TWI329647B - Vaccines - Google Patents

Abstract

THE INVENTION PROVIDES A NUCLEOTIDE SEQUENCE THAT ENCODES AN HIV-1 GAG PROTEIN OR FRAGMENT THEREOF CONTAINING A GAG EPITOPE AND A SECOND HIV ANTIGEN OR A FRAGMENT ENCODING AN EPITOPE OF SAID SECOND HIV ANTIGEN, OPERABLY LINKED TO A HETEROLOGOUS PROMOTER. PREFERRED POLYNUCLEOTIDE SEQUENCES FURTHER ENCODES NEF OR A FRAGMENT THEREOF AND RT OR A FRAGMENT THEREOF.

Description

1329647 (1) 发明, the description of the invention (the description of the invention should be clarified: the technical field of the invention, the prior art 'content, the embodiment and the schematic description of the drawings) FIELD OF THE INVENTION The present invention relates to a nucleic acid structure, a host cell containing the same, and Its use in nucleic acid vaccines. The invention further relates to vaccine formulations comprising the structure and to the medical use of the formulation. In particular, the present invention relates to DNA vaccines useful for the prevention and treatment of HIV infection, and more particularly to the administration of the vaccine via granule delivery. BACKGROUND OF THE INVENTION HIV-1 is the leading cause of acquired immunodeficiency syndrome (AIDS), It is regarded as one of the major health problems in the world. Although the global research on vaccines has been carried out globally, its efforts have not been successful. Non-membrane proteins of HIV-1 have been described, including, for example, internal structural proteins such as gag and pol gene products and other non-binding proteins such as Rev, Nef, Vif and Tat (Green) ' New England J. Med, 324, 5, 308 (1991) and Bryant et al. (Pizzo), Pediatr. Infect. Dis. J., 1, 1, 5, 3 90 Below page (1 992)).

The Gag gene line is translated from unabridged RN A to produce a precursor polyprotein' which is subsequently cleaved into 3-5 cap sid proteins, matrix proteins, capsid proteins and nucleic acid junction proteins and proteases. (1. Fundamental Virology' Fields BN, Knipe DM, and Howley Μ 1 996 2. Fields Virology ’ Vol. 2, 996). The gag gene produces a 55-kilometer deuterium (kD) Gag precursor protein, also known as p55', which is expressed by unconjugated viral mRNA. At the time of translation, the N-terminus of P55 1329647 (7) is tetradecylated, triggering its cytoplasmic binding to the cell membrane. Membrane-associated Gag polyproteins recruit two sets of viral genomes, RN A and other viral and cellular proteins, and cause viral particles to germinate from the surface of infected cells. After budding formation, during virus maturation, p 5 5 is split by the virus-encoding protease (product of the pol gene) into four smaller proteins, which are 1^8 (matrix 1 > 17), and eight (capsid) [?24]), :^(:(virions [?9]), and p 6 · (4) In addition to the three major Gag proteins, all Gag precursors contain several other parts, which can be split. It is stored in virions in peptides of various sizes. These proteins have different roles, such as the p2 protein can regulate protease activity and help correct the timing of the proteolytic step. MA polypeptides are derived from the N-terminal, p55 fourteen fluorenyl groups. Most of the MA molecules remain attached to the inner surface of the virion lipid layer to stabilize the particles. The primary group A is concentrated in the deep inner side of the virion and becomes part of the complex that can escort the viral DNA to the nucleus (5). These MA molecules promote nuclear transport of the viral genome, and the nuclear importation mechanism recognizes the nucleophilic signal of MA. This phenomenon makes HIV infect non-dividing cells, which is unusual for retroviruses. p24(CA) protein The vertebral core that forms the virion. Cyclophilin A has been shown to interact with the p24 site of p55 and cause it to be incorporated into HIV granules. The interaction between Gag and Cyclolin A is important. The interaction of cyclosporine A inhibits viral replication.

The NC site of Gag is particularly valuable for identifying so-called HIV packaging signals. Package 1329647

(3) The signal is composed of four stem loop structures located at the 5' end of the near-viral RNA, which can be incorporated into the HI V-1 virus particles by the vector heterologous RN A. The interaction of the NC with the packaging signal via eNC can also facilitate reverse transcription via the interaction of two zinc-finger motifs. The ρ6 polypeptide site mediates the interaction between p55 Gag and the accessory protein Vpr, which can result in the incorporation of Vpr into the assembled virion. The p6 site also contains a so-called late functional site, which is required for the release of germ cells from the infected cells.

The Pol gene can be programmed into two proteins, the activity of which is required for early viral infection, that is, the RT required for integration of viral DNA into cellular DNA and the main product of ligase protein, Pol, can be produced by cleavage of virion protease. RT peptides, whose activity is required for DNA synthesis (DNA and DNA-directed DNA polymerase, ribonuclease H) and reciprocal ligase proteins. HIV RT is a heterodimer consisting of a full length 2RT (P66) and a cleavage product (p 5 1) lacking a few ribonuclease ligase functional sites. RT is one of the most highly preservative proteins' which is encoded by the retroviral genome. The two main activities of RT are DN A P 〇丨 and ribonuclease Η. The DNA Pol activity function of RT can alternatively use RNA and DNA as a template, and like all known DNA polymerases, DNA resynthesis cannot be initiated without the presence of pre-existing molecules acting as a guide (RNA). Ribonuclease Η activity in early replication 1329647

(4) plays an important role in removing the RNA genome during DNA synthesis. It selectively degrades RNA from all RNA-DNA hybrid molecules. Structurally, the polymerase and ribo 单独 each occupy a non-overlapping functional _ position, where two-thirds of the Pol covers the amine group. The p 6 6 catalytic subunit folds into 5 different sub-functional sites. The amine terminus 2 of these secondary functional sites has an RT active moiety. Its carboxyl moiety is the ribonuclease Η functional site.

The retroviral RN Α genome can be replicated as linear double-stranded DNA by reverse transcriptase present in the infected granule after infection of the host cell. The ligase (see Skalka AM '99 Adv in Virus Res 5_2 271-273) recognizes viral DNA ends and trims viral DNA to the host chromosomal location, thus catalyzing integration. It calibrates many parts of the host DN 以 for integration. Although ligase is sufficient for biocatalytic integration, it is not the only protein associated with viral DNA in vivo - the large protein-virus isolated from infected cells is a pre-integrated complex. It can help the progeny virus genome to acquire host cell genes. The ligase system consists of three distinct functional sites, the N-terminal functional site, the catalytic core, and the C-terminal functional site. The catalytic core functional site contains all the chemical conditions required for the transfer of polynucleic acid. It is known that the Nef protein can remove CD4 (HIV receptor) from the cell surface. However, the biological importance of this effect remains to be discussed. In addition, 'Nef can interact with the T cell signaling pathway to induce an active state' which can subsequently promote more efficient gene expression. Certain HIV isolates have spurs at this site. • 10–1329647 (5) The invention says that it is a barrier to purchase, which can lead to the inability to encode functional proteins and severely endanger the ability to replicate and pathogenic in vivo.

The DN A vaccine is usually composed of a bacterial plastid vector in which a strong promoter gene, a gene encoding the desired antigen peptide, and a set of polynucleotide/transcription termination sequences can be inserted. The desired gene should encode an intact protein or only an antigenic peptide sequence encoding a pathogen, tumor or other substance to be protected against. Prior to administration to the host, the plastid can be grown in bacteria (e.g., E. coli), subsequently isolated and prepared in an appropriate medium according to the intended route of administration. After administration, the plastid is taken up by the host cell and produces a coded peptide. Preferably, the source of the plastid vector is not replicated in eukaryotic cells to prevent plastid replication in the mammalian host and integration with the chromosomal DNA of the animal of interest.

DN A vaccination has many advantages over traditional vaccine technology. It is first expected that since the protein encoded by the DNA sequence is synthesized in the host, the structure or construction of the protein will be similar to the native protein responsible for the condition. Moreover, by generating a killer T lymphocyte response that recognizes epitopes from preservative proteins, D N A vaccination may provide protection against different strains of the same virus. In addition, because the quality system is taken up by host cells that produce antigenic proteins, it can elicit a long-lasting immune response. The art also provides the possibility of combining multiple antigenic bodies into a single preparation to facilitate simultaneous immunization against a variety of conditions. A variety of useful background information on DN A vaccination is provided by Donnelly et al., "DNA Vaccines" Ann. Rev Immunol. 1997 15: 617-648, the entire contents of which are incorporated herein by reference.入本7-··> 7 -11 - 1329647

(6) In the text. SUMMARY OF THE INVENTION The present invention provides novel structures in nucleic acid vaccines useful for the prevention and treatment of HIV infection and AIDS.

Accordingly, a first aspect of the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding an HIV gag protein or a fragment thereof, and linked to a nucleotide sequence encoding another HI V antigen or a fragment thereof, And when administered, it can be ligated to a heterologous promoter gene. A fragment of the nucleotide sequence encodes a HI V epitope and typically encodes a peptide of at least 8 amino acids. Preferably, the nuclear acid sequence is a DN A sequence and is preferably contained in a plastid from a different source of replication. Such nucleic acid molecules can be formulated with pharmaceutically acceptable excipients, carriers, diluents or adjuvants to produce pharmaceutical compositions suitable for the treatment and/or prevention of HI V infection and AIDS. In a preferred embodiment, the DNA sequence is formulated to the surface of inert particles or apertured beads suitable for particulate media delivery. Perforated beads are preferably

Gold system. In a preferred embodiment of the invention, a DNA sequence is provided in which the code which highly expresses the gag protein has been optimized to resemble the codon used for the gene of the mammalian cell. In particular, the gag protein has been optimized to resemble a highly representative relative human gene. The DNA code has four letters (A, T, C, and G) that can be used to spell out the three-letter "codon", which represents the encoded amino acid and protein in the biological gene. The linear amino acid sequence of the protein encoded by those genes can be translated along the codon linear sequence of the DN A molecule. The cryptographic system is -12- 1329647 (7) The touch repair is highly degraded, 61 of which can encode 20 natural amino acids, and 3 of which represent the M-terminated "signal codon. Therefore, most amino acids The code may be derived from more than one codon - in fact several amino acids may be encoded by four or more different codons. Although more than one codon is available to encode a particular amino acid, The codon usage patterns observed for the organisms are rather non-random. The codon usage of different species shows different preferences, and even more, even if the same species uses different codons for different concentrations of genes. Viruses, plants, bacteria, and mammalian cells have different preferences, and some species show a stronger bias toward the random selection of codons than others, such as humans and other breastfeedings compared to certain bacteria or viruses. Animals do not have a strong preference. For these reasons, mammalian genes expressed in E. coli or in mammalian cells are likely to be foreign or recombinant. Inappropriate codon distribution, thus affecting the effective expression. If the heterologous DNA sequences of multiple codons or large numbers of codons that are rare in the host are expressed in the host, they can be expected to be low. In a specific embodiment of the present invention, a gag polynucleotide sequence encoding an amino acid sequence is provided, wherein the codon usage pattern of the polynucleotide sequence is similar to the highly representative codon usage pattern of the mammalian gene. Preferably, the polynucleotide sequence is a DNA sequence. The codon usage pattern of the polynucleic acid sequence is preferably a highly expressed human gene pattern. In the polynucleic acid of the present invention, the codon usage pattern is represented by a typical human immunodeficiency virus. The pattern changes to a codon that is closer to the target organism 1329647

(8)

Preference, such as mammals, especially humans. The codon usage factor is used to measure the degree of similarity between the codon pattern of a given polynucleic acid sequence and the codon pattern of the underlying species. The codon frequency of highly expressed genes in many species can be obtained from literature (see, for example, Naka Nakamura et al., Nucleic Acid Research 1996, 24: 214-215). The codon frequency of each of the 61 codons (represented as the occurrence rate per 1000 codons in the selected gene rank) is 2 0 The natural amino acid classification is normalized so that the most common codon values for each amino acid are set to 1 and the less common codon frequencies are proportionally between 0 and 1. Thus, 61 passwords Each of the sub-species can specify a highly expressed gene with a value of 1 or slightly lower than the target species. To calculate the codon usage factor of a particular polynucleic acid relative to the highly expressed gene of the species, each specific polynucleoside is recorded. The grading value of the acid codon and calculating the geometric mean of all these values (the sum of the natural logarithms of these values is divided by the total number of all codons and the inverse-logarithm The coefficient value is between 0 and 1 and the higher the coefficient, the more frequently used codons in polynucleic acid. If the codon usage factor of the polynucleotide sequence is 1, all codons are the target species. The highly expressed gene "the most commonly used" codon. As in the present invention, the codon usage pattern of the polynucleotide preferably excludes codons having an RS CU value of less than 0.2 (relative to the highly expressed gene of the target organism). If a set of codons provides less than 10% of the codon used to represent a particular amino acid, it should be excluded from the codon usage pattern. Relative synonymous codon usage (RSCU) values are observed codons. The total number is divided by the expected number of times when all codons of the amino acid are used at the same frequency. Benfa-14 - 1329647 (9) Invention _:! Month: The codon of the human gene is expressed relative to the height of the polynucleotide The utilization factor (or RSCU) is usually greater than 0.3, preferably greater than 0.4, and most preferably greater than 0.5, and the human codon usage table can also be found in Genebank. In contrast, the RSCU of the highly expressive actin gene is 0. 747. The human codon usage table is as follows: Codon usage Table 1: Modern people [gbpri]: 27143 CDS's (12816923 codon)

Representation fields: [triple] [frequency: per thousand groups] ([quantity]) UUU 17.0 (217684) UCU 14.8 (189419) TOC 20.5 (262753) UCC 17.5 (224470) UUA 7.3 ( 93924) UCA 11.9 (152074) UUG 12.5 (159611) UCG 4.5 ( 57572) CUU 12.8 (1S3707) CCU 17.3 (222146) CUC 19.3 (247391) CCC 20.0 (256215) CUA 7.0 ( 89078) CCA 16.7 (214583) CUG 39.7 (509096) CCG 7.0 ( 89619 ) AUU 15.8(202844) ACU 12.9(165392) AUC 21.6 (277066) ACC 19.3 (247805) AUA 7.2( 92133) ACA 14.9(191518) AUG 22.3 (285776) ACG 6.3 ( 80369) GUU 10.9 (139611) GCU 18.5 (.236639 GUC 14.6(187333) GCC 28.3(362086) GUA 7.0( 89644) GCA 15.9(203310) GUG 28.8 (369006) GCG 7.5 ( 96455) UAU 12.1(155645) UGU 10.0(127719) UAC 15.8 (202481) UGC 12.3 (157257 UAA 0.7( 9195) UGA 1.3( 16025) UAG 0.5( S789) UGG 12.9(165930) CAU 10.5 (134186) CGU 4.6 ( 594S4 ) CAC 14.9(190928) CGC 10.8 (137865) CAA 12.0 (153590) CGA 6.3 ( 80709 ) CAG 34.5 (441727) CGG 11.6 (148666) AAU'17.0 (218508) AGU 12.0 (154442) AAC 19.8 (253475) AGC 19.3 (247583) AAA 24.0 (308123) AGA 11.5 (147264) AAG 32.6 ( 418141) AGG 11.3 (145276) GAU 22.4 (286742) GGU 10.8 (138606) GAC 26.1 (334158) GGC 22.7 (290904) GAA 29.1 (373151) GGA 16.4 (210643) GAG 40.2 (515485) GGG 16.4 (209907) Password GC 52.51 % First letter GC 56.04% Second letter GC 42_35% Third letter GC 59.13% Codon usage Table 2 (better): Codon usage of human rhyme (high performance) gene 1/24/91 (human_high.cod) -15 - 241 1329647 (10) Amino acid

Gly

Gly

Gly

Gly

Glu

Glu

Asp

Asp

Val

Val

Val

Val

Ala

Ala

Ala

Ala 8 s Γ Γ s S η η2tn>ala>°· ArATseseLyLyASASMeIleIleIleThr Codon number/1000 fragment GGG 905.00 18.76 0.24 GGA 525.00 10.88 0.14 GGT 441.00 9.14 0.12 GGC 1867.00 38.70 0.50 GAG 2420.00 50.16 0.75 GAA 792.00 16.42 0.25 GAT 592.00 12.27 0.25 GAC 1821.00 37.75 0.75 GTG 1866.00 38.68 0.64 GTA 134.00 2.78 0.05 GTT 198.00 4.10 0.07 GTC 728.00 15.09 0.25 GCG 652.00 13.51 0.17 GCA 488.00 10.12 0.13 GCT 654.00 13.56 0.17 GCC 2057.00 42.64 0.53 AGG 512.00 10.61 0.18 AGA 298.00 6.18 0.10 AGT 354.00 7.34 0.10 AGC 1171.00 24.27 0.34 AAG 2117.00 43.88 0.82 AAA 471.00 9.76 0.18 AAT 314.00 6.51 0.22 AAC 1120.00 23.22 0.78 ATG 1077.00 22.32 1.00 ATA 88.00 1.82 0.05 ATT 315.00 6.53 0.18 ATC 1369.00 28.38 0.77 ACG 405.00 8.40 0.15 1329647 (11)

Thr ACA 373.00 7.73 0.14 Thr ACT 358.00 7.42 0.14 Thr ACC 1502.00 31.13 0.57 Tip TGG 652.00 13.51 1.00 End TGA 109.00 2.26 0.55 Cys TGT 325.00 6.74 0.32 Cys TGC 706.00 14.63 0.68 End TAG 42.00 0.87 0.21 End TSS 46.00 0.95 0.23 Tyr TAT 360.00 7.46 0.26 Tyr TAC 1042.00 21.60 0.74 Leu TTG 313.00 6.49 0.06 Leu TTA 76.00 1.58 0.02 Phe TTT 336.00 6.96 0.20 Phe TTC 1377.00 28.54 0.80 Ser TCG 325.00 6.74 0.09 Ser TCA 165.00 3.42 0.05 Ser TCT 450.00 9.33 0.13 Ser TCC 958.00 19.86 0.28 Arg CGG 611.00 12.67 0.21 Arg CGA 183.00 3.79 0.06 Arg CGT 210.00 4.35 0.07 Arg CGC 1086.00 22.51 0.37 Gin CAG 2020.00 41.87 0.88 Gin CAA 283.00 5.87 0.12 His CAT 234.00 4.85 0.21 His CAC 870.00 18.03 0.79 Leu CTG 2884.00 59.78 0.58 Leu CTA 166.00 3.44 0.03 Leu CTT 238.00 4.93 0.05 Leu CTC 1276.00 26.45 0.26 1329647 (12)

Pro CCG 482.00 9.99 0.17 Pro CCA 456.00 9.45 0.16 Pro CCT 568.00 11.77 0.19 Pro CCC 1410.00 29.23 0.48 A further aspect of the invention provides an expression vector comprising a polynucleotide sequence according to the first aspect of the invention and can be directed The expression of the polynuclear acid sequence of the first aspect of the present invention is specifically included. The codon of a gag polynucleotide sequence which is typically highly representative of a mammalian gene, preferably a highly expressed human gene. Use the mode. The vector is adapted to drive the expression of heterologous DNA in bacterial, insect or mammalian cells, particularly human cells. The exemplary carrier in one embodiment is p7313 (see Figure 1).

In a third embodiment, a gag gene controlled by a heterologous promoter gene is fused to a set of DN A sequences encoding NEF, a fragment thereof, or HIV reverse transcriptase (RT) or a fragment thereof. The gag portion of the gene can be located at the N-terminus or C-terminal portion of the fusion gene. In a preferred embodiment, the g a g gene does not encode a g a g p 6 peptide. Preferably, the NEF gene is truncated, and the sequence encoding the N-terminal portion is removed, ie, 3 0 - 8 5 , preferably 6 0 - 8 5 , typically about 81, preferably N-terminal, are removed. 6 5 amino acids. In still further embodiments, the RT gene can also be optimized to resemble a highly expressed human gene. Preferably, RT encodes a mutation that substantially inactivates any reverse transcription activity. A preferred passivation mutation involves the substitution of K (iso-acid) with W-tryptophan 229. -18 - 1329647 * » (13) %φΜ§Β In a further embodiment, the RT gene can also be optimized to resemble a highly expressed human gene. Preferably, RT encodes a mutation that substantially inactivates any reverse transcriptase activity. A preferred passivation mutation involves the substitution of hydrazine (iso-acid) with W-tryptophan 229. According to a further aspect of the invention, there is provided a host cell comprising a polynucleic acid sequence according to the invention, or an exemplary vector according to the invention. The host cell can be a bacterium (e.g., E. coli), a mammal (e.g., a human), or can be an insect cell. A mammalian cell comprising a vector according to the present invention may be cultured in vitro for cell transfer infection or a mammalian vector may be administered to a living body for metastatic infection. The invention further provides a pharmaceutical composition comprising a polynucleotide sequence according to the invention. The composition preferably comprises a DNA vector. In a preferred embodiment, the composition comprises a plurality of particles, preferably gold particles, and the surface coated DNA comprises a vector encoding a polynucleotide sequence of the invention. Preferably, the sequence encodes an HIV gag amino acid sequence in which the codon usage pattern of the polynuclear citrate sequence is a typically highly expressed mammalian gene, particularly a human gene. In another embodiment, the composition comprises a pharmaceutically acceptable excipient and a DN A carrier according to the second aspect of the invention. The composition may also contain an adjuvant. Thus, in one embodiment of the invention, the vector of the invention can be used in conjunction with an immunostimulant. The immunostimulant is preferably administered simultaneously with the nucleic acid vector of the present invention, and in a preferred embodiment, the two are tunable together. Such immunostimulants are included (but the following list is not exhaustive and does not exclude other agents): Synthetic iso- 17 is more than ° 奎 B B, such as imiquim 〇d 1329647 (14) [S-26308, R-837]' (Harrison et al. 'Reduction of recurrent HSV disease using imiquimod alone or combined with a glycoprotein vaccine', Vaccine 19 : 1 8 2 0- 1 826, (2001) and Resiquimo Resiquimod [S-28463, R-848] (Vasilakos et al., 'Adjuvant activites of immune response modifier R-848: Comparison with CpG ODN', Cellular immunology 204: 64-74 (2000 ))), fixed performance in

The antigen expresses the carbonyl and amine Schiff bases on the surface of cells and T-cells, such as Tucaray avoidance (^11〇& [63〇1] Rhodes (1111〇(^3), 1. etc. Human, 'Therapeutic potentiation of the immune system by costimulatory Schiff-base-forming drugs', Nature 3 77 : 71-75 (1995)), cytokine, chemokine and co-excited molecules Co-stimulatory, such as a protein or peptide, which may comprise pro-inflammatory cytokines

(pro-inflammatory cy t oki ne s) (eg G Μ - CSF, IL-1 a, IL-1 泠, TGF-α and TGF-泠), Th1 inducer (eg interferon τ, il-2, IL-12, IL-15 and IL-18), Th2 inducers (such as IL-4, IL-5, IL-6, IL-10 and IL-13) and other chemical kinesins and co-stimulatory genes (eg MCP-1 'MIP-1 a , MIP-1/S , RANTES, TCA-3, CD80, CD86 and CD40L), other immunostimulatory ligands (eg CTLA-4 and L-shrectin (selectin) ), apoptosis (apoptosis) stimulates proteins and peptides, such as Fas, (49), synthetic lipid-based adjuvants, such as vaxfectin (Reyes et al., Vaxfectin enhances antigen) Specific antibody titeres and maintains Thl type 246 -20- 1329647 t

(15)

Immune responses to plasmid DNA immunization', Vaccine 19. 3778-3786) Party, a - childbearing', polysorbate 80, DOPC and cholesterol, endotoxin 'LPS', Beutler B. ('Endotoxin, Toll-like receptor 4, and the afferent limb of innate immunity', Current Opinion in Microbiology 3 : 23-30 (2000)); CpG oligo- and dinucleotide, Sato , Y. et al., 'Immunostimulatory DNA sequences necessary for effective intradermal gene immunization', Science 2 7 3 (5273 ) : 3 5 2-3 54 (1 996). Hemmi, H. et al., A

Toll-like receptor recognizes bacterial DNA', Nature 408: 740-745, (2000) and other ligands that may trigger endotoxin receptors (Toll receptors) to produce cytokines induced by Th1, such as synthetic branches Bacterial lipoprotein, mycobacterial protein pl9, peptidoglycan, squamous acid and lipid A. Preferred adjuvants which may induce a significant Th1-type response include, for example, a lipid A derivative such as lipid monophosphate A, or preferably 3-de-purine-deuterated monophosphate lipid A. MPL® adjuvants are produced from Corixa Corporation (Seattle, WA, see U.S. Patent Nos. 4,436,727, 4,877,611, 4,866,034 and 4,912,094). An oligonucleotide containing CpG (wherein the CpG dinuclear acid demethylation) can also induce a significant Thl response. Such oligo-nuclear acids are well known and can be found in, for example, WO 96/02555, WO 99/33488, and U.S. Patent Nos. 6, 8,200 and 5,856,462. Immunologically excited DNA sequences are also described in, for example, Sato et al., Science 273: 352, 1996. Another preferred adjuvant includes the hormone, 1329647 €

(16) For example, Quil A, or a derivative thereof, comprising QS21 and QS7 (Aqui 1 a B iopharmaceuticals Inc.), Framingham (MA), Escin, Ditute Donin (Digitonin), or Gypsophila or Chenopodium quinoa. The use of a polynucleotide according to the invention or a vector according to the invention for the treatment or prevention of HIV infection is also provided. The invention also provides for the treatment or prevention of HIV. A method of infecting, any symptom or disease associated therewith, comprising administering an effective amount of a polynuclear according to the invention: y: an acid, a carrier or a pharmaceutical composition. One or more separate doses may be employed in administering the pharmaceutical composition. Type, such as in the same dose of the same DN A plastid pattern, or in the "first contact-reinforcing" therapeutic vaccination method. In some cases, "first contact" vaccination can be delivered via granular vector DNA The polynucleotide of the invention is preferably incorporated into a plastid-derived vector and is "reinforced" by administration of a recombinant viral vector comprising the same polynucleotide sequence, or reinforced with a protein present in the adjuvant. on the contrary The first exposure may also use a viral vector or protein formulation (usually a protein formulated in an adjuvant) to be reinforced with a DNA vaccine according to the invention. Multiple doses may be used for both first contact and/or reinforcement. In particular embodiments, a gag, nef or RT protein fragment is contemplated. For example, the multinuclear:y:acid of the invention may encode an HIV gag fragment, nef or RT protein. The polynuclear tantalate system contemplated by the scope of the invention may encode at least 8 , such as 8-10 amino acids or fragments of up to 20, 50, 60' 70, 80, 100, 150 or 200 amino acid lengths, and must be able to encode an oligomeric group that exhibits HI V antigenicity Peptide or peptide. In particular (but does not exclude outside 1329647 «

(17) This aspect of the invention encompasses the condition that the polynucleotide encodes a complete HIV protein sequence fragment and an isolated epitope that can represent one or more of the proteins. The fragment can be an optimized codon such that the fragment is similarly highly representative of the codon usage pattern of the mammalian gene. Preferred structures according to the invention comprise: 1. pl7, p24, fused to a truncated NEF (lack of nucleotides encoding a terminal amino acid 1-65) 2. pl7, p24, RT, truncated NEF ( Lack of nucleotides encoding the amino acid 1-65) 3. pl7, p24 (optimized gag), truncated NEF (lack of nuclear acid encoding the amino acid 1-65) 4. pl7 ' p24 (optimized gag), RT (optimized)' truncated NEF (lack of nucleotides encoding the terminal amino acid 1-85) 5. pl7, p24, RT (optimization), truncation Short NEF (lack of nucleotide acid encoding end amino acid 1-65) 6. Truncated NEF- (lack of nucleotide 1-65) fusion to optimize pl7, p24 gag 0 7. Excellent for the present invention The structure comprises a triple fusion RT-NEF-Gag, and specifically RT-Gag-Nef. 8. Optimize RT, truncated NEF and optimize P17, p24(gag) (RNG) and

9. Optimized RT, optimized pl7, 24 (gag), truncated Nef (lack of amino acid 1-65) RGN 1329647 mMm (18) Preferably ΗIV structure is derived from ΗI V differentiation branch B or differentiation Branch C, especially the differentiation branch B. As indicated above, the invention includes an expression vector comprising a nucleotide sequence of the invention. The expression vector can be routinely constructed by molecular biology techniques and can be used, such as plastid DN A and appropriate initiation factors, promoter genes, enhancers and other elements, as may require polyadenylation signals, and Placed in the right direction for protein performance. Other suitable carriers are also known to those skilled in the art. For further examples, see Sambrook et al., Molecular Cloning: Laboratory Manual, 2nd Edition, CSH Laboratory Press. (1989) o Preferably, the polynucleotide of the present invention, or a polynuclear ruthenium useful in the vector of the present invention The acid ' can be operably linked to a control sequence which allows the host cell to express the coding sequence, i.e., the vector becomes an expression vector. The term "operably linked" refers to a side-by-side approach in which the relationship between the components allows each component to perform its intended function. The regulatory sequence (eg, the promoter gene) "operably linked, to the coding sequence The arrangement is such that the coding sequence can be expressed under conditions compatible with the regulatory sequence. The vector can be 'such as a plastid' artificial chromosome (such as BAC, PAC, YAC), a diseased mother or a sputum carrier 'including replication The source, the promoter gene to be used as needed (for expression of the polynucleotide) and, if necessary, to modulate the promoter gene. The vector may comprise one or more selectable marker genes. A gene for the treatment of a drug or a drug, and a drug carrier can be used as a drug-resistant gene. The vector can be used to produce DNA or RNA in vitro or used to transfer infection or transform a host cell (eg, mammal-24-250 1329647). (19) a host cell, such as by a vector encoding to produce a protein. The vector may also be suitable for use in vivo, such as by DNA vaccination or gene therapy. Other expression-regulating signals to match specific host cells that are designed to be expressed, such as mammalian promoter genes, including metallothionein promoter genes that are responsive to heavy metals (such as cadmium), and /3-actin promoter genes. Viral promoter genes, such as the SV40 large T antigen promoter gene, the human cell giant virus (CM V) very early (IE) promoter gene, the Rous sarcoma virus LTR promoter gene, the adenovirus promoter gene, or HP V promoter Genes, in particular, HP V upstream regulatory sites (URR) can also be used. All of these promoter genes are described in detail and ready for use in the art. Preferred promoter elements are CMV very early promoter genes, lacking insertion sequences A, but comprises the expression sequence 1. The promoter gene element may be a minimal promoter gene element or a booster promoter gene, preferably a booster promoter gene, thereby providing a vector comprising the polynucleotide of the present invention, which is initiated early by HCMV IE Controlled by genes. Examples of suitable viral vectors include herpes simplex viral vectors, vaccinia or alpha-viral vectors, and Viruses, including lentiviruses, adenoviruses, and adeno-associated viruses. Gene transfer techniques using these viruses are known to those skilled in the art. For example, retroviral vectors can be used to stably incorporate the polynucleotides of the present invention into the host genome. However, this recombination is not preferred. In contrast, replication-defective adenoviral vectors have episomal residues and thus provide transient expression. They can drive insect cells (such as baculovirus vectors), Vectors expressing human cells, yeast or bacteria can be used -25329647 (20) to produce a large number of HIV proteins encoded by the polynucleotides of the invention, and can be used as, for example, subunit vaccines or immunoassays.

The polynuclear acid of the present invention can be used to express the production of a coded protein which can occur in vitro, in vivo or ex vivo. Thus, nucleoside acid can be utilized in recombinant protein synthesis techniques, such as to increase yield; or even found to be a therapeutic agent using DNA vaccination techniques under its own conditions. When the encoded protein is prepared in vitro or ex vivo using the multinuclear station acid of the present invention, the cells (e.g., in cell culture) can be modified to include the polynucleic acid to be expressed. Such cells may comprise transient, or preferably stable, mammalian cell lines. Cell-specific examples modified by embedding a vector encoding a polypeptide of the invention comprise mammalian HEK293 T, CHO, HeLa, 293 and COS cells. Preferably, the selected cell line is not only stable but also provides mature glycosylation and cell surface expression of the polypeptide. Transforming egg cells can satisfy this expression. The polypeptide may be expressed by the polynucleic acid of the present invention in a non-human animal (preferably mouse) cell of the transgenic gene. The scope of the invention encompasses a transgenic non-human animal that can express a polypeptide of the polynucleotide of the invention. The invention further provides a method of vaccinating a mammalian subject comprising administering an effective amount of a vaccine or vaccine composition thereto. The expression vector for use in DN A vaccines, vaccine compositions, and immunotherapy is preferably a plastid vector. DNA vaccines can be administered in a "single naked DNA" format, such as in a liquid formulation, in a syringe or high pressure nozzle, or in liposomes or enhancers that stimulate the transfer of infection, or by particle-mediated DNA delivery (PMDD). ). All of these delivery systems are familiar to us in the art -26- 1329647

(21) The method of knowing. The vector can be introduced into the mammal by, for example, a viral vector delivery system. The compositions of the invention may be delivered by a variety of routes, such as intramuscular injection, subcutaneous injection, intraperitoneal injection, intravenous injection or transmucosal administration.

In a preferred embodiment, the composition is delivered by intradermal injection. In particular, the composition is delivered in the form of a gene gun (cannon), in particular a particle bombardment drug delivery technique, which comprises applying a carrier to a porous bead (such as gold) and then using a high pressure drug to enter the epidermis. Such as Haynes et al., J Biotechnology 44: 3 7-42 (1996).

In an illustrative example, pneumatics can be achieved by means of a device manufactured by Powderject Pharmaceutics PLC (Oxford, UK) and Powderject Vaccine Inc. (Madison, WI). -driven) Particle acceleration, some examples of which are found in U.S. Patent Nos. 5,846,796, 6, 010, 478, 5, 865, 796, 5, 584, 807, and EP Patent No. 0500 799. The method provides a delivery method that does not require an injection needle, wherein a dry powder formulation of fine particles (such as a polynucleotide) is lifted to a high speed by a helium gas flow generated by a hand-held device, pushing the particles into a desired tissue (typically skin). Preferably, the particles are 0.4-4.0 micron gold apertured beads, more preferably 0.6-2.0 micrometers in diameter, to which a DNA conjugate is applied and filled into a cartridge or cartridge for loading into the "gene" Guns. In a related embodiment, other apparatus and methods for pneumatic needleless injection that can be used in the compositions of the present invention include by Byo Jackett -27- 1329647 (22)

(Bioject, Inc. (Portland, OR)), several examples are described in U.S. Patent Nos. 4,790,824, 5,064, 4 1 3, 5,3 1 2, 3 3 5, 5,383,851 > 5,399,163, 5,5 2 0,6 3 9 and 5,993,4 1 2. The dose of the vector containing the nucleotide sequence encoding the antigenic peptide should be effective for prevention or treatment. The granule-vehicle delivery dose is usually in the range of 1 picogram to 1 mg per dose, preferably 1 picogram to 10 microgram of nucleotide acid, and the other route is 100 nanograms to 1 milligram per dose, preferably 10 Micrograms to 1 mg of nucleoside acid. The exact amount to be used depends on the weight of the patient to be immunized and the route of administration. The antigenic component comprising a nucleotide sequence encoding an antigenic peptide can be administered once or repeatedly, such as 1 to 7 times, preferably 1 to 4 times, at intervals of from about 1 day to about 18 months. However, this therapeutic regimen may vary widely, with the primary considerations being the patient's size, the amount of nucleotide sequence administered, the route of administration, and other factors that are clearly considered by a professional veterinarian or practitioner. The patient may receive one or more other anti-HIV retroviral drugs as part of their overall therapeutic regimen. In addition, the nucleic acid immunogen can be administered together with an adjuvant. The adjuvant components specified herein can likewise be administered via a variety of different routes of administration, such as by oral, nasal, pulmonary, intramuscular, subcutaneous, intradermal or topical routes of administration. The adjuvant component is preferably administered by intradermal injection or topical administration. The best is to administer the drug by topical route. The adjuvant component can be administered from about 14 days prior to administration of the nucleotide sequence to about 14 days after administration, preferably from about 1 day before administration of the nucleotide sequence to about 3 days after administration. In a specific embodiment, the substantially adjuvant component can be associated with the nucleotide sequence 1329647 (23)

At the same time, by subcutaneous injection of drugs. "substantially simultaneous" means that the adjuvant component is preferably administered simultaneously with the nucleotide sequence, or if not administered at the same time, at least prior to administration of the nucleotide sequence or within hours of administration. In the plan, the adjuvant component administration system is concurrently administered with the nucleotide sequence. It is obvious that the program may be changed according to the variable factors mentioned above. The preferred adjuvant is 1 Η-isopyrazole [4, 5 c ] Porphyrin-4 -amine derivatives, such as imiquimod. Usually imiquimod can be formulated as a topical cream and can be administered as planned above.

As before, depending on the variables, the dosage of the derivative may vary, but ranges from about 0.1 mg per kg to about 0 mg per kg, where "per kg refers to the weight of the mammal. 1 Η - The administration of the isopyrazole [4,5-c] porphyrin-4 -amine derivative is preferably repeated with the subsequent or continuation of the nucleotide sequence. The optimal dosage is about 1 mg per kg. Up to about 50 mg. Derived from imiquimod or other 1 Η-isopyrazole [4,5-c] porphyrin 4-amine in the case of "first exposure to antigen-reinforcing" The substance can be administered when it is first exposed to antigen or tonic, or when it is first exposed to antigen and when it is reinforced. If the adjuvant component contains only 1 Η-different bite [4,5 - c] It can be directly administered in the original chemical state, but the preferred dosage form is its pharmaceutical formulation. That is, the adjuvant component preferably comprises 1 Η-isopyrazole [4,5-c] porphyrin-4-amine, combined One or more pharmaceutically acceptable carriers, and other optional therapeutic ingredients. " Acceptable π carrier means that it is compatible with the other ingredients in the formulation, Deleterious to the recipient. Formulations of the expected characteristics to follow the route of administration to be changed, can be prepared by techniques pharmaceutically -29-1329647 I known as a method of

(twenty four)

Ready. All methods involve the step of bringing into association a 1H-isopyrazole [4,5-c]quinoline-4-amine derivative with a suitable carrier or carrier. In general, the formulation is prepared by uniformly and intimately mixing the derivative with a liquid carrier or a finely divided solid carrier, or both; and, if necessary, shaping the product into the desired formulation shape. Formulations of the invention suitable for oral administration can be formulated as discrete units (e.g., capsules, cachets or tablets containing a predetermined amount of active ingredient), powders or granules, aqueous or nonaqueous liquid solutions or suspensions, or oils in water Liquid emulsion or water emulsion in oil. The active ingredient can also be formulated into a macropill, a medicinal or a paste.

Tablets may be made by compression or molding, and one or more additional ingredients may be added as needed. In the manufacture of compressed tablets, the free-flowing type of active ingredients (such as powder or granules) can be compressed in a suitable machine, as needed, with the binder 'lubricant, inert diluent, lubricant (1 ubricating agent), surface active Mixing agents or dispersing agents. In the manufacture of molded tablets, a mixture of powdered compounds moistened with an inert liquid diluent can be molded in a suitable machine. The tablets may be coated or scored as needed and may be formulated to provide slow or controlled release of the active ingredient. Formulations for injection which can be administered by intramuscular, intraperitoneal, or subcutaneous injection, comprise aqueous and nonaqueous sterile injectable solutions, which may contain antioxidants, buffer solutions, bacteriostatic agents, and may be formulated with the desired The isotonic solute of the blood, and aqueous and non-aqueous sterile suspensions, which may contain suspending agents and thickening agents. Formulations can be stored in unit dose or multi-dose containers, such as sealed ampoules and vials, and can be stored in freeze-dried -30- 1329647

(25)

In the (freeze-dried) state, it is only necessary to add a sterile liquid carrier, such as water for injection, before use. The in situ injection solutions and suspensions can be prepared from the various types of sterile powders, granules and tablets described above. Formulations suitable for pulmonary administration via the oral or nasal cavity can be made into granules containing the active ingredient, suitably in the range of 0.5 to 7 microns in diameter for delivery to the bronchial tree of the subject. The formulation may be in the form of a powder into a fine powder, which may conveniently be placed in a pierceable capsule (such as a gelatin) suitable for use in an inhalation device, or may be formulated as an automatic spray formulation containing the active ingredient, suitably Liquid propellant and other ingredients as needed, such as surfactants and/or solid diluents. When the active ingredient is distributed into a droplet form in a solution or suspension, it can also be applied as an automatic spray formulation. Such auto-injection formulations are analogous to those known in the art and can be prepared by existing procedures. It may suitably be made into a manual or automatic flap type having the desired spray characteristics; the latter may advantageously be designed in a measurable manner to deliver a fixed dose, such as 50 to 1000 microliters, per operation.

In a further possibility, the adjuvant component can be in the form of a solution that can be used in an atomizer or nebulizer to produce an inhalable fine droplet spray by accelerating airflow or supersonic vibration. Formulations suitable for intranasal administration typically comprise a product form similar to that described above for pulmonary administration, but wherein the formulation preferably has a particle diameter ranging from about 10 to about 200 microns so that it remains in the nasal cavity. To achieve this, use a powder of the appropriate particle size or choose the appropriate valve. Other suitable formulations comprise a coarser powder having a particle diameter ranging from about 20 to about 500 microns, which is rapidly inhaled by the container adjacent to the nose during use; and contains from about 0.2 to 5% by weight - 31 - 41329647 (26) Aqueous or oily solution nasal drops of percentage active ingredient. In a specific embodiment of the present invention, the vector containing the nucleotide sequence encoding the antigen peptide can be the same as the 1H-iso 0 ratio [4,5-c] <» quinoline-4-amine derivative. The formulations are administered together. Thus, in this particular embodiment, the immunogenic and adjuvant components are found in the same formulation.

In one embodiment, the adjuvant component is prepared in a form suitable for genomic-gun administration, and the nucleotide sequence is administered substantially simultaneously via the route of administration. In the preparation of a formulation suitable for use in the present process, the 1 H-isopyrazole [4,5-c]quinolin-4-amine derivative is subjected to lyophilization and is attached thereto, such as gold suitable for administration by gene gun. Made of small beads. In an alternative embodiment, the adjuvant component can be advanced by high pressure gas and administered in a dry powder form. Even if the adjuvant component is not co-formulated with the nucleotide sequence, the adjuvant component can be administered at or near the same site as the nucleotide sequence.

Further pharmaceutical preparations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania (1985), the entire disclosure of which is hereby incorporated by reference herein in Suitable techniques also include topical application with suitable carriers. The nucleic acid can be administered topically to the skin, or to the mucosal surface, such as by intranasal administration, orally, intravaginally, or rectally. The naked polynucleic acid or carrier can be coexisted with a pharmaceutically acceptable excipient such as phosphate buffered saline (PBS). Use of a helper (such as bupivacaine) can further promote DNA intake, which can be used individually or -32-258 1329647 (27) ♦

It is included in the DN A formulation. Other methods by which nucleic acids can be administered directly to a recipient include ultrasound, electrical stimulation, electroporation, and microseeding described in U.S. Patent No. 5,697,901 (〇1丨(:11〇566(1丨11笆). Known transfer infection techniques can increase the intake of nucleic acid structures, such as those in which a transfer agent is employed. Examples of such agents include cationic agents such as calcium phosphate and DEAE-dextran and lipofectants such as fat fertilizers. Lipofectam and transfectam. The nucleic acid dosage can be changed. The nucleic acid sequence of the present invention can also be administered by a specific delivery vector commonly used for gene therapy. The method of gene therapy is described in detail. (Verme) et al., Nature 1 997, 3 8 9 : 2 3 9 - 2 4 2. Both viral and non-viral vector systems can be used. Virus-based systems contain retroviruses, lentiviruses , adenovirus, gland-associated virus, blister virus, canarypox virus (Canarypox) and vaccinia virus-based system. Non-viral system includes direct administration of nucleic acid, centrosome packaging technology (poly(lactic-co- -sweet Alkyd) and liposome-based systems, if necessary, can be combined with viral and non-viral delivery systems for re-injection after initial vaccination, such as the initial "first exposure to antigen" DNA vaccination using non-viral vectors (eg Plasm, followed by one or more "reinforcing" vaccination using a viral vector or a non-viral system. Similarly, the present invention also contemplates a first-contact antigen-initiating system comprising a polynucleotide of the present invention, which is subsequently The protein adjuvant may be reinforced; or vice versa. The nucleic acid sequence of the invention may also be administered by transformed cells. The cells comprise cells collected from a subject. The naked multinuclear citrate of the invention is 1329647 in vitro.

(28) or a vector is introduced into the cell, and the transformed cell is subsequently returned to the therapeutic object. The polynucleic acid of the present invention can be incorporated into a nucleic acid already present in a cell by the result of homologous recombination. If necessary, the transformed cells can be cultured in vitro and one or more of the produced cells can be used in the present invention. Cells are obtained from appropriate sites of the patient by known external or microsurgical techniques (eg, transplantation, microinjection, etc.). The pharmaceutical compositions of the present invention may comprise an adjuvant compound as detailed above, or other substance which is useful for increasing the immune response elicited by the protein encoded by DN A. These substances can be encoded by DNA, either independently or in combination with an antigen, or as a non-DNA element of a formulation. Examples of adjuvant-type substances that may be included in the formulations of the invention include ubiquitin, lysosomal associated membrane protein (LAMP), hepatitis B virus core antigen, FLT3-ligand (one in the production of specialized antigenic expression) Cells (specifically known as dendritic cells) are important cytokines and other cytokines such as IFN-7* and GMCSF. Other preferred adjuvants include Imiquimod and Resimquimod and Tucarasol. Imiquimod is a great one. In a preferred embodiment of the invention, the invention provides the use of a nucleic acid molecule as described herein for the treatment or prevention of HI V infection. The nucleic acid molecule is better administered with Imiquimod. Imiquimod is preferably administered topically, and the nucleic acid molecule is preferably delivered by granular media delivery. Accordingly, the present invention provides a method of treating a sputum-affected or suspected sputum IV infection comprising administering a nucleic acid molecule as described herein and imiquimod. 1329647

(29) The present invention will be described by the following reference examples: Example Example 1: Optimizing p55 gag (pl7, p24, pl3) to resemble a codon desired for highly expressing human genes, using PCR self-ligencing Nucleotide synthesis of p55 gag antigen encoding η IV-1 differentiation branch B strain HXB2 (GenBank entry k03455)

The gene is optimized to be expressed in mammalian cells. Optimization involves changing the codon usage pattern of the viral gene so that the codon frequency is close to highly expressing the human gene. Using a new version of Syngene (Calcgene), R.S. Hale and G. Tompson, Protein Expression and

Purification, Vol. 12, pp. 185-188, 1998) Visual Basic program to specify codons. Selection: The 1 52 8 base pair (bp) gag PCR product was gel-purified, cleaved with the restriction endonucleases Notl and Bam HI, and ligated into the Notl/Bam HI-cleaved vector WRG7077. It can place the gene between the CMV promoter/insert sequence A and the bovine growth hormone polyadenylation signal. Sort the above selected plants and check for errors. No single colony was 100% correct. Therefore, it is necessary to combine the correct sequence portions derived from the two selected strains, which are obtained by overlapping the P C R reaction 'appropriately combining the optimized monomer groups to obtain the full length codon optimized gag gene. Then found this most • 35· 261 1329647

(30) The deletion of a single nucleotide in the final selection resulted in a frameshift and led to the termination of translation. When the deleted part is repaired, the gene containing the incorrect sequence is deleted and the correct sequence from the counterpart of the other selection is selected into the selected strain. The P5 5 gag colony of the final optimized codon was thus obtained: Gagoptrpr2 (see Figure 2). Example 2: Preparation of a pl7/p24 truncated Nef fusion gene

The pl7 and p24 portions of the p55gag gene derived from HIV-1 differentiated shoot B strain HXB2 were amplified by PCR reaction via plastid pHXB?Pr (B. Maschera, Effinfine and ED Blair ( Blair) 1995 J_ Virol 69 5431-5436). Using the same plastid will be derived from the 3' end of the HXB2 nef gene? 11 Parent 8??1'.426 5? Zoom in. Since the 11乂8 2116€ gene contains a premature stop codon, the codon is repaired by two overlapping PCRs (from TGA [stop] to TGG [Trp]).

The PCR product (reverse) binds to the PCR product of the p17/p24 linker and the trNEF linker to form the pi7p24trNEF fusion gene (Fig. 3). The 1 542 bp product was gel purified, cut with restriction endonucleases Notl and BamHI and cloned into the Notl BamHI portion of vector WRG7077. This gene can be placed between the CM V promoter/insert sequence A and the bovine growth hormone polyadenylation signal. Example 3: Preparation of Gag pl7/24opt/trNefl ('Gagopt/Nef') fusion gene Desirable gene Optimized p55gag gene derived from HIV-1 differentiated B strain HXB2 -36- 262 1329647

(31) The code p 1 7/p24 portion was amplified by PCR reaction via the plastid pGagOPTrpr2. The truncated HXB2 Nef gene in which the premature stop codon has been repaired (from TGA [stop] to TGG [Trp]) was amplified by PCR reaction via plastid 7077trNef20. The two PCR products were designed to have overlapping ends so that the two genes can be joined in the second PCR.

The 1 5 44 bp product was gel purified, cut and cloned with restriction endonucleases Notl and BamHI (see figure) to the Notl BamHI site of vector WRG7077. This gene can be placed between the CM V promoter/insert sequence A and the bovine growth hormone polyadenylation signal. Example 4: plastid: P7077-RT3 clonal strain #A desired gene:

A synthetic gene encoding the RT portion of the pol gene of HIV-1 differentiated shoot B strain HXB2, optimized for expression in mammalian cells, is a combination of overlapping oligonucleotides by P C R . The sequence sequenced corresponds to the 25 50-4222 position of the HXB2 overlapping reference sequence (GenBank entry K03 45 5). To ensure its expression, the selected sequence was at 5, with two additional codons not present in the original gene, _AUG GGC (Met Gly). Optimization involves changing the codon usage pattern of the viral gene to obtain a codon frequency that closely approximates the human gene, but excludes the rare use of the secret. Using the pr〇tein Expression and written by the Xin Gene (an updated version of the Kalk gene, R.S. Harr and G. Two Poussin)

Purification, Vol. 12, pp. 185-188, 1998) The statistical image base program specifies codons. The final selection strain consisted of two intermediate selection strains # i 6 and # 2 1 . -37- 263 1329647 (32)

Selection: The 1.7 kb PCR product was gel purified, cut with Notl and BamHI, and purified by PCR' and then ligated into Notl/BamHI-cut PWRG7077. This gene can be placed between the Cmv promoter gene and the bovine growth hormone polyadenylation signal. Sort the selected strains. Although the selected strain is not 100 ° /. Correctly, but by replacing the 4〇3bp KpnI-BamHI fragment containing 3 errors with the correct Kpnl-BamHI fragment derived from the selected strain #2 i, the correcting strain #16» can be sorted to check the final selection ^ ( See Figure 5) Example 5: Optimizing RT The desired gene will encode the synthetic portion of the RT portion of the pol gene of HIV-1 differentiated shoot b strain HXB2 (optimized for expression in mammalian cells) from plastids

A 1697 bp Notl/BamHI fragment was excised in P7077-RT3, purified by gel and cloned into the Notl and BamHI sites of p7313-ie (derived from pepC31), and the gene was placed in the Iowa section (Iowa length). The HCMV promoter gene is shown downstream of sequence 1 and upstream of the rabbit hemagglutinin polyadenylation signal. (R7 004 p27) (Figure 6). Example 6 Platinum: 7077trNef20 Gene: The embedded gene includes a portion of the Nef gene derived from the HIV-1 differentiation branch B strain HXB2. 195 bp was deleted from the 5' end of the gene to remove the 65 amino acid codons prior to Nef. In addition, the early termination codon repair of the published HXB 2 nef sequence (from TAG to TGG[Trp]) step as plastid -38 - 1329647

(33) As described in pl7/24trNEFl. The truncated nef sequence was amplified by PCR reaction via plastid p 17/24trNefl. The sequence of the selection corresponds to the position of 8992-9417 of the HXB2 reference sequence (GenBank entry K03455). To ensure expression, the cloning sequence has an additional codon - AUG (Met) that is not present in the original gene at the 5' end. Introduction:

StrNef(forward)ATAAGAATGCGGCCGCCATGGTGGGTTTT CCAGTCACACCTT [Sequence Identification Number: 1] AStrNef (reverse) CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [Sequence Identification Number: 2] PCR: 94°C for 2 minutes, followed by 25 cycles: 94°C for 30 seconds, 50°C 30 seconds, 72 ° C 2 minutes, the end of 72 ° C 5 minutes of selection:

The PCR product of 455 bp of RT was gel purified, cut with restriction endonucleases Notl and Bam HI and ligated into the vector WRG7077 cleaved with Notl/BamHI. This gene can be placed between the CMV promoter gene/insert sequence A and the bovine growth hormone polyadenylation signal. Example 7 Platinum: 7077RT 8 Gene of interest The RT portion of the pol gene is derived from the HIV-1 differentiation branch B strain HXB2. This was amplified by the PCR reaction by the plasmid p7077Poll4. The selected sequence corresponds to the HXB2 reference sequence (GenBank entry K03455) -39- 265 1329647

(34) Position 2550-4234. To ensure expression, the cloning sequence has two additional codons at the 5' end that are not present in the original gene - AUG GGC (Met Gly). Primer: SRT (forward) ATATAAATGCGGCCGCCATGGGCCCCATTAGC CCTATTGAGACT [Sequence Identification Number: 3]

ASRT (reverse) CCGGGATCCTTAATCTAAAAATAGTACTTTC CTGATT [Sequence identification number: 4] PCR: 94 〇C for 2 minutes, followed by 25 cycles: 94 ° C for 30 seconds, 50. . 30 seconds, 72 ° C for 4 minutes, termination at 72 ° C for 5 minutes. Selection: The 1 720 bp RT PCR product was gel purified, cut with restriction endonucleases Notl and Bam HI and ligated into Notl/B amHI The cutting carrier WRG7077. This gene can be placed between the CMV promoter gene/insert sequence A and the bovine growth hormone polyadenylation signal.

Example 8 p 1 7/2 4opt/RT/trNef 1 3 ('Gagopt/RT/Nef') This construct contains a PCR that causes a change in R to amidinoic acid. Desirable gene: The pl7/p24 portion of the optimized p55gag gene cryptotype derived from the HIV-1 differentiation branch B strain HXB2 was amplified by the PCR reaction from the plastid pGagOPTrpr2. The RT coding sequence was amplified by plastid 7077RT 8 by PCR reaction. The truncated HXB2 Nef gene in which the premature stop codon has been repaired (from TGA[stop] to TGG[Trp]) was subjected to PCR reaction via plastid 7077trNef20 -40- 41329647

(35) Large. Three PCR products with overlapping ends are designated so that the three genes can be joined in the second PCR. Introduction: (P17/24)

Spl7p24opt (forward)

ATAAGAATGCGGCCGCCATGGGTGCCCGAGCTTCGGT [Sequence Identification Number: 5] ASpl7p24optRT Linker Gene (reverse) TGGGGCCCATCAACACTCTGGCTTTGTGTC [Preface 另 另 ' 'J No.: 6] PCR: 94 〇C 1 minute, followed by 20 cycles: 94 ° C 30 sec, 50 ° C The 1114 bp pl7/24opt product was gel purified at 30 seconds, 72 ° C for 2 minutes, and terminated at 72 ° C for 4 minutes. (RT)

Spl7p24optRT Linker Gene (forward) CAGAGTGTTGATGGGCCCCATTAGCCCTAT [Sequence Identification

No.: 7] ASRTtrNef ligation gene (reverse) AACCCACCATATCTAAAAATAGTACTTTCC [Sequence identification number: 8] PCR: The 1711 bp RT PCR product was gel purified as above. (5. truncated nef) SRTtrNef ligation gene (forward) CTATTTTTAGATATGGTGGGTTTTCCAGTCAC [SEQ IDENTIFICATION - 41 - I1329647 (36) No.: 9] AStrNef (reverse) CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [Sequence identification number: 10] P C R was performed as described above. The product of 4 4 8 b p was purified by gel.

The three PCR products were ligated into the second PCR and the primers Spl7/24opt and AstrNef were ligated together. PCR: 94eC for 1 minute, followed by 30 cycles: 94 ° C for 30 seconds, 50 ° C for 30 seconds, 72 ° C for 4 minutes, termination of 7 2 ° C for 4 minutes to gel purification of 3 253 bp of the product, to limit The endonucleases Notl and BamHI were excised and cloned into the Notl BamHI site of the vector WRG7077. This gene can be placed between the CMV promoter/insert sequence A and the bovine growth hormone polyadenylation signal. Example 9

Platinum: pGRN#16 (pl7/p24opt corr /RT/trNef.)

A truncation of ~30 kD a exhibited by a cluster of poor codons near amino acid 270 in p24 can be noted in the polyprotein produced by pl7/24opt/RT/trNefl3 (, Gagopt/RT/Nef'). product. These codons can be replaced by PCR-linked mutagenesis to the optimal codon. Using p 1 7/24opt/RT/trNefl 3 as a template, amplify the Gag 51 portion of the mutant with the Spl7/p24opt and GTR-A primers and amplify the Gag 3 of the mutant with GTR-S and Aspl7/p24optRT ,section. Use Spl7/p24opt and Aspl7/p24optRT • 42- 1329647

The gene primer is ligated and the overlapping portion of the product containing the altered codon is linked to the gel purified product. The product was cleaved with Notl and Agel and inserted into the likewise cleaved p 1 7/24opt/RT/trNef 1 3 to generate pGRN. Confirmed the selection of strain #1 6 and developed it. Primer: 5· PCR:

Spl7p24opt (forward) ATAAGAATGCGGCCGCCATGGGTGCCCGAGCTTCGGT [Sequence Identification Number: 11] GTR-A (reverse) GCGCACGATCTTGTTCAGGCCCAGGATGATCCACCGTTTATAGA TTTCTCC [Sequence Identification Number: 12]

3' PCR Forward: GTR-S (forward) ATCCTGGGCCTGAACAAGATCGTGCGCATGTACTCTCCGACATC CATCC [SEQ ID NO: 13] ASpl7p24optRT Linker (reverse) TGGGGCCCATCAACACTCTGGCTTTGTGTC [Sequence Identification Number: 14] When using PWO DNA polymerase (Roche), The conditions for PCR and binding of individual products are: 9 5 °C for 1 minute, followed by 20 cycles: 9 5 °C for 30 seconds, 5 5 °C for 30 seconds, 7 2〇C for 180 seconds, End 7 2 °C for 1 2 0 seconds and keep at 4 °C. The product of 1 1 1 4 b p was gel purified and cleaved with N 〇 11 and A g e I to release

26S-43 - 1329647 (38) 6647 bp fragment, which was gel purified and ligated into pl7/24opt/RT/trNefl3 which was gel-purified by Notl/Agel to produce pGRN#16. Example 10: plastid: p73i-GRN2 clonal strain #19 (pl7/p24(opt)/RT(opt)trNef) - repaired gene: optimized p1 7/p24 portion of the gag codon , codon-optimized RT and truncated Nef gene; the latter from HIV-1 differentiated B strain HXB2, which is the Iowa passage HCMV promoter + expression sequence 1 downstream, rabbit / 3 - hemagglutinin polygland Upstream of the signal. The plastid containing the trNef gene derived from the plastid pl7/24trNef contains a PCR error, thereby producing an R to amidino acid change affecting the 19 amino acids at the end of the nef. It can be corrected by PCR mutagenesis, and the corrected nef PCR can be ligated to the codon-optimized RT from p7077-RT3, and the junction fragment is cleaved with Apal and BamHI, and then inserted into P73 cut by Apal/B amHI. i-GRN. Primer: The PCR reaction of coRT was performed from p7077-RT3 using the following primer: (polymerase = PWO (Roche)). Forward: U1 GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGT GCCGGTGAAGCTGAAACCCGGGAT [Sequence Identification Number: 15] AScoRT-Nef -44 - 1329647 (39) GGTGTGACTGGAAAACCCACCATCAGCACCTTTCTAATCCCCGC [Sequence Identification Number: 16]

Cycle: 95 ° C (30 seconds), then 20 cycles: 95 ° C (30 seconds), 55 ° C (30 seconds), 72 ° C (180 seconds), then 72 ° C (120 seconds) and The 1.7 kb PCR product was gel purified at 4 °C. The 5' Nef PCR reaction was carried out from pl7/24trNefl using the following primer: Forward: S-Nef ATGGTGGGTTTTCCAGTCACACC [SEQ ID NO: 17] Reverse: ASNef-G: GATGAAATGCTAGGCGGCTGTCAAACCTC [Sequence Identification Number: 18] Cycle: 95 ° C ( 30 seconds), followed by 15 cycles: 95 ° C (30 seconds), 55 ° C (30 seconds), 72 ° C (60 seconds), then 72 ° C (120 seconds) and kept at 4 ° C The following primers were used for PCR reaction of 3' Nef from pl7/24trNefl:

Forward ·· SNEF-G GAGGTTTGACAGCCGCCTAGCATTTCATC [Sequence Identification Number: 19] Reverse: AStrNef (reverse) CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [Sequence Identification Number: 20]

Cycle: 9 5 °C (30 seconds), then 15 cycles: 9 5 °C (30 seconds), 5 5 °C (30 seconds), 72 °C (60 seconds), then connect 72 The PCR product was gel purified at °C (120 sec) and maintained at 4 °C using 5' (S-Nef) and 3' (AstrNef) -45-271 41329647

(40) Sub-association of the first two N e f products. Cycle: 9 5 °C (30 seconds), then 15 cycles: 9 5 °C (30 seconds), 5 5 °C (30 seconds), 7 2 °C (60 seconds), then Connect to 7 2 °C (1 800) and keep at 41. The PCR product was purified by PCR and ligated to the RT product using U1 and AstrNef primers:

Cycle: 9 5 °C (30 seconds), followed by 20 cycles: 9 5 °C (30 seconds), 5 5 °C (30 seconds) '7 2 °C (1 800 seconds)' The product was further purified by gel filtration of the product of 2.1 kb at 7 2 ° C (180 seconds) and kept at 4 ° C and cut with Apal and BamHI. The plastid P7 3I-GRN was also cut with Apal and BamHI, purified by gel and ligated with Apal-Bam RT3 trNef to regenerate the p 1 7/p24(opt)/RT(opt) trNe f gene. Example 1 1 p 7 3 i - GN2 Breeding strain #2 (pl7/p2 4 op t/t rN e f) - Repaired Gene:

The codon-optimized gag pl7/p24 portion and the truncated Nef gene; the latter from the HIV-1 differentiation branch B strain HXB2, located downstream of the Iowa passage HCMV promoter + expression sequence 1, rabbit cold-blood cells The upstream of the protein polyadenylation signal. The plastid containing the trNef gene derived from the plastid pl7/24trNefl contains a PCR error, which results in a change in the amino acid of R to oxime, affecting the 19 amino acids at the Nef end. This change was corrected by PCR mutagenesis, and the corrected fragment was cut with Bglll and BamHI and cloned into P73I-GN transfected with Bglll/BamHI. (Fig. 12) Recombinant corrected p17/p24opt/trNefa synthase' which is the Iowa passage HCMV promoter + under expression 1 -46- 1329647

(41) Swimming, and upstream of the rabbit yS-hemoglobulin polyadenylation signal. PCR of 5' Nef was performed using pl7/24trNefl using primers: polymerase = P W 0 (Roche). Forward: S-Nef ATGGTGGGTTTTCCAGTCACACC [Sequence Identification 丨j No.: 21] Reverse: ASNef-G : GATGAAATGCTAGGCGGCTGTCAAACCTC [Sequence Identification Number: 22] Cycle: 95 ° C (30 seconds), followed by 15 cycles: 95 ° C (30 seconds), 55 ° C (30 seconds), 72 ° C (60 seconds), then 72 ° C (120 seconds), and kept at 4 ° C using primers from pl7/24trNefl for 3' Nef PCR :

Forward: SNEF-G GAGGTTTGACAGCCGCCTAGCATTTCATC [Sequence Identification Number: 23] Reverse: AStrNef CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [Sequence Identification Number: 24]

Cycle: 95 ° C (30 seconds), followed by 15 cycles: 95 ° C (30 seconds) ' 55 ° C (30 seconds), 72 ° C (60 seconds), then 72 ° C (120 seconds), The PCR product was gel purified and maintained at 4 ° C and ligated using 5' (S-Nef) and 3' (AstrNef) primers.

Cycle ·· 9 5V ( 30 seconds), then 15 cycles: 9 5 °C (30 seconds), 5 5 °C (30 seconds), 72 °C (60 seconds), then 72 °C (180 sec) and kept at 4 ° C. The PCR product was cleaned by PCR reaction, cut with Bglll/BamHI, and 1329647

(42) The 3 67 bp fragment was gel purified and cloned into p73i-GN which was cleaved by Bglll/BamHI and gel purified. Example 1 2 plastid: p73I-RT w229k (non-activated RT) Gene: Produces an inactivated RT gene located downstream of the Iowa Pass HCMV promoter + expression sequence 1, and rabbit spot-hemagglutinin aggregation Upstream of the adenylation signal. Since it is considered to avoid the use of active HIV RT species in therapeutic vaccines, the genes need to be inactivated. This can be achieved by PCR mutagenesis by changing the RT (derived from P73I-GRN2) amino acid position 229 from Trp to Lys (R7271 pl-28). Primer: 5' RT PCR + mutation using the following primer: (polymerase = PWO (Roche) full range) Forward: RT3-u : 1 GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGT GCCGGTGAAGCTGAAACCCGGGAT [Sequence Identification Number: 25] Reverse: AScoRT-Trp229Lys GGAGCTCGTAGCCCATCTTCAGGAATGGCGGCTCCTTCT [ shore Column Identification Number: 26] Cycle: 1 X [94〇C (30 seconds)] 15 X [94〇C (30 seconds) / 55°C (30 seconds) / 72°C (60 seconds)] 1329647 (43) 1 X [72〇C (180 sec)] PCR gel purification using primers for PCR amplification of 3' RT: Reverse: RT3-1: 1 GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCA GCTTGTCGACCTGCTCGTTGCCGC [Sequence Identification Number: 27]

Forward: ScoRT-Trp229Lys CCTGAAGATGGGCTACGAGCTCCATG [Sequence Identification Number: 28] Cycle: 1 X [94°C (30 seconds)] 15 X [94°C (30 seconds) / 55°C (30 seconds) / 72 °C (60 sec)] 1 X [72 ° C (180 sec)] PCR gel purification

The PCR product was gel purified and the 5' and P' ends of RT were ligated using 5' (RT3-U1) and 3' (RT3-L1) primers. Cycle. 1 X [94〇C (30 seconds)] 15 X [94°C (30 seconds) / 55°C (30 seconds) / 72°C (120 seconds)] 1 X [72°C (180 seconds) The PCR product was gel purified and cloned into p73 1 3ie, and the positions were restricted with Notl and BamHI to generate p73I-RTw229k (see Figure 13). Example 1 3: plastid: p73i-Tgrn (#3) -49- 275 1329647

(44) The desired gene: codon-optimized gag pl7/p24 portion, rt and truncated Nef gene; the latter is derived from HIV-1 differentiated shoot B strain HXB2, which is located in the Iowa paragraph HCMV promoter gene + performance Downstream of Sequence 1, upstream of the rabbit stone-hemoglobin polyadenylation signal. The triple-fusion structure containing the RT-active type may not be available for human use because of the inability to obtain regulatory authorization, so the Nhel and Apal cut fragments derived from p73i-RT w229k can be inserted into Nhel/Apal cut p73i-GRN2#19 (Fig. 14). 'And RT is not activated. It can result in a W-K change at the 2 2 9 position of RT. Example 1 4 p73I-Tnrg (#16) The desired gene:

Truncated N ef, inactivated codon-optimized rt and codon-optimized gag pl7/p24 portion; latter from HIV-1 differentiated shoot B strain HXB2, which is located in the Iowa paragraph HCMV promoter + It is downstream of the sequence 1 and upstream of the rabbit/5-hemoglobulin polyadenylation signal. The gene sequence of the polyprotein encoded by p73i-Tgrn was rearranged by PCR reaction and PCR linkage, and p73I-Tnrg was generated (Fig. 15). Each gene was amplified by P C R reaction, gel purified, and ligated with P C R to form a single polyprotein. The product was gel purified, digested with N 〇 11 / B a m Η I and ligated into P7313ie cleaved by Notl/BamHI.

Primer: trNef PCR -\-rc L : ;-7 -50- 1329647 #

(45) S-Nef (Not I) CATTAGAGCGGCCGCGATGGTGGGTTTTCCAC [Sequence Identification Number: 29] AS-Nef-coRT Linker Gene GATGGGACTGATGGGGCCCATGCAGTTCTTGAACTACTCCGG [Sequence Identification Number: 30]

RTw229k PCR S-coRT ATGGGCCCCATCAGTCCCATCGAG [SEQ ID NO: 31] AS-coRT-pl7p24 Linker Gene CAGTACCGAAGCTCGGGCACCCATCAGCACCTTTCTAATCCCCG C [SEQ ID NO: 32] p 17p24opt PCR S-p17p24opt ATGGGTGCCCGAGCTTCGGTACTG [Sequence Identification Number: 33] AS-pl7p24opt (BamHI) GATGGGGGATCCTCACAACACTCTGGCTTTGTGTCC [Sequence Identification Number: 34] Individual products and PCR conditions linked using VENT DNA polymerase (NEB): 1 X [94 ° C (30 sec)] 25 x [94 ° C (30 sec) / 55 ° C (30 sec) ) / 72 ° C (120 sec [ρ17ρ24 or RT] or 60 sec [trNef])] 1 X [72 ° C (240 sec)] 41329647 (46) PCR product purified by gel and using the primer S-trNef (Notl And AS-pl7p24opt (BamHI) for PCR linkage. 1 X [94°C (30 seconds)] 25 X [94〇C (30 seconds) / 55°C (30 seconds) / 72°C (210 seconds)] 1 X [72°C (240 seconds)]

The 3000 bp product was gel purified and cleaved with Notl and BamHI, and the product was cleaned by PCR and ligated into Notl/BamHI-digested, gel-purified p7313ie to produce p73i-Tnrg. Example 1 5: 1. Plastid: P73i-Tngr (#3) Desired gene: truncated Nef and codon-optimized gag pl7/p24 portion and inactivated codon-optimized RT gene; HI V-1 differentiated shoot B strain HXB2, which is located downstream of the Iowa passage HCMV promoter + expression sequence 1 and upstream of the rabbit/5-hemoglobulin polyadenylation signal.

The gene sequence of the polyprotein encoded by p 7 3 i - T g r η was rearranged by the P C R reaction to generate p73I-Tngr (Fig. 16). The pl7/p24 and RT, which optimize the codon, are made into a single product and linked to the enlarged trNef by the PCR reaction. The product was gel purified, Notl/BamHI digested and ligated into p7313ie cleaved by Notl/BamHI. Primer: P17/p24-RT 3'PCR:

Sp 1 7p24opt (forward) ATGGGTGCCCGAGCTTCGGTACTG [Sequence Identification Number: 35] -52- 41329647

(47) RT3 1 : 1 (reverse) GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCA GCTTGTCGACCTGCTCGTTGCCGC [Sequence Identification Number: 36]

TrNef 5'PCR S-Nef (Notl) CATTAGAGCGGCCGCGATGGTGGGTTTTCCAC [SEQ ID NO: 37] AS-Nef-pl7p24 CAGTACCGAAGCTCGGGCACCCATGCAGTTCTTGAACTACTCCG G [SEQ ID NO: 38] PCR conditions for individual products and binding using VENT DNA polymerase (NEB): 1 X [94〇C (30 seconds)] 25 X [94 °C (30 seconds) / 55 °C (30 seconds) / 72 °C (180 seconds [pl7p24+RT] or 60 seconds [trNef] or 210 seconds [ Binding])] 1 X [72〇C (240 sec)] The 3 000 bp product was gel purified and cut with Notl and BamHI, cleaned by PCR and ligated into Notl/BamHI digested, gel purified P7313ie Generation of p73i-Tngr 〇 Example 1 6 : plastid: p73I-Trgn (#6) Gene: Unactivated codon-optimized RT, codon-optimized gag-53-^ 70 41329647

(48) pl7/p24 partial and truncated Nef gene; the latter is derived from HIV-1 differentiation branch B strain HXB2, which is located downstream of the Iowa passage HCMV promoter + expression sequence 1, rabbit no-hemoglobin polyglycan Upstream of the signal to the glycosylation signal. To complete the gene sequence in the construct, the amplification of pi 7p24-trNef and RTw229k can be performed by the PCR reaction from the plastids P73I-GN2 and p73I-RTw229k, respectively. The PCR was coupled and the product was gel purified, cleaved with N 〇 11 /B a m ΗI, and ligated into p7313ie digested with No 11 / B a m ΗI. The ranking revealed that ρ17ρ24 was not fully optimized, so a 700 bp fragment was next cleaved from the coding site with Agel/MunI and replaced with a Munl/Age fragment derived from p73i-Tgrn#3 containing the correct coding sequence. (See Figure 17). Primer: p!7p24-trNef PCR S-p17p24opt ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 39] AstrNef (BamHI) RTw229k RT3-U : 1 GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGT GCCGGTGAAGCTGAAACCCGGGAT [Sequence Identification Number: 40] AS-coRT-pl7p24opt Linker Gene CAGTACCGAAGCTCGGGCACCCATCAGCACCTTTCTAATCCCCG C [Sequence Identification Number: 41]

Individual products and PCR when coupled with VENT DNA polymerase (NEB) -54- 280 1329647 (49) Condition: 1 X [94°c (30 seconds)] 25 x [94〇C (30 seconds) / 55°C (30 seconds) / 72 ° C (120 seconds (PCR) or 180 seconds (joined) 1 X [72〇C (240 seconds)]

The 3000 bp product derived from the PCR reaction was gel-purified and cleaved with Notl and B amHI, cleaned by PCR and ligated into p73 13ie gelatinized by Notl/B amHI to produce p73i-Tngr. Sequence analysis revealed that the ρ17ρ24 sequence obtained from P73I-GN2 was not fully codon optimized and that this defect was introduced into the new plastid. If you want to be bridged, you can

A 700 bp fragment was cleaved from Muni and Agel-cut p73i-Tngr, and a 700 bp Munl/Agel digested product derived from p73i-Tgrn was ligated to generate the construct p73I-Tngr#6. Example 1 7 plastid: p73i-Trng (#1 1)

The desired gene: inactivated codon-optimized RT, truncated Nef and codon-optimized pl7/p24 portion of the gag gene; the latter is derived from the HIV-1 differentiation branch B strain HXB2, which is the Iowa passage The HCMV promoter gene + shows the downstream of sequence 1, and the rabbit) upstream of the S-hemoglobulin polyadenylation signal. To achieve the gene sequence within the construct, the RT-trNef and ρ17ρ24 genes can be amplified from p73i-Tgrn by PCR. Two DNA fragments were ligated by PCR and the 3 kb product was gel-purified and cleaved with Notl/BamHI, and ligated with Notl/BamHI-digested p7313ie to obtain p73I Trng (#11).

-55- 『I329647 (50) Primer: RTw229k-trNef RT3-u: 1 GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGT GCCGGTGAAGCTGAAACCCGGGAT [Sequence Identification Number: 42] AS-Nef-pl7p24opt Linker Gene

CAGTACCGAAGCTCGGGCACCCATGCAGTTCTTGAACTACTCCG G [SEQ ID NO: 43] P17d24 S-p 17p24opt ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 44] AS-pl7p24opt(BamHI) GATGGGGGATCCTCACAACACTCTGGCTTTGTGTCC [Sequence Identification Number: 45]

PCR conditions for individual products and binding using VENT DNA polymerase (NEB): 1 X [94 〇C (30 sec)] 25 X [94 〇C (30 sec) / 55 ° C (30 sec) / 72 ° C (120 seconds (PCR of gene) or 180 seconds (joined) 1 X [72 °C (240 sec)] The 3 000 bp product derived from PCR linkage was gel purified and cut with N 〇 11 and BamHI Then, it was cleaned by PCR and ligated into Notl/B amHI-digested, gel-purified p7313ie to produce p73i-Tngr. Example 18:

-56- rI329647

p73i-Tgnr (#fl) gene: codon-optimized pl7/p24 portion of gag, truncated Nef and inactivated codon-optimized RT gene; latter from HI V-1 differentiated B strain HXB2, which is located downstream of the Iowa Parallel HCMV Promoter Gene + Expression Sequence 1, upstream of the rabbit/3-hemoglobulin polyadenylation signal.

In order to achieve the genetic sequence within the structure, the P C R method can be used to enlarge the pl7p24-trNef and RTw 2 2 9 k force ports derived from the plastids p73I-GN2 and p73I - RTw229k, respectively. The linkage was carried out by the P C R method and the product was gel-purified, cleaved with Notl/BamHI, and ligated with Notl/BamHI-digested p7313ie. Errors in the two sequences can be found in the sequence (pi 7p2 4 and RT), which can then be replaced with the correct position in the polyprotein to replace the correct portion of the gene. (See Figure 1 9)

p!7p24-trNef PCR S-p17p24opt ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 46] AS-Nef-coRT Linker Gene GATGGGACTGATGGGGCCCATGCAGTTCTTGAACTACTCCGG [Sequence Identification Number: 47] RTw229k

S-coRT ATGGGCCCCATCAGTCCCATCGAG [Sequence Identification Number: 48] RT3-1 : 1 -57- 1329647

(52) GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCA GCTTGTCGACCTGCTCGTTGCCGC [Sequence 4:49] PCR conditions for individual products and binding using VENT DNA polymerase (NEB): 1 X [94〇C (30 sec)] 25 X [94〇C (30 Second) / 55 ° C (30 seconds) / 72 ° C (120 seconds (PCR) or 180 seconds (joined)

1 X [72 °C (240 seconds)]

The 3 000 bp product was gel purified and cleaved with Notl and BamHI, cleaned by PCR and ligated into p7313ie digested with Notl/BamHI to obtain p73i-Tngr. Sorting revealed that ρ17ρ24 was not completely optimized, so a 700 bp fragment was cleaved from the Agel/MunI self-coding site and replaced with a Muncl/Age fragment derived from p73i-Tgrn#3 containing the correct coding sequence. The polyprotein also contains a single point mutation (G2609A) which results in the replacement of the amino acid Thr in the RT portion of the multiprotein into Ala. This mutation can be corrected by digesting its construct by Apal/BamHI and by PCR to remove the sequence that produces the mutation, which can be replaced by a portion of the RT portion derived from p73i-Tgnr that is digested by Apal/BamHI. Example 1 9: Preparation of a plastid-coated gold slurry for the use of the gene gun 1 DNA drug 1 plastid DNA (about 1 μg/μl, such as 100 μg) and 2 μm gold The granules (eg 50 mg, PowderJect) are suspended in 〇.〇5M sub-sperm-58·284 4 , 1329647 (53) \mm^'amine (eg 100 μl) (Sigma) )). After the addition of 1 M CaCl2 (e.g., 100 microliters (American Pharmacotty Partners, Inc., USA)), the DNA was precipitated onto gold particles. The DNA/gold complex was incubated at room temperature for 1 minute and washed 3 times with absolute alcohol, such as 3 X 1 ml (previously dried in a molecular sieve 3A (BDH)). The sample was resuspended in absolute alcohol containing 5 mg/ml of polyvinylpyrrolidone (PVP 'Sigma) and divided into three equal portions into a 1 -5 ml microcentrifuge tube (Eppenci〇rf ))). The analysis items for this aliquot are: (a) gold syrup I, (b) eluate-plastid from (a) elution and (c) preparation, gene robbing, (see the following three groups of examples) The gold/plastid body is coated with Tefzel. To prepare samples (a) and (b), place the centrifuge tube containing the plastid DNA/'Jinrong:' ethanol/pvp in the Ibndorf 5418 microcentrifuge for 2 minutes at the highest speed. The supernatant was removed and the 1 gold paste was dried at room temperature for 1 minute. The sample (a) was resuspended in TE of pH 8.0 containing 0.5·1·〇 microgram/μl of plastid DNA, assuming a coating rate of about 50%. For elution, the sample (^ was resuspended in pH 8.0 containing 0.5-1.0 μg/μl of plastid DNA^TE and cultured at 37. The sputum was incubated for 30 minutes, shaken vigorously, followed by Ibndorf Rotate the supernatant at the southernmost speed for 5 minutes in a 4丨8 microcentrifuge and remove the supernatant, eluate and store at _2〇π. The exact DNA concentration eluted by spectrophotometry using gene quantification (GenequaiU) II (Pharmacia Bi〇tech) Assay Example 20: Preparation of DNA immunization Drugs Prepared as previously described for the Accel(R) gene transfer device -59-1329647 (54) Medicines used (Eisenbraun et al., DNA and Cell Biology' 1993, Vol. I No. 9 791-797; Pertner et al.) Simply put, The body dnA was coated on 2 micron gold particles (DeGussa Corp., South Plainfield, N_J., USA) and loaded into a Teflon tube, which was then cut into I]? cm length for use as a drug. S and 'dehydrated storage before 4'. Before the typical inoculation, each drug E contains 毫克.5 mg of gold, which is coated with each drug. The total amount is 微5 μg of DNA. Example 2 1 : Immune response to HIV antigen after vaccination with DNA. Inoculated mice (n = 3/group) using PSN encoded by nucleic acid and placed in two vectors The HCMV IE promoter gene, which comprises the insertion sequence A and the expression sequence 1 (fcmv promoter gene). 731, although delivering the same antigen, contains the insertion sequence A in the HCMV IE promoter gene (iamv promoter gene), and only contains the expression sequence. 1. The plastid was delivered to the site of the shaved tFi (C3H X Balb/c) mouse abdominal skin. On the second day, the mouse was given 2 X 0.5 μg DNA for the first immunization, and on the 35th day, 2 X 0.5 μg. DNA was reinforced and IFN- r Elysip (E1 is ρ 〇t) was used to detect cellular responses on day 40. • P73I - blank vector • P7077 - blank vector • P7077 GRN- (f CMV promoter) Gag, RT, Nef • P73I GRN-(i CMV promoter gene) Gag, RT, Nef • P73I GR3N- (CMV promoter gene) optimization Gag, optimization RT, Nef 1329647 • % (55) • P7077 GN-(f CMV promoter gene) Gag, Nef • P73I GN-(i CMV promoter gene) Gag, Nef killer T cell Should by CD8 + T cells - limiting IFN- r Division Iraqi forces were analyzed Pat splenocytes collected 5 days to evaluate the reaction of killer cells τ. The rats were sacrificed by cervical dislocation and the spleens were collected into ice-cold PBS. The spleen cells were extracted into the buffered saline (PB S), and the red blood cells were hemolyzed (discussed by a buffer consisting of 155 milliequivalents of NH4C1, 10 milliequivalents of KHC〇3, and 01 milliequivalents of edta). 1 minute in the solution) * After rinsing twice in PBS to remove the particulate matter, 'a single cell suspension was aliquoted into the Irispat test plate, and the test plate was pre-coated with the capture IF N - T antibody. And stimulated with c D 8 -restricted homologous peptide (G ag, Nef or RT). After incubation overnight, 'by applying anti-murine IFN_ 7"-biotin standard δ-hexabody (pharmjngen), and then using streptavidin-binding phosphatase and using image analysis to quantify After seeing ^... T made cells. The experimental results are not as shown in Figures 20, 21 and 22. Example 22: Immunogenicity of Vaccine Structure 1. Cell Analysis Cellular immune responses include killer CD8 cells and helper CD4 cells. A sensitive method for detecting specific C D 8 and C D 4 cells is the Irispatt assay, which quantifies the number of cells that secrete interferon-T4IL_2. Yili Spat analysis relies on capturing the kinesin secreted by individual cells. Simply put, the 'specificized microtiter plate is coated with anti-cell cytokines antibody 1329647

(56) Overlay. Splenocytes isolated from immunized animals were cultured overnight with specific peptides representing known epitopes (CD8) or proteins (CD4). If the stimulated cells release cytokines, they will bind to antibodies surrounding the surface of the test disc surrounding each of the fabricated cells. After the cells are lysed and rinsed, the remaining cytokines are still attached to the coated antibody. The development of this assay is similar to the E LI S A assay, which uses a biotin/albumin amplification system. The number of points is equivalent to the number of cells produced by cytokines. - Recorded among all six structures, CD8 responds to the following K2d-restricted murine epitopes: Gag (AMQMLKETI), Nef (MTYKAAVDL) and RT (YYDPSKDLI), and CD4 to Gag and RT proteins The reaction. The results of these analyses were statistically analyzed and the structures were evaluated according to their immunogenicity. The results are shown in Figure 23. 2. Body fluid analysis Blood samples were collected from the two trials on days 7 and 14 after reinforcement for antibody analysis. Serum was separated and frozen for Sf storage, and antibody titers were measured using a specific ELISA analysis. All antibodies to Gag, Nef and RT were tested in all samples. Briefly, the ELISA test panel is first coated with the relevant protein. Wash off. After the excess protein, dilute the serum sample and incubate it in the well. The serum samples were washed away and anti-mouse antiserum was added in combination with an appropriate label. After the test disc is cultivated, the test disc reader is used for identification. The results are shown in Figure 24. 3. Antibody data The price of all six antibodies in the four trials was tested. The structure P 7 3 i - G N R does not always produce an antibody response to Gag and only has a limit on the antibody against Nef m -62 - 1329647

(57) should. Since the T-cell reaction can be observed in the spleen cells isolated from the same mouse, it means that the Gag protein can be expressed in the body, so the cause of this phenomenon is unknown.

The evaluation of the production of Gag-specific antibodies is as follows: RNG>GRN>NRG>RGN>NGR> GNR analysis of cellular immunological data The objective is to rank six structures from three immunological tests based on dot count data. A total of three groups of responses were evaluated:

CD8 response to Gag, Nef and RT on day 7 (7th day after first inoculation), CD4 response to Gag and RT at 35th (7th after reinforcement), CD8 at 35th to Gag, Nef And RT reaction (7th after strengthening).

A linear mixed effect model of SAS version 8 was used to model the response of each reaction (eg, CD8 to Gag). The model contains the structural fixation effect, regardless of the specific antigen (Gag, Nef or IL-2 is present. In addition, for the CD8 response, the data of each mouse can provide research, so the model can include the research object Random Influencing Factors β The interactions involved in this model allow for the study of the different effects of the combination of various antigens (presence/absence) and IL-2 (presence/absence) in each structure. Evaluate the adjusted average response difference between each structure and P 7 3 1 3 (control group) for a combination of various antigens (presence/absence) & IL · 2 (presence/absence), and - The value indicates whether the difference is statistically significant. In the case of antigen but lacking IL-2, the structure is evaluated according to the difference and the p-value, and the structure with the largest difference is rated as 6'. 5, and so on, and 0 means that any difference is not met*^

2oS • 63 - 41329647

(58) A meaningful 5% structure. The hypothesis of this model is that if the variable is fixed, the residue should be normally distributed. Therefore, the authenticity can be analyzed by graphical methods and sensitivity analysis. The first logarithm of the reaction and the second square root transformation model must be established. The evaluation of the structure is not sensitive enough to deviate from this model hypothesis. After the evaluation of each reaction in each experiment was separately calculated, the total evaluation of the three groups of reactions in all three experiments was calculated. The table below shows the overall rating of the three experiments. The overall rating of each structure in the three sets of reactions in all three experiments. Construction No. 7 (7th after the first inoculation) CD8 35th (7th day after reinforcement) CD4 CD8 GRN 5 18 3 GNR 17 24 28 RGN 28 23 33 RNG 25 27 37 NRG 25 19 0 NGR 4 14 10 RNG Ranked the highest in the two groups on the 35th day, and ranked second in the 7th group, second only to the RGN. RGN also received high ratings in the two sets of reactions on the 35th day. BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 P7313-ie Fig. 2 Sequence of p55 gag insertion gene in pGagOptrpr2Fig. 3 Sequence of pl7/24trNEF insertion gene in pl7/24trNEF1Fig. 4 Sequence diagram of pl7/24opt/trNEF insertion gene in pl7/24opt/trNefl 5 p7077-RT3 RT insertion gene sequence

-64 - 1329647 (59) Figure 6 Sequence of the inserted gene in p73i-RT3 Figure 7 Sequence of the Nef insertion gene in 7077trNef20 Figure 8 Sequence of the RT insertion gene in 7077 RT8 Figure 9 p 17/24opt/RT/trNefl 3 p 17 Sequence of the /24opt/RT/trNef insertion gene Figure 10 Sequence of the inserted gene of pl7/p24opt(cor)/RT/trNef in WRG7077

Figure 11 Sequence of pl7/p24(opt)/RT(opt)trNef insertion gene in p73i-GRN2 Figure 12 Sequence of pl7/p24opt/trNef insertion gene in p73i-GRN2 Figure 13 Sequence of RT w299k Figure 14 p73i-Tgrn Figure 15 Sequence of Tnrg Figure 16 Sequence of Tngr insertion gene in p7313ie _

Figure 17 Sequence of the inserted gene Trgn#6 Figure 18 Sequence of the inserted gene of Trng#11 Figure 19 Sequence of TgnR (F1) Figure 20 Using the INF-γ enzyme-linked immunospot assay (ELIspot), measuring the binding of Gag peptide after 5 补 reinforcement Reaction Figure 21 uses the INF-γ enzyme-linked immunospot assay (ELIspot) to measure the response to the N ef peptide after 5 days of enhancement. Figure 22 uses the INF-γ enzyme-linked immunospot assay (ELIsP〇t) to measure the response after 5 days of reinforcement. Figure 23 This example is in the mouse model 'after immunization with a recombinant construct consisting of Gag, RT & Nef in a triple fusion mode' -65- 291 41329647

(60) Detect its C D 8 immune response. Figure 24 Gag antibody measured on day 35 (after 7 补 reinforcement) using ELISA

Claims (1)

1329647 No. 09112162! Lin Li Chinese application for Kunben (Jianyian|April), life K lg repair (more), pick up, apply for a patent selection 1. A nucleotide sequence, which can encode HIV-1 gag protein or The gag epitope and the HIV-1 Nef protein or Nef epitope are operably linked to a heterologous promoter gene. 2. For the nucleotide sequence of claim 1, the gag protein includes pl7. 3. The nucleotide sequence of claim 2, wherein the gag protein further comprises p24. 4. The core of any one of claims 1 to 3: y: acid sequence, wherein the gag sequence is codon-optimized into a codon similar to that used to highly express human genes, with relative synonymous codons The utilization (RSCU) value is 0.5. 5. A core according to any one of claims 1 to 3: y: an acid sequence, wherein the sequence further encodes an RT protein or an rt epitope. 6. The nucleic acid sequence of claim 5, wherein the sequence of the sequence is RT, gag, Nef or RT, Nef, gag. 7. A nucleotide sequence as claimed in claim 5, wherein the rt sequence is codon-optimized to express human genes in a similar height. 8. A nucleus selected from the group consisting of: y: acid sequence, • Gag (pl7, p24), truncated Nef _ Gag (p 1 7, p24) (codon optimization), Nef ( Truncated) • Gag (pl7, p24), RT, Nef (truncated) • Gag (pl7, p24) codon optimization, RT, Nef (truncated) 80745-990420.doc I329M7 Gag (pl7, p24) codon optimization, RT codon optimization, truncated N ef RT (codon optimization), Gag (pl7, p24) codon optimization, truncated N ef RT (post, code optimization), truncated nef, gagp 1 7 , p 2 * codon optimization, wherein the Defy Nef includes removal of the N-terminal amino acid, and wherein the nucleotide φ sequence It is operably linked to a heterologous promoter gene. 9. The nucleotide sequence of claim 8 wherein the truncated n e f comprises removing 65 N-terminal amino acids. 10. The nucleic acid sequence of the nuclear station of any one of claims 1 to 3 and 8 to 9 wherein the heterologous promoter gene is derived from the promoter gene of the HCΜV IE gene. U. A nucleotide sequence in which the 51-end of the promoter gene comprises the expression sequence 1. Φ 12· The nucleotide sequence of claim 5, wherein the RT line encodes a canine A' to substantially deactivate any reverse transcriptase activity. 13. The nucleotide sequence of claim 12, wherein the RT is mutated by the substitution of tryptophan 229 as an lysine. 14. A carrier comprising a nucleotide sequence as claimed in claims 1 to 3 and 8 to 9 of the patent application. 15. The vector of claim 14 which is a viral vector. 16. The vector of claim 15 of the patent application, which is a replication-defective adenosis 80745-990420.doc 1329647 Poison. 17. The carrier of claim 14 of the patent scope, which is a double-stranded DN A plastid. 18. A protein encoded by a nucleotide sequence as set forth in any one of claims 1 to 3 and 8 to 9. 19. A pharmaceutical composition comprising the nucleotide sequence of claims 1 to 3 and 8 to 9 and a pharmaceutically acceptable excipient, diluent, carrier or adjuvant. 20. A pharmaceutical composition comprising a carrier as claimed in claim 14 and a pharmaceutically acceptable excipient, diluent, carrier or adjuvant. 21. The pharmaceutical composition of claim 19, which is suitable for intramuscular or intradermal delivery. 22. A pharmaceutical composition as claimed in claim 20, which is suitable for intramuscular or intradermal delivery. 23. The pharmaceutical composition of claim 19, wherein the carrier is a gold perforated bead. 24. A pharmaceutical composition according to claim 20, wherein the carrier is a gold perforated bead. 25. An intradermal delivery device comprising a pharmaceutical composition according to claim 19 of the patent application. 26. An intradermal delivery device comprising a pharmaceutical composition according to claim 20 of the patent application. 27. A pharmaceutical composition according to claim 19, which is useful for treating a patient suffering from or susceptible to a disease. 80745-990420.doc I32%47 28. A pharmaceutical composition as claimed in claim 20, which is useful for treating a patient suffering from or susceptible to a disease. 29. A nuclear station acid sequence according to any one of claims 1 to 3 and 8 to 9 which can be used in medicine. 30. If the carrier of claim 14 is applied, it can be used in medicine. 31. A pharmaceutical composition as claimed in claim 19, which can be used in medicine 〇 32. A pharmaceutical composition as claimed in claim 20, which can be used in medicine. 33. Use of a nucleotide sequence according to any one of claims 1 to 3 and 8 to 9 for the preparation of a medicament for treating a disease. 34. A vector according to claim 14 of the patent application for the preparation of a medicament for treating a disease. 35. A method of producing a nucleotide according to any one of claims 1 to 3 and 8 to 9 which comprises, by operation, encoding a HI V-1 gag protein and a second HIV-1 Nef The nuclear station acid sequence of the protein is ligated to the heterologous promoter gene sequence. 80745-990420.doc