RU2312896C2 - Nucleic acid sequence encoding hiv-1 gag protein, method for its preparing, vector containing thereof, protein encoded by its, pharmaceutical composition and their using in prophylaxis and/or treatment of hiv-infection and aids - Google Patents

Abstract

FIELD: medicine, virology, molecular biology, genetic engineering.

SUBSTANCE: invention relates to nucleic acid constructions and to vaccine preparations containing such construction and to using such preparations in medicine. Nucleotide sequence that encodes HIV-1 gag protein or its fragment containing gag epitope and HIV-1 Nef protein or its fragment containing nef epitope, and RT protein or its fragment containing RT epitope is coupled operatively with heterologous promoter wherein gag sequence is optimized by cordons. This sequence is a component of pharmaceutical composition and used in treatment and/or prophylaxis of HIV-infection and AIDS.

EFFECT: valuable medicinal properties of constructions, protein and pharmaceutical composition.

15 cl, 50 dwg, 22 ex

Description

Field of Invention

The present invention relates to nucleic acid constructs, to host cells containing such constructs, and to their use in nucleic acid vaccines. In addition, the invention relates to vaccine preparations containing such constructs, and to the use of such drugs in medicine. In particular, the invention relates to DNA vaccines that are useful in the prophylaxis and treatment of HIV infections, more particularly when administered by particle-mediated delivery.

BACKGROUND OF THE INVENTION

HIV-1 (HIV-1) is the main cause of Acquired Immunodeficiency Syndrome (AIDS), which is considered as one of the main problems of world health. Although large-scale vaccine research has been undertaken worldwide, such efforts have nonetheless been unsuccessful.

Non-envelope HIV-1 proteins are described which include, for example, internal structure proteins such as gag and pol gene products and other non-structural proteins such as Rev, Nef, Vif and Tat (Green et al., New England J. Med. 324, 5, 308 et seq (1991) and Bryant et al. (Ed. Pizzo), Pediatr. Infect. Dis. J., 11, 5, 390 et seq (1992)).

The Gag gene is translated from full-sized RNA to form the precursor polyprotein, which is then cleaved into 3-5 capsid proteins; matrix protein, capsid protein and nucleic acid binding protein, as well as protease (1. Fundamental Virology, Fields BN, Knipe D.M. and Howley M., 1996; 2. Fields Virology, vol. 2, 1996).

The gag gene encodes a 55 kilodalton (KD) Gag precursor protein, also called p55, which is expressed with unspliced viral mRNA. During translation, the N-terminus of p55 undergoes myristoylation, which triggers its binding to the cytoplasmic part of cell membranes. The membrane-bound Gag polyprotein recruits two copies of the viral genomic DNA in parallel with other viral and cellular proteins that trigger the budding of the viral particle from the surface of the infected cell. After budding, p55 is cleaved by the virus-encoded protease (product of the pol gene) during maturation of the virus into four smaller proteins, designated MA (matrix [p17]), CA (capsid [p24]), NC (nucleocapsid [p9]) and p6 (4 )

In addition to the three main Gag proteins, all Gag precursors contain several other regions that cleave and remain in the virion in the form of peptides of various sizes. These proteins play various roles, for example, p2 protein presumably plays a role in the regulation of protease activity and contributes to the correct determination of the proteolytic processing time.

The MA polypeptide is formed from the N-terminal myristoylated end of p55. Most of the MA molecules remain attached to the inner surface of the lipid bilayer of the virion, stabilizing the particle. The MA subgroup is recruited inside the deeper layers of the virion, where it becomes part of the complex that delivers viral DNA to the nucleus (5). These MA molecules contribute to the nuclear transport of the viral genome, since the karyophilic signal on the MA is recognized by the cellular mechanism of nuclear import. This phenomenon makes it possible for HIV to infect non-dividing cells, which is an unusual property for retrovirus.

Protein p24 (CA) forms the conical core of the viral particles. It has been demonstrated that cyclophilin A interacts with the p24 region of the p55 protein, leading to its incorporation into HIV particles. The interaction between Gag and cyclophilin A is significant because interruption of this interaction by cyclosporin A inhibits viral replication.

The NC Gag region is responsible for the specificity of recognition of the so-called HIV packaging signal. The packaging signal consists of four hairpin structures localized near the 5 'end of the viral RNA, and is sufficient as a mediator to incorporate heterologous RNA into HIV-1 virions. NC binds to the packaging signal through interactions mediated by two zinc finger motifs. NC also promotes reverse transcription.

The p6 polypeptide region mediates interactions between the p55 Gag and the auxiliary Vpr protein, leading to the incorporation of Vpr into assembled virions. Region p6 also contains the so-called late domain, which is necessary for the effective release of budding virions from an infected cell.

The pol gene encodes two proteins containing two activities necessary for the virus in early infection, the RT protein (reverse transcriptase) and integrase protein, which is necessary for the integration of viral DNA into cellular DNA. The primary Pol product is cleaved by the virion protease to form the RT amino-terminal peptide, which contains the activities necessary for the synthesis of DNA (RNA and DNA-dependent DNA polymerase, ribonuclease H) and the carboxy-terminal integrase protein. HIV RT is a heterodimer of full-length RT (p66) and a cleavage product (p51), in which there is no carboxy-terminal domain of RNase and integrase.

RT is one of the most highly conserved proteins encoded by the retroviral genome. The two main activities of RT are DNA polymerase and ribonuclease N. The activity of RT DNA polymerase uses RNA and DNA as templates interchangeably and, like all known DNA polymerases, is not able to initiate de novo DNA synthesis, but it needs a previously existing molecule that serves as a primer (RNA).

The activity of RNase H, which is characteristic of all RT proteins, plays a significant role in the removal of genome RNA as DNA synthesis continues during early replication. It selectively destroys RNA from all hybrid RNA-DNA molecules. Structurally, polymerase and RNase H occupy separate non-overlapping domains within Pol, covering two thirds of the amino acid sequence of Pol.

The p66 catalytic subunit is packaged in 5 different subdomains. Its amino end 23 has a portion of RT activity. At its carboxy terminus is the RNase N. domain.

After infection of the host cell, the retroviral RNA genome is copied by reverse transcriptase, which is present in the infectious particle, into a linear double-stranded (ds, double strand) DNA. Integrase (reviewed in Skalka AM'99 Adv in Virus Res, 52: 271-273) recognizes viral DNA ends, shortens them and accompanies viral DNA to the site of the host chromosome, catalyzing integration. Targets for integration can be many host DNA sites. Although integrase is sufficient to catalyze in vitro integration, it is not the only protein associated with the in vivo viral DNA complex — the large protein – viral DNA isolated from infected cells has been called the preintegration complex. This complex promotes the acquisition of host cell genes by progeny viral genomes.

Integrase consists of 3 separate domains, an N-terminal domain, a catalytic core and a C-terminal domain. The catalytic core domain contains everything necessary for the chemistry of polynucleotide transfer.

Nef protein is known to cause the removal of CD4, an HIV receptor, from the cell surface, but the biological significance of this function is a matter of debate. In addition, Nef interacts with the biochemical pathway of T-cell signaling and induces an active state, which, in turn, can contribute to more efficient gene expression. Some HIV isolates have mutations in the area that cause them to lack a functional protein encoding, and they have slightly impaired replication and in vivo pathogenesis.

Vaccine DNAs typically consist of a bacterial plasmid vector into which a strong promoter is inserted, a target gene that encodes an antigenic peptide, and polyadenylation / transcription termination sequences. The target gene may encode a full-sized protein or simply an antigenic peptide sequence related to a pathogen, tumor, or other agent against which protection is necessary. This plasmid can be grown in bacteria, such as, for example, E. coli, and then isolated and received its preparation in a suitable medium depending on the intended route of administration, after which it is administered to the host. After administration, this plasmid is captured by the host cells, where the encoded protein is produced. The plasmid vector should preferably be constructed without a replication origin that is functional in eukaryotic cells to prevent plasmid replication in the host mammal for its participation in integration into the chromosomal DNA.

There are several advantages of DNA vaccination over traditional vaccination methods. First, it is predicted that due to the fact that the proteins encoded by the DNA sequence are synthesized in the host, the structure or conformation of this protein will be similar to the native protein associated with the disease state. It is also likely that DNA vaccination will provide protection against various strains of the virus by generating a response of cytotoxic T lymphocytes that recognize epitopes from conserved proteins. In addition, since plasmids are captured by host cells, where antigenic protein can be produced, a prolonged immune response can be generated. This technique also provides the opportunity to combine different immunogens in one drug, which contributes to the simultaneous immunization against a number of painful conditions.

Useful information on the background of the invention regarding DNA vaccination is provided by Donnelly et al. "DNA vaccines". Ann. Rev. Immunol. 1997, 15: 617-648, the description of which is incorporated herein in full by reference.

Summary of the invention

The present invention provides new constructs for use in nucleic acid vaccines for the prevention and treatment of HIV infections and AIDS.

Accordingly, in a first aspect, a nucleic acid molecule is provided comprising a nucleotide sequence encoding an HIV gag protein or fragment thereof linked to a nucleotide sequence encoding an additional HIV antigen or fragment thereof and operably linked to a heterologous promoter. A fragment of the indicated nucleotide sequence will encode an HIV epitope and typically encodes a peptide of at least 8 amino acids. This nucleotide sequence is preferably a DNA sequence and is preferably contained within a plasmid without a replication origin. The preparation of such nucleic acid molecules is prepared with pharmaceutically acceptable excipient, carriers, diluents or adjuvants to obtain a pharmaceutical composition suitable for the treatment and / or prevention of HIV infection and AIDS.

In a preferred embodiment, a DNA sequence preparation is prepared on the surface of inert particles or granules suitable for particle-mediated drug delivery. Preferably, these granules are gold.

In a preferred embodiment of the invention, there is provided a DNA sequence that encodes a gag protein with high expression, the sequence being optimized so that the use of codons is similar to that for genes in mammalian cells. In particular, the gag protein is optimized in such a way that it is similar to that for human genes with high expression.

The DNA code has 4 letters (A, T, C, and G) and uses them to write three-letter “codons” that represent the amino acids of the proteins encoded in the body’s genes. The linear sequence of codons throughout the DNA molecule translates into a linear sequence of amino acids in the protein (s) encoded by these genes. The code is highly degenerate, since 61 codons encode 20 natural amino acids and 3 codons represent stop signals. Thus, most amino acids are encoded by more than one codon - in fact, some of them are encoded by four different codons or a large number of them.

If more than one codon is available for encoding a given amino acid, it has been observed that patterns of using codons of organisms are highly nonrandom. Different species exhibit different trends in codon selection, and in addition, the use of codons can be significantly different in the same species between genes that are expressed at high and low levels. This tendency is different in viruses, plants, bacteria and mammalian cells, and some species show a stronger tendency to differ from the random selection of codons than others. For example, humans and other mammals have a lesser tendency than some bacteria or viruses. For these reasons, there is a significant chance that a mammalian gene expressed in E. coli, or a foreign or recombinant gene expressed in mammalian cells, will have an inappropriate codon distribution for efficient expression. It is believed that the presence of a heterologous sequence of clusters of DNA codons or an abundance of codons that are rarely observed in the host in which the expression is to be carried out, allows to predict low levels of heterologous expression in this host.

An embodiment of the present invention provides a gag polynucleotide sequence that encodes an amino acid sequence where the pattern of codons of this polynucleotide sequence is similar to that of mammalian genes with high expression. Preferably, this polynucleotide sequence is a DNA sequence. It is desirable that the pattern of codons of this polynucleotide sequence is typical of human genes with high expression.

In the polynucleotides of the present invention, the pattern of codon usage is changed compared to that typical of human immunodeficiency viruses, towards a codon shift closer to the target organism, for example, a mammal, in particular a human. The "codon utilization rate" is a measure of how closely the codon pattern of a given polynucleotide sequence is similar to that for the target species. Codon frequencies can be obtained from literature for genes of many species with high expression (see, for example, Nakamura et al., Nucleic Acids Research, 1996, 24: 214-215). The codon frequencies for each of the 61 codons (expressed as the number of codons per 1000 codons of the selected class of genes) are normalized for each of the twenty natural amino acids, so the value for the most commonly used codon for each amino acid is reduced to 1, and the frequencies for less common codons are plotted on a scale between 0 and 1. Thus, for each of the 61 codons, a value of 1 or lower is determined for the genes of the target species with high expression. To calculate the codon utilization coefficient for a particular polynucleotide relative to genes of a given species with high expression, note the value on the scale for each codon of a particular polynucleotide and determine the geometric mean of all these values (by dividing the sum of the natural logarithms of these values by the total number of codons and taking the antilogarithm). This coefficient will have a value between 0 and 1, and the higher this coefficient, the more codons in the polynucleotide are frequently used codons. If the polynucleotide sequence has a codon utilization factor of 1, then all codons are the “most frequent” codons for the genes of the target species with high expression.

In accordance with the present invention, the pattern of using codons of a polynucleotide should preferably exclude codons with an RSCU value of less than 0.2 compared with the genes of the target organism with high expression. Alternatively, the codon usage pattern should exclude codons constituting <10% of the codons used for a particular amino acid. The relative usage of synonym codons (RSCU) value is the observed number of codons divided by the expected number if all codons for a given amino acid were used equally often. The polynucleotide of the present invention will typically have a codon utilization coefficient (or RSCU) for human genes with high expression higher than 0.3, preferably higher than 0.4, most preferably higher than 0.5. Codon usage tables for humans can also be found at Genebank.

For comparison, the highly expressed beta-actin gene has an RSCU of 0.747. The codon usage table for Homo sapiens is presented below:

According to a further aspect of the invention, there is provided an expression vector that comprises and is capable of directing the expression of a polynucleotide sequence according to the first aspect of the invention, in particular the pattern of using codons of the gag polynucleotide sequence is typical of mammalian genes with high expression, preferably human genes with high expression. This vector may be suitable for directing the expression of heterologous DNA in bacterial, insect or mammalian cells, in particular in human cells. In one embodiment, this expression vector is p7313 (see FIG. 1).

In a third embodiment, the gag gene is provided under the control of a heterologous promoter fused to a DNA sequence encoding Nef or a fragment thereof or HIV reverse transcriptase (RT) or a fragment thereof. The gag gene region may comprise either the N or C-terminal portion of the fusion construct.

In a preferred embodiment, the gag gene does not encode the gag p6 peptide. Preferably, the NEF gene is shortened by removing the sequence encoding the N-terminal region, i.e. by removing 30-85, preferably 60-85, typically about 81, preferably 65 N-terminal amino acids.

In a further embodiment, the RT gene is also optimized in a manner that is similar to a highly expressed human gene. RT preferably encodes a mutation that essentially inactivates any reverse transcriptase activity. A preferred inactivation mutation involves replacing W (tryptophan) 229 with K (lysine).

According to a further aspect of the invention, there is provided a host cell comprising a nucleotide sequence according to the invention or an expression vector according to the invention. This host cell may be a bacterial cell, for example, E. coli, a mammalian cell, for example a human, or it may be an insect cell. Mammalian cells containing the vector according to the present invention can be cultured cells transfected in vitro, or they can be transfected in vivo by introducing the vector to the mammal.

The present invention further provides a pharmaceutical composition comprising a polynucleotide sequence according to the invention. Preferably, this composition comprises a DNA vector. In preferred embodiments, the composition comprises a plurality of particles, preferably gold particles, coated with DNA containing a vector encoding the polynucleotide sequence of the invention. Preferably, this sequence encodes the HIV gag amino acid sequence, where the codon pattern of this polynucleotide sequence is typical of mammalian genes with high expression, especially human genes. In alternative embodiments, the composition comprises a pharmaceutically acceptable excipient and a DNA vector according to a second aspect of the present invention. This composition may also include an adjuvant.

Thus, one embodiment of the invention is such that the vectors of the invention are used with immunostimulatory agents. Preferably, the immunostimulatory agent is administered concurrently with the nucleic acid vector of the invention and, in preferred embodiments, are included in a single preparation together. Such immunostimulatory agents include (although this list is by no means exhaustive and does not eliminate other agents) synthetic imidazoquinolines such as imichimod [imiquimod, S-26308, R-837] (Harrison et al. 'Reduction of recurrent HSV disease using imiquimod alone or combined with a glycoprotein vaccine ', Vaccine 19: 1820-1826, (2001)) and reshimod [resiquimod, S-28463, R-848] (Vasilakos et al.' Adjuvant activities of immune response modifier R-848: Comparison with CpG ODN ', Cellular Immunology 204: 64-74 (2000)), Schiff bases of carbonyls and amines that are constitutively expressed on the surfaces of antigen-presenting cells and T cells (Rhodes, J. et al. Therapeutic potentiatio n of the immune system by costimulatory Schiff-base-forming drugs', Nature 377: 71-75 (1995)), cytokine, chemokine, and bone molecules, either as a protein or as a peptide, that include pro-inflammatory cytokines, such like GM-CSF (granulocyte-macrophage colony-stimulating factor), IL-1 (interleukin-1) -alpha, IL-1-beta, TNF (tumor necrosis factor) -alpha and TNF-beta, Th1 inducers such as interferon-gamma , IL-2, IL-12, IL-15 and IL-18, Th2 inducers, such as IL-4, IL-5, IL-6, IL-10 and IL-13, as well as other genes of chemokines and costimulators, such as MCP-1, MIP-1 alpha, MIP-1 beta, RANTES, TCA-3, CD80, CD86 and CD40L, other immunostimulation target ligands, such as CTLA-4 and L-selectin, apoptosis stimulating proteins, and peptides, such as Fas (49), synthetic lipid-based adjuvants, such as waxfectin [vaxfectin] (Reyes et al., 'Vaxfectin enhances antigen specific antibody titres and maintains Th1 type immune responses to plasmid DNA immunization', Vaccine 19: 3778-3786), squalene, alpha-tocopherol, polysorbate 80, DOPC and cholesterol, endotoxin [LPS] (Beutler, B. 'Endotoxin, Toll-like receptor 4, and the afferent limb of innate immunity', Current Opinion in Microbiology 3: 23-30 (2000)); CpG oligo and dinucleotides, Sato, Y. et al., 'Immunostimulatory DNA sequences necessary for effective intradermal gene immunization', Science 273 (5273): 352-354 (1996), Hemmi, H. et al., 'A Toll -like receptor recognizes bacterial DNA ', Nature 408: 740-745, (2000) and other potential ligands that trigger Toll receptors to produce Th-1 inducing cytokines, such as synthetic mycobacterial lipoproteins, mycobacterial protein p19, peptidoglycan, teichoic acid and lipid A.

Some preferred adjuvants that elicit a predominantly Th-1 type response include, for example, a lipid A derivative such as monophosphoryl lipid A or preferably 3-de-O-acylated monophosphoryl lipid A. MPL® adjuvants can be obtained from Corixa Corporation (Seattle, WA; see, for example, US patents Nos. 4436727, 4877611, 4866034 and 4912094). CpG-containing oligonucleotides (in which the CpG dinucleotide is not methylated) also elicit a predominantly Th-1 type response. Such oligonucleotides are well known and described, for example, in WO 96/02555, WO 99/33488 and in US patent No. 6008200 and 5856462. Immunostimulatory DNA sequences are also described, for example, Sato et al., Science 273: 352, 1996. Another a preferred adjuvant contains saponin, such as Quil A, or its derivatives, including QS21 and QS7 (Aquila Biopharmaceuticals Inc., Framingham, MA), escin, digitonin or saponins of Gypsophila or Chenopodium quinoa.

The use of a polynucleotide according to the invention or a vector according to the invention is also proposed in the treatment or prevention of HIV infection.

The present invention also provides methods for treating or preventing HIV infections, any symptoms or diseases associated therewith, in which an effective amount of a polynucleotide, vector or pharmaceutical composition according to the invention is administered. The administration of the pharmaceutical composition may take the form of one or more than one individual dose, for example, in the form of repeated doses of the same DNA plasmid, or in the form of a “primary vaccination – revaccination” regimen of therapeutic vaccination. In some cases, “primary” vaccination can be carried out by particle-mediated DNA delivery of a polynucleotide according to the present invention, preferably inserted into a vector of plasmid origin, and revaccination can be carried out by introducing a recombinant viral vector containing the same polynucleotide sequence, or by revaccination with a protein in an adjuvant. Conversely, primary vaccination can be carried out with a viral vector or a protein preparation, typically a protein preparation in an adjuvant, and revaccination can be carried out with the DNA vaccine of the present invention. Multiple doses of primary vaccination and / or revaccination may be used.

In embodiments of the invention, fragments of gag, nef or RT proteins are contemplated. For example, a polynucleotide of the invention may encode a fragment of a gag, nef or RT HIV protein. A polynucleotide that encodes a fragment of at least 8, for example, from 8-10 amino acids, or up to 20, 50, 60, 70, 80, 100, 150, or 200 amino acids in length, is considered to be within the scope of the invention if the encoded oligo - or the polypeptide exhibits antigenic properties of HIV. In particular, but not exclusively, this aspect of the invention encompasses a situation where a polynucleotide encodes a fragment or full-length sequence of an HIV protein and may represent one or more discrete epitopes of the protein. Such fragments can be optimized for codons, so this fragment has a codon usage pattern that is similar to that for a mammalian gene with high expression.

Preferred structures according to the present invention include:

1. p17, p24, fused with a shortened NEF (without nucleotides encoding terminal amino acids 1-65);

2. p17, p24, RT, shortened NEF (without nucleotides encoding terminal amino acids 1-65);

3. p17, p24 (optimized gag), truncated NEF (without nucleotides encoding terminal amino acids 1-65);

4. p17, p24 (optimized gag), RT (optimized), truncated NEF (without nucleotides encoding terminal amino acids 1-85);

5. p17, p24, RT (optimized), shortened NEF (without nucleotides encoding terminal amino acids 1-65);

6. Shortened NEF (without nucleotides 1-65), fused with optimized p17, p24gag;

7. Particularly preferred constructs of the invention include triple fusions of RT-NEF-Gag and RT-Gag-Nef, in particular:

8. Optimized RT, shortened NEF and optimized p17, p24 (gag) (RNG);

9. Optimized RT, optimized p17, 24 (gag), shortened Nef (without AK 1-65) (RGN).

Preferably, HIV constructs are derived from HIV isolate B or isolate C, especially isolate B.

As discussed above, the present invention includes expression vectors that contain nucleotide sequences of the invention. The construction of such expression vectors is a routine molecular biology technique and involves the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as, for example, polyadenylation signals that may be necessary and which are located in the correct orientation to allow expression of the protein. Other suitable vectors should be apparent to those skilled in the art. As an additional example in this regard, the inventors refer to Sambrook et al. Molecular Cloning: a Laboratory Manual, 2 ^nd Edition, CSH Laboratory Press (1989).

Preferably, the polynucleotide of the invention or for use in the vector of the invention is operably linked to a regulatory sequence that is capable of providing expression of the coding sequence by the host cell, that is, this vector is an expression vector. The term “operatively linked” refers to an adjacent position where the described components are in a relationship that allows them to function properly. A regulatory sequence, such as a promoter “operably linked” to a coding sequence, is positioned such that expression of the coding sequence is achieved under conditions compatible with that regulatory sequence.

Vectors can be, for example, plasmids, artificial chromosomes (e.g., BAC, PAC, YAC), viral or phage vectors provided with a replication origin, possibly a promoter for expression of the polynucleotide and, possibly, a regulator of this promoter. The vectors may contain one or more than one selective marker gene, for example, an ampicillin or kanamycin resistance gene in the case of a bacterial plasmid or a resistance gene for a fungus vector. Vectors can be used in vitro, for example, to produce DNA or RNA, or used to transfect or transform a host cell, such as a mammalian host cell, for example, to produce a protein encoded by a vector. The vectors can also be adapted for in vivo use, for example, with a DNA vaccination or gene therapy method.

Promoters and other expression regulation signals may be selected so as to be compatible with the host cell for which expression is intended. For example, mammalian promoters include a metallothionein promoter that can be induced in response to heavy metals such as cadmium and the β-actin promoter. Viral promoters can also be used, such as the SV40 large T-antigen promoter, the immediate early (IE) promoter of the human cytomegalovirus (CMV) promoter, the Routh sarcoma virus LTR promoter, the adenovirus promoter or the HPV promoter, in particular the upstream regulatory region (URR, upstream regulatory region) HPV. All of these promoters are well described and readily available in the art.

The preferred promoter element is the fast early CMV promoter, with the exception of intron A, but including exon 1. The promoter element may be a minimal promoter element or an amplified promoter, with an amplified promoter being preferred. Accordingly, a vector is provided comprising the polynucleotide of the invention under the control of the early promoter IE HCMV.

Examples of suitable viral vectors include herpes simplex vectors, vaccinia virus or alpha virus and retrovirus vectors, including lentiviruses, adenoviruses and adeno-associated viruses. Gene transfer techniques using these viruses are known to those skilled in the art. Retroviral vectors, for example, can be used to stably integrate the polynucleotide of the invention into the host genome, although such recombination is not preferred. Replication-defective adenoviral vectors, in contrast, are maintained in episomic state and, therefore, allow transient expression. Vectors capable of directing expression in insect cells (e.g., baculovirus vectors), in human cells, in yeast, or in bacteria can be used to produce amounts of HIV protein encoded by the polynucleotides of the present invention, for example, for use as subunit vaccines or in immunological analyzes.

The polynucleotides of the invention are useful in the production by expression of encoded proteins, which expression may occur in vitro, in vivo or ex vivo. Nucleotides, therefore, can be involved in the synthesis of a recombinant protein, for example, to increase yields, or they can indeed find application as therapeutic agents as such used in DNA vaccination techniques. If the polynucleotides of the present invention are used in the production of encoded proteins in vitro or ex vivo, cells, for example, in cell culture, should be modified to include the polynucleotide whose expression is necessary. Such cells include transit or, preferably, stable mammalian cell lines. Specific examples of cells that can be modified by inserting vectors encoding the polypeptide of the invention include mammalian HEK293T, CHO, HeLa, 293 cells and COS cells. Preferably, the selected cell line should not only be stable, but such as to allow glycosylation and expression of the mature polypeptide on the cell surface. Expression can be achieved in transformed oocytes. The polypeptide can be expressed from the polynucleotide of the present invention in the cells of a transgenic non-human animal, preferably a mouse. A transgenic non-human animal expressing a polypeptide from a polynucleotide of the invention is included in the scope of the invention.

The invention further provides a method for vaccinating a mammal subject in which an effective amount of such a vaccine or vaccine composition is administered. Most preferably, the expression vectors for use in DNA vaccines, vaccine compositions and immunotherapeutic agents will be plasmid vectors.

DNA vaccines can be administered in the form of “naked DNA”, for example, in a liquid preparation that is administered using a syringe or high pressure jet, or a DNA preparation is prepared with liposomes or an irritating transfection enhancer, or administered by particle-mediated DNA delivery (PMDD, particle mediated DNA delivery). All of these delivery systems are well known in the art. A vector can be administered to a mammal, for example, using a viral vector delivery system.

The compositions of the present invention can be delivered via a number of routes, such as intramuscular, subcutaneous, intraperitoneal, intravenous or mucosal administration.

In a preferred embodiment, the composition is delivered intradermally. In particular, the composition is delivered using a “gene gun”, in particular particle bombardment techniques, which include coating a vector in the form of a coating on a granule (for example, gold), which is then injected under high pressure into the epidermis, for example, as described in Haynes et al., J. Biotechnology 44: 37-42 (1996).

In one illustrative example, gas-driven particle acceleration can be achieved using devices available from PowderJect Pharmaceuticals PLC (Oxford, UK) and PowderJect Vaccines Inc. (Madison, WI), and some examples of such devices are described in US patent No. 5846796, 6010478, 5865796, 5584807 and in European patent No. 0500799. This approach enables needle-free delivery, where a dry powdery preparation of microscopic particles, such as a polynucleotide, is accelerated to a high speed inside a jet of helium gas generated by a hand-held device that moves particles into the target tissue, usually the skin.

The particles are preferably gold beads of 0.4-4.0 microns, more preferably 0.6-2.0 microns, coated with a DNA conjugate and then packaged in a cartridge or cartridge for placement in a "gene gun".

In a related embodiment, other devices and methods that may be useful for a gas-driven needleless injection of the compositions of the present invention include devices manufactured by Bioject, Inc. (Portland, OR), and some examples of such devices are described in US patent No. 4790824, 5064413, 5312335, 5383851, 5399163, 5520639 and 5993412.

Vectors that contain nucleotide sequences encoding antigenic peptides are administered in an amount that will be prophylactically or therapeutically effective. The amount to be administered is usually in the range from one picogram to 1 milligram, preferably from 1 picogram to 10 micrograms of nucleotide per dose for particle-mediated delivery, and from 100 nanograms to 1 milligram, preferably from 10 micrograms to 1 milligram of nucleotide dose for other routes. The exact amount can vary greatly depending on the weight of the patient to be immunized and the route of administration.

For an immunogenic component containing a nucleotide sequence encoding an antigenic peptide, single administration or repeated administration is possible, for example, from 1 to 7 times, preferably from 1 to 4 times, at intervals of about 1 day and about 18 months. However, this regimen will vary significantly depending on the size of the patient to be treated, the amount of nucleotide sequence introduced, the route of administration, and other factors that will be apparent to veterinarians or medical practitioners. A patient may receive one or more of the other HIV antiviral drugs as part of their general administration regimen. In addition, the nucleic acid immunogen can be administered with an adjuvant.

The adjuvant component described herein can be similarly administered by a number of different routes of administration, such as, for example, by the oral, intranasal, pulmonary, intramuscular, subcutaneous, intradermal or local routes. Preferably, the adjuvant component is administered via the intradermal or local routes. Most preferred local route. This administration can take place between about 14 days before administration and about 14 days after the introduction of the nucleotide sequence, preferably between about 1 days before administration and about 3 days after the introduction of the nucleotide sequence. The adjuvant component in the embodiment is administered substantially simultaneously with the introduction of the nucleotide sequence. By “substantially simultaneous” is meant that the introduction of the adjuvant component is preferably at the same time as the introduction of the nucleotide sequence, or, if not at the same time, then at least within a few hours in any direction from the introduction of the nucleotide sequence . In the most preferred administration protocol, the adjuvant component will be administered substantially simultaneously with the introduction of the nucleotide sequence. Obviously, this protocol can be varied, if necessary, in accordance with the type of variation described above. Advantageously, the adjuvant is a 1H-imidazo [4,5-c] quinolin-4-amine derivative, such as imichimod. Typically, an imichimod will be presented as a local preparation in the form of a cream, and it will be administered in accordance with the protocol described above.

Again, depending on such variations, the dose of administration of this derivative will also vary, but may, for example, be in the range between about 0.1 mg per kg to about 100 mg per kg, where “per kg” refers to the body weight of the mammal to be treated. This administration of the 1H-imidazo [4,5-c] quinolin-4-amine derivative should preferably be repeated with each subsequent or repeated introduction of the nucleotide sequence. Most preferably, the dosage will be between about 1 mg per kg and about 50 mg per kg. In the case of the scheme “primary vaccination - revaccination”, as described above, imichimod or another derivative of 1H-imidazo [4,5-c] quinolin-4-amine can be administered either with primary vaccination or with revaccination, or with primary vaccination, and with revaccination.

Although it is possible that the adjuvant component contains only 1H-imidazo [4,5-c] quinolin-4-amine derivatives as a crude chemical, it is preferred that it be in the form of a pharmaceutical preparation for administration. Thus, the adjuvant component will preferably contain 1H-imidazo [4,5-c] quinolin-4-amine combined with one or more pharmaceutically acceptable carriers and optionally other therapeutic ingredients. The carrier (s) must be “acceptable” in the sense that it must be compatible with other ingredients in the preparation and not be harmful to its recipient. The nature of these preparations will naturally vary in accordance with the intended route of administration, and they can be obtained by methods well known in the pharmaceutical field. All methods include the step of contacting the 1H-imidazo [4,5-c] quinolin-4-amine derivative with a suitable carrier or carriers. As a rule, these preparations are prepared by uniformly and closely bringing this derivative into contact with liquid carriers or finely divided solid carriers, or both, and then, if necessary, give this product the form of the desired preparation. Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; in the form of powder or granules; in the form of a solution or suspension in an aqueous liquid or in a non-aqueous liquid; or in the form of an oil-in-water liquid emulsion or a water-in-oil emulsion. The active ingredient may also be presented as a bolus, electuary or paste.

A tablet may be made by compression or molding, optionally with one or more than one auxiliary ingredient. Compressed tablets can be made by compressing in a suitable machine the active ingredient in a free-flowing form, such as a powder or granules, optionally mixed with a binding agent, a lubricant, an inert diluent, a lubricating, surface-active or dispersing agent. Molded tablets can be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.

The tablets may optionally be coated or labeled and may be formulated so as to provide a slow or controlled release of the active ingredient.

Preparations for injection using, for example, the intramuscular, intraperitoneal or subcutaneous route of administration include aqueous or non-aqueous sterile injectable solutions, which may contain antioxidants, buffers, bacteriostats and dissolved substances that make this drug isotonic with the blood of the intended recipient; and aqueous or non-aqueous sterile suspensions, which may include suspending agents and thickeners. These preparations can be presented in containers containing a single dose or multiple doses, for example, in sealed ampoules and vials, and they can be stored in a dry, frozen (lyophilized) state, requiring only the addition of a sterile liquid carrier, for example, water for injection, immediately before use . Injection solutions and suspensions, which are prepared immediately before use, can be made from sterile powders, granules and tablets of the type described above. Preparations suitable for pulmonary administration through a buccal or nasal cavity are presented in such a way that particles containing the active ingredient, preferably having a diameter in the range of 0.5 to 7 microns, are delivered to the recipient's bronchial tree. The possibilities for such preparations are such that they are in the form of finely divided powders, which can conveniently be presented either in the form of a punctured capsule, suitable material for which is, for example, gelatin, for use in an inhalation device, or alternatively in the form of a self-sprayed preparation containing active ingredient, suitable liquid propellant, and possibly other ingredients, such as a surfactant and / or solid diluent. Self-spraying formulations may also be used if the active ingredient is distributed in the form of droplets of a solution or suspension. Such self-spraying preparations are similar to those known in the art and can be made using developed techniques. They are suitably equipped with either a manual or automatically functioning valve having the desired atomization characteristics; preferably, this valve is a meter type valve, supplying a fixed volume, for example, from 50 to 100 μl for each operation with it.

At the next opportunity, the adjuvant component may be in the form of a solution for use in an aerosol inhaler or nebulizer, with which an accelerated air flow or ultrasonic excitation is used to obtain aerosol from small droplets for inhalation.

Formulations suitable for intranasal administration typically include forms similar to those described above for pulmonary administration, although for such formulations it is preferable to have a particle diameter in the range of from about 10 to about 200 microns to ensure retention in the nasal cavity. This can be achieved, respectively, by using a powder of particles of a suitable size or by choosing a suitable valve. Such suitable preparations include coarse powders having a particle diameter in the range of from about 20 to about 500 microns for administration by quick inhalation through the nasal passage from a container held near the nose, and nasal drops containing from about 0.2 to 5% wt. / wt. active ingredient in aqueous or oily solutions. In one embodiment of the invention, it is possible for a vector that contains a nucleotide sequence encoding an antigenic peptide to be administered in the same preparation as the 1H-imidazo [4,5-c] quinolin-4-amine derivative. Therefore, in this embodiment, the immunogenic and adjuvant component are in the same preparation.

In an embodiment, the adjuvant component is prepared in a form suitable for administration using a “gene gun”, and is administered by this route substantially simultaneously with the introduction of the nucleotide sequence. For the manufacture of preparations suitable for administration by this method, it may be necessary that the 1H-imidazo [4,5-c] quinolin-4-amine derivative be lyophilized and attached to the surface of, for example, gold granules that are suitable for administration using " the gene gun. " In an alternative embodiment, the adjuvant component may be administered as a dry powder by high pressure pushing of the gas.

Even if they are not included in the preparation together, it may be appropriate for the adjuvant component to be introduced at the same or approximately the same site of administration as the nucleotide sequence.

Other details about pharmaceutical preparations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania (1985), this description being incorporated herein in its entirety by reference.

Suitable techniques for administering a naked polynucleotide or vector to a patient also include topical administration with a suitable carrier. Nucleic acid can be administered topically to the skin or on the surface of the mucous membranes, for example, by intranasal, oral, intravaginal or intrarectal administration. A naked nucleotide or vector may be presented together with a pharmaceutically acceptable excipient, such as phosphate buffered saline (PBS). DNA uptake can be further enhanced by the use of adjuvants, such as bupivacaine (bupivacaine), either alone or included in the DNA preparation. Other methods for administering the nucleic acid directly to the recipient include ultrasonic, electrical stimulation, electroporation, and micropowing, which are described in US Pat. No. 5,697,901.

The capture of nucleic acid constructs can be enhanced using some well-known transfection techniques, such as those involving the use of transfection agents. Examples of these agents include cationic agents, for example calcium phosphate and DEAE-dextran, and lipofectants, for example lipofect and transfers. The dosage of the nucleic acid to be administered can be changed.

The nucleic acid sequence of the present invention can also be introduced through specialized delivery vectors used in gene therapy. Gene therapy approaches are discussed, for example, Verme et al., Nature 1997, 389: 239-242. Both viral and non-viral vector systems can be used. Viral-based systems include those based on retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, Canarypox, and vaccinia virus. Non-viral-based systems include direct nucleic acid administration, microsphere encapsulation techniques (poly (lactide-co-glycoside)), and liposome-based systems. Viral and non-viral delivery systems can be combined, where desired, to provide revaccination injections after the initial vaccination, for example, the initial “primary” DNA vaccination using a non-viral vector, such as plasmids, followed by one or more revaccinations using a viral vector or system on a non-viral basis. Similarly, the invention contemplates primary vaccination systems — revaccination with a polynucleotide of the invention followed by revaccination with a protein in an adjuvant, or vice versa.

The nucleic acid sequence of the present invention can also be introduced using transformed cells. Such cells include cells collected from a subject. A “naked” polynucleotide or vector of the present invention can be introduced into such cells in vitro, and then these transformed cells can be returned to the subject. The polynucleotide of the invention can integrate into a nucleic acid already in the cell through homologous recombination events. The transformed cell can, if desired, be grown in vitro, and one or more of the resulting cells can be used in accordance with the present invention. Cells can be introduced at a suitable patient site using known surgical or microsurgical techniques (e.g., transplantation, microinjection, etc.).

The pharmaceutical compositions of the present invention may include adjuvant compounds, as described in detail above, or other substances that can serve to enhance the immune response induced by a protein that is encoded by DNA. These proteins can be encoded by DNA, either individually or as a fusion with an antigen, or can be incorporated into the preparation as non-DNA elements. Examples of adjuvant-type substances that can be included in the preparations of the present invention include ubiquitin, liposome-associated membrane protein (LAMP), hepatitis B core antigen, FLT-3 ligand (cytokine, important in generating professional antigen-presenting cells, in particular dendritic cells) and other cytokines such as IFN-γ and GM-CSF. Other preferred adjuvants include imichimod and resimchimod, as well as tucarasol (Tucarasol). Imimohimod is particularly preferred.

The present invention, in preferred embodiments of the invention, provides the use of a nucleic acid molecule as described herein for the treatment or prevention of HIV infection. This nucleic acid molecule is preferably administered with an imichimod. The imichimod is preferably administered topically, while the nucleic acid molecule is preferably administered via a particle-mediated delivery.

Accordingly, the present invention provides a method of treating a subject suffering from or susceptible to HIV infection in which a nucleic acid molecule is introduced as described herein and imichimod.

Now the present invention will be illustrated with reference to the following examples.

EXAMPLES

Example 1: Optimization of p55 gag (p17, p24, p13) so that the use of codons is similar to human genes with high expression

Target gene

The assembly of a synthetic gene encoding the p55 gag antigen of HIV-1 isolate B strain HXB2 (GenBank entry K03455), optimized for expression in mammalian cells, was performed using overlapping oligonucleotides by PCR.

Optimization included changing the pattern of using codons of the viral gene to obtain a codon frequency closer to that found in human genes with high expression. Codons were evaluated using a Visual Basic statistical program called Syngene (a modern version of Calcgene written by R.S. Hale and G. Thompson, Protein Expression and Purification, Vol.12, pp. 185-188, 1998).

Cloning:

PCR product gag 1528 bp gel purified, restriction restriction with NotI and BamHI restriction endonucleases and ligated into Notl / BamHI restriction vector WRG7077. Thus, the gene was placed between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Clones were sequenced and checked for errors. No clone was 100% correct. Regions of the correct sequence of two clones, therefore, were combined using overlapping PCR using appropriate combinations of a series of optimization oligonucleotides to obtain a full-length codon-optimized gag gene. It was then determined that this final clone contains a single nucleotide deletion, which results in a reading frame shift and premature translation termination. This deletion was repaired by cutting out a region of a gene containing the wrong sequence and cloning it into the correct sequence of the equivalent region of another clone. Thus, a final p55 gag clone optimized for the codons: Gagoptrpr2 (see FIG. 2) was obtained.

Example 2: Preparation of p17 / p24 / truncated Nef fusion gene

Target gene

Plots of p17 and p24 of the p55 gag gene of origin of HIV-1 isolate B strain HXB2 were amplified by PCR from plasmid pHXB / Pr (B. Maschera, E. Furfine and E.D. Blair, 1995, J. Virol. 69, 5431-5436). PHXB / Pr 426 bp from the 3 'end of the nef gene, HXB2 was amplified from the same plasmid. Since the nef NHB2 gene contains a premature termination codon, two overlapping PCRs (TGA [stop codon] on TGG [Trp]) were used to repair this codon.

The PCR products of the p17 / p24 linker and the trNEF linker were combined to form a fusion gene (FIG. 3) in a PCR reaction (antisense).

PCR Product 1542 bp gel purified, restriction restriction with NotI and BamHI restriction endonucleases and cloned into the NotI and BamHI sites of the WRG7077 vector. Thus, the gene was placed between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 3: Preparation of the Gag p17 / 24opt / trNef1 fusion gene ('Gagopt / Nef)

Target gene

Plot p17 / p24 codon-optimized for the p55 gag gene of origin of HIV-1 isolate B strain HXB2 was amplified by PCR from plasmid pGagoptTrpr2. The truncated Nef HXB2 gene with the repaired premature termination codon (TGA [stop codon] on TGG [Trp]) was amplified by PCR from plasmid 7077trNef20. These two PCR products had to have overlapping ends so that the two genes could be combined in the second PCR.

PCR Product 1544 bp gel purified, restriction restriction with NotI and BamHI restriction endonucleases and cloned (see FIGS. 3-4) into NotI and BamHI sites of WRG7077 vector. Thus, the gene was placed between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 4: Plasmid p7077-RT3 clone # A

The synthetic gene encoding the RT region of the pol gene HIV-1 isolate B strain HXB2 was optimized for expression in mammalian cells by assembly using overlapping oligonucleotides by PCR. This cloned sequence is equivalent to positions 2550-4222 of the HXB2 comparison sequence (GenBank entry K03455). To ensure expression, this cloned sequence has two additional codons at the 5 ′ end that are absent in the original gene — AUG GGC (Met Gly).

Optimization included changing the pattern of using codons of the viral gene to obtain a codon frequency closer to that found in human genes with high expression, excluding rarely used codons. Codons were evaluated using a Visual Basic statistical program called Syngene (a modern version of Calcgene written by R.S. Hale and G. Thompson, Protein Expression and Purification, Vol. 12, pp. 185-188, 1998).

The final clone was constructed from two intermediate clones, # 16 and # 21.

Cloning

PCR products 1.7 kb gel purified, NotI and BamHI restricted and PCR purified, then ligated to Notl / BamHI restricted pWRG7077. Thus, the gene was placed between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal. The clones were sequenced. No clone was 100% correct, but clone # 16 was corrected by replacing the 403 bp KpnI-BamHI fragment containing 3 errors with the correct KpnI-BamHI fragment from clone # 21. The final clone was verified by sequencing (see FIG. 5).

Example 5: Optimized RT

Target gene

A synthetic gene encoding the RT region of the HIV-1 pol gene isolate B strain HXB2, optimized for expression in mammalian cells, was excised from plasmid p7077-RT3 as a 1697 bp Notl / BamHI fragment, gel purified and cloned into NotI sites and BamHI p7313-ie (derived from pspC31) to place this gene downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal (R7004 p27) (FIG. 6).

Example 6

Plasmid: 7077 trNef20

Target gene

The insert contains a portion of the Nef gene from HIV-1 isolate B strain HXB2. 195 bp deleted from the 5'end of this gene, removing codons for the first 65 amino acids of Nef. In addition, the premature termination codon in the published nef HXB2 sequence was repaired (TAG on TGG [Trp]) as described for plasmid p17 / 24trNEF1. This shortened nef sequence was amplified by PCR from plasmid p17 / 24trNef1. This cloned sequence is equivalent to provisions 8992-9417 of the HXB2 comparison sequence (GenBank entry K03455). To ensure expression, this cloned sequence has an additional codon at the 5'end that is absent in the original gene, AUG (Met).

Primers:

StrNef (semantic)

ATAAGAATGCGGCCGCCATGGTGGGTTTTCCAGTCACACCTT [SEQ ID NO: 1]

AstrNef (antisense)

CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 2]

PCR: 94 ° C for 2 min, then 25 cycles: 94 ° C for 30 sec, 50 ° C for 30 sec, 72 ° C for 2 min, end 72 ° C for 5 min.

Cloning:

PCR product RT 455 bp gel purified, restriction restriction with Notl and BamHI restriction endonucleases and ligated into the Notl / BamHI restriction vector WRG7077. Thus, the gene was placed between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 7

Plasmid: 7077RT 8

Target gene

The RT region of the pol gene is derived from HIV-1 isolate B strain HXB2. This plot was amplified by PCR from plasmid p7077pol14. The cloned sequence is equivalent to positions 2550-4234 of the HXB2 comparison sequence (GenBank entry K03455). To ensure expression, this cloned sequence has two additional codons at the 5 ′ end that are absent in the original gene — AUG GGC (Met Gly).

Primers:

SRT (semantic)

ATAAGAATGCGGCCGCCATGGGCCCCATTAGCCCTATTGAGACT [SEQ ID NO: 3]

ASRT (Antisense)

CGCGGATCCTTAATCTAAAAATAGTACTTTCCTGATT [SEQ ID NO: 4]

PCR: 94 ° C for 2 min, then 25 cycles: 94 ° C for 30 sec, 50 ° C for 30 sec, 72 ° C for 4 min, end 72 ° C for 5 min.

Cloning:

PCR product RT 1720 bp gel purified, restriction restriction with NotI and BamHI restriction endonucleases and ligated into NotR / BamHI restriction vector WRG7077. Thus, the gene was placed between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 8

p17 / 24opt / RT / trNef1 ('Gagopt / RT / Nef')

PCR is included in this construct, which causes an amino acid substitution of R for N.

Target gene

Plot p17 / p24 codon-optimized for the p55 gag gene of origin of HIV-1 isolate B strain HXB2 was amplified by PCR from plasmid pGagoptTrpr2. The RT coding sequence was amplified from plasmid 7077RT 8. The truncated Nef HXB2 gene with the repaired premature termination codon (TGA [stop codon] on TGG [Trp]) was amplified by PCR from plasmid 7077trNef20. These three PCR products had to have overlapping ends so that the three genes could be combined in the second PCR.

Primers:

(P17 / 24)

Sp17p24opt (semantic)

ATAAGAATGCGGCCGCCATGGGTGCCCGAGCTTCGGT [SEQ ID NO: 5]

Asp14p24optRT linker (antisense)

TGGGGCCCATCAACACTCTGGCTTTGTGTC [SEQ ID NO: 6]

PCR: 94 ° C for 1 min, then 20 cycles: 94 ° C for 30 sec, 50 ° C for 30 sec, 72 ° C for 2 min, end 72 ° C for 4 min.

PCR product p17 / 24opt 1114 bp gel purified.

(RT)

Sp17p24optRT linker (semantic)

CAGAGTGTTGATGGGCCCCATTAGCCCTAT [SEQ ID NO: 7]

ASRTtrNef Linker (Antisense)

AACCCACCATATCTAAAAATAGTACTTTCC [SEQ ID NO: 8]

PCR: as described above.

PCR product RT 1711 bp gel purified.

(5 'shortened nef)

SRTtrNef Linker (semantic)

CTATTTTTAGATATGGTGGGTTTTCCAGTCAC [SEQ ID NO: 9]

AstrNef (antisense)

CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 10]

PCR: as described above.

PCR Product 448 bp gel purified.

Then, these three PCR products were crosslinked in the second PCR with Sp17 / 24opt and AstrNef primers.

PCR: 94 ° C for 1 min, then 30 cycles: 94 ° C for 30 sec, 50 ° C for 30 sec, 72 ° C for 4 min, end 72 ° C for 4 min.

PCR Product 3253 bp gel purified, restriction restriction with NotI and BamHI restriction endonucleases and cloned into the NotI and BamHI sites of the WRG7077 vector. Thus, the gene was placed between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 9

Plasmid: pGRN # 16 (p17 / p24opt corr / RT / trNef)

Target Gene:

It was observed that the polyprotein generated by p17 / 24opt / RT / Nef13 ('Gagopt / RT / Nef') expresses a truncated product of ~ 30 kDa due to a cluster of unfavorable codons inside p24 around amino acid 270. These codons were replaced by optimal codons using cross-linking PCR mutagenesis . P17 / 24opt / RT / trNef13 was used as a matrix to amplify the Gag 5 ′ region prior to mutation with Sp17 / p24opt and GTR-A primers and the Gag 3 ′ region prior to mutation with GTR-S primers and Asp17 / p24optRT linker. Overlapping products containing codon substitutions and gel-purified products were crosslinked using the Sp17 / p24opt and Asp17 / p24optRT linker primers. This product was subjected to restriction with NotI and Agel and inserted into similarly resected p17 / 24opt / RT / trNef13 to form pGRN. Clone # 16 was checked and propagated.

Primers:

5 'PCR:

Sp17p24opt (semantic)

ATAAGAATGCGGCCGCCATGGGTGCCCGAGCTTCGGT [SEQ ID NO: 11]

GTR-A (antisense)

GCGCACGATCTTGTTCAGGCCCAGGATGATCCACCGTTTATAGATTTCTCC [SEQ ID NO: 12]

3 'PCR:

Semantic: GTR-S (semantic)

ATCCTGGGCCTGAACAAGATCGTGCGCATGTACTCTCCGACATCCATCC [SEQ ID NO: 13]

Asp17 / p24optRT linker (antisense)

TGGGGCCCATCAACACTCTGGCTTTGTGTC [SEQ ID NO: 14]

PCR conditions for individual products and crosslinking using PWO DNA polymerase (Roche):

95 ° C for 1 min, then 20 cycles of 95 ° C 30 s, 55 ° C 30 s, 72 ° C 180 s, end 72 ° C 120 s and storage 4 ° C.

Product 1114 bp gel purified and NotI and Agel restricted to release a 6647 bp fragment, which was gel purified and ligated into restricted Notl / Agel and gel purified p17 / 24opt / RT / trNef13 to form pGRN # 16.

Example 10

Plasmid: p73i-GRN2 clone # 19 (p17 / p24 (opt) / RT (opt) trNef) - repaired

Target Gene:

Plot optimized for gag codons p17 / p24, optimized for RT codons, and truncated nef gene from HIV-1 isolate B strain HXB2 downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

Plasmids containing the trNef gene, derived from the plasmid p17 / 24trNef1, contain a PCR error, which leads to the amino acid replacement of R with H of the 19th amino acid from the end of nef. This error was corrected by PCR mutagenesis, the corrected nef PCR product was crosslinked with RT codons optimized from p7077-RT3, and the crosslinked fragment was subjected to restriction with Apal and BamHI and cloned into restricted Apal / BamHI p73i-GRN.

Primers:

CoRT PCR from p7077-RT3 using primers:

(polymerase = PWO (Roche) everywhere).

Semantic: U1

GAATTCGCGGCCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCGGGAT [SEQ ID NO: 15]

AscoRT-Nef

GGTGTGACTGGAAAACCCACCATCAGCACCTTTCTAATCCCCGC [SEQ ID NO: 16]

Cycle: 95 ° C (30 s), then 20 cycles 95 ° C (30 s), 55 ° C (30 s), 72 ° C (180 s), then 72 ° C (120 s) and storage at 4 ° FROM.

PCR product 1.7 kb gel purified.

PCR 5 'Nef from p17 / 24trNef1 using primers:

Semantic: S-Nef

ATGGTGGGTTTTCCAGTCACACC [SEQ ID NO: 17]

Antisense: ASNef-G:

GATGAAATGCTAGGCGGCTGTCAAACCTC [SEQ ID NO: 18]

Cycle: 95 ° C (30 s), then 15 cycles 95 ° C (30 s), 55 ° C (30 s), 72 ° C (60 s), then 72 ° C (120 s) and storage at 4 ° FROM.

PCR 3 'Nef from p17 / 24trNef1 using primers:

Semantic: SNEF-G

GAGGTTTGACAGCC G CCTAGCATTTCATC [SEQ ID NO: 19]

Antisense:

AStrNef (antisense)

CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 20]

Cycle: 95 ° C (30 s), then 15 cycles 95 ° C (30 s), 55 ° C (30 s), 72 ° C (60 s), then 72 ° C (120 s) and storage at 4 ° FROM.

PCR products were gel purified. First, two Nef products were crosslinked using primers 5 ′ (S-Nef) and 3 ′ (AstrNef).

Cycle: 95 ° C (30 s), then 15 cycles 95 ° C (30 s), 55 ° C (30 s), 72 ° C (60 s), then 72 ° C (180 s) and storage at 4 ° FROM.

The PCR product was purified by PCR and crosslinked with the RT product using primers U1 and AstrNef:

Cycle: 95 ° C (30 s), then 20 cycles 95 ° C (30 s), 55 ° C (30 s), 72 ° C (180 s), then 72 ° C (180 s) and storage at 4 ° C.

Product 2.1 kb gel purified and restricted with Apal and BamHI. Plasmid p73i-GRN was also digested with Apal and BamHI, gel purified and ligated with Apal-BamHI RT3trNef to restore the p17 / p24 (opt) / RT (opt) trNef gene.

Example 11

p73i-GN2 clone # 2 (p17 / p24opt / trNef) - repaired

Target Gene:

Plot p17 / p24 of codon-optimized gag gene and truncated Nef gene from HIV-1 isolate B strain HXB2 downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

Plasmids containing the trNef gene, derived from the plasmid p17 / 24trNef1, contain a PCR error, which leads to the amino acid replacement of R with H of the 19th amino acid from the end of nef. This error was corrected by PCR mutagenesis, and the corrected fragment was subjected to BglII and BamHI restriction and cloned into restricted BglII / BamHI p73i-GN (Fig. 12). The corrected p17 / p24opt / trNef fusion gene was restored downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

PCR 5 'Nef from p17 / 24trNef1 using primers:

(polymerase = PWO (Roche) everywhere)

Semantic: S-Nef

ATGGTGGGTTTTTCCAGTCACACC [SEQ ID NO: 21]

Antisense: ASNef-G:

GATGAAATGCTAGG C GGCTGTCAAACCTC [SEQ ID NO: 22]

Cycle: 95 ° C (30 s), then 15 cycles 95 ° C (30 s), 55 ° C (30 s), 72 ° C (60 s), then 72 ° C (120 s) and storage at 4 ° FROM.

PCR 5 'Nef from p17 / 24trNef1 using primers:

Semantic: SNEF-G

GAGGTTTGACAGCC G CCTAGCATTTCATC [SEQ ID NO: 23]

Antisense: AStrNef

CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO.-24]

Cycle: 95 ° C (30 s), then 15 cycles 95 ° C (30 s), 55 ° C (30 s), 72 ° C (60 s), then 72 ° C (120 s) and storage at 4 ° FROM.

PCR products were gel purified and crosslinked using primers 5 ′ (S-Nef) and 3 ′ (AstrNef).

Cycle: 95 ° C (30 s), then 15 cycles 95 ° C (30 s), 55 ° C (30 s), 72 ° C (60 s), then 72 ° C (180 s) and storage at 4 ° FROM.

The PCR product was purified by PCR, subjected to restriction with BglII / BamHI and a 367 bp fragment. gel purified and cloned into restricted BglII / BamHI gel purified p73i-GN.

Example 12

Plasmid: p73i-RT w229k (inactivated RT)

Target Gene:

Construction of the inactivated RT gene downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

Due to concerns about the use of active HIV RT species in a therapeutic vaccine, inactivation of this gene was desirable. This inactivation was achieved by RT PCR mutagenesis (derived from p73i-GRN2) of amino acid position 229 from Trp to Lys (R7271 p1-28).

Primers:

PCR 5 'RT + mutation using primers:

(polymerase = PWO (Roche) everywhere)

Semantic: RT3-u: 1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCGGGAT [SEQ ID NO: 25]

Antisense: AscoRT-Trp229Lys

GGAGCTCGTAGCCCATCTTCAGGAATGGCGGCTCCTTCT [SEQ ID NO: 26]

Cycle:

1 × [94 ° C (30 s)]

15 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (60 s)]

1 × [72 ° C (180 s)]

PCR gel purification

PCR 3 'RT + mutation using primers:

Antisense: RT3-L: 1

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTGCTCGTTGCCGC [SEQ ID NO: 27]

Semantic: ScoRT-Trp229Lys

CCTGAAGATGGGCTACGAGCTCCATG [SEQ ID NO: 28]

Cycle:

1 × [94 ° C (30 s)]

15 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (60 s)]

1 × [72 ° C (180 s)]

PCR gel purification

PCR products were gel purified and the 5 'and 3' ends of the RTs were crosslinked using primers 5 '(RT3-U1) and 3' (RT3-L1).

Cycle:

1 × [94 ° C (30 s)]

15 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (120 s)]

1 × [72 ° C (180 s)]

The PCR product was gel purified and cloned into p7313ie using NotI and BamHI restriction sites to form p73i-RT w229k [see Fig.13].

Example 13

Plasmid: p73i-Tgrn (# 3)

Target Gene:

Plot optimized for gag codons p17 / p24, optimized for RT codons, and truncated nef gene from HIV-1 isolate B strain HXB2 downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

Triple fusion constructs that contain an active form of RT may not be acceptable by law for human use, so RT inactivation was achieved by inserting a fragment cut out by Nhel and Apal from p73i-RT w229k into Nhel / Apal restriction p73i-GRN2 # 19 (FIG. .fourteen). The result was a replacement W → K at position 229 in RT.

Example 14

P73i-Tnrg (# 16)

Target Gene:

The truncated Nef, inactivated RT codon optimized and p17 / p24 region of the gag codon optimized HIV-1 isolate B strain HXB2 downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

The order of the genes in the polyprotein encoded by p73i-Tgrn was rearranged by PCR and PCR cross-linking to form p73i-Tnrg (Fig. 15). Each gene was amplified by PCR and gel purified, after which these genes were crosslinked by PCR to form a single polyprotein. This product was gel purified, digested with Notl / BamHI and ligated into Notl / BamHI restriction p7313ie.

Primers:

TrNef PCR

S-Nef (NotI)

CATTAGAGCGGCCGCGATGGTGGGTTTTCCAC [SEQ ID NO: 29]

AS-Nef-coRT Linker

GATGGGACTGATGGGGCCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 30]

RTw229k PCR

S-coRT

ATGGGCCCCATCAGTCCCATCGAG [SEQ ID NO: 31]

AS-coRT-p17p24 linker

CAGTACCGAAGCTCGGGCACCCATCAGCACCTTTCTAATCCCCGC [SEQ ID NO: 32]

P17p24opt PCR

S-p17p24opt

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 33]

AS-p17p24opt (BamHI)

GATGGGGGATCCTCACAACACTCTGGCTTTGTGTCC [SEQ ID NO: 34]

PCR conditions for individual products and cross-linking using VENT DNA polymerase (NEB):

1 × [94 ° C (30 s)]

25 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (120 s [p17p24 or RT] or 60 s [trNef])]

1 × [72 ° C (240 s)]

PCR products were gel purified and used in PCR crosslinking using S-trNef (NotI) and AS-p17p24opt (BamHI) primers:

1 × [94 ° C (30 s)]

25 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (210 s)]

1 × [72 ° C (240 s)]

Product 3000 bp gel purified and NotI and BamHI restricted and this fragment was purified by PCR and ligated into hydrolyzed Notl / BamHI and gel purified p7313ie to form p73i-Tnrg.

Example 15:

1. Plasmid: p73i-Tngr (# 3)

Target gene

Shortened Nef, region p17 / p24 of the gag codon optimized codon and inactivated RT codon optimized from HIV-1 isolate B strain HXB2 downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

The order of the genes in the polyprotein encoded by p73i-Tgrn was rearranged by PCR and PCR cross-linking to form p73i-Tngr (Fig. 16). The c17-optimized p17 / p24 and RT codons were designed as a single product and crosslinked by PCR with amplified trNef. This product was gel purified, digested with Notl / BamHI and ligated into Notl / BamHI restriction p7313ie.

Primers:

P17 / p24-RT3 'PCR

Sp17p24opt (semantic)

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 35]

RT3 L: 1 (antisense)

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTGCTCGTTGCCGC [SEQ ID NO: 36]

TrNef5 'PCR

S-Nef (NotI)

CATTAGAGCGGCCGCGATGGTGGGTTTTCCAC [SEQ ID NO: 37]

AS-Nef-p17p24

CAGTACCGAAGCTCGGGCACCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 38]

PCR conditions for individual products and crosslinking using VENT DNA polymerase (NEB):

1 × [94 ° C (30 s)]

25 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (180 s [p17p24 + RT], or 60 s [trNef], or 210 s [crosslinking)]

1 × [72 ° C (240 s)]

PCR product 3000 bp gel purified and NotI and BamHI restricted, and this fragment was purified by PCR and ligated into hydrolyzed Notl / BamHl and gel purified p7313ie to form p73i-Tngr.

Example 16:

Plasmid: p73i-Trgn (# 6)

Target gene

Inactivated RT codon-optimized region, p17 / p24 region of the gag codon-optimized gag codon and shortened Nef gene from HIV-1 isolate B strain HXB2 downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

The gene order in this construct was achieved by PCR amplification of p17p24-trNef and RTw229k from plasmids p73i-GN2 and p73i-RTw229k, respectively. PCR crosslinking was performed and the product was gel purified and Notl / BamHl was digested, followed by ligation with hydrolyzed Notl / BamHl p7313ie. Sequencing revealed that p17p24 was not fully optimized. Then a fragment of 700 bp Agel / Munl was excised from the coding region and replaced with a MunI / Agel fragment from p73i-Tgrn # 3 containing the correct coding sequence (see FIG. 17).

Primers:

P17p24-trNef PCR

S-p17p24opt

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID No: 39]

AstrNef (BamHI)

RTw229k

RT3-U: 1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCGGGAT [SEQ ID NO: 40]

AS-coRT-p17p24opt linker

CAGTACCGAAGCTCGGGCACCCATCAGCACCTTTCTAATCCCCGC [SEQ ID NO: 41]

PCR conditions for individual products and crosslinking using VENT DNA polymerase (NEB):

1 × [94 ° C (30 s)]

25 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (120 s (PCR) or 180 s (crosslinking)]

1 × [72 ° C (240 s)]

PCR Crosslinking Product 3000 bp gel purified and NotI and BamHI restricted and this fragment was purified by PCR and ligated into hydrolyzed NotI / BamHI and gel purified p7313ie to form p73i-Tngr. Sequence analysis showed that the p17p24 sequence obtained from p73i-GN2 was not fully codon-optimized, and that this sequence was transferred to a new plasmid. This sequence was purified by cutting out a 700 bp fragment. from p73i-Tngr Munl and Agel and replacing it with 700 bp Munl / Agel enzymatic hydrolysis product from p73i-Tgrn to form the p73i-Tngr # 6 construct.

Example 17:

Plasmid: p73i-Trng (# 11)

Target gene

Inactivated RT codon-optimized, truncated Nef and region p17 / p24 optimized for codons of the gag gene and from HIV-1 isolate B strain HXB2 downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

The gene order in this construct was achieved by PCR amplification of the RT-trNef and p17p24 genes from p73i-Tgrn. PCR crosslinking of two DNA fragments and a product of 3 kb were performed. gel purified and NotI / BamHI was digested, followed by ligation with hydrolyzed NotI / BamHI p7313ie to give p73i-Trng (# 11).

Primers:

RTw229k-trNef

RT3-U: 1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCGGGAT [SEQ ID NO: 42]

AS-Nef-p17p24opt linker

CAGTACCGAAGCTCGGGCACCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 43]

P17p24

S-p17p24opt

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 44]

AS-p17p24opt (BamHI)

GATGGGGGATCCTCACAACACTCTGGCTTTGTGTCC [SEQ ID NO: 45]

PCR conditions for individual products and crosslinking using VENT DNA polymerase (NEB):

1 × [94 ° C (30 s)]

25 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (120 s (PCR gene) or 180 s (crosslinking)]

1 × [72 ° C (240 s)]

PCR crosslinking product of 3000 bp gel purified and NotI and BamHI restricted and this fragment was purified by PCR and ligated into hydrolyzed Notl / BamHI and gel purified p7313ie to form p73i-Tngr.

Example 18:

p73i-tgnr (# f1)

Target gene

Plot p17 / p24 of gag codon-optimized, shortened Nef and inactivated codon-optimized RT gene and from HIV-1 isolate B strain HXB2 downstream of the short promoter HCMV + exon 1 and upstream of the rabbit β-globin polyadenylation signal.

The gene order in this construct was achieved by PCR amplification of p17p24-trNef and RTw229k from plasmids p73i-GN2 and p73i-RTw229k, respectively. PCR crosslinking was performed and the product was gel purified and Notl / BamHI was digested, followed by ligation with hydrolyzed Notl / BamHI p7313ie. Two sequence errors localized in the sequence (p17p24 and RT) were sequentially repaired by replacing the correct portions of these genes using restriction sites within the polyprotein (see FIG. 19).

Primers:

P17p24-trNef PCR

S-p17p24opt

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 46]

AS-Nef-coRT Linker

GATGGGACTGATGGGGCCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 47]

RTw229k

S-coRT

ATGGGCCCCATCAGTCCCATCGAG [SEQ ID NO: 48]

RT3-L: 1

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTGCTCGTTGCCGC [SEQ ID NO: 49]

PCR conditions for individual products and crosslinking using VENT DNA polymerase (NEB):

1 × [94 ° C (30 s)]

25 × [94 ° C (30 s) / 55 ° C (30 s) / 72 ° C (120 s (PCR) or 180 s (crosslinking)]

1 × [72 ° C (240 s)]

PCR Crosslinking Product 3000 bp gel purified and NotI and BamHI restricted and this fragment was purified by PCR and ligated into hydrolyzed Notl / BamHI and gel purified p7313ie to form p73i-Tngr. Sequencing revealed that p17p24 was not fully optimized, and therefore the fragment 700 p. Agel / Munl was excised from the coding region and replaced with a Munl / Agel fragment from p73i-Tgrn # 3 containing the correct coding sequence. The polyprotein also contained a single point mutation (G2609A), resulting in the amino acid replacement of Th2 with Ala in the RT region of the polyprotein. This mutation was corrected by enzymatic hydrolysis of the Apal / BamHI construct and purification by PCR to remove the mutated sequence, which was replaced by ligation with the hydrolyzed Apal / BamHI region of RT from p73i-Tgnr.

Example 19:

Obtaining plasmid-coated "golden suspension" for DNA cartridges "gene gun"

Plasmid DNA (approximately 1 μg / μl), approximately 100 μg, and 2 μm gold particles, approximately 50 mg (PowderJect), were suspended in 0.05 M spermidine, approximately 100 μl (Sigma). DNA was precipitated on gold particles by adding 1 M CaCl ₂ , approximately 100 μl (American Pharmaceutical Partners, Inc., USA). The DNA / gold complex was incubated for 10 minutes at room temperature, washed 3 times in absolute ethanol, about 3 × 1 ml (pre-dried on a 3Å molecular sieve (BDH)). Samples were resuspended in absolute ethanol containing 0.05 mg / ml polyvinylpyrrolidone (PVP, Sigma) and divided into three equal aliquots in 1.5 ml microcentrifuge tubes (Eppendorf). These aliquots are intended to analyze (a) the “gold suspension”, (b) the eluate — a plasmid eluted from (a) and (b) to obtain Tefzel plasmid / gold coated “gene gun” cartridges (see Example 3 below). To obtain samples (a) and (b), tubes containing plasmid DNA / gold suspension in ethanol / PVP were centrifuged for 2 minutes at maximum speed in an Eppendorf 5418 microcentrifuge, the supernatant was removed, and the gold suspension was dried for 10 minutes at room temperature. Sample (a) was resuspended to 0.5-1.0 μg / μl of plasmid DNA in TE pH 8.0, allowing approximately 50% coverage. For elution, sample (b) was resuspended to 0.5-1.0 μg / μl of plasmid DNA in TE pH 8.0 and incubated at 37 ° C for 30 minutes, shaking vigorously, and then centrifuged for 2 minutes at maximum speed in an Eppendorf 5418 microcentrifuge, and the supernatant, eluate, was separated and stored at -20 ° C. The exact concentration of eluted DNA was determined by spectrophotometric quantification using Genequant II (Pharmacia Biotech).

Example 20:

DNA Immunization Cartridge Preparations

The preparation of cartridge preparations for the Accell gene transfer device was carried out as previously described (Eisenbraun et al DNA and Cell Biology, 1993, Vol 12, No. 9, pp.791-797; Pertner et al). Briefly, plasmid DNA was coated with 2 μm gold particles (DeGussa Corp., South Plainfield, NJ, USA) and loaded into Tefzel tubes, which were then cut into lengths of 1.27 cm that served as cartridges, and they were stored in a desiccator at 4 ° C until use. In typical vaccinations, each cartridge contained 0.5 mg of gold plated with 0.5 μg of total DNA / cartridge.

Example 21:

Immune response to HIV antigens after DNA vaccination using a gene gun

Mice (n = 3 / group) were vaccinated with antigens encoded by nucleic acid and localized in two vectors. P7077 used the IE HCMV promoter, including intron A and exon 1 (fcmv promoter). P73i delivers the same antigen but contains the HCMV IE promoter (icmv promoter), which lacks intron A but includes exon 1.

The plasmid was delivered to the shaved area of the abdominal skin that is the target of F1 mice (C3H × Balb / c). Mice were given primary immunization with 2 × 0.5 μg DNA on day 0, 2 × 0.5 μg DNA on day 35 were revaccinated, and the cell response on day 40 was determined using IFN gamma ELIspot analysis.

- P73I - blank vector

- P7077 - blank vector

- p7077 GRN - (promoter f CMV) Gag, RT, Net

- P73I GRN - (i CMV promoter) Gag, RT, Net

- P73I GR3N - (CMV promoter) Gag optimized, RT optimized, Nef

- P7077 GN - (f CMV promoter) Gag, Nef

- P73I GN - (i CMV promoter) Gag, Nef

Cytotoxic T-cell responses

The cytotoxic T-cell response was evaluated based on the limited T-cell CD8 + analysis of ELIspot IFN-γ splenocytes collected after 5 days. Mice were sacrificed by cervical dislocation and spleens were collected in FSB chilled in ice. Splenocytes were prepared in phosphate-buffered saline (PBS), followed by lysis of red blood cells (1 minute in a buffer consisting of 155 mM NH ₄ Cl, 10 mM KHCO ₃ , 0.1 mM EDTA). After two washes in PBS to remove solid particles, the homogeneous cell suspension was aliquoted into ELISPOT plates previously coated with IFN-γ capture antibody and stimulated with the corresponding peptide limited to CD8 (Gag, Nef or RT). After overnight cultivation, IFN-γ producing cells were visualized by applying anti-mouse IFN-γ antibody labeled with Biotin (Pharmingen) and then streptavidin-conjugated alkaline phosphatase, and quantified using image analysis.

The results of this experiment are presented in FIGS. 20, 21 and 22.

Example 22:

Immunogenicity of vaccine constructs

1. Cellular assays

The cellular immune response includes CD8 cytotoxic cells and CD4 helper cells. A sensitive way to detect specific CD8 and CD4 cells is an ELISPOT assay, which can be used to quantify the number of cells that can secrete interferon-γ or IL-2. ELISPOT analysis is based on the capture of cytokines secreted from individual cells. Briefly, specialized microtiter plates are coated with anti-cytokine antibodies. Splenocytes isolated from immunized animals are incubated overnight in the presence of specific peptides representing known epitopes (CD8) or proteins (CD4). If cells are stimulated to release cytokines, they will bind to antibodies on the surface of the tablet, surrounded by locally individual producing cells. Cytokines remain attached to the antibody coating after lysis of the cells, and then the plates are washed. This assay is performed in the same manner as an ELISA assay (enzyme-linked immunosorbent assay) using a biotin / avidin amplification system. The number of spots is equal to the number of cells producing cytokines.

CD8 responses to the following K2 ^d- restricted mouse epitopes: Gag (AMQMLKETI), Nef (MTYKAAVDL) and RT (YYDPSKDLI), and CD4 responses to Gag and RT proteins were recorded for all 6 constructs. The results of these analyzes were analyzed statistically, and the constructs were evaluated according to their immunogenicity. The result is shown in FIG.

2. Humoral tests

Blood samples were collected for analysis on antibodies on days 7 and 14 after revaccination from two experiments. Serum was separated and stored frozen until antibody titer was measured using specific ELISA assays. All samples were tested for antibodies to Gag, Nef and RT. Briefly, ELISA plates were coated with the corresponding protein. Excess protein was washed, after which serum samples were diluted and incubated in tablets. Serum samples were washed and the anti-mouse antiserum was conjugated to a suitable label. The tablet was developed and read on a tablet reader. The results are presented in Fig.24.

3. Antibody data

Antibody titers were measured for all six constructs in four experiments. The p73i-GNR construct did not constantly produce antibody responses to Gag and gave limited antibody responses to Nef. The reason for this is unclear, since T-cell responses were observed from splenocytes isolated from the same mice, which indicated the expression of the Gag protein in vivo.

The ranking of the formation of specific Gag antibodies was:

RHG> GRN> NRG> RGN> NGR> GNR

Cell immunology data analysis

The task was to rank 6 constructs based on spot count data as a result of 3 immunological experiments. Three series of responses were evaluated:

CD8 responses to Gag, Nef and RT on day 7 (7 days after primary immunization)

CD4 responses to Gag and RT on day 35 (7 days after revaccination)

CD8 responses to Gag, Nef, and RT on day 35 (7 days after booster)

Each response (e.g., CD8 response to Gag) was modeled using a linear mixed-effect model in SAS version 8. The model included fixed design effects, a specific antigen (Gag, Nef, or RT) is present or absent and IL-2 is present or absent. In addition, for CD8 responses, where data were available from each individual mouse, the subject was included as a random effect in the model. The model included interrelated parameters that allowed us to differentiate the design effect for each combination of antigens (presence / absence) and IL-2 (presence / absence).

Based on this model, the difference in the adjusted average response between each construct and p7313 (control group) was evaluated separately for each combination of antigens (presence / absence) and IL-2 (presence / absence) together with a p-value indicating the statistical significance of this difference . Based on the differences and p-values in the presence of antigen and in the absence of IL-2, the structures were ranked, designating with a score of 6 the structure with the largest difference, 5 with the next largest, etc., but 0 for any structures where the difference was not statistically significant at 5% level.

The assumptions of this model - that the residues were distributed in accordance with the normal distribution with a constant variant, were estimated using graphical methods and sensitivity analyzes, where, firstly, the logarithmic transformation and, secondly, the square root of the answer were modeled. The ranking of the structures was not sensitive to deviations from the assumptions of the model.

After calculating the ranking for each answer in each experiment separately, the total ranking for 3 series of answers was calculated for all three experiments. The table below shows the total ranking for all three experiments.

The total ranking of constructs for each of the 3 series of responses combined for all 3 immunological experiments

Design Day 7 (7 days after primary immunization) Day 35 (7 days after revaccination) Cd8 Cd4 Cd8 GRN 5 eighteen 3 GNR 17 24 28 RGN 28 23 33 Rng 25 27 37 Nrg 25 19 0 NGR four fourteen 10

RNG has the highest rate for both series of responses on day 35 and the second highest rate after RGN on day 7. RGN also shows high rates for both series of responses on day 35.

Claims (16)

1. The nucleotide sequence that encodes the gag protein HIV-1 (HIV-1) or its fragment containing the gag epitope, Nef HIV-1 protein or its fragment containing the nef epitope, RT protein or its fragment containing the RT epitope, operably linked with a heterologous promoter, the gag sequence being optimized for codons such that the use of codons is similar to that of a human gene with high expression with an RSCU value of 0.5, wherein said nucleotide sequence is selected from SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83. 2. The nucleotide sequence according to claim 1 for use in medicine. 3. Vector, nucleotide sequence contents according to claim 1. 4. The vector according to claim 3, which is a viral vector. 5. The viral vector according to claim 4, which is an adenovirus that is replication defective. 6. The vector according to claim 3, which is a plasmid from double-stranded DNA. 7. Vector according to any one of claims 3 to 6 for use in medicine. 8. The protein for the treatment and / or prevention of HIV infection and AIDS, encoded by the nucleotide sequence according to claim 1. 9. A pharmaceutical composition for treating and / or preventing HIV infection and AIDS, comprising the nucleotide sequence of claim 1 or the vector of claims 3-5 or 6 and a pharmaceutically acceptable excipient, diluent, carrier or adjuvant. 10. The pharmaceutical composition according to claim 9, adapted for intramuscular or intradermal delivery. 11. The pharmaceutical composition according to claim 9 or 10, where the carrier is a gold granule. 12. The composition according to any one of paragraphs.9 and 10 for use in medicine. 13. A method of treating and / or preventing HIV infection and AIDS in a patient suffering from a disease or susceptible to a disease, wherein a safe and effective amount of a pharmaceutical composition according to any one of claims 9 to 11 is administered. 14. The method according to item 13, where the introduction of the specified pharmaceutical composition is carried out by delivery using a device for gas-controlled needleless injection. 15. The use of the nucleotide sequence according to claim 1 or the vector according to claims 3-6 in the manufacture of a medicament for treating a disease. 16. The method for producing the nucleotide sequence according to claim 1, wherein the nucleotide sequence encoding the HIV-1 gag protein or fragment thereof, the second HIV-1 Nef protein or fragment thereof, and RT protein or fragment thereof are brought into operative linkage with the heterologous promoter sequence .

Images