TWI633114B - Preparation method of pcv2 capsid protein and pharmaceutical composition containing said capsid protein - Google Patents

Abstract

The present invention provides a method for preparing a porcine second type circovirus outer sheath protein and a pharmaceutical composition containing the outer sheath protein. The method of the present invention enhances the synthesis efficiency of the porcine second type circovirus outer sheath protein by using a novel arabinose-inducing expression vector. On the other hand, the pharmaceutical composition of the present invention combines the outer sheath protein and other advantageous components in an appropriate ratio to obtain an excellent immune-inducing effect.

Description

Method for preparing porcine second type circovirus outer sheath protein and containing the outer sheath protein Quality pharmaceutical composition

The invention relates to a method for preparing a porcine second type circovirus outer sheath protein; in particular to a method for preparing a porcine second type circovirus outer sheath protein using a prokaryotic expression system.

The second type of porcine circovirus type 2 (PCV2) is a viral pathogen that affects the global pig industry. It mainly causes post-weaning multisystemic wasting syndrome (PMWS). Symptoms include fever, swollen lymph nodes, weight loss or weakness, difficulty breathing, diarrhea, paleness, and occasional jaundice. It may also cause porcine dermatitis and nephropathy syndrome (PDNS), infectious congenital tremor (ICT) and reproductive disorders. In addition, PCV2 mixed with other viral or bacterial pathogens infecting pigs can cause porcine respiratory disease complex (PRDC). Diseases caused by pigs infected with PCV2 cause a lower rate of growth and feed change, which in turn causes serious economic losses for pig farmers.

In the field, the prevention and control of PCV2 proposes 20 points of feeding management, such as unified management, good health management, obsolescence or isolation and vaccination. Among them, vaccination can effectively reduce the infection rate of PCV2, thereby increasing the breeding rate. Currently The PCV2 vaccines in the field are divided into three categories, including non-activated PCV2 vaccine, non-activated baculovirus subunit vaccine, and non-activated porcine type 1 and type 2 circovirus (PCV1-PCV2) chimeric virus vaccines (Beach and Meng, 2012; Chanhee, 2012).

The PCV2 vaccine is not activated. After PCV2 is infected with the porcine kidney cell line PK-15, the virus solution is prepared by inactivated treatment and mixed adjuvant. The non-activated baculovirus subunit seedling is to carry the PCV2 outer sheath protein. (Capsid protein) After the baculovirus of the ORF2 gene was transfected into insect cells, the expression of the immunogenic ORF2 was performed. If the antigen is expressed in a cell, the vaccine is prepared by ultrasonically disrupting the culture solution containing the cells, and then performing the inactivation treatment and the mixed adjuvant. If the antigen is secreted extracellularly, the cell culture supernatant is collected, and then the vaccine is inactivated by the viral vector and mixed with the adjuvant to make a vaccine; the non-activated PCV1-PCV2 chimeric virus vaccine is replaced by the ORF2 in PCV1. It is made up of ORF2 of PCV2 and is subjected to cell infection, viral fluid collection, virus inactivation and mixed adjuvant.

Looking at the current production methods of PCV2 vaccines, the method of cultivating viruses is carried out, which has the disadvantages of long preparation time and high production cost. In order to reduce the cost of vaccines, researchers in the field tried to produce vaccine antigen ORF2 using recombinant E. coli with lower culture cost, but still suffered from low yield of ORF2, unable to form virus-like particles, complex process or The bottleneck of poor immune system.

Accordingly, it is an object of the present invention to provide a method for preparing a porcine second type circovirus outer sheath protein to reduce the production time and cost of the PCV2 vaccine.

Another object of the present invention is to provide a composition for preventing infection of a porcine type 2 circovirus, which comprises a porcine second type circovirus outer sheath protein as an active ingredient and a suitable adjuvant to provide an industry one. A tool for the prevention and treatment of porcine type 2 circovirus infection.

It is still another object of the present invention to provide a method for preparing porcine interferon to reduce the time and cost required for the production of porcine interferon, and to facilitate the use of porcine interferon for the control of porcine type 2 circovirus infection.

In order to achieve the above object, the present invention provides a method for expressing a protein comprising: (a) obtaining an arabinose-inducing expression vector; wherein the arabinose-inducing expression vector comprises a nucleotide sequence of a expression element and a target protein; Wherein the aforementioned expression element comprises: a promoter; a T7 phage translation enhancing element having the sequence of SEQ ID NO 01; and a ribosome binding site having the sequence of SEQ ID NO 02; (b) The arabinose-inducing expression vector is transformed into an E. coli host and subjected to induction of expression of the target protein; wherein the aforementioned target protein is: porcine type 2 circovirus outer sheath protein or porcine interferon.

Preferably, the -16 portion of the aforementioned promoter has the sequence set forth in SEQ ID NO:03.

Preferably, the aforementioned expression element has the sequence shown in SEQ ID NO 04.

Preferably, the aforementioned arabinose-inducing expression vector further comprises a nucleotide sequence of a fusion partner, and/or a nucleotide sequence of a marker molecule. Preferably, the fusion partner is: MsyB of Escherichia coli, YjgD gene of Escherichia coli, Lambda phage D protein, Baker's yeast SUMO protein, or a combination thereof. Preferably, the aforementioned labeling molecule is: His tag, Strep II tag, FLAG tag, or a combination thereof.

Preferably, the aforementioned target protein is a porcine second type circovirus outer sheath protein, and the nucleotide sequence thereof has the sequence shown by SEQ ID NO 09 or SEQ ID NO 24. Preferably, the aforementioned arabinose-inducing expression vector has the sequence shown in SEQ ID NO:46.

Preferably, the aforementioned porcine interferon is porcine interferon alpha or porcine interferon gamma. Preferably, the aforementioned target protein is porcine interferon, and the nucleotide sequence thereof has the sequence of SEQ ID NO 64 or SEQ ID NO 76. Preferably, the aforementioned arabinose-inducing expression vector has the sequence of SEQ ID NO 80, SEQ ID NO 87, or SEQ ID NO 95. Preferably, the aforementioned method does not comprise the folding step of the aforementioned porcine interferon.

Preferably, the aforementioned step (b) further comprises a step (c) of purifying the aforementioned target protein. Preferably, the aforementioned step (c) further comprises a step (d) of treating the aforementioned target protein with a SUMO protease. Preferably, in the treatment of the step (d), the weight ratio of the target protein to the SUMO protease is 4 to 20.

The present invention provides yet another composition for preventing and treating porcine type 2 circovirus infection, comprising: 2.5 to 250 μg/mL of porcine second type circovirus outer sheath protein; 2.5 to 25 μg/mL of porcine interferon alpha; 2.5 to 25 μg/mL of porcine interferon gamma; and a pharmaceutically acceptable carrier.

Preferably, the aforementioned composition further comprises a pharmaceutically acceptable adjuvant. Preferably, the pharmaceutically acceptable adjuvant is: MONTANIDE ^TM ISA 563 VG adjuvant, MONTANIDE ^TM GEL 01 adjuvant, Freund's complete or incomplete adjuvant, aluminum gel, surface active agent, polyanionic polymers, peptides , oil emulsion, or a combination thereof.

Preferably, the aforementioned composition comprises: 3.5 to 170 μg/mL of porcine second type circovirus outer sheath protein; 5 to 20 μg/mL of porcine interferon alpha; 5 to 20 μg/mL of porcine interferon gamma; A pharmaceutically acceptable carrier.

In summary, the present invention mainly provides a method for expressing a protein which induces expression vectors by using an arabinose. The method of the present invention contributes to the synthesis of porcine second type circovirus outer sheath protein and porcine interferon used as an adjuvant in vaccines with higher efficiency. On the other hand, the pharmaceutical composition of the present invention combines the outer sheath protein and other advantageous components in an appropriate ratio to obtain an excellent immune-inducing effect. Accordingly, the disclosure of the present invention is of significant benefit to the prevention and treatment of porcine type 2 circovirus in the field.

The first panel is a schematic representation of five porcine second type circovirus outer sheath protein expression vectors prepared in Example 1.

The second panel shows the protein-induced expression of the five expression vectors prepared in Example 1 after transfection into E. coli hosts by protein electrophoresis and Western blotting. (A) Protein electrophoresis results. (B) Western blotting results; line 1: BL21(DE3)/pET29a; line 2: BL21(DE3)/pET-SUMO-ORF2; line 3: BL21(DE3)/pET-OPTSUMO-ORF2; Line 4: Rosetta2/pET-SUMO-ORF2; Line 5: BL21(DE3)/pET-SUMO-OPTORF2; Line 6: BL21(DE3)/pET-OPTSUMO-OPTORF2; Line 7: BL21/pBA- OPTSUMO-OPTORF2.

The third panel shows the performance of the fusion protein after transformation of the four expression vectors prepared in Example 1 into E. coli host by protein electrophoresis. T: total cell disruption; S: soluble protein; IS: insoluble protein. The arrow indicates the target protein.

The fourth panel is a protein electropherogram showing the results of purification of the fusion protein expressed by pBA-OPTSUMO-OPTORF2 in host cells ( E. coli BL21) by immobilized metal ion affinity chromatography. Line 1: Total cell disruption of E. coli BL21 (pBA-OPTSUMO-OPTORF2); line 2: purified fusion protein.

The fifth panel shows the performance of recombinant SUMO protease (SUMOPH) and recombinant D-SUMO protease (DSUMOPH) in host cells [ E.coli BL21(DE3)] by protein electrophoresis and Western blotting. (A) Protein electrophoresis results. (B) Western blotting results. T: total cell disruption; S: soluble protein; IS: insoluble protein. The arrow indicates the target protein.

The sixth panel is a protein electropherogram showing the results of purification of recombinant proteases expressed by pET-SUMOPH and pET-D-SUMOPH in host cells [ E. coli BL21 (DE3)] by immobilized metal ion affinity chromatography. Line 1: Purified SUMO protease (SUMOPH); Line 2: purified D-SUMO protease (DSUMOPH).

The seventh panel is a protein electropherogram showing purification, shearing and filtration of the recombinant SUMO-ORF2 fusion protein. Line 1: Purified SUMO-ORF2 fusion protein quality. Line 2: Sheared SUMO-ORF2 fusion protein. Line 3: ORF2 fusion protein obtained after shearing and filtration (100 kDa filter membrane).

The eighth image is a transmission electron microscope image showing the SUMO-ORF2 fusion protein (A), the protease-cleaved recombinant SUMO-ORF2 fusion protein (B), and the ORF2 fusion obtained by protease cleavage and filtration. Protein (C) forms an image of viroid-like particles.

The ninth panel is a protein electropherogram showing the performance of recombinant porcine interferon of Example 3; T: total cell disruption; S: soluble protein. (A) pET-OPTPIFNAH/ E.coli Shuffle; (B) pBA-OPTPIFNAH/ E.coli Shuffle; (C) pET-SUMO-OPTPIFNAH/ E.coli Shuffle; (D) pET-OPTSUMO-OPTPIFNAH/ E.coli Shuffle; (E) pBA-OPTSUMO-OPTPIFNAH-l/ E.coli Shuffle; (F) pET-OPTPIFNRH/ E.coli BL21(DE3); (G) pET-SUMO-OPTPIFNRH/ E.coli BL21(DE3); (H) pET-OPTSUMO-OPTPIFNRH/ E.coli BL21(DE3); (I) pBA-OPTSUMO-OPTPIFNRH/ E.coli BL21 (DE3). The arrow indicates the target protein.

The tenth panel is a protein electropherogram showing the results of purification of the recombinant porcine interferon of Example 3. Line 1: E. coli Shuffle (pET-OPTPIFNAH) shows the result of purification of the fusion protein; Line 2: E. coli Shuffle (pBA-OPTSUMO-OPTPIFNAH) shows the fusion protein obtained by D-SUMO protease [pET- D-SUMOP/ E.coli BL21 (DE3) cell disrupted product] the result of purification after cleavage; line 3: E. coli BL21 (DE3) (pET-OPTSUMO-OPTPIFNRH) expressed the fusion protein by D- SUMO protease [pET-D-SUMOP/ E.coli BL21 (DE3) cell disrupted material] was purified after shearing.

The eleventh panel is the result of an ELISA test showing the anti-PCV2 antibody titer produced by each sample in the experiment of Example 4 in the pig.

The twelfth figure shows that each sample in Example 3 of Experiment 4 reduces viremia in pigs. Degree.

The thirteenth panel is the result of an ELISA test showing the anti-PCV2 antibody titer produced by each sample in the experiment 4 of Example 4.

The fourteenth graph shows the extent to which each sample in Example 4 of Example 4 reduced viremia in pigs.

The fifteenth panel is the result of an ELISA test showing the anti-PCV2 antibody titer produced by each sample in the experiment of Example 4 in the pig.

As mentioned above, although the field has attempted to produce the outer sheath protein of the porcine type II circovirus through the E. coli expression system, as of the application of the present invention, the shortcomings of the low yield have not been overcome, and the pig second has been hindered. The improvement of the epidemic prevention work of the circovirus.

The method of the present invention adopts the arabinose-inducing performance element disclosed in the applicant's invention patent application No. 103146225 (application date: December 30, 2014) to prepare a porcine type 2 circovirus. Outer sheath protein. The entire disclosure of the Chinese Patent No. 103146225 is incorporated herein by reference.

As used herein, "target protein" refers to a protein to be expressed by a prokaryotic expression system. In the present invention, the aforementioned target protein is a porcine second type circovirus outer sheath protein, porcine interferon alpha, or porcine interferon gamma.

As used herein, "nucleotide sequence of a protein of interest" or other similar description refers to a nucleotide sequence which, upon in vivo or in vitro transcription/translation mechanisms, forms the aforementioned protein of interest. Accordingly, the "nucleotide sequence of the porcine second type circovirus outer sheath protein" or "the nucleotide sequence of porcine interferon" of the present invention is also defined as before. Similarly, the "nucleotide sequence of the fusion partner" or "the nucleotide sequence of the labeled molecule" of the present invention is also defined as before.

The "fusion partner" as used in the present invention means a molecule which is used to enhance the water solubility of the aforementioned target protein for synthesis. For the above purpose, the nucleotide sequence of a fusion partner and the nucleotide sequence of the aforementioned target protein are genetically engineered on the same expression vector, thereby synthesizing the target protein and the fusion partner into a fusion protein. The aforementioned fusion partner is, for example but not limited to, MsyB of Escherichia coli, YjgD of Escherichia coli, Lambda phage D protein, Baker's yeast SUMO protein, or a combination thereof.

The "marker molecule" as used in the present invention refers to a molecule which is useful for observing the synthesis of the aforementioned target protein or for facilitating purification of the aforementioned target protein. For the above purpose, the nucleotide sequence of a labeled molecule and the nucleotide sequence of the aforementioned target protein are genetically engineered on the same expression vector, thereby synthesizing the target protein and the labeled molecule into a fusion protein. The aforementioned labeling molecules are for example but not limited to: His tag, Strep II tag, FLAG tag, or a combination thereof.

The first aspect of the present invention is directed to a method for producing a porcine second type circovirus outer sheath protein, porcine interferon alpha, or porcine interferon gamma. The above method comprises (a) obtaining an arabinose-inducing expression vector; wherein the arabinose-inducing expression vector comprises a nucleotide sequence of a expression element and a target protein; and (b) translating the aforementioned arabinose-inducible expression vector into a The expression of the target protein is carried out in an E. coli host.

In a possible embodiment, the aforementioned target protein is a porcine second type circovirus outer sheath protein. In a possible embodiment, the aforementioned target protein is porcine interferon alpha or porcine interferon gamma.

In a preferred embodiment, the foregoing performance component is as described in the applicant's invention patent application No. 103146225 (application date: December 30, 2014). Specifically, the aforementioned expression element comprises: a promoter; a T7 phage translation enhancing element; and a ribosome binding site. For example, the aforementioned performance component is the araB- M11 performance component described in the Chinese Patent Application No. 103146225.

In a preferred embodiment, the aforementioned T7 phage translation enhancing element has SEQ ID NO: The sequence shown by 01. In a preferred embodiment, the ribosome binding site has the sequence set forth in SEQ ID NO 02. In a preferred embodiment, the -16 portion of the aforementioned promoter has the sequence set forth in SEQ ID NO:03. In a preferred embodiment, the aforementioned expression element has the sequence set forth in SEQ ID NO:04.

In a possible embodiment, the foregoing step (b) further comprises a step (c) of purifying the aforementioned target protein. When a His tag is used as the aforementioned labeling molecule in the method of the present invention, the aforementioned target protein can be purified by immobilized-metal ion affinity chromatography.

In a possible embodiment, when the SUMO protein is used as the fusion partner in the method of the present invention, further comprising a step (d) after the step (c): treating the target protein with a SUMO protease. The above "treatment" means that the SUMO protease is cleaved by the SUMO fusion partner to separate the target protein from the SUMO protein.

In a possible embodiment, the aforementioned SUMO protease is produced by a T7 expression vector. In a preferred embodiment, in the foregoing treatment, the weight ratio of the target protein to the SUMO protease is 4 to 20.

In a preferred embodiment, the foregoing method does not comprise the folding step of the aforementioned porcine interferon. A "folding step" in the art that can be understood in a prokaryotic cell expression system refers to the process of dissolving the inclusion body by using urea or guanidine hydrochloride, and then dialysis and folding the peptide obtained. The process of forming a tertiary structure or a quaternary structure. Therefore, those skilled in the art can understand that the "folding step without the aforementioned porcine interferon" as described in the present invention means that the peptide prepared in the method of the present invention can be self-folded into a desired protein without using the aforementioned urea. Or artificial steps such as guanidine hydrochloride and dialysis.

In a possible embodiment, the aforementioned host is an Escherichia coli. Preferably, the aforementioned Escherichia coli is BL21, BL21 (DE3), Rosetta 2, or Shuffle.

The second aspect of the present invention is a group for preventing and treating porcine type 2 circovirus infection A compound comprising: a porcine second type circovirus outer sheath protein, porcine interferon alpha, porcine interferon gamma, and a pharmaceutically acceptable carrier.

In a preferred embodiment, the composition for preventing porcine second type circovirus infection comprises: porcine second type circovirus outer sheath protein of 2.5 to 250 μg/mL; and pig interference of 2.5 to 25 μg/mL; Αα; 2.5 to 25 μg/mL of porcine interferon gamma; and a pharmaceutically acceptable carrier. In yet another preferred embodiment, the aforementioned composition for controlling porcine type 2 circovirus infection comprises: 3.5 to 170 μg/mL of porcine second type circovirus outer sheath protein; 5 to 20 μg/mL Porcine interferon alpha; 5 to 20 μg/mL of porcine interferon gamma; and a pharmaceutically acceptable carrier.

In a preferred embodiment, the porcine second type circovirus outer sheath protein is produced by the method of the present invention. In a preferred embodiment, the aforementioned porcine interferon alpha, and/or the aforementioned porcine interferon gamma is produced by the method of the present invention.

The "pharmaceutically acceptable carrier" as used in the present invention means that the porcine second type circovirus outer sheath protein, the aforementioned porcine interferon alpha, and/or the aforementioned porcine interferon are not considered from the viewpoint of medicine/pharmacy. γ is a substance which adversely affects the purpose of the aforementioned composition against the infection of a porcine type 2 circovirus. In a possible embodiment, the aforementioned pharmaceutically acceptable carrier is, for example, but not limited to, water, phosphate buffered saline, alcohol, glycerin, chitin, alginate, chondroitin, vitamin E, minerals, or combination.

In a preferred embodiment, the aforementioned composition further comprises a pharmaceutically acceptable adjuvant. The "pharmaceutically acceptable adjuvant" as used in the present invention means that the porcine second type circovirus outer sheath protein, the aforementioned porcine interferon alpha, and/or the aforementioned pig are helpful from the viewpoint of medicine/pharmacy. Interferon gamma is a substance which produces an immunopotentiating effect on the purpose of preventing the infection of a porcine type 2 circovirus by the aforementioned composition. In one possible aspect of the embodiment, the pharmaceutically acceptable carrier such as, but not limited to: MONTANIDE ^TM ISA 563 VG adjuvant, MONTANIDE ^TM GEL 01 adjuvant, Freund's complete or incomplete adjuvant, aluminum gel, a surfactant Agents, polyanionic polymers, peptides, oil emulsions, or combinations thereof. In a preferred aspect of the embodiment, the pharmaceutically acceptable carrier is an adjuvant MONTANIDE ^TM ISA 563 VG, MONTANIDE ^TM GEL 01 adjuvant, or combinations thereof.

The research process of the present invention will be further detailed in the following examples. However, the following is merely illustrative of the features of the invention in order to facilitate understanding. It is within the scope of the invention to be apparent to those of ordinary skill in the art that the present invention may be practiced without departing from the spirit and scope of the invention.

Example 1: Construction of a porcine second type circovirus outer sheath protein (PCV2 ORF2) expression vector. Isolation and genomic sequencing of PCV2 virus

The lymphoid organs such as the spleen and lymph nodes of the sick pigs were obtained from the pig farm infected with PCV2 (Yunlin, Taiwan), and then cut with sterile scissors, and the lymphatic organs were ground with a sterilized grinding pest and a grinding rod, and the appropriate amount was added. The sterilized phosphate buffer solution was uniformly mixed to prepare an emulsion. The supernatant was collected by centrifugation (6,000 x g, 20 minutes) and filtered through a sieve to remove tissue debris. Viral DNA extraction was performed using a DNA purification kit (DNeasy Blood & Tissue kit; Qiagen, USA). 100 μL of the emulsion supernatant was taken, and 180 μL of ATL Buffer and 20 μL of proteinase K (proteinase K; 10 mg/mL) were added and allowed to act at 56 ° C for 2 hours. After that, add 200 μL of absolute alcohol and mix well. All the solution was pipetted into a spin column, and the centrifuge tube was placed in a collection tube and centrifuged at 6,000 x g for 1 minute. The centrifuge tube was placed in a new collection tube, and 500 μL of AW1 Buffer was added to the separation tube and centrifuged at 6,000 × g for 1 minute. The centrifuge tube was placed in a new collection tube, and 500 μL of AW2 Buffer was added to the centrifuge tube and centrifuged at 20,630 × g for 5 minutes. Place the centrifuge tube into a sterile microcentrifuge tube and drain the DNA by adding appropriate amount of sterile deionized water.

The primer PCVF (5'-ACCAGCGCACTTCGGCAGC-3'; SEQ ID NO 05) and PCVR (5'-AATACTTACAGCGCACTTCTTTCGT TTTC-3'; SEQ ID NO 06) were designed and amplified by polymerase chain reaction (PCR). PCV2 genomic DNA. PCR reaction mixture The volume was 100 μL, including 10 μL of the aforementioned DNA extracted from lymphoid organs, 10 μL of 10X Taq buffer, 200 μM of dATP, dTTP, dGTP and dCTP, 1 μM amplification primer and 2.5 U DreamTaq DNA Polymerase (Thermo, USA). The PCR reaction conditions were 94 ° C for 5 minutes (1 step); 94 ° C for 30 seconds, 59 ° C for 30 seconds, 72 ° C for 1 minute and 30 seconds (35 cycles); 72 ° C for 7 minutes (1 step) . DNA fragments were confirmed by DNA electrophoresis for the estimated size.

After the PCR product was recovered by PCR- ^MTM Clean Up kit (GMbiolab, Taiwan), TA selection was carried out using the probiotic yT&A selection vector reagent group (Yeastern, Taiwan). The experimental procedure is carried out by referring to the manufacturer's yT&A selection vector reagent set operation manual. 5 μL of the purified PCR product was mixed with 2 μL of yT&A vector, 1 μL of ligation buffer A, 1 μL of ligating buffer B, and 1 μL of T4 DNA ligase (2 unit/μL), and then applied at 22 ° C. minute. 1 μL of the ligation mixture was transformed into E. coli ECOS 9-5 (Yeastern, Taiwan). The transformed cells were added to 1 mL of SOC regeneration medium and shaken at 37 ° C for 60 minutes at 250 rpm. Thereafter, an appropriate amount of the bacterial solution was applied to a solid medium containing ampicillin (final concentration: 100 μg/mL), and cultured at 37 ° C for 16 hours.

Thereafter, the transformant strain was selected by colony polymerase chain reaction. The colony polymerase chain reaction reaction experimental procedure is as follows. First, prepare a microcentrifuge tube to add 50 μL of 2 times Premix reaction buffer (GMbiolab, Taiwan), 0.5 μL of 100 mM PCVF primer, 0.5 μL of 100 mM PCVR primer and 49 μL of sterilized water, mix well, and then carry out PCR reaction. The fraction was placed in a PCR vial (10 μL/tube). After the colony is spotted into the PCR vial with a toothpick, the PCR reaction can be performed. The PCR reaction conditions were 95 ° C for 5 minutes (1 step); 95 ° C reaction for 30 seconds, 59 ° C reaction for 30 seconds, 72 ° C, reaction for 1 minute and 30 seconds (25 cycles); 72 ° C reaction for 7 minutes (1 step) ). DNA fragments were confirmed by DNA electrophoresis for the estimated size. After confirming that the recombinant plastid in the transgenic strain carries the insert DNA, the plastid in the transgenic strain is extracted and subjected to DNA sequencing (Source International Biotechnology Co., Ltd.), which will contain PCV2 DNA. The plastid was named pTA-PCV2.

Amplification of ORF2 gene (the gene of outer sheath protein) and codon optimization (1) Amplification of the ORF2 gene:

Using the aforementioned pTA-PCV2 as a template, ORF2F/ORF2R primer combination (ORF2F; 5'-CAATATGGATCCATGA CGTATCCAAGGAGGCGT TTC-3'; SEQ ID NO 07 and ORF2R; 5'-GATATAGTCGTAGTAGGGT TTAAGTGGGGGGTCTTTAAGATTAA-3'; SEQ ID NO 08) Amplification of genes. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng pTA-PCV2 and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 60 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). Agarose gel electrophoresis was used to confirm whether the PCR product contained a DNA fragment of a predetermined size. Next, the PCR product was recovered using the PCR- ^MTM Clean Up kit. According to the sequencing result, the sequence of the aforementioned ORF2 gene is shown as SEQ ID NO 09.

(2) Codon optimization of the synthesis of the ORF2 (OPTORF2) gene:

The amino acid sequence of ORF2 is reverse deduced into a nucleotide sequence based on the preferred codons of E. coli. Design primers based on the aforementioned nucleotide sequence: OPTORF2-T1, OPTORF2-T2, OPTORF2-T3, OPTORF2-T4, OPTORF2-T5, OPTORF2-T6, OPTORF2-T7, OPTORF2-T8, OPTORF2-T9, OPTORF2-T10, OPTORF2 -T11, OPTORF2-T12, OPTORF2F and OPTORF2R, the sequences of which are shown in Table 1 below.

OPTORF2-T1~OPTORF2-T12 was used as a template primer, and OPTORF2 and OPTORF2R were used as amplification primers. The codon-optimized ORF2 gene was amplified in a large amount by an overlay-extension polymerase chain reaction (OEPCR). The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM primer and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit. According to the sequencing result, the sequence of the aforementioned codon-optimized ORF2 gene is shown in SEQ ID NO 24.

Amplification of SUMO gene and codon optimization (1) Amplification of SUMO gene:

The baker's yeast ( Saccbaromyces cerevisiae ) isolated from the Japanese food DIY instant yeast was inoculated into YPD (20% yeast, 10% yeast, 20% glucose; pH 6.5) and oscillated at 30 ° C and 200 rpm. after incubation for 16 hours using ^{YeaStar TM Genomic DNA kit (Zymo Research} , USA) for extraction of the yeast genome. Take 1.5 mL of the overnight culture solution into a microcentrifuge tube, centrifuge (2,000 × g, 5 minutes, room temperature) to collect the bacterial part, and add 120 μL of YD Digestion Buffer and 5 μL of R-Zymolase, and mix at 37 ° C. For one hour. Then, 120 μL of YD Lysis Buffer was added, and the mixture was gently mixed for several times, and then 250 μL of chloroform was added thereto and shaken for 1 minute. The supernatant was collected by centrifugation (10,000 x g, 2 minutes, room temperature). The centrifuge tube was placed on a collection tube, and the supernatant was placed in a centrifuge tube, and after centrifugation (10,000 × g, 1 minute, room temperature), the filtrate was removed. 300 μL of DNA washing buffer was added to the centrifuge tube, centrifuged (10,000 × g, 1 minute, room temperature), the filtrate was removed, and this step was repeated once. The centrifuge tube was placed in a sterile microcentrifuge tube, and an appropriate amount of the elution solution was added to the centrifuge tube and centrifuged (10,000 x g, 2 minutes, room temperature) to drain the genomic DNA.

The SUBS gene was used as a template in the previous paragraph, using the SUMOF (5'-GATATAGGTACCATGTCGGACTCAGAAGTCAATCAAG-3'; SEQ ID NO 25)/SUMOR (5'-CAATATGGATCCACCACCAATCTG TTCTCTGTGAGC-3; SEQ ID NO 26) primer combination for SUMO gene Amplification. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 200 ng baker's yeast genome and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 5 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

(2) Codon-optimized synthesis of SUMO (OPTSUMO) gene:

The amino acid sequence of SUMO is reversely deduced into a nucleotide sequence according to the preferred codon of E. coli. According to the above nucleotide sequence design primers: OPTSUMO-T1, OPTSUMO-T2, OPTSUMO-T3, OPTSUMO-T4, OPTSUMO-T5, OPTSUMO-T6, OPTSUMO-T7, OPTSUMO-T8, OPTSUMOF and OPTSUMOR, the sequence is shown in Table 2 below. Shown.

OPTSUMO-T1~OPTSUMO-T8 was used as a template primer, and OPTSUMOF and OPTSUMOR were used as amplification primers. A large number of codon-optimized SUMO genes were amplified using the overlap extension polymerase chain reaction. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM primer and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit. According to the sequencing result, the sequence of the aforementioned codon-optimized SUMO gene is shown in SEQ ID NO 37.

Construction of ORF2 fusion protein expression vector (1) Construction of pET-DRAHIS:

Using pET29a as a template, PCR reaction was carried out using a combination of DRAF (5'-GATATACATATGAAAAAAAAATTCGTATCGCATCACCATCACCA TCACAGCGGTGGTGGTACCCCAGATCTGGGTACCCTGG-3'; SEQ ID NO 38)/T7 terminator (GCTAGTTATTGCTCAGCGG; SEQ ID NO 39) primer. 1 comprising double Ex Taq ^TM buffer 50μL PCR reaction mixture, 200μM of dATP, dTTP, dGTP and dCTP, 1μM amplification primer, 100ng pET29a and 1.25U TakaRa Ex Taq ^TM DNA polymerase (Takara, Japan). The reaction conditions of the PCR were 94 ° C for 5 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 50 seconds (35 cycles); 72 ° C for 7 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the PCR product was cleaved with Nde I and Sal I, the DNA fragment was ligated into pET29a cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli XL1-blue (Protech, Taiwan). The transgenic strains were randomly selected for DNA sequencing confirmation. The plastid with the correct DNA sequence was named pET-DRAHIS. The start code of this plastid is followed by a downstream sequence (DS) AAAAAAAAATTCGTATCG (SEQ ID NO 40) and a His tag DNA sequence CATCACCATCACCATCAC (SEQ ID NO 41).

(2) Construction of pET-SUMO-ORF2 expression vector:

After the SUMO gene amplified from the baker's yeast gene was cleaved with Kpn I and BamH I, the DNA fragment was ligated into pET-DRAHIS which was cleaved by the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The correct quality of the DNA sequence was named pET-SUMO.

The ORF2 gene amplified from the PCV2 Yunlin virus gene was cleaved with Bam HI and Sal I, and the DNA fragment was ligated into pET-SUMO which was cleaved by the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-SUMO-ORF2, which has the sequence shown as SEQ ID NO 42.

(3) Construction of pET-OPTSUMO-ORF2 expression vector:

After the synthetic OPTSUMO gene was cleaved with Kpn I and BamH I, the DNA fragment was ligated into pET-DRAHIS which was cleaved by the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plastid with the correct DNA sequence was named pET-OPTSUMO.

The ORF2 gene amplified from the PCV2 Yunlin virus gene was cut with Bam HI and Sal I, and the DNA fragment was ligated into pET-OPTSUMO which was cleaved by the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plastid with the correct DNA sequence was named pET-OPTSUMO-ORF2, which has the sequence shown as SEQ ID NO:43.

(4) Construction of pET-SUMO-OPTORF2 expression vector:

After the synthetic OPTORF2 gene was cleaved with BamH I and Sal I, the DNA fragment was ligated into pET-SUMO cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plastid with the correct DNA sequence was named pET-SUMO-OPTORF2, which has the sequence shown as SEQ ID NO:44.

(5) Construction of pET-OPTSUMO-OPTORF2 expression vector:

After the synthetic OPTORF2 gene was cleaved with BamH I and Sal I, the DNA fragment was ligated into pET-OPTSUMO cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-OPTSUMO-OPTORF2, which has the sequence shown as SEQ ID NO:45.

(6) Construction of pBA-OPTSUMO-OPTORF2 expression vector:

The pBA-OPTSUMO-OPTORF2 constructed in this experiment was obtained by embedding the DNA fragment of OPTSUMO-OPTORF2 into a novel arabinose-inducing expression vector pBCM-araM11. pBCM-araM11 is the applicant of the invention in the Republic of China invention patent application No. 103146225 (application date: December 30, 2014) and 103142753 (application date: December 9, 2014) The disclosed arabinose-inducible expression element and pBRCMMCS (SEQ ID NO 100) were constructed. The construction process of the performance carrier is described below.

After pARABM11-GFPT was cleaved with EcoRI and NdeI , a DNA fragment containing araC and araB- M11 expression elements was recovered using a Gel- ^MTM gel extraction system kit (GMbiolab, Taiwan). The araC and araB- M11 expression elements were ligated into the same restriction enzyme cleavage pBRCMMCS using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction and the plastids were extracted for DNA sequencing confirmation. The plasmid with the correct sequence was named pBCM-araM11, which has the sequence shown in SEQ ID NO 98.

After pET-OPTSUMO-OPTORF2 was cleaved with NdeI and SalI , the DNA fragment containing OPTSUMO-OPTORF2 was recovered using the Gel- ^MTM gel extraction system kit. OPTSUMO-OPTORF2 was inserted into pBCM-araM11 cut with the same restriction enzymes using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction and the plastids were extracted for DNA sequencing confirmation. The plastid with the correct sequence was named pBA-OPTSUMO-OPTORF2, which has the sequence shown as SEQ ID NO 46.

The aforementioned DNA fragment containing the araB- M11 expression element, that is, the arabinose-inducing expression element of the present invention, comprising a promoter (the 16th portion thereof is represented by SEQ ID NO 03) and a T7 phage translation enhancing element (SEQ ID NO 01) And a ribosome binding site (SEQ ID NO 02). The aforementioned arabinose-inducing expression element is shown in the case of the Republic of China Invention Patent Application No. 103146225 (application date: December 30, 2014), which has the sequence shown in SEQ ID NO:04.

summary

In summary, in this example, five porcine second type circovirus outer sheath protein expression vectors were prepared, respectively: pET-SUMO-ORF2 (SEQ ID NO 42), pET-OPTSUMO-ORF2 (SEQ ID) NO 43), pET-SUMO-OPTORF2 (SEQ ID NO 44), pET-OPTSUMO-OPTORF2 (SEQ ID NO 45), and pBA-OPTSUMO-OPTORF2 (SEQ ID NO 46), and refer to the schematic diagram contained in the first figure .

Example 2: Preparation of the porcine second type circovirus outer sheath protein of the present invention.

As described above, each of the vectors (SEQ ID NOS 42 to 46) prepared in Example 1 contains the DNA of the outer sheath protein ORF2, and can be applied to the production of outer sheath proteins. Furthermore, for the purpose of purification and water-soluble performance, the target protein is synthesized as a fusion protein with SUMO protein and His tag, and the fusion protein is referred to herein as a SUMO-ORF2 fusion protein, and the fusion protein band is not described again. Has His Tag. In this example, the preparation of the SUMO-ORF2 fusion protein of the present invention will be carried out using the expression vector described in Example 1.

Induction of Escherichia coli and Recombinant SUMO-ORF2 Fusion Protein (1) Experimental steps:

Expression vectors such as pET-SUMO-ORF2, pET-OPTSUMO-ORF2, pET-SUMO-OPTORF2, and pET-OPTSUMO-OPTORF2 were transformed into E. coli BL21 (DE3) (Yeastern, Taiwan), respectively. pET-SUMO-ORF2 was transformed into E. coli Rosetta 2 (EMD Millipore, USA). pBA-OPTSUMO-OPTORF2 was transformed into E. coli BL21 (New England Biolabs, USA). The method of transformation is carried out by referring to the steps provided by the manufacturer.

The E. coli BL21 (DE3) transformant was inoculated into LB medium containing kanamycin (final concentration: 30 μg/mL), and shake culture was carried out at 37 ° C and 180 rpm. After overnight incubation, the bacterial solution was inoculated at a ratio of 1:100 to LB medium containing kanamycin (final concentration 30 μg/mL). The shaking culture was carried out at 37 ° C and 180 rpm. The bacteria were cultured to measure the cell concentration by spectrophotometry to an OD _{600 of} about 0.4 to 0.6, and 0.1 mM isopropyl-β-D-thiogalactoside (IPTG) was added for proteinization. Inducing performance. Four hours after the induction, the cells were collected by centrifugation (8,000 × g, 30 minutes, 4 ° C) and the expression of the SUMO-ORF2 fusion protein was observed by protein electrophoresis and Western blotting. The primary antibody and the secondary antibody used in the Western blotting method are rabbit anti-His tag polyclonal antibody (rabbit anti-6×His polyclonal antibody; Protech, Taiwan) and alkaline phosphatase conjugate goat anti-rabbit antibody [alkaline] Phosphatase-conjugated goat anti-rabbit IgG (H+L)]; the coloring agent used was NBT/BCIP (Thermo, USA). In addition, the division of soluble protein and insoluble protein (ie, solubility) was carried out for the cells, and the soluble performance of the SUMO-ORF2 fusion protein was observed by protein electrophoresis.

The E. coli Rosetta 2 transformant was inoculated into LB medium containing chloramphenicol (final concentration 34 μg/mL) and connamycin (final concentration 30 μg/mL) at 37 ° C and 180 rpm. The shaking culture was carried out. After overnight incubation, the bacterial solution was inoculated at a ratio of 1:100 to LB medium containing chloramphenicol (final concentration 34 μg/mL) and connamycin (final concentration 30 μg/mL). The shaking culture was carried out at 37 ° C and 180 rpm. The bacteria were cultured to measure the cell concentration by spectrophotometry to an OD _{600 of} about 0.4 to 0.6, and 0.1 mM IPTG was added for protein induction. Four hours after the induction, the cells were collected by centrifugation (8,000 × g, 30 minutes, 4 ° C) and the expression of the SUMO-ORF2 fusion protein was observed by protein electrophoresis and Western blotting. The soluble protein and the insoluble protein were also divided into the cells, and the soluble performance of the SUMO-ORF2 fusion protein was observed by protein electrophoresis.

The E. coli BL21 transformant was inoculated into LB medium containing chloramphenicol (25 μg/mL), and shake culture was carried out at 37 ° C and 180 rpm. After overnight incubation, the bacterial solution was inoculated at a ratio of 1:100 to LB medium containing chloramphenicol (25 μg/mL). The shaking culture was carried out at 37 ° C and 180 rpm. The bacteria were cultured to measure the cell concentration by spectrophotometry to an OD _{600 of} about 0.4 to 0.6, and 0.2% arabinose was added for protein-induced expression. Four hours after the induction, the cells were collected by centrifugation (8,000 × g, 30 minutes, 4 ° C) and the expression of the SUMO-ORF2 fusion protein was observed by protein electrophoresis and Western blotting. The soluble protein and the insoluble protein were also divided into the cells, and the soluble performance of the SUMO-ORF2 fusion protein was observed by protein electrophoresis.

After scanning the protein electrophoresis film, the percentage of performance of the recombinant SUMO-ORF2 fusion protein was estimated using Image Quant TL 7.0 (GE Healthcare Life Sciences, USA) software, and the yield of the fusion protein was further calculated.

(2) Experimental results:

The results showed that pET-SUMO-ORF2 and pET-OPTSUMO-ORF2 were transformed into E. coli BL21 (DE3) and induced, and the recombinant SUMO-ORF2 fusion protein did not show at all (second panel). pET-SUMO-ORF2 was transformed into E. coli Rosetta2 which produced the corresponding rare codon tRNA and induced. The results showed that the recombinant SUMO-ORF2 fusion protein could be expressed (Fig. 2) and was mainly soluble protein (Fig. 3); the yield of the soluble recombinant SUMO-ORF2 fusion protein was 46.81 mg/L. The fact that the above ORF2 gene cannot be expressed in E. coli BL21 (DE3) indicates that the codon contained in ORF2 seriously affects the expression of the SUMO-ORF2 fusion protein in Escherichia coli.

pET-SUMO-OPTORF2 with the codon-optimized ORF2 gene was transformed into E. coli BL21 (DE3) and induced. The results showed that the recombinant SUMO-ORF2 fusion protein was successfully expressed (Fig. 2) and was mainly soluble protein (Fig. 3); the yield of the soluble recombinant SUMO-ORF2 fusion protein was 54.62 mg/L. This result indicates that the ORF2 codon is optimized to enhance the performance of the SUMO-ORF2 fusion protein in E. coli BL21 (DE3).

The pET-OPTSUMO-OPTORF2 expression vector with the codon-optimized ORF2 full-length gene and the codon-optimized SUMO gene was transformed into E. coli BL21 (DE3) and induced. The results showed that the recombinant SUMO-ORF2 fusion protein was successfully expressed (Fig. 2) and was mainly soluble protein (Fig. 3); the yield of the soluble recombinant SUMO-ORF2 fusion protein was 81.66 mg/L. This result indicates that the codons of the fusion partner gene can be further optimized to further enhance the expression of the ORF2 fusion protein in E. coli. Past studies have not exemplified the optimization of the SUMO codon to increase the amount of fusion protein expression. The present invention confirms that the codon of the SUMO gene is optimized to increase the yield of the SUMO-ORF2 fusion protein.

The SUMO gene-codon optimized ORF2 gene-optimized DNA fragment with the downstream sequence-His tag DNA-codon was inserted into the arabinose-inducible expression vector pBCM-araM11 and transformed into E. coli BL21 for recombinant SUMO- Production of ORF2 fusion protein. The results show that the recombinant SUMO-ORF2 fusion protein can also be produced using the arabinose-inducible expression system (Fig. 2), and is mainly soluble protein (Fig. 3). Using this expression vector for the production of the SUMO-ORF2 fusion protein, the highest yield (103.04 mg/L) was obtained; compared with the highest yield of the T7 performance system (81.66 mg/L), the yield was increased by 1.27 times. Each of the performance vectors of Example 1 of the present invention showed that the yield of the soluble SUMO-ORF2 fusion protein in this experiment was summarized in Table 3 below.

Purification of recombinant SUMO-ORF2 fusion protein by immobilized metal ion affinity chromatography

The N-terminus of the recombinant SUMO-ORF2 fusion protein was characterized by the His tag to form a coordinating covalent bond with nickel or cobalt ions, and the protein was purified by immobilized metal ion affinity chromatography. Purified using protein liquid chromatography manner based system ÄKTA prime plus (GE Healthcare, Sweden ) with 5mL HiTrap ^TM Ni excel column (GE Healthcare, Sweden) performed.

The cells were suspended in a Lysis buffer (50 mM Tris-HCl, 500 mM NaCl, pH 8.0), and the cells were disrupted by an ultrasonic breaker, and the supernatant fraction was collected by centrifugation (8,000 × g, 15 minutes). In the column balance 25mL Lysis buffer, the supernatant of disrupted bacteria injection HiTrap ^TM Ni excel column. After the sample injection was completed, the specifically bound protein was washed with 100 mL of washing buffer (50 mM Tris-HCl, 500 mM NaCl, 30 mM imidazole, pH 8.0). Finally, the recombinant protein on the resin was extracted with 150 mL of Elution buffer (50 mM Tris-HCl, 500 mM NaCl, 250 mM imidazole, pH 8.0), which competed with the recombinant protein for the resin binding site by high concentration of imidazole, resulting in recombinant SUMO-ORF2 fusion protein. It was washed out from the resin. The purification of the recombinant SUMO-ORF2 fusion protein was observed by protein electrophoresis. The experimental results are shown in the fourth figure.

The SUMO-ORF2 fusion protein of the present invention is cleaved by SUMO protease

This experiment used SUMO protease to cleave the ORF2 fusion protein produced by the E. coli expression system. After cleavage, a SUMO fusion partner fragment with a His tag and an outer sheath protein fragment will be obtained. In this experiment, SUMO protease will be produced through the E. coli expression system and used in the previous application. This step can be carried out by a person skilled in the art who can also obtain SUMO protease by other means.

(1) Construction of recombinant SUMO protease expression vector pET-SUMOPH:

Amplification of SUMO protease gene using SUMPPF (5'-CAATATGGATCCCTTGTTCCTGAATTAAATGAAAAAGACG-3'; SEQ ID NO 47)/SUMOPENZHISR (5'-GATATACTCGAGT TAGTGATGGTGATGGTGATGACCACTGCCGCTACCTTTTAAAG CGTCGGTTAAAATCAAATG-3; SEQ ID NO 48) primer combination . The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 200 ng baker's yeast genome and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 5 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the SUMO protease gene amplified from the yeast genome was cleaved with BamH I and Xb ₀ I, the DNA fragment was ligated into pET29a cleaved with BamH I and Sal I using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-SUMOPH, which has the sequence shown in SEQ ID NO:49.

(2) Construction of recombinant D-SUMO protease expression vector pET-D-SUMOPH:

Using Lambda phage DNA (Promega, USA) as a template, D protein was synthesized using DF (5'-GATATAGGTACCATGACGAGCAAAGAAACCTTTACC-3'; SEQ ID NO 50) in combination with DR (5'-CAATATGGATCCAACGATGCTG ATTGCCGTTC-3'; SEQ ID NO 51) primer Amplification of genes. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng Lambda phage DNA and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 5 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the D protein gene amplified from Lambda phage DNA was cleaved with Kpn I and BamH I, the DNA fragment was ligated into pET29a cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-D, which has the sequence shown in SEQ ID NO 99.

After the SUMO protease gene amplified from the yeast genome was cleaved with BamH I and Xb ₀ I, the DNA fragment was ligated into pET-D cleaved with BamH I and Sal I using T4 DNA ligase . The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-D-SUMOPH, which has the sequence shown in SEQ ID NO 52.

(3) Induction and purification of recombinant protease:

Expression vectors such as pET-SUMOPH and pET-D-SUMOPH were transformed into E. coli BL21 (DE3), respectively. The E. coli BL21 (DE3) transformant was inoculated into LB medium containing kanamycin (final concentration: 30 μg/mL), and shake culture was carried out at 37 ° C and 180 rpm. After overnight incubation, the bacterial solution was inoculated at a ratio of 1:100 to LB medium containing connamycin (final concentration of 30 μg/mL). The shaking culture was carried out at 37 ° C and 180 rpm. The bacteria were cultured to measure the cell concentration by spectrophotometry to an OD _{600 of} about 0.4 to 0.6, and 0.1 mM IPTG was added for protein induction. Four hours after the induction, the cells were collected by centrifugation (8,000 × g, 30 minutes, 4 ° C) to separate the soluble protein and the insoluble protein, and the soluble performance of the recombinant protease was observed by protein electrophoresis and Western blotting. The primary antibody and secondary antibody used in the Western blotting method are rabbit anti-His tag multi-drug antibody and alkaline phosphatase conjugate goat anti-rabbit antibody; the coloring agent used is NBT/BCIP. The purification method of the recombinant protease is the same as the purification method of the recombinant ORF2 fusion protein.

The results showed that both SUMO protease and D-SUMO protease were expressed in E.coli BL21(DE3) (figure 5), and the yields were 20.55 mg/L and 46.94 mg/L, respectively. The yield of D-SUMO protease was higher. Its molar number is about 2.2 times that of SUMO protease. This result demonstrates that the strategy of fusion performance can enhance the performance of SUMO protease in E. coli.

Next, the protein was purified by immobilized metal ion affinity chromatography using the His tag of the C-terminus of the recombinant protease. The results show that the use of immobilization The metal ion affinity column can be used for purification of intracellular soluble recombinant SUMO protease and D-SUMO protease (Fig. 6); wherein the purification yield of D-SUMO protease is high, and 21.50 mg of protein can be purified from 1 L culture solution. It is about 1.4 times the purified yield of SUMO protease (15.33 mg).

(4) Shearing the recombinant SUMO-ORF2 fusion protein and observing the formation of viroid-like particles:

The purified recombinant SUMO-ORF2 fusion protein is mixed with a recombinant protease (SUMO protease or D-SUMO protease) at a weight ratio of 1:0.05 (for example, 1 mg of recombinant ORF2 fusion protein and 0.05 mg of recombinant protease), and the mixture is allowed to be 4 Act at °C for 16 hours. The sheared protein solution was placed in an Amicon ultra-15 ultracel-100K centrifuge tube (Merck Millipore, USA) and centrifuged at 2,600 x g to an appropriate volume at 4 °C. The filtered protein was then filtered using a 100 kDa regeberated cellulose filter membrane. The results show that the 100kDa filter membrane can effectively remove the fusion partner, and the separation of ORF2 and fusion partner is needed by column chromatography, which can effectively save the antigen production cost (seventh figure).

Next, the SUMO-ORF2 fusion protein, the protease-cleaved SUMO-ORF2 fusion protein, and the ORF2 fusion protein obtained by protease cleavage and filtration were placed on a copper grid and placed at room temperature. three minutes. Then, the excess water was blotted dry with a filter paper, and then a uranyl acetate dye was added for negative staining for about 40 seconds to 1 minute. Thereafter, the excess dye was blotted dry using a filter paper, and the virus-like particles were observed by a field emission transmission electron microscope JEM-2100F (JEOL, Japan).

The results showed that the SUMO-ORF2 fusion protein could not form viroid-like particles, but the recombinant SUMO-ORF2 fusion protein by protease cleavage and the ORF2 fusion protein obtained by protease cleavage and filtration could form viroid-like particles (eighth) Figure). The average particle size of the virus-like particles calculated by the transmission electron microscope pattern is about 19 Nm.

Example 3: Preparation of porcine interferon.

The present invention discloses that porcine interferon is an adjuvant particularly suitable as a secondary unit vaccine for porcine second type circovirus. Therefore, in the present example, porcine interferon alpha and porcine interferon gamma required for producing the subunit vaccine of the present invention by E. coli host cells are used.

Synthesis of recombinant porcine interferon alpha (IFN-α) and γ (IFN-γ) genes (1) Synthesis of IFN-α gene:

The amino acid sequence of the mature porcine interferon alpha-6 was reversely deduced into a nucleotide sequence according to the preferred codon of E. coli. According to the above nucleotide sequence design primers: OPTIFNA-T1, OPTIFNA-T2, OPTIFNA-T3, OPTIFNA-T4, OPTIFNA-T5, OPTIFNA-T6, OPTIFNA-T7, OPTIFNA-T8, OPTIFNAF and OPTIFNAR, the sequence is shown in Table 4 below. Shown.

OPTIFNA-T1~OPTIFNA-T8 was used as a template primer, and OPTIFNAF and OPTIFNAR were used as amplification primers. The codon-optimized IFN-α gene was amplified in large numbers by overlapping extension polymerase chain reaction. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM primer and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 58 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

The genes were colonized using the CloneJET PCR Cloning Kit (Thermo, USA) and the ligation mixture was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pJET-IFNA-6, which has the sequence shown as SEQ ID NO 63. Codon-optimized IFN-α The gene has the sequence shown in SEQ ID NO: 64.

(2) Synthesis of IFN-γ:

The amino acid sequence of the mature porcine interferon gamma is reversely deduced into a nucleotide sequence according to the preferred codon of E. coli. According to the above nucleotide sequence design primers: OPTIFNR-T1, OPTIFNR-T2, OPTIFNR-T3, OPTIFNR-T4, OPTIFNR-T5, OPTIFNR-T6, OPTIFNR-T7, OPTIFNR-T8, OPTIFNRF and OPTIFNRR, the sequence is shown in Table 5 below Shown.

OPTIFNR-T1~OPTIFNR-T8 was used as a template primer, and OPTIFNRF and OPTIFNRR were used as amplification primers. The codon-optimized IFN-γ gene was amplified in large numbers by overlapping extension polymerase chain reaction. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM primer and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 57 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

Gene selection was performed using the CloneJET PCR Cloning Kit and the adhesive mixture was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pJET-IFNR, which has the sequence shown as SEQ ID NO:75. Upon sequencing verification, the codon-optimized IFN-γ gene has the sequence shown in SEQ ID NO 76.

Construction of Porcine Interferon α and γ Expression Vector (1) Construction of pET-OPTPIFNAH expression vector:

Using pJET-IFNA-6 plastid as a template, IFN-α was performed using PIFNANDEIF (5'-CAATATCATATGTGCGATCTGCCGCAAACC-3'; SEQ ID NO 77)/PIFNAHISSALIR (5'-GATATAGTCGACTTATTAGTGATGGTG ATGGTGATGTTCCTTTTTACGCAGGCGGTC-3'; SEQ ID NO 78) primer combination Amplification of genes. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng pJET-IFNA-6 and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the PCR product was cleaved with Nde I and Sal I, the DNA fragment was ligated into pET29a cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-OPTPIFNAH, which has the sequence shown in SEQ ID NO:79.

(2) Construction of pBA-OPTPIFNAH expression vector:

After the above-mentioned PCR-amplified IFN-α gene was cleaved with Nde I and Sal I, the DNA fragment was separately ligated into pBCM-araM11 which was cleaved by the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plastids with the correct DNA sequence were designated pBA-OPTPIFNAH, respectively, which has the sequence set forth in SEQ ID NO:80.

(3) Construction of pET-SUMO-OPTPIFNAH expression vector:

Amplification of the SUMO gene was carried out using the Baker's yeast genome as a template and using the SUMOF (SEQ ID NO 25)/SUMOR2 (5'-ACCACCAATCTGTTCTCTGTGAGC-3'; SEQ ID NO 81) primer combination. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 200 ng baker's yeast genome and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 5 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using a Gel- ^MTM gel extraction system kit.

Amplification of the IFN-α gene was carried out using the pJET-IFNA-6 plastid as a template, using SUMOIFNAF (5'-GCTCACAGAGAACAGATTGGTGGTTGCGATCTGCCGCAAACC-3'; SEQ ID NO 82)/PIFNAHISSALIR (SEQ ID NO 78) primer combination. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng pJET-IFNA-6 and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 5 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using a Gel- ^MTM gel extraction system kit.

The SUMO-IFN-α fusion gene can be obtained by performing a polymerase chain reaction using the SUMOF (SEQ ID NO 25)/PIFNAHISSALIR (SEQ ID NO 78) primer combination using the above two PCR products as a template. 1X GDP-HiFi PCR Buffer B, 200μM dATP, dTTP, dGTP and dCTP, 1μM amplification primer, 100ng SUMO PCR product, 100ng IFN-α PCR product and 1U GDP-HiFi DNA polymerization in 50μL PCR reaction mixture Enzyme. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 1 minute (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the PCR product was cleaved with Kpn I and Sal I, the DNA fragment was ligated into pET29a cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plastid with the correct DNA sequence was named pET-SUMO-OPTPIFNAH, which has the sequence shown in SEQ ID NO:83.

(4) Construction of pET-OPTSUMO-OPTPIFNAH expression vector:

Amplification of the OPTSUMO gene was carried out using pET-OPTSUMO-ORF2 (SEQ ID NO 43) as a template using the primer combination of OPTSUMOF (SEQ ID NO 35)/OPTSUMOR2 (5'-GCCGCC GATTTGTTCACGG-3'; SEQ ID NO 84).

One-fold GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng pET-OPTSUMO-ORF2 and 1 U GDP-HiFi DNA polymerase were included in the 50 μL PCR reaction mixture. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using a Gel- ^MTM gel extraction system kit.

Amplification of the IFN-α gene was carried out using the pJET-IFNA-6 plastid (SEQ ID NO 63) as a template using the OPTSUMOIFNAF (CCGTGAACAAATCGGCGGCTGCGATCTG CCGCAAACC; SEQ ID NO 85)/PIFNAHISSALIR (SEQ ID NO 78) primer combination. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng pJET-IFNA-6 and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using a Gel- ^MTM gel extraction system kit.

The OPTSUMO-IFN-α fusion gene can be obtained by performing a polymerase chain reaction using a combination of OPTSUMOF (SEQ ID NO 35)/PIFNAHISSALIR (SEQ ID NO 78) primers using the above two PCR products as a template. 1x GDP-HiFi PCR buffer B, 200μM dATP, dTTP, dGTP and dCTP, 1μM amplification primer, 100ng OPTSUMO PCR product, 100ng IFN-α PCR product and 1U GDP-HiFi DNA polymerization in 50μL PCR reaction mixture Enzyme. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 1 minute (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the PCR product was cleaved with Kpn I and Sal I, the DNA fragment was ligated into pET29a cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-OPTSUMO-OPTPIFNAH, which has the sequence shown in SEQ ID NO:86.

(5) Construction of pBA-OPTSUMO-OPTPIFNAH expression vector:

After pET-OPTSUMO-OPTPIFNAH was cleaved with Nae I and Sal I, a DNA fragment containing the OPTSUMO-IFN-α fusion gene was recovered using a Gel-M ^TM gel extraction system kit. The DNA fragment was ligated into pBCM-araM11 which was cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plastid with the correct DNA sequence was named pBA-OPTSUMO-OPTPIFNAH, which has the sequence shown in SEQ ID NO:87.

(6) Construction of pET-OPTPIFNRH expression vector:

Using the pJET-IFNR plastid as a template, the IFN-γ gene was carried out using the primer combination of PIFNRNDEIF (5'-CAATATCATATGCAAGCCCCGTTTTTCAAAGAA-3'; SEQ ID NO 88)/PIFNRHISSALIR (5'-GATATAGTCGACTTATTAGTGATG GTGATGGTGATGTTTGCTGGCACGCTGACC-3'; SEQ ID NO 89) Amplification. One-fold GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng pJET-IFNR and 1 U GDP-HiFi DNA polymerase were included in the 50 μL PCR reaction mixture. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the PCR product was cleaved with Nde I and Sal I, the DNA fragment was ligated into pET29a cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-OPTPIFNRH, which has the sequence shown in SEQ ID NO 90.

(7) Construction of pET-SUMO-OPTPIFNRH expression vector:

Amplification of the SUMO gene was carried out using the baker's yeast genome as a template and the SUMOF (SEQ ID NO 25)/SUMOR2 (SEQ ID NO 81) primer combination. The amplification conditions and PCR recovery methods are as described above.

Amplification of IFN-γ gene using pJET-IFNR plastid (SEQ ID NO 75) as a template, using SUMOIFNRF (5'-GCTCACAGAGAACAGATTGGTGGTCAAGCC CCGTTTTTCAAAGAA-3'; SEQ ID NO 91) / PIFNRHISSALIR (SEQ ID NO 89) primer combination . One-fold GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng pJET-IFNR and 1 U GDP-HiFi DNA polymerase were included in the 50 μL PCR reaction mixture. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using a Gel- ^MTM gel extraction system kit.

The SUMO-IFN-γ fusion gene can be obtained by performing a polymerase chain reaction using the SUMOF (SEQ ID NO 25)/PIFNRHISSALIR (SEQ ID NO 89) primer combination using the above two PCR products as a template. 1X GDP-HiFi PCR Buffer B, 200μM dATP, dTTP, dGTP and dCTP, 1μM amplification primer, 100ng SUMO PCR product, 100ng IFN-γ PCR product and 1U GDP-HiFi DNA polymerization in 50μL PCR reaction mixture Enzyme. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 1 minute (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the PCR product was cleaved with Kpn I and Sal I, the DNA fragment was ligated into pET29a cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-SUMO-OPTPIFNRH, which has the sequence shown in SEQ ID NO 92.

(8) Construction of pET-OPTSUMO-OPTPIFNRH expression vector:

Using pET-OPTSUMO-ORF2 (SEQ ID NO 43) as a template, using OPTSUMOF (SEQ ID NO 35)/OPTSUMOR2 (SEQ ID NO 84) A primer combination is used to amplify the OPTSUMO gene. The amplification conditions and PCR recovery methods are as described above.

Expansion of porcine interferon gamma gene using pJET-IFNR plastid (SEQ ID NO 75) as a template using OPTSUMOIFNRF (5'-CCGTGAACAAATCGGCGGCCAAGCCCC GTTTTTCAAAGAAATC-3'; SEQ ID NO 93)/PIFNRHISSALIR (SEQ ID NO 89) primer combination increase. One-fold GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 100 ng pJET-IFNR and 1 U GDP-HiFi DNA polymerase were included in the 50 μL PCR reaction mixture. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using a Gel- ^MTM gel extraction system kit.

The OPTSUMO-IFN-γ fusion gene can be obtained by performing a polymerase chain reaction using a combination of OPTSUMOF (SEQ ID NO 35)/PIFNRHISSALIR (SEQ ID NO 89) primers using the above two PCR products as a template. Includes 1x GDP-HiFi PCR Buffer B, 200μM dATP, dTTP, dGTP and dCTP, 1μM amplification primer, 100ng OPTSUMO PCR product, 100ng porcine interferon gamma PCR product and 1U GDP-HiFi DNA in 50μL PCR reaction mixture Polymerase. The PCR reaction conditions were 96 ° C for 2 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 1 minute (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the PCR product was cleaved with Kpn I and Sal I, the DNA fragment was ligated into pET29a cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-OPTSUMO-OPTPIFNRH, which has the sequence shown in SEQ ID NO:94.

(9) Construction of pBA-OPTSUMO-OPTPIFNRH expression vector:

After pET-OPTSUMO-OPTPIFNRH was cleaved with Nde I and Sal I, the DNA fragment containing the OPTSUMO-IFR-γ fusion gene was recovered using the Gel-M ^TM gel extraction system kit. The DNA fragment was ligated into pBCM-araM11 which was cleaved with the same restriction enzyme using T4 DNA ligase. The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pBA-OPTSUMO-OPTPIFNRH, which has the sequence shown in SEQ ID NO: 95.

Performance and purification of recombinant porcine interferon (1) Performance of recombinant porcine interferon:

pET-OPTPIFNAH (SEQ ID NO 79), pBA-OPTPIFNAH (SEQ ID NO 80), pET-SUMO-OPTPIFNAH (SEQ ID NO 83), pET-OPTSUMO-OPTPIFNAH (SEQ ID NO 86), and pBA-OPTSUMO-OPTPIFNAH (SEQ ID NO 87) was transformed into E. coli Shuffle (NEB, USA), respectively; pET-OPTPIFNRH (SEQ ID NO 90), pET-SUMO-OPTPIFNHR (SEQ ID NO 92), pET-OPTSUMO-OPTPIFNRH ( SEQ ID NO 94) and pBA-OPTSUMO-OPTPIFNRH (SEQ ID NO 95) were transformed into E. coli BL21 (DE3), respectively. The transformed strain was inoculated into an LB medium containing connamycin (final concentration: 30 μg/mL), and shake culture was carried out at 37 ° C and 180 rpm. After overnight incubation, the bacterial solution was inoculated at a ratio of 1:100 to an LB medium containing a final concentration of kanamycin of 30 μg/mL. The shaking culture was carried out at 37 ° C and 180 rpm. The bacteria were cultured to measure the cell concentration by spectrophotometry to an OD600 of about 0.4 to 0.6, and the induction performance of the protein was carried out by adding 0.1 mM IPTG at 25 ° C and 180 rpm. Four hours after the induction, the cells were collected by centrifugation (8,000 × g, 30 minutes, 4 ° C) and the expression of recombinant porcine interferon was observed by protein electrophoresis. The soluble protein and insoluble protein were also divided into the cells, and the soluble performance of recombinant porcine interferon was observed by protein electrophoresis.

Please refer to the experimental results in Figure 9 (A to E). The results show that the present invention successfully produces soluble recombinant porcine IFN-α and SUMO-IFN-α fusion protein by E. coli Shuffle host, and the folding step can be eliminated to avoid the problem of poor folding efficiency affecting biological activity. In the expression part of the SUMO-IFN-α fusion protein, the SUMO-IFN-α fusion protein can be increased by optimizing the codon of the SUMO gene. The effect of different expression systems on the performance of SUMO-IFN-α fusion protein showed that the production of SUMO-IFN-α by the mutant arabinose-induced expression system was higher (155.07 mg/L; ninth (E)). Please also refer to the experimental results in the ninth figure (F to I). The results show that the strategy of SUMO fusion can improve the solubility of recombinant porcine IFN-γ. The SUMO gene codon is optimized to increase the yield of the SUMO-IFN-γ fusion protein. The effect of different expression systems on the performance of SUMO-IFN-γ fusion protein showed that the production of SUMO-IFN-γ by T7-induced expression system and mutant arabinose-induced expression system was quite satisfactory.

(2) Construction and performance of recombinant SUMO protease expression vector pET-D-SUMOP:

In order to cleave porcine interferon expressed in the E. coli expression system described in the previous paragraph to obtain porcine interferon without the SUMO protein fragment, SUMO protease was produced in this experiment through the E. coli expression system. This step can be carried out by a person skilled in the art who can also obtain SUMO protease by other means.

Amplification of the SUMO protease gene was carried out using the baker's yeast genome as a template and using SUMOPF (SEQ ID NO 47) / SUMOPENZR (5'-GATATACTCGAGTTATTTTAAAGCGTCGGT TAAAATCAAATG-3; SEQ ID NO 96) primer combination. The 50 μL PCR reaction mixture contained 1×GDP-HiFi PCR buffer B, 200 μM dATP, dTTP, dGTP and dCTP, 1 μM amplification primer, 200 ng baker's yeast genome and 1 U GDP-HiFi DNA polymerase. The PCR reaction conditions were 96 ° C for 5 minutes (1 step); 94 ° C for 30 seconds, 55 ° C for 30 seconds, 68 ° C for 30 seconds (35 cycles); 68 ° C for 5 minutes (1 step). After the end of the PCR reaction, agarose gel electrophoresis was used to confirm the presence or absence of a DNA fragment of an estimated size. The PCR product was then recovered using the PCR- ^MTM Clean Up system kit.

After the SUMO protease gene amplified from the yeast genome was cleaved with BamH I and Xb ₀ I, the DNA fragment was ligated into pET-D cut with BamH I and Sal I using T4 DNA ligase . The adhesive product was transformed into E. coli ECOS 9-5. The transgenic plants were selected by colony polymerase chain reaction. After confirming the recombinant plastid in the transformed strain with the extrapolated DNA by DNA electrophoresis, the plastid in the transformed strain was extracted and subjected to DNA sequencing. The plasmid with the correct DNA sequence was named pET-D-SUMOP, which has the sequence shown in SEQ ID NO:97.

pET-D-SUMOP (SEQ ID NO 97) was transformed into E. coli BL21 (DE3). The E. coli BL21 (DE3) transformant was inoculated into LB medium containing connamycin (final concentration of 30 μg/mL), and shake culture was carried out at 37 ° C and 180 rpm. After overnight incubation, the bacterial solution was inoculated at a ratio of 1:100 to LB medium containing connamycin (final concentration of 30 μg/mL). The shaking culture was carried out at 37 ° C and 180 rpm. The bacteria were cultured to measure the cell concentration by spectrophotometry to an OD _{600 of} about 0.4 to 0.6, and the induction performance of the protein was carried out by adding 0.1 mM IPTG at 28 ° C and 180 rpm. After 4 hours of induction, the bacterial fraction was collected by centrifugation (8,000 × g, 30 minutes, 4 ° C).

(3) Shearing and purification of recombinant porcine interferon:

The transformed strains carrying the SUMO-porcine interferon fusion protein expression vector and the SUMO protease expression vector were induced, and the bacterial fraction was collected by centrifugation (8,000 × g, 30 minutes, 4 ° C). The collected cells were suspended in an appropriate amount of Lysis buffet (20 mM sodium phosphate, 500 mM NaCl, pH 7.4) to make them at 600 nm. The absorbance value is up to 50. After the cells were disrupted by an ultrasonic breaker, the supernatant fraction was collected by centrifugation (8,000 × g, 15 minutes, 4 ° C). The purified recombinant SUMO-porcine interferon fusion protein was mixed with the recombinant protease (SUMO protease) at a weight ratio of 4, and allowed to stand at 4 ° C for 16 hours; in this stage, the SUMO-porcine interferon fusion protein was subjected to SUMO protease. Shear into SUMO protein and porcine interferon with His-tag at the C-terminus.

Protein purification is then carried out using immobilized metal ion affinity chromatography. Purified using protein-based embodiment ÄKTA prime plus liquid chromatography system with 5mL HiTrap ^TM Ni excel column for. In the column balance 25mL Lysis buffer, the fusion protein solution was injected into the shear HiTtap ^TM Ni excel column. After the sample injection was completed, the specifically bound protein was washed with 100 mL of washing buffer (20 mM sodium phosphate, 500 mM NaCl, 30 mM imidazole, pH 7.4). Finally, recombinant porcine interferon on the resin was eluted with 150 mL of Elution buffer (20 mM sodium phosphate, 500 mM NaCl, 250 mM imidazole, pH 7.4) and the purification was observed by protein electrophoresis (as shown in the tenth panel).

Example 4: Preparation and application of the composition for preventing and treating porcine type 2 circovirus infection of the present invention.

In the present embodiment, the ORF2, SUMO-ORF2 fusion protein prepared by the above-mentioned Example 2 and Example 3, and porcine interferon were used to prepare a composition for preventing and treating porcine type 2 circovirus infection. In many samples, the composition further comprises an adjuvant MONTANIDE ^TM ISA 563 VG (SEPPIC, France), and / or adjuvant MONTANIDE ^TM GEL 01 (SEPPIC, France). The ingredients were mixed according to the following experimental designs and then inoculated into piglets to observe the induced immune response or whether adverse reactions (such as vomiting, trembling, depression, shortness of breath, and swelling of the affected area were observed; The above pre-existing symptoms and the proportion of symptoms appearing above 50% determine that the composition is less safe).

(1) Experiment 1: Effect of porcine interferon content on the safety of the composition of the present invention:

Fourteen-week-old field piglets were selected and grouped in a random manner. They were divided into seven groups of A~G, and the number of pigs in each group was two. Each group was intramuscularly immunized once, and the immunization dose was 2 mL. The relevant vaccine components are listed in Table 6 below. On the day of the vaccine, the next day was observed and the proportion of adverse clinical reactions was recorded.

The experimental results showed that (Table 7), the pigs inoculated with V-001 samples showed clinical symptoms of depression, but no other adverse reactions. Pigs inoculated with V-002 samples showed symptoms of vomiting and trembling. In addition, the safety of the V-003 sample was more doubtful, and the adverse reactions of pigs inoculated with V-004 samples, V-005 samples, or V-006 samples were mild. According to this follow-up test, the content of porcine interferon will be maintained at 25 μg per dose (2 mL).

(2) Experiment 2: Effect of adjuvant content on the safety of the composition of the invention:

Seventy-three-year-old field piglets were selected and grouped in a random manner, which were divided into two groups: A and B; the number of pigs in group A was 38, and that in group B was 35. Each group was intramuscularly immunized once, and the immunization dose was 2 mL. The relevant vaccine components are listed in Table VIII below. On the day of the vaccine, the next day was observed and the proportion of adverse clinical reactions was recorded. The experimental results show (Table 9) that the safety of the V-009 sample is higher, but the safety of the V-008 sample is also acceptable.

(3) Experiment 3: Effect of different adjuvants on the immune-inducing effect of the composition of the present invention:

This experiment was carried out in animally certified organisms (GMOs) animal houses in the Animal Health Laboratory. 11 pigs with no specific pathogens at 4 weeks of age were randomly divided into five groups: A~E; A~D were experimental groups, each group had 2 pigs, and group E was control group, pig. only The number of heads is three. Pigs in group A~D were immunized with intramuscular injection at 4 and 6 weeks of age, and the immunization dose was 2 mL; group E was not treated with immunotherapy. The relevant vaccine components are listed in Table 10 below.

All groups of pigs were challenged with PCV2 at 8 weeks of age, and all were necropsy 4 weeks after challenge. Serum and plasma samples were collected before pig immunization (4 weeks old), after immunization (6 and 8 weeks old), and after challenge (9, 10, 11 and 12 weeks old). The titer of anti-PCV2 antibodies in serum was determined using a commercially available ELISA kit (BioCheck, Netherlands). The amount of virus in the plasma was determined using an instant quantitative polymerase chain reaction.

The results showed that V-009, V-010, V-011, and V-012 all induced anti-ORF2 antibody production (Fig. 11) and reduced viremia in experimental pigs (Fig. 12). From the experimental results, it was also observed that each dose (2 mL) containing 67 μg of ORF2 produced sufficient immunological effects (V-011 and V-012).

(4) Experiment 4: Effect of SUMO-ORF2 fusion protein or OFR2 on the immunostimulatory effect of the composition of the present invention:

This experiment was carried out in the animal house of the genetic modification product of the animal drug testing branch of the Animal Health Laboratory. Sixteen pigs with no specific pathogens at 4 weeks of age were selected and grouped in a random manner, divided into five groups A~E; A~D were experimental groups, and the number of pigs in each group was 3 Head, group E is the control group, and the number of pigs is four. Pigs in group A~D were immunized with intramuscular injection at 4 and 6 weeks of age, and the immunization dose was 2 mL; group E was not treated with immunotherapy. The relevant vaccine components are shown in Table 11 below.

All groups of pigs were challenged with PCV2 at 8 weeks of age and all were necropsy 5 weeks after challenge. Collection of serum and plasma samples was performed at specific time points. The titer of anti-PCV2 antibodies in serum was determined using a commercially available ELISA kit. The amount of virus in the plasma was determined using an instant quantitative polymerase chain reaction.

The results showed that each sample induced pigs to produce anti-PCV2 antibodies, and V-013 samples (containing 27 μg of ORF2 fusion protein) were the best (Fig. 13). In addition, all samples reduced viremia in pigs (Figure 14).

(5) Experiment 5: Effect of porcine interferon alpha and porcine interferon gamma on the immunogenic effect of the composition of the present invention:

This experiment was conducted in a pasture with low pathogen contamination and no PCV2 infection. Twenty-two-year-old SPF pigs of 4 weeks old without PCV2 were selected. They were grouped in a random manner and divided into five groups of A~E. The number of pigs in each group was 4; A~D was the experimental group and E was the control group. Pigs in groups A~D were given intramuscular injections at 4 and 7 weeks of age. The immunization dose was 2 mL; the E group was not subjected to immunotherapy. The relevant vaccine components are shown in Table 12 below. The collection of serum samples was performed at specific time points. The titer of anti-PCV2 antibodies in serum was determined using a commercially available ELISA kit.

The experimental results show that the addition of IFN-α (V-018) or IFN-γ (V-019) alone has an enhanced effect on the induction of immune response in the composition of the present invention; the effect of adding IFN-α is better than adding IFN. - γ. On the other hand, the simultaneous addition of IFN-α and IFN-γ (V-020) to the composition of the present invention induces a better immune response, showing that IFN-α and IFN-γ enhance immunity in the composition of the present invention. The reaction has a synergistic effect (fifteenth map).

<110> Institute of Agricultural Science and Technology

<120> Preparation method of porcine second type circovirus outer sheath protein and pharmaceutical composition containing the outer sheath protein

<130>

<160> 99

<170> PatentIn version 3.5

<210> 1

<211> 10

<212> DNA

<213> ENTEROBACTERIA PHAGE T7

<400> 1

<210> 2

<211> 10

<212> DNA

<213> Escherichia coli

<400> 2

<210> 3

<211> 10

<212> DNA

<213> Escherichia coli

<400> 3

<210> 4

<211> 89

<212> DNA

<213> Artificial Sequence

<220>

<223> EXPRESSION CASSETTE

<400> 4

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 5

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 6

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 7

<210> 8

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 8

<210> 9

<211> 702

<212> DNA

<213> porcine circovirus

<400> 9

<210> 10

<211> 73

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 10

<210> 11

<211> 93

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 11

<210> 12

<211> 77

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 12

<210> 13

<211> 85

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 13

<210> 14

<211> 84

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 14

<210> 15

<211> 86

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 15

<210> 16

<211> 90

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 16

<210> 17

<211> 90

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 17

<210> 18

<211> 75

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 18

<210> 19

<211> 67

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 19

<210> 20

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 20

<210> 21

<211> 60

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 21

<210> 22

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 22

<210> 23

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 23

<210> 24

<211> 705

<212> DNA

<213> porcine circovirus

<400> 24

<210> 25

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 25

<210> 26

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 26

<210> 27

<211> 58

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 27

<210> 28

<211> 61

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 28

<210> 29

<211> 62

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 29

<210> 30

<211> 55

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 30

<210> 31

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 31

<210> 32

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 32

<210> 33

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 33

<210> 34

<211> 46

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 34

<210> 35

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 35

<210> 36

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 36

<210> 37

<211> 294

<212> DNA

<213> Escherichia coli

<400> 37

<210> 38

<211> 82

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 38

<210> 39

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 39

<210> 40

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 40

<210> 41

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 41

<210> 42

<211> 6315

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 42

<210> 43

<211> 6315

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 43

<210> 44

<211> 6318

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 44

<210> 45

<211> 6318

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 45

<210> 46

<211> 4688

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 46

<210> 47

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 47

<210> 48

<211> 75

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 48

<210> 49

<211> 6051

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 49

<210> 50

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 50

<210> 51

<211> 32

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 51

<210> 52

<211> 6351

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 52

<210> 53

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 53

<210> 54

<211> 79

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 54

<210> 55

<211> 67

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 55

<210> 56

<211> 93

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 56

<210> 57

<211> 81

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 57

<210> 58

<211> 83

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 58

<210> 59

<211> 90

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 59

<210> 60

<211> 85

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 60

<210> 61

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 61

<210> 62

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 62

<210> 63

<211> 3472

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 63

<210> 64

<211> 498

<212> DNA

<213> Artificial Sequence

<220>

<223> IFN-α GENE

<400> 64

<210> 65

<211> 66

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 65

<210> 66

<211> 78

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 66

<210> 67

<211> 76

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 67

<210> 68

<211> 86

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 68

<210> 69

<211> 94

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 69

<210> 70

<211> 73

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 70

<210> 71

<211> 72

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 71

<210> 72

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 72

<210> 73

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 73

<210> 74

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 74

<210> 75

<211> 3403

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 75

<210> 76

<211> 429

<212> DNA

<213> Artificial Sequence

<220>

<223> IFN-γ GENE

<400> 76

<210> 77

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 77

<210> 78

<211> 57

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 78

<210> 79

<211> 5784

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 79

<210> 80

<211> 4154

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 80

<210> 81

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 81

<210> 82

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 82

<210> 83

<211> 6138

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 83

<210> 84

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 84

<210> 85

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 85

<210> 86

<211> 6138

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 86

<210> 87

<211> 4508

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 87

<210> 88

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 88

<210> 89

<211> 54

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 89

<210> 90

<211> 5715

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 90

<210> 91

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 91

<210> 92

<211> 6069

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 92

<210> 93

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 93

<210> 94

<211> 6069

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 94

<210> 95

<211> 4439

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 95

<210> 96

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> PRIMER

<400> 96

<210> 97

<211> 6318

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 97

<210> 98

<211> 3662

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 98

<210> 99

<211> 5671

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 99

<210> 100

<211> 2340

<212> DNA

<213> Artificial Sequence

<220>

<223> PLASMID

<400> 100

Claims (19)

A composition for preventing infection of a porcine type 2 circovirus comprising: porcine second type circovirus outer sheath protein of 2.5 to 250 μg/mL; porcine interferon alpha of 2.5 to 25 μg/mL; 2.5 to 25 μg/ Swine interferon gamma in mL; and a pharmaceutically acceptable carrier. The composition of claim 1, which comprises: 3.5 to 170 μg/mL of porcine second type circovirus outer sheath protein; 2.5 to 20 μg/mL of porcine interferon alpha; 2.5 to 20 μg/mL Porcine interferon gamma; and a pharmaceutically acceptable carrier. The composition of claim 2, which comprises: 3.5 to 170 μg/mL of porcine second type circovirus outer sheath protein; 2.5 to 12.5 μg/mL of porcine interferon alpha; 2.5 to 12.5 μg/ Swine interferon gamma in mL; and a pharmaceutically acceptable carrier. A composition according to any one of items 1 to request items, which further comprises a pharmaceutically acceptable adjuvant, wherein the adjuvant is pharmaceutically acceptable: MONTANIDE ^TM ISA 563 VG adjuvant, MONTANIDE ^TM GEL 01 Adjuvant, Freund's complete or incomplete adjuvant, aluminum gel, surfactant, polyanionic polymer, peptide, oil emulsion, or a combination thereof. The composition of claim 1, wherein the porcine second type circovirus outer sheath protein, the porcine interferon alpha and/or the porcine interferon gamma system are obtained by the following method: (a) obtaining one An arabinose-inducing expression vector; wherein the aforementioned arabinose-inducing expression vector comprises a nucleotide sequence of a expression element and a target protein; Wherein the aforementioned expression element comprises: a promoter; a T7 phage translation enhancing element having the sequence of SEQ ID NO 01; and a ribosome binding site having the sequence of SEQ ID NO 02; (b) The arabinose-inducing expression vector is transformed into an E. coli host and subjected to induction of expression of the target protein; wherein the target protein is the aforementioned porcine second type circovirus outer sheath protein, the aforementioned porcine interferon alpha and/or the aforementioned pig Interferon gamma. The composition of claim 5, wherein the 16th portion of the promoter has the sequence of SEQ ID NO 03. The composition of claim 5, wherein the aforementioned expression element has the sequence of SEQ ID NO 04. The composition of claim 5, wherein the arabinose-inducing expression vector further comprises a nucleotide sequence of a fusion partner, and/or a nucleotide sequence of a marker molecule. The composition of claim 8, wherein the fusion partner is: MsyB of Escherichia coli, YjgD gene of Escherichia coli, Lambda phage D protein, Baker's yeast SUMO protein, or a combination thereof. The composition of claim 8, wherein the aforementioned labeling molecule is: His tag, Strep II tag, Flag tag, or a combination thereof. The composition of claim 5, wherein the target protein is a porcine second type circovirus outer sheath protein, and the nucleotide sequence thereof has the sequence of SEQ ID NO 09 or SEQ ID NO 24. The composition of claim 11, wherein the aforementioned arabinose-inducible expression vector has the sequence of SEQ ID NO 46. The composition of claim 5, wherein the aforementioned target protein is porcine interferon alpha, and the nucleotide sequence thereof has the sequence of SEQ ID NO: 64. The composition of claim 5, wherein the aforementioned target protein is porcine interferon γ, and the nucleotide sequence thereof has the sequence of SEQ ID NO 76. The composition of claim 5, wherein the aforementioned arabinose-inducible expression vector has the sequence of SEQ ID NO 80, SEQ ID NO 87, or SEQ ID NO 95. The composition of claim 15 which does not comprise the folding step of the aforementioned porcine interferon. The composition of claim 12, wherein the step (b) further comprises a step (c) of purifying the target protein. The composition of claim 17, wherein the step (c) further comprises a step (d) of treating the target protein with a SUMO protease. The composition according to claim 18, wherein in the treatment of the aforementioned step (d), the weight ratio of the target protein to the SUMO protease is 4 to 20.