TWI449532B - Use of pedf-derived polypeptides for preventing and/or ameliorating skin aging - Google Patents

Description

Use of pigment epithelium-derived factor-derived multi-peptide to prevent and/or alleviate skin aging

The present invention relates to the prevention and/or alleviation of skin aging, and in particular to the use of synthetic peptides derived from pigment epithelium-derived factor (PEDF) to prevent and/or alleviate skin aging.

Human skin, like other living tissues, ages over time. The process of skin aging causes wrinkles and fine lines on the skin, thinning of the skin, partial discoloration or pigmentation of the skin, and loss of firmness and elasticity. According to the cause of skin aging, it can be divided into intrinsic aging and extrinsic aging. Intrinsic aging is also known as chronologic aging, which affects almost all organs and is primarily regulated by the genetic makeup of the individual. Exogenous aging is the aging caused by exposure to a variety of environmental factors. The above environmental factors are mainly ultraviolet (UV) radiation, so this process is also called photoaging. Parts that are often exposed to the sun, such as the face, neck, back and arms, are subject to both internal aging and photoaging, so the signs of aging in these areas are particularly noticeable.

Collagen is a major component of connective tissue and has a fibrous appearance and is an extracellular insoluble protein. Among the various collagens, type I and type III collagen are the most important. Type I collagen is the most important human skin The structural protein accounts for more than 90% of the dry weight of the skin; while the third type of collagen is mainly distributed in various parts of the body and is abundant in the embryonic tissue. As the skin ages, the total collagen content in the skin decreases, and the ratio of type 1 collagen to type III collagen also decreases; in addition, the extracellular matrix (ECM) will become more irregular. For example, intrinsic aging and ultraviolet B (UVB) radiation can impair the rate of renewal of collagen fibers, especially type I collagen fibers. In addition, UVB radiation increases the performance of a variety of matrix metalloproteinases (MMPs), which degrade collagen. Within a few hours after UVB irradiation, the body can be induced to express matrix metalloproteinases (especially collagenase and gelatinase). All of the above phenomena may lead to changes in the composition of the extracellular matrix of the skin.

There are a variety of treatments available to combat skin aging. For example, since collagen degradation is a key process of aging, a variety of topical surface-applied products containing collagen have been developed. Many beauty care products also use ingredients that are said to stimulate collagen renewal, such as retinoic acid, vitamin C and hyaluronic acid. There are also some cosmetic surgery (such as laser resurfacing), which can also effectively reduce facial wrinkles and skin irregularities.

Although there have been many solutions to reduce signs of aging or to stimulate skin regeneration, existing methods have failed to initiate endogenous repair mechanisms (eg, collagen synthesis) of the skin. Therefore, there is a need in the related art to provide a drug and method that can effectively prevent and/or alleviate skin aging, especially photoaging.

SUMMARY OF THE INVENTION The Summary of the Disclosure is intended to provide a basic understanding of the present disclosure. This Summary is not an extensive overview of the disclosure, and is not intended to be an SUMMARY OF THE INVENTION The Summary of the Disclosure is intended to provide a basic understanding of the present disclosure. This Summary is not an extensive overview of the disclosure, and is not intended to be an

The present invention is based, at least in part, on the discovery that a PEDF-derived synthetic peptide (hereinafter referred to as a synthetic peptide or a PEDF peptide) is capable of stimulating collagen production, promoting fibroblast proliferation, and reducing the expression of matrix metalloproteinases induced by UVB; Therefore, these PEDF peptides are effective in preventing and/or alleviating skin aging of a body. From this, it can be seen that the PEDF-derived synthetic peptide proposed herein can be used as an active compound for preventing and/or alleviating skin aging.

In view of this, one aspect of the present invention relates to the use of a PEDF-derived synthetic peptide which can be used to prevent and/or alleviate skin aging in a body.

According to various embodiments of the present specification, the synthetic peptide is 20-39 amino acid residues in length, and the sequence thereof is at least 80% identical to the sequence number: 1. Furthermore, the above amino acid sequence comprises at least 20 contiguous amino acid residues having a sequence of at least 90% and amino acid residues 11-30 of SEQ ID NO: 1. The same, so that the synthetic peptide can be used to prevent and / or alleviate the skin aging phenomenon of a body.

In an optional embodiment, the above synthetic peptide has at least four consecutive amino acids having the same sequence as the amino acid residues 11-14 of SEQ ID NO: 1. Non-limiting examples of such synthetic peptides include amino acid sequences such as SEQ ID NO: 1 (39-mer), SEQ ID NO: 2 (34-mer), SEQ ID NO: 3 (29-mer), SEQ ID NO: 5 (24-mer), SEQ ID NO: 6 (20-mer), SEQ ID NO: 8 (MO 29-mer) and SEQ ID NO: 9 (MO 20-mer). According to some embodiments of the present invention, the amino acid sequence of the above synthetic peptide is SEQ ID NO: 3 (29-mer), SEQ ID NO: 5 (24-mer) or SEQ ID NO: 6 (20-mer) Shown.

According to various embodiments of the invention, the skin aging is caused by ultraviolet radiation.

According to various embodiments of the invention, the individual may be any mammal, including a human.

In another aspect of the invention, a topical topical composition (hereinafter referred to as a composition) for preventing and/or alleviating skin aging in a body is proposed. The individual can be any mammal, including a human.

According to an embodiment of the present invention, the above composition comprises any of the synthetic peptides according to the above aspect/embodiment of the present invention, and the synthetic peptide is present in an amount sufficient to prevent and/or alleviate the skin aging phenomenon of the individual. The composition also includes a dermatologically acceptable excipient that can be used to carry the synthetic peptide.

According to various embodiments of the invention, the composition may be as follows A dosage form: solution, spray, aerosol, foam, cream, lotion, cream, gel or dressing.

Yet another aspect of the invention is a method for preventing and/or alleviating skin aging in a body. The individual can be any mammal, including a human.

In one embodiment, the above method comprises administering to the individual a synthetic peptide according to the above aspect/embodiment of the invention such that the synthetic peptide is delivered to the dermis layer of the individual via the transdermal membrane.

In an optional embodiment of the invention, the synthetic peptide can be formulated into a composition according to the above-described embodiment. In one embodiment, the composition can be applied topically to the skin of an individual. In an optional embodiment, the method further comprises applying an external stimulus (eg, a mechanical, electrical, thermal, ultrasonic or radio frequency (radio) to the skin of the individual prior to, and simultaneously after, the surface application step. Frequency, abbreviated as RF), to promote transdermal delivery efficiency of the synthetic peptide or pharmaceutical composition. Also optionally, the composition may further comprise at least one penetration enhancer to promote the transdermal efficiency of the synthetic peptide or composition.

According to various embodiments of the invention, the skin aging is caused by ultraviolet radiation.

The basic spirit and other objects of the present invention, as well as the technical means and implementations of the present invention, will be readily apparent to those skilled in the art of the invention.

The description of the embodiments of the present invention is intended to be illustrative and not restrictive. The features of various specific embodiments, as well as the method steps and sequences thereof, are constructed and manipulated in the embodiments. However, other specific embodiments may be utilized to achieve the same or equivalent function and sequence of steps.

The scientific and technical terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention pertains, unless otherwise defined herein. In addition, the singular noun used in this specification covers the plural of the noun in the case of no conflict with the context; the plural noun of the noun is also included in the plural noun used.

Although numerical values and parameter boundaries are used to define a broad range of values for the present invention, the relevant values of the specific embodiments have been presented as precisely as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range. Alternatively, the term "about" means that the actual value falls within the acceptable standard error of the average, depending on the considerations of those of ordinary skill in the art to which the invention pertains. Except for the experimental examples, or unless otherwise explicitly stated, all ranges, quantities, values, and percentages used herein are understood (eg, to describe the amount of material used, the length of time, the temperature, the operating conditions, the quantity ratio, and the like. Are all modified by "about". Therefore, unless otherwise stated to the contrary, the numerical parameters disclosed in the specification and the accompanying claims are It is an approximate value and can be changed according to the needs. At a minimum, these numerical parameters should be understood as the number of significant digits indicated and the values obtained by applying the general carry method.

The term "peptide" as used herein refers to a polymer composed of amino acid residues. The word "synthetic peptide" means that the peptide does not contain intact protein molecules found in nature. The reason why such a peptide is "synthetic" is that it is obtained by humans using technical means such as chemical synthesis, recombinant genetic techniques or segmentation of the entire antigen. In the present specification, any amino acid residue based on the position in a peptide is counted from the N-terminus of the peptide.

The various parts of the word "proliferation" or "proliferation" herein refer to the situation in which the number of cells in a population increases through cell division.

"Percent % amino acid sequence identity" as used herein with respect to the synthetic peptide sequence means the amino acid residue of the candidate synthetic peptide and the amino acid of a reference polypeptide The percentage of residues that are identical. When performing the above alignment, the candidate synthetic peptide can be side by side with the reference polypeptide, and a gap is introduced as necessary to form the highest sequence similarity of the two sequences, and when calculating the similarity, the Amino acid residues of conservative substitutions are taken into account. A variety of methods are available for the above-described side-by-side, such as publicly available software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR). Those skilled in the art to which the present invention pertains may select appropriate parameters and calculation methods when performing side-by-side to obtain an optimal arrangement. In the present specification, sequence comparison between diamine acid sequences is carried out using the protein-protein BLAST analysis software Blastp provided by the National Center for Biotechnology Information (NCBI). Amino acid sequence similarity of a candidate amino acid sequence A compared to a reference amino acid sequence B (also referred to herein as sequence A and sequence B have a specific percentage (%) of amino acid sequence similarity Degree) is calculated as follows: Where X is the identity of the same amino acid residue obtained by aligning the sequences A and B with Blastp software, and Y is the total number of amino acid residues of the shorter of the A and B sequences.

In the present specification, the various parts of speech and the tense (such as treat, treating or treatment) mean that the synthetic peptide or composition described herein is administered or administered to a body which may exhibit the skin. A sign of aging or prone to skin aging in order to partially or completely alleviate, improve, or alleviate, or delay the onset, hinder its progression, reduce its severity, and/or reduce the incidence of skin aging. .

As used herein, the term "effective amount" means an amount of a component sufficient to induce a desired response or effect. The specific effective amount depends on various factors such as the particular condition to be treated, the individual's physiological condition (eg, individual body weight, age or sex), the type of mammal or animal being treated, the duration of treatment, and other current treatments The nature of (if any) and the specific formulation used and the structure of the compound or derivative thereof. An effective amount also refers to the toxicity of the compound or composition at this level. The negative effects are not as good as the positive effects.

The word "application" or "administration" as used herein refers to the administration of one or more doses of the effective amount of the PEDF-derived synthetic peptide or composition to an individual to prevent and/or alleviate skin aging. According to an embodiment of the invention, the preferred mode of delivery is transdermal delivery. For example, the PEDF-derived synthetic peptide or composition can be topically applied to the skin of an individual and brought to a target site (eg, the dermis layer) to prevent or alleviate skin aging.

The term "excipient" as used herein refers to any inert substance (including powder or solution) which can be used as a vehicle/carrier for the PEDF-derived synthetic peptide. Excipients are generally safe, non-toxic materials, and broadly include any material that can be used in the pharmaceutical industry to prepare compositions, such as fillers, diluents, coagulants, binders, lubricants, glidants, stabilizers, Colorants, sizing agents, etc.

In the present specification, "dermatologically acceptable" means that it is suitable for use on human and/or animal skin and does not cause undue side effects (eg toxicity, at a reasonable benefit/risk ratio) Stimulation and allergic reactions). In addition, each excipient must be compatible with the other ingredients in the pharmaceutical formulation to be an "acceptable" ingredient.

The term "subject" as used herein refers to a mammal (including a human) that can receive a synthetic peptide, composition and/or method of the invention for disposal. Unless otherwise indicated, "individual" generally includes males and females.

As used in this specification, the term "transdermal" refers to an active compound (eg, a synthetic peptide or composition as described herein). The epidermis reach the dermis.

Pigment epithelium-derived factor (PEDF) is a multifunctional secreted protein with anti-angiogenic, anti-tumorigenic and neurotrophic functions. . The human PEDF protein (SEQ ID NO: 11) is a secreted protein of approximately 50 kDa with 418 amino acids. It is known that the 34-mer fragment of PEDF (corresponding to residues 44-77 of PEDF) and the 44-mer fragment (corresponding to residues 78-121 of PEDF; SEQ ID NO: 10) have antiangiogenic effects, respectively. Nerve nourishing properties.

This specification is based, at least in part, on the discovery that synthetic peptides from 44-mer PEDF are capable of protecting the skin from skin aging damage through a variety of mechanisms. The experiments provided in the present specification demonstrate that the synthetic peptide can increase the collagen content in the dermis layer, initiate the expansion of dermal fibroblasts, and reduce MMP-1, a collagenase that is induced by UVB. which performed. Another innovative feature of the present invention is that the synthetic peptide proposed herein has only 20 to 39 amino acid residues, which is much shorter than the full length PEDF described in the prior art; therefore, the present invention overcomes the traditional protein in clinical practice. Difficulties often encountered in use, such as high manufacturing costs, low bioavailability, and poor pharmacokinetics. Therefore, these synthetic peptides can be used to prevent and/or alleviate skin aging.

In view of this, an aspect of the present invention relates to a use of a PEDF-derived synthetic peptide for preventing and/or alleviating skin aging in a body. this Another aspect of the invention is directed to another use of the above PEDF-derived synthetic peptide which can be used to prepare a composition for preventing and/or alleviating skin aging in a body. In addition to the above uses, an aspect of the present invention also provides a method of preventing and/or alleviating skin aging in a body. Various embodiments suitable for the above aspects are described below.

According to various embodiments of the present specification, the synthetic peptide has 20 to 39 amino acid residues, and the amino acid sequence thereof has at least 80% amino acid sequence similarity to SEQ ID NO: 1 (LSVATALSALSLGAEQRTESIIHRALYYDLISSPDIHGT). For example, the amino acid sequence sequence of the synthetic peptide and SEQ ID NO: 1 can be about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93. , 94, 95, 96, 97, 98, 99 or 100%. In addition, the synthetic peptide comprises at least 20 contiguous amino acid residues having at least 90% amino acid sequence similarity to SEQ ID NO: 1 from 11 to 30 residues. Specifically, the 20 consecutive amino acid residues may have a similarity to the amino acid sequence of the 11th to 30th residues of SEQ ID NO: 1 of about 90, 91, 92, 93, 94, 95, 96, 97. , 98, 99 or 100%.

In one embodiment of the invention, the synthetic peptide has 39 amino acid residues, the sequence of which is as shown in SEQ ID NO: 1. In the experimental examples below, this synthetic peptide was also referred to as a 39-mer. Such a 39-mer peptide is a shorter variant of the known 44-mer fragment from human PEDF (PEDF residues 78-121).

The previous inventor's experiment was performed by the inventor of the present invention (for example, U.S. Patent Application Serial No. 13/428,996, the disclosure of which is incorporated herein by reference. The experimental examples provided in this specification and the present specification show that there are several other short PEDF synthetic peptides derived from this 39-mer which can be used to prevent and/or alleviate skin aging.

For example, from the experimental examples of the following and the prior application, the 34-mer synthetic peptide as shown in SEQ ID NO: 2 (ALSALSLGAEQRTESIIHRALYYDLISSPDIHGT) can effectively prevent and/or alleviate the phenomenon of skin aging. The 34-mer synthetic peptide corresponds to amino acid residues 88-121 of human PEDF; the 34-mer and 39-mer amine groups are calculated according to the amino acid sequence similarity calculation method described above. The acid sequence similarity is 100%, and the amino acid sequence residues of amino acids 6 to 25 of the 34-mer and the amino acid residues of the 39-mer amino acid residues are also 100%.

Furthermore, the following experimental examples demonstrate that the 29-mer synthetic peptide as shown by SEQ ID NO: 3 (SLGAEQRTESIIHRALYYDLISSPDIHGT) is effective in preventing and/or alleviating skin aging in an individual. This 29-mer synthetic peptide corresponds to amino acid residues 93-121 of human PEDF; its similarity to the amino acid sequence of 39-mer is 100%, and the amine of No. 1-20 of 29-mer The amino acid sequence has a similarity to the amino acid sequence of the amino acid residues 11-30 of the 39-mer.

As demonstrated in some experiments below, a 24-mer synthetic peptide is also effective in preventing and/or alleviating skin aging in an individual. The sequence of this 24-mer is shown in SEQ ID NO: 5 (SLGAEQRTESIIHRALYYDLISSP) and corresponds to amino acid residues of human PEDF No. 93-116. In addition, the 24-mer sequence is identical to the amino acid residues 11-30 of the 39-mer (amino acid sequence similarity: 100%) and is similar to the amino acid sequence of the 39-mer. The degree is also 100%.

Certain experiments in this specification demonstrate that a 20-mer as shown in SEQ ID NO: 6 (SLGAEQRTESIIHRALYYDL) is also effective in preventing and/or alleviating skin aging in an individual. The sequence of this 20-mer corresponds to the amino acid residue of human PEDF No. 93-112, which is identical to the amino acid residues 11-30 of the 39-mer (amino acid sequence similarity: 100%) And its similarity to the amino acid sequence of the 39-mer is also 100%.

The experimental examples disclosed in the present application and the prior application also show that two other short, synthetic peptides derived from mouse PEDF are also effective in preventing and/or alleviating skin aging. The first synthetic peptide derived from mouse is referred to in this specification as Mo 29-mer, the sequence of which is shown in SEQ ID NO: 8 (SLGAEHRTESVIHRALYYDLITNPDIHST), which has a similarity to the 39-mer amino acid sequence of 83. %, and its first 20 amino acid residues have a similarity to the amino acid sequence of the 11- to 30-residue of the 39-mer. Another synthetic peptide derived from mouse PEDF is called Mo 20-mer and its sequence is shown as SEQ ID NO: 9 (SLGAEHRTESVIHRALYYDL). The amino acid sequence residues of the Mo 20-mer and the 39-mer or 39-mer amino acid residues are all 90% similar.

In an optional embodiment, the PEDF-derived synthetic peptide has at least four consecutive amino acids in the same sequence as the amino acid residues 11-14 of SEQ ID NO: 1. The experimental results carried out by the inventors of the present invention show that the amino acid residues 11-14 of the sequence of SEQ ID NO: 1 (i.e., SLGA) play an important role in maintaining the physiological function of the short PEDF synthetic peptide. color. For example, the various experimental examples presented below show that an 18-mer synthetic peptide (EQRTESIIHRALYYDLIS; SEQ ID NO: 7) without this SLGA fragment does not protect the individual against skin aging. Further, it can be found from the experimental examples contained in the present application and the prior application that the 25-mer synthetic peptide (EQRTESIIHRALYYDLISSPDIHGT; SEQ ID NO: 4) containing no SLGA sequence is also effective in preventing and/or alleviating skin aging.

The synthetic peptides described herein, such as t-BOC or FMOC, can be synthesized using any conventional technique to protect alpha-amino groups. Both methods employ a stepwise synthesis starting with the C-terminus of the peptide, each time adding an amino acid. Other known solid phase peptide synthesis (SPPS) methods can also be utilized to synthesize the synthetic peptides described herein.

Also included within the scope of the invention are other synthetic peptides that have conservative variations compared to 39-mer. Here, the term "conservative substitution" refers to the replacement of a residue with another biologically similar residue. Illustrative of conservative substitutions include substitutions of hydrophilic residues (such as isoleucine, valine, leucine, and methionine) with each other, or similar polar residues (such as arginine and lysine; Or glutamic acid and aspartate) replacement with each other, and other similar modes of substitution. "Conservative substitution" as used herein also refers to the use of a substituted amino acid to replace an unsubstituted amino acid, as long as the antibody reactive with the substituted amino acid can also react with the original amine. The base acid can be used for an immune reaction.

According to various embodiments of the invention, the skin aging is caused by ultraviolet (especially UVB) illumination.

The PEDF multipeptide fragments described herein can be used to prevent and/or alleviate skin aging in mammals. The mammals include, but are not limited to, humans, primates other than humans, murines, and the like. In a preferred embodiment, the individual is a human.

The various synthetic peptides described in the above embodiments may also be formulated into a composition to prevent and/or alleviate skin aging in an individual; such compositions are within the scope of another aspect of the invention.

According to an embodiment of the present invention, the above composition comprises any of the synthetic peptides according to the above aspect/embodiment of the present invention, and the synthetic peptide is present in an amount sufficient to prevent and/or alleviate the skin aging phenomenon of the individual. The composition also includes a dermatologically acceptable excipient that can be used to carry the synthetic peptide.

The above compositions can be prepared according to established pharmaceutical procedures, as described in, for example, Remington's Pharmaceutical Sciences (17th edition, ed. Alfonoso R. Gennaro, Mack Publishing Company, Easton, Pa (1985).).

In selecting an excipient suitable for delivery of a synthetic peptide, it is primarily necessary to consider the mode of administration of the composition. According to an optional embodiment of the invention, the synthetic peptide or composition can be delivered to the dermis layer of the individual via a transdermal membrane route; thus, any excipient suitable for use in this pathway can be used herein. In the preparation of the above composition, various dermatologically acceptable inert excipients can be used; for example, water, ethyl alcohol, polyvinyl pyrrolidone, propylene glycol, mineral oil , stearyl alcohol, ointment base and other materials that form a gel.

In an optional embodiment, a vesicle-forming vehicle, such as a liposome, a microsphere or a nanosome, may also be utilized. The synthetic peptide is embedded therein and then formulated into the desired dosage form. These microbubble-forming carriers can promote transdermal delivery efficiency of the synthetic peptides proposed herein; in addition, they can also be used as sustained release dosage forms to ensure that the compositions provide long-lasting protection.

In an alternative or combinable regimen, the composition may further comprise an optional penetration enhancer that is capable of promoting transdermal delivery efficiency of the synthetic peptide or composition. For example, penetration enhancers can disrupt the original regular arrangement of stratum corneum lipids, interactions with intercellular proteins, or enhance the entry of active compounds, co-enhancers or carriers. The distribution coefficient of the stratum corneum; in turn, the purpose of promoting the delivery efficiency of the transdermal membrane is achieved. Examples of penetration enhancers include, but are not limited to, sulphoxides such as dimethyl sulfoxide (DMSO) and dimethylformamide (DMF); terpenoids ( Azones, such as: 1-dodecylazacycloheptan-2-one; pyrrolidone, such as N-methyl-2-pyrrolidone N-methyl-2-pyrolidone); oils such as: terpenes and menthol (L-menthol); oxazolidinones, such as 4-mercaptooxazolidin-2-one (4 -decyloxazolidin-2-one); fatty acids such as: lauric acid, myristic acid With capric acid; glycols, such as: diethylene glycol and tetraethylene glycol; surfactants, such as polyoxyethylene Polyoxyethylene-2-oleyl ether and polyoxyethylene-2-stearly ether; pore-forming peptides, such as Xenopus a peptide (magainin); and a cell penetrating peptide, such as a transportan and a penetratin.

Also optionally, the compositions of the present invention may also comprise one or more dermatologically acceptable additives known to those of ordinary skill in the art to enhance delivery efficiency of synthetic peptides and to improve user use. experience. The above optional ingredients include, but are not limited to, one or more of the following ingredients: drying agents, anti-itch agents, anti-foaming agents, buffers, Neutralizing agents, pH adjusting agents, coloring agents, discoloring agents, emollients, emulsifying agents, emulsion stabilizers ), viscosity builders, humectants, odorants, preservatives, antioxidants, chemical stabilizers, thickening agents, Stiffening agents, suspending agents, and the like.

According to various embodiments of the invention, the composition is adjustable to the following Any of the dosage forms suitable for transdermal delivery: solutions, sprays, aerosols, foams, creams, lotions, ointments, Gel or patch.

According to an optional embodiment of the invention, the synthetic peptide is present in the composition at a level of from about 0.1 to 100 μM; preferably from about 1 to 25 μM. For example, the content of the synthetic peptide can be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 μM. Specifically, the dose concentration for the approximately 20 gram mouse was used in the experimental examples below to be about 25 μM. The technical field of the present invention has a dosage of a mouse that can be administered by a person of ordinary skill based on the present specification, and according to the guidelines proposed by the US Food and Health Administration (titled as "Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers"), which is converted to human equivalent dose (HEQ).

In still another aspect, the present invention provides a method for preventing and/or alleviating skin aging in a body. The individual can be any mammal, including a human.

In one embodiment, the method comprises administering to the individual an effective amount of a synthetic peptide according to the above aspect/embodiment of the invention, such that the peptide is delivered to the dermis layer of the individual via a transdermal membrane.

In an optional embodiment, the synthetic peptide can be formulated into the compositions described above in the aspects/embodiments of the invention.

In one embodiment, the composition can be applied as a partial surface The synthetic peptide or composition is delivered to the dermis layer of the individual by the transdermal means, with or without the use of external stimuli.

When no external stimuli are used, the composition can be applied topically to the skin of the individual by spraying, applying, massaging, applying or otherwise. At this point, the composition preferably may comprise at least one penetration enhancer as described above. In addition, the synthetic peptide can also be encapsulated in a microbubble forming carrier according to the method described above to promote transdermal delivery efficiency of the synthetic peptide.

A variety of external stimuli are known to increase the permeability of the coating to the active ingredient (e.g., the synthetic peptide proposed herein). The external stimuli include, but are not limited to, mechanical stimulation, current stimulation, temperature stimulation, ultrasonic stimulation, or radio frequency stimulation. In actual practice, additional stimulation may be applied to the skin prior to, concurrently with, or after application of the above composition to the skin. Similarly, when an external stimulus is used to assist in the delivery of the composition or synthetic peptide, the optional penetration enhancer and/or microbubble forming carrier described above may also be included in the composition.

In one embodiment, a mechanical stimulus can be applied to the skin using a microstructured applicator such as a microneedle system or a microchannel system. The microneedle system can have a plurality of solid or hollow microneedles having a length of about 100-1000 μM. When a solid microneedle system is employed, the synthetic peptide or composition presented herein can be applied to the tip of each microneedle. When the microneedle system is applied to the skin, the microneedle will pass through the stratum corneum and stay in the skin. Thus, the synthetic peptide or composition can be delivered to the dermis layer. When using a hollow microneedle system, The composition can be prepared into a liquid state which is then filled into a cavity inside each microneedle which, when applied to the skin and passed through the skin, allows liquid to flow from the system into the dermal layer of the skin. Inside. Alternatively, the composition presented herein can be topically applied to the skin, and then a microchannel system having a plurality of microneedles can be applied to the skin such that the microneedles pass through the skin (with a penetration depth of less than 100 microns). Multiple microchannels are formed in the skin to enable the composition to reach the epidermal layer via the transmembrane form. Alternatively, the composition presented herein can be topically applied to the skin after the microchannels are formed on the skin.

In addition, other methods of use (such as specific humidity or temperature) can be used in implementing the methods presented herein. For example, in an optional embodiment, it can be administered under relatively warm and humid conditions to increase the efficiency of transdermal delivery of the drug.

A number of experimental examples are set forth below to illustrate certain aspects of the present invention, and the present invention may be practiced by those of ordinary skill in the art. These examples should not be construed as limiting the scope of the invention. It is believed that the skilled artisan, after reading the description set forth herein, may fully utilize and practice the invention without undue interpretation. All publications cited herein are hereby incorporated by reference in their entirety.

Experimental example Materials and Methods <material>

DMEM medium (Dulbecco’s modified Eagle’s Medium), fetal bovine serum (FBS), 0.25% trypsin were purchased from Invitrogen (Carlsbad, CA). Light mineral oil, glycerol, dimethyl sulfoxide (DMSO), bovine serum albumin (BSA), 5-bromo-2'-deoxyuridine (5-bromo-2'-deoxyuridine, referred to as BrdU), Hoechst 33258 dye, Hoechst 33342 dye, anti-β-actin antibody, Masson's Trichrome Other chemical materials were purchased from Sigma-Aldrich (St. Louis, MO). Dispase II and collagenase I were purchased from Roche (Indianapolis, IN). Anti-BrdU antibody (GTX42641), anti-MMP-1 antibody and anti-vimentin antibody (GTX100619) were purchased from GeneTex (Taipei, Taiwan). Anti-collagen 1A1 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Various fluorescent dye-binding secondary antibodies were purchased from BioLegend (San Diego, CA). Hematoxylin and eosin (H&E) dyes were purchased from Merck (Rayway, NJ, USA).

FITC-bound 29-mer and other short synthetic peptides (including 29-mer (SEQ ID NO: 3), 24-mer (SEQ ID NO: 5), 20-mer (SEQ ID NO: 6) and 18-mer (sequence No.: 7)) purchased from GenScript (Piscataway, NJ). After synthesis, its N-terminal is acetylated and C-terminally amidated to enhance stability and characterize by mass spectrometry (purity) >95%). PEDF-derived synthetic peptides (29-mer, 24-mer, 20-mer or 18-mer) were prepared in DMSO as solvent It was a 5 mM stock solution and stored at -20 °C for subsequent use.

Paraffin grease (10% w/w), glycerin (10% w/w) was mixed with light mineral oil (1% w/w) and distilled water to prepare a skin ointment. 5 μl of PEDF peptide storage solution and 1 g of cream were mixed to prepare a cream containing PEDF peptide.

<animal>

All animals used in the examples contained in this specification were housed in a cage with temperature and humidity control at a temperature of about 24 ° C to 25 ° C and a light dark cycle of 12: 12 hours. Drinking water and standard rodent feed are provided for the meal during the test. The experimental plans were approved by the Ethics Committee of the Ma Rong Memorial Hospital (New Taipei City, Taiwan) and followed the national animal protection regulations.

<Separation and culture of skin fibroblasts from mouse dermis layer>

A full depth of skin tissue is obtained from the C57BL/6 mouse. The subcutaneous tissue was carefully excised from the sample and washed three times with sterile phosphate-buffered saline (PBS). The resulting tissue is then cut into small pieces (1-2 mm ³ ). After treatment with 0.1% dispase for one night at 4 ° C, the epidermal layer was removed; the remaining dermal tissue was treated with 0.1% collagenase for 4 hours at 37 °C. The treated cells were collected by centrifugation (400 g, 5 minutes) and resuspended in high glucose concentration DMEM medium supplemented with FBS (10%), L-sitamine (2 mM) and penicillin/ Streptomycin antibiotic mixture (1%). The cells were seeded on tissue culture plates (Falcon Labware; NJ, USA) at a density of 1 x 10 ³ cells per square centimeter and incubated at 37 ° C with 5% carbon dioxide. At 24 hours, the medium was discarded to remove non-adherent cells and fresh medium was added. . For subculture, enzyme treatment (0.25% trypsin/EDTA) was used to collect near-confluent cells.

<WS-1 Cell Culture>

The human skin fibroblast WS-1 cell line was obtained from the Food Industry Development Institute of the Corporation (Hsinchu, Taiwan). The WS-1 cells were cultured in a single layer in a cell culture flask in a humidity-conditioned incubator at 37 ° C under 5% carbon dioxide. The medium used was 10% FBS-DMEM, and L-situramine (2 mM), non-essential amino acid (0.1 mM) and penicillin/streptomycin antibiotic mixture (1%) were added. For subculture, enzyme treatment (0.25% trypsin/EDTA) was used to collect nearly overgrown cells.

<Histological Analysis>

After the skin samples were fixed with 4% formaldehyde, they were dehydrated with a series of concentration gradients of ethanol and then embedded in solid paraffin blocks. The tissue was cut into sheets of about 5-μm. The paraffin was removed in xylene before use and the sample was returned to the series with a concentration gradient of ethanol.

General histological observations were performed using H&E staining. Samples were stained using Manson's trichrome dye according to the method described by the manufacturer. The samples were observed with a Nikon Eclipse 80i optical microscope and images were taken (original magnification: 400 times). For semi-quantitative analysis of collagen area (mm ² /mm ² ), 10 fields of view were selected from each slide under an optical microscope and the entire image was measured using the Image-Pro Plus 4.5.1 system (Media Cybernetics). The area of the area stained by blue in the slice area.

<Immunofluorescence staining and BrdU staining>

After the cells were fixed with 4% formaldehyde, they were treated with cold methanol for 2 minutes, followed by treatment with 1 N HCl for 1 hour at room temperature, followed by immunofluorescence staining.

For animal experiments, a stock solution containing 10 mM BrdU was prepared using DMSO as a solvent. After 10 μl of the BrdU stock solution and 90 μl of PBS were mixed, the mice were intraperitoneally injected, and the mice were euthanized after 16 hours. A formaldehyde-fixed and paraffin-embedded skin sample was placed in xylene to remove paraffin and the sample was returned to the series with a concentration gradient of ethanol. The samples were then contacted with 1 N HCl for 1 hour at room temperature and subjected to immunofluorescence staining analysis.

BrdU-labeled DNA was detected using an anti-BrdU multi-strain antibody and rose-conjugated sputum-anti-rabbit-IgG. Next, the nuclei were stained with Hoechst 33258 stain (blue).

<Immune dot analysis>

The formulation of the lysis buffer is as follows: 20 mM HEPES (pH 7.4), 150 mM NaCl, 1% SDS, 1 mM EDTA, 5 mM phenylmethanesulfonyl fluoride (abbreviated) PMSF) with 1 mM dithiothreitol (DTT). Cells were homogenized using 0 °C cell lysate, 1% Triton X-100, and a freshly prepared protease inhibitor cocktail (available from Roche; Indianapolis, IN). The resulting homogenate was then centrifuged at 12,000 g for 30 minutes at 4 ° C, and the supernatant was collected and stored at -70 °C. The Bradford assay was used to determine the protein content of the lysate. The whole cell lysate was obtained using the above cell lysate, and then a small amount of the lysate was separated by SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore; Bedford, MA). Immunoblot analysis was then performed.

The antibody used in the immuno dot analysis contained anti-type 1 collagen 1A1 antibody (dilution ratio: 1:1000 dilution), anti-MMP-1 antibody (dilution ratio: 1:500), and anti-β-actin Antibody (dilution ratio 1:10000). The target protein is then detected using an appropriate IgG-HRP di-antibody and ECL preparation (Amersham; Arlington Heights, IL). X-ray films were scanned using a Model GS-700 development optical hydrometer (Bio-Rad Laboratories; Hercules, CA) and analyzed in Labworks 4.0 software. Quantitative analysis used ink dots from at least three independent experiments.

<RNA extraction and reverse transcription polymerase chain reaction>

Total RNA was extracted from cells by TRIzol (Invitrogen) and treated with DNase I (Qiagen, Santa Clarita, CA) without ribohydrolysis enzyme (Rnase-free). Remove genomic DNA, then purify the set of Dynabeads with RNA (Invitrogen) was purified. Add 1 μg of total RNA from fibroblasts to 200 units of reverse transcriptase in 20 μl of reaction buffer (containing 0.25 μg of random primer and 0.8 mM deoxyribonucleoside triphosphate (dNTPs)) (Roche , Mannheim, Germany), reacted at 42 ° C for 1 hour to reverse transcribe RNA into cDNA. In the subsequent PCR reaction, 2 μl of cDNA was taken as a reaction template. The PCR reaction has a reaction volume of 30 μl containing 15 μl of EconoTaq® PLUS GREEN 2×Master Mix (Lucigen® Corp.) and 1 μM of various primers with 2 μl of template DNA. The proliferative reaction of the synthetic cDNA was about 18-22 cycles (denaturation: 20 seconds, 94 ° C; adhesion: 30 seconds, 57 ° C; and polymerization: 40 seconds, 72 ° C).

The number of cycles used for each primer set falls within the linear range of the extension. The primer set used to propagate the murine MMP-13 gene (registration number: NM_008607) contained a forward primer (ATCCTGGCCACCTTCTTCTT; SEQ ID NO: 12) and a reverse primer (TTTCTCGGAGCCTGTCAACT; SEQ ID NO: 13), and the PCR product was about 201 bp in size. In addition, a mouse glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene (registration number: M32599) was used as a housekeeping gene to standardize gene expression. The primer set for proliferating the GAPDH gene includes a forward primer (AACTTTGGCATTGTGGAAGG; SEQ ID NO: 14) and a reverse primer (ACACATTGGGGGTAGGAACA; SEQ ID NO: 15), and the PCR product has a size of about 223 bp. The PCR product was electrophoresed using 2% acacia gum containing ethidium bromide and developed by UV light. Utilize FUJI LAS-3000 system with Multi Gauge Ver. The PCR product was quantitatively analyzed by optical density method using 1.01 software (Fujifilm, Tokyo, Japan).

<Statistical Analysis>

The results are expressed as mean ± standard error of the mean (SEM). Statistical comparisons were made using one-way ANOVA analysis. Statistically significant differences were obtained at P < 0.05 unless otherwise stated.

Experimental example 1 Transdermal delivery of PEDF peptide

This experiment used a luciferin (FITC)-conjugated 29-mer peptide to investigate in vivo transdermal delivery of the PEDF peptide proposed herein.

First, after the mice were subjected to general anesthesia, the back of the mice was treated with a melted wax/rosin (1:1) mixture to remove hair. A luciferin-conjugated 29-mer ointment (concentration 25 μM) was applied to the back skin of the mice on the next day. In the FITC-29mer/MN group, after applying the ointment, gently press the microneedle (3M ^TM Microchannel Skin System; taken from Singapore 3M) onto the back skin, so that the microneedle penetrates the skin (penetration depth is less than 100 microns) ). In the control group (i.e., FITC-29mer/CT group), the subsequent microneedle treatment was not performed after the ointment was applied. At 24 hours, skin samples were collected and the sections were observed under a fluorescent microscope. Figure 1 presents a representative photograph of three independent experiments (original magnification: 400 times).

The left side of the first picture is the H&E stained sample, and the photo shows the sample. Epidermis and dermis parts. The fluorescent images in the middle and right of Figure 1 show the distribution of FITC-bound 29-mer in skin samples. Specifically, significant green fluorescence signals were observed in both the epidermal and dermal layers of the FITC-29mer/MN group, representing the successful delivery of the FITC-conjugated 29-mer transdermal membrane into the dermis layer. In contrast, in the FITC-29mer/CT group, the green fluorescent signal in the dermis was very weak, and most of the luciferin signals remained in the epidermal layer.

Experimental example 2 PEDF peptide can increase skin collagen content

Collagen forms the main component of the dermal matrix and forms a strong fibrous structure to give the skin the proper elasticity. The purpose of this experimental example is to investigate whether the PEDF peptide proposed here can increase the amount of collagen in the skin. Mice were depilated according to the method described in Experimental Example 1 and randomly assigned to the following groups. Apply 50 μl of ointment (containing 29-mer, 20-mer or DMSO-only ointment) to one side of the midline of the back (about 2 cm2), and then perform microneedle treatment; Apply 50 μl of the same ointment to the other side of the line without microneedle treatment. The treatment was continued twice a week for two weeks, the skin was directly exposed to the air, and a skin sample was taken 14 days after the first treatment. Skin collagen was stained with a Manson's trichrome stain (blue); representative photos are shown in Figure 2. The stained collagen area was quantified according to the method described in the "Materials and Methods" section above and normalized to the area of the vector/MN group. The content of the first type collagen COL1A1 was also quantified using the animal experiment method described above, followed by immunoblot analysis, and the results were normalized based on the results of the vector/CT group. A summary of the quantitative analysis results is summarized in Table 1 ( ^* P < 0.05 compared to the vehicle / MN group; ^** P < 0.002 compared to the vehicle / CT group).

The photograph in Fig. 2 shows that in the sections of the 29-mer/MN and 20-mer/MN groups, a more pronounced blue region (compared to the carrier/MN group) can be observed, so it can be inferred that 29-mer Or 20-mer with microneedle treatment can increase the collagen content in the dermis. Furthermore, comparing the vector/CT with the carrier/MN slice, it was found that the microneedle treatment itself did not have an effect of increasing the collagen content. Furthermore, there was no significant difference in the content of collagen in the carriers/CT, 20-mer/CT and 29-mer/CT groups, indicating that there was no significant difference in the intrinsic content of collagen between different subjects.

Type 1 collagen COL1A1 is the main component of skin collagen. The results of immuno dot analysis showed that 29-mer/MN and 20-mer/MN treatment significantly increased COL1A1 content (compared to vehicle/CT control group).

Experimental example 3 PEDF peptide promotes skin fibroblast expansion

Fibroblasts are the main cells responsible for the production of collagen in human skin, and thus a number of in vitro and in vivo analyses were performed here to evaluate the PEDF peptides proposed herein for skin fibroblasts. The impact of amplification.

Experimental example 3.1 PEDF peptide can promote skin fibroblast expansion in vitro

Mouse skin fibroblasts were isolated and cultured as described in the Materials and Methods section. The second generation of dermal fibroblasts were cultured at a density of 2×10 ⁵ per well in a 6-well plate on a gelatin-coated slide and cultured in DMEM medium containing 10% FBS for 24 hours, and then only 1 % FBS minimal medium (UT control) or PEDF peptide with 1% FBS and 50 nM (ie, 29-mer, 24-mer, 20-mer, 18-mer, Mo 29-mer or Mo 20-mer) The medium was cultured for 24 hours. For BrdU labeling analysis, BrdU (final concentration 10 μM) was added to the culture system for 2 hours. In addition, fibroblasts (green) were stained with fibroblast molecular marker-vimentin; representative photographs are shown in Figure 3. Here, the BrdU/middle silk protein labeling index is used to indicate the number of BrdU- and intermediate filament protein double positive cells, which is calculated by dividing the number of cells positive for BrdU and intermediate filament protein by the cells positive for the intermediate filament protein. The total, expressed as a percentage (%); the results are summarized in Table 2 ( ^* P < 0.002 compared to the untreated group).

In summary, the dermal fibroblasts cultured in a medium containing the PEDF peptide (eg, 29-mer, 24-mer, 20-mer, and two mouse homologs) proposed herein are amplified. The activity was more than 5 times higher than that of the untreated control group. Conversely, when treated with an 18-mer peptide that does not contain the SLGA sequence, such an effect of promoting amplification cannot be achieved.

Experimental Example 3.2 PEDF peptide can promote skin fibroblast expansion in vivo

Here, the sample of the above experimental example 2 was stained to detect the molecular marker of the fibroblast (intermediate silk protein), and the number thereof was calculated under a microscope, and the number of intermediate silk proteins per unit area (per square mm) was summarized. In Table 3 ( ^* P < 0.002 compared to the carrier / MN group).

The data in Table 3 shows that samples treated with 29-mer/MN and 20-mer/MN have higher fibroblast density (compared to vehicle/MN group and vehicle/CT group). This result shows that the transdermal delivery of the PEDF peptide proposed herein is positively correlated with the density of fibroblasts in the dermis.

To investigate whether transdermal delivery of PEDF peptides can promote the expansion of dermal fibroblasts in vivo, mice were intraperitoneally injected with BrdU and euthanized at 16 hours after PEDF peptide/MN treatment or vehicle/MN treatment. After obtaining a skin sample, the stain detects intermediate filament protein (green) and BrdU (red). The number of BrdU- and intermediate filament protein-double positive cells was expressed by BrdU/intermediate protein labeling index; the results are summarized in Table 4 ( ^* P < 0.05 compared to vector/MN group).

As can be seen from Table 4, the amount of fibroblasts in the amplification was higher in the group treated with 29-mer/MN and 20-mer/MN (compared to the carrier treated with DMSO-containing ointment/MN) group). This result shows that transdermal delivery of the PEDF peptide here can effectively enhance skin fibroblast expansion activity. Here, the result of an increase in the activity of skin fibroblast amplification corresponds to the result of the increase in collagen content above (Table 1).

Experimental Example 3.3 PEDF peptide can promote the expansion of photodamaged fibroblasts in vivo

It is known that ultraviolet radiation (UVB) causes the collagen matrix of the skin to break, which in turn leads to the cell cycle arrest of the fibroblasts. Therefore, it was investigated through this experimental example whether the transdermal delivery of the PEDF peptide proposed herein can effectively restore the amplifying activity of fibroblasts damaged by UVB irradiation.

Six-week-old female nude mice (BALB/cAnN.Cg-Foxnlnu/CrlNarl) were irradiated with UVB on the back for five weeks every Friday; the light source used contained five UV lamps (XL-1000B, Spectrolinker ^TM apparatus; emission peak) : 312 nm), about 20 cm above the back of the mouse. During the UVB irradiation, the small genus is free to move inside the cage. The intensity of the irradiation is expressed by the minimum erythemal dose (MED). The intensity of the first two weeks is 1 MED (60 mJ/cm ² ), and then gradually increases; the intensity of the 3rd to 4th week is 2 MED (120 mJ/cm ² ); the irradiation intensity at 5th to 6th week was increased to 3 MED (180 mJ/cm ² ); the intensity at 7th 8th week was 4MED (240 mJ/cm ² ). After 8 weeks of UVB irradiation, the test animals showed obvious wrinkles on the back. At this time, the animals were randomly divided into the following 4 groups of 3 mice each. In the UVB/carrier, UVB/29-mer, UVB/20-mer and UVB/18-mer groups, 350 μl of ointment (containing DMSO, 29-mer, 20-mer or 18-mer PEDF, respectively) Topically applied to the back skin of the mouse, and then the skin is puncture with a microneedle, so that the ointment is delivered through the transfer film. Ointment and microneedle treatment were performed twice a week for two weeks. After the last treatment, BrdU was intraperitoneally injected into mice and euthanized 16 hours later. In addition, mice that were not irradiated with UVB (normal group) and no treatment (UVB/UT) after UVB irradiation were used as control mice. The resulting skin samples were stained to detect intermediate filament protein and BrdU, and the number of stained cells was counted under a microscope. The number of BrdU- and intermediate filament protein-double positive cells was expressed by BrdU/intermediate protein labeling index; the results are summarized in Table 5 ( ^* P < 0.01 compared to the normal group; ^** P < 0.05 compared to UVB/ Carrier group).

As can be seen from Table 5, compared with normal skin without UVB irradiation (normal: 4.1 ± 0.8%), after UVB irradiation (UVB / carrier: 2.1 ± 1.1%), the activity of skin fibroblasts decreased. About 50%. On the other hand, delivery of the 29-mer and 20-mer transdermal membranes to mice after UVB irradiation increased the amplifying activity of dermal fibroblasts by about 2.5-fold (compared to the UVB/carrier group). It can be noted that in mice treated with 29-mer or 20-mer, the amplifying activity of fibroblasts was even higher than that of mice not irradiated with UVB, but this difference was less significant. Conversely, an 18-mer without a SLGA sequence does not promote the expansion of skin fibroblasts.

In summary, various data in Experimental Example 3 (including Experimental Examples 3.1 to 3.3) confirmed that the PEDF peptide proposed herein can effectively promote the expansion activity of skin fibroblasts in normal skin tissues (ie, without irradiation). It can also enhance the amplifying activity of skin fibroblasts in skin tissue damaged by light (ie, those who form obvious wrinkles after UVB irradiation). Since fibroblasts are mainly responsible for collagen synthesis, boosting fibroblast expansion Activity increases the density of fibroblasts and may help to increase collagen synthesis in animals. Therefore, the PEDF peptide proposed herein can initiate an endogenous repair mechanism of the skin and stimulate collagen synthesis.

Experimental example 4 PEDF peptide can reduce MMP-1 expression induced by UVB

MMP-1 (interstitial collagenase) is the only enzyme in the human body that is capable of cutting collagen helix in type 1 and type 3 collagen. In addition, MMP-1 is the main enzyme responsible for collagen cleavage in human skin, and the expression of MMP-1 in fibroblasts is regulated by UV radiation. Rodents do not have the MMP-1 gene and their function is replaced by MMP-13. Therefore, the purpose of this experimental example is to investigate whether the synthetic peptide proposed herein can reduce the performance of MMP-1 and MMP-13 induced by UVB irradiation.

Preliminary experiments showed that after UVB irradiation at 15 mJ/cm ² , the cell viability of human skin fibroblasts (WS-1 cells) and primary mouse skin fibroblasts reached 95% of the control group (data not shown) ). Human skin fibroblasts (WS-1 cells) and primary mouse skin fibroblasts did not significantly affect cell viability after treatment with 100 nM 29-mer for 24 hours (data not shown), and were subjected to transfer plates ( Transwell) did not significantly alter cell migration (data not shown). The experimental results also show that under this dose of UV irradiation, it will lead to an increase in MMP performance. Therefore, the irradiation amount used in the following experimental examples was 15 mJ/cm ² .

WS-1 cells were cultured on a six-well plate at a density of 1 × 10 ⁵ and cultured in 10% FBS-DMEM medium for 24 hours, followed by 1% FBS-DMEM with or without 100 nM PEDF peptide. The medium was further cultured for 24 hours. After the cells were washed twice with PBS, they were covered with PBS and irradiated with UVB. In cell culture fume hood to UVB light ^{(XL-1000B, Spectrolinker TM Inc.} ) was irradiated, a final dose of 15 mJ / cm ^2, the irradiation time is about 100 seconds. Cell viability (greater than 95%) was analyzed using a trapan blue exclusion assay. After UVB irradiation, PBS was replaced with 1% FBS-DMEM with or without PEDF peptide, and culture was continued for 48 hours, after which protein extract was obtained, and Western blotting method was used to analyze the expression of MMP-1 protein. . In addition, cells which were not irradiated with UVB were used as a control group (normal group). The expression amount of MMP-1 was normalized by the amount of expression of the carrier/UVB group (set to 100%), and the results of quantitative analysis are shown in Table 6 ( ^* P < 0.02 compared to the carrier/UVB group).

Comparing the vector/UVB with the normal group, it was found that UVB irradiation caused a significant increase in the expression of MMP-1 protein (carrier/UVB group: 100%; unirradiated group: about 5%). However, pretreatment of fibroblasts with a 29-mer, 24-mer or 20-mer resulted in a significant reduction in the amount of MMP-1 protein expression to one-half or less of the carrier/UVB group.

Monolayer cell cultures Second generation mouse skin fibroblasts were cultured for 24 hours in 1% FBS-DMEM medium with or without addition of 100 nM PEDF peptide, followed by UVB irradiation according to the method described above. After the end of the irradiation, the PBS was replaced with 1% FBS-DMEM with or without the addition of PEDF peptide, and incubation was continued for 24 hours; then the entire RNA of the cells was extracted and subjected to a reverse transcription polymerase chain reaction. The amount of expression of MMP-13 was normalized by the amount of performance of the carrier/UVB group (set to 100%), and the results of quantitative analysis are shown in Table 7 ( ^* P < 0.0001 compared to the carrier/UVB group).

The results in Table 7 are similar to those in Table 6. The performance of MMP-13 is up-regulated by UVB irradiation (UVB/carrier group vs. normal group). Furthermore, in the cells in the PEDF peptides proposed here, the upward regulation was significantly reduced (29-mer/UVB group, 24-mer/UVB group and 20-mer/UVB group compared to the vector) /UVB group). In addition, the 18-mer without the SLGA sequence did not reduce the effect of UVB-induced MMP-13 expression.

These results show that the PEDF peptide proposed herein protects human skin fibroblasts against UVB-induced MMP-1 expression. The degradation of type I collagen caused by MMP-1 is an important key to photoaging, The PEDF peptide can be used as an active compound against photoaging.

Experimental example 5 PEDF peptide reduces UV-induced wrinkles

There is a close relationship between wrinkle formation and repeated exposure to UV radiation. Specifically, ultraviolet irradiation can cause degradation of collagen in the dermis layer and inhibit the biosynthesis of procollagen; thereby causing a decrease in collagen content to form wrinkles. The purpose of this experimental example was to investigate the anti-wrinkle effect of PEDF peptide in nude mice. Mice were subjected to UVB irradiation for eight weeks to induce wrinkles according to the method described in Experimental Example 3.3 above. Small before UVB irradiation (normal), after UVB irradiation (UVB/UT) and after two weeks of ointment treatment (UVB/carrier, UVB/29-mer, UVB/20-mer and UVB/18-mer) The appearance image of the mouse, representative photos are shown in Figure 4.

As can be seen from Fig. 4, after UVB irradiation, the mice formed a large number of deep and long wrinkles (normal group compared to UVB/UT group). Mice treated with vehicle or 18-mer ointment also had deep and long wrinkles, indicating that 18-mer could not improve wrinkles that were originally formed by UVB irradiation. In contrast, in mice treated with PEDF peptides (eg, 29-mer and 20-mer) presented here, the number of wrinkles is less and shallower (compared to UVB/UT, UVB/vector) With UVB/18-mer and other groups).

The skin samples were subjected to Manson's trichrome staining to estimate the collagen content, and representative photographs are shown in Fig. 5 (original magnification: 200 times). In addition, immunoblotting analysis was used to quantify the content of type 1 collagen (COL1A1), and the collagen content of normal untreated skin (set to 100%) was used to standardize the collagen content. Table 8 ( ^* P < 0.0001 compared to the unirradiated group; ^** P < 0.001 compared to the UVB/carrier group).

Referring to the results of Fig. 5 and Table 8, it can be found that the repeated exposure to UVB in the normal group of mice without UVB irradiation causes a significant decrease in collagen signal and COL1A1 content in the dermis layer (UVB/). UT group). Conversely, when the PEDF peptide proposed here is transdermally treated (eg, UVB/29-mer and UVB/20-mer), the collagen and COL1AL levels in the dermis can be significantly increased (compared to UVB). / carrier group). These results show that transdermal delivery of the PEDF peptide proposed herein can initiate collagen synthesis in the UVB-damaged dermis layer, and this result further confirms that the PEDF peptide proposed herein can reduce mouse wrinkle formation.

The present disclosure demonstrates for the first time that administration of a short PEDF synthetic peptide in the form of topical topical administration is resistant to skin aging. The topical surface application method proposed herein is not only safer but also relatively inexpensive compared to the delivery of a full-length PEDF peptide by intravenous or intramuscular injection.

Although the embodiments of the present invention are disclosed in the above embodiments, they are not intended to limit the present invention, and the present invention has In general, the various modifications and variations can be made without departing from the spirit and scope of the invention, and the scope of the invention is defined by the scope of the appended claims.

The above and other objects, features, advantages and embodiments of the present invention will become more apparent and understood. The description of the drawings is as follows: The representative photograph of Figure 1 contains the skin of H&E staining in an experimental example of the present invention. Sliced photographs (left), and fluorescent photographs of the skin samples (middle, right); representative photographs of Fig. 2 are skin slices stained with Manson's three-color dye in another experimental example of the present invention, The stained collagen (blue) is clearly visible in the figure; the third is a representative photograph of the skin fibroblast sample immunostained (intermediate silk protein: green; BrdU: red) and with Hoechst 33258 (nuclei: Blue) a combined photograph of the stained sample; a representative photograph of Fig. 4 shows a wrinkle formation condition of each group of mice in another experimental example of the present invention; and a representative photograph of Fig. 5 is another experimental example of the present invention The skin section stained with Manson's trichrome dye, the stained collagen (blue) is clearly visible in the figure.

<110> Taiwan's Presbyterian Church, Ma Rong Memorial Social Enterprise Foundation, Ma Rong Memorial Hospital

<120> Pigment epithelium-derived factor-derived multi-peptide to prevent and/or alleviate skin aging

<130> P2731-TW

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 39

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 1

<210> 2

<211> 34

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 2

<210> 3

<211> 29

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 3

<210> 4

<211> 25

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 4

<210> 5

<211> 24

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 5

<210> 6

<211> 20

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 6

<210> 7

<211> 18

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 7

<210> 8

<211> 29

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 8

<210> 9

<211> 20

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 9

<210> 10

<211> 44

<212> PRT

<213> Artificial sequence

<220>

<223> Synthetic peptide

<400> 1

<210> 11

<211> 418

<212> PRT

<213> Homo sapiens

<400> 11

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 12

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 13

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 14

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Introduction

<400> 15

Claims (2)

Use of a synthetic peptide for the preparation of a composition for preventing and/or alleviating skin aging in a body consisting of an amino acid sequence of 20-39 amino acid residues in length a composition wherein the amino acid sequence has a nucleotide sequence similarity to SEQ ID NO: 1 of at least 80%, and the amino acid sequence comprises at least 20 contiguous amino acid residues, which is SEQ ID NO: 1 11-30 amino acid residues having at least 90% amino acid sequence similarity, the synthetic peptide having at least four consecutive amino acid residues and the 11th to 14th amino acids of SEQ ID NO: 1. The residues are the same. A method for promoting proliferation of dermal fibroblasts in vitro comprises: administering a synthetic peptide to a dermal fibroblast in vitro, wherein the synthetic peptide is composed of a length of 20-39 amino acids The amino acid sequence of the residue consisting of the amino acid sequence having at least 80% amino acid sequence similarity to SEQ ID NO: 1, and the amino acid sequence comprising at least 20 contiguous amino acid residues, It has at least 90% amino acid sequence similarity to the 11-30 amino acid residues of SEQ ID NO: 1, which has at least four contiguous amino acid residues and SEQ ID NO: 1. The 11-14th amino acid residues are the same.