TWI698526B - Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna - Google Patents

Abstract

The present disclosure relates generally to novel methods and compositions for using engineered reprogramming factor(s) for the creation of induced pluripotent stem cells (iPSCs) through a kinetically controlled process. Specifically, this disclosure relates to establishing combinations of reprogramming factors, including fusions between conventional reprogramming factors with transactivation domains, optimized for reprogramming various types of cells. More specifically, the exemplary methods disclosed herein can be used for creating induced pluripotent stem cells from various mammalian cell types, including human fibroblasts. Exemplary methods of feeder-free derivation of human induced pluripotent stem cells using synthetic messenger RNA are also disclosed.

Description

Feeder-free derivation of human induced pluripotent stem cells using synthetic messenger RNA (DERIVATION) Related applications

This application claims the rights and interests of the U.S. application serial number 13/893,166 filed on May 13, 2013, and is part of the continuation application; it claims the U.S. provisional application serial number filed on May 13, 2012 61/646,292 priority. The content of each case is incorporated into this article by way of reference in its entirety.

The present invention generally relates to a novel method and composition for establishing induced pluripotent stem cells (iPSC) through a controlled process using engineered reprogramming factors. Specifically, the present invention relates to the establishment of a combination of reprogramming factors optimized for reprogramming various cell types (including the fusion between conventional reprogramming factors and transactivation domains). More specifically, the exemplary methods disclosed herein can be used to establish induced pluripotent stem cells from various mammalian cell types, including non-human primate cells. An exemplary method for feeder-free derivation of human induced pluripotent stem cells using synthetic messenger RNA is also disclosed.

The following includes information that can be used to understand various aspects and embodiments of the present invention. It is not an acknowledgement that any information provided in this article is prior art, or is incompatible with what is currently described or claimed Any publications or documents related to the invention, or specifically or implicitly introduced, are prior art.

The therapeutic potential of induced pluripotent stem cells (iPSC) has prompted efforts to develop reprogramming methods that avoid the need to genetically modify somatic cells to achieve reprogramming to a pluripotent state. The first "non-integrated" method (protein transduction, plastid transfection, and use of adenoviral vectors) to achieve this point is limited in application due to the low efficiency of the achieved iPSC transformation. Recently, techniques using episomal DNA, Sendai virus, and synthetic messenger RNA (mRNA) have been shown to produce "nothing" with efficiency similar to or better than those achieved by using integrated viral vectors. Footprint (footprint-free)" iPSC. In principle, RNA transfection is the most attractive of these methods because it can precisely control the reprogramming factor (RF) performance schedule while completely avoiding any need to "clean" the reprogrammed cells to remove residual traces of vectors. Powerhouse. However, the current protocol based on mRNA reprogramming is quite labor intensive, as it requires daily retransfection for ~2 weeks, which is required to induce pluripotency of human cells. These procedures also rely on the use of feeder cells, which increases the complexity and technical variability of the process, and at the same time introduces possible sources of biological material contamination by non-human derivatives ("xeno).

The main difficulty in generating induced pluripotent stem cells (iPSC) is the low efficiency of reprogramming differentiated cells into pluripotent cells. It has previously been reported that 5% of mouse embryonic fibroblasts (MEF) are reprogrammed when transduced with Sox2, Klf4, and c-Myc (SKM) using a fusion gene containing Oct4 and MyoD transactivation domain (called M3O) Into iPSC. In addition, M3O promotes chromatin remodeling of pluripotency genes in most transduced MEFs (including cells that do not become iPSCs). These observations show that more than 5% of the cells have acquired the possibility of becoming iPSC under more favorable culture conditions.

The use of mRNA to successfully reprogram cells of non-human origin is unknown due to the possible cellular immune response induced by RNA molecules when they are transfected into cells (in particular mammalian cells). In reprogramming human fibroblasts, the commonly used operating system uses The viral protein acts as a decoy receptor to inactivate the interferon induced by the transfected mRNA molecule. However, this strategy using decoy receptors or other similar strategies has not been successful in the reprogramming of fibroblasts of non-human species (including baboons, horses, and dogs).

Therefore, in order to solve these shortcomings, the present invention provides methods and compositions for generating stem cells that can produce all different tissues of the body. In some aspects, messenger RNA molecules are used and no viral vectors or feeder cells are required, the method disclosed herein can be used to reprogram non-human fibroblasts into induced pluripotent stem cells (iPSC). Using exemplary methods and compositions, it achieves amazing and unexpected improvement efficiency over previously reported cell reprogramming methods, and overcomes the previously unresolved problem of inhibiting cellular immune responses in non-human mammalian cells.

Therefore, provide a cocktail that can be used to improve the reprogramming factor (RF) (especially through the administration of conventional reprogramming factors (such as Oct4 (also known as Oct3/4), Sox2, etc.)) and have known strong transcription factors (Engineered variants of the transactivation domain such as VP16 and MyoD) methods, reagents and/or compositions to promote mRNA-mediated reprogramming. The methods and compositions disclosed herein achieve a feeder cell-free solution that significantly reduces the time, cost, and effort involved in mRNA-based reprogramming.

In one aspect, the present invention provides a method for dedifferentiation or reprogramming of somatic cells, the method comprising: a) using an effective amount of synthetic properties selected from Oct4, Sox2, Klf4, cMyc, Nanog and Lin28 The combination of any one or more of the mRNA reprogramming factors and the fusion product of the transactivation domain is transfected into the isolated somatic cell, thereby reprogramming or dedifferentiating the somatic cell.

In one embodiment, the method of technical solution 1 is provided, wherein the composition comprises Oct4 fused to the N-terminal MyoD transactivation domain. In one embodiment, the Oct4 is fused to the N-terminal MyoD transactivation domain in in tandem triplicates.

In one aspect, there is provided a method for reprogramming mammalian cells by using one or more of the synthetic mRNA reprogramming factors as in Technical Solution 1, the method includes Including: a) Growing target cells on the surface of feeder-free cells at a density of 15k to 500k cells/standard 6-well plate; b) Transfection with variable doses of 50ng to 800ng/ml mRNA each time during reprogramming cell.

In one embodiment, the target cell lines are grown on the surface of feeder-free cells at a density of 30k, 75k, 100k or 150k cells per standard 6-well plate; b) each time a variable dose is used during reprogramming. Cells were transfected with 50ng to 800ng/ml mRNA, and the dose used at the earlier time point was lower than the later time point; c) iPSC was obtained without subculture.

In one embodiment, the target cell lines are grown on the surface without feeding cells at a density of 15k, 75k, 100k or 150k cells/standard 6-well plate hole, and the volume of each well is adjusted to be between 0.5ml Between and 5ml of suitable medium; during reprogramming, cells are transfected with a variable dose of 50ng to 800ng/ml mRNA each time, and the earlier time point is lower than the later time point; under non-subculture Get iPSC.

In certain embodiments, lower doses are used throughout the reprogramming process to reduce cellular immune responses and obtain improved iPSC success rates. In other embodiments, the use of higher purity mRNA molecules (that is, the absence of contaminating abnormal transcripts from in vitro transcription) allows cells to be seeded at a lower density and survive repeated transfection and higher iPSC production. rate.

In one embodiment, the mammalian cells are human cells. In one embodiment, the method is Xeno-free. In one embodiment, the mammalian cells are non-human primate cells. In one embodiment, the non-human primate cells are Malay monkey cells.

In one embodiment, the one or more factors are selected from the group consisting of mRNAs, regulatory RNA, siRNA, miRNA, and combinations thereof.

In one embodiment, the somatic cells are transfected with at least two different RNAs. In one embodiment, the somatic cell lines are selected from the group consisting of unipotent, multipotent, multipotent and differentiated cells. In one embodiment, the one or more RNAs induce the somatic cells to dedifferentiate into unipotent, pluripotent or pluripotent cells.

In one embodiment, at least one of the factors is selected from the group consisting of OCT4, SOX2, NANOG, LIN28, KLF4, and MYC mRNA. In one embodiment, the OCT4, SOX2, NANOG and LIN28 mRNA are administered in combination. In one embodiment, the OCT4, SOX2, KLF4 and MYC mRNA are administered in combination.

In one embodiment, the transfected cell lines are maintained in culture as induced pluripotent stem (iPS) cells. In one embodiment, the formation of induced pluripotent stem cells by the transfected cells further includes inducing iPS cells to form differentiated cells.

In one aspect, a method of treating or inhibiting one or more symptoms of a disease or condition in a patient is provided, the method comprising dedifferentiating cells in vitro and administering the cells to the patient. In one embodiment, the composition further comprises Rarg and LrH-1 transaction activation domains. In one embodiment, the composition comprises OCT4 fused to the transactivation domain of VP16.

In one embodiment, the present invention provides iPSC derived from non-human primate cells, which is used to establish a disease model system because it can produce a non-integrated, feeder cell-free test environment without other animal products. Therefore, the non-human iPSC described herein is suitable for preclinical testing.

The invention described and claimed herein has many attributes and embodiments, including (but not limited to) those described or described or cited in the [Summary of the Invention]. It is not intended to include all and the invention described and claimed herein is not limited or limited to the features or embodiments described in the [Summary of the Invention], and its inclusion is only for the purpose of illustration and not limitation. Other embodiments can be disclosed in the following [Implementation Mode].

Figure 1. iPSC colonies derived from M3O-based mRNA reprogramming mixture. (A) 10× bright-field images derived from two amplified iPSC clones of the first M3O-based BJ reprogramming experiment. (B) Immunostaining for pluripotency markers of amplified clones.

Figure 2. Feeder-free cell reprogramming using M3O-based mixture.

(A) Shows the yield of TRA-1-60 ⁺ colonies derived from feeder-free cells on 50K XFF fibroblasts and compares immunofluorescence based on the mixture of c-Myc and L-Myc and the 4-hour and 24-hour transfection protocol Light imaging. Transfect all wells for 9 days. The 4-hour transfected culture was fixed and stained on the 15th day of the experiment, and the 24-hour transfected culture was fixed and stained on the 11th day. (B) 10× bright-field imaging of 400ng/ml Stemfect wells of the same experiment, which showed that the nearly overgrown hESC-like colonies beyond the culture on the 9th day of derivation. (C) The 10× bright field time course of the labeled domain in the 9-day follow-up trial of 100K XFF retransfected with a 400ng/ml Stemfect protocol, showing epithelial formation and subsequent appearance of hESC-like colonies.

Figure 3. Comparison of reprogramming efficiency using 4 different mRNA mixtures. The flow chart outlines the four mixture comparison experiments.

Figure 4. HDF-a feeder-free reprogramming of hESC-like colonies in culture. On the 9th day of derivation of 75K HDF-a adult fibroblasts without feeder cells treated with 400ng/ml mRNA mixture (M3O+c-Myc ⁺ Nanog ⁺ ) delivered in the form of medium supplement with Stemfect transfection reagent for 9 days 10× bright-field image of hESC-like colonies appearing at the time.

Figure 5. Production of synthetic mRNA mixture. (A) A schematic diagram outlining the procedure for making the mRNA reprogramming mixture. (B) Synthetic mRNA encoding several RF and fluorescent reporters on SYBR E-gel. Load 500ng RNA in each channel.

Figure 6. Using 2-thiouracil for the reprogramming mix to generate a synthetic mRNA mix. Synthetic mRNA codes for several RFs on the SYBR E-gel. 10% of the uracil bases of these mRNAs were replaced with 2-thiouracil. Load 100ng RNA per channel.

Figure 7. Human iPSC established using a mixture of mRNAs with 2-thiouracil-modified mRNA. Human iPSC populations reprogrammed (A) 7 days or (B) 11 days after different reprogramming operations in Pluriton (A) or Allele reprogramming medium (B).

Figure 8. Malay monkey iPSC colonies established using mRNA mixtures in feeder-free cell reprogramming culture. The photo shows the 10× bright-field images of hESC-like colonies that appeared on the 10th and 13th days. In the passage on day 10, cells near the center exhibited morphological changes from fibroblasts to stem cells. In the passage on day 13, these cells formed large colonies of fully transformed monkey iPSCs.

When describing the present invention, all terms not defined herein have their meanings recognized by the art. To the extent that the following descriptions are specific embodiments or specific uses of the present invention, it is intended to be illustrative only and not to limit the claimed invention. The following description is intended to cover all alternatives, modifications, and equivalents included in the spirit and scope of the present invention.

Differentiated cells can be restored to a pluripotent state by the performance of selected transcription factor groups. Turning on patient-specific cells can be used to generate any desired types of cells for the study of in vitro genetic diseases and ultimately for the prospect of cell replacement therapy. The performance of these reprogramming factors can be achieved through the application of viral vectors integrated into the genome, and iPSC derivation is still often performed using integrated retroviruses or lentiviruses. The accompanying modification of the genome represents an important obstacle to the therapeutic application of iPSC, and even in vitro studies still need to consider the possibility of reactivation of the integrated viral sequence cassette. Recently, significant progress has been made in the application of novel expression vectors to alleviate or eliminate genome modification problems. A lentiviral vector is now available, which encodes in a single polycistronic cassette flanking the lox recombination site to induce a variety of factors required for iPSC, thus allowing the reprogramming of Cre recombinase through transitional expression, almost GMO is removed seamlessly. It is also possible to use transposon vectors followed by transient expression of the translocase for insertion of the transgene and subsequent excision. Several different types of non-integrated DNA vectors have been used, which can over-express reprogramming factors for a period of time sufficient to induce pluripotency, including adenovirus, plastid and gene appendage type DNA. It has also been confirmed that the recombinant RF protein with cell penetrating peptide can be used to repeatedly transduce cells to produce iPSC, but the efficiency is low. Now it is possible to use Sendai virus with a completely RNA-based reproductive cycle, and to achieve quite effective iPSC transformation by continuously transfecting synthetic mRNA transcripts encoding Yamanaka factor.

The application of mRNA transfection to reprogramming (and potentially leading differentiation and transdifferentiation) is an attractive approach, because this system can adjust the reprogramming mixture and even individually by simply changing the transcripts added to the cell culture medium every day The performance of component factors. Once the transfection of the specific factor is terminated, the heterotopic expression in the target cell will immediately stop due to the rapid attenuation of mRNA in the cytoplasm. In contrast to non-integrated DNA vectors or RNA viruses, mRNA transfection requires neither cleaning nor any risk of random genome integration or persistent viral infection. If it is envisaged that it is possible to eventually use multiple atopic RF performance procedures, from patient biopsy through iPSC intermediates to the required types of specialized cells, these advantages should be more important. However, currently implemented mRNA-based reprogramming has drawbacks. Although the expression of RF is usually robust for about 24 hours after transfection of mRNA, it takes about two weeks for factor expression to induce the pluripotency of human cells. Therefore, the hands-on time required for cell reprogramming with this technology ) Is quite long. Not all cell types and media are equally conducive to effective mRNA delivery, and this is currently an obstacle to mRNA-based reprogramming of the specific cell types (including blood cells). So far, it has also been confirmed that the use of a mitotically suppressed fibroblast feeding layer is necessary to successfully reprogram cells into iPSCs using the mRNA method. The population density of these buffered cultures of feeding cells, because the target cells grow from a low starting density during the prolonged time course required for iPSC induction, even exceeding the delivery dose of RNA and transfection reagents (both of which have associated toxicity) And to support the survival rate of target cells in the face of pro-apoptosis and cell growth inhibitory forces produced by the reprogramming process. This requirement increases the complexity of the procedure and operation time and introduces an important source of technical variability, especially if the feeder cells themselves are transfected. The presence of the feeder cell layer also hinders the monitoring and analysis of the reprogramming process. Ultimately, although human feeder cells are currently the standard for mRNA reprogramming, when non-human animal products are used for their derivation and amplification, even these cells are possible sources of foreign biological contamination.

Therefore, in view of the problems associated with previously known procedures, this article provides novel methods, materials, and solutions to generate improved reprogramming efficiency and improved gains Cell quality iPSC. The examples of the present invention have been successfully used to achieve remarkable, surprising and unexpected improvements by enhancing the RF mixture delivered to cells. The embodiments of the present invention also provide novel solutions that compress and streamline the mRNA reprogramming process, and support the generation of footprintless iPSCs from human fibroblasts without the use of feeding cells or any other potentially contaminated reagents. The novel methods and compositions provided herein will extend the advantages of previously known mRNA methods and help clear the remaining obstacles to the therapeutic application of iPSC technology.

The present invention generally relates to a method for establishing induced pluripotent stem cells (iPSC) through a dynamic control process using engineered reprogramming factors. More specifically, the present invention relates to the establishment of a combination of reprogramming factors optimized for reprogramming different types of cells (including the fusion of conventional reprogramming factors and transactivation domains); these factors are synthesized The messenger RNA (mRNA) form is introduced into cultured mammalian cells at a better density by a method that results in a suitable degree of transgene expression; the cells are maintained under defined conditions to obtain reprogramming efficiency that was previously difficult to achieve. Compared with other methods known in the art, the present invention significantly shortens the time, cost, and effort involved in reprogramming, completely free of feeder cells and foreign matter, and does not require subculture as needed. The materials and procedures disclosed herein can be used to establish induced pluripotent stem cells from different types of mammalian cells (including human fibroblasts).

Aspects of the present invention also provide a method for generating stem cells capable of producing many different tissues of the human body by using messenger RNA molecules without the need for viral vectors, animal products or feeder cells. The novel method disclosed herein can be used to reprogram human fibroblasts under optimal conditions into induced pluripotent stem cells (iPSC) with surprising and unexpected efficiency.

The present invention provides useful methods and compositions for treating non-human mammalian cells (e.g., fibroblasts) with a mixture of "cleaning" mRNAs encoding the exemplary reprogramming factors described herein. The mRNA composition can be used without causing the treated cells to experience cell death associated with the introduction of mRNA molecules. In one embodiment, the non-human mammalian cells are Malay monkey cells. In another embodiment, the male monkey cells Seeding in the wells with a certain gradient allows the cells to grow at variable local density.

definition

As used herein, cells suitable for use with the method include (but are not limited to) primary cells and established cell lines, embryonic cells, immune cells, stem cells and differentiated cells (including but not limited to) derived from ectoderm, endoderm Germ and mesoderm (including fibroblasts, parenchymal cells, hematopoietic cells and epithelial cells). As used herein, stem cells include unipotent cells, pluripotent cells, and pluripotent cells; embryonic stem cells and adult stem cells, such as hematopoietic stem cells, mesenchymal stem cells, epithelial stem cells, and muscle satellite cells. In one embodiment, the somatic cell line is dedifferentiated or reprogrammed. Any suitable somatic cell can be used. Representative somatic cells include fibroblasts, keratinocytes, adipocytes, muscle cells, organ and tissue cells and various blood cells (including but not limited to hematopoietic cells (including hematopoietic stem cells and cells that provide short-term or long-term hematopoietic transplantation)) . The best cell types include (but are not limited to) human fibroblasts, keratinocytes and hematopoietic stem cells. These methods are particularly useful for de-differentiating or redifferentiating cells as appropriate without permanently modifying the cell genome.

The RNA that can be used in the disclosed method includes mRNA, regulatory RNA or small RNA such as siRNA or miRNA, where the one or more mRNAs encode polypeptides that function to dedifferentiate or reprogram cells. The transfection efficiency is extremely high. Generally, 90% of the transfected cell population will express inducible RNA. Therefore, cells can be transfected with one or more different RNAs. For example, a population of cells can be transfected with one or more different mRNAs, one or more different siRNAs, one or more different miRNAs, or a combination thereof. The cell population can be transfected with multiple RNAs at the same time in a single administration, or multiple administrations can be staggered in minutes, hours, days or weeks. Can stagger the transfection of multiple different RNAs. For example, if the first RNA is expected to be expressed before the expression of one or more other RNAs.

The degree of expression of the transfected RNA can be controlled in a wide range by changing the amount of input RNA, so that the degree of expression of each transfected RNA can be individually adjusted. Determine the effective amount of input RNA based on the desired result. In addition, PCR-based techniques for mRNA generation include Facilitate the design of mRNAs with different structures and domain combinations. The RNA that can be used in the method of the present invention is known in the art and will be selected based on the target host cell type and the pathway or cell activity or therapeutic application to be controlled. Based on known genes, mRNA or other nucleotide or protein sequences, constructs that can be used to dedifferentiate cells, such as transforming into differentiated somatic cells into stem cells, can be constructed.

The terms "polynucleotide" and "nucleic acid" used interchangeably herein refer to polymerized forms (ribonucleotides or deoxyribonucleotides) of nucleotides of any length. Therefore, this term includes (but is not limited to) single-stranded, double-stranded or multiple-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA mixtures, or unnatural or non-natural or non-natural or biological modifications that contain purine and pyrimidine bases or other natural, chemical or biological modifications. Polymer of derivatized nucleotide bases. "Oligonucleotides" generally refer to polynucleotides of between about 5 and about 100 nucleotides of single-stranded or double-stranded DNA. However, for the purpose of the present invention, there is no upper limit on the length of the oligonucleotide. Oligonucleotides are also called oligomers, and can be isolated from genes or chemically synthesized by methods known in the art.

As used herein, the term "microRNA" refers to any type of interfering RNA, including (but not limited to) endogenous microRNA and artificial microRNA (eg, synthetic miRNA). Endogenous microRNAs are small RNAs naturally encoded in the genome that can regulate the productive utilization of mRNA. The artificial microRNA can be any type of RNA sequence capable of regulating the activity of mRNA other than endogenous microRNA. A microRNA sequence can be an RNA molecule that includes any one or more of these sequences.

"MicroRNA precursor" (or "premiRNA") refers to a nucleic acid with a stem-loop structure in which a microRNA sequence is incorporated. "Mature microRNA" (or "mature miRNA") includes a microRNA precursor ("premiRNA") that has been cleaved or synthesized (for example, synthesized by a cell-free synthesis method in the laboratory) and has about 19 nuclei Glucose acid to about 27 nucleotides in length, for example, a mature microRNA may have a length of 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, or 27nt. Mature microRNA can bind to target mRNA and inhibit the translation of target mRNA.

Exemplary genomic mRNA (cDNA) and protein sequences of OCT4 are known in the art, see, for example, (OCT4) POU5F1 POU Class 5 homeobox [modern human ( Homo sapiens )] Gene ID: 5460, It provides mRNA (cDNA) sequence gene bank (Genbank) accession number NM-001173531.1, titled modern human POU class 5 homeobox 1 (POU5F1), transcript variant 3, mRNA; gene bank accession number NM-002701.4 , The title is modern human POU type 5 homeobox 1 (POU5F1) transcript variant 1, mRNA; and gene bank accession number NM-203289.4, the title is modern human POU type 5 homeobox 1 (POU5F1) , Transcript variant 2, mRNA. Exemplary genomic mRNA (cDNA) and protein sequences of SOX2 are also known in the art, see, for example, SOX2 SRY (sex determining region Y)-box 2 [modern people], gene ID: 6657, which provides mRNA (cDNA) Sequence gene bank accession number NM-003106.2, titled mRNA sequence modern human SRY (sex determining region Y)-box 2 (SOX2), mRNA. The exemplary genomic mRNA (cDNA) and protein sequences of NANOG are also known in the art, see, for example, NANOG Nanog Homeobox [Modern People], Gene ID: 79923, which provides the mRNA (cDNA) sequence gene bank registration number NM-024865.2, titled Modern Human Nanog Homeobox (NANOG), mRNA. Exemplary genomic mRNA (cDNA) and protein sequences of LIN28 are also known in the art, see, for example, LIN28A homolog A ( C.elegans ) [modern people], gene ID: 79727, which provides mRNA (cDNA) sequence Genbank accession number NM-024674.4, titled modern human lin-28 homolog A (cryptobacter elegans) (LIN28A), mRNA. Exemplary genomic mRNA (cDNA) and protein sequences of KLF4 are known in the art, see for example KLF4 Kruppel-like factor 4 (intestine) [modern people], gene ID: 9314, which provides mRNA (cDNA) sequence gene library deposit No. NM-004235.4, titled modern human Kruppel-like factor 4 (gut) (KLF4), mRNA. The mRNA sequence of MYC is also known in this technology, see (for example) MYC v-myc myeloid tissue proliferation virus oncogene homolog (avian) [modern man], gene ID: 4609, which provides mRNA (cDNA) sequence The gene bank deposit number is NM-002467.4, and the title is modern human v-myc myeloid tissue proliferation virus oncogene homolog (birds) (MYC), mRNA.

"Dry loop structure" refers to a nucleic acid with a secondary structure in a region including a region of nucleotides known or predicted to form a double strand (stepped portion) connected to one side by a region of primary single stranded nucleotides (loop portion) . The terms "hairpin" and "fold-back" structure are also used herein to refer to the stem loop structure. These structures are well known in the art and these terms are always used in their known meanings in the art. The actual primary sequence of nucleotides within the stem loop structure is not critical to the practice of the invention, as long as there is a secondary structure. As is known in the art, the secondary structure does not require exact base pairing. Therefore, stems can include one or more base mismatches. Alternatively, the base pairing may be exact, that is, not including any mismatches.

As used herein, the term "stem cell" refers to undifferentiated cells that can be induced to proliferate. Stem cells can be self-maintenance, which means that for each cell division, a daughter cell will also be a stem cell. Stem cells can be obtained from embryonic tissue, fetal tissue, postnatal tissue, juvenile tissue or adult tissue. As used herein, the term "precursor cell" refers to an undifferentiated cell derived from a stem cell, but not a stem cell itself. Some precursor cells can produce offspring that can differentiate into more than one cell type.

As used herein, the term "induced pluripotent stem cells" (or "iPS cells") refers to stem cells that are induced by autologous cells (eg, differentiated somatic cells) and have higher potency than the somatic cells. iPS cells can renew themselves and differentiate into mature cells, for example, smooth muscle cells. iPS can also differentiate into smooth muscle precursor cells.

As used herein, the term "isolated" in relation to a cell refers to a cell that is in an environment different from the environment in which the cell is naturally produced, for example, when the cell is naturally produced in a multicellular organism, and from that Multicellular organisms remove the cell and the cell line is "isolated." The isolated genetically modified host cells may exist in a mixed population of genetically modified host cells, or in a mixed population including genetically modified host cells and unmodified host cells. For example, the isolated genetically modified host cell can exist in vitro. A mixed population of modified host cells, or an in vitro mixed population comprising genetically modified host cells and non-genetically modified host cells.

As used herein, "host cell" means a cell in vivo or in vitro (e.g., a eukaryotic cell cultured as a single cell entity) (the eukaryotic cell can be used or has been used for nucleic acid (e.g., exogenous nucleic acid) The recipient) and includes the progeny of the original cell that has been genetically modified by nucleic acid. It should be understood that due to natural, accidental or precise mutations, the progeny of a single cell need not be identical in morphology or genome or total DNA complementation to the original parent.

The term "genetic modification" refers to a permanent or transitional genetic change induced in a cell after the introduction of a new nucleic acid (ie, an exogenous nucleic acid from the cell). Genetic changes ("modifications") can be achieved by incorporating new nucleic acids into the genome of the host cell, or by transitional or stable maintenance of the new nucleic acids as extrachromosomal elements. In the case of a eukaryotic cell, permanent genetic changes can be achieved by introducing nucleic acid into the cell's genome. Suitable methods for gene modification include viral infection, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate precipitation, direct microinjection and similar methods.

As used herein, the term "exogenous nucleic acid" refers to nucleic acid that is not normally or naturally present in a cell and/or is not actually produced by the cell and/or introduced into the cell (for example, by electroporation, transfection, infection , Liposome transfection or any other means of introducing nucleic acid into cells) nucleic acid.

As used herein, the term "treatment" and similar terms refers to obtaining the desired pharmacological and/or physiological effect. The effect may be preventive in terms of completely or partially preventing the disease or its symptoms and/or may be therapeutic in terms of partially or completely curing the disease and/or adverse effects attributable to the disease.

As used herein, "treatment" includes any treatment for a disease in mammals (especially humans), and includes: (a) preventing the disease from occurring in individuals who may be susceptible to the disease but have not yet been diagnosed with the disease; b) inhibit the disease, that is, prevent its development; and (c) alleviate the disease, that is, cause the disease to resolve.

The terms "individual", "subject", "host" and "patient" used interchangeably herein refer to mammals, including (but not limited to) humans, non-human primates, rodents Animals (e.g., mice, rats, etc.), ungulates, canines, rabbits, cats, etc. In some embodiments, the individual is a human. In some embodiments, the individual is a non-human, non-human animal, such as a monkey, a rodent, or a lago.

"Therapeutically effective amount" or "effective amount" means the amount of a compound, nucleic acid, or many cells that is sufficient to achieve treatment of the disease when administered to an individual to treat the disease. The "therapeutically effective amount" will vary depending on the compound or cell, the disease and its severity, and the age and weight of the individual to be treated.

Before further describing the present invention, it should be understood that the present invention is not limited to the specific embodiments described, and therefore can of course be changed. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be restrictive, because the scope of the present invention will only be limited to the scope of the appended patents.

In the case of providing a certain range of values, it should be understood that the present invention includes each intermediate value between the upper limit and the lower limit of the range, unless otherwise clearly specified herein, to a tenth unit of the lower limit and the Any other stated or intermediate value in the stated range. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges and are also included in the present invention, including any explicitly excluded limit in the stated range. In the case where the stated range includes one or both of the limit values, the range excluding any one or both of the included limit values is also included in the present invention.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by ordinary persons of the technology to which the present invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, preferred methods and materials are still described. All publications described herein are incorporated herein by reference to disclose and describe methods and/or materials that can be combined to quote publications material.

In one aspect of the present invention, mRNA-based reprogramming can be achieved by using Oct4 or Sox 2 with an N-terminal MyoD transactivation domain (Hirai et al., Stem Cells, 2011) or a C-terminal triple repeat VP16 transactivation domain (Wang et al., EMBO Reports, 2011; The synthetic reprogramming factor is prepared by fusing the VP16 transactivation domain to OCT4 (also known as Pou5f1), NANOG and SOX2, respectively. These synthetic factors can enhance the efficiency and Accelerated kinetics to reprogram engineered variants of both mouse and human fibroblasts), or by enhancing the "standard" RF mixture with two other factors Rarg and Lrh-1 (Wang et al., PNAS, 2011) Enhanced. The content of each case is incorporated into this article by reference. Strong transcriptional agonists can effectively recruit multiple chromatin remodeling complexes when they bind to specific sites in DNA. A good example is MyoD, which is the main transcription factor for skeletal myogenesis that can switch the fate of differentiated cells. Hirai et al. speculate that because MyoD is a strong transcription factor, it can increase chromatin accessibility to iPS factors (if fused together). When combined with Sox2 and Klf4, the reverse transcription vector with Oct-MyoD TAD fusion gene was used to transduce mouse or human cells, compared with typical iPS factors, they increased the number of iPSC colonies by ~50 times. Similarly, the well-known robust transcription agonist VP16 can exhibit a strong stimulating effect on reprogramming when fused to different iPS factors.

Exemplary preparation method of human iPSC

This method can also be widely used to re-differentiate or reprogram cells, for example, to generate iPS cells that can be further regulated to form the following cells: hematopoietic stem cells, mesenchymal stem cells, epithelial stem cells and muscle satellite cells, or of human tissue Differentiated cells, including (but not limited to) red blood cells, white blood cells (including lymphocytes), platelets, stromal cells, adipocytes, skeletal cells (including osteoclasts), epithelial tissues (including skin cells), muscle tissues (including smooth muscle, bone) Muscle and myocardium), vascular tissue (including endothelial cells), liver tissue (including hepatocytes) and nerve tissue (including neurons). Induce iPS cells to differentiate into various differentiated cell types (including but not limited to cardiomyocytes, hematopoietic stem cells, skeletal cells (such as osteoclasts) Cells), hepatocytes, retinal cells and neurons, stem cells (including (but not limited to) isolated embryonic stem cells, hematopoietic stem cells and induced pluripotent stem cells)) methods can be achieved by transitional transfection with induced differentiation RNA To induce differentiation. Alternatively or alternatively, the cells can be redifferentiated by culturing the cells under cell type specific conditions. For example, iPS cells can be maintained on CF-1 feeder cells and then adapted to feeder cell-free conditions. iPS cells can be induced to form differentiated retinal cells by culturing these cells in the presence of noggin, Dkk-1 and IGF-1.

The previously reported methods rely on integrating vectors, ie, viruses or plastids, with modified factors. In one embodiment, a reprogramming test is performed to compare 6 different mRNA combination mixtures containing transcripts of five factors (Oct4, Sox2, Klf4, cMyc-T58A, and Lin28) used for mRNA reprogramming or including Rarg and Lrh -1 The performance of the 7 reprogramming factor RF mixtures, each combination was tested with three changes based on wild-type Oct4 and MyoD- and VP16-Oct4 fusion constructs (named M3O and VPx3, respectively). BJ fibroblasts were transfected in feeder cell-based reprogramming cultures for 11 days, at which time, evolutionary morphology appeared in several wells. In the next few days, colonies with characteristic hESC morphology appeared in wells transfected with a mixture based on wild-type Oct4 and M3O. Although the target cells in the cultures transfected with VPx3 maintained the morphology of fibroblasts, they also showed accelerated growth and a certain tendency to aggregate into foci, and no colonies appeared. The 5-factor and 7-factor examples based on a mixture of wild-type Oct4 and M3O showed similar colony productivity, therefore, including Rarg and Lrh-1 in the mixture did not produce advantages. However, the number of colonies produced by the M3O mixture was several times that of the wild-type Oct4. Based on this result, colonies were selected from the M3O 5-factor well for amplification and further analysis (Figure 1). The multipotency of colonies derived from M3O was confirmed by immunostaining of cell nucleus and cell surface markers, and by differentiation into three main germ layers in vitro. The karyotype analysis and DNA fingerprinting of the 6 amplified iPSC colonies can confirm the normal karyotype and BJ cell lineage of these cells in all cases.

This method can also be widely used to redifferentiate or reprogram cells (for example) to generate iPS cells that can be further regulated to form the following cells: hematopoietic stem cells, mesenchymal stem cells, epithelial stem cells and muscle satellite cells, or human tissues. Differentiated cells, including (but not limited to) red blood cells, white blood cells (including lymphocytes), platelets, stromal cells, adipocytes, skeletal cells (including osteoclasts), epithelial tissues (including skin cells), muscle tissues (including smooth muscle) , Skeletal muscle and cardiac muscle), vascular tissue (including endothelial cells), liver tissue (including hepatocytes) and nerve tissue (including neurons). Methods for inducing iPS cells to differentiate into various differentiated cell types (including but not limited to cardiomyocytes, hematopoietic stem cells, skeletal cells (such as osteoclasts), hepatocytes, retinal cells and neurons) are known in the art ( Song et al., Cell Res. , 19(11): 1233-42 (2009), Lamba et al., PLoS One , 5(1): e8763 (2010), Gai et al., Cell Biol Int. 200933(11): 1184-93 (2009). Grigoriadis et al., Blood , 115(14): 2769-76 (2010)). Stem cells including (but not limited to) isolated embryonic stem cells, hematopoietic stem cells, and induced pluripotent stem cells can be induced to differentiate by transitional transfection with differentiated RNA. Alternatively or alternatively, the cells can be re-differentiated by culturing the cells under cell type-specific conditions. For example, iPS cells can be maintained on CF-1 feeder cells and then adapted to feeder cell-free conditions. iPS cells can be induced by culturing these cells in the presence of noggin, Dkk-1 and IGF-1 to form differentiated retinal cells. In another aspect, the effectiveness of the mRNA mixture can be further enhanced by the inclusion of Nanog transcripts. In this example, four wells containing 50K BJ fibroblasts on feeder cells were transfected with 5-factor or 6-factor mixture based on wild-type Oct4 or M3O for 6 days, and then cultured for each 1:6 Subculture onto fresh feeder cells to fill the 6-well plate (4). Transfection in each plate continued for another 0 to 5 days. The cultures were fixed on day 18 (wherein day 0 corresponds to the first transfection) and stained with TRA-1-60 antibody to evaluate the effects of different mixtures and transfection schedules on iPSC productivity. The results show that it is extremely beneficial to add Nanog to the mixture regardless of the Oct4 variant used, while achieving maximum conversion efficiency when M3O is used together with Nanog.

In one example, the efficacy of the M3O-based 5-factor or 6-factor mixture was confirmed in other feeder cell-based experiments using three other human fibroblast cell lines (HDF-f, HDF-n and XFF). For all these three low-subculture cell lines, reprogramming kinetics and efficiency are significantly improved, which shows that the natural population doubles faster than BJ in normal expansion culture. In some cases, we obtained hESC-like colonies from as little as 6 days of transfection, however, the yield was much higher in experiments where transfection lasted more than a few days. Experiments involving periodic strengthening of the feeder cell layer by adding fresh cells have shown that although this strategy can provide certain advantages, they will be offset by the complexity of the resulting solution. So we decided to focus on the application of more effective mixtures to develop a streamlined feeder-free regimen.

The present invention is about establishing feeder cell-free iPSC. The iPSC derivation independent of feeder cells has generally proven to be a certain challenge independent of the reprogramming technique used, and adds to the specific difficulties in the content of the continuous transfection protocol. The density of inoculation of fibroblasts without compromising cell survival and proliferation activity is less restricted. When stress is exerted on cells by transfection of reprogramming factors and by the ectopic performance of reprogramming factors, these cells have an increased tendency to undergo mitotic suppression or apoptosis in sparse culture. In addition, RNA doses that are well tolerated under the high cell density characteristics based on reprogramming of feeder cells produce more severe cytotoxic effects when distributed in a smaller number of cells. At the same time, the out-of-performance that can be achieved by mRNA transfection decreases significantly after fibroblasts reach fullness, which may be due to the down-regulation of endocytosis associated with contact inhibition and G1 suppression. This low transfection tolerance in cluster culture seems to slow down after cells undergo mesenchymal to epithelial transition (MET) during reprogramming. However, in general, even if the cells are seeded at the lowest viable initial density, the ~7 days required for human fibroblasts to reach MET when using the current mRNA mixture is extremely difficult to eliminate the problem of overgrowth of fibroblasts. Cells can be diluted by subculture to delay this fate, but it is extremely difficult to predict the inoculation efficiency of high-stress reprogramming intermediates, and in any case, a subculture-based derivation scheme will undesirably sacrifice high-throughput applications. Convenience and scale. In some embodiments, the cells can also be seeded in the wells with a certain gradient so that different local Cell density can promote repeated transfection.

The present invention relates to phenotypic indicators of MET (degeneration of fibroblastic process and appearance of colony and pebble morphology). In one embodiment, with the present invention, the enhanced mixture is used, the 6-factor M3O mixture is used to achieve feeder-free cell reprogramming without subculture, and the target is inoculated at various low densities (50K vs. 100K vs. 150K per well) Cells to accelerate MET. In another embodiment, the cell lines are seeded with a density gradient ranging from about 15K to 500K cells in the total number of cells per well.

One aspect of the present invention relates to the fate of these reprogramming cultures, which proves to be highly sensitive to the seeding density, presumably because the effects of excessive cytotoxicity and excessive growth of fibroblasts are self-enhanced during the transfection protocol. In an experiment using "standard" RNA administration (1200ng/well), dozens of hESC-like colonies were obtained from HDF-n and XFF fibroblasts seeded at 100K/well, and the corresponding 50K and 150K cultures were taking place. Only a small number of colonies are provided after the rapid population decline and the overgrowth of fibroblasts. In attempts to derivatize with two other fibroblast cell lines, BJ and HDF-a, even the most promising (150K) culture became substantially stationary shortly after reaching full growth, and then only produced sporadic kinetics with delayed Colony.

One aspect of the present invention relates to purification of in vitro transcribed mRNA by size exclusion chromatography to remove abnormal RNA species that can form a dsRNA structure alone or together with mRNA, and to induce cellular immune response. Using these "clean" mRNAs (mRNAs with low cellular immunogenicity) can effectively reprogram non-human primate cells growing at a gradient density.

In a specific embodiment of the present invention, switching from environment to 5% oxygen culture and gradually increasing from a quarter dose to full RNA administration during the first four days of transfection in an attempt to minimize stress-induced cell senescence .

In one example of the present invention, using these novel conditions, the inventors tested whether the replacement of L-Myc or c-Myc could further improve the reprogramming mixture.

In another example, we evaluated a simplified transfection protocol of adding RNA to cells and changing the medium daily instead of delivering in individual steps 4 hours early. In the "24-hour transfection" wells, the RNA administration was scaled down to compensate for the expected increase in cytotoxicity, and two different transfection reagents (RNAiMAX and Stemfect) were tested. XFF cells were seeded at 50K/well and transfected for 9 days. Each well with a c-Myc-based mixture of the conventional "4-hour transfection" protocol provided approximately one hundred TRA-1-60 ⁺ colonies, while the L-Myc mixture performed relatively poorly (Figure 2). The results of the "24-hour transfection" culture are still more impressive. In the most productive of these wells (corresponding to the c-Myc 400ng/ml Stemfect condition), the hESC-like cells in this culture have become almost excessive on day 9 (24 hours after the last transfection) Grow. The mechanism basis for the excellent performance of "24-hour transfection" may already have the effect of increasing the effective density of the dilution culture by concentrating the diffusion factors released by the cells. When these optimal conditions are applied to another example experiment (derivation using HDF-a fibroblasts in a culture seeded at 75K cells/well), the productivity is not as high as that achieved with highly proliferative XFF cells The results were significant, but many hESC-like colonies reappeared as early as the 9th day of the protocol (Figure 4).

In a specific embodiment, when cells are inoculated with a medium smaller than the usual volume, such as 1ml, 0.75ml, 0.5ml, or the smallest volume of medium that can continue cell culture, the efficiency of reprogramming using the conditions disclosed above is obvious Improved. These low volume conditions during reprogramming are therefore incorporated into the present invention.

The embodiments described herein are by no means the only application of the present invention. Those skilled in the art should know that the present invention can also be used to reprogram other cells under mildly variable conditions or using a similar combination of conventional or engineered factors for reprogramming, directed differentiation or transdifferentiation.

In other embodiments, optimization of factor stoichiometry can also enhance the pace of reprogramming-the mRNA approach provides an opportunity to define a mixture that independently addresses the early and late stages of ipPSC induction. The gain obtained by using M3O provides verification for the recent application of novel engineered reprogramming factors to iPSC generation. These engineered reprogramming factors include To fusion SOX2, KLF4, CMYC, LMYC, LIN28, NANOG, etc. to the transactivation domain of factors other than VP16 OR MYOD, SUCH AS GAL4, GATA1, P53, etc. The reagents and methods used to deliver mRNA can also be used to co-transfect siRNA and miRNA, which has long proven its value in the generation of iPSCs. However, the feeding-cell-free solution disclosed in the present invention represents a substantial improvement over the current solution. It shortens the time required for reprogramming by as much as half and reduces labor and material costs by half or more, eliminating tricky procedures from the program. Steps, and allow mRNA to be delivered to cells in nearly the same conditions as growth factors or cytokines-that is, as a medium supplement.

In some embodiments, the cells are reprogrammed to modulate the immune response. For example, lymphocytes can be reprogrammed into regulatory T cells that can be administered to patients in need to increase or transfer immune tolerance (specifically, self-tolerance). The induction or administration of Foxp3-positive T cells can be used to reduce autoimmune responses such as transplant rejection, and/or reduce, inhibit or alleviate one or more of the following plastid immune diseases or disorders: diabetes, multiple sclerosis Syndrome, asthma, inflammatory bowel disease, thyroiditis, kidney disease, rheumatoid arthritis, systemic lupus erythematosus, severe alopecia (alopecia greata), ankylosing myelitis, antiphospholipid syndrome, autoimmune Addison's disease (Addison's disease) ), autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behcet's disease, Bullous pemphigoid, cardiomyopathy, celiac disease-dermatitis, chronic fatigue syndrome immunodeficiency syndrome (CFIDS), chronic demyelinating polyneuritis, cicatricial pemphigoid, cold agglutinin disease, Crest syndrome, gram Crohn's disease, Dego's disease, dermatomyositis, juvenile dermatomyositis, discoid lupus, primary mixed cryoglobulinemia, fibromyalgia Symptoms-fibromyositis, Grave's disease, Guillain-Barre, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura ( ITP), IgA nephropathy, insulin-dependent diabetes (type I), juvenile arthritis, Meniere Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, rheumatic polymuscularis Pain, polymyositis and dermatomyositis, primary aglobulinemia, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever , Sarcoidosis, scleroderma, Sjogren's syndrome, stiff-man syndrome, Takayasu arteritis, temporal arteritis/giant cell arteritis, ulcerative colon Inflammation, uveitis, vasculitis, leukoplakia, and Wegener's granulomatosis.

These methods can be used to produce cells that can be used to treat a variety of diseases and disorders including (but not limited to) diseases such as Parkinson's, Alzheimer's disease, wound healing and multiple sclerosis . These methods can also be used for organ regeneration and immune response recovery or supplementation. For example, cells at different stages of differentiation such as iPS cells, hematopoietic stem cells, pluripotent cells or unipotent cells (such as precursor cells, such as epithelial precursor cells) and other cells can be administered intravenously or by local surgery. These methods can be used in combination with other conventional methods such as prescription therapy, surgery, hormone therapy, chemotherapy, and/or radiation therapy.

In one embodiment, the kit includes RNA, cells, and a device for transfecting RNA into cells. The RNA can be lyophilized or in solution form. The kit may optionally include other materials, such as cell culture reagents. In an alternative embodiment, the kit provides redifferentiated, dedifferentiated or reprogrammed cells prepared according to the disclosed method and storage and/or refrigerated or frozen transport for subsequent use. Cells are usually stored in a solution to maintain survival. The kit containing the cells should use a method consistent with the survival rate, such as storage or transportation in a cooler containing dry ice, so that the cells are maintained below 4°C and preferably below -20°C.

These kits include one or more of the following as appropriate: bioactivator, culture medium, excipient, and one or more of the following: syringe, needle, hanging thread, gauze, Bandages, disinfectants, antibiotics, local anesthetics, analgesics, surgical thread, scissors, scalpel, sterile fluid, and sterile containers. The components of the kit can be individually packaged and can be sterile. These sets are generally provided in containers such as plastic containers, cardboard containers or metal containers suitable for commercial scale. Any such kits may include instructions for use. These methods can be used to generate cells that can be used to treat a variety of diseases or disorders including but not limited to neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease and multiple sclerosis. The method disclosed herein can also be used for organ regeneration and immune system recovery or supplementation. For example, cells in different stages of differentiation such as iPS cells, hematopoietic stem cells, pluripotent cells or unipotent cells (such as precursor cells, such as epithelial precursor cells) and other cells can be administered intravenously or by local surgery. These methods can be used in combination with other conventional methods such as prescription therapy, surgery, technical therapy, chemotherapy, and/or radiation therapy.

Aspects of the present invention provide a stem cell culture system and a differentiation method for producing skin tissue cells for wound treatment, and stem cell therapy for treating arthritis, lupus and other autoimmune related diseases.

Instance

The present invention will now be described with reference to the following examples. These examples are provided for the purpose of illustration only, and the present invention is not limited by these examples, but includes all the changes that prove to be the results of the teachings provided herein.

Example 1-Generation of IVT template

Use ligation-independent selection (LIC) to construct a plastid construct used to generate a linear PCR product in vitro transcription (IVT) template. First, construct a parent body (pIVT) flanked by the 5'and 3'untranslated region (UTR) of the insertion site designed to accept the open reading frame (ORF) insert encoding the protein. The ORF side has a sequence line as described in Warren et al., Cell Stem Cell, 2010, which includes a low secondary structure leader and a strong Kozak site (5' UTR) and a murine α-globulin 3'UTR. The linearized variant of the PIVT vector with 5'overhangs is prepared by re-annealing two PCR products amplified from the plastids using customized primers. By analogy Sequence production of ORF PCR products with complementary overhangs, group PCR products together with vector and transform into DH5α bacteria by thermal shock to colonize gene-specific constructs (pIVT-KLF4, etc.). The resulting plastids are used in templated PCR reactions to produce linear IVT templates with T7 promoter, UTR-flanked ORF, and T120 tails to drive poly-A tails, as described in Warren et al., Cell Stem Cell, 2010. The T120 tail region was introduced by using a customized reverse primer (T120CTTCCTACTCAGGCTTTATTCAAAGACCA). For the M3O and VPx3 fusion construct, the transactivation domain coding sequence was added to the ORF by PCR using custom primers. The stock solution of PCR product template is maintained at a concentration of ~100ng/uL.

Example 2-Making mRNA Mix

The mRNA synthesis method is summarized in Figure 5. A 4:1 ratio of ARCA cap analog to GTP was used to generate synthetic mRNA in the IVT reaction to produce a high ratio of capped transcripts. Use CTP to change from 5m-CTP and UTP to pseudo-UTP in nucleoside triphosphate (NTP) mixture to reduce the immunogenicity of RNA products. Cap analogs and modified NTP were purchased from Trilink Biotechnologies. Prepare 2.5×NTP mixture (ARCA: ATP: 5m-CTP: GTP: False-UTP 15: 15: 3.75: 3.75: 3.75 mM) to replace the MEGAscript T7 kit (Ambion) provided with the IVT reaction Standard NTP. Each 40uL IVT reaction contains 16uL NTP mix, 4uL 10×T7 buffer, 16uL DNA template and 4uL T7 enzyme. The reaction was incubated at 37°C for 4 to 6 hours and then treated with 2uL TURBO Dnase at 37°C for another 15 minutes, and then purified on a MEGAclear (Ambion) spin column. The RNA products were eluted in a volume of 100uL. To remove the immunogenic 5'triphosphate portion from the uncapped transcript, 10 uL Antarctic Phosphatase reaction buffer and 3 uL Antarctic Phosphatase (NEB) were added to each preparation. Incubate the phosphatase reaction at 37°C for 30 minutes and then purify the IVT products. The RNA yield was quantified by Nanodrop (Thermo Scientific), and therefore the preparations were adjusted to a standardized working concentration of 100 ng/uL by adding TE pH 7.0 (Ambion). The RNA mixture is assembled by combining the preparations representing various RFs in the desired stoichiometric ratio. Used The fraction of each RF takes into account the predicted molecular weight of each transcript. Except for Oct4 and its derivatives contained at a concentration of 3×mole, all RF lines are equal to mol. Add up to 10% of the mRNA encoding the short-lived nucleated monomer LanYFP fluorescent protein to these mixtures to facilitate monitoring of transfection efficiency during the reprogramming test. In other embodiments, mRNA is also produced by using 25% or 10% of the total uracil of 2-thiouracil (see Figure 6).

Example 3-Cells and Media

Targeted cells for reprogramming include BJ neonatal fibroblasts (ATCC), HDF-f fetal fibroblasts, HDF-n neonatal fibroblasts, HDF-a adult fibroblasts (ScienCell) and XFF No foreign matter neonatal fibroblasts (Millipore). For BJ, HDF and XFF cells, they were expanded and cultured in BJ medium (DMEM+10% FBS), ScienCell fibroblast medium and FibroGRO non-exogenous human fibroblast expansion medium (Millipore). The feeding cell line used was 3001G-irradiated neonatal human foreskin fibroblasts (GlobalStem) and FibroGRO mitomycin C-inactive non-exogenous human neonatal fibroblasts (Millipore). TrypLE Select (Gibco) (an animal product-free cell lysis reagent) was used to perform cell subculture steps related to the exogenous-free feeder cell and feeder-free reprogramming test.

Example 4-Reprogramming of human fibroblasts

All the reprogramming experiments described were carried out in 6-well tissue culture dishes coated with CELLstart (Gibco) substrate without foreign substances according to the manufacturer's instructions. At the beginning of the BJ reprogramming experiment, BJ medium containing FBS was used to inoculate GlobalStem feeder cells at 250K/well. In some later feeder cell-based experiments, the seeding density was increased and feeder cells were replenished during medium exchanges in an attempt to maintain a nearly overgrown feeder cell layer in response to the high wastage rate encountered with the novel RF mixture. Exogenous-free feeder cells (when used) were seeded in serum-free Pluriton-based reprogramming medium. The target cells were inoculated in Pluriton serum-free medium (Stemgent) plus antibiotics, Pluriton supplements and 200ng/ml B18R interferon inhibitor (eBioscience). During reprogramming And then change the medium every day, and stop B18R supplementation the day after the final transfection. In an experiment in which cells divide onto freshly cultured cells during reprogramming, the medium used for re-seeding contains 10 uM Y27632 (Stemgent). Transfection starts the day after inoculation of target cells, and repeats at 24 hour intervals for the duration shown here. RNAiMAX (Invitrogen) was used to deliver a dose of 1200 ng of RNA to each well 4 hours before the daily medium replacement, unless otherwise noted. The RNAiMAX-based transfection mixture is prepared by diluting 100ng/uL RNA 5× in calcium/magnesium-free DPBS and diluting 5uL RNAiMAX/ug RNA 10× in the same diluent together to produce 10ng/uL RNA/vehicle suspension It is prepared by distributing to the culture medium after 15-minute incubation at room temperature. For transfection using Stemfect reagent (Stemgent), RNA and Stemfect (4uL/1ug RNA) are mixed in Stemfect buffer to provide an RNA concentration of 10ng/uL. The mixture is incubated for 15 minutes, and then delivered to the culture medium or refrigerated for subsequent use.

In other embodiments, the reprogramming of human fibroblasts is also performed in a medium other than pluriton, such as Allele reprogramming medium (see Figure 7). In some embodiments, B18R is not used at all, and in other embodiments, B18R is only used in some transfections.

Example 5. Analysis of characteristics of iPSC colonies

To evaluate the productivity of iPSC colonies, the reprogrammed cultures were fixed with 4% paraformaldehyde in DPBS (with calcium/magnesium) and StainAlive TRA-1-60 Alexa 488 diluted with 100× in DPBS (with calcium/magnesium) Antibody (Stemgent) immunostaining. Perform colony selection, expansion and subsequent immunostaining and three-line differentiation analysis for molecular and functional verification of pluripotency. Perform DNA fingerprinting and karyotype analysis. The formation of teratomas was performed and confirmed in more than one set of mouse models. This demonstrates the pluripotency of stem cells.

It is revealed that a combination of target cells and engineered reprogramming factors and non-engineered reprogramming factors can be contacted to make non-stem cells efficient by contacting iPSCs in about 9 days (sometimes as short as 6 days or even 5 days). A novel method of reprogramming into pluripotent stem cells. These iPS cells can be produced in the form of feeder-free cells, no foreign substances and no footprint iPSCs. except In addition to significantly improving the efficiency of reprogramming by the method of the present invention, the novel technology is also different from all previously known technologies in that the iPSC system thus established is "clean" because it has never been in contact with any virus or vector. The utility of the present invention can be found in virtually all fields related to stem cell establishment, differentiation, utility in cell and development research, and clinical applications. Similar procedures can also be used for directed differentiation and transdifferentiation.

Example 6-Reprogramming of Malay Monkey Fibroblasts

The reprogramming experiment using Malay monkey fibroblasts was carried out in a 6-well tissue culture dish coated with CELLstart (Gibco) substrate according to the manufacturer's instructions. The target cells were seeded in Allele Biotech's serum-free medium plus antibiotics. The medium was replaced with a 2-thio-modified mRNA/transfection reagent mixture delivered with fresh medium every day during and after reprogramming with or without B18R for 12 consecutive days (Figure 8). The colonies of monkey iPSC began to appear on the 9th day and reached the mature stage, and reached the compact colony stage on the 12th day.

Claims (21)

A feeder-free, xeno-free, and integration-free method for dedifferentiating or reprogramming mammalian somatic cells, the method comprising: using Transfection of isolated non-human primate somatic cells with the composition: (i) an effective amount of purified synthetic mRNA encoding the reprogramming factor Oct4 fused to the N-terminal MyoD transactivation domain; and (ii) encoding renewal Purified synthetic mRNA of programming factors Sox2, Klf4, cMyc, Nanog, and Lin28, thereby reprogramming or dedifferentiating somatic cells; wherein the synthetic mRNA is purified and removed during the in vitro transcription reaction used to produce the synthetic mRNA The abnormal RNA species produced; and the cell lines are inoculated according to a density gradient. The method of claim 1, wherein the cells are Malay monkey cells. The method of claim 1, wherein the cells are rhesus monkey cells. The method of claim 1, wherein the cells are baboon cells. The method of claim 1, wherein the cells are canine cells. The method of claim 1, wherein the cells are equine cells. The method of claim 1, wherein the cells are bovine cells. The method of claim 1, wherein the cells are pig cells. The method of claim 1, wherein the cells are sheep cells. Such as the method of claim 1, wherein Oct4 is fused to the N-terminal MyoD transactivation domain by in tandem triplicates. A feeder-free method for reprogramming non-human mammalian cells, wherein the method comprises: growing target cells on feeder-free cells at a density of 15k to 500k cells/ml On the surface, and wherein the cell lines are seeded according to a density gradient; and the cells are transfected with the purified synthetic mRNA as in claim 1 in a dose range of about 50ng to about 800ng/ml. The method of claim 1, wherein the method comprises: growing target cells at a density of 25k cells/ml to 300k cells/ml on the surface of feeder-free cells, wherein the synthetic mRNA is purified to remove any transcription from The contaminating non-mRNA species in which the cell lines are inoculated according to a density gradient; and the purified synthetic mRNA as in claim 1 in a dose range of about 50ng to about 800ng/ml is used to transfect the cells, wherein the earlier time point The dose used is lower than the later time point; and iPSC is achieved without subculture; wherein the synthetic mRNA is purified to remove any contaminating non-mRNA species from transcription. The method of claim 1, wherein the method comprises: growing the target cells at a density selected from the group consisting of 15k, 30k, 50k, 75k, 100k, 150k, 250k, 500k cells/well in standard 6-wells On the surface of the plate without feeding cells; the volume of each well is adjusted between 0.5ml to 5ml of suitable medium; and the cell lines are inoculated according to a density gradient; and a dosage range of about 50ng to 800ng/ml is used as requested The purified synthetic mRNA of item 1 is transfected into these cells, where the dose used at an earlier time point is lower than that at a later time point; and these cells reach iPSC without subculture. The method of claim 1, wherein the somatic cells include unipotent, multipotent, multipotent, or differentiated cells. The method of claim 1, wherein the synthetic mRNA induces the dedifferentiation of somatic cells into unipotent, pluripotent or pluripotent cells. The method of claim 1, wherein the transfected cell lines are maintained in culture as induced pluripotent stem (iPS) cells. The method of claim 1, wherein the transfected cells form induced pluripotent stem cells, further comprising inducing the iPS cells to form differentiated cells. The method of claim 1, wherein the composition further comprises Rarg and LrH-1 transaction activation domains. The method of claim 1, wherein the composition further comprises Oct4 fused to the transactivation domain of VP16. The method of claim 1, wherein the purified synthetic mRNA contains 2-thiouracil. The method of claim 11, wherein the purified synthetic mRNA contains 2-thiouracil.

Images