TWI304810B - Oil body-based purification of proteins - Google Patents

Description

1304810 VII. Designated representative map: (1) The representative representative of the case is: (2). (2) A brief description of the symbol of the representative figure: If there is no eight-style hybrid language, please disclose the chemical that best depends on the hair of the yan. The invention is as follows: [Technical field of the invention] The present invention relates to A method of producing a protein, which comprises purifying the hybrid molecule by expressing a hybrid molecule comprising the protein and the binding oil body protein, and then separating the target protein from the remaining part of the hybrid molecule. [Prior Art] The use of recombinant nucleic acid systems for protein expression and purification is an effective and widely used technique. In general, protein purification requires multiple steps and its production process is often expensive. Purification methods such as sinking method, molecular sieve chromatography (m〇lecular also chr_tGgraphy), electrophoresis, affinity chromatography (aff ini technique chr〇庆庆庆) and common & chromatography (covalent) Chromatography) is a well-known technique and has been commonly used in cell extracts to purify proteins. Such purification methods often require the expression of the target protein as a fusion protein or a nucleus protein. Fusion protein technology is often used to provide "labeling" or "operation" during protein purification. Typically, these systems exhibit fusion proteins that contain an affinity tag, such as glutathione S-transferase ( Glutathione S-transferase), maltose binding protein (brittle-binding pr〇tein), cellulose binding domain (cellul〇se_binding © 5 1304810 domain), polyhistidine (polyhistidine), polycysteine protein a (p 〇iycysteine, protein A) and streptavidin, and covalently bind to the N-terminus or C-terminus of the target protein (Smith DB and Johnson KS 1998 Gene 67: 31-40

Sakhamuru K., et al. 2000. Biotechnol Prog 16: 296-298, Mateo C et al. 2001. J Chromatogr A 915: 97-106.). To facilitate affinity purification, a ligand specific to this label is typically immobilized on a solid phase of the column. After binding to the affinity column, the high purity fusion protein is flushed by adding excess ligand or adjusting the pH of the buffer. The separation of the target protein from the labeling molecule is followed by a defined amount of proteolytic enzyme cleavage into its zygote sequence after introduction into the column or extraction (Schauer-Vukasionovic V., et al. 2002. Anal. Bioanal. Chem. 373 : 501-507.). The preparation and operation of the affinity column used therein is simple but expensive. For example, U.S. Patent No. 4,782,137 discloses an antibody-immobolized immunoaffinity technique that incorporates an expression of a fusion protein comprising an antigenic oligopeptide tag having an "antigenic front end""antigenichead„) part and a "linking tail"("linkingtail") part of the antigenic part of the composition of the hydrophilic amino acid can quickly initiate an antigenic reaction. The marker is cleaved from the desired protein after the fusion protein is isolated from the cell. Other methods involving performance and purification techniques use an enzyme marker such as glutathione transferase, galactosidase (beta_galact〇sidase) and chloramphenicol acetyl transferase, these markers can be combined with appropriate substrates. See Smith DB et al, Gene, 67, 31-40 (1988) for details. The labeled enzyme is fused to the target protein, the fusion product is bound to a fixed substrate, and the labeling enzyme is biochemically Protein excision is required. All of the above examples require special column and expensive reagents. 6 d 1304810 Plant seed oil body is a storage organ for budding and fuel for growth of young plants (this AHC 1996. Plant Physiol. : 1055-1061., Peng CC and Tzen " JCT 1998. Plant Cell Physiol. 39: 35-42., Frandsen GI, 2001.

Physiol· Plant. 112: 301-307.). The oil system consists of a triacylglycerol matrix surrounded by a single layer of phospholipids and a protein having a size of 0.5-2 μm in diameter. (ChenJ.C.F., et al., 1999. Plant Cell Physiol. 40: 1079-1086.). The oil body contains oil film protein, which provides stereo structure exclusion and electronegativity repulsion of φ, making the oil body particularly stable in cells or in separation preparation (Tzen JTC and Huang AHC 1992. J. Cell Bi〇i · Π 7. 327-335., Tzen JTC, et al. 1992. J. Biol. Chem. 267: 15626-15634.). Seed oil bodies extracted from transgenic plants capable of expressing oil film protein fusions have been used as carrier carriers for recombinant protein production and purification (Van R〇〇ij en G. j. H. and M〇丨 (五) Μ M. 1995. Biotechnology. 13:72-77.). Once centrifuged, the fusion of the target protein and oil film protein on the surface of the oil body is like “scum” suspended on the surface of the solution, which can be easily separated and recovered (Tzen JTC, et al. 1997. J. Biochem. - 121:762-768.) The recovered oil body can be directly cleaved by a specific protease on the designed linker sequence to separate the target protein from the oil membrane protein. The South Purity Target Protein can then be recovered from the centrifugation supernatant. The method of using the recombinant oil body is relatively inexpensive compared to the ligand exchange purification method, but high-priced proteases must still be used. In addition, the prior inventions such as the US patent In No. 565〇554, in order to separate the target protein from the knot α/body protein, the protease added during purification must have specificity for the cleavage site in the zygote sequence. Similarly, the target protein cannot contain the same The cleavage site is cleavage site to avoid cleavage of the target protein. These considerations limit the purification method that can be used on this oil body. The choice of proteases in the process. Intein is a self-cleavable peptide, originally found in the yeast (10)/efts TFP1 gene (Kane, P. M., et al,

Science 1990, 250, 651-657). In a later study, it was revealed that the amino acid in the isolation region of the 5>ceVMA intein can be modified to produce a system of in vitro cleavage (in vitr〇splicing) (Chong, S., et al, j. Biol). Chem. 1996, 271, 22159-22168). Among all genetically engineered inteins, the inclusion is particularly striking because it can be dithiothreitol (14_dithi〇threit〇1, DTT) (Mathys, S., et al, Gene 1999, 231 , 1-13) and temperature changes to induce self-cleavage (Southworth, Μ W., et al, BioTechniques 1999, 27, 110-120). Peptide chain cleavage initiated by intein begins with a thioester bond formed at the nitrogen end of the eGyrA intein via N-Sacyl rearrangement. DTT can cleave this thioester bond and initiate the cleavage of the nitrogen end (Telenti, A., & 1, fork)

Bacteriol. 1997, 179, 6378-6382). In contrast, at the permissible temperature, the peptide-containing carbon-terminal asparagine in the DnaB promotes the formation of succinimide and causes separation at the carbon end. There is also a protein fusion expression and purification system IMPACTTM-TWIN System (New England Biolabs, Catalog Number E6_S), which is based on the expression of the target protein shell and intein and chitin binding region (also gamma (10) heart D〇main) is opened into a fusion protein, and then by using the inducible self-cleavage activity of the intein, the target egg is transferred out on a chitin chromatography column to reach a decanting column for protein separation and purification. The advantage of this side is that by using a protein ligation reaction, a non-coding amino acid fragment or a standard 1304810 can be attached to the 6 fine egg from (4). ❹ , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , After the (4)-incorporated protein-containing protein is separated by the #-separation, it is possible to form a cyclic protein by forming a peptide bond at both ends of the cysteine at the end of the chain and the thioacetic acid at the C-terminus.

These products have the following easy-to-operate advantages, including single-column-step purification, without the need for additional steps to remove the affinity-bonded egg (4); without the use of protein - the target protein can be recorded from the fusion; The cleavage side of the sputum and the temperature of the affinity column; the protein expression system containing the cysteine and the end of the bond can be used for labeling, ligation and cyclization of the protein. However, in order to effectively reduce the purification cost of the protein, it is still necessary to reduce the use of the purification column. For example, in the Republic of China Patent Bulletin No. _9322, the oil body and the associative protein as an affinity parent material: provide a molecular method for separating and detaching from the sample, and the properties of the oil-associated protein are used for non-management. The column coding method is as follows: floating or size exclusion method. At present, there is no provision for the separation and release of the target protein from the fusion body without the need of egg __, and the simple method is to clean the method. In the present invention, the inventors use artificial oil bodies (milk out (five) & old) to link the Zhao protein with the protein (9) to the intein to be purified, thereby reducing the cost of purification and eliminating the need for use. Expensive proteases to release target eggs. The use of transgenic plants to express and purify proteins is more expensive and less effective. According to the ingredients of the three brains of the brain, namely, tristearate, phospholipids Relative to the ratio of oil film protein, can be constructed in (in vitrQ) stable artificial milk (four) 1304810 oil bodies, AOBsXTzen, C. et al, J. Biochem. 1998, 123, 319-324., Tai, K. etal , Biosci. Biotech. Bioc Hem. 2002, 66, 2146-2153., Peng, C. etal' Biotechnol. Prog. 2003, 19, 1623-1626.) By virtue of this feasible technique, the A0B system of the present invention can provide the same purity and energy production. Increasing yield is simpler and faster than traditional use of oil bodies from transgenic plants. The A0B system also has an advantage that when the recombinant protein is purified, it can be recovered due to excessive expression of E. coli to enable heterologous transmission; Covering inclusion bodies (inclusi〇nb〇dies) into non-soluble protein forms. Many heterologous soluble proteins that are overexpressed in E. coli tend to form insoluble inclusion bodies. Can be reduced, several protein f renature techniques have been developed (10) ddelberg A. pj 2002· Trends Biotech. 20:437-443.) In the A0B system, the folding process of the target protein is No Oil County From the anti-water end of f. In the process of 郷 fine_胄, the anaesthetic 4 wounds are embedded in the diglyceride matrix, so that the desired protein is left on the surface of the molecule to fold into the correct configuration and restore it Wei. This hybrid resembles a chaperone-assisted folding in a hydrophobic pocket in the Chaperone complex (Hartl FU 1996. Nature 381: 571-579.). A0B can effectively save the cost of purified protein, but the use of proteases such as factor Xa or thrombin to separate the target protein from the recombinant oil membrane protein-binding polypeptide is still quite expensive' thus limiting the utility of this technique. In the present invention, the inventors used the A0B system to link the oil film protein to the protein to be purified by the intein. Thus, the purified thief can be reduced and the expensive protease is not required to release the target protein. The outstanding feature of the present invention is that it achieves the purification of microorganisms and higher organisms, and the self-splicing of the intein based on the oily egg to facilitate the purification of the target protein. The best performance of the actual performance is the big Lin _ and yeast. The invention also has the biological components used to express and purify the polypeptide of the product. In particular, the invention specifically includes a protein purification construct that binds to a product polypeptide. In general, the biological components encompassed by the present invention are as follows: a. An expressed protein purification construct consisting of three parts, each of which is a required & 'in vivo protein or polypeptide, comprising an intein ( Intein) linked polypeptide, and target protein. b. - establishing a recombinant gene for use in purifying the protein; c. a recombinant expression vector comprising the recombinant gene; d. a cell or a higher organism having the expression vector transfl〇rm; e. - a binding oil body protein gene linked to the linked polypeptide; f. the target protein is linked to the linked polypeptide at the carbon or nitrogen term; and g. the target protein can be further associated with the proprotein polypeptide (pr〇pr〇tein, Pr〇qing he) connected. In other words, the invention relates to a polypeptide comprising: a. - a terminal peptide that binds to an oil body; and b. - an intein amino acid fragment linked to a terminal peptide. The polypeptide further comprises a polypeptide of interest. The polypeptide of interest is also linked to an intein. The protein purification construct used in the present invention contains "the protein portion of the oil body-connecting polypeptide-target protein", "the target protein_connecting peptide-binding protein portion of the oil body", and the combination The protein part of the oil body _ connecting peptide (propeptide) - propeptide - target protein and "propeptide target egg 11 1304810 • _ linkage (eGnneetin _e) ~ combined with the protein part of the oil body" and other combination mode, / The U segment and the bound oil body protein moiety can bind to the human body oil body (10)). The second fragment is a ligated sequence in which the peptide contains a self-cleaving activity and _ is attached to the target protein. The third fragment is the target protein, which may be any natural or synthetic quinone peptide' and functions as a protein, preferably an enzyme. In general, the protein of interest consists of an early-polypeptide or a multi-unit product polypeptide. This protein limb meets the final product of _ demand. This protein of interest can be in a variety of forms. The first is a mono-product polypeptide. The second is a multiple-multiple repeat of a single-product, in which the interconnected polypeptides are linked. In both cases, the same intein sequence is included and can therefore be cleaved by the same temperature, division or compound stimulation. The preferred compound for cleavage is dithiothreitol (clear threitol); the temperature range for cleavage is zero. (: to 5 (TC, the preferred temperature range is from generation to grab, and the better temperature range is 25 ° C to 3 rC 'The optimum temperature is 3rc; the range of cracking used is the best pH value of pe Η 9 · 5 ' The range is from ριΐ7 to pH9, and the optimal pH is pH 7.5. The bound oil body fragment in the protein purification construct is usually a binding body protein (body-binding protein), which includes a truncated, altered or functionally Modified • (This refers to better function.) Proteins that bind to oil bodies have a high affinity for oil bodies or oil body derivatives, especially for artificial oil bodies (10). Because of its strong affinity, it is generally combined with the oil body egg to self-align the oil body to make the combination of pure pure content and other cell extracts. Examples of the combination of oil body proteins include oil film proteins obtained from any source, especially from plants and a version that improves their function. The best implementation of binding to oil body proteins is oil film protein (〇leosin). The oil film protein may be derived from a plant, preferably a canola oil. Other combinations of oil body proteins, which can be strongly combined with oil bodies, can perform the same function in the same manner to obtain the same effect, based on the fact that they are the part of the protein purification construct that binds oil body protein 12 1304810

Such a mixture for purifying a protein of interest comprises a hybrid polypeptide of the present invention and an oil body for binding to an oil body peptide in the hybrid polypeptide, and the combined oil body peptide has a high affinity with the oil body. The hybrid polypeptide of the present invention is produced using yeast or bacterial host cells, and a preferred embodiment is the large intestine rod g. Heterozygous refers to the combination of the end of the oil body; the intein amino acid that binds between the oil body peptide and the target protein>[sequence sequence, the fragment self-splicing reaction function available compound, temperature Or a pH change induces initiation; and a target polypeptide which is a multiplex of a single product peptide or a single product peptide, and adjacent product peptides are linked by an intein. In addition, the peptide of the target polypeptide may also be linked to the target polypeptide in an operational direction, and then the self-extinguishing and the lyophilized egg. The heterozygous township is the key to the oil film protein _ cysteine protein, which is combined with triglyceride and vinegar. The oil system is refined from plants by the composition of triglyceride and gamma, preferably from rapeseed oil (c fine oil). AOBs were added to 1 mL of 1% sodium sulphate buffer (pH 7.5), and added to 15 succinate (separated from rapeseed oil (_1&) obtained from Leader Price ca, TW) , 15_ phospholipid, and containing 55 (^g oil film protein_heteropolypeptide E. coli debris sediment layer • composed of oil body extracted from vegetable Xuan oil, artificial synthesis, oil body triglyceride and bowl. Month. The ratio is 50:1 to 1:50, and the preferred embodiment is 100: :1〇〇, and the best embodiment is 1GG: 嶙 嶙 and heterozygous polypeptide _ is 1: 10 to 1 〇: The preferred embodiment is 1: 4 to 4: 1, and the preferred embodiment is 丨: 4.

Add the I process after the translation. It consists of - (iv) molecular_shear-linking reaction. The proteinaceous intein is a polypeptide sequence in a protein precursor that catalyzes its own cleavage from the protein precursor, allowing the protein to be succulent from the fucking egg. This turn (4) contains the splicing element as the target egg self-quality in the recombination of the hybrid. 13 1304810. The purified structure of the protein encoded by the t-group gene contains the Wangzi no.# segment, each of which is the third segment of the construction, and the township peptide phase is encoded. The measurement of the # segment is such that the gene f fragment that binds to the oil body protein gene or the target egg is preferentially read. A preferred protein purification construct is such that the binding oil body protein gene fragment can be preferentially read. Gene fragments can be obtained synthetically or from natural sources. The DNA sequence of the target protein is derived from the genomic or synthetically fragile sequence of the ship or naturally isolated. Including the performance of the heavy wire 雠·Guxian County silk core filaments are now the egg of the invention (10) φ chemical body. The expression vector comprises a protein purification construct gene and a base vector fragment. The base vector fragment can include DNA sequences that are capable of proper transcription, translation, phenotype, transient or other expression regulation, RNA binding regulation or manipulation with the product. The performance vector generally includes structural features such as a promoter, an operator, a regulatory sequence, and a translation termination message. The expression vector can be synthesized from a host or a higher organism compatible base vector which provides the aforementioned features. The regulatory sequences of the expression vector will be specifically or in a heterozygous manner compatible with prokaryotic or eukaryotic host cells or higher organisms. The post-Wei regulatory sequence that directs the secretion of the protein purification construct can also be included in the expression vector. A preferred expression vector is capable of acting on a host cell or a higher organism at the same time, and is stimulated to cause excessive expression of the protein purification construct. Transduced prokaryotic or eukaryotic cells or higher organisms carrying appropriately recombinant prokaryotic or eukaryotic vectors constitute the transformed microorganism and higher organism of the present invention. Prokaryotic cell hosts include any prokaryotic cell that is compliant with foreign proteins. A preferred embodiment is Escherichia coli. Eukaryotic cells include single cell organisms such as yeast cells, as well as undead cells derived from higher organisms such as plants, insects or mammals. A preferred eukaryotic host is a yeast. Useful higher organism hosts include higher plants and animals with germ cells that can be transformed. Plants include tobacco, maize, yellow ugly, and fruit-producing plants, invertebrates and vertebrates such as fish, birds and mammals, including 1304810 sheep, goats, cattle, horses, and pigs. The invention also encompasses a cultured host cell transformed from the above expression vector or a body composition or animal capable of expressing this purified egg method. In general, the methods claimed in the present invention comprise the following: (a) a host cell or host organism regulated by recombinant expression of a recombinant gene sequence carrying a protein purification construct; (b) an oil-based separation Techniques for purifying a protein purified construct product; and (c) self-cleaving the protein purification construct by temperature or chemical stimulation in one or more procedures to prepare a product polypeptide. The steps of the method of expression contained in the present invention are based on microbial or higher biological protein expression. The step requires the recombinant base to be a suitable basic vector, and the recombinant vector is then transformed into a host cell or a higher organism. Preferably, the heavy domain exhibits a soluble product of the purified structure of the protein in the host cell or higher organism, or an insoluble product expressed in the cytoplasm, or becomes a host cell or a higher biologically secreted product. t select the higher organism silk host, the creature is fertilized _ cell _, and Na's creature is bred in a thief. The purification step requires the protein purification construct to bind to the artificial oil body and separate it from other cellular components, fragments and culture. The target protein is obtained by self-cleaving the intein on the protein purification construct under the stimulation of temperature, pH or compound, thereby separating the target protein from the cleavage enzyme. Another method of this purification step is to separate the protein purification construct from the fiber, after purification, and by temperature or chemical reaction, to produce a mixture comprising the target egg self-mass and the binding oil body protein. This mixture can separate oil body proteins using Α0Β and purify the target protein. The present invention relates to a method for purifying a target protein, comprising the steps of: a. preparing a hybrid polypeptide comprising: · 15 ! 3 〇 〇 〇 一 一 一 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合 结合An intein amino acid fragment to the target protein's self-splicing reaction function can be initiated by a compound, temperature or pH change; and 111. a target polypeptide which is a single product peptide or a single product peptide Multiple repeats, while adjacent product peptides are linked by inteins; b. mixing the polypeptide with the oil body to form an oil body mixture; c. separating the oil body mixture from the remaining cell extract fragments; d· The polypeptide of interest is cleaved from the bound oil body; and e. separates the polypeptide of interest from the remaining oil body mixture. According to the method of the present invention, wherein the mixture of step b can be generated using ultrasonic oscillation; the separation of step c can be carried out by centrifugation; and the target polypeptide of step e can be separated from the remainder of the oil body mixture by centrifugation. Preferred embodiments of the method include the expression of a recombinant gene, wherein the constituent nucleic acid fragments of the recombinant gene include lynized egg (or a modified version thereof), an intein, and a single product polypeptide or a multi-unit product. In addition, the preferred specific examples include E. coli or yeast for performance, and impurities such as temperature, nutrients, isopropyl thi〇galactoside (IPTG), 吲哚acrylic acid (ind 〇le acryHc acid) 'Break the performance of the eggs from the purification of the sputum and other materials. More preferred embodiments include the expression vector of prokaryotic cells, wherein the construction of the merged diplasts, and the expression of the yeast cells, the combined health of the towel (Eco-e vector) having an Escherichia coli and a yeast Replication start point (〇rigin μ replication) ° Detailed description of the invention 16 1304810 • , '° combined use of the host and the host cell to cut the host organism's biological integration system, for the table, now - a foreign protein has It is a well-known technique for biochemical protein injection. The present invention utilizes a novel improved performance technique combined with an oil body-based separation technique to establish a biosynthetic method that is unprecedented in cost and low in cost. By using the intein as the cleavage mechanism of the isolated protein. The present invention eliminates the use of expensive machines and reagents as well as lengthy chemistry. Time required for synthesis. - This county's method integration provides factors that are sufficiently efficient and reduce the cost of purifying the marrow. • In the protein purification construct designed for the Na system used in the present invention, the unique protein and the combined oil portion can be clean and light (4) separating the target egg from other components. Centrifugation is the most common (4) separation technique of the present invention, thereby reducing the cost of various types of pure wire columns and expensive reagents. ΙΑ·Expression method-host cell 发 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 生物学 贱 贱 贱 贱 贱 贱 贱 贱 魏 魏The purification of the protein in the vector is carried out by inserting the nucleic acid fragment encoding the protein purification construct into a suitable basic vector. - In the 'planting body's financial needle, combined with the lyophilized egg (four) leg fragment, _ the oil film protein. Gene, for example, the gene is inserted into a basal plastid that is compatible with the host to be transformed. This basal body contains the necessary regulatory sequences to facilitate the large representation of gene fragments placed downstream. - Synthetic viscous sequence ' wherein the sequence is encoded as an intein, inserted near the 3' end of the binding oil body protein gene. In the vicinity of the binding protein gene 3, the position-restriction enzyme cleavage site is inserted in order to insert the surface. In addition, at least the tilt-limit_butter position (the intermediate restriction enzyme cleavage site) must also be designed into the DNA sequence of the intein synthesized, such that the DNA fragment of the target protein can then be inserted into the correct reading frame. If these restriction enzyme cleavage sites are absent, site-directed mutagenesis is performed according to the standard procedure of Sam 130, J., et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989). The design is imported into this location.

The resulting vector construct is an intermediate vector for the incorporation of the protein purified construct gene into the larger vector. Any DNA sequence from nature or synthetic can be inserted into the restriction enzyme cleavage site of the intermediate vector vector to incorporate the protein purification construct gene of the expression vector. Appropriate insertion and framing can be confirmed by known techniques such as the binding region of the nucleic acid sequencing sequence binding protein to various fusion DNA polypeptide sequences according to the Sambro〇k experimental manual. Alternative synthetic routes can also be used to prepare the same expression vector. One of the alternative synthetic pathways is that any egg from the purified construct can be ligated to form an inter-tissue gene, which in turn binds to a third stretch of 0-like fragments to produce an independent protein purified construct gene (ie, separate entities). The lyric self-acting gene can be inserted into the appropriate basal dragon by the aforementioned restriction enzyme _ money processing. If the base vector has an appropriate unique restriction enzyme cleavage site, it can be inserted into the vector using the procedure published in the Sambrook Laboratory Manual. Substitute alternatives ‘In the miscellaneous miscellaneous sense, the Lin’s cap gene can be transferred to the Qing. The first phase of the combination of the oily gene) is based on the procedures of the experimental manual (10), including the construction of appropriate and appropriate vectors. The basis of the system and the construction of the final stalk _ _ method, also: the order =:::: 軚 protein-intein-oil body combined with more than the number. All restriction protein genes are inserted into the binding oil body protein with = white = cause and / or mesh 18 1304810 enzyme cleavage, gene segment insertion, ligation and follow-up manual. For related basic procedures, please refer to Sambrook.

The face of the right Wei _ 嶋 恤 恤 , — — — — — — 删 删 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师 师According to the basic scheme of the disclosure, the Gu and the real pavement can be modified on the side or modified.

f When the host cell is a maternal synthesis. (4) Nuclear cells (4), it is best to carry the signal sequence and/or other chicks to say that the egg can be secreted outside the cell or allowed to be translated. The method of the present invention comprises any _, the lining host is compatible, stable and allows the transformation of the morphological quality into a genus. Such miscellaneous includes p. h. p_is, et al., Cloning Vectors ’ % followed by i985. The preferred inter-container carrier is different from the age-sequence, and it depends on the form of the cut. Any restriction enzyme cleavage site can be compatible with the intein DNA sequence, or can be changed by enzyme treatment (such as T4 DNA polymerization i|, S1 nuclease, Klen〇w; i segment, qing _ nUclease or not _e job udeases ) _ can be used by adding a splicer or adapter to ensure that the sequence is correct in the joint area and the reading frame is correctly arranged. The isolates of the host cells transformed with the most recombinant expression vector are screened using phenotypes or other properties designed for the recombinant vector. Basically, such screening characteristics include antibiotic resistance or a complementary host deletion function. Preferred anabolic genes for recombinant vectors of the invention include antibiotic resistant phenotypes, essential amino acid phenotypes and other essential complex phenotypes. Screened transformed host cells cultured in nutrient-containing growth factors and vitamins

19 1304810 • The medium should be used to purify the protein from the protein using a non-inducible expression system. More preferably, the transformed host cell can be grown in the cell to the pre-intermediate log phase using an inducible expression system. The inducing substance is processed to produce a protein purified construct protein product. In general, the host is cultured for several hours, and the cells are collected and lysed to purify the protein contained in the cells. If the fruit of the transgenic host cell is secreted from the egg, it can be raised to the egg. • The self-purified structure product is concentrated in the culture liquid towel. If the host-hybrid protein is purified and purified, the culture is _ until the silk is good. The protein is then purified by the culture of the matured cells. If the protein purified construct product is deposited in the host cell as an insoluble particle, the matured cells are lysed and released into the insoluble particles, and the insoluble particles are dissolved by a chaotropic solution (cha〇tr〇pic) reagent. Refolding in vitro. This process of culture, proliferation and dissolution can be performed in batch or continuous form. In the selection of two alternative protein purification protein production methods, the culture solution of the protein purification construct obtained from the cells is used as a raw material for the crude mixture in the purification method. IB·Performance method one in higher organisms

P - Multi-cell method for the present invention - a gene that is genetically transferred, carries a recombinant protein, and the gene of the purification domain is expressed by a gene that expresses a secret and can purify the structure. The cassette E (Cassette) carrying the protein purification construct gene was prepared by inserting the leg coding fragment of the protein purification construct into a suitable base cassette. The base card is designed to be compatible with the germ cells of the host organism and suitably bind to the genetic material of these cells. It can be carried or altered to carry the appropriate promoter 'traps or chicks and to represent the scales for (4) finely turned eggs from the purified constructs for protein transcription, translation and post-translational modification processes. Second-class organisms include sesame, corn 'yellow beans and plants such as grass, or include such as fish or breastfeeding

20 1304810 (such as goat 'bovine 'horse' rabbits and mice) can be used as a host for this method. In the host 7 = body germ cells are sexually conjugated and the fertilized germ cells are transformed into a recombinant expression assembly. "Transgenic animals can be cultured by re-implanting the transplanted germ cells in the uterus. Plants can also be used as a remainder. The planting wheel uses fine-grain cancer _ (as fine as (4) (10) media transformation or plant protoplasts by electroporation (eiectroporaton) or microinjection method. After the growth of the transgenic animal or the transgenic plant, the plant-derived substance A protein purification construct found in leaves, seeds, fruit or animal tissues such as meat, organs or tissues, such as body fluids, urine or milk. Homogenization and/or concentration of these substances, tissue or secretions can be produced A preliminary mixture comprising a protein purification construct, etc. The mixture is then used to purify the protein of interest. In general, these methods are based on the technical procedures provided in the literature listed in Table 1 to prepare a transgenic sheep and a transgenic mouse.

1. Gordon K., Lee L., Vitale JA, Smith AE, Westphal H., and Hennighausen L. (1987) Bio/Technology, 5, 1183-1187. 2. Pittius CW, Hennighausen L., Lee L., Westphal H., Nichols E., Vitale JA, and Gordon K. (1988) Proc. Natl. Acad. Sci. USA, 85, 5874-5878. 3. Clark AJ, Bessos H., Bishop JD, Brown P., Harris S., Lathe R., McLenaghan M., Prouse C., and Simons JP (1989) Bio/Technology, 7, 487-492. Method for preparing a rabbit for transfer 1. Buhler Th. A., Bruy ere Th. , Went DF, Stranzinger G., and Burki 21 1304810 Κ. (1990) Bio/Technology, 8, 140-143. 方法 Methods for preparing transplanted plants 1. Hooykaas PJJ, and Schilperoort RA (1987) Methods in Enzymology, 153 , 305-313. 2. ShillitoR. D., and Potrykus I., (1987) Methods in Enzymology, 153, 313-336. 3. Weissinger A., Thornes D., Maddock S., Fromm M., and Sanford J. _ (1988) Current Communications in Molecular Biology, (Fraley RT,

Frey NM, and Schell J., eds.) Cold Spring Harbor, NY. 4. Lichtenstein C., and Draper J. (1986) in DNA Cloning, vol. II, (Glover DM ed.), IRL Press Ltd., Oxford UK. II. Purification method

The purification method using A_ system is shown in Figure 9. To carry out the purification, the coarse wheel mixture and Na are combined with the Zhao egg. Egg self-purification can be incorporated into A0B due to its combined oil_portion. _ Ageing towel group New Zealand _ _ _ _ _ _ _ _ _ _ _ ° In order to isolate the target protein, the purified egg domain is subject to a fixed phase or a solution to the target protein, the light, intein portion, and the other target protein. Including the oil body part _ inclusion: - end, the target egg is compiled. The snare towel is detached from the binding oil body protein-intein portion.冱Repeated target released from the external sequence according to the selected expression gene (a) a separate target protein separation pattern, or ', and contains (6) multiple units of the target protein, and requires further processing. 22 1304810 ―Multiple units of multiple planting forms can be scaled together. In the first form, the (10) unit may consist of a series of identical product polypeptides linked by intein fragments. In the other formula 7, the composition of the plurality of early positions may be a series of repeated repeats of a series of different products, 'a non-repetitive unit consisting of a number of _ or a reduced product. Each unit is linked by the above-mentioned intein. Different product polypeptides will be selected such that their physical or chemical properties allow separation in a conventional manner. In addition to the single difficult green record, the time peptide paste is removed as a cracking position, and the sub-composition of the product _ product money can also provide chemical or physical distinction. Separately or in combination with an attached product polypeptide _ contains a base group, anaerobicity, acidity, test H anti-hybridity allowed _ other known township peptide separation green turn, using affinity chromatography, Xuan exchange color layer Analytical method, reverse phase or normal phase chromatography, separation of the product from the flow direction, acid or feed. The one-sided element to be considered when selecting these intein fragments is the intrinsic shape and the gene-coding fragment thereof. The position and change to provide the gene sequence diversity of various fusion peptides 1 diversity allows multi-unit small peptides expression. It is currently known that replied gene sequences are often removed or deleted by the host organism prior to recombination. Since the present invention utilizes self-cleavage of the intein, it is only necessary to change the temperature, the value of the Qiel or the stimulation of the compound to cleave the target white and oil body proteins. Thus the integrity of the product polypeptide can be preserved without compromising the functionality of the product polypeptide. III. Preferred Embodiments - Generally, any protein can be produced and purified in large quantities. The method is useful in the production of a large number of peptides. According to the greening of the oil-based self-contained (four) material, the specific embodiment of the present invention will further read the present invention. The combination of this green implementation and the composition is based on oil film proteins. 23 1304810 III· Α·Biological composition DNA and amino acid sequence of h protein purification construct a. Binding oil body protein fraction The preferred combination oil body egg is oil film protein or its modified or improved version. In detail, the sturdy lyrics are inserted into the expression carrier that is compatible with the gene. The leg of the thief under the sugar zone on the carrier is cut, and the gene is inserted by a flat-end filamentous connection to form a recombinant vector. Alternatively, an alternative restriction enzyme cleavage site sequence can be introduced at the 5, or 3, terminus of the sputum protein gene so that subsequent operations can be performed. A. A. 1· b. Intein fragment A short DNA sequence 'The decoded product of this sequence is an intein which can be inserted into the 3 or 5 end of the intact or part of the oil film protein group S. When inserting a gene, the ugly sequence at the junction still has to go through the aforementioned

Confirmed by standard DNA sequencing in Sambrook et al. A feature of the invention is that the intein' can be automatically cleaved by temperature, pH changes or stimulation of the compound. Inteins known in the art can be used in the scope of the present invention. A preferred embodiment is the intein GyrA and DnaB. A preferred cleavage reaction is initiated by stimulation with temperature, pH or compound. III. A.l c. Variable fusion polypeptide portion The third portion of the sequence consists of the nucleic acid coding sequence of the protein of interest, wherein a preferred embodiment is a single product polypeptide or a plurality of product polypeptide units. The units therein can in turn accommodate one or two product polypeptides. To prepare a single product polypeptide, a single copy of the gene is ligated to the DNA fragment selected by the above list. To prepare two copies of a product polypeptide incorporated in a plurality of units, the binding between the nucleic acid sequences of the two product polypeptides is linked by the DM sequence of the intein, and the nucleic acid sequence of the interconnected polypeptide selected between the units by the foregoing list connect them. After repeated colonization, multiple units of this gene can bind to each other. This multi-unit gene encodes a fusion polypeptide fragment encoding variable 24 1304810. HI. A. 2. Recombinant Genes Incorporate Expression Vectors Recombinant expression vectors that ultimately incorporate a protein purification construct gene are compatible with host cells. The carrier used has many features in common. These features include a replication initiation site compatible with host cells 'DNA sequences for transcriptional regulation and control of transcription (for inducible systems)' an efficient ribosome binding site (prokaryotic host), a P〇 1y_A message (eukaryotic host). In addition, this vector may also include phenotypic genes, regulatory regions and leader sequences. Prokaryotic vectors, such as E. coli, are characterized by a genetic marker (phenotype) for screening of the transformant strain and a DNA regulatory sequence for directing the expression of the target gene. The basic regulatory sequence contains a promoter (P) to initiate transcription. An operon (〇) controls transcription (on/off transition)' an effective ribosome binding site (10) s) to initiate translation, and a transcription termination message. The start and stop codons are provided by the inserted gene segment (protein purification construct). Prokaryotic vectors specifically include a suitable "eXpressi" ncassette" based on any applicable promoter/manipulation subsystem. Promoters typically contained in prokaryotic vectors include galactose, tryptophan, T7, lipoprotein, alkaline phosphatase, lambda left or right promoter or a combination of the above promoters. The galactose and tryptophan operons, as well as the temperature-sensitive lambda promoter, are also typically open/closed species that can be included in prokaryotic vectors. The phenotypic markers typically included in prokaryotic vectors include the development of resistance genes to ampicillin, tetracycline, kanamycin, chloramphenicol. The prokaryotic diplast system includes a T7 promoter for initiating expression of a gene of interest (protein purification construct gene). The second plastid provides a > lysozyme for tight control of performance. The π RNA polymerase gene, under the control of any of the aforementioned promoter/operators, can be placed in a low copy number plastid, incorporated into a chromosome or infected by a lambai cell. The second plastid preferably carries a different genetic marker (i.e., a different phenotypic marker). 1304810 • Eukaryotic vectors, such as those used in yeast performance, basically contain one copy of E. coli and yeast, a genetic origin for both cells, and a DNA regulation to control yeast performance. Sequence shuttle vector. The regulatory sequence generally includes a promoter, a regulatory sequence and a transcription termination message (including a polyadenylati〇n message). It is also possible to insert a message sequence that directs secretion of the cell into the eukaryotic vector. Typical introductory positive screening markers include the provision of uracil, leucine, histidine, adenine, tryptophan and other φ similarities. The gene mutation complements the marker. A preferred promoter sequence incorporated into a eukaryotic vector, comprising alcohol dehydrogenase I or II (1, glyceraldehyde dehydrogenase, phospho Lactose, tryptophan, mating facto _a promoter and other similar products. Insect cell expression system, including the BEVS system contained in US Patent No. 4745〇51. ΠΙ. A· 3. Microbial transformation for metastasis The microorganism capable of expressing the vector may be a prokaryotic cell of a single cell or a eukaryotic multicellular organism based on a cell of a mammal or an insect. A single cell or a simple multicellular '纟 object is a preferred host cell. Preferred host cells include E. coli and yeast Saccharomyces cerevisiae) - a preferred specific complement, such as the field rod 8 fox 21 (10) 3) pLysS secretory diploid prokaryotic expression system. Other large intestine rods can also be used to play the role of this performance system. Yeast® with some proteases is a preferred eukaryotic host when the protein is purified by the (four) degree method. Temperature sensitive yeast mutants are also preferred eukaryotic hosts. ΠΙ. B. Implementation method of performance steps

26 1304810 The reconstituted sieve splicing and construction are carried out in standard light-sequence steps. The restriction enzyme cleavage, insertion, ligation, trace _ and analysis are contained in the aforementioned Sambr〇〇k experimental manual.构 · · 1 1 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组 重组Such as _, Γ step gamma protein purification enzyme knives, nucleic acid insertion and ligation steps are contained in the aforementioned Sambrook laboratory manual. ^

III. B. 2 Multi-unit gene method Transmitted Na (4) (4)-Fu includes the integration of all the early genes and the inter-peptides into an intermediate multi-unit gene. This intermediate multifilament is then transferred to the fusion expression by being directly linked to the phase-containing peptide-encoded visceral sequence. The second method consists of sequentially aligning each of the one-touch gene units and the legs of the interconnected polypeptides to the performance of the age. After the single-base and leg sequences are inserted, the second group is directly connected to the -(four)' in this way to repeat the_connection. In either case, the individual gene units of the one or more product polypeptides and their corresponding internal elements are formed when all of the units and the interconnected polypeptide sequences are inserted. III. B. 3 Method of Transducing Host Cells The shape of the transformation is based on the age of the species. A better implementation of the lion E. coli and nematode cells can be found in the Sambrook Laboratory Manual. Briefly, E. coli is first grown to a degree of growth, at which point a solution is used to make the cell wall or cell membrane permeable. These cells are then mixed with the recombinant nucleic acid. Upon absorption and re-recovery of the recombinant vector, the transformed cells continue to screen for the specific colonies desired in a selective medium. An expression assembly (eXpressi〇ncassette) according to one embodiment of the invention is introduced into a host cell in the form of a performance assembly that is stably incorporated into the genome of the host cell. It is obvious that 27 8 1304810 • * can also be used as a part of the sputum in the host cell and not in the human host cell genome. This method can be found in a variety of vectors such as viruses or shellfish vectors capable of replicating and expressing proteins in host cells. A particular embodiment is a plastid that uncovers the origin of replication, which allows for high copy numbers such as Puc of the large intestine (4). Systematic body. Additionally, the plastid can be altered to include an inducible promoter, a gamma tract attached to the f_IPTG solution. 11B·4 cell culture method #α, 败A狮和杂4 need to bribe. Continue to train to make the egg from the purification structure to achieve good quality. For adequate culture, colonies containing a single recombinant selection are inoculated to an appropriate amount of culture medium, and cultured in an appropriate amount of growth medium under the desired temperature conditions until the cell concentration reading is required. ΙΠ _ B. 5 Separation method Combining oil film proteins into the hall enables a simple and efficient protein purification. Polypeptides fused to the ends of oil film proteins do not affect the ability of the protein to bind to the hall. The paste oil protein carrier or transport method provides - the simple thief New Zealand egg from the f soup body in vivo or reconstituted • The oil body part of the hybrid protein can be achieved in a single step with most of the cell group Separation of matter (such as centrifugation or flotation). IV. PROGRAM, PREPARATION, AND EXAMPLES The following procedures, preparations, and examples further clarify certain aspects of the invention. They do not represent the scope of the invention as set forth above. IV. A. Synthetic gene program 1. Polypeptide of DNA of product polypeptide and DNA sequence The oligonucleic acid representing the DNA sequence of the target protein can generally be synthesized according to the automatic technology of S. l. Beaucage and H. Caruthers, Tet. Letters, 1981. 221, 859-62 28 1304810 or the DNA encoding the 'naturally desired protein can be isolated using the purification techniques disclosed in the Sambrook Laboratory Manual. IV. B. Procedure for gene insertion and transformation The procedures for restriction enzymes, ligation, spinach, transfer culture and dissolution methods of the genes in the present invention 'substantially comply with the basic methods disclosed in the art. The literature providing details includes the work of Sambrook et al. cited above. In a preferred embodiment, the DNA sequence can be joined according to the procedures of the Sarabruk experiment manual cited above. IV. B. 1. Restriction enzyme cleavage procedure a. Intra-restriction enzyme cleavage of dna In general, 0.5 to 2 g of plastid DNA is cleaved with restriction enzymes in 1-20 units in 20 L of 1 restriction enzyme buffer. The reaction mixture was reacted at room temperature for up to 16 hours as recommended by the restriction enzyme supplier. The reaction mixture is then subjected to gel electrophoresis to separate the molecular weight or further purify the DNA according to the standard procedure of the Sambrook Laboratory Manual, cited above. IV·B· 2. Procedure for gene insertion and ligation Generally, the selection vector is subjected to the restriction enzyme cleavage procedure described above to appropriately limit enzymatic cleavage. The linearized vector can then be dephosphorylated by cal f intest ina 1 phosphatase (CIP) or bacteri ia 1 a 1 ka 1 ine phosphatase (BAP). Chemical. The DNA was further purified according to the standard procedure of the Sambrook Laboratory Manual cited above, wherein the procedure was usually performed using a rock carbonic acid extraction and alcohol precipitation. The DNA fragment to be inserted is then mixed with a 3-5-fold (large fragment) or 20-30-fold (short fragment oligo) over-cutting selection vector. The ligation reaction was carried out in 1 ligase buffer (20 inM Tris pH 7. 6,10 inM MgCK 0.4 mM beta-mercaptoethanol, 0. 4-1. 〇mM ATP) in the presence of T4 DNA ligase at 16 The reaction was carried out at ° C for 16 hours. A small number of ligated vectors were used to screen for competent cells and recombinant plastids of E. coli 29 1304810. Ιν·B. 3. Transformation procedure for E. coli In a preferred embodiment, recombinant plastids can be transformed into E. coli according to the art. iV· Β·4· Yeast transformation procedure There are several yeast transformation procedures. Two of the main applications are the spheroplast- and lithium methods, both of which are cited by R〇thstein, r, DNA C1〇ning PP. 45-66, IRL Press Ltd., 〇xford (1986). iV·C. Screening Procedure In a preferred embodiment, the transformed E. coli colonies can be applied to a selective medium containing an appropriate amount of antibiotic to screen their expression (antibiotic resistance). A preferred method of screening for transformed yeast cells is by means of the art using a nutrient omitting medium for screening. Other screening techniques known in the art can also be used. IV. D. Culture Procedure In a preferred embodiment, the method of culturing cells can be processed according to the Sambr〇〇k procedure cited above. In short, the method must transfer a single colony to a small amount (3-5 ml) of a culture medium containing the appropriate antibiotic (such as Luria broth). The culture was cultured at 37T. (or other suitable temperature) and zoom in on a larger volume. The culture of the yeast cells was similar and cultured at 3〇. (; yeast nutrition omitting medium. IV. E. The protein required for the lysis procedure can be extracted by various techniques depending on the characteristics of the zygote host cell, including extracting the culture solution with an aqueous solution, a buffer solution, and grinding, breaking, grinding, etc. Or other means of rupturing the cells. The host cells can be extracted (for example, by centrifugation or deposition of debris) into three parts: > granules or insoluble sediments, liquid supernatants, and a seed-containing lipid The vapor layer of the oil body. These oil bodies contain the native oil body protein and the chimeric oil body protein.

30 1304810, which contains the product polypeptide to be purified. IV. F. Oil protein-based separation procedure and preparation After culture, the desired protein is purified as follows: after centrifugation, because oily impurities can float on the surface, it is required to fuse with oil body protein on the surface of the oil body. Proteins can be easily separated from other cell extracts. Can the resuspended oil body be directly attached to the target protein_stationary phase, or designed to be joined? The order is separated by temperature or chemical material. In the present invention, if a zygote comprises an intein, the suspension buffer is treated with a specific temperature or chemical, and this step releases the desired polypeptide out of the aqueous layer. The second centrifugation step will float the treated oil body to the upper layer of the solution, leaving the released polypeptide or the desired protein in the aqueous layer. The released polypeptide or desired protein may be dried, chemically altered or dried by cold beads depending on its nature or application. IV. G. Final Separation Procedure After the desired protein is cleaved from the bound oil body protein by temperature or chemical, separation of the composition can be accomplished using techniques well known in the art. _ The desired protein released from the recombinant oil body can be centrifuged more than once in high purity in the supernatant. «^(VanRooijenG.J.H. and Moloney Μ. Μ. 1995. Biotechnology. 13: 72-77.). Therefore, the inventors have invented a new method for functional expression and & protein based on bacterial expression and oil body technology. The inventor also used Natto Lin (natt〇ki coffee & performance and function also this new party extract effect. In this method towel, green target protein in the form of insoluble oil film protein fusion polypeptide over-expression, easily by centrifugation Recycling from the debris deposition in cell lysis 'recombination into the Α0Β and separating the self-cleavage function of the intein from A〇B, and finally obtaining the target egg by centrifuging the final, silky way. She is on the past side Na system

31 1304810 Explosive proteases must be used for specific cleavage (Peng, c. c., et al, ^

Biotechnology 2GG4, 111, 51-57), the method utilizes temperature, pH adjustment or stimulation of the chemical dithiothreitol (DTT) to initiate self-cleavage of the intein, which can significantly reduce operating costs. The arbitrarily-targeted egg can be fused with the nitrogen or carbon end of the lysin, and can achieve a yield of about 3 〇〇 mg/L and a recovery of about 6%. Therefore, the user can choose any fusion protocol depending on the limitations of the target protein. Obviously, this system provides a simple and inexpensive method of protein expression and purification. The following examples are not intended to be exhaustive of the full scope of the invention. Furthermore, the present invention may also be used for other implementations. This is an illustration of the scope of the application in this book. [Embodiment] Construction of plastid of Example 1 The oligonucleic acid used for PCR in this example is shown in Table 2. The inventors constructed the final vectors P0SP1 and p〇SP2 in several steps, each having an intein linked to the oil membrane protein at the nitrogen end and the carbon end, respectively. The vector pET-265 (Wang, z. w., et al, lacI. Bi (ytechn〇1.

Prog. 2004, 20, 1352-1358) Amplification of the DNA fragment containing the T7 promoter and laclts (replacement of Gly265 with Asp of lacl) using primers CH015 and CH016. Using the primers CH017 and CH018, DM containing the bla gene was generated from the vector PPL450 (Love, C. A., et al, Escherichia coli. Gene 1996' 176, 49-53). Subsequent bonding of the two pcr DMAs produced the vector PWIN20. Similar to PWIN20, the vector pET29a (Novagen, ffl) was cleaved with the restriction enzyme Xhol-Mlul and ligated with the same restriction enzyme-cleaved pWIN2(R) fragment, thus producing a muitipie ci〇ning site containing the vector pET29a. The vector pj〇i. In order to obtain the oil film protein, the inventors used the primers 8le8 and 〇e9 to increase the vector pET29〇ie (Peng, C. C., et al, J. Agric. Food Chem. 2004, 52, 3115-3119)

Oil film protein gene in 32 1304810. The DM was again re-selected into the Nc〇i-BamHi position of the vector pj〇i to generate the vector pJOl-〇le4. PCR DNA containing the intein Ssp DnaB was generated from the vector pTWIN1 (New England BioLabs, ΜΑ) using the primers Ssp2 and Ssp3. The PCR-amplified DNA was cleaved with pJOl-ole4 with EcoRI-Sall restriction enzyme and ligated to form vector p〇spl. Similarly, the oil film proteins produced by the primers Jo7 and Jo8 are sub-selected into the position of pj〇i.

Set to generate vector pJ01-〇le2. Similarly, the vector pj〇i-〇ie2 and the DNA containing the intein Mxe GyrA were cleaved with restriction enzymes Notl and Hindlll, and ligated into the vector p〇sp2. This intein-containing DNA was obtained from the primer vector Mxe2 and the j〇6 amplification vector pTWIN. Table II. This list of primers used in example g bow I promoter sequence coding Sfe wood CH015 TGCAGGCCTACAGGGCGCfiTCCCΑΤΤΓ (/ T Ί CH016 GATCCTGCAGCCTAATGAGTGAGCTAAC (Pstl) CH017 TCGAGGCCTGCGAGCTTGG (Stul) CH018 CGCTCTGCAGCTTCCTCGomrTi; r ~n CH0112 TGCGGAAnCGCGGAAAAAGCAGTACAG (ΕηΗϋλ Ί Jo6 GACCGCGGCCGCCAGTAGCGTG f exit ΙΊ Jo7 TCGGGCGGCCGCAAATGGCTGAGCAnATG (Ά ^ ίΤΊ Jo8 AGAMCTCGAGTAAAGAAGTTTGAGAC () Hxe2 GCGAATTAAGCTTGGGCTCTTCCTGC (Hindi 11) 01e8 TCTTAGATCTAATGGTGAGCATTATGGTC {BgllI) 01e9 TGAGCCATGGCAACAGGCTGCTGCTGCGAG (Ncol) RC0310 TAGAGTCGACTAAnGTGCAGCTGCTTGTAC (Sail) RC0325 ACATGAATTCGCGCAAATCTGTTCC (EccRl) RC0436 CCATAGATCTGGCCGGAAAAAGCAG (Lai I) RC0437 AGGTGAATTCTTTGTGCAGCTGCTTG (ifccRI) Ssp2 GGTCCCATGGTGCGCGAGTCC {Ncol) 33 1304810

SsP3 GCCGGATCCGGCTCTTCCGTTGTG (square aa/HI) * The position of the introduced restriction enzyme is indicated by parentheses and is indicated by the bottom line below the sequence. • The inventors used two sets of primers to synthesize CH0112-RC0310 and RC0436-RC0437 with PCR from vector pTrc-proNAT (Y. P. Chao) to synthesize a nattokinase gene with its propeptide and pronattokinase. ) DNA. The resulting PCR product was ligated to the p限制SP1 _ and p0SP2 designated restriction enzyme cleavage by restriction enzyme-Enzyme EcoRI_Sa11 or Bglll-EcoRI to generate vectors pNAT1 and pNAT2, respectively. To generate a vector pMT3 similar to pNAT1 but carrying the precursor polypeptide nattokinase gene, the inventors ligated pOSP1 to a nattokinase gene amplification fragment amplified by primer 阢〇31〇 and RC0325. In a similar procedure, the inventors replaced the pro-nattokinase gene in the vector pTrc-proNAT with the vector pTrc-NAT in this PCR fragment. Example 2 Culture Method The inventors transformed the designated vector into the E. coli strain leg (brain) (N〇vagene) and _ (4) penicillin (medicinal screening). The cells of the lion were cultured in -a-(6) her (10)-culture medium, and the cell growth density was measured using a spectrophotometer (Lion, Jasco) with an absorbance of 550 γ. To express the recombinant protein, overnight cultures were prepared and freshly cultured. The cell culture medium was transferred to 37 γ until the cell density reached 0 D coffee value 〇. 5, and starter protein production was induced with 100 μΜ IPTG. After 4 hours of induction, collect the cells by centrifugation and take!虬 〇. 〇 1 M sodium phosphate buffer (Qiu 5) resuspend the cells for subsequent detection. Eight recombination nano-reading enzymes or their precursor proteins, that is, with the leader peptide, nattokinase, were expressed in E. coli under the control of the trc promoter and IpTG induction (Fig.). 34 1304810 • The performance of nattokinase (28 kDa) or pre-nattokinase (37 kDa) occurs mainly in the insoluble fraction after cell lysis (Fig.). This produces lysin kinase or pre-nattokinase without any enzyme activity. Example 2 Preparation of artificial oil tank (Aob) and protein renaturation The Α0Β system is composed of triglyceride, a hybrid peptide of phospholipid and oil membrane protein-cysteine protein. a〇B was prepared in the manner disclosed (Peng, c. c., et al, Bi〇techn〇i. apr〇g. 2003, 19, 1623-1626). The cells in the 1 mL of the nano-buffer buffer were resuspended (to reach Lu OD55. Value 10) #Frenchpress Breaking' and then separated into supernatants and sediment fragments by centrifugation. AOBs were added to 1 mL of 10 mM sodium citrate buffer (pH 7 5), and 15 triglycerides (separated from rapecane oil obtained from Leader Price Co., TW), 15 〇Hongg 鳞月曰, and consists of a 550/zg oil film protein-hybrid polypeptide E. coli fragment precipitation layer. The mixture was treated with ultrasound at a strength of 3 〇% for 2 sec. A〇B was then withdrawn by centrifugation and rinsed with buffer. To obtain the target protein, A0B was treated at the specified temperature or treated with 4 〇 μΜ DTT for 16 hours. Finally, the oil and water layers are separated by centrifugation and analyzed for protein in the aqueous layer or in the oil layer by SDS_pAGE or enzyme activity assay. φ Example Four Protein Analysis Method The inventors analyzed proteins by the SDS-PAGE method known in the art (peng, c. C., et al, J. Biotechnol. 2004, 111, 51-57). The method for detecting the activity of nattokinase is to first add 0.01 mL of the protein sample to 0.9 反应 of the reaction solution, and the reaction solution is 〇 5% caseins in 0.1 Μ sodium phosphate buffer (pH 7_ 5). The enzyme was reacted at 37 ° C for 5 minutes and then 0.1 raL 2N HCl was added to stop the reaction. After centrifugation, the supernatant was recovered and measured at 275 nm. One CU of enzyme activity is defined as 2 tyrosine (tyrosine) produced per minute per mL. Example 5 Expression and purification of natto citrate 35 1304810 using A0B system For functional expression and purification, the inventor first introduced natto Kinase (NK) or pre-nattokinase (proNK) is overexpressed in E. coli via the intein DnaB (intein linked to the carbon-terminal form of oil film protein) (Figure 1). These two overexpressed proteins , that is, the oil film protein-intein S-Μ or the oil film protein-intein s_pr〇NK, are mainly found in the insoluble layer after centrifugation (Fig. 38 '48). Α0Β is mainly deposited by insoluble fragments. It mainly consists of membrane protein-intein S-NK or oil membrane protein-intein S-pr〇NK. After centrifugation, a milk-like "floating" floats on top, while supernatant (sup_2) ) is relatively transparent and contains almost no debris deposition (ppt-2). Membrane protein-intein S_NK or oil film protein_intein S-proNK, and other insoluble bacterial proteins, mainly appear in the A〇B layer ( Figure 3B, four illusions. Ting some Α 0 Β extremely stable and can maintain its number of structures ABOB consisting of TAG, pL and other proteins fused to oil film proteins in similar literature (Peng, CC, et al, J. Biotechnol. 2〇〇4, 111, 51-57, Peng, C. C., etal , J. Agric. Food Chem. 2004, 52, 3115_3119). Using an increase in temperature from 4 ° C to 37 X, the intein can self-cleave and release nattokinase or pre-nattokinase in AOB. It was found that the mature nattokinase appeared mainly in the supernatant (sup-3) in both performance schemes, while the oil membrane protein-intein S mainly appeared in the aob (Fig. 3c, c). The leading precursor polypeptide of nattokinase appears to be cleaved automatically after separation from the oil film protein-intein S. The final supernatant is concentrated to obtain a soluble nattokinase produced by hydrazine.

Example 6 Yield and Performance Optimum pH for Nattokinase To obtain the best purification method, the inventors tested the purified yield at different pH values. Protein yields at pH 7-9 were similar in both performance protocols (using fusion with membrane protein-intein S-NK or with oil membrane protein-containing S-proNK) (Figure 5A). The yield of recombinant natto kinase at pH below 6 was not measured because A0B tends to aggregate under acidic conditions, probably because the surface electronegativity is weakened by neutralization. Based on the better casein water 36 ^04810 cleavage, the nattokinase expressed from the oil film protein-intein S-proNK is more specific than the release from the prion-intein S-NK. Five times higher (Figure 5b). The optimal conditions for the production of nattokinase are as follows: at pH 7.5, the oil membrane protein-intein s~Pr〇NK is used as a recombinant vector in the Α0Β performance/purification system. As expected, fibrinolytic activity was detected in recombinant nattokinase (Figure 6). Example 7 Pre-nattokinase linked to the N-terminus of the oil membrane protein with the integrose ifreGyrA. To test the purification system using the Α0Β expression, can the target protein be fused to the nitrogen end of the oil membrane protein, the inventor will use the former nattokinase as another linker, intein The inclusion of peptide (^, which can stimulate self-cleavage by compound DTT, and fusion with oil film proteins (Fig. 1). This recombinant protein overexpresses, retracts, integrates and self-expresses in the same way as the oil membrane protein carbon end fusion described above. A〇b release (Figure 7). Similarly, 'mature nattokinase can be recovered from the final supernatant, and the precursor precursor polypeptide has been automatically cleaved. The inventor has a heavy weight of _ Bean kinase in the office. The yields at 25 and 37 X (Fig. 8A). The inventors found that at 37%, a fairly efficient yield was obtained, and at this temperature, different pH values were produced for the production of f. The inventors found that according to this scheme, the most The performance of the recombinant nattokinase is at pH 7.5 (Fig. 8B, VIIIc). Example 8 Recovery of the target protein was therefore invented by the inventor - based on bacterial expression and oil body technology, functional expression The inventors of the purified protein I have demonstrated the efficacy of this new method with the performance and function of nattokinase. In this method, the target protein is overexpressed in the form of insoluble oil membrane protein fusion polymorphism, easily by centrifugation. The debris was deposited in the cell lysis, recombined into Α0Β, and then separated by the self-cleavage function of the intein, and finally concentrated by centrifugation of the final supernatant to obtain the target protein (Fig. 9). The inventor also found - The target protein can achieve a yield of about _ _ and a recovery of about 6% regardless of whether it is fused with the nitrogen or carbon end of the lyophilized egg.

37 1^04810, [Simple description of the schema], the purpose, - the card shed all the hair of the day. The relative positions of nattokinase, precursor polypeptide, oil membrane protein, intein s, intein M and their molecular weights are shown on the map of each recombinant polypeptide. B. A series of nattokinase and pre-nattokinase that are expressed in the bacterium. Induction by the inventors with or without the induction of IPTG, (a) natto, 81 and (8) pre-nattokinase were extracted and separated into supernatants (qing-n and sedimentary layers (卯(4), and SDS-PAGE assay. Nattokinase (28 kDa) and pre-nattokinase (37 _ position markers are indicated. Molecular weight markers include (116 (d), bovine serum albumin (66.2 kDa) > ovalbumin (45 kDa) ^ lactate dehydrogenase ( 35 kDa) 'Restriction enzymes Bsp981 (25 kDa) and yS-latoglobulin (18.4 kDa) Figure 3. Analysis of the oil film protein-intein S-NK expressed in E. coli. (A) All oil-containing membrane proteins containing - Escherichia coli containing the peptide S-NK was extracted and separated into supernatant (sup-i)

With the deposited layer (ppt-1). And analyzed by SDS-PAGE. (Β) Α0Β Recombined with lysed cells of the deposited layer (ppt-1) and Escherichia coli containing the oil film protein-intein S_NK. After reconstitution, after 10'000 g, 15 minutes of centrifugation, three layers, a supernatant layer (sup_2), a deposition layer (PPt-2) and A0B were produced. The three layers were analyzed by SDS-PAGE. (C) Increasing the temperature from 4 to 25X to stimulate self-cleavage of the oil membrane protein_intein s-NK recombined with a〇b. The oil layer (cleaved A0B) and the supernatant (sup-3) were separated by centrifugation. Both were analyzed by SDS-PAGE 38 1304810. The positions of nattokinase (28 kDa) and the oil film protein-intein S-ΝΚ (63 kDa) were identified. Figure 4 is an analysis of the oil film protein-intein s_pr〇NK, which is overexpressed in E. coli. (A) All E. coli containing the oil film protein-intein §_ρΓ〇ΝΚ were extracted and separated into the supernatant (sup-1) and the sediment layer (ρρ1 > 1). And analyzed by SDS_pAGE. A〇B recombines with the lysed cells of the deposited layer (ppt-1) and Escherichia coli containing the oil film protein-intein s_pr〇NK. After reconstitution, after 10, g, 15 minutes of centrifugation, three layers, a supernatant layer (sup-2), a sediment layer (ppt-2) and A0B were produced. The three layers were analyzed by SDS-PAGE. (C) Increasing the temperature from 4 to 25T to stimulate self-cleavage of the oil membrane protein-intein s-pr〇NK recombined with Α0Β. The oil layer (cracked A〇B) and the supernatant (3111)_3) were separated by centrifugation. Both were analyzed by SDS-PAGE. The positions of nattokinase (28 kDa) and the oil film protein-intein S-proNK (72 kDa) were identified. Figure 5 shows nattokinase produced by a〇B at different pHs. The (A) yield and (B) relative specific activity of nattokinase obtained from the recombination of oil film protein-containing S-NK (〇) oil membrane protein_intein s_pr〇NK (·) at pH 7 respectively Between 9 measurements. Figure 6 is a fibrinolytic activity (fibrin〇ly1:ic activity) of nattokinase produced from Α0Β. A drop of chicken blood was coagulated on a agarate gel and the caseinlytic activity was measured by treatment with water (control group) or obtained nattokinase. The hydrolysis of blood agglutination was observed for 4 hours at room temperature. Figure VII is an analysis of the overexpressed pr〇NK-intein M-oil membrane protein in E. coli. (a)

39 1304810 All of the large intestines containing the ΡΠΜ-intein M_崎(四) were extracted and separated into the supernatant (sound 1) and the deposited layer (ppt-丨). And analyzed by sds_page. (8) Recombination with the deposited layer (PPt-υ and containing the _ peptide-containing county _ Dalin _ lysed cells. After reconstitution, after centrifugation at 1 M 〇Gg, after 15 minutes of centrifugation, three layers were formed, the supernatant layer (sup -2), sedimentary layer (ppt_2) and Na. The three layers were analyzed by age. (6) DTT was added to stimulate the self-cleavage of the pr〇NJ^-containing peptide M oil membrane protein recombined with the hall, and then separated into oil layers by centrifugation. Cleaved) with supernatant (10) -3). Both are analyzed by SDS PAGE. The positions of nattokinase (28 ca) and ρΐΌΝΚ_intein M_oil membrane protein (π kDa) are indicated. Figure VIII shows the production of nattokinase from A0B recombined with the proNK-intein M-oil membrane protein. (a) The production of ugly kinase (pH 7.5) produced by A0B recombined with pr〇NK-intein Μ-oil membrane protein was measured at 4, 25 and 37 °C, respectively. The recombinant nattokinase (B) yield and (C) relative specific activity at pH 7 to 9. Figure 9 is a schematic representation of the Β0Β performance/purification system. Step 1 (shown in Arabic numerals): Excessive expression of the target protein in E. coli, an insoluble fusion membrane protein. Step 2: Composition of Α0Β with an insoluble oil film protein-intein fusion protein. Step 3: Collect Α0Β by centrifugation. Step 4: Separation of the target protein from the oil-membrane egg-intein fusion protein bound to Α0Β by temperature change or addition of DTT. Step 5: Collect the target protein in the final supernatant after centrifugation.

Claims (1)

1304810 Announcement** ___ . . . I. n. I, II 1U__ _ ~ • δ月曰U曰修(i)本本« X. Patent Application: L---- 1· A polypeptide, including: a - a combination of oil film protein [〇le〇sin]; and b. - intein amino acid fragment, which is linked to the oil membrane protein [oleosin], the intein is vifre GyrA or 6! Sp DnaB. 2. The polypeptide of claim 1, further comprising a polypeptide of interest, the polypeptide being linked to the inclusion. 3. A polypeptide according to claim 1 of the patent application, which is produced using yeast or bacterial host cells. S 4. The polypeptide according to claim 1 of the patent application, which is produced by using Escherichia coli. 5. A polypeptide according to the scope of the patent application, wherein the self-splicing reaction function of the intein can be initiated by a change in the compound, temperature or pH. 6) The polypeptide according to item 2 of the patent application, wherein the target polypeptide is a single product peptide or a multi-repetition product of a single zero-product peptide. 7. The polypeptide according to item 2 of the scope of the patent application wherein the polypeptide of interest is linked to the propeptide in an operative direction. 8. According to the peptides of the application, the peptidomimetic and the target polypeptide can be directly linked to the intein. The polypeptide according to the second aspect of the patent application, wherein the target polymorphism refers to nattokinase ° 41 1304810 . 钃 J 10. The polypeptide according to claim 5, wherein the compound refers to dithiosu Dithiothreitol (DTT). 11. A polypeptide according to claim 5, wherein the temperature is 〇. (: to 5 ° ° C. 12. The polypeptide according to claim 11 wherein the temperature means 4 ° C to 37 ° C. 13. The polypeptide according to claim 12, wherein the temperature means 25 ° C to 37 ° C. 14. The polypeptide according to claim 13 wherein the temperature means 37. (: 15. The polypeptide according to claim 5, wherein the pH means PH 6, 5 to The polypeptide according to the fifteenth aspect of the patent application, wherein the pH value refers to pH 7 to Qiu 9. The polypeptide according to item 16 of the patent application, wherein the pH value means pH 7.5. The polypeptide according to the first aspect of the invention, wherein the oil film protein is derived from a plant. The polypeptide according to claim 1, wherein the oil film protein is from a canola oil. The polypeptide comprising the scope of the patent application and the oil body for binding to the oil body peptide in the polypeptide. 21. The mixture according to the second aspect of the patent application is used for purifying the target polypeptide. a mixture of the second item, wherein the oil system is extracted from the plant 23_ A mixture according to the scope of claim 2, wherein the oil system is extracted from canola oil. 42 1304810 24 A mixture according to the scope of claim 2, wherein the oil body is synthetic 25_ According to the scope of claim 20, wherein the oil system consists of triglyceride and fat. 26_The mixture according to claim 25 of the patent application' wherein the triglyceride and the disc grease in the oil body The ratio is 100: 1 to 1: 100. 27. According to the mixture of the application for patent No. 26, the ratio of triglyceride to scale in the oil body is 5〇: 1 to 1: 50. 28. A mixture according to claim 26, wherein the ratio of triglyceride to scale in the oil body is 1 : 1 . 29. A mixture of the second and fifth items of the patent application, wherein the ratio of the scale to the polypeptide in the oil body is 1:10 to 1 :1. 30. The mixture according to claim 29 of the patent application wherein the ratio of the phospholipid to the polymorphism in the oil body is 1:4 to 4:1. 31. A mixture according to claim 30, wherein the ratio of scale to polymorphism in the oil body is 1:4. 32. A method for purifying a polypeptide of interest, comprising the steps of: a. preparing a polypeptide comprising: i. an oil film protein [oleosin] in combination with an oil body; ii. an intein amino acid fragment Is linked to oil film protein 43 1304810 [oleosin], the intein is GyrA or island ο DnaB; and iii. a target polypeptide, the polypeptide is linked to the intein; b_ mixed polymorphism and oil body, resulting in oil body a mixture; c. separating the oil body mixture from the fragments of the remaining cell extract; d. cleavage of the polypeptide of interest from the bound oil body; and e. separating the polypeptide of interest from the remaining oil body mixture. 33_ The method according to claim 32, wherein the self-introduction function of the intein is initiated by a change in the compound, temperature or pH. 34. The method of claim 32, wherein the polypeptide of interest is a single product peptide or a multiple repeat of a single product peptide. 35. The method of claim 32, wherein the mixture of step b is produced using ultrasonic oscillation. 36. The method of claim 32, wherein the separating of step c is performed by centrifugation. 37. The method according to claim 32, wherein the target polypeptide of step e is separated from the remainder of the oil body mixture by centrifugation. 44 Ϊ304810图五-/6ε) SS 2 5000500050 ο ·°Η 8 ρ ·5 ο ο ο ο ο ο 0 8 6 4 2 1 (次) 谀丨蛉 谀丨蛉 萆 8· ΡΗ 3 Ί304810 5