u or c; the symbol m represents a or c; the symbol w represents a or t/u; the symbol r represents g or a; and the symbol d represents a or g or t/u. experimental method:

First, the fruit bodies of the 16 Antrodia cinnamomea strains described in Items 1 and 2 of the above "Experimental Materials" were cut into pieces (about 0.5 cm ^{3 in} volume), and then inoculated on Malt Extract Agar (MEA) Plate [malt extract agar (MEA) plate] (purchased from Merck), and cultured at room temperature for 14 days. Then, NucleoSpin ^® Plant II (MACHEREY-NAGEL GmbH & Co. KG) was used to extract the genomic DNA of the Antrodia cinnamomea strain according to the operating instructions provided by the manufacturer.

Specifically, about 100 mg of dikaryotic mycelium formed on the MEA culture plate was scraped and placed in a 2 mL microtube, and then 400 μL of PL1 buffer and 0.05 were added. g Chelex resin, followed by grinding. Next, 10 μL of ribonuclease A (RNase A) was added to the formed grind and mixed uniformly, and then heated in a dry bath with a temperature set to 65°C for 10 minutes, followed by 13,000 Centrifugation at rpm lasted 2 minutes. After that, the supernatant was collected and placed in a NucleoSpin ^® filter (NucleoSpin ^® filter), followed by centrifugation at 13,000 rpm for 2 minutes, and then aspirated the obtained filtrate into a 1.5 mL microcentrifuge tube Then, add 450 μL of phosphatidylcholine (PC) buffer [phosphatidylcholine (PC) buffer] and mix well. Next, put a NucleoSpin ^® Plant II column (NucleoSpin ^® Plant II column) into a collection tube, and transfer 700 μL of the mixture to the column, and then centrifuge at 13,000 rpm for a period of time 1 minute. After removing the eluate, the column was put back into the collection tube and 400 μL of PW1 buffer was added, followed by centrifugation at 13,000 rpm for 1 minute. After removing the eluate, the column was put back into the collection tube and 650 μL of PW2 buffer was added, followed by centrifugation at 13,000 rpm for 1 minute. After removing the eluate, put the column back into the collection tube and add 200 μL of PW2 buffer, and then centrifuge at 13,000 rpm for 2 minutes. Finally, put the column into a new collection tube, then add 50 μL of PE buffer and heat it in a dry bath set at 70°C for 5 minutes, and then centrifuge at 13,000 rpm for a period of time One minute to elute the genomic DNA of the Antrodia cinnamomea strain.

Use the obtained genomic DNA as a template, and use the primer pairs RPB2-5F/RPB2-7.1R, V9G/LR1, and LROR/LR5 as described in item 3 of the "Experimental Materials" above for polymerase Chain reaction (polymerase chain reaction, PCR), and the reaction conditions related to PCR are shown in Table 2 below. Table 2. Reaction conditions for PCR Contents Volume (µL) Genomic DNA (100 ng/µL) 2 Forward primer (10 µM) 0.5 Reverse primer (10 µM) 0.5 O'in 1 DNA polymerase premix (2X) (contains 100 U/µL YEAtaq DNA polymerase and 0.4 mM dNTPs) 12.5 Pure water 9.5 Operating conditions: denaturation at 94°C for 10 minutes; followed by 35 cycles as follows: denaturation at 94°C for 30 seconds, primer annealing at 50°C for 1 minute The extension reaction (extension) was performed at 72°C for 1 minute; finally, the elongation reaction (elongation) was performed at 72°C for 5 minutes.

After completing the PCR, the 48 PCR amplification products obtained were respectively used for 1.2% agarose gel electrophoresis (agarose gel electrophoresis) to confirm whether the PCR products of the predetermined size as shown in Table 1 above can be obtained . Next, the confirmed PCR product was recovered and purified from the gel, and was entrusted to Tri-I Biotech, Inc. for sequencing, and the sequencing results obtained were obtained using the NCBI website The provided Gene Blast software was used for comparison and analysis to obtain the nucleotide sequences of the full-length RPB2, ITS and nrLSU genes of the 16 Antrodia cinnamomea strains. When the sequenced bases are represented by the symbols y, r, w, m, s, and k, they represent that the corresponding nucleotide residue positions on the two sets of chromosomes have the two types shown in Table 3 below. Base. Table 3. Two kinds of bases represented by different symbols symbol Base y t c r g a w t a m c a s c g k g t

Next, use BioEdit software and ClustalW software to perform multiple sequence alignment analysis on the nucleotide sequences of the RPB2, ITS, and nrLSU genes of the 16 Antrodia cinnamomea strains to detect and identify these three genes. Single nucleotide polymorphism (SNP). Afterwards, the genetic variation of SNPs located in the RPB2, ITS and nrLSU genes among the 16 Antrodia cinnamomea strains were analyzed to perform genotyping of the Antrodia cinnamomea strains. result:

Table 4 below shows the results of genotyping by comparing the genetic variation of SNPs in the RPB2 gene of 16 Antrodia cinnamomea strains. It can be seen from Table 4 that there are 64 SNPs in the RPB2 gene, which are located at nucleotide residue positions 16, 21, 22, 25, 31, 34, 40, 76, 79 to 83, 85, 91, 93, 100. , 101, 107, 113 to 115, 175, 244, 253, 256, 295, 337, 349, 403, 409, 418, 424, 440, 463, 475, 481, 484, 508, 541, 547, 661, 673 , 682, 685, 725, 727, 754, 775, 796, 799, 832, 844, 877, 922, 1066, 1078, 1085, 1089, 1096, 1102, 1105, 1108 and 1113 [RPB2 of Antrodia cinnamomea BCRC 35396 The nucleotide sequence of the gene (sequence identification number: 7) is the basis]. Based on the base differences of the SNPs, 16 Antrodia cinnamomea strains can be distinguished into 16 genotypes. This means that the SNP in the RPB2 gene can be effectively used to distinguish different Antrodia cinnamomea isolates. BCRC 38806 BCRC 37941 BCRC 37893 BCRC 37889 BCRC 37609 BCRC 36795 BCRC 36401 BCRC MU30118 BCRC 37848 BCRC 37616 BCRC 35716 BCRC 35398 BCRC 13M0052 BCRC 36799 BCRC 13M0049 BCRC 35396 Strains Table 4. SNP sites on the RPB2 gene of each Antrodia cinnamomea strain-continuation table 4-continuation table 4-continuation table 4 t y y t t t t c t t t y c y y t 16 Nucleotide residue position Nucleotide residue position Nucleotide residue position Nucleotide residue position t t t t t t t t y t t y t t t t twenty one c y c y y c y y y c y c c y c c twenty two t c y y y t y y y t y y c c y t 25 g a r r r g r r r g r r a a r g 31 t y t y y t y c y t y t t y t t 34 g r g r r g r g r g r g g r g g 40 t w w t t t t t t t t w a w w t 76 c y y c c c c c c c c y t y y c 79 g r r g g g g g g g g r a r r g 80 c y y c c c c c c c c y t y y c 81 t y t t t t t t t t t t c y y t 82 c y c c c c c c c c c c t y y c 83 Nucleotide residue position -Continued from Table 4- a w a w w a w t w a w a a w a a 85 c m m c c c c c c c c m a m m c 91 c y c c y c y y y c y c c y c c 93 c m m c c c c c m c c m a m m c 100 g r r g g g g g r g g r a r r g 101 c y y c c c c c c c c y t y y c 107 t y y t t t t t t t t y c y y t 113 c s s c c c c c c c c s g s s c 114 g k k g g g g g g g g k t k k g 115 t y t y y t y y y t y t t y t t 175 a a r r a a r a a a r a a a a a 244 t t t t t t t t t y t t t t t t 253 g g g g g r g g g g g g g g g g 256 a r r g r a g r r r g a a r a a 295 c c c c c c y y c c c c c c c c 337 g r r a g g a r g g a g g g g g 349 Nucleotide residue position -Continued from Table 4- c c c c c c y y c c c c c c c c 403 a r g g r a r a r r g a a r r g 409 c y t y y y y c c y y c c c y t 418 t t t t y y t t t t t t t t t t 424 t t t t t t t t t y t t t t t t 440 t y c y y y y t t y y t t t y c 463 g r a r r r r g g r r g g g r a 475 m c c c c c c m c m c c c m c c 481 c y t y c c y c c y y c c c y t 484 g g g g k k g g g g g g g g g g 508 a a a a r r a a a a a a a a a a 541 c c c c y y c c c c c c c c c c 547 y y y y t y c y t y y y c t y c 661 t y t t c y t y t y t t t c t t 673 g r g g r r g g g r g g g r g g 682 r r r r g r r r g r r g a g r a 685 Nucleotide residue position -Continued from Table 4- t y y t c y t y t y t c t c y t 725 r r r r a r r r a r r a a a r g 727 y y y y c y y t c y y c c c y t 754 r r r r a r r r a r r a a a r g 775 y c c y c c y c t c y c t c c c 796 y y y y c y y y c y y c c c y t 799 a w a a w w a a a w a a a w a a 832 c y c c y y c c c y c c c y c c 844 r r r r g r r r g r r g g g r a 877 y c c y y y y c t y y y t y y t 922 c c c c c c c c c y c c c c y t 1066 y t t y y y y c t y y y c y t t 1078 a a a a a a a a r a a a a a a a 1085 c c c c s c c c c c c c c s c c 1089 t t t t t t t t t t t w t t t t 1096 a a a a a a a a a r a a a a a a 1102 Nucleotide residue position -Continued from Table 4- y t y y y y y c t y c y c y t t 1105 g g g g r g g g g g g g g r g g 1108 c c c c y c c c c c c c c y c c 1113

Table 5 below shows the results of genotyping by comparing the genetic variation of SNPs in the ITS genes of 16 Antrodia cinnamomea strains. It can be seen from Table 5 that there are 25 SNPs in the ITS gene, which are located at nucleotide residue positions 310, 333, 367, 591, 597, 643, 677, and 682 to 699 [The ITS gene of Antrodia cinnamomea BCRC 37941 Nucleotide sequence (Sequence Identification Number: 8) as the basis]. Based on the base differences of these SNPs, the 16 Antrodia cinnamomea strains can only be distinguished into 10 genotypes. Among them, Antrodia cinnamomea BCRC 13M0049, 36799, MU30118 and 36795 have the same genotype, and Antrodia cinnamomea BCRC 35716, 37609 and 37889 have the same genotype. The genotype of Antrodia cinnamomea, and BCRC 35396 and 38806 have the same genotype. This means that the SNP in the ITS gene cannot be used to distinguish different Antrodia cinnamomea isolates. BCRC 37941 BCRC 37893 BCRC 37848 BCRC 37616 BCRC 35398 BCRC 13M0052 BCRC 36401 BCRC 38806 BCRC 35396 BCRC 37889 BCRC 37609 BCRC 35716 BCRC 36795 BCRC MU30118 BCRC 36799 BCRC 13M0049 Strains Table 5. SNP sites on the ITS gene of each Antrodia cinnamomea strain t t t t y t t t t t t t t t t t 310 Nucleotide residue position t t t t t t y t t t t t t t t t 333 t t t k t t t t t t t t t t t t 367 t t t y t t t c c t t t y y y y 591 t - - - - t - - - - - - - - - - 597 a a r a a a a a a a a a a a a a 643 t c t t t t t t t t t t t t t t 677 g g g g g - g g g g g g g g g g 682 a a a a a - a a a a a a a a a a 683 g g g g g - g g g g g g g g g g 684 g g g g g - g g g g g g g g g g 685 t t t t t - t t t t t t t t t t 686 g g g g g - g g g g g g g g g g 687 g g g g g - g g g g g g g g g g 688 Nucleotide residue position -Continued from Table 5- g g g g g - g g g g g g g g g g 689 a a a a a - a a a a a a a a a a 690 t t t t t - t t t t t t t t t t 691 c c c c c - c c c c c c c c c c 692 g g g g g - g g g g g g g g g g 693 g g g g g - g g g g g g g g g g 694 c c c c c - c c c c c c c c c c 695 t t t t t - t t t t t t t t t t 696 t t t t t - t t t t t t t t t t 697 c c c c c - c c c c c c c c c c 698 t t t t t - t t t t t t t t t t 699

Table 6 below shows the results of genotyping by comparing the genetic variation of the SNP in the nrLSU gene of 16 Antrodia cinnamomea strains. It can be seen from Table 6 that there are 8 SNPs in the nrLSU gene, which are located at nucleotide residue positions 142, 380, 388, 515, 539, 653, 681, and 757 [The nucleoside of the nrLSU gene of Antrodia cinnamomea BCRC 37609 Acid sequence (sequence identification number: 9) as the basis]. Based on the base differences of these SNPs, the 16 Antrodia cinnamomea strains can only be distinguished into 8 genotypes, among which Antrodia cinnamomea BCRC 36799, 13M0052, 35398, 37616, 36795, 37893, 37941 and 38806 have the same genotype, and Antrodia cinnamomea BCRC 35716 and 37889 have the same genotype. This means that the SNP in the nrLSU gene cannot be used to distinguish different Antrodia cinnamomea isolates. BCRC MU30118 BCRC 37848 BCRC 37609 BCRC 13M0049 BCRC 35396 BCRC 36401 BCRC 37889 BCRC 35716 BCRC 38806 BCRC 37941 BCRC 37893 BCRC 36795 BCRC 37616 BCRC 35398 BCRC 13M0052 BCRC 36799 Strains Table 6. SNP sites of various Antrodia cinnamomea strains on the nrLSU gene r g g g g g g g g g g g g g g g 142 Nucleotide residue position c y c c c c c c c c c c c c c c 380 - - c - - - - - - - - - - - - - 388 r a a r g a a a a a a a a a a a 515 a a a a a r a a a a a a a a a a 539 c c c c c c y y c c c c c c c c 653 g r g g g g g g g g g g g g g g 681 y c c y t c c c c c c c c c c c 757

The results of the SNP genotyping of the Antrodia cinnamomea strains against the nrLSU and ITS genes are summarized in Table 7 below. It can be seen from Table 7 that the 8 strains of Antrodia cinnamomea BCRC 36799, 36795, 13M0052, 35398, 37616, 37893, 37941 and 38806 will be identified as having the same genotype when SNP genotyping is performed with the nrLSU gene. The isolates of (III) will be identified as 7 isolates with different genotypes (a to g) when SNP genotyping is performed using the ITS gene. However, for the three strains of Antrodia cinnamomea BCRC 35716, 37889 and 37609, if the ITS gene is used for SNP genotyping, they will be identified as isolates with the same genotype (h). If the nrLSU gene is used for SNP genotyping, SNP genotyping will be identified as two isolates with different genotypes (V to VI). Even when these two genes were further combined for SNP genotyping, the 16 Antrodia cinnamomea strains could only be identified as 14 isolates with different genotypes (1 to 14), of which Antrodia cinnamomea BCRC 36799 and 36795 were identified as The isolates of the same genotype, and Antrodia cinnamomea BCRC 35716 and 37889 were identified as isolates of the same genotype. In contrast, as described above, SNP genotyping with RPB2 gene alone can effectively identify 16 isolates with different genotypes.

Accordingly, the applicant believes that the SNP genotyping for the RPB2 gene can be used for the identification of Antrodia cinnamomea strains. Table 7. Types of genotypes identified in SNP genotyping using nrLSU and/or ITS genes Strains nrLSU SNP genotype ITS SNP genotype nrLSU+ITS SNP genotype BCRC MU30118 I a 1 BCRC 13M0049 II 2 BCRC 36799 III 3 BCRC 36795 BCRC 13M0052 b 4 BCRC 35398 c 5 BCRC 37616 d 6 BCRC 37893 e 7 BCRC 37941 f 8 BCRC 38806 g 9 BCRC 35396 IV 10 BCRC 35716 V h 11 BCRC 37889 BCRC 37609 VI 12 BCRC 36401 VII i 13 BCRC 37848 VIII j 14

In addition, the applicant further analyzed the 64 SNPs in the RPB2 gene in Table 4 above and found that at least only 7 SNP loci in the RPB2 gene need to be compared to completely distinguish the Antrodia cinnamomea strains (as shown below) Tables 8 to 10), and the 7 SNP sites have the following three combinations: (1) nucleotide residue positions 16, 25, 31, 295, 349, 418, and 1105; (2) nucleosides Acid residue positions 16, 25, 31, 295, 349, 463, and 1105; and (3) nucleotide residue positions 16, 25, 31, 295, 349, 475, and 1105 [RPB2 of Antrodia cinnamomea BCRC 35396 The nucleotide sequence of the gene (sequence identification number: 7) is the basis]. Table 8. Combinations of nucleotide residue positions of RPB2 gene used to distinguish various Antrodia cinnamomea strains 1 Strains Nucleotide residue position 16 25 31 295 349 418 1105 BCRC 35396 t t g a g t t BCRC 13M0049 y y r a g y t BCRC 36799 y c a r g c y BCRC 13M0052 c c a a g c c BCRC 35398 y y r a g c y BCRC 35716 t y r g a y c BCRC 37616 t t g r g y y BCRC 37848 t y r r g c t BCRC MU30118 c y r r r c c BCRC 36401 t y r g a y y BCRC 36795 t t g a g y y BCRC 37609 t y r r g y y BCRC 37889 t y r g a y y BCRC 37893 y y r r r t y BCRC 37941 y c a r r y t BCRC 38806 t t g a g c y Table 9. Combinations of nucleotide residue positions of the RPB2 gene used to distinguish each Antrodia cinnamomea strain 2 Strains Nucleotide residue position 16 25 31 295 349 463 1105 BCRC 35396 t t g a g c t BCRC 13M0049 y y r a g y t BCRC 36799 y c a r g t y BCRC 13M0052 c c a a g t c BCRC 35398 y y r a g t y BCRC 35716 t y r g a y c BCRC 37616 t t g r g y y BCRC 37848 t y r r g t t BCRC MU30118 c y r r r t c BCRC 36401 t y r g a y y BCRC 36795 t t g a g y y BCRC 37609 t y r r g y y BCRC 37889 t y r g a y y BCRC 37893 y y r r r c y BCRC 37941 y c a r r y t BCRC 38806 t t g a g t y Table 10. Combinations of nucleotide residue positions of RPB2 gene used to distinguish various Antrodia cinnamomea strains 3 Strains Nucleotide residue position 16 25 31 295 349 475 1105 BCRC 35396 t t g a g a t BCRC 13M0049 y y r a g r t BCRC 36799 y c a r g g y BCRC 13M0052 c c a a g g c BCRC 35398 y y r a g g y BCRC 35716 t y r g a r c BCRC 37616 t t g r g r y BCRC 37848 t y r r g g t BCRC MU30118 c y r r r g c BCRC 36401 t y r g a r y BCRC 36795 t t g a g r y BCRC 37609 t y r r g r y BCRC 37889 t y r g a r y BCRC 37893 y y r r r a y BCRC 37941 y c a r r r t BCRC 38806 t t g a g g y

All patents and documents cited in this specification are incorporated into this case as reference materials in their entirety. If there is a conflict, the detailed description of the case (including definitions) will prevail.

Although the present invention has been described with reference to the above specific specific examples, it is obvious that many modifications and changes can be made without departing from the scope and spirit of the present invention. Therefore, it is intended that the present invention is only limited by the scope of the patent application attached hereto.

Claims (8)

A method for identifying Antrodia cinnamomea strains, the method comprising: Provide a DNA fragment containing the RPB2 gene of an Antrodia cinnamomea strain; and The DNA fragment was used for SNP genotyping with the RPB2 gene of an Antrodia cinnamomea strain for comparison, so as to detect the base differences at the SNP site of the RPB2 gene of the Antrodia cinnamomea strains. Wherein, if there is a base difference in at least one SNP site, it means that the Antrodia cinnamomea strains are different isolates from each other. The method of claim 1, wherein the SNP genotyping is performed by using at least one of the following methodologies: sequencing, restriction fragment length polymorphism analysis, oligonucleotide conjugation analysis, molecular beacon, 5'-nuclease analysis, dynamic allele-specific hybridization, SNP microarray, DNA-DNA hybridization, and denaturing gradient gel electrophoresis. The method of claim 1, wherein the base difference at the at least one SNP site is the presence of a nucleotide residue position selected from the following RPB2 genes: 16, 21, 22, 25, 31, 34, 40 , 76, 79, 80, 81, 82, 83, 85, 91, 93, 100, 101, 107, 113, 114, 115, 175, 244, 253, 256, 295, 337, 349, 403, 409, 418 , 424, 440, 463, 475, 481, 484, 508, 541, 547, 661, 673, 682, 685, 725, 727, 754, 775, 796, 799, 832, 844, 877, 922, 1066, 1078 , 1085, 1089, 1096, 1102, 1105, 1108, 1113, and combinations thereof. The method of claim 3, wherein the base difference at the at least one SNP site is the presence of a nucleotide residue position selected from the following RPB2 genes: 16, 25, 31, 34, 76, 79, 80 , 81, 82, 83, 93, 100, 101, 107, 113, 114, 115, 295, 349, 409, 418, 463, 475, 484, 508, 661, 673, 685, 725, 727, 754, 775 , 796, 799, 922, 1066, 1078, 1105, and combinations thereof. The method of claim 3, wherein the detection of the base difference at the SNP site includes detecting the following nucleotide residue positions of the RPB2 gene: 16, 25, 31, 295, 349, 418, and 1105. The method of claim 3, wherein the detection of the base difference at the SNP site includes detecting the following nucleotide residue positions of the RPB2 gene: 16, 25, 31, 295, 349, 463, and 1105. The method of claim 3, wherein the detection of the base difference at the SNP site includes detecting the following nucleotide residue positions of the RPB2 gene: 16, 25, 31, 295, 349, 475, and 1105. The method of claim 1, wherein the Antrodia cinnamomea strain for comparison is selected from the group consisting of: BCRC 35396, BCRC 35398, BCRC 37609, BCRC 37941, and combinations thereof.