KR20170023014A - Feeder-free derivation of human-induced pluripotent stem cells with synthetic messenger rna - Google Patents

Abstract

This disclosure is generally directed to novel methods and compositions using engineered reprogramming factor (s) for generation of induced pluripotent stem cells (iPSCs) through a dynamically controlled process. Specifically, this disclosure relates to establishing a combination of reprogramming factors including fusion between a conventional reprogramming factor and a transcription activation domain, optimized for reprogramming various cell types. More specifically, the exemplary methods disclosed herein can be used to generate pluripotent stem cells derived from a variety of mammalian cell types, including human fibroblasts. An exemplary method from mu-feeder of human induced pluripotent stem cells using synthetic messenger RNA is also disclosed.

Description

[0001] Description [0002] FEEDER-FREE DERIVATION OF HUMAN-INDUCED PLURIPOTENT STEM CELLS WITH SYNTHETIC MESSENGER RNA OF MANUAL-

Related application

This application is a continuation-in-part of U.S. Serial No. 13 / 893,166, filed May 13, 2013, which claims priority to U.S. Provisional Serial No. 61 / 646,292, filed May 13, This application is a continuation-in-part of U.S. Serial No. 14 / 292,317 filed on May 30. The contents of each of the above applications are incorporated herein by reference in their entirety.

Field of invention

The present disclosure relates generally to novel methods and compositions that employ manipulated reprogramming factor (s) for the production of induced pluripotent stem cells (iPSCs) through control processes. Specifically, this disclosure relates to establishing a combination of reprogramming factors including fusion between a conventional reprogramming factor and a transcription activation domain, optimized for reprogramming various cell types. More specifically, the exemplary methods disclosed herein can be used to generate pluripotent stem cells derived from a variety of mammalian cell types, including non-human primate cells. An exemplary method from a feeder-free origin of human induced pluripotent stem cells using synthetic messenger RNA is also disclosed.

The following includes information that may be useful in understanding various aspects and embodiments of the present disclosure. This does not imply that any information provided herein is or will be prior art to the invention described or claimed herein, or that any publication or document referenced in particular or implicit is prior art.

The therapeutic potential of induced pluripotent stem cells (iPSCs) has spurred efforts to develop a reprogramming method that avoids the need to genetically modify somatic cells to perform reprogramming into universal state. The first "non-integrated" approach to achieving success with this - protein transduction, plasmid transfection and the use of adenoviral vectors - was limited in application due to the low efficiency of the iPSC conversion obtained. More recently, techniques using episomal DNA, Sendai virus and synthetic messenger RNA (mRNA) have been described as "footprint-efficient " with efficiencies comparable to or better than those achieved using integration of viral vectors. free "iPSC. < / RTI > Since RNA transfection completely precludes any requirement for "cleanup" of reprogrammed cells to eliminate residual traces of the vector, while providing accurate control over the reprogramming factor (RF) expression time, Are the most attractive of these methods. However, the current protocol of mRNA-based reprogramming is relatively labor-intensive due to the need for daily retransfection for ~ 2 weeks required for the induction of universality in human cells. These procedures also depend on the use of feeder cells to add complexity and technical variability to the process, while introducing a potential source of contamination by non-human-derived ("xeno") biological materials.

The main difficulty in the production of induced pluripotent stem cells (iPSC) was the low efficiency of reprogramming from differentiated cells to pluripotent cells. Previously, 5% of mouse embryonic fibroblasts (MEF) when transfected with a fusion gene consisting of Oct4 and MyoD (termed M3O) with Sox2, Klf4 and c-Myc (SKM) It was reported to be reprogrammed as. In addition, M3O in many of the transduced MEFs, including cells without iPSC, facilitated chromatin remodeling of the universal gene. These observations suggested the possibility that over 5% of the cells had acquired the ability to become iPSCs under more favorable culture conditions.

Successful reprogramming of cells from non-human origin using mRNA is difficult to achieve due to the potential cellular immune response induced by the RNA molecule when it is transfected into cells, particularly mammalian cells. In reprogramming human fibroblasts, the practice is to use viral proteins as decoy receptors to attenuate interferons induced by transfected mRNA molecules. However, this strategy of using decoy receptors or other similar strategies has not been successful in reprogramming fibroblasts from non-human species, including baboons, horses, and dogs.

Thus, to address these drawbacks, the present disclosure provides methods and compositions for producing stem cells capable of producing all different tissues of the body. In particular aspects, the methods disclosed herein can be used for reprogramming into pluripotent stem cells (iPSCs) derived from non-human fibroblasts, using messenger RNA molecules without the need for viral vectors or feeder cells. The use of exemplary methods and compositions has resulted in surprising unexpected improved efficiencies over previously reported cell reprogramming methodologies and has not previously been addressed in solving cellular immune responses in non-human mammalian cells Overcome.

Thus, the application of engineered variants such as, for example, Oct4 (also referred to as Oct3 / 4), Sox2, etc., which incorporates notably known strong transcription factors such as VP16 and the transcription activation domain of MyoD, Agents and / or compositions useful for accelerating mRNA-mediated reprogramming by improving reprogramming factor (RF) cocktail are provided. The methods and compositions disclosed herein provide a no-feeder protocol that dramatically reduces the time, cost, and effort associated with mRNA-based reprogramming.

In one aspect, the disclosure provides a method of treating a subject comprising: a) isolating isolated somatic cells with an effective amount of a fusion product between any one or more of the synthetic mRNA reprogramming factors selected from Oct4, Sox2, Klf4, cMyc, Nanog and Lin28, Lt; RTI ID = 0.0 > reprogramming < / RTI > or demultipating somatic cells.

In one embodiment, the method of claim 1 is provided wherein the composition comprises Oct4 fused to an N-terminal MyoD transcription activation domain. In one embodiment, Oct4 is fused to the N-terminal MyoD transcription activation domain in tandem.

In one aspect, a) growing target cells at a density of 15 k to 500 k cells / well on a no-feeder surface in a standard 6-well plate; And b) transfecting the cells with a variable dose of 50 ng to 800 ng / ml mRNA each time during reprogramming. The method of any one of claims 1 to 6, A method of reprogramming a cell is provided.

In one embodiment, target cells are grown at a density of 30 k, 75 k, 100 k or 150 k cells / well on a no-feeder surface in a standard 6-well plate; b) transfecting the cells with a variable dose of 50 ng to 800 ng / ml mRNA each time during reprogramming, wherein a lower dose is used at a later point in time than later; c) iPSC is obtained without passaging.

In one embodiment, target cells are grown at a density of 15 k, 75 k, 100 k or 150 k cells / well on a no-feeder surface in a standard 6-well plate, wherein the volume of each well is varied from 0.5 ml to 5 ml < / RTI > of medium; Transfected cells with variable doses of 50 ng to 800 ng / ml mRNA each time during reprogramming, wherein a lower dose is used at a later point in time than later; IPSC is obtained without subculturing.

In certain embodiments, using lower doses throughout the reprogramming process has reduced the cellular immune response and has resulted in improved iPSC success rates. In another embodiment, the use of higher purity mRNA molecules, i. E. No staining by an ideal transcript from in vitro transcription, allows the cells to be seeded at lower densities and survive repeated transfection, iPSC yield was obtained.

In one embodiment, the mammalian cell is a human cell. In one embodiment, the method is Xeno-free. In one embodiment, the mammalian cell is a non-human primate cell. In one embodiment, the non-human primate cell is a Cynomolgus monkey cell.

In one embodiment, the one or more factors are selected from the group consisting of mRNA, regulatory RNA, siRNA, miRNA, and combinations thereof.

In one embodiment, somatic cells are transfected with at least two different RNAs. In one embodiment, somatic cells are selected from the group consisting of monoclonal, multifunctional, universal and differentiated cells. In one embodiment, the one or more RNAs induce dedifferentiation into somatic, monotypic or pluripotent cells.

In one embodiment, at least one of the factors is selected from the group consisting of OCT4, SOX2, NANOG, LIN28, KLF4 and MYC mRNA. In one embodiment, OCT4, SOX2, NANOG and LIN28 mRNA are administered in combination. In one embodiment, OCT4, SOX2, KLF4 and MYC mRNA are administered in combination.

In one embodiment, the transfected cells are maintained in culture as induced pluripotent stem (iPS) cells. In one embodiment, the transfected cells further comprise inducing induced pluripotent stem cells and inducing iPS cells to form differentiated cells.

In one aspect, there is provided a method of treating or inhibiting one or more symptoms of a disease or disorder in a patient, comprising: demineralizing the cell in vitro and administering the cell to the patient. In one embodiment, the composition further comprises Rarg and LrH-1 transactivation domains. In one embodiment, the composition comprises OCT4 fused to the VP16 transcriptional activation domain.

In one embodiment, the disclosure provides an iPSC derived from non-human primate cells that was used to establish a disease model system since it can generate a no-integrated, no-feeder test environment without any other animal products. Thus, the non-human iPSCs described herein are useful for preclinical studies.

The inventions described and claimed herein have many attributes and embodiments, including, but not limited to, those set forth or described or mentioned in the context of this invention. It is not intended to be exhaustive and the invention herein described and claimed is not limited to or limited by the features or embodiments identified in the scope of this invention which are included for purposes of illustration only and not limitation . Further embodiments can be disclosed in the detailed description for carrying out the invention described below.

Figure 1. iPSC colonies derived using M3O-based mRNA reprogramming cocktail. (A) 10x bright field image of two proliferated iPSC clones derived from the original M3O-based BJ reprogramming test. (B) Immunostaining of proliferating clones to universal markers.
Figure 2. Reprogramming non-feeder using M3O-based cocktail. (A) Immunity showing TRA-1-60 ⁺ colony yield from no-feeder origin for 50K XFF fibroblasts comparing c-Myc and L-Myc-based cocktail and 4- and 24- Fluorescent imaging. All wells were transfected for 9 days. Four-hour transfection cultures were fixed on day 15, 24-hour transfection cultures on day 11 for staining. 10x bright field imaging of a 400 ng / ml Stemfect well from the same experiment, showing nearly full-growth hESC-like colonies that surpassed culture on Day 9, derived from (B). (C) 10x light field-of-view time-course of the marked field of view in a tracing test in which 100K XFF was transfected again for 9 days using 400 ng / ml stamfecture, showing epithelialization and subsequent appearance of hESC-like colonies.
Figure 3. Comparison of reprogramming efficiencies using four different mRNA cocktails. A flow chart summarizing the four cocktail comparison experiments.
Figure 4. hESC-like colonies in HDF-a non-feeder reprogrammed cultures. Derived from the 75K HDF-a embryonic fibroblasts treated for 9 days with 400 ng / ml mRNA cocktail (M3O + c-Myc ⁺ Nanog ⁺ ) delivered as media supplement using a stem-specific transfection reagent. 10x bright field image of hESC-like colonies emerging on days.
Figure 5. Generation of synthetic mRNA cocktails. (A) Schematic summarizing the procedure for producing mRNA reprogramming cocktail. (B) Synthetic mRNA and fluorescent reporter coding multiple RFs on SYBR E-gel. 500 ng of RNA per lane was loaded.
Figure 6. Generation of synthetic mRNA cocktail using 2-thio-uracil for reprogramming cocktail. Synthetic mRNA encoding multiple RFs on the SYBR E-gel. mRNA was replaced by 10% of its uracil base by 2-thio-uracil. 100 ng of RNA per lane was loaded.
Figure 7. Human iPSCs generated using mRNA cocktails with mRNA modified by 2-thio-uracil. A population of human iPSCs (A) 7 days or (B) 11 days after reprogramming during different reprogramming runs in Pluriton (A) or allele reprogramming medium (B).
Figure 8. Cynomolgus monkey iPSC colonies generated using mRNA cocktails in a feeder reprogrammed culture. A 10x bright field image of hESC-like colonies emerged at days 10 and 13 is shown in the photograph. In the tenth day panel, cells near the center indicate morphological changes from fibroblasts to stem cells. On the thirteenth panel, the cells formed macro colony of fully transformed monkey iPSC.

When describing the present invention, all terms not defined herein have their ordinary meaning recognized in the pertinent art. As the description below is for a specific embodiment or specific use of the invention, it is only intended to be illustrative and not to limit the claimed invention. The following description is intended to cover all alternatives, modifications and equivalents as may be included within the spirit and scope of the present invention.

The possibility that the differentiated cells can be returned to the versatile state by expression of the transcription factors of the selected group means that the patient-specific cells can be used for the study of genetic diseases in vitro and ultimately for any desired type Which can be used to generate cells of the cell line. Expression of the reprogramming factor can be achieved through the application of a viral vector integrated into the genome, and the iPSC-derived is still usually carried out with the integration of retrovirus or lentivirus. The accompanying genomic variation represents an important obstacle to the therapeutic application of iPSC, and the possibility of reactivated expression from integrated viral cassettes is also important in in vitro studies. Significant progress has recently been made in the application of novel expression vectors to alleviate or eliminate genomic-strain problems. Encoding a multiple factor required for iPSC induction in a single polysystron cassette flanked at the lox recombination site that allows for transgene ablation with little traces after reprogramming through transient expression of Cre recombinase Virus vectors are now available. Transgene insertion followed by ablation can also be performed by using transposon vectors followed by short transposons. Several different types of non-integrated DNA vectors have been used that can transiently express reprogramming factors for a sufficient time to induce universality, including adenovirus, plasmid and episomal DNA. It has also been demonstrated that it is possible to produce iPSC by repeated transduction of cells using recombinant RF proteins incorporating cell-penetrating peptides, albeit at low efficiency. Relatively efficient iPSC transduction can now be achieved by the continuous transfection of synthetic mRNA transcripts encoding the Yamanaka factor using Sendai virus with a fully RNA-based reproductive cycle.

The application of mRNA transfection for reprogramming (and potentially specific differentiation and transduction differentiation) requires that the system merely modifies the reprogramming cocktail and even the expression of individual component factors by changing which transcript is to be added to the cell culture medium It is attractive because it makes it adjust daily. Once the transfection of a particular agent is terminated, the rapid disruption of intracellular mRNA causes immediate ectopic expression in the target cell to stop. In contrast to non-integrated DNA vectors or RNA viruses, no cleanup of mRNA transfection is required and there is no risk of random genomic integration or persistent viral infection. These advantages assume greater significance if the inventors envision that a number of ectopic RF expressions can ultimately be used to become the desired type of specialized cells from an iPSC intermediate from a patient biopsy. Nonetheless, there are drawbacks to mRNA-based reprogramming as currently practiced. Expression of RF is typically strong for approximately 24 hours after mRNA transfection, but it takes about two weeks for expression of the factor to induce universality in human cells, and thus the experience required to reprogram the cells with this technique Time is relatively long. Not all cell types and culture media contribute equally to efficient mRNA delivery, which is currently an obstacle to mRNA-based reprogramming of certain types of cells of interest, including blood cells. Also, until now, it has been demonstrated that it is necessary to use the feeder layer of a stopped fibroblast in mitosis to successfully reprogram cells into iPSC using the mRNA method. These feeder cells buffer the population density of the culture as the target cells grow from a low starting density over an extended period of time required for iPSC induction, resulting in the transfer of RNA and transfection reagent (both of which have associated toxicity) Capacity, and supports the survival rate of target cells in the face of apoptosis promotion and cell proliferation inhibitory tendency caused by the reprogramming process. These requirements add complexity and experience time to the procedure and become an important source of technical variability, especially when feeders are applied to transfection themselves. The presence of the feeder layer also delays the monitoring and analysis of the reprogramming process. Finally, although currently human feeder cells are the standard for mRNA reprogramming, these cells are potential sources of heterogeneous-biological contamination when non-human animal products are used for their origin and propagation.

Thus, in view of the problems associated with previously known procedures, novel methods, materials, and protocols for producing iPSCs with improved efficiency of reprogramming and improved quality of generated cells are provided herein. An embodiment of the present invention has been used to successfully achieve a surprisingly surprising improvement through the enhancement of the RF cocktail delivered to the cell. Embodiments of the present invention also provide a new protocol (e. G., ≪ RTI ID = 0.0 > e. ≪ / RTI > ). The novel methods and compositions provided herein will extend the benefits of previously known mRNA methods and will help resolve the remaining obstacles to therapeutic applications of iPSC technology.

The present disclosure generally relates to methods of using reprogramming factor (s) engineered for the generation of induced pluripotent stem cells (iPSCs) through a dynamically controlled process. More particularly, the present invention relates to establishing a combination of reprogramming factors, including fusion between a conventional reprogramming factor and a transcription activation domain, optimized for reprogramming different types of cells; By introducing these factors as synthetic messenger RNA (mRNA) into mammalian cells cultured at the desired density by a method that results in an appropriate level of transgene expression and maintaining the cells under defined conditions, Thereby causing reprogramming. Compared to other methods known in the pertinent art, the present invention completely eliminates the time, cost and effort involved in reprogramming, without the need for subculture, with the option of being totally feederless and disparate. The materials and procedures disclosed herein are useful for generating pluripotent stem cells derived from different types of mammalian cells, including human fibroblasts.

An aspect of the disclosure also provides a method of producing stem cells capable of producing a variety of different tissues of the human body using messenger RNA molecules without the need for viral vectors, animal products or feeder cells. The novel methods disclosed herein can be used to reprogram human fibroblasts with induced unexpected efficiency under optimal conditions to induced pluripotent stem cells (iPSCs).

The present disclosure provides useful methods and compositions for treating non-human mammalian cells (e. G., Fibroblasts) using a cocktail of "cleanup" mRNAs encoding the exemplary reprogramming factors described herein. The mRNA composition can be used without causing the treated cells to undergo apoptosis associated with the introduction of mRNA molecules. In one embodiment, the non-human mammalian cell is a Cynomolgus monkey cell. In another embodiment, the Cynomolgus monkey cells are seeded with a gradient into the wells such that the cells grow at varying local densities.

Justice

As used herein, cells suitable for use in the methods include, but are not limited to, primary cells and established cell lines, embryonic cells, immune cells, stem cells, and differentiated cells, including but not limited to fibroblasts, parenchymal cells, But are not limited to, cells derived from ectoderm, endoderm, and mesoderm, including cells. Stem cells used herein include monocytes, pluripotent and pluripotent cells; Embryonic stem cells and adult stem cells such as hematopoietic stem cells, mesenchymal stem cells, epithelial stem cells and muscle satellite cells. In one embodiment, somatic cells are depolymerized or reprogrammed. Any suitable somatic cell can be used. Representative somatic cells include fibroblasts, keratinocytes, adipocytes, muscle cells, organs and tissue cells; And various hematopoietic cells, including, but not limited to, hematopoietic stem cells, and cells that provide short or long term hematopoietic engraftment. The most preferred cell types include, but are not limited to, human fibroblasts, keratinocytes and hematopoietic stem cells. The method is particularly useful for demineralizing and optionally regenerating cells without permanent alteration of the cell genome.

RNAs useful in the disclosed methods include mRNA, regulatory RNA, or small RNA, such as siRNA or miRNA, wherein one or more mRNAs encode polypeptides that function to depolymerize or reprogram the cells. The efficiency of transfection is high. Typically more than 90% of the population of transfected cells will express the introduced RNA. Thus, it is possible to transfect cells with one or more distinct RNAs. For example, the cell population may be transfected with one or more distinct mRNAs, one or more distinct siRNAs, one or more distinct miRNAs, or a combination thereof. The population of cells can be transfected with multiple RNAs simultaneously with a single administration, or multiple administrations can be delayed by several minutes, hours, days or even weeks. Transfection of a number of distinct RNAs can be time lag. For example, it is preferred that the initial RNA is expressed prior to expression of one or more additional RNAs.

The level of expression of the transfected RNA can be manipulated over a wide range by varying the amount of the incoming RNA so that it is possible to individually regulate the expression levels of each transfected RNA. The effective amount of the incoming RNA is determined based on the desired result. In addition, PCR-based mRNA production techniques facilitate the design of mRNAs with different structure and domain combinations. RNAs useful in the disclosed methods are well known in the art and will be selected based on the target host cell type, as well as the pathway or cellular activity to be engineered, or therapeutic applications. The constructs that are useful for the de-differentiation of cells, e. G., To convert adult differentiation somatic cells into stem cells, can be constructed based on known genes, mRNA, or other nucleotide or protein sequences.

The terms "polynucleotide" and "nucleic acid" used interchangeably herein refer to polymeric forms of nucleotides of any length that are ribonucleotides or deoxyribonucleotides. Thus, the term is intended to encompass a single, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or purine and pyrimidine bases or other natural, chemically or biochemically modified non- Or a polymer comprising a derivatized nucleotide base. "Oligonucleotide" refers generally to polynucleotides of single- or double-stranded DNA of about 5 to about 100 nucleotides. However, for purposes of this disclosure, there is no upper limit to the length of the oligonucleotide. Oligonucleotides are also known as oligomers or oligos and can be isolated from genes or synthesized chemically by methods known in the art.

As used herein, the term "microRNA" refers to any type of interfering RNA, including but not limited to endogenous microRNAs and artificial microRNAs (eg, synthetic miRNAs). Endogenous microRNAs are small RNAs that are naturally encoded in the genome that can regulate the production and utilization of mRNA. The artificial microRNA may be any type of RNA sequence other than the endogenous microRNA, which can modulate the activity of the mRNA. The microRNA sequence may be an RNA molecule composed of any one or more of these sequences.

A "microRNA precursor" (or "pre-miRNA") refers to a nucleic acid having a stem-loop structure in which a microRNA sequence is incorporated. "Mature microRNA" (or "mature miRNA") includes microRNAs that have been truncated or synthesized (e. G., Synthesized by cell-free synthesis in the laboratory) from microRNA precursors Mature microRNAs have a length of about 19 nucleotides to about 27 nucleotides, for example, mature microRNAs have a length of 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, or 27 nt Lt; / RTI > The mature microRNA can bind to the target mRNA and inhibit translation of the target mRNA.

Exemplary genomic, mRNA (cDNA), and protein sequences for OCT4 are known in the art and include, for example, Homo sapiens POU class 5 Protein 1 (POU5F1), transcript variant 3, mRNA Genbank Accession Nos. NM-001173531.1; Homo sapiens POU Class 5 Home Box 1 (POU5F1), Transcript variant 1, Genbank accession number NM-002701.4 named mRNA; And (OCT4) POU5F1 POU class 5 homoboxes providing the mRNA (cDNA) sequence of Homo sapiens POU class 5 Homo box 1 (POU5F1), Transcript variant 2, Genbank accession number NM-203289.4, Homo sapiens] Gene ID: 5460. Exemplary genomic, mRNA (cDNA) and protein sequences for SOX2 are also known in the art and include, for example, the mRNA sequence Homo sapiens SRY (sex determining region Y) - Box 2 (SOX2), mRNA (cDNA) Sequence See SOX2 SRY (sex determination region Y) - Box 2 [Homo sapiens], Genzyme ID: 6657, which provides Genbank accession number NM-003106.2. Exemplary genomic, mRNA (cDNA) and protein sequences for NANOG are also known in the art and include, for example, Homo sapiens Nanog, NANOG, mRNA (cDNA) NANOG Nanog Homo-box [Homo sapiens], which provides NM-024865.2, JIN ID: 79923. Exemplary genomic, mRNA (cDNA) and protein sequences for LIN28 are also known in the art and include, for example, Homo sapiens lin-28 phase A ( C. elegans ) (LIN28A) (SEQ ID NO: 79727), which provides the mRNA (cDNA) sequence designated mRNA (SEQ ID NO: 9) providing the Accession Number NM-024674.4. Exemplary genomic, mRNA (cDNA) and protein sequences for KLF4 are known in the art and include, for example, the homologous Kruppel-like factor 4 (KLF4), the mRNA named mRNA cDNA). See KLF4 Crepel-like Factor 4 (Chapter) [Homo sapiens], Ser. No. 9314, which provides Sequence Bank Accession No. NM-004235.4. The mRNA sequence for MYC is also known in the art and includes, for example, Homo sapiens v-myc myelodysplastic virus tumor gene homologue (algae) (MYC), mRNA (cDNA) MYC v-myc myelomatosis virus tumor genome (bird) [Homo sapiens], No. ID: 4609, which provides number NM-002467.4.

The term "stem-loop structure" is intended to include a region of nucleotides that is known or predicted to form a double strand (stem portion) which is predominantly connected to one side by a region of a single- Refers to a nucleic acid having a differential structure. The terms "hairpin" and "fold-back" structures are also used herein to refer to a stem-loop structure. Such structures are well known in the relevant art, and these terms are used consistently in their known meaning in the related art. The actual primary sequence of the nucleotides in the stem-loop structure is not critical to the practice of the present invention as long as the secondary structure is present. As is known in the relevant art, the secondary structure does not require precise base-pair formation. Thus, the stem may comprise one or more base mismatches. Alternatively, base-pairing can be accurate, i.e. it may not contain any mismatches.

The term "stem cells" as used herein refers to undifferentiated cells that can be induced to proliferate. Stem cells are self-sustaining, meaning that one daughter cell is also a stem cell at the time of each cell division. Stem cells can be obtained from an embryo, a fetus, a baby, a child or an adult tissue. The term "precursor cells" as used herein refers to undifferentiated cells derived from stem cells, and not stem cells as such. Some progenitor cells can produce offspring that can be differentiated into more than one cell type.

The term "derived pluripotent stem cells" (or "iPS cells") as used herein refers to stem cells derived from somatic cells, for example, differentiated somatic cells and having a higher potency than the somatic cells. iPS cells are capable of differentiation into self-renewing and mature cells, such as smooth muscle cells. iPS may also be able to differentiate into smooth muscle progenitor cells.

As used herein, the term "isolated " refers to a cell in which the cell naturally occurs, for example, in a different environment from where the cell naturally occurs in the multicellular organism, and when the cell is removed from the multicellular organism, Is "isolated". Isolated genetically modified host cells may be in a mixed population of genetically modified host cells or in a mixed population comprising genetically modified host cells and unmodified host cells. For example, isolated genetically modified host cells can be present in an in vitro blended population of genetically modified host cells, or in an in vitro blended population comprising genetically modified host cells and unmodified host cells.

As used herein, "host cell" refers to a eukaryotic cell that can be used as a recipient of a nucleic acid (e. G., An exogenous nucleic acid) or used in vivo or in vitro cells (e. G. , And progeny of the original cell genetically modified by the nucleic acid. It is understood that the offspring of a single cell may not necessarily be completely identical to the original parental form or the genomic or total DNA complement due to natural, accidental or deliberate mutation.

The term " transgenic "refers to a permanent or transient genetic change induced in a cell after introduction of a new nucleic acid (i. E., A nucleic acid that is exogenous to the cell). Genetic alteration ("transformation") can be achieved by incorporating the new nucleic acid into the genome of the host cell, or by temporary or stable maintenance of the new nucleic acid as an extrachromosomal element. If the cell is a eukaryotic cell, a permanent genetic change can be achieved by introducing the nucleic acid into the genome of the cell. Suitable methods of gene modification include viral infection, transfection, splicing, protoplast fusion, electroporation, particle gun techniques, calcium phosphate precipitation, direct microsurgery, and the like.

As used herein, the term "exogenous nucleic acid" refers to a nucleic acid molecule that is not normally or naturally found and / or which is not produced by the cell in nature and / or is introduced into the cell (e. G., Electroporation, transfection, infection, By any other means of introducing the nucleic acid into the cell).

The terms "treating "," treating ", etc. as used herein refer to obtaining the desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing the disease or its symptoms and / or may be therapeutic in terms of partial or complete healing of the adverse effects that may be due to the disease and / or disease.

As used herein, "treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes (a) preventing the disease from occurring in a subject that may be postmarked for the disease, but has not yet been diagnosed as having the disease Prevention; (b) inhibiting the disease, i.e., arresting the development of the disease; And (c) relieving the disease, i. E., Causing regression of the disease.

The terms "individual", "subject", "host", and "patient" used interchangeably herein are intended to encompass all types of human, non-human primate, rodent (eg, mouse, rat, , Cats, and the like. In some embodiments, the subject of interest is a human. In some embodiments, the subject is a non-human animal, such as a monkey, rodent or rabbit species.

"Therapeutically effective amount" or "effective amount" means the amount of a compound, amount of nucleic acid or number of cells sufficient to effect such treatment for a disease when administered to a subject for treating the disease. The "therapeutically effective amount" will vary depending on the compound or cell, the disease and its severity, and the age, weight, etc. of the subject to be treated.

Before the present invention is further described, it is to be understood that the invention is not to be limited to the specific embodiments described, but may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting, since the scope of the present invention should be limited only by the appended claims.

Where a range of values is provided, each intermediate value from the upper or lower limit of the range to the tenth of the lower limit unit, and any other stated value of the stated range, unless expressly specified otherwise in the context Or intermediate values are understood to be encompassed within the present invention. The upper and lower limits of these smaller ranges may be included independently in smaller ranges and are also encompassed within the invention, apart from any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the present invention.

Unless defined otherwise, all technical scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated by reference herein to disclose and describe the methods and / or materials recited in the publications.

In one aspect of the disclosure, mRNA-based reprogramming is performed using the N-terminal MyoD transcription activation domain (Hirai et al., Stem Cells, 2011) or the triple repeat of the C-terminal VP16 transcription activation domain (Wang et al. , EMBO Reports, 2011, where the synthetic reprogramming factor was generated by fusing the VP16 transcriptional activation domain to OCT4 (also known as Pou5f1), NANOG and SOX2, respectively, and these synthetic factors were enhanced in both mouse and human fibroblasts Through the use of engineered variants of Oct4 or Sox2 incorporating either a "standard" RF cocktail, which can be reprogrammed with the aid of two additional factors, Rarg and Lrh-1 Wang et al., PNAS, 2011). The contents of each of these are incorporated herein by reference. Strong transcriptional activators can effectively mobilize multiple chromatin remodeling complexes when bound to DNA of a specific site. A good example is MyoD, the master transcription factor of skeletal muscle development that can alter the fate of differentiated cells. Hirai et al. Estimated that because MyoD is such a strong transcription factor, it could increase the chances of chromatin access to the iPS factor if fused together. When mouse or human cells were transduced with retroviral vectors carrying the Oct-MyoD TAD fusion gene with Sox2 and Klf4, they increased the number of iPSC colonies by ~ 50-fold compared to the normal iPS factor. Similarly, VP16, widely known as a potent transcriptional activator, may exhibit a strong stimulatory effect on reprogramming when fused to different iPS factors.

Exemplary manufacture of human iPSC

The method may further comprise, for example, adjusting hematopoietic stem cells, mesenchymal stem cells, epithelial stem cells, and muscle satellite cells, or leukocytes, platelets, stromal cells, adipocytes, osteoclasts including erythrocytes, lymphocytes But are not limited to, osteocytes including, but not limited to, osteocytes, epithelial tissues including skin cells, muscle tissues including smooth muscle, skeletal muscle and cardiac muscle, vascular tissue including endothelial cells, liver tissue including hepatocytes, Lt; RTI ID = 0.0 > iPS < / RTI > cells capable of forming differentiated cells of the iPS cells. In iPS cells, myocardial cells, hematopoietic stem cells, osteocytes such as osteocytes, hepatocytes, retinal cells, and neurons, stem cells such as unrestricted isolated embryonic stem cells, hematopoietic stem cells and induced pluripotent stem cells Methods of inducing differentiation into a variety of differentiated cell types including, but not limited to, can be induced to differentiate by transient transfection with RNAs that induce differentiation. Additionally or alternatively, the cells can be regenerated by culturing the cells under cell type-specific conditions. For example, iPS cells may be adapted to no-feeder conditions after being maintained on a CF-I feeder. iPS cells can be induced to form differentiated retinal cells by culturing the cells in the presence of noggin, Dkk-1 and IGF-1.

Previously reported methodologies relied on integrating the vector, viral or plasmid, to carry the modified factor. In one embodiment, the reprogramming test was performed using a transcript for five mRNA reprogramming factors (Oct4, Sox2, Klf4, cMyc-T58A and Lin28), or a 7- reprogramming factor including Rarg and Lrh- RF cocktail, and each combination was tested in three mutations based on wild-type Oct4 and MyoD- and VP16-Oct4 fusion constructs (designated M3O and VPx3, respectively) Was tested. BJ fibroblasts were transfected with feeder-based reprogramming cultures for 11 days, and the morphology advanced to this point was evident in several wells. Over the next few days, colonies with characteristic hESC morphology appeared in wells transfected with cocktails based on wild-type Oct4 and M3O. Target cells in VPx3-transfected cultures maintained morphology of fibroblasts, but exhibited some tendency to aggregate into accelerated growth and proliferation and no colonies appeared. The 5-factor and 7-factor embodiments of the wild-type Oct4 and M3O-based cocktails showed similar colony productivity and therefore did not benefit from the inclusion of Rarg and Lrh-1 in the cocktail. However, the M3O cocktail provided multiple times the number of colonies produced by wild-type Oct4. In view of these results, colonies were selected from M3O 5-factor wells for propagation and further analysis (Fig. 1). The versatility of M3O-derived colonies was confirmed by immunostaining for nuclear and cell-surface markers and in vitro differentiation into three primary platelets. Six proliferated iPSC clones were subjected to karyotyping and DNA fingerprinting, and the karyotyping and BJ sequences of the cells were confirmed in all cases.

The method may further comprise, for example, adjusting hematopoietic stem cells, mesenchymal stem cells, epithelial stem cells, and muscle satellite cells, or leukocytes, platelets, stromal cells, adipocytes, osteoclasts including erythrocytes, lymphocytes But are not limited to, osteocytes including, but not limited to, osteocytes, epithelial tissues including skin cells, muscle tissues including smooth muscle, skeletal muscle and cardiac muscle, vascular tissue including endothelial cells, liver tissue including hepatocytes, Lt; RTI ID = 0.0 > iPS < / RTI > cells capable of forming differentiated cells of the iPS cells. Methods for inducing differentiation into various differentiated cell types, including, but not limited to, myocardial cells, hematopoietic stem cells, osteocytes such as osteoclasts, hepatocytes, retinal cells and neurons in iPS cells are known in the art , PLoS One, 5 (1): e8763 (2010), Gai et al., Cell Biol Int 2009 3333 (11): 1184-93 (2009) Grigoriadis et al., Blood, 115 (14): 2769-76 (2010)). Stem cells, including, but not limited to, isolated embryonic stem cells, hematopoietic stem cells, and induced pluripotent stem cells may be induced to differentiate by transient transfection with RNAs that induce differentiation. Additionally or alternatively, the cells can be regenerated by culturing the cells under cell type-specific conditions. For example, iPS cells may be adapted to no-feeder conditions after being maintained on a CF-I feeder. iPS cells can be induced to form differentiated retinal cells by culturing the cells in the presence of noggin, Dkk-1 and IGF-1. In yet another aspect, the efficacy of mRNA cocktails can be further enhanced by the inclusion of Nanog transcripts. In this embodiment, four wells containing 50K BJ fibroblasts on the feeder were transfected with wild-type Oct4 or M3O-based 5-factor or 6-factor cocktail for 6 days, then each culture was transferred to 6- Were subcultured 1: 6 on fresh feeders to be aggregated in plates (4). Transfection continued for 0-5 days in each plate. To evaluate the effect of different cocktail and transit time lapse on iPSC productivity, cultures were fixed and stained with TRA-1-60 antibody on day 18 (day 0 corresponds to the initial transfection). The results suggested that the addition of Nanog to the cocktail was very beneficial independent of the Oct4 variant used, while the maximum conversion efficiency was obtained when M3O and Nanog were used together.

In one embodiment, the efficacy of an M3O-based 5-factor or 6-factor cocktail was confirmed in further feeder-based experiments using three additional human fibroblast cell lines (HDF-f, HDF-n and XFF) . Reprogramming kinetics and efficiency were significantly improved by all three of these low-passaged cell lines, indicating a faster natural population doubling time than BJ in normal proliferating cultures. In some cases, the inventors obtained hESC-like colonies at least 6 days after transfection, and the yield was much higher in experiments in which transfection continued for several more days. Experiments involving periodic enhancement of the feeder layer by the addition of fresh cells suggested that this strategy could provide some benefit, but would be offset by the complexity of the protocol generated. Therefore, the inventors have decided to focus on applying more powerful cocktails for the development of streamlined feeder-free protocols.

The present disclosure relates to the generation of a no-feeder iPSC. The origin of feeder-independent iPSCs has proven to be somewhat more difficult, irrespective of the commonly used reprogramming techniques, but raises specific difficulties in the context of persistent transfection therapies. There is a lower limit on the density at which fibroblasts can be plated without compromising cell viability and proliferative activity. The tendency of cells to undergo mitotic arrest or apoptosis in lean cultures is exacerbated when the cells are stressed by transfection and by ectopic expression of reprogramming factors. Moreover, the well-tolerated RNA capacity for high cell density features in feeder-based reprogramming results in a more severe cytotoxic effect when there is little or no cell distribution. At the same time, the degree of penetration of expression that can be achieved by mRNA transfection is likely to decline sharply after fibroblasts reach full growth due to possibly down regulation of intracellular entry and G1 arrest associated with contact inhibition. This reduced tolerance to transfection in dense cultures appears to be alleviated during reprogramming after the cells have undergone mesenchymal-epithelial transition (MET). However, the ~7 days typically required for human fibroblasts to reach MET when using current mRNA cocktails make it difficult to prevent the problem of fibroblast overgrowth even if the cells are plated at the lowest viable initial density. Cells may be diluted by subculture to postpone this fate, but the plating efficiency of highly stressed reprogrammed intermediates is difficult to predict, and in some cases subculture-based protocol sacrifices convenience and high throughput It does not fit the application. In certain embodiments, the cells may also be seeded with a gradient into the wells such that different local cell densities facilitate repeated transfection.

This disclosure relates to phenotypic indicators of MET (degeneration of the fibroblast process and appearance of proliferative and pebble forms). In one embodiment, MET provides enhanced cocktails that allow seeding of the target cells with various low densities (50K vs. 100K vs. 150K per well), no-feeder reprogramming using 6-factor M3O cocktails without subculture The inventions of the inventors of the present invention were accelerated. In another embodiment, the cells are seeded with a density gradient using cells ranging from about 15K to 500K total cells per well.

One aspect of the invention relates to the fate of these reprogrammed cultures, presumably because they are highly susceptible to seeding densities because both the effects of excessive cytotoxicity and fibroblast transient growth are self-reinforcing over the course of transfection therapy Proven. In experiments using "standard" RNA administration (1200 ng per well), dozens of hESC-like colonies were obtained from HDF-n and XFF fibroblasts plated at 100K per well, while the corresponding 50K and 150K cultures were group But only a few colonies as a result of destruction and fibroblast overgrowth. Even with the most promising (150K) cultures, only a sporadic colony with delayed kinetics was found to be inactivated immediately after reaching the full growth, in the results obtained by two other fibroblast cell lines BJ and HDF-a ≪ / RTI >

One aspect of the invention is a method of purifying mRNA transcribed in vitro via size exclusion chromatography to remove abnormal RNA species that can form the dsRNA structure by itself or can be formed using mRNA and that can cause a cellular immune response . Using this "clean-up" mRNA-mRNA with reduced cellular immunogenicity-effectively enabled reprogramming of non-human primate cells grown at a density of the gradient.

In one specific embodiment of the present invention, the present inventors have turned to a 5% oxygen culture in the surroundings and, from an effort to minimize stress-induced cell senescence, RNA administration.

In one example of the present invention, using these novel conditions, the present inventors have tested whether substitution of c-Myc with L-Myc can further improve reprogramming cocktail.

In another embodiment, we evaluated simplified transfection schemes by adding RNA to the cells daily, replacing the medium rather than delivering the RNA to the separation step 4 hours prior. RNA administration was down-regulated in "24-hour transfection" wells to compensate for the expected increase in cytotoxicity, and two different transfection reagents were tested (RNAiMAX and stems). XFF cells were plated at 50K per well and transfected for 9 days. Conventional "4-hour transfection" therapy provided approximately several hundred TRA-1-60 ⁺ colonies per well using c-Myc-based cocktails, while L-Myc cocktail was performed relatively poorly (FIG. 2). The results of the "24-hour transfection" culture were more impressive. The most productive cases in these wells (corresponding to c-Myc 400 ng / ml stem condition conditions), cultures were almost overgrown by hESC-like cells 24 hours after the last transfection on day 9. The mechanistic basis for the superior performance of "24-hour transfection" can have the effect of increasing the effective density of dilute cultures by concentrating the diffusion factors released by the cells. When these preferred protocol conditions were applied to another exemplary experiment using HDF-a fibroblasts in cultures seeded with 75 K cells per well, productivity was less dramatic than that achieved when it was a highly proliferating XFF cell, hESC-like colonies again appeared on day 9 of the protocol (Fig. 4).

In one particular embodiment, when the cells are seeded in a volume of a conventionally used volume, for example, 1 ml, 0.75 ml, 0.5 ml, or a medium of lower volume than the minimum amount of medium that can still sustain cell culture , The efficiency of reprogramming using the conditions described above is clearly improved. The low volume conditions during this reprogramming are included herein by the present invention.

The embodiments described herein are, of course, not the sole applications of the present invention. Those of ordinary skill in the relevant art will appreciate that the disclosure is also useful for reprogramming other cells under conditions that are somewhat variable or with similar combinations of conventional or manipulated factors for reprogramming, Will recognize.

In another embodiment, optimization of the factor stoichiometry can also improve the rate of reprogramming-the mRNA method provides an opportunity to define a cocktail that handles the early and late stages of ipPSC induction independently. Advantages obtained from the use of M3O provide verification of the recent application of novel manipulated reprogramming factors for iPSC generation. Such engineered reprogramming factors include fusion of SOX2, KLF4, CMYC, LMYC, LIN28, NANOG, etc. to transcriptional activation domains from other factors other than VP16 or MYOD, such as GAL4, GATA1, The reagents and methodology used to deliver mRNA can also be used to co-transfect siRNA and miRNAs and their value in iPSC generation has already been demonstrated. Nevertheless, the no-feeder protocol disclosed herein reduces the time required for reprogramming by as much as half, with the same or greater reduction of labor and material costs, eliminates the cumbersome steps in the procedure, That is, the mRNA is delivered to the cell with almost the same ease as the media supplements, which represents a significant improvement over current protocols.

In some embodiments, the cells are reprogrammed to modulate the immune response. For example, a lymphocyte can be reprogrammed into a regulatory T cell that can be administered to a patient in need thereof for increased immunity, particularly autoimmunity or delivery. The induction or administration of Foxp3-positive T cells may be used to reduce autoimmune reactions such as transplant rejection and / or to treat autoimmune diseases or disorders such as diabetes, multiple sclerosis, asthma, inflammatory bowel disease, thyroiditis, renal disease, rheumatoid arthritis, (ALPS), autoimmune thrombocytopenic purpura (ATP), autoimmune thrombocytopenic purpura (ATP), autoimmune thrombocytopenic purpura (ATP), autoimmune thrombocytopenic purpura Chronic inflammatory syndrome (CFIDS), chronic inflammatory dehydrative polyneuropathy, cicatricial pemphigoid, cold agglutinin disease, Crest syndrome, Crohn's disease, Crohn's disease, Crohn's disease, Disease disease, dermatomyositis, pediatric dermatomyositis, dysmenorrhoea, intrinsic mixed cold globulinemia, fibromyalgia - fibrosis, Graves' disease (ITP), IgA nephropathy, insulin-dependent diabetes mellitus (Type I), pediatric arthritis, Meniere's disease, mixed connective tissue disease, multiple sclerosis, severe Psoriasis, Raynaud's phenomenon, Reiter's syndrome, myasthenia gravis, myelodysplastic syndrome, rheumatoid arthritis, myasthenia gravis, myasthenia gravis, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reduction of one or more symptoms of rheumatic fever, sarcoidosis, scleroderma, Sjogren's syndrome, dyskinesia, Takayas's arteritis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vaginitis, vitiligo and Wegener's granulomatosis, Lt; RTI ID = 0.0 > and / or < / RTI >

The methods can be used to produce cells that may be useful in the treatment of a variety of diseases and disorders including, but not limited to, Parkinson's disease, Alzheimer's disease, wound healing, and diseases such as multiple sclerosis. The method is also useful for regeneration or supplementation of organ regeneration and immune systems. For example, cells at different stages of differentiation, such as iPS cells, hematopoietic stem cells, pluripotent cells or mononuclear cells, such as precursor cells, such as epithelial precursor cells, may be administered intravenously or by local surgery. The method may be used in combination with other conventional methods, such as prescription medicines, surgery, hormone therapy, chemotherapy and / or radiation therapy.

In one embodiment, the kit comprises means for transfecting RNA, cells, and RNA into cells. The RNA can be lyophilized or in solution. The kit may optionally comprise other substances, such as cell culture reagents. In an alternative embodiment, the kit provides regenerated, demineralized or reprogrammed cells prepared according to the disclosed method and is stored and / or shipped frozen or frozen for later use. Cells are typically stored in solution to maintain viability. The kit containing the cells should be stored or shipped using a method that is consistent with the survival rate, such as in a cooler containing dry ice so that the cells remain below 4 ° C, preferably below -20 ° C.

The kit optionally comprises one or more of the following: bioactive agents, media, excipients; And at least one of a syringe, a needle, a thread, a gauze, a bandage, a disinfectant, an antibiotic, a local anesthetic, an analgesic, a surgical thread, a scissors, a sterilized fluid, and a sterilized container. The ingredients of the kit can be individually packaged and sterilized. The kit is generally provided in a container, for example a plastic, cardboard or metal container suitable for commercialization. Any kit may contain instructions for use. Methods can be used to generate cells that may be useful in the treatment of various diseases and disorders including, but not limited to, neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease and multiple sclerosis. The methods disclosed herein are also useful for regeneration or supplementation of organ regeneration and immune systems. For example, cells at different stages of differentiation, such as iPS cells, hematopoietic stem cells, pluripotent cells or mononuclear cells, such as precursor cells, such as epithelial precursor cells, may be administered intravenously or by local surgery. The method may be used in combination with other conventional methods, such as prescription medicines, surgery, hormone therapy, chemotherapy and / or radiation therapy.

Aspects of the present disclosure provide stem cell culture systems and methods of differentiation for the production of dermal tissue cells for wound healing, and stem cell therapy for the treatment of arthritis, lupus and other autoimmune-related diseases.

Example

The present invention will now be described with reference to the following examples. These embodiments are provided for illustrative purposes only, and the present invention is not limited to these embodiments, but rather encompasses all variations evident as a result of the teachings provided herein.

Example 1 - Generation of IVT template

Plasmid constructs for the generation of linear PCR-products in in vitro transcription (IVT) templates were constructed using Ligation Independent Cloning (LIC). We first constructed a parent plasmid (pIVT) with 5 'and 3' untranslated regions (UTRs) flanked with inserts designed to accommodate open-reading frame (ORF) inserts encoding the protein of interest. The ORF-flanking sequences are described in Warren et al., Cell Stem Cell, 2010, and include a low secondary structure leader and a strong Kozak site (5 'UTR) and a murine a-globin 3' UTR . A linearized version of the PIVT vector carrying the 5 'overhang was produced by re-annealing the two PCR products amplified from the plasmid using tailed primers. ORF PCR products with complementary overhangs were produced by similar procedures and transformed into DH5a bacteria by heat shock to pool with vector PCR products and to clone gene-specific constructs (pIVT-KLF4, etc.). The resulting plasmids were prepared as described in Warren et al., Cell Stem Cell, 2010, by preparing a linear IVT template incorporating the T120 tail to cause the addition of the T7 promoter, UTR-flanked ORF and poly A tail Lt; RTI ID = 0.0 > PCR < / RTI > The T120 tail region was introduced through the use of a tailored reverse primer (T120CTTCCTACTCAGGCTTTATTCAAAGACCA). For M3O and VPx3 fusion constructs, the transcriptional activation domain-coding sequence was added to the ORF by PCR using tailed primers. The PCR product template stock was maintained at a concentration of ~ 100 ng / uL.

Example 2 - Production of mRNA cocktail

The mRNA synthesis process is summarized in FIG. A synthetic mRNA was generated by IVT reaction using a 4: 1 ratio of ARCA cap analog to GTP to produce a high percentage of capped transcripts. The overall substitution of CTP for 5m-CTP in the nucleotide triphosphate (NTP) mixture and for UTP in pseudo-UTP was used to reduce the immunogenicity of the RNA product. Cap analogs and modified NTP were purchased from Trilink Biotechnologies. A 2.5x NTP mixture was prepared to replace the standard NTP provided in the MEGAscript T7 kit (Ambion) used to perform the IVT reaction (15: 15: 3.75: 3.75: 3.75 mM ARCA : ATP: 5m-CTP: GTP: Pseudo-UTP). Each 40 uL IVT reaction contained 16 uL NTP mixture, 4 uL 10x T7 buffer, 16 uL DNA template and 4 uL T7 enzyme. The reaction was incubated at 37 ° C for 4-6 hours and then treated with 2 μl TURBO DNase at 37 ° C for an additional 15 minutes and then purified on a MEGAclear (armion) spin column to yield 100 μl of RNA product ≪ / RTI > To remove the immunogenic 5 ' triphosphate moiety from the unencapsulated transcript, 10 [mu] L of Antarctic Phosphatase reaction buffer and 3 [mu] L of antarctic phosphatase (NEB) were added to each preparation . The phosphatase reagent was incubated at 37 < 0 > C for 30 minutes and the IVT product was refed. The RNA yield was quantified as Nanodrop (Thermo Scientific) and the preparation was final adjusted to a standardized working concentration of 100 ng / uL by the addition of TE pH 7.0 (cancer temperature). The RNA cocktail was assembled by pooling the preparations representing various RFs at the desired stoichiometric ratio. The fractions of each RF used accounted for the predicted molecular weight of each transcript, and all RFs remained stationary except for Oct4 and its derivatives contained at 3x molar concentrations. A 10% spike of mRNA encoding a short-lived nucleotide monomer LanYFP fluorescent protein was added to the cocktail to facilitate monitoring of transfection efficacy during the reprogramming test. In another embodiment, mRNA was also produced using 2-thio-uracil at 25% or 10% of total uracil (see FIG. 6).

Example 3 - Cells and Culture Medium

Cells targeted for reprogramming were BJ neoplastic fibroblasts (ATCC), HDF-f embryonic fibroblasts, HDF-n neoplastic fibroblasts and HDF-a adult fibroblasts (ScienCell), and XFF non- 0.0 > fibroblast < / RTI > cells (Millipore). Proliferation cultures were performed in BJ medium (DMEM + 10% FBS), cyanocyte fibroblast medium, and FibroGRO non-xenograft human fibroblast growth medium (Millipore) for each of BJ, HDF and XFF cells . The feeder cells used were 3001G irradiated neonatal human prey fibroblast cells (GlobalStem) and mitomycin C-inactivated non-heterologous human neonates fibroblast (Millipore) on piebrag. An appropriate cell passaged culture step for a non-heterogeneous feeder-based and no-feeder reprogramming test was performed using TrypLE Select (Gibco), a non-animal product cell dissociation reagent.

Example 4 - Reprogramming of human fibroblasts

All reprogramming experiments described were performed on 6-well tissue culture plates coated with CELLstart (Gibco) non-xenogenic substrates according to the manufacturer's instructions. The global stem feeder was plated at 250K per well in an initial BJ reprogramming experiment using FBS-containing BJ medium. In some later feeder-based tests, in order to increase the seeding density and respond to the high consumption rate encountered using the new RF cocktail, the feeder is replenished instantaneously during medium change in an effort to sustain the feed- Respectively. Non-heterogeneous feeders were plated on serum-free pluritone-based reprogrammed medium when used. Target cells were plated in Fluriton's serum-free medium (Stemgent) plus antibiotics, fluritone supplements and 200 ng / ml B18R interferon inhibitor (eBioscience). The medium was changed daily during reprogramming and after reprogramming and B18R supplementation was stopped the day after the final transfection. In experiments in which the cells were divided on a fresh feeder during reprogramming, 10 uM Y27632 (stemgent) was included in the medium used for replating. Transfection began on the day following seeding of the target cells and was repeated at 24-hour intervals for the duration indicated in the literature. Unless otherwise noted, 1200 ng RNA volume was delivered to each well using RNAiMAX (Invitrogen) 4 hours before the day of medium change. The RNAiMAX-based transfection cocktail was prepared by diluting 100 ng / uL RNA in 5x no-calcium / magnesium DPBS to 5 x, and 5 uL RNAiMAX per ug of RNA in the same diluent to 10x and adding 10 ng / uL RNA / vehicle Pooled to produce a suspension, and dispensed into the culture medium after a 15 minute room temperature incubation. For transfection using the stem-effect reagent (stemgent), RNA and stems (4 uL per ug of RNA) were mixed in a stem-block buffer to provide an RNA concentration of 10 ng / uL. The mixture was incubated for 15 minutes and then transferred to the culture medium or frozen for later use.

In another embodiment, reprogramming of human fibroblasts was also performed in a medium other than fluritone, for example, a reprogrammed medium of alleles (see FIG. 7). In some experiments, B18R was not used at all, and in other experiments it was used only in a subset of transfection.

Example 5 - Characterization of iPSC colonies

To evaluate iPSC colony productivity, the reprogrammed cultures were fixed with 4% paraformaldehyde in DPBS (containing calcium / magnesium) and stained with 100x diluted StainAlive TRA (containing calcium / magnesium) in DPBS -1-60 Alexa 488 antibody (stemgent). Colonial sorting, proliferation, and subsequent immunostaining and triplet differentiation assays were performed for molecular and functional validation of universality. DNA fingerprinting and karyotyping were performed. Terrestidome formation was performed and confirmed in more than one set of mouse models. This proved the pluripotency of stem cells.

in which a target cell is contacted with a combination of an engineered reprogramming factor and a non-engineered reprogramming factor in such a way that the iPSC can be produced within about 9 days, sometimes even 6 days, or even 5 days. - a novel method for highly efficient reprogramming from stem cells to pluripotent stem cells has been disclosed. These iPS cells can be produced as a no-feeder, no-heterogeneous and no-footprint iPSC. In addition to the dramatically increased reprogramming efficiency achieved by the method of the present invention, the new technique also differs from all previously known techniques in that the resulting iPSC is "clean " since it is not in contact with any viruses or vectors . The utility of the present invention can be found in virtually all areas involving cell and developmental studies, as well as stem cell establishment, differentiation, and utility in clinical applications. Similar procedures may also be useful for directed differentiation or conversion differentiation.

Example 6 - Reprogramming of Cynomolgus monkey fibroblast

Reprogramming experiments using synomolgus monkey fibroblasts were performed on 6-well tissue culture plates coated with a CellStart (Gibco) substrate according to the manufacturer's instructions. Target cells were plated on a non-serum medium + antibiotic of Allele Biotech. The medium was changed daily during and after reprogramming with the 2-thio-modified mRNA / transfection reagent mixture delivered with fresh medium for 12 consecutive days with or without B18R (FIG. 8). Colonies of monkey iPSCs began to appear on day 9 and reached a mature, dense colony stage on day 12.

                               SEQUENCE LISTING <110> ALLELE BIOTECHNOLOGY AND PHARMACEUTICALS, INC.   <120> FEEDER-FREE DERIVATION OF HUMAN-INDUCED PLURIPOTENT STEM CELLS       WITH SYNTHETIC MESSENGER RNA <130> F6035-00038 <140> PCT / US2015 / 033275 <141> 2015-05-29 <150> 14 / 292,317 <151> 2014-05-30 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 120 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       폴리 누리otide <400> 1 tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt 60 tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt 120 <210> 2 <211> 149 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic       primer <400> 2 tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt 60 tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt tttttttttt 120 cttcctactc aggctttatt caaagacca 149

Claims (31)

The isolated somatic cells are transfected with a composition comprising an effective amount of a fusion product between any one or more of the synthetic mRNA reprogramming factors selected from Oct4, Sox2, Klf4, cMyc, Nanog and Lin28 and the transcription activation domain, &Lt; / RTI &gt; wherein the somatic cells are depleted or reprogrammed. 3. The method of claim 1, wherein the synthetic mRNA is purified to remove any contaminating non-mRNA species from the transcription. 2. The method of claim 1, wherein the cells are seeded with a density gradient in the well. 2. The method of claim 1, wherein the cell is a non-human primate cell. 2. The method of claim 1, wherein the cell is a Cynomolgus monkey cell. 2. The method of claim 1, wherein the cell is a Lysus monkey cell. The method according to claim 1, wherein the cell is a baboon. 2. The method of claim 1, wherein the cell is a canine cell. 2. The method of claim 1, wherein the cell is a marine cell. The method of claim 1, wherein the cell is a small cell. The method of claim 1, wherein the cell is a porcine cell. 10. The method of claim 1, wherein the cell is both cells. 2. The method of claim 1, wherein the composition comprises Oct4 fused to an N-terminal MyoD transcription activation domain. 3. The method of claim 2, wherein Oct4 is fused to the N-terminal MyoD transcriptional activation domain in a ternary triplet. Growing the target cells at a density of 25 k to 250 k cells / well on a no-feeder surface in a standard 6-well plate; And
Synthesis of the reprogramming factor of claim 1 The step of transfecting cells using at least one of the mRNAs in a volume ranging from about 50 ng to about 800 ng / ml
Lt; RTI ID = 0.0 &gt; reprogramming &lt; / RTI &gt; the mammalian cell. 5. The method of claim 4,
Growing the target cells at a density of 50 k, 75 k, 100 k or 150 k cells / well on a no-feeder surface in a standard 6-well plate; And
Synthesis of the reprogramming factor of claim 1 Use any one or more of the mRNAs to transfect cells using an mRNA dose ranging from about 50 ng to about 800 ng / ml, wherein lower doses The method comprising: And
Step of obtaining iPSC without subculture
&Lt; / RTI &gt; 5. The method of claim 4,
Target cells are grown at a density selected from any one of 15K, 30K, 50k, 75k, 100k, 150k, 250K, 500K cells / well on a no-feeder surface in a standard 6-well plate, Adjusting the volume of each well to from 0.5 ml to 5 ml of the appropriate medium; And
Synthesis of the reprogramming factor of claim 1 Any one or more of the mRNAs are used to transfect cells using an mRNA dosage in the range of about 50 ng to 800 ng / ml, wherein a lower dose is used at a later point in time ; And
Step of obtaining iPSC without passaging of cells
&Lt; / RTI &gt; 5. The method of claim 4, wherein the mammalian cell is a human cell. 5. The method according to claim 4, which is Xeno-free. 3. The method of claim 1, wherein the one or more factors are selected from the group consisting of mRNA, regulatory RNA, siRNA, miRNA, and combinations thereof. 2. The method of claim 1, wherein somatic cells are transfected with at least two different RNAs. 2. The method according to claim 1, wherein the somatic cell is selected from the group consisting of monoclonal, pluripotent, universal and differentiated cells. 2. The method of claim 1, wherein the at least one RNA induces dedifferentiation from somatic cells to monodent, versatile or pluripotent cells. 5. The method of claim 4, wherein at least one of the factors is selected from the group consisting of OCT4, SOX2, NANOG, LIN28, KLF4, and MYC mRNA. 5. The method of claim 4, wherein OCT4, SOX2, NANOG and LIN28 mRNA are administered in combination. 5. The method of claim 4, wherein OCT4, SOX2, KLF4 and MYC mRNA are administered in combination. 2. The method of claim 1, wherein the transfected cells are maintained in culture as induced pluripotent stem (iPS) cells. The method according to claim 1, wherein the transfected cells further comprise induced pluripotent stem cells and inducing iPS cells to form differentiated cells. A method of treating or inhibiting one or more symptoms of a disease or disorder in a patient, comprising: demineralizing the cells in vitro in accordance with the method of claim 1; and administering the cells to the patient. 3. The method of claim 2, wherein the composition further comprises a Rarg and LrH-1 transactivation domain. 2. The method of claim 1, wherein the composition comprises Oct4 fused to a VP16 transcriptional activation domain.

Images