KR20040039387A - Hiv-gag codon-optimised dna vaccines - Google Patents

Abstract

THE INVENTION PROVIDES A NUCLEOTIDE SEQUENCE THAT ENCODES AN HIV-1 GAG PROTEIN OR FRAGMENT THEREOF CONTAINING A GAG EPITOPE AND A SECOND HIV ANTIGEN OR A FRAGMENT ENCODING AN EPITOPE OF SAID SECOND HIV ANTIGEN, OPERABLY LINKED TO A HETEROLOGOUS PROMOTER. PREFERRED POLYNUCLEOTIDE SEQUENCES FURTHER ENCODES NEF OR A FRAGMENT THEREOF AND RT OR A FRAGMENT THEREOF.

Description

HIV-GAA codon-optimized DNA vaccine {HIV-GAG CODON-OPTIMISED DNA VACCINES}

HIV-1 is the main cause of AIDS, which is considered one of the major health problems worldwide. Intensive research has been carried out worldwide to develop vaccines, but to date these efforts have not been successful.

Non-enveloped proteins of HIV-1 have been reported, including, for example, internal structural proteins such as the products of the gag and pol genes, and other non-structural proteins such as Rev, Nef, Vif and Tat. See, Green et al., New England J. Med, 324, 5, 308 et seq (1991) and Bryant et al. (Ed. Pizzo), Pediatr. Infect. Dis. J., 11, 5, 390 et seq (1992).

The Gag gene is translated from full length RNA to produce precursor polyproteins, which are then cleaved into three to five capsid proteins, namely matrix proteins, capsid proteins and nucleic acid binding proteins and proteases. 1. Fundamental Virology, Fields BN , Knipe DM and Howley M 1996 2. Fields Virology vol 2 1996].

The gag gene produces 55 kilo Daltons (kD) of Gag precursor protein (also named p55), expressed from unspliced viral mRNAs. During translation, the N terminus of p55 is myristoylated to induce binding to the cytoplasmic side of the cell membrane. Membrane-bound Gag polyproteins absorb two copies of viral genomic RNA along with other viral and cellular proteins that induce budding of viral particles from the surface of infected cells. After budding, p55 is designated MA (matrix [p17]), CA (capsid [p24]), NC (nucleocapsid [p9]) and p6 by viral encoded protease (product of the pol gene) during the virus maturation process. Are cleaved into four small proteins.

In addition to the three major Gag proteins, all Gag precursors include several other regions that are cleaved as peptides of various sizes and remain as virions. These proteins have different roles, for example, the p2 protein has a suggested role in regulating the activity of proteases and contributes to precise time regulation of the proteolytic process.

The MA polypeptide is derived from the myristoylated terminus of the N terminus of p55. Most MA molecules are attached to the inner surface of the virion lipid bilayer to stabilize the particles. The subset of MA is absorbed inside the deep layer of virion, which becomes part of the complex that guides the viral DNA into the nucleus [5]. These MA molecules promote nuclear transport of the viral genome because nuclear affinity signals on the MA are recognized by the cell nuclear transduction mechanism. This phenomenon allows HIV to infect non-dividing cells, a particular property of retroviruses.

p24 (CA) protein forms the conical core of viral particles. Cyclophilin A has been demonstrated to interact with the p24 region of p55 to induce its incorporation into HIV particles. The interaction of Gag with cyclophilin A is essential because blocking this interaction with cyclosporin A inhibits viral replication.

The NC region of Gag serves to specifically recognize the so-called packaging signal of HIV. The packaging signal consists of four stem loop structures located near the 5 'end of the viral RNA and is sufficient to mediate the incorporation of heterologous RNA into the HIV-1 virion. The NC binds to the packaging signal through an interaction mediated by two zinc finger motifs. NC also promotes reverse transcription.

The p6 polypeptide region mediates the interaction of p55 Gag with the accessory protein Vpr, leading to the incorporation of Vpr into the assembling virion. The p6 region also contains the so-called late domains required for efficient budding and release of virions from infected cells.

The Pol gene encodes two proteins that contain the two activities required for the virus at the initial infection, ie the integrase protein required for the integration of RT and viral DNA into cellular DNA. The main product of Pol is cleaved by virion protease to produce amino terminal RT peptides (RNA and DNA directed DNA polymerase, ribonuclease H) and carboxy terminal integrase protein possessing the necessary activity for DNA synthesis. .

HIV RT is a heterodimer of full length RT (p66) and a cleavage product (p51) lacking the carboxy terminal Rnase integrase domain.

RT is one of the most highly conserved proteins encoded by the retroviral genome. Two major activities of RT are DNA Pol and ribonuclease H. The DNA Pol activity of RT uses RNA and DNA interchangeably as a template, and all known DNA polymerases cannot initiate DNA synthesis in de novo but act as primers (RNA). -existing) requires a molecule.

Rnase H activity unique to all RT proteins plays an essential role in eliminating the RNA genome as DNA synthesis proceeds during initial replication. It selectively degrades RNA from all RNA-DNA hybrid molecules. Structurally, the polymerase and ribo H occupy separate non-overlapping domains and involve three thirds of the amino acids of Pol.

The p66 catalyst subunit is folded into five separate subdomains. 23 of these amino termini have an RT active moiety. Their carboxy terminus is the Rnase H domain.

After infection of the host cell, the retroviral RNA genome is replicated into linear double-stranded DNA by reverse transcriptase present in the infected particles. Integrase (Skalka AM '99 Adv in Virus Res 52 271-273) recognizes the ends of viral DNA, trims them and transfers the viral DNA to host chromosomal sites to catalyze integration. Multiple sites in the host DNA can be targets for integration. While integrase is sufficient to catalyze integration in vitro, this suggests that the large protein, which is not the only protein associated with viral DNA in vivo, is a viral DNA complex isolated from infected cells, is a pre-integration complex. This promotes the acquisition of host cell genes by the descendant viral genome.

Integrase consists of three separate domains, namely N terminal domain, catalyst core and C terminal domain. Catalytic core domains include everything that is required for chemical reactions to polynucleotide transfers.

Nef proteins are known to remove CD4, an HIV receptor, from the cell surface, but the biological importance of this function is controversial. In addition, Nef interacts with the signaling pathways of T cells to induce an active state, which in turn can promote more efficient gene expression. Some HIV isolates have mutations in this region that prevent them from encoding functional proteins so that in vivo they are severely impaired in replication and pathology.

DNA vaccines generally comprise a bacterial plasmid vector into which a strong promoter, a gene of interest encoding an antigenic peptide, and a polyadenylation / transcription termination sequence are inserted. The gene of interest may encode antigenic peptide sequences associated with intact proteins or simply pathogens, tumors or other agents intended to be protected against them. Plasmids are, for example, E. coli. It can be cultured in bacteria such as collie and then prepared separately in the appropriate medium according to the intended route of administration prior to administration to the host. After administration, the plasmid is taken up by the host cell from which the encoded peptide is produced. Plasmid vectors are preferably prepared without the origin of replication functioning in eukaryotic cells to prevent plasmid replication in host mammals and integration into chromosomal DNA of related animals.

There are numerous advantages to DNA vaccination over conventional vaccination techniques. First, because the protein encoded by the DNA sequence is synthesized in the host, the structure or form of the protein is expected to be similar to the original protein associated with the disease state. DNA vaccination also has the potential to provide protection against viruses of different strains by generating cytotoxic T lymphocyte responses that recognize epitopes from conserved proteins. In addition, the plasmid will be taken up by a host cell from which the antigenic protein can be produced to induce a long term immune response. This technique also offers the possibility of combining various immunogens into a single agent, facilitating simultaneous immunization against multiple disease states.

Helpful background information relating to DNA vaccination techniques can be found in Donnelly et al., “DNA vaccines” Ann. Rev Immunol. 1997 15: 617-648.

Summary of the Invention

The present invention provides novel constructs for use in vaccines for the prevention and treatment of HIV infection and AIDS. Thus, in a first aspect, there is provided a nucleic acid molecule comprising a nucleotide sequence encoding an HIV gag protein or fragment thereof linked to a nucleotide sequence encoding a further HIV antigen or fragment thereof and operably linked to a heterologous promoter. Fragments of such nucleotide sequences encode HIV epitopes and typically encode peptides of eight or more amino acids. The nucleotide sequence is preferably a DNA sequence and is preferably contained within a plasmid with no origin of replication. Such nucleic acid molecules are formulated with pharmaceutically acceptable excipients, carriers, diluents or adjuvants to produce pharmaceutical compositions suitable for the treatment and / or prevention of HIV infection and AIDS.

In a preferred embodiment, the DNA sequence is formulated onto the surface of inert particles or beads suitable for particle mediated drug delivery. Preferably, the beads are gold.

In a preferred embodiment of the present invention, a DNA sequence encoding a highly expressed gag protein is provided, which sequence is optimized to resemble the codon usage of genes in mammalian cells. In particular, gag proteins are optimized to resemble those of highly expressed human genes.

The DNA code has four letters (A, T, C and G) and is used to represent the three letter “codon” which represents the amino acid of a protein encoded in an organism gene. Codon sequences linearly arranged along the DNA molecule are translated into the linear amino acid sequence of the protein encoded by these genes. This code is highly degenerate, with 61 codons encoding 20 natural amino acids and 3 codons representing a "stop" signal. Thus, most amino acids are encoded by one or more codons, in fact several are encoded by four or more different codons.

If more than one codon is used to encode a given amino acid, the codon usage pattern of the organism does not appear highly random. Different species exhibit different biases in their codon selection and in addition, the use of codons can certainly differ between genes expressed at high and low levels in a single species. These biases differ in viruses, plants, bacteria and mammalian cells, and some species show strong biases apart from random codon selection than other species. For example, humans and other mammals are less strongly biased than certain bacteria or viruses. For these reasons, Lee. Mammalian genes expressed in collie, or foreign or recombinant genes expressed in mammalian cells, are likely to have improper distribution of codons for efficient expression. The presence of rare codon clusters or abundant codon heterologous DNA sequences in the host to be expressed suggests a low level of heterologous expression in such hosts.

One embodiment of the present invention provides a gag polynucleotide sequence that encodes an amino acid sequence, wherein the codon usage pattern of the polynucleotide sequence is similar to that of a highly expressed mammalian gene. Preferably, the polynucleotide sequence is a DNA sequence. Preferably, the codon usage pattern of a typical polynucleotide sequence is a highly expressed human gene.

In the polynucleotides of the present invention, codon usage patterns are modified from typical human immunodeficiency viruses and appear more similar to codon bias in target organisms such as mammals, especially humans. "Codon usage factor" is a measure of how closely the codon pattern of a given polynucleotide sequence is similar to the pattern of a target species. Codon frequencies can be derived from literature on highly expressed genes of many species (Nakamura et al., Nucleic Acids Research 1996, 24: 214-215). The codon frequency (expressed as the number of presence per 1000 codons of the selected class of genes) for each of the 61 codons is normalized by each of the 20 natural amino acids, with the number of codons used most frequently for each amino acid equal to 1. Set the frequency for less common codons to be values between 0 and 1. Thus, each of 61 codons is assigned a value of 1 or less than 1 for the highly expressed gene of the target species. To calculate the codon usage coefficients of specific polynucleotides for the highly expressed genes of the species, check the measurements for each codon of the specific polynucleotide and obtain the geometric mean of all these values (sum of the natural logarithm of these values) Divide by the codon total and find the logarithmic number). The modulus has a value between 0 and 1, and a higher value means that more codons are used more frequently in the polynucleotide. If the polynucleotide sequence has a codon usage coefficient of 1, all codons are the "most frequent" codons for the highly expressed gene of the target species.

According to the present invention, the codon usage pattern of polynucleotides will preferably not include codons having an RSCU value of less than 0.2 in the highly expressed gene of the target organism. Optionally, the codon usage pattern will not include codons that represent less than 10% of the codons used for a particular amino acid. Relatively similar codon usage (RSCU) values are the observed number of codons divided by the number expected when all codons for the amino acids used were used at the same frequency. Polynucleotides of the invention will generally have a codon usage factor (or RSCU) for a highly expressed human gene of greater than 0.3, preferably greater than 0.4 and most preferably greater than 0.5. Codon usage tables for people can also be searched in Genebank.

In comparison, the RSCU of the highly expressed beta actin gene is 0.747. Codon usage tables for Homo sapiens are shown below:

Codon usage Table 1:

Homo sapiens [gbpri]: 27143 CDS's (12816923 codon)

Field: [Triple] [Frequency: per thousand] ([Number])

Coding GC 52.1% First letter GC 56.4% Second letter GC 42.35% Third letter GC 59.13%

Codon Table 2 (preferred):

Codon use for human (highly expressed) gene 1/24/91 (human high codon)

According to a further aspect of the invention there is provided an expression vector comprising a polynucleotide sequence according to the first aspect of the invention and capable of directing its expression, in particular the codon usage pattern for a gag polynucleotide sequence being highly expressed It is typical for mammalian genes, preferably highly expressed human genes. Vectors may be suitable for driving expression of heterologous DNA in bacterial insects or mammalian cells, particularly human cells. In one embodiment, the expression vector is p7313 (see FIG. 1).

In a third embodiment, a gag gene is provided that is under the control of a heterologous promoter fused with a DNA sequence encoding a NEF, a fragment thereof, or an HIV reverse transcriptase (RT) or fragment thereof. The gag portion of this gene may be the N or C terminal portion of the fusion.

In a preferred embodiment, the gag gene does not encode a gag p6 peptide. Preferably, the NEF gene is cleaved to remove the sequence encoding the N terminal region, i.e. 30 to 85 removed, preferably 60 to 85 removed, typically about 81, preferably N terminal 65 amino acids Is removed.

In further embodiments, the RT gene is also optimized to resemble a highly expressed human gene. RT preferably encodes the mutation to substantially disable any reverse transcriptase activity. Preferred inactivation mutations include replacement of K (lysine) with W tryptophan 229.

According to a further aspect of the invention, a host cell is provided comprising a polynucleotide sequence according to the invention or an expression vector according to the invention. Host cells are E. coli. It may be a bacterium such as collie, or a mammal such as a human or may be an insect cell. Mammalian cells comprising a vector according to the invention may be cultured cells transfected in vitro or may be transfected in vivo by administering the vector to a mammal.

The invention further provides a pharmaceutical composition comprising a polynucleotide sequence according to the invention. Preferably, the composition comprises a DNA vector. In a preferred embodiment, the composition comprises a plurality of particles, preferably gold particles, coated with DNA comprising a vector encoding a polynucleotide sequence of the invention. Preferably, the sequence encodes an HIV gag amino acid sequence, wherein the codon usage pattern of the polynucleotide sequence is typical for highly expressed mammalian genes, particularly human genes. In another embodiment, the composition comprises a pharmaceutically acceptable excipient and a DNA vector according to the second aspect of the present invention. The composition may also include an adjuvant.

Thus, certain embodiments of the invention use the vector of the invention in combination with an immunostimulant. Preferably, the immunostimulant is administered simultaneously with the nucleic acid vector of the invention and formulated together in a preferred embodiment. Such immunostimulants are imiquimod [S-26308, R-837], Harrison, et al. 'Reduction of recurrent HSV disease using imiquimod alone or combined with a glycoprotein vaccine', Vaccine 19: 1820-1826, (2001)] and leciquimod [S-28463, R-848] [Vasilakos, et al. ' Synthetic imidazoquinolines, tucarazole, such as Adjuvant activites of immune response modifier R-848: Comparison with CpG ODN ', Cellular immunology 204: 64-74 (2000)] (Rhodes, J. et al.' Therapeutic potentiation of the immune system by costimulatory Schiff-base-forming drugs', Nature 377: 71-75 (1995)], antigen-presenting cells and T cell plates, such as cytokines, chemokines, and co-stimulatory molecules as proteins or peptides. Schiff bases of carbonyl and amines that are structurally expressed in the stomach, but are not limited to this list and do not exclude other agents, including GM-CSF, IL-1 alpha, IL-1 beta, TGF-alpha and TGF- Pro-inflammatory cytokines such as beta, interferon gamma, Th1 inducers such as IL-2, IL-12, IL-15 and IL-18, IL-4, IL-5, IL-6, IL-10 and IL- Th2 inducers such as 13 and other chemokines and co-stimulatory genes such as MCP-1, MIP-1 alpha, MIP-1 beta, RANTES, TCA-3, CD80, CD86 and CD40L, CTLA-4 and L-selectin Other immunostimulatory targeting ligands, such as apoptosis stimulating proteins and peptides, such as Fas (49), backspectin [Reyes et al. ., 'Vaxfectin enhances antigen specific antibody titres and maintains Th1 type immune responses to plasmid DNA immunization', Vaccine 19: 3778-3786], squalene, alpha-tocopherol, polysorbate 80, DOPC and cholesterol, endotoxins [Ref. LPS], Beutler, B., 'Endotoxin,' Toll-like receptor 4, and the afferent limb of innate immunity ', Current Opinion in Microbiology 3: 23-30 (2000)]; CpG oligo- and di-nucleotides (Sato, Y. et al., 'Immunostimulatory DNA sequences necessary for effective intradermal gene immunization', Science 273 (5273): 352-354 (1996). A synthetic lipid based adjuvant, such as Hemmi H. et al., 'A Toll-like receptor recognizes bacterial DNA', Nature 408: 740-745, (2000)], and toll receptors for synthetic mycobacterial lipoproteins, mycobacteria Other potent ligands for producing Th1-induced cytokines such as protein p19, peptidoglycan, teiconic acid and lipid A are included.

Certain preferred adjuvants primarily intended to elicit a Th1 response are lipid A derivatives such as, for example, monophosphoryl lipid A or preferably 3-de-O-acylated monophosphoryl lipid A. MPL? Adjuvants are commercially available from Corixa Corporation (Seattle, WA; for example, US Pat. Nos. 4,436,727, 4,877,611, 4,866,034, and 4,912,094). CpG containing oligonucleotides, wherein the CpG dinucleotides are not methylated, also mainly induce a Th1 response. Such oligonucleotides are well known and are described, for example, in WO 96/02555, WO 99/33488 and US Pat. Nos. 6,008,200 and 5,856,462. Immunostimulatory DNA sequences are also described, for example, in Sato et al., Science 273: 352, 1996. Still other preferred adjuvants include saponins such as Quil A or derivatives thereof and include QS21 and QS7 (Aquila Biopharmaceuticals Inc., Framingham, MA); Escin; Digitonin; Or Gippsophila or Chenopodium quinoa saponins.

Also provided is the use of a polynucleotide according to the invention or a vector according to the invention in the treatment or prevention of HIV infection.

The invention also provides a method for treating or preventing HIV infection, symptoms or diseases associated therewith, including administering an effective amount of a polynucleotide, vector or pharmaceutical composition according to the invention. Administration of the pharmaceutical composition may be in the form of one or more individual dosages, for example, in the repeated administration of the same DNA plasmid or in a "prime boost" therapeutic vaccination regimen. In certain cases, “prime” vaccination can be via particle mediated DNA delivery of a polynucleotide according to the invention, preferably incorporated into a plasmid derived vector, and comprises a recombinant viral vector comprising the same polynucleotide sequence. It can be "boost" by the administration of or boosted with the protein in the adjuvant. Conversely, it can be primed with a viral vector or protein formulation, typically a protein formulated in an adjuvant and a DNA vaccine boost of the invention. Multiple doses of prime and / or boost may be used.

In an embodiment of the invention, fragments of gag, nef or RT proteins are contemplated. For example, the polynucleotides of the present invention can encode fragments of HIV gag, nef or RT proteins. Polynucleotides encoding 8 or more, e.g., 8 to 10 amino acid fragments or up to 20, 50, 60, 70, 80, 100, 150 or 200 amino acid fragments in length It is contemplated that the encoded oligos or polypeptides fall within the scope of the present invention as long as they demonstrate HIV antigenicity. In particular, such embodiments of the invention include, but are not limited to, where the polynucleotides can encode fragments of an intact HIV protein sequence and represent one or more individual epitopes of the protein. Such fragments may be codons optimized to have codon usage patterns similar to the codon usage patterns of highly expressed mammalian genes.

Preferred constructs according to the invention comprise the following components:

1. fused to p17, p24, truncated NEF (no nucleotides encoding 1-65 terminal amino acids),

2. p17, p24, RT, truncated NEF (no nucleotides encoding 1-65 terminal amino acids),

3. p17, p24 (optimized gag) truncated NEF (no nucleotide encoding 1-65 terminal amino acids),

4. p17, p24 (optimized gag) RT (optimized) cleaved NEF (no nucleotides encoding from 1 to 85 terminal amino acids),

5. p17, p24, RT (optimized) truncated NEF (no nucleotides encoding 1-65 terminal amino acids),

6. Truncated NEF- (without 1-65 nucleotides) fused with optimized p17, p24 gag,

7. Particularly preferred constructs of the invention include triple fusion RT-NEF-Gag, and RT-Gag-Nef,

8. Optimized RT, truncated NEF and optimized P17, p24 (gag) (RNG) and

9. Optimized RT, optimized p17, 24 (gag), Nef cleavage (without 1-65 amino acids) RGN.

The HIV construct is preferably derived from HIV clade B or clade C, in particular clade B.

As discussed above, the present invention encompasses expression vectors comprising the nucleotide sequences of the present invention. Such expression vectors are typically constructed in the art of molecular biology and may include, for example, the use of plasmid DNA and other elements such as suitable initiators, promoters, enhancers, and, for example, essential polyadenylation signals. And they are positioned in the correct orientation to express the protein. Other suitable vectors are apparent to those skilled in the art. In this regard, as further examples, see Sambrook et al. Molecular Cloning: a Laboratory Manual. 2 ^nd Edition. CSH Laboratory Press. (1989).

Preferably, the polynucleotide of the present invention for use as a vector in the present invention is operably linked with regulatory sequences that may be provided for expression of the coding sequence by the host cell. The term “operably linked” refers to those immediately adjacent such components that are described in such a way that they may function in the intended manner. Regulatory sequences, such as promoters "operably linked" to a coding sequence, are positioned in such a way that expression of the coding sequence is made under conditions that can be compatible with the regulatory sequence.

For example, the vector can be a plasmid, artificial chromosome (eg, BAC, PAC, YAC), viral or phage vector provided with origin of replication, optionally a promoter for polynucleotide expression and optionally a regulator of the promoter. The vector may contain one or more selectable marker genes, for example ampicillin or kanamycin resistance genes for bacterial plasmids, or resistance genes for fungal vectors. The vector may be used in vitro, for example, to prepare DNA or RNA, or may be transfected or transfected with a host cell, eg, a mammalian host cell, for example, to prepare a protein encoded by the vector. Can be used to convert. The vector may also be adapted for use in vivo, for example in methods of DNA vaccination or gene therapy.

Promoters and other expression control signals may be selected to be compatible with host cells designed to express. For example, mammalian promoters include metallothionein promoters and βactin promoters that can be induced in response to heavy metals such as cadmium. Viral promoters such as the SV40 large T antigen promoter, human cytomegalovirus (CMV) early (IE) promoter, Raus sacoma virus LTR promoter, adenovirus promoter or HPV promoter, in particular HPV upstream regulatory region (URR), can also be used. have. All these promoters are widely reported and readily available in the art.

Preferred promoter elements are CMV early promoters without extron A but with exon 1. The promoter element may be a minimal promoter element or an enhanced promoter, but an enhanced promoter is preferred. Thus, a vector is provided comprising a polynucleotide of the present invention under the control of an HCMV IE early promoter.

Examples of suitable viral vectors include simple herpes virus vectors, vaccinia or alpha virus vectors and retroviruses including lentiviruses, adenoviruses and adeno-associated viruses. Gene delivery techniques using these viruses are known to those skilled in the art. For example, retroviral vectors can be used to stably integrate the polynucleotides of the invention into the host genome, but such recombination is undesirable. In contrast, replication deficient adenovirus vectors exist in episomal state and thus allow for transient expression. Using vectors capable of driving expression in insect cells (eg baculovirus vectors), in human cells, in yeast or in bacteria, for use as a subunit vaccine or for use in immunoassays HIV proteins encoded by the polynucleotides of the invention can be prepared.

The polynucleotides according to the invention are used in the production method by the expression of encoded proteins which can be expressed in vitro, in vivo or ex vivo. Thus, nucleotides may, for example, be involved in recombinant protein synthesis to increase yield, or they may be used as therapeutic agents in themselves, substantially used in DNA vaccination techniques. When the polynucleotides of the present invention are used for the production of proteins encoded in vitro or ex vivo, for example, cells in cell culture can be modified to allow such polynucleotides to be expressed. Such cells include mammalian cell lines that are transiently or preferably stable. Specific examples of cells that can be modified by insertion of a vector encoding a polypeptide according to the present invention include mammalian HEK293T, CHO, HeLa, 293 and COS cells. Preferably, the selected cell lines are not only stable but also allow mature glycosylation and cell surface expression of the polypeptide. Can be expressed in a transformed egg. The polypeptide may be expressed from a polynucleotide of the invention in cells of a transformed non-human animal, preferably a mouse. Transformed non-human animals expressing polypeptides from the polynucleotides of the present invention are included within the scope of the present invention.

The invention further provides a method of vaccinating a mammalian subject comprising administering an effective amount of such a vaccine or vaccine composition. Most preferably, the expression vector for use as a DNA vaccine, vaccine composition and immunotherapeutic is a plasmid vector.

DNA vaccines may be administered by particle mediated DNA delivery (PMDD), for example in the form of syringes or high pressure jets, or “exposed DNA” such as DNA formulated with liposomes or stimulatory transfection enhancers. All of these delivery systems are well known in the art. The vector can be introduced into a mammal, for example, in a viral vector delivery system.

The compositions of the present invention can be delivered by a number of routes, such as intramuscular, subcutaneous, intraperitoneal, intravenous or intramucosal.

In a preferred embodiment, the composition is delivered transdermally. In particular, the compositions are delivered by gene total microparticle bombardment techniques, as described in Haynes et al, J Biotechnology 44: 37-42 (1996), and then beads administered to the epidermis under high pressure (eg, For example, coating the vector with gold).

In one illustrative example, gas driven particle acceleration is prepared by Powderject Pharmaceuticals PLC (Oxford, UK) and Powderject Vaccines Inc. (Madison, WI). Devices such as those described, and some examples thereof are described in US Pat. Nos. 5,846,796, 6,010,478, 5,865,796, 5,584,807, and European Patent 0 500 799. This method includes a needle less delivery device wherein the anhydrous powder formulation (eg, polynucleotide) of the microscope particles is accelerated at high speed in the helium gas jet produced by the handle retainer, Is pushed into the target tissue, typically the skin.

Preferably, the particles are gold beads having a diameter of 0.4 to 4.0 μm, more preferably 0.6 to 2.0 μm, and the DNA conjugate is coated on them and then cartridges or cassettes for positioning into “gene guns”. Is built in.

In related embodiments, other devices and methods that may be useful for gas driven needle-free injection of the compositions of the present invention include those provided by Biojet, Inc. (Portland, OR). And some examples thereof are described in US Pat. Nos. 4,790,824, 5,064,413, 5,312,335, 5,383,851, 5,399,163, 5,520,639, and 5,993,412.

A vector comprising a nucleotide sequence encoding an antigenic peptide is administered prophylactically or therapeutically in an effective amount. The amount to be administered is generally 1 pg to 1 mg, preferably 1 pg to 10 μg, and 100 ng to 1 mg, preferably 10 μg to 1 mg as the nucleotide per dose for particle mediated delivery. The exact amount may vary considerably depending on the weight of the patient to be immunized and the route of administration.

Immunogen components comprising a nucleotide sequence encoding an antigenic peptide can be administered once or repeatedly, eg, once to seven times, preferably once to four times, about 1 day to about 18 months apart. have. However, such therapeutic dosing regimens vary considerably depending on the size of the patient involved, the amount of nucleotide sequence to be administered, the route of administration and other factors apparent to the veterinarian or physician. Patients may receive one or more anti-HIV retroviral drugs as part of their overall therapeutic dosing schedule. In addition, nucleic acid immunogens may be administered with an adjuvant.

The adjuvant components specified herein can be similarly administered by a variety of different routes of administration, eg, via oral, nasal, pulmonary, intramuscular, subcutaneous, intradermal or topical routes. Preferably the adjuvant component is administered via an intradermal or topical route. The local route is most preferred. Such administration may be carried out from about 14 days prior to nucleotide sequence administration to about 14 days after administration, preferably from about 1 day before administration of the nucleotide sequence to about 3 days after administration. Adjuvant components are administered in one embodiment substantially together with the nucleotide sequence. By “substantially simultaneously” it is meant that the adjuvant component is administered either nucleotide sequence at least within a few hours, preferably at the same time as the nucleotide sequence administration. In the most preferred treatment protocol, the adjuvant component is administered substantially concurrently with the nucleotide sequence administration. Obviously, the protocol can vary as needed depending on the variable types mentioned above. The adjuvant is preferably a 1H-imidazo [4,5c] quinolin-4-amine derivative such as imiquimod. Typically imiquimod is provided as a topical cream formulation and administered according to the above protocol.

Once again, depending on these variables, the dosage of the derivative may also vary but, for example, in the range of about 0.1 mg / kg to about 100 mg / kg, where "per kg" refers to the weight of the relevant mammal. . Administration of the 1H-imidazo [4,5-c] quinolin-4-amine derivatives is preferably repeated with subsequent or booster administration of the nucleotide sequence. Most preferably, the dosage is about 1 mg / kg to about 50 mg / kg. In the case of a "prime-boost" scheme as described herein, imiquimod or other 1H-imidazo [4,5-c] quinolin-4-amine derivatives may be administered in prime or boost, or in both prime and boost. Can be.

It is possible for the adjuvant component to contain only 1H-imidazo [4,5-c] quinolin-4-amine derivatives to be administered as raw chemical state, but administration in the form of pharmaceutical formulations is preferred. That is, the adjuvant component preferably comprises 1H-imidazo [4,5-c] quinolin-4-amine in combination with one or more pharmaceutically acceptable carriers and any other therapeutic component. The carrier must be "acceptable" in the sense of being compatible with the other ingredients in the formulation and must not be harmful to its recipient. The nature of the formulation can vary essentially depending on the intended route of administration and can be prepared by methods known in the pharmaceutical industry. All methods include the step of combining 1H-imidazo [4,5-c] quinolin-4-amine with a suitable carrier or carriers. Generally, formulations are prepared by combining these derivatives uniformly and intimately with a liquid carrier or finely divided solid carrier or both and optionally molding the product into the desired formulation. Formulations of the present invention suitable for oral administration include discrete units, each containing a predetermined amount of active ingredient, such as capsules, sachets or tablets; As a powder or granules, it may be provided as a solution or as a suspension in an aqueous liquid or a non-aqueous liquid or as an oil-in-water liquid emulsion or a water-in-oil emulsion. The active ingredient may also be provided as a pill, sugar or staple.

Tablets may be prepared by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compacting the active ingredient in a free flowing form, for example as a powder or granules, in a suitable machine and optionally mixed with a binder, lubricant, inert diluent, lubricant, surfactant or dispersant. Molded tablets may be made by molding, in a suitable machine, a mixture of powdered compounds moistened with an inert liquid diluent.

Tablets may optionally be coated or grooved and formulated to release sustained release of the active ingredient.

For example, formulations for injection via an intramuscular, intraperitoneal or subcutaneous route of administration include aqueous and non-aqueous sterile injection solutions, which are antioxidants, buffers, bacteriostatic and blood and isotonic of intended recipients. Solutes imparted to the formulations such that; And aqueous and non-aqueous sterile suspending agents which may include suspending agents and thickening agents. Such formulations may be provided in unit dose or multi-dose containers and may be, for example, sealed ampoules and vials, and lyophilized requiring only the addition of a sterile liquid carrier such as water for injection immediately prior to use. Can be stored under conditions. Instant injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the kind previously described. Formulations suitable for pulmonary administration via oral or nasal passages are provided such that particles containing the active ingredient, with a diameter of 0.5 to 7 microns, are delivered to the recipient's bronchus. The potential for such formulations is that they may be, for example, self-propelled into perforated capsules of gelatin or other components such as active ingredients, suitable liquid propellants and optionally surfactants and / or solid diluents, suitable for use in inhalation devices. It is in the form of a fine powder that can be conveniently provided as a formulation. Self-propelled formulations can also be used when the active ingredient is dispersed in the form of drops into a solution or suspension. Such self-propelled formulations can be prepared by similar and established procedures as known in the literature. They are equipped with valves with the desired spray properties, suitably manually operable or functioning automatically, the valves being advantageously metered type which delivers, for example, at a fixed volume of 50 to 100 μl in their operation. to be.

In a further possibility, the adjuvant component may be in solution form for use in nebulizers or nebulizers and may produce fine drop sprays for inhalation using accelerated airflow or ultrasonic agitation.

Formulations suitable for intranasal administration generally include forms similar to those described above for pulmonary administration, but preferably the indenter diameter of the formulation can remain in the nasal cavity in the range of about 10 to about 200 microns. This may optionally be achieved by the selection of a suitable particle size powder or suitable valve. Other suitable formulations include coarse powders, the particle diameter of which is about 20 to about 500 microns and is rapidly inhaled and administered through a nasal passage from a container kept in close proximity to the nose and the nasal drops are active as aqueous or oily solutions. Component from about 0.2 to 5% w / w. In one embodiment of the invention, the vector may comprise a nucleotide sequence encoding an antigenic peptide to be administered in the same formulation as the 1H-imidazo [4,5-c] quinolin-4-amine derivative. Thus, in this embodiment, the immunogenic and adjuvant components are identified in the same formulation.

In certain embodiments, the adjuvant component is prepared in a form suitable for total gene administration and is administered via this route substantially concurrently with the administration of the nucleotide sequence. 1H-imidazo [4,5-c] quinolin-4-amine derivatives need to be lyophilized and attached onto gold beads suitable for total gene administration, for the preparation of formulations suitable for use in this manner. There can be.

In another embodiment, the adjuvant component may be administered via high pressure gas propulsion as anhydrous powder.

Even if not formulated together, it is suitable that the adjuvant component is administered at or near the same site of administration as the nucleotide sequence.

Other details about pharmaceutical formulations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennysylvania (1985), which is incorporated herein by reference in its entirety.

Suitable techniques for introducing an exposed polynucleotide or vector to a patient also include topical application to a suitable vehicle. The nucleic acid can be administered topically to the skin or to the mucosal surface, for example by intranasal, oral, vaginal or rectal administration. The exposed polynucleotide or vector may be provided with a pharmaceutically acceptable excipient such as phosphate buffered saline (PBS). DNA uptake can further be promoted separately or using a facilitation agent such as bupivacaine included in the DNA formulation. Other methods of administering nucleic acids directly to recipients include ultrasound, electrical stimulation, electroporation, and microinoculation described in US Pat. No. 5,697,901.

Uptake of nucleic acid constructs can be enhanced by some known transfection techniques, such as those involving the use of transfection agents. Examples of these agents include cationic agents such as calcium phosphate and DEAE-dextran and lipophilic agents such as lipofectam and transfectam. The dosage of nucleic acid to be administered may vary.

Nucleic acid sequences of the invention can also be administered by certain delivery vectors useful for gene therapy. Gene therapy methods are discussed, for example, in Verme et al., Nature 1997, 389: 239-242. Both viral and nonviral vector systems can be used. Virus family systems include retroviruses, lentiviruses, adenoviruses, adeno related viruses, herpes virus, canarypox and vaccinia virus family systems. Non-viral line systems include nucleic acids, microsphere encapsulation techniques (poly (lactide-co-glycolide)) and liposome line systems. Viral and nonviral delivery systems may be initially vaccinated, eg, initial "prime" DNA vaccinations using nonviral vectors such as plasmids, and then one or more "boost" vaccinations using viral vectors and nonviral family systems. It may be desirable to inject the booster afterwards. Similarly, the present invention contemplates boosting with the protein in the adjuvant after the prime boot system with the polynucleotide of the present invention and vice versa.

Nucleic acid sequences of the invention can also be administered by transformed cells. Such cells include cells harvested from an individual. The exposed polynucleotide or vector of the invention can be introduced into such cells in vitro and the transformed cells can then be re-administered to the subject. Polynucleotides of the invention can be integrated into nucleic acids already present in cells by homologous recombination reactions. The transformed cells can optionally be grown in vitro and one or more obtained cells can be used in the present invention.

The cells may be provided to a suitable site of the patient by known surgery or microsurgical techniques (eg, implantation, microinjection, etc.).

The pharmaceutical composition of the present invention may comprise adjuvant compounds as described in detail above or other substances capable of increasing the immune response induced by proteins encoded by DNA. They can be encoded as fusions with the antigen or by separate DNA and can be included as non-DNA components of the formulation. Examples of adjuvant type materials that may be included in the formulations of the present invention are ubiquitin, lysosomal related membrane protein (LAMP), hepatitis B virus core antigen, FLT3-ligand (important antigen-providing cells, especially important for the production of dendritic cells). Cytokines) and other cytokines such as IFN-γ and GMCSF. Other preferred adjuvants include imiquimod and resimquimod, and tucarazole. Imiquimod is particularly preferred.

In a preferred embodiment of the invention, the invention provides the use of nucleic acid molecules as described herein for the treatment or prevention of HIV infection. The nucleic acid molecule is preferably administered with imiquimod. Imiquimod is preferably administered topically, while nucleic acid molecules are preferably administered by particle mediated delivery.

Accordingly, the present invention provides a method for treating a subject suffering from or susceptible to HIV infection, comprising administering a nucleic acid molecule and imiquimod as described herein.

The present invention is now described with reference to the following examples:

The present invention relates to nucleic acid constructs, host cells comprising such constructs and their use in nucleic acid vaccines. The invention further relates to vaccine formulations comprising such constructs and the use of such formulations in medicine. The present invention is particularly useful for the prevention and treatment of HIV infection, and more particularly, to a DNA vaccine when administered by particle mediated delivery.

Example 1: Optimization of p55 gag (p17, p24, pl3) to resemble codon usage of highly expressed human genes

Gene of interest

Synthetic genes encoding the p55gag antigen of HIV-1 clade B strain HXB2 (GenBank entry K03455), optimized for expression in mammalian cells, were assembled from duplicate oligonucleotides by PCR.

Optimization included changing codon usage patterns of viral genes to bring codon frequencies closer to those found in highly expressed human genes. A statistical visual basic program called Syngene [an updated version of Calcgene, written by R. S. Hale and G. Thompson, Protein Expression and Purification Vol. 12 pp 185-188, 1998].

Cloning:

The 1528 bp gag PCR product was gel purified, digested with restriction endonuclease NotI and BamHI, and linked to NotI / BamHI cleavage vector WRG7077. This places the gene between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Clones were sequenced and errors examined. No single clones were 100% corrected. Thus, the calibration sequence regions from the two clones were combined by overlapping PCR using a suitable combination of optimization of oligo sets to obtain full length codon optimized gag genes. Subsequently these final clones were found to contain a single nucleotide deletion, which subsequently led to early termination of translation and frame changes. The deletion was repaired by cleaving the gene region containing the non-definable sequence and cloning the correct sequence from the corresponding region of another clone. This gave the final codon optimized p55 gag clone: Gagoptrpr2 (see FIG. 2).

Example 2: Preparation of p17 / p24 truncated Nef fusion gene

Gene of interest

The p17 and p24 portions of the p55gag gene derived from HIV-1 clade B strain HXB2 were converted into plasmid pHXB? PCR amplification from Pr (B. Maschera, E Furfine and E. D. Blair 1995 J. Virol 69 5431-5436). PHXB from the 3 'end of the HXB2 nef gene? Pr. 426 bp was amplified from the same plasmid. Since the HXB2 nef gene contains an early termination codon, two duplicate PCRs were used to recover the codons (TGA [stop] to TGG [TRP]).

p17 / p24 linker and trNEF linker PCR products were combined to form a p17p24trNEF fusion gene (FIG. 3) by PCR reaction (antisense).

The 1542 bp product was gel purified, digested with restriction endonuclease NotI and BamHI and cloned into the NotI / BamHI site of vector WRG7077. This places the gene between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 3: Preparation of Gag p17 / p24opt / trNef1 ('Gagopt / Nef') Fusion Genes

Gene of interest

The p17 and p24 portions of the codon optimized p55gag gene derived from HIV-1 clade B strain HXB2 were PCR amplified from plasmid pGagOPTrpr2. The truncated HXB2 Nef gene with repaired early termination codon (TGG [TRP] to TGA [stop]) was PCR amplified from plasmid 7077trNef20. The two PCR products were designed with duplicate ends, so that two genes could be linked in the second PCR.

The 1544 bp product was gel purified, digested with restriction endonuclease NotI and BamHI and cloned into the NotI / BamHI site of vector WRG7077 (see figure). This places the gene between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 4: Plasmid: p7077-RT3 Clone #A

Gene of interest

Synthetic genes encoding the RT portion of the pol gene of HIV-1 clade B strain HXB2, optimized for expression in mammalian cells, were assembled from duplicate oligonucleotides by PCR. The cloned sequence corresponds to positions 2550-4222 of the HXB2 reference sequence (GenBank entry K03455). To ensure expression, the cloned sequence has two additional codons at the 5 'end that were not present in the original gene-AUG GGC (Met Gly).

Optimization included changes in the codon usage patterns of the viral genes to bring the codon frequencies close to those found in highly expressed human genes, but excluding rarely used codons. A statistical visual basic program called budding [an updated version of Calcgene, written by R. S. Hale and G. Thompson, Protein Expression and Purification Vol. 12 pp 185-188, 1998].

Final clones were constructed from two intermediate clones # 16 and # 21.

Cloning:

The 1.7 kp PCR product was gel purified, cleaved with NotI and BamHI and PCR washed, then linked using NotI / BamHI cleavage vector pWRG7077. This places the gene between the CMV promoter and the bovine growth hormone polyadenylation signal. Clones were sequenced. No single clone was 100% corrected, but clone # 16 was corrected by replacing the 403 bp KpnI-BamHI fragment containing three errors with the corrected Kpn1-BamHI fragment from clone # 21. Final clones were confirmed by sequencing (see FIG. 5).

Example 5: Optimized RT

Gene of interest

The synthetic gene encoding the RT portion of the pol gene of HIV-1 clade B strain HXB2, optimized for expression in mammalian cells, was deleted from plasmid p7077-RT3 as a 1697 bp NotI / BamHI fragment, gel purified, and p7313 Cloned to the NotI / BamHI site of -ie (derived from pspC31), this gene was located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit globin poly-adenylation signal (R7004 p27) (See Figure 6).

Example 6

Plasmid: 7077trNef20

Gene of interest

Insertion includes a portion of the Nef gene from HIV-1 clade B strain HXB2. 195 bp is removed from the 5 'end of the gene which removes the codons for the first 65 amino acids of Nef. In addition, early termination codons of the published HXB2 nef sequence were recovered as described for plasmid p17 / 24trNef1 (TGG [Trp] in TAG). The cleaved nef sequence was PCR amplified from plasmid p17 / 24trNef1. The cloned sequence corresponds to positions 8992-9417 of the HXB2 reference sequence (GenBank entry K03455). To ensure expression, the cloned sequence has one additional codon at the 5 'end that was not present in the original gene-AUG (Met).

primer:

StrNef (Sense) ATAAGAATGCGGCCGCCATGGTGGGTTTTCCAGTCACACCTT [SEQ ID NO: 1]

AStrNef (antisense) CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 2]

PCR: 94 ° C 2min, then 25 cycles: 94 ° C 30sec, 50 ° C 30sec, 72 ° C 2min, final 72 ° C 5min

Cloning:

The 455 bp RT PCR product was gel purified, digested with restriction endonuclease NotI and BamHI and linked to NotI / BamHI cleavage vector WRG7077. This places the gene between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 7

Plasmid: 7077RT 8

Gene of interest

The RT portion of the pol gene was derived from HIV-1 clade B strain HXB2. This was PCR amplified from plasmid p7077Pol14.

The cloned sequence corresponds to positions 2550-4234 of the HXB2 reference sequence (GenBank entry K03455). To ensure expression, the cloned sequence has two additional codons at the 5 'end that were not present in the original gene-AUG GGC (Met Gly).

primer:

SRT (Sense) ATAAGAATGCGGCCGCCATGGGCCCCATTAGCCCTATTGAGACT [SEQ ID NO: 3]

ASRT (antisense)

CGCGGATCCTTAATCTAAAAATAGTACTTTCCTGATT [SEQ ID NO: 4]

PCR: 94 ° C 2min, then 25 cycles: 94 ° C 30sec, 50 ° C 30sec, 72 ° C 4min, final 72 ° C 5min

Cloning:

The 1720 bp RT PCR product was gel purified, digested with restriction endonuclease NotI and BamHI and linked to NotI / BamHI cleavage vector WRG7077. This places the gene between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 8

p17 / p24opt / RT / trNef13 ('Gagopt / RT / Nef')

This construction involves PCR causing an amino acid change in R.

Gene of interest:

The p17 / p24 portion of the codon optimized p55gag gene derived from HIV-1 clade B strain HXB2 was PCR amplified from plasmid pGagOPTrpr2. RT coding sequences were PCR amplified from plasmid 7077RT 8. The truncated HXB2 Nef gene with repaired early termination codon (TGG [TRP] to TGA [stop]) was PCR amplified from plasmid 7077trNef20. Three PCR products were designed with duplicate ends, so that three genes could be combined in the second PCR.

primer:

(P17 / 24)

Sp17p24opt (sense)

ATAAGAATGCGGCCGCCATGGGTGCCCGAGCTTCGGT [SEQ ID NO: 5]

ASp17p24optRTLinker (antisense)

TGGGGCCCATCAACACTCTGGCTTTGTGTC [SEQ ID NO: 6]

PCR: 94 ° C 1min, followed by 20 cycles: 94 ° C 30sec, 50 ° C 30sec, 72 ° C 2min, final 72 ° C 4min

The 1114bp p17 / 24opt product was gel purified.

(RT)

Sp17p24optRTLinker (Sense)

CAGAGTGTTGATGGGCCCCATTAGCCCTAT [SEQ ID NO: 7]

ASRTtrNef Linker (antisense)

AACCCACCATATCTAAAAATAGTACTTTCC [SEQ ID NO: 8]

PCR: same as above

1711 bp RT PCR product was gel purified.

(5 'cut nef)

SRTtrNef Linker (Sense)

CTATTTTTAGATATGGTGGGTTTTCCAGTCAC [SEQ ID NO: 9]

AStrNef (antisense)

CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 10]

PCR is as above.

The 448 bp product was gel purified.

Three PCR products were then stitched with primers Sp17 / 24opt and AstrNef in the second PCR.

PCR: 94 ° C 1min, then 30 cycles: 94 ° C 30sec, 50 ° C 30sec, 72 ° C 4min, final 72 ° C 4min

The 3253 bp product was gel purified, digested with restriction endonuclease NotI and BamHI and cloned into the NotI / BamHI site of vector WRG7077. This places the gene between the CMV promoter / intron A and the bovine growth hormone polyadenylation signal.

Example 9

Plasmid: pGRN # 16 (p17 / p24opt corr / RT / trNef.)

Gene of interest:

The polyprotein produced by p17 / 24opt / RT / trNef13 ('Gagopt / RT / Nef') was observed to express the cleaved product ˜30 kDa due to an undesirable cluster of codons into p24 around amino acid 270. These were replaced by optimal codons by PCR stitching mutagenesis. Gag 5 'portion for mutation using primers Sp17 / p24opt and GTR-A using p17 / 24opt / RT / trNef13 as template and Gag 3' portion for mutation using primers GTR-S and Asp17 / p24optRT linker Was amplified. Duplication of product included codon changes and gel purified products were stitched together using Sp17 / p24opt and Asp17 / p24optRT linker primers. The product was cleaved with NotI and AgeI and inserted into similarly cleaved p17 / p24opt / RT / trNef13 to generate PGRN. Clone # 16 was identified and run.

primer:

5 ' PCR:

Sp17p24opt (sense)

ATAAGAATGCGGCCGCCATGGGTGCCCGAGCTTCGGT [SEQ ID NO: 11]

GTR-A (antisense)

GCGCACGATCTTGTTCAGGCCCAGGATGATCCACCGTTTATAGATTTCTCC [SEQ ID NO: 12]

3 'PCR

Sense: GTR-S (sense)

ATCCTGGGCCTGAACAAGATCGTGCGCATGTACTCTCCGACATCCATCC [SEQ ID NO: 13]

ASp17p24optRTLinker (antisense)

TGGGGCCCATCAACACTCTGGCTTTGTGTC [SEQ ID NO: 14]

PCR conditions for individual products and stitching using PWO DNA polymerase (Roche):

95 ° C 1min followed by 20 cycles 95 ° C 30s, 55 ° C 30s, 72 ° C 180s, final 72 ° C 120s and 4 ° C.

The 1114 bp product was gel purified and cleaved with NotI and AgeI to release 6647bp fragments which were then gel purified to connect to NotI / AgeI cleaved gel purified p17 / 24opt / RT / trNef13 to generate pGRN # 16.

Example 10:

Plasmid: p73i-GRN2 Clone # 19

(p17 / p24 (opt) / RT (opt) / trNef)-recovered

Gene of interest:

Of the codon optimized gag, codon optimized RT and truncated Nef genes from HIV-1 clade B strain HXB2 located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit β-globin poly-adenylation signal p17 / p24 moiety.

Plasmids containing the trNef gene derived from plasmid p17 / 24trNef1 contain a PCR error, which changes amino acid 19 from R to H from the end of nef. This was corrected by PCR mutagenesis, the corrected nef PCR was stitched from p7077-RT3 to codon optimized RT, the stitched fragments were cut with ApaI and BamHI and cloned into AapI / BamHI cleaved p73i-GRN.

primer:

PCR coRT from p7077-RT3 using primers:

(Polymerase = PWO (Roche)

Sense: U1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCGGGAT [SEQ ID NO: 15]

AScoRT-Nef

GGTGTGACTGGAAAACCCACCATCAGCACCTTTCTAATCCCCGC [SEQ ID NO: 16]

Cycle: Hold at 95 ° C (30s), followed by 20 cycles at 95 ° C (30s), 55 ° C (30s), 72 ° C (180s), followed by 72 ° C (120s) and 4 ° C

1.7 kb PCR product was gel purified.

PCR 5'Nef from p17 / 24trNef1 using primers:

Sense: S-Nef

ATGGTGGGTTTTCCAGTCACACC [SEQ ID NO: 17]

Antisense: ASNef-G:

GATGAAATGCTAGGCGGCTGTCAAACCTC [SEQ ID NO: 18]

Cycle: Hold at 95 ° C (30s), followed by 15 cycles at 95 ° C (30s), 55 ° C (30s), 72 ° C (60s), followed by 72 ° C (120s) and 4 ° C

PCR 3'Nef from p17 / 24trNef1 using primers:

Sense: SNEF-G

GAGGTTTGACAGCCGCCTAGCATTTCATC [SEQ ID NO: 19]

Antisense:

AStrNef (antisense)

CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 20]

Cycle: Hold at 95 ° C (30s), followed by 15 cycles at 95 ° C (30s), 55 ° C (30s), 72 ° C (60s), followed by 72 ° C (120s) and 4 ° C

PCR products were gel purified. Initially two Nef products were stitched using 5 '(S-Nef) and 3' (AstrNef) primers.

Cycle: Hold at 95 ° C (30s), followed by 15 cycles at 95 ° C (30s), 55 ° C (30s), 72 ° C (60s), followed by 72 ° C (180s) and 4 ° C

PCR products were PCR washed and stitched using U1 and AstrNef primers using primers for RT products:

Cycle: Hold at 95 ° C (30s), followed by 20 cycles at 95 ° C (30s), 55 ° C (30s), 72 ° C (180s), followed by 72 ° C (180s) and 4 ° C

The 2.1 kb product was gel purified and cleaved with ApaI and BamHI. Plasmid p73I-GRN was also digested with ApaI and BamHI and gel purified to link to ApaI-Bam RT3trNef to regenerate the p17 / p24 (opt) / RT (opt) trNef gene.

Example 11

p73i-GN2 clone # 2 (p17 / p24opt / trNef)-Recovery

Gene of interest:

P17 / p24 portion of the codon optimized gag and truncated Nef gene from the HIV-1 clade B strain HXB2 located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit ß-globin poly-adenylation signal.

Plasmids containing the trNef gene derived from plasmid p17 / 24trNef1 contain a PCR error, which changes amino acid 19 from R to H from the end of Nef. This was corrected by PCR mutagenesis, the corrected fragments were cleaved with BglII and BamHI and cloned into BglII / BamHI cleaved p73I-GN (FIG. 12). The corrected p17 / p24 (opt) / trNef fusion gene was located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit ß-globin poly-adenylation signal.

PCR 5'Nef from p17 / p24 / trNef1 using primers:

Polymerase = PWO (Roche).

Sense: S-Nef

ATGGTGGGTTTTCCAGTCACACC [SEQ ID NO: 21]

Antisense: ASNefG:

GATGAAATGCTAGGCGGCTGTCAAACCTC [SEQ ID NO: 22]

Cycle: 95 ° C (30s) followed by 15 cycles at 95 ° C (30s), 55 ° C (30s), 72 ° C (60s), followed by 72 ° C (120s) and 4 ° C

PCR 3'Nef from p17 / 24trNefl using primers:

Sense: SNEF-G

GAGGTTTGACAGCCGCCTAGCATTTCATC [SEQ ID NO: 23]

Antisense: AStrNef

CGCGGATCCTCAGCAGTTCTTGAAGTACTCC [SEQ ID NO: 24]

Cycle: Hold at 95 ° C (30s), followed by 15 cycles at 95 ° C (30s), 55 ° C (30s), 72 ° C (60s), followed by 72 ° C (120s) and 4 ° C

PCR products were gel purified and stitched using 5 '(S-Nef) and 3' (AstrNef) primers.

Cycle: Hold at 95 ° C (30s), followed by 15 cycles at 95 ° C (30s), 55 ° C (30s), 72 ° C (60s), followed by 72 ° C (180s) and 4 ° C

PCR products were PCR washed, digested with BglII / BamHI, and 367bp fragments were cloned into BglII / BamHI cleaved gel purified p73i-GN by gel purification.

Example 12

Plasmid: p73I-RT w229k (inactivated RT)

Gene of interest:

Generation of Inactivated RT Gene Located Downstream of the Iowa Length HCMV Promoter + Exon1 and Upstream of the Rabbit ß-globin Poly-adenylation Signal

Due to concerns about the use of active HIV RT species in therapeutic vaccines, it was desirable to inactivate genes. This was achieved by PCR mutagenesis at amino acid position 229 of RT (derived from p73I-GRN2) to Lys (R7271 pl-28) in Trp.

primer:

Mutations using PCR 5'RT + primers:

(Polymerase = PWO (Roche)

Sense: RT3-u: 1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCGGGAT [SEQ ID NO: 25]

Antisense: AScoRT-Trp229Lys

GGAGCTCGTAGCCCATCTTCAGGAATGGCGGCTCCTTCT [SEQ ID NO: 26]

Cycle:

1 x [94 ° C (30s)]

15 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (60s)]

1 x [72 ° C (180s)]

PCR gels were purified.

Mutations using PCR 3'RT + primers:

Antisense: RT3-1:

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTGCTCGTTGCCGC [SEQ ID NO: 27]

sense:

ScoRT-Trp229Lys

CCTGAAGATGGGCTACGAGCTCCATG [SEQ ID NO: 28]

Cycle:

1 x [94 ° C (30s)]

15 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (60s)]

1 x [72 ° C] (180s)]

PCR gel purification

PCR products were gel purified and the 5 'and 3' ends of RT were stitched using 5 '(RT3-U1) and 3' (RT3-L1) primers.

Cycle:

1 x [94 ° C (30s)]

15 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (120s)]

1 x [72 ° C (180s)]

PCR products were gel purified and cloned into p7313ie using NotI and BamHI restriction sites, resulting in p73I-RT w229k (see FIG. 13).

Example 13:

Plasmid: p73i-Tgrn (# 3)

Gene of interest:

Of the codon optimized gag, codon optimized RT, and truncated Nef gene from HIV-1 clade B strain HXB2 located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit ß-globin poly-adenylation signal p17 / p24 moiety.

Since triple fusion constructs containing the active form of RT may not be acceptable to regulatory authorities for human use, RT inactivation may result in NheI / ApaI cleavage fragments from p73i-RT w229k and NheI / ApaI cleavage p73i-GRN2 # 19. Was achieved by inserting (see FIG. 14). This causes a W-> K change at position 229 during RT.

Example 14

p73I-Tnrg (# 16)

Gene of interest:

Nef, inactivated codon optimized RT, codon optimized gag cleaved from HIV-1 clade B strain HXB2 located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit ß-globin poly-adenylation signal P17 / p24 portion of the gene.

The sequence of the polyprotein genes encoded by p73i-Tgrn was rearranged by PCR, resulting in p73I-Tnrg by PCR stitching (FIG. 15). Each gene was PCR amplified and purified, and then the genes were PCR stitched to produce a single polyprotein. The product was gel purified, NotI / BamHI digested and linked with NoTI / BamHI cleavage p7313ie.

primer:

trNef PCR

S-Nef (Not I)

CATTAGAGCGGCCGCGATGGTGGGTTTTCCAC [SEQ ID NO: 29]

AS-Nef-coRT linker

GATGGGACTGATGGGGCCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 30]

RTw229k PCR

S-coRT

ATGGGCCCCATCAGTCCCATCGAG [SEQ ID NO: 31]

AS-CORT-p17p24 linker

CAGTACCGAAGCTCGGGCACCCATCAGCACCTTTCTAATCCCCGC [SEQ ID NO: 32]

p17p24opt PCR

S-p17p24opt

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 33]

AS-p17p24opt (BamHI)

GATGGGGGATCCTCACAACACTCTGGCTTTGTGTCC [SEQ ID NO: 34]

Stitching Using VENT DNA Polymerase (NEB) and PCR Conditions for Individual Products:

1 x [94 ° C (30s)]

25 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (120s [p17p24 or RT] or 60s [trNef])]

1 x [72 ° C (240s)]

PCR products were gel purified and used in PCR stitching with primers S-trNef (NotI) and AS-p17p24opt (BamHI):

1 x [94 ° C (30s)]

25 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (210s)]

1 x [72 ° C (240s)]

The 3000 bp product was gel purified and digested with NotI and BamHI which was PCR washed and linked to NotI / BamHI digested and gel purified p7313ie to generate p73i-Tnrg.

Example 15:

Plasmid: P73i-Tngr (# 3)

Gene of interest:

Truncated Nef from the HIV-1 clade B strain HXB2 located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit ß-globin poly-adenylation signal, p17 / p24 portion of the codon optimized gag gene, and Inactivated codon optimized RT gene.

The sequence of genes of the polyprotein encoded by p73i-Tgrn was rearranged by PCR to generate p73I-Tngr (FIG. 16). Codon optimized p17 / p24 and RT were generated as a single product and PCR stitched to produce amplified trNef. The product was gel purified, NotI / BamHI digested and linked to NoTI / BamHI cleavage p7313ie.

primer:

P17 / P24-RT 3'PCR:

Sp17p24opt (sense)

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 35]

RT3 1: 1 (antisense)

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTGCTCGTTGCCGC [SEQ ID NO: 36]

TrNef 5'PCR

S-Nef (NotI)

CATTAGAGCGGCCGCGATGGTGGGTTTTCCAC [SEQ ID NO: 37]

AS-Nef-p17p24

CAGTACCGAAGCTCGGGCACCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 38]

Stitching Using VENT DNA Polymerase (NEB) and PCR Conditions for Individual Products:

1 x [94 ° C (30s)]

25 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (180s [p17p24 + RT] or 60s [trNef] or 210s [Stitching])]

1 x [72 ° C (240s)]

The 3000 bp product was gel purified and digested with NotI and BamHI which was PCR washed and linked to NotI / BamHI digested and gel purified p7313ie to generate p73i-Tngr.

Example 16:

Plasmid: p73I-Trgn (# 6)

Gene of interest:

P17 of inactivated codon optimized RT, codon optimized gag gene from HIV-1 clade B strain HXB2 located downstream of Iowa length HCMV promoter + exon1 and upstream of rabbit ß-globin poly-adenylation signal / p24 moiety and truncated Nef gene.

The sequence of genes in the construct was achieved by PCR amplification of p17p24-trNef and RTw229k from plasmids p73I-GN2 and p73I-RTw229k, respectively, PCR stitching and gel purification of the product, NotI / BamHI cleavage and then to NotI / BamHI cleavage p7313ie Connected. Sequencing showed that p17p24 was not fully optimized and the 700 bp fragment was then AgeI / MunI cleaved from the encoding region and replaced with MunI / Age fragment from p73i-Tgrn # 3 containing the calibration coding sequence (FIG. 17).

primer:

p17p24-trNef PCR

S-p17p24opt

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 39]

AstrNef (BamHI)

RTw229k

RT3-U: 1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCGGGAT [SEQ ID NO: 40]

AS-coRT-p17p24opt linker

CAGTACCGAAGCTCGGGCACCCATCAGCACCTTTCTAATCCCCGC [SEQ ID NO: 41]

Stitching Using VENT DNA Polymerase (NEB) and PCR Conditions for Individual Products:

1 x [94 ° C (30s)]

25 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (120s (PCR) or 180s (stitching)

1 x [72 ° C (240s)]

The 3000 bp product from the PCR stitch was gel purified and cleaved with NotI and BamHI which was PCR washed and linked to NotI / BamHI digested and gel purified p7313ie to generate p73i-Tngr. Sequence analysis showed that the p17p24 sequence obtained from p73I-GN2 was not fully optimized and carried over to the new plasmid. This was cut by cleaving the 700 bp fragment from p73i-Tngr digested with MunI and AgeI and linking it with 700 bp MunI / AgeI digestion product from p73i-Tgrn to give construct p73I-TNgr # 6.

Example 17:

Plasmid: p73i-Trng (# 11)

Gene of interest:

Inactivated codon optimized RT, truncated Nef and codon optimized from HIV-1 clade B strain HXB2 located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit ß-globin poly-adenylation signal p17 / p24 partial gene of the gag gene.

Sequence of the genes in the construct was achieved by PCR amplification of the RT-trNef and p17p24 genes from p73i-Tgrn. Two DNA fragments were PCR stitched and the 3 kb product was gel purified, NotI / BamHI cleaved and NotI / BamHI digested p7313ie Linked to and obtained p73I-Trng (# 11)

primer:

RTw229k-trNef

RT3-u: 1

GAATTCGCGGCCGCGATGGGCCCCATCAGTCCCATCGAGACCGTGCCGGTGAAGCTGAAACCCGGGAT [SEQ ID NO: 42]

AS-Nef-p17p24opt linker

CAGTACCGAAGCTCGGGCACCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 43]

p17p24

S-p17p24opt

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 44]

AS-p17p24opt (BamHI)

GATGGGGGATCCTCACAACACTCTGGCTTTGTGTCC [SEQ ID NO: 45]

Stitching Using VENT DNA Polymerase (NEB) and PCR Conditions for Individual Products:

1 x [94 ° C (30s)]

25 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (120s (gene PCR) or 180s (stitching)

1 x [72 ° C (240s)]

The 3000 bp product from the PCR stitch was gel purified and cleaved with NotI and BamHI which was PCR washed and linked to p7313ie digested and gel purified to NotI / BamHI to generate p73i-Tngr.

Example 18:

p73i-Tgnr (# f1)

Gene of interest:

P17 / p24 portion of the codon optimized gag gene from the HIV-1 clade B strain HXB2, located downstream of the Iowa length HCMV promoter + exon1 and upstream of the rabbit ß-globin poly-adenylation signal, truncated Nef and Inactivated codon optimized RT gene.

The order of genes in the construct was achieved by PCR amplification of p17p24-trNef and RTw229k from plasmids p73I-GN2 and p73I-RTw229k, respectively. PCR was stitched and the product was gel purified, NotI / BamHI digested and then linked to NotI / BamHI digested p7313ie. Two sequence errors were found in the sequences (p17p24 and RT) and repaired by subsequently replacing them with the corrected portion of the gene utilization restriction site in the polyprotein (FIG. 19).

primer:

p17p24-trNef PCR

S-p17p24opt

ATGGGTGCCCGAGCTTCGGTACTG [SEQ ID NO: 46]

AS-Nef-coRT Linker

GATGGGACTGATGGGGCCCATGCAGTTCTTGAACTACTCCGG [SEQ ID NO: 47]

RTw229k

S-coRT

ATGGGCCCCATCAGTCCCATCGAG [SEQ ID NO: 48]

RT3-1: 1

GAATTCGGATCCTTACAGCACCTTTCTAATCCCCGCACTCACCAGCTTGTCGACCTG CTCGTTGCCGC [SEQ ID NO: 49]

Stitching Using VENT DNA Polymerase (NEB) and PCR Conditions for Individual Products:

1 x [94 ° C (30s)]

25 x [94 ° C (30s) / 55 ° C (30s) / 72 ° C (120s (PCR) or 180s (stitching)

1 x [72 ° C (240s)]

The 3000 bp product was gel purified and digested with NotI and BamHI which was PCR washed and linked to NotI / BamHI digested and gel purified p7313ie to generate p73i-Tngr. Sequencing showed that p17p24 was not fully optimized and the 700bp fragment was subsequently AgeI / MunI cleaved from the encoding region and from p73i-Tgrn # 3 containing the calibration coding sequence it was replaced with MunI / Age fragment. The polyprotein also contained a single point mutation (G2609A) resulting in amino acid substitution from Thr to Ala in the RT portion of the protein. Mutations were corrected for ApaI / BamHI digestion of the constructs and PCR rinsing removed the mutated sequences and replaced by linkage with the ApaI / BamHI digestion portion of RT from p73i-Tgnr.

Example 19:

Preparation of plasmid-coated 'gold slurry' for 'gene gun' DNA cartridges

Plasmid-DNA (about 1 μg / μl, eg 100 ug) and 2 μm gold particles eg 50 mg (PowderJect) were suspended in 0.05M spermidine eg 100 μl (Sigma). DNA was precipitated onto gold particles by addition of 1 M CaCl ₂ , for example 100 μl (American Pharmaceutical Partners, Inc., USA). DNA / gold complexes were incubated at room temperature for 10 minutes and washed three times (eg 3 × 1 ml) in dry ethanol (pre-dried on molecular sieve 3A (BDH)). Samples were resuspended in anhydrous ethanol containing 0.05 mg / ml polyvinylpyrrolidone (PVP, Sigma) and digested into three equal fragments in 1.5 ml small centrifuge tubes (Eppendorf). The nuclei were for (a) 'gold slurry', (b) eluent- analysis of plasmid eluted from (a) and (c) preparation of gold / plasmid coated Tefzel cartridges for 'gene gun' (see Example 3 below). ). For the preparation of samples (a) and (b), the tube containing the plasmid DNA / 'gold slurry' in ethanol / PVP was spun for 2 minutes at full speed in an Eppendorf 5418 small centrifuge, the supernatant was removed and the 'gene' Total 'was dried at room temperature for 10 minutes. Sample (a) was resuspended in 0.5-1.0 μg / μl of plasmid DNA in TE pH 8.0w assuming about 50% coverage. For elution, sample (b) is resuspended in 0.5-1.0 μg / μl of plasmid DNA in TE pH 8.0w, incubated at 37 ° C. for 30 minutes, vibrated violently and best in an Eppendorf 5418 small centrifuge Spin at speed for 2 minutes, remove the upper eluate and store at -20 ° C. The exact DNA concentration eluted was determined by spectrophotometry using Genequant II (Pharmacia Biotech).

Example 20:

Preparation of Cartridges for DNA Immunization

Cartridges for the Accell gene delivery device were prepared as already known (Eisenbraun et al DNA and Cell Biology, 1993 Vol 12 No 9 pp 791-797; Pertner et al. In short, the plasmid DNA was coated onto 2 μm gold particles (DeGUssa Corp., South Plainfield, NJ, USA) and loaded into Tefzel tubing, then cut into 1.27 cm lengths, obtained as a cartridge and dried at 4 ° C. until use. Stored. In a typical vaccination, each cartridge contained 0.5 mg of gold coated with a total 0.5 μg DNA / cartridge.

Example 21:

Immune response to HIV antigen following DNA vaccination with gene gun.

Mice (n = 3 / group) were encoded with nucleic acids and vaccinated with antigens placed in two vectors. p7077 uses the HCMV IE promoter (fcmv promoter), which includes intron A and exon 1. P73I carries the same antigen but contains the HCMV IE promoter (icmv promoter) without intron A but with exon 1.

Plasmids were delivered to shaved abdominal skin target sites in F1 (C3H × Balb / c) mice. Mice were first immunized on day 0 with 2 × 0.5 μg DNA, boosted on day 35 with 2 × 0.5 μg DNA and cell responses were detected on day 40 using IFN-gamma Elispot.

P73I-Empty Vector

P7077-Ball Vector

ㆍ P7077 GRN-(f CMV promoter) Gag, RT, Nef

ㆍ P73I GRN-(i CMV Promoter) Gag, RT, Nef

ㆍ P73I GR3N-(CMV Promoter) Optimized Gag, Optimized RT, Nef

ㆍ P7077 GN-(f CMV promoter) Gag, Nef

ㆍ P73I GN-(i CMV Promoter) Gag, Nef

Cytotoxic T Cell Response

Cytotoxic T cell responses were assessed by CD8 + T cell-limited IFN-γ ELISPOT assay of splenocytes harvested after 5 days. Mice were killed with cervical distal bone and spleens were harvested into ice cold PBS. Splenocytes were teased into phosphate buffered saline (PBS) and red blood cells were lysed (1 min in a buffer consisting of 155 mM NH ₄ Cl, 10 mM KHCO ₃ , O.lmM EDTA). After washing twice in PBS to remove particulates, single cell suspensions were fragmented into ELISPOT plates that were previously coated with capture IFN- [gamma] antibodies and stimulated with CD8-restricted cognate peptides (Gag, Nef or RT). After overnight incubation, IFN- [gamma] producing cells were visualized by application of anti-murine IFN- [gamma] -biotin labeled antibody (Pharmingen) followed by streptavidin-conjugated alkaline phosphatase and quantified using image analysis.

The results of this experiment are shown in FIGS. 20, 21 and 22.

Example 22:

Immunogenicity of Vaccine Constructs

1. Cell assay

Cellular immune responses include cytotoxic CD8 cells and helper CD4 cells. A sensitivity assay for detecting specific CD8 and CD4 cells is an ELIspot assay that can be used to quantify the number of cells capable of isolating interferon-γ or IL-2. ELIspot assays rely on the capture of cytokines isolated from individual cells. In sum, dedicated microtiter plates were coated with anti-cytokine antibodies. Splenocytes isolated from immunized animals were incubated overnight in the presence of specific peptides representing known epitopes (CD8) or proteins (CD4). When the cells are stimulated to release cytokines, they bind to antibodies on the surface of the plate around the local individual producing cells. Cytokines remain attached to the coated antibody after the cells are lysed and the plates are washed. This assay is developed in a manner similar to the ELISA assay using a biotin / avitin amplification system. The number of spots corresponds to the number of cytokine producing cells.

CD8 response to the following K2 ^d -limiting murine epitopes: Gag (AMQMLKETI), Nef (MTYKAAVDL) and RT (YYDPSKDLI) and CD4 responses to Gag and RT proteins were recorded for all six constructs. The results of these assays were statistically analyzed to grade the constructs according to their immunogenicity. The results are shown in FIG.

2. Humoral assay

Blood samples were collected for antibody analysis on days 7 and 14 after boost from two experiments. Serum was separated and stored frozen until antibody titers could be measured using specific ELISA assays. All samples were tested for antibodies against Gag, Nef and RT. In short, ELISA plates were coated with the relevant proteins. Excess protein was washed away and then diluted serum samples were incubated in wells. Serum samples were washed and added to the appropriate tags conjugated anti-mouse antiserum. The plate is developed and read with a flake reader. The results are shown in FIG.

3. Antibody Data

Antibody titers were measured for all six constructs in four trials. Construct p73i-GNR did not consistently elicit an antibody response to Gag and limited the antibody response to Nef. The reason is not clear, as the T-cell response is observed in splenocytes isolated from the same mouse, which means that the Gag protein is expressed in vivo.

The grades for Gag specific antibody production were as follows:

RNG> GRN> NRG> RGN> NGR> GNR

Cellular Immunology Data Analysis

Subjects were graded six constructs based on spot count data from three immunology experiments. Three sets of responses were measured:

CD8 response to Gag, Nef and RT on day 7 (7 days after primary),

CD4 Response to Gag and RT at Day 35 (7 Days After Boost)

CD8 response to Gag, Nef and RT on day 35 (7 days after boost).

Each response (eg CD8 response to Gag) was modeled using a linear mixed efficacy model in SAS version 8. The model included the fixed potency of the construct, the presence of specific antigens (Gag, Nef or RT), and the presence of IL-2. In addition, for the CD8 response, subjects were included as random efficacy in the model if the data were available from individual mice. The model included interaction conditions that allowed for different efficacy of the constructs for each combination of antigen (presence / absence) and IL-2 (presence / absence).

From the model, the difference in the adjusted mean response between each construct and p7313 (control), along with the p-value indicating whether the difference is statistically significant, is present in the antigen (presence / absence) and IL-2 (presence). Each combination of individual components). The constructs are graded based on the p-value in the presence of the antigen and in the absence of IL-2 and the difference, with 6 points for the construct with the largest difference and 5 next with the largest, but We assigned 0 for all constructs where the difference was not statistically significant at the 5% level.

The model was evaluated using a graph method and sensitivity analysis, assuming that the error was normally distributed as a constant deviation. The first-order logarithm and second-order square root transformation of the response were modeled. The rating of the construct was not sensitive to initiation from the model's assumptions.

The grade for each response was calculated individually for each experiment, and the overall grade for three sets of responses was calculated for all three experiments. The table below shows the overall rating for the three experiments.

Overall rating of the construct for each of three sets of responses to three immunological experiments

Construct 7th day (the 7th after the first) CD8 Day 35 (seven days after boost) CD4 CD8 GRN 5 18 3 GNR 17 24 28 RGN 28 23 33 RNG 25 27 37 NRG 25 19 0 NGR 4 14 10

RNG is the highest rating for both set 2 reactions on day 35, and the second highest is RGN on day 7, RGN is also high on both set 2 reactions on day 35

Claims (21)

A nucleotide sequence encoding a fragment containing an HIV-1 gag protein or gag epitope operably linked to a heterologous promoter, and a fragment encoding a second HIV antigen or epitope thereof. The nucleotide sequence of claim 1, wherein the second HIV antigen is selected from the group consisting of a nef or a nef epitope thereof, or a fragment containing a reverse transcriptase (RT) or an RT epitope thereof. 3. The nucleotide sequence of claim 1 or 2, wherein the gag protein comprises p17. 4. The nucleotide sequence of claim 3, wherein the gag protein further comprises p24. 5. The nucleotide sequence of claim 1, wherein the gag sequence is codon optimized to resemble codon usage in highly expressed human genes. 6. The fragment of claim 1, wherein the sequence comprises a fragment containing an HIV-1 gag protein or a gag epitope, a fragment containing a nef protein or a nef epitope, and a fragment containing an RT protein or an RT epitope. , Preferably, RT, gag, nef or nucleotide sequence characterized in that the encoding in the order of RT, nef, gag. 7. The nucleotide sequence of claim 2, wherein the RT sequence or fragment thereof is codon optimized to resemble a highly expressed human gene. 8. 8. The nucleotide sequence of claim 1, wherein the nucleotide sequence encodes a nef protein or epitope thereof. 9. Nucleotide sequence selected from the group consisting of: Gag (p17, p24), nef cleavage; (Codon optimized) gag (p17, p24), nef (cut); Gag (p17, p24), RT, nef (cut); Codon optimized gag (p17, p24), RT, nef (cut); Codon optimized gag (p17, p24), codon optimized RT, nef cleavage; (Codon optimized) RT, codon optimized gag (p17, p24), nef cleavage; And (Codon optimized) RT, nef cleavage, codon optimized gag p17, p24. 10. The nucleotide sequence of any one of claims 1 to 9, wherein the heterologous promoter is a promoter from the HCMV IE gene. The nucleotide sequence of claim 10, wherein 5 ′ of the promoter comprises exon 1. A vector comprising a nucleotide sequence according to any of the preceding claims. 13. The vector of claim 12, wherein the vector is a double stranded DNA plasmid. A pharmaceutical composition comprising a nucleotide sequence according to any one of claims 1 to 11 or a vector according to claim 12 or 13 and a pharmaceutically acceptable excipient, diluent, carrier or adjuvant. The pharmaceutical composition according to claim 14, which is configured for intramuscular or intradermal delivery. The pharmaceutical composition according to claim 14 or 15, wherein the carrier is a gold bead. Intradermal delivery device comprising a pharmaceutical composition according to any one of claims 14 to 16. A method of treating a patient suffering from or susceptible to disease, comprising administering a safe effective amount of the pharmaceutical composition of claim 14. A nucleotide sequence according to any one of claims 1 to 11, a vector according to claim 12 or 13, or a pharmaceutical composition according to claim 14 for use in medicine. Use of a nucleotide sequence according to any one of claims 1 to 11 for the manufacture of a medicament for the treatment of a disease. A nucleotide according to any one of claims 1 to 11, including operatively linking a nucleotide sequence encoding a HIV-1 gag protein or fragment thereof and a second HIV protein or fragment thereof to a heterologous promoter sequence. How to prepare.