TWI283268B - Novel microorganism strain GM-020 of Lactobacillus rhamnosus and its use for treating obesity - Google Patents

Abstract

The present invention provides an isolated microorganism strain, Lactobacillus rhamnosus GM-020, which is found to be effective in treating obesity and a complication thereof. The use of the Lactobacillus rhamnosus GM-020 in treating obesity and a complication thereof is also provided.

Description

1283268

BRIEF DESCRIPTION OF THE INVENTION [Technical Field] The present invention relates generally to a novel microorganism strain, Lactobacillus rhamnosus GM-020, and its use for treating obesity or its onset. [Prior Art] Obesity is an excess of body fat caused by a change in physiological or biochemical function, which can significantly impair health. Fat usually includes neutral lipids, phospholipids and cholesterol. The increase in weight depends on the energy intake of the person being greater than the energy consumption. There are two types of obesity: (a) simpie obesity, and (b) second obesity. Simple obesity can be divided into idiopathic obesity and aCqUired 〇besity, which can account for more than 95% of obesity. Congenital obesity is caused by a large number of fat cells and is common in childhood obesity. Acquired obesity is caused by the larger size of fat cells and is common in adulthood obesity. Secondary obesity is also known as symptomatic obesity, and its sling is caused by endocrine or metabolic diseases. Obesity is associated with several chronic diseases such as diabetes, cardi〇pathy, hypertension, stroke, biliary calculus, gout and certain cancers. There are five strategies for treating obesity: diet, exercise, behavioral therapy, drug therapy, and surgical therapy (therapeutic operati〇n). Depending on the patient's health risk factors, and the speed and effectiveness of weight loss, these strategies can be selected or combined to treat obese patients. The rate and effectiveness of weight loss are affected by factors such as age, height, family history and risk factors. The influence of one factor. Mechanisms of drug treatment include appetite suppression, increased energy expenditure, and stimulation of fat movement,

O:\84\84198.DOC -6 - 1283268

Reduces trimethyl glycerol synthesis and inhibits fat absorption. Examples of such drugs are phenylpropanolamine (PPA), orlistat (XenicalTM), and sibutramine (ReductilTM). However, treating obesity with natural substances rather than drugs is a new trend. In the prior art, it has been found that some microbial strains can be used to treat obesity, or its onset. For example, it has been found that Lactobacillus gasseri gwwr〇SBT0270 has the ability to reduce the concentration of cholesterol associated with debinding of bile acids (Usman, B. and Hosono, A. (2001), "L. lactis causes silver to be rich in cholesterol. Hypocholesterolemic effect of Lactobacillus gasseri SBT0270 in rats fed a cholesterol-enriched diet, J. Dairy Res 68: 617-624. The mechanism for treating obesity is: Free form of bile acid is absorbed by Lactobacillus gasseri and is excreted by feces (because the bile acid that is excreted cannot be recycled back to the liver and needs to be synthesized from cholesterol to synthesize new bile acids) to reduce the decomposition The solubility of bile acids. In addition, it was found that Lactobacillus kawaii β can be combined with bile acids and cholesterol to achieve excretion. Lactobacillus rhamnosus is considered to be a probiotic probiotic lactic acid bacteria with improved immunity. The safety assessment of Lactobacillus has also been investigated. Zhou et al. revealed the mice that were administered Lactobacillus rhamnosus. Fluid parameters (red blood cell and platelet count, hemoglobin concentration, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin and the concentration), different white blood cell count, blood biochemistry (plasma total protein,

O:\84\84198.DOC 1283268

Albumin, cholesterol, and glucose), mucosal histology (epithelial height, mucosal thickness, and villus height), and bacterial displacement to the extraintestinal tissues (blood, liver, spleen, kidney, and mesenteric lymph nodes), Similar maps of control mice (Zhou, J. S., Shu, Q., Rutherfurd, KJ, Prasad, J., Birtles, M. J., Gopal, PK and Gill, HS (2000) , "Safety assessment of potential probiotic lactic acid" in the BALB/e mouse potential probiotic lactic acid strain Lactobacillus rhamnosus HN001, Lactobacillus acidophilus HN017, and Bifidobacterium HN019 Bacterial strains Lactobacillus rhamnosus HN001, Lb. acidophilus HN017, and Bifidobacterium lactis HN019 in BALB/c mice) 5 International Journal of Food Microbiology 56: S7-96) ° In addition, Agerholm-Larsen et al. revealed the fermentation of Lactobacillus rhamnosus Yogurt does not alter low-density lipoprotein (LDL)-cholesterol, but only significantly reduces systolic blood pressure (Agerholm-Larsen, L., Raben, A., Ha Ulrik N., Hansen, A. S., Manders, M., and Astrup Α · (2000), "Effect of 8 weeks intake of probiotics in the intake of probiotic dairy products" (Effect of 8 week intake of probiotic) Milk products on risk factors for cardiovascular diseases), Eur J Clin Nutr. 54(4): 288-97). Therefore, it can be confirmed that the conventional rhamnosus strain does not change plasma total cholesterol and LDL-cholesterol. In addition, no change in body weight was observed when the conventional L. rhamnosus strain was administered. [Summary of the Invention]

O:\84\84198.DOC

1283268 The present invention provides a novel microbial strain of Lactobacillus rhamnosus GM_020 °. In another aspect, the present invention provides a method for treating obesity and a bipolar disorder thereof, the method comprising the subject A composition comprising the microbial strain Lactobacillus rhamnosus GM-020 is administered; wherein the sputum is preferably selected from the group consisting of hypercholesterolemia, atherosclerosis and coronary heart disease. In still another aspect, the present invention provides a method for treating obesity and a sputum of a subject, the method comprising administering to the subject a microorganism comprising Lactobacillus rhamnosus GM-020 and A composition of the Auricularia polytricha strain; wherein the sputum is preferably selected from the group consisting of hypercholesterolemia, atherosclerosis, coronary heart disease, fatty liver, and diabetes. [Embodiment] The present invention provides a novel microorganism strain, Lactobacillus rhamnosus GM-020, which is capable of treating obesity. On November 18, 2003, the plant GM-020 was deposited at the Food Industry Research and Development Institute (FIRDI) accession number BCRC910236 in Hsinchu, Taiwan. Lactobacillus rhamnosus GM-020 is isolated from the human stomach. The fungal characteristics of Lactobacillus rhamnosus GM-020 are shown below: (a) Morphological characteristics (1) Shape and size of cells · When cells are cultured overnight in MRS medium at 37 ° C, they can be microscopeed Bacillus was observed, which had a circle of O:\84\84198.DOC - 9 -

1283268 Rod-shaped shape of the edge. (2) Activity: inactive (3) Flagella: none (4) sporulation: no sporulation (5) Gram stain: positive (b) culture characteristics: (1) medium: MRS medium (DIFCO® 0881 ) (as shown in Table 1), final pH 6.5 soil 0.2 Table 1 component g/L protein (Proteose peptone) 10.0 Beef Extrac 10.0 Yeast Extract 5.0 Dextrose 20.0 Polysorbate 80 1.0 Ammonium citrate 2.0 Sodium acetate 5.0 Sulfuric acid 0.1 Sulphuric acid 0.05 Dipotassium Phosphate 2.0 (2) Culture conditions: Anaerobic culture at 37 °C Culture) or aerobic culture (c) Physiological characteristics: (1) Catalase: negative (2) Oxidase: negative (3) API 50 CHL test: identification using API 50 CHL system Lactic acid O:\84\84198.DOC -10- 1283268

bacteria. The identity of the lactic acid can be determined by assaying the reaction of a series of enzymes. The results of the API 50 CHL test for GM-020 are listed in Table 2: Table 2 Enzyme reaction 1 Enzyme reaction Enzyme reaction Glycerol + D-Tagatos + Erythritol Sorbitol 5 keto gluconic acid D-arabine 糠 α-methyl _D-glucoside + 2 keto gluconic acid L-arabinose Ν Ν glucosamine gluconic acid - ribose + amygdalin + L-arabitol - D-xylose Arbutine + D-arabitol - L-xylose Esculine + L_fucose - Adonitol _ Salicin + D-fucoid Sugar-cold-methyl-^-glycoside cellobiose + D-lysine D-grass + galactose + bacterium bovine flat test (inuline) D-fructose + lactose + sucrose - D-mannose + (2 - M-D-mannose glycoside Glycogene L-sorbose + Melezitose + Xylitol rhamnose + D-Raffinose Cold gentian disaccharide (Gentiobiose) Dulcitol - Amidon D-Turanose Inositol - Maltose - I Honeydew - Trehalose - 1 (d) Genetic characteristics: The 16S rDNA sequence analysis of GM-020 was determined by the Food Industry Development Institute of Hsinchu, Taiwan, as shown in SEQ ID NO: 1. Conclusion O:\84\84198.DOC - 11 - 1283268

The results show that GM-020 is highly homologous to other strains of L. rhamnosus and has a similarity of over 99%. (e) Cell wall proteins of GM-020: The cell wall proteins of GM-020 showed a specific pattern when compared with other conventional strains of L. lactis. The SDS-PAGE pattern of the cell wall protein of GM-020 is shown in Figure 2. The total protein of GM-020 can be subjected to 2-D electrophoresis, and the pattern shown in Fig. 3 is specific. (f) Standardized detection system for identifying GM-020: A standard detection system that can be used to identify microorganisms is disclosed in U.S. Patent Application Serial No. 1/446,78, filed on May 29, 2003. The difference in gene expression of a test cell line cultured with a given microorganism and cultured without a given microorganism was used as a marker for identification. The genes tested are listed in Table 3. Table 3_Signal transducer and activator of transcription 3_ c-rel_ growth-related protein 43 ~ — N-face myc_ IGF-binding protein 1 IL-16 lymphotoxin “(!^111卩11(^〇 1^1〇〇 (previous tumor necrosis factor/3)_ interferon-inducible protein 9-27 connective tissue growth factor interleukin-10 receptor calpamodulin mRNA_ubiquitin cross-linking enzyme (UbcH8) mRNA, complex (comp) _ O:\84\84198.DOC -12- 1283268

Homo sapiens protein kinase A binding protein AKAP110 mRNA, complete cds ketoacid dehydrogenase kinase, isozyme 4 p than citrate (pyridoxine, vitamin B6) kinase _ MAP kinase interaction Serine/threonine kinase 1_^Blood tyrosine kinase via nutrient tyrosine kinase, receptor, type 3 (TrkC) - pyruvate dehydrogenase kinase isozyme 3 ( PDK3) mRNA, complete cds human dicylglycerol kinase zeta mRNA, complete cds_^white kinase C, alpha deoxyguanosine kinase __ adenosine kinase_ topoisomerase (DNA) II ;g(180kD) IkB kinase cold subunit mRNA___ ~stat5a (signal transduction and transcriptional activator 5A) ~ colony stimulating factor 1 (M-CSF) HGF - IL-1 receptor type 1 interleukin 7 Metallothionein ι-Β gene interleukin-6 (B cell stimulating factor 2)_____ Inducible small molecule cytokine A2 (monomaryocyte chemotactic protein 1, ____ protein disintegration (Proteasome) 26S sub Unit, ATPase, 3_______ ubiquitin cross-linking enzyme E2A (RAD6 homolog) ____ thymus shouting nuclear bud (thymidine kinase) 1, soluble __ ^ tyrosine kinase 2 ____ transcriptase - kinase transforming growth factor / 9 (Transforming growth factor beta) - activated kinase 1 ^ tyrosine associated with Fms Kinase 3______ Creatine kinase B _____ protein serine/s-glycine kinase stk2______ stress-activated protein kinase 3 (SAPK3) Mma.______ human adenylate kinase 2 (adk2) mRNA, complete cds_____ RAC-α serine/crisp Amino acid kinase ___ hexokinase 1_____ CDC28 protein kinase 2 (CKS2) mRNA superoxide dismutase 2, mitochondria ___ tumor necrosis due to receptor 2 "^ZZZ growth-related eggs associated with ρ53 O:\84 \84198.DOC -13- 1283268

JCD30 '白-ΠΙ' ^ jade receptor ^ inducible protein ip-30 precursor a //S receptor alpha chain precursor 3SjT long response protein 1 "

Jj^Jr-13 receptor mRNA, complete cds protease inhibitor 12 (PI 12 ; neuroserpin) cis acid protein kinase KKIALRE Phosphorylase kinase, β cis amino acid kinase 9 / leucine kinase 10 ] protein Protein kinase mitogen-activated 8 (MAP kinase) focal adhesion kinase (FAK) mRNA, complete cds "X activation of p21cdc42Hs kinase (ack) mRNA, complete cds human integrin Integrin-linked kinase (ILK) mRNA, complete cds guanylate kinase (GUK1) mRNA, complete cds BMK1 alpha kinase mRNA, complete cds___ i flavin monooxygenase 5 (FM05) mRNA - pro-acid kinase, liver ____ ^The extension factor S-II, hS-II_T — ~~ ^Nitrogen synthase 3 (endothelial cells) $cl2, p53 binding protein Bbp/53BP2 (BBP/53BP2) mRNA, 1 week telomeric DNA sequence — statin (Fe65) mRNA, complete cds lL-5 receptor a "EGF " FGF2 > albumin 2 receptor 7-chain-CC chemokine receptor type 2 - guanylate-binding protein 1, interference Inducible, 67kD mitochondrial processing peptidase point - narcissus syntaxin 8_ cytokine inhibition Anti-inflammatory drug binding protein 1 (p38 MAP kinase) protein tyrosine kinase 6 branched-chain alpha-keto acid dehydrogenase stimuli selenate/sweet acid kinase 2 ~~ protein kinase, mitogen activated 4 ( ^1八? kinase 4^63)^11014)1111 with eight tyrosine-protein kinase SYK " human putative serine/laminate protein kinase PRK (prk) mRNA, complete cds O:\84 \84198.DOC -14- 1283268(10)

Adenylate kinase isoenzyme l_ hematopoietic kinase _ glycerol kinase _ tyrosine-protein kinase CSK general transcription factor IIB_ interleukin 6 signal transduction (gpl30, oncostatin Μ receptor) " caspase -8 (apoptosis of caspase mch5 (mach-α-Ι))_ tumor protein p53_ transforming growth factor, cold receptor III (cold glycan, 3 - IFN-g transforming growth factor, cold 3_ TGF-/ 3 protein superfamily, complete_fibroblast growth factor 7 (keratinocyte growth factor) inducible small molecule cytokine A4 (same as murine Mip-lb) ~~ hepatocyte growth factor activator inh_ pancreatic hormone Carboxyl-terminal hydrolase isoenzyme 11 a serine/mute acid kinase 11 (Pink pigment polyposis Cyclin-dependent kinase inhibitor 3 (CDK2-related bispecific phosphatase) _ Pyruvate dehydrogenase kinase, isozyme 3 carnitine palmitoyl transferase I, liver_protein kinase mitogen activation 7 (MAP kinase) ~ human protein tyrosine kinase mRNA, complete cds protein-tyramine Acid kinase 7 lymphocyte-specific protein tyrosine kinase ribosomal protein s6 kinase Src kinase-like (slk) mRNA, complete cds_ nucleoside diphosphate kinase a cyclin-dependent kinase 2 " STATAa/β Angiopoietin-1_ phospholipase C STAT2 (signal transduction and activator of transcription 2) -src glutamate kinase _ IL-15 TGFb receptor-associated protein 1 - Annexin V (liposide V; inline protein II) - interferon regulatory factor 5 interferon-7 receptor alpha chain precursor _ Transformational Growth Factor, Stone Receptor II (70-80kD) O:\84\84198.DOC -15- 1283268

Modern human apoptotic protease activating factor 1 (Apaf-1) i hormone cross-linking enzyme E2B (RAD6 homolog) MAP/ERK kinase kinase 3 acidase kinase, α2 (liver), glycogen storage i valine Acid kinase 4 ' glucosamine-6-phosphate deamination < ' : Mevalonate kinase glucokinase (hexose kinase 4, young adult diabetes (onset diabetes of the young) 2) Deoxycytidine kinase j kinase type plasminogen activator' mitochondrial creatine kinase (CKMT) gene, end-biliary kinase ~~ human phospholipid muscle 4-phosphate 5-kinase (ΡΠ > Κ) type 53K isoform of Il mRNA, complete cds ^hemagglutinin cold subunit -- Cf〇S — "" — phosphoenolpyruvate carboxykinase death cysteine protease mch4 ' -- &quot ΐ 细胞 趋 趋 趋 趋 4 4 4 4 4 ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( 4 ( ( ( ( ( ( ( ( 4 4 4 ( 4 4 4 4 4 4 Deciding cysteine gas protease mch4) ^kinase (TTK) mRNA, complete cds ~ --- "7-2 adrenergic receptor ~~ ~~- ^ hormone sulfonate Transferase (ste) "-i transduction and transcriptional activator 6, 6% '~~^ white kinase clkl " - Ίν白素-8 precursor'' $代人FAST kinase mRNA — ~~ -- Interferon-7 Receptor α-Chain Precursor ~ -~ ΐ»Insulin Growth Factor I Receptor Precursor ~ --- ^Geosome Transcription Termination Factor ---~~ $ Transduction and Transcriptional Activator 3 (Emergency $ Human protein kinase CK1 mRNA~~~1-- ϋΜΑΡ kinase-activated protein kinase^ - protein kinase clk3 ~ INF-b ~ -~~ C-like transcription factor IIB --- 5, PDGF B chain - 1 muscle Protein -- O:\84\84198.DOC -16 - 1283268 (12) Glutathione S-transferase Ml_ IL-lb MAP/ERK kinase kinase 3 INF-b EGR-1 Glutathione S - Transferase 12 (microsomes) The standard detection system for the identification of GM_020 uses the Hep G2 cell line as a test cell line. When comparing the representation patterns of cultured HepG2 cell lines with or without GM-020, Table 4 The set of genes listed can vary significantly. Table 4 Gene-Interleukin 10 Receptor IL-16

EGF lymphotoxin alpha (previous tumor necrosis factor/3) interferon regulatory factor 5_ fibroblast growth factor 7 (keratinocyte growth factor) proteolytic 26S subunit, ATPase, 3 calpamodulin mRNA_ panthenol carboxy-terminal hydrolase Isozyme LI — Hexokinase 1 — Human phospholipid 醯 inositol-4·phosphate 5-kinase (PIPK) Type II mRNA 53K isoform, complete cds_ mitochondrial transcriptional terminal factor — STAT-lg//3 — urokinase- Type plasminogen activator _ human adenosine diesterase 2 (adk2) mRNA, complete cds_ protein kinase C, a proto-oncogene tyrosine-protein kinase FES/FPS — human mitochondrial creatine kinase (CKMT) gene , completely cds ~

Protein tyrosine kinase 6 serine/sweetamine kinase 9 IkB kinase called subunit mRNA caspase-8 (apoptosis cysteine protease mch5 (mach-a-1)) O:\84\ 84198.DOC -17- 1283268

Bcl2, p53 binding protein Bbp/53BP2 (BBP/53BP2) mRNA '_ growth-associated protein 43 protein kinase clk3 _ tumor necrosis factor-inducible protein TSG-6 precursor - insulin-like growth factor I receptor precursor + monocyte Chemotactic protein 1 _ white blood cell adhesion protein / 3 subunits -

Sis, PDGF B chain —

Humig mRNA_CD27L receptor precursor ~ retinoic acid and interferon-inducible 58K protein RI_ IRF-1 The present invention provides a method for treating obesity and its onset in a subject, the method This includes administering to the subject a composition comprising GM-020. In the present invention, it has been surprisingly found that even if the subject ingests a high-energy food, the strain GM-020 has an ability to suppress the subject's weight gain and can suppress the body weight. In an embodiment according to the present invention, an ICR mouse treated with strain GM-020 and fed with a high energy food which causes obesity maintains body weight without any treatment compared to an untreated control group. increase. It has also been found in the present invention that the GM-020 strain is effective in regulating the ratio of cholesterol to lipoprotein. In an embodiment according to the present invention, in obese mice and hamsters fed a cholesterol-rich food that causes hypercholesterolemia, treatment with GM-020 strain reduces serum and liver total cholesterol. concentration. It also reduces the serum concentration of low-density lipoprotein-cholesterol (LDL-C). In addition, the ratio of LDL-C in serum to high-density lipoprotein cholesterol (HDL-C) (LDL-C/HDL_C) can be lowered. In summary, GM-020 strain is used to treat hypercholesterolemia and reduce the incidence of atherosclerosis and coronary heart disease. O:\84\84198.DOC -18- 1283268

〇 4) Aspects are valid. That is, the (10) (4) strain can be used for the preparation of a composition for treating - fat and octopus (such as hypercholesterolemia) and reducing the incidence of atherosclerosis and coronary heart disease. ^ This month also provides a method for treating obesity and its symptoms in a subject, which comprises administering to the subject a substance comprising a microbial strain of rhamnose; " Bacillus GM-020 and black fungus A composition of the strain; wherein the sputum is preferably selected from the group consisting of hypercholesterolemia, atherosclerosis n, fatty liver, and diabetes. In the present invention, it was found that the GM_〇2〇 strain combined with the black fungus (black fungus) can provide a surprising effect when treating obesity in comparison with the treatment with black fungus or gm__ strain alone. Black fungus, commonly known as fungus, tree ear, etc., is a gelatinous, tasteless edible fungus. It is closely related to black fungus grown in Asia and has been consumed for a long time. Black fungus was found to be wild on conifers and sometimes on deciduous trees in both spring and autumn. Black fungus is usually dried for consumption. When the dried black fungus is eaten, the edible fiber can extend about 8 to 10 times after water absorption. Consumers can feel full and eat less. In addition, it has been reported that polysaccharides in black fungus have an effect of lowering the serum concentration of total cholesterol in rabbits. In an embodiment according to the present invention, the weight of an obese animal model treated with a combination of black fungus and GM-020 can be reduced; on the contrary, administration of pure black fungus or GM-020 can only inhibit the increase in body weight. In the present invention, it was found that the combination of the black fungus and the GM_〇2〇 strain has reduced total cholesterol and triterpenoids in the serum and liver of the animal model compared to the control group.

O:\84\84198.DOC -19- 1283268 (15) The ability to concentrate glycerol. In summary, a combination of black fungus and GM-020 strain can be used to prepare a composition for treating hypercholesterolemia, fatty liver, diabetes, and reducing the incidence of atherosclerosis and coronary heart disease. In one embodiment according to the invention, the effect of treating obesity and hypercholesterolemia and reducing the incidence of atherosclerosis and coronary heart disease is directly proportional to the dose of black fungus. Normally, the recommended dose (丨X) per adult black fungus is 6 g X 0.0026 X surface area. In one embodiment of the invention, the 10 X black fungus has a better effect than the 1 X black fungus. According to the present invention, only the combination of GM-020 strain, and GM-020 and black fungus does not cause damage to the liver and kidneys. In animal models, when monitoring the amount of glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), uric acid, and creatinine, liver function Normal, this may indicate that the combination of only GM-020 strain, or GM-020 strain and black fungus is a safe way to treat obesity and its complications. It has also been found in the present invention that the trimethyl glycerol in the serum is reduced after treatment with a combination of GM-020 and black fungus. The following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Example 1: Isolation of Lactobacillus rhamnosus GM-020 A piece of stomach tissue of a person taken out by an endoscope was cultured in 2 mL of Lactobacillus MRS medium (DIFCO® 0881). The medium containing the tissue was placed on a selective agar of Lactobacillus and incubated at 37 ° C for one day. Select a single colony grown on the plate and allow it to accept Gram O:\84\84198.DOC -20- 1283268

(16) Dyeing. Then choose Gram's bacteria. A single strain was selected, which was called Lactobacillus rhamnosus GM-020. Example 2 Cell Wall Protein Extraction of GM-020 and Analysis of 24-Hour Cells of Thermophilic Lactobacillus Harvested in MRS Medium (Difco®) at 0·05 M Tris_HCl (ρΗ7·5) containing 0.1 M CaCl2 It was rinsed twice and resuspended in 1 ml of the same buffer of 0.06〇〇. After centrifugation at 8,000 xg for 5 minutes, the pellets were obtained from 1.0 ml of extraction buffer (pH 8.0) containing 0.01 M EDTA, 0.01 M NaCl, and 2% (wt/vol) SDS. (pellet) to extract cell wall proteins. The suspension was stored for 60 minutes at room temperature, heated at 100 ° C for 5 minutes and centrifuged at 11,600 X g for 10 minutes at 4.0 °C. The supernatant was analyzed by 12% SDS-PAGE and stained with Comassie blue. Example 3 GM-020 2-D total protein electrophoresis along with 0.5 mL Dissolution Buffer C (7M urea, 4% CHAPS, 2M thiourea, 40 mM trishydroxymethane, 0.5% IPG buffer and 5 mM TBP) and 100 L glass Beads, add 10mg GM-020. The solution was then subjected to ultrasonic degradation treatment and centrifuged at 10,000 rpm for 30 minutes. Total protein can be assayed by Bio-rad Plus OneTM protein assay and then subjected to 2-D electrophoresis at pH 3 to 10 IEF. Electrophoresis as designed in Table 5 was performed for 4 hours by a 10% gel and at 40 mA/gel. The gel was then fixed by 10% methanol and 7% acetic acid for 30 minutes. After fixation, the gel was colored by sypro ruby dye for 5 hours, and then the gel was decolorized with 10% sterol and 7% acetic acid for 6 hours. The result is shown in Figure 3. O:\84\84198.DOC -21 - 1283268

(17) Table 5 30 V 12 hr 100 V 0:10 hr 250 V 0:10 hr 500 V 0:10 hr 1000 V 0:30 hr 4000 V 0:30 hr 6000 V 60 KVhr Example 4 is used to identify GM- The standardized detection system of 020 was used to prepare the GM-020 of the standardized detection system: in the stalked MRS medium (DIFCO® 0881), the cells of the strain GM-020 were incubated to the stationary phase. After centrifugation at 3,000 g for 15 minutes, the culture was washed with 2 mL and 1 mL of IX PBS (phosphate buffered saline, ρΗ7·2), and then suspended in 1 mL of PBS (IX). Where the cell concentration was adjusted to lx 109 CFU/mL. The cultures were stored at -20QC. Excitability: Hep G2 cells can be refred by adding fresh medium and incubating for 16 hours. Subsequently, the cells were divided into two groups, and one group was used for culturing by lactic acid bacteria and the other group was used for culturing without lactic acid bacteria. When the cell concentration reached 1 X 107/10 mL, the cells were stimulated with lx 107 GM-020 or not by 1 x 107 GM-020 for 24 hours. After stimulation, the cells were harvested, washed twice with PBS and used for RNA isolation.

Bifurcation and · · · Extract RNA from cells by using Trizol reagent (Life Technologies®, Gaithersburg, Md.) according to the manufacturer's instructions. 8 L of RNA (lOjLig) was thoroughly mixed with 2 L of oligomeric dT (12-18 mer, 0.1 g/L) and kept at 70 ° C for 10 minutes, and then cooled by ice for 2 minutes. In the dark, mix the RNA with the reverse transcription marker and 3 L Cy5-dUTP O:\84\84198.DOC -22-

1283268 (1 mM), 2 L SuperScriptll (200 U/L) and RNasin (l L) mixed. The mixture was incubated for 2 hours at 42 °C for reverse transcription, and the reaction was terminated by the addition of 1.5 L of 20 mM EDTA. After labeling, RNA was removed by treatment with NaOH and neutralized by HCl. The cDNA was rapidly purified by STRATAGENETM PCR purification kit. #摩婷|造•• The selected hundreds of genes were amplified by a chain reaction of polymerase and quantified by a 260 nm spectrophotometry. All purified PCR products were adjusted to a concentration of 0.1 pg/pL in 50% dimethyl sulfoxide and spotted on UltraGAPSTMTM coated slides in duplicate. (Corning®, Inc., Corning, NY). After printing, the microarrays were crosslinked by ultraviolet light at 300 m Joulesand in a glass slide container stored at room temperature in a desiccator. These genes are listed in Table 3. #摩办#爻••在1〇〇. 〇: The fluorescently labeled cDNA was denatured in a hybridization solution (5xSSC, 0.1% SDS and 25% carbamide) for 5 minutes, cooled to ambient temperature and stored on a glass slide. Hybridization was carried out for 18 hours at 42 °C. After hybridization, the cells were washed sequentially in low-stringency (lxSSC and 0.1% SDS), medium stringency (0.1 x SSC and 0.1% SDS), and high stringency (O.lx SSC) buffer. The sheet is finally dried by compression of N2.讯捃赉漱与资科分# •• For each slide with the same laser power and photomultiplier sensitivity level, immediately on the GenePix® 4000B scanner (Axon Instruments®, Inc.) Scanned by N2 dry loading O:\84\84198.DOC -23-

1283268 (19) Slides. Raw fluorescent data (10-nm resolution) is available and subsequent processing and data visualization are performed in Microsoft ExcelTM. To compare the results of independent hybridization experiments, the local background signal was subtracted from the hybridization signals at each independent point and then divided by housekeeping gene /3-actin. The average of the duplicates is used to represent the final expression of each gene. The gene expression profile of Hep G2 cells cultured with GM-020 and without GM-020 was then obtained. A group of Hep G2 cultured in GM-020 was selected to have a gene that was adjusted up or down by more than 2 folds compared to Hep G2 cultured without the bacteria. The results are shown in Table 4. Example 5 GM-020 for the treatment of obesity ##麦: Male ICR mice can be purchased from the National Laboratory Animal Center in Taiwan, and at a temperature of 25 〇C and 60 5%. Under humidity, it was kept alone in the light for 12 hours and in the dark for 12 hours. Fully supplement food and water. The mice were divided into two groups. One group was the normal control group and the other group was the high energy group. The normal control group was fed a normal diet and the high energy group was fed a high energy diet containing 48% dry feed, 8% corn oil and 44% concentrated milk. The body weight of the mice was measured weekly. According to the treatment, the high energy group is further divided into the following groups: (a) l black fungus, (b) 1 X black fungus combined with GM-020, (c) GM-020, (d) 10 X black fungus, (e) 10X black fungus combined with GM-020, (1) negative control treated with saline, and (g) positive control treated with PPA. Table 6 shows the difference in body weight between before and after feeding a high-energy diet, where ** stands for O:\84\84198.DOC -24-

1283268 ρ<0·01; a represents a negative control; b represents a positive control; c represents black fungus of IX; d represents 10X black fungus; e represents GM-020; and f represents black fungus of IX in combination with GM-020; And § represents the 10X black fungus combined with GM-020. Table 6 Group weight (%) Normal control 12.25±1.80 Negative control 20.93+2.27 Positive control 20.43±1.35 IX black fungus 22.45±1.46 10X black fungus 18.45±1.03 GM-020 19.23±1.75 Combined with GM-020 IX Black fungus 21.37+1.05 10X black fungus combined with GM-020 22.im.61 P value 0·000,, b, c, d, e, t, g can be analyzed by Kruskal Wallis Η test and will be normal The control group served as the baseline for the Dunnett test. After 4 weeks, the average body weight of the high energy group was significantly higher than the average body weight of the normal control group (ρ < 〇·〇1). And /4, black ice early bathing • The normal control group was continuously fed a normal diet. Treated twice a day. The dose per PPA was 4.875 mg. In the diet of black fungus of IX, there was 15.6 mg of black fungus in the 3 g diet, and 156 mg of black fungus in the 3 g diet in the diet of 10X black fungus. The dose of GM-020 was 109 CFU/mL. After the treatment, 4 weeks later, blood samples were collected from the tail for biochemical tests. Data were analyzed by the Kruskal Wallis® test and the normal control group was used as a baseline for the Dunnett test. The results are shown in Figure 4. After 1 week of treatment, the 10X black fungus group combined with GM-020 showed a significant decrease in body weight compared with the negative control group. After 2 weeks, the positive control group and the GM-020 group O:\84\84198.DOC -25-

1283268 The 1 X black fungus group and the 10X black fungus group combined with GM-020 were significantly less than the negative control group. After 3 weeks, the positive control group, the black fungus group of IX, the GM-020 group, the black fungus group of IX combined with GM-020, and the 10 X black fungus group combined with GM-020 were compared with the negative control group. Significant weight loss. These results demonstrate that GM-020 and black fungus are effective in treating obesity.睪尤思之蘼 if.组鲥重# The difference is • The mouse is killed, and the lipid tissue around the testicle is extracted and weighed. The data was analyzed by the Kruskal Wallis(R) test and the data from the normal control group was used as the baseline for the Dunnett test. The results are shown in Figure 5. According to Fig. 5, only the positive control group and the 10X black fungus group combined with GM-020 showed a significant decrease compared to the negative control group. Jfjf 居思之廯if重# The squid killed the mouse and extracted the lipid tissue around the kidney and weighed it. Data were analyzed using the Kruskal Wallis(R) test and the data from the normal control group was used as the baseline for the Dunnett test. The results are shown in Figure 6. According to Fig. 6, the black fungus group of IX, the black fungus group of 10 X, the black fungus group of 1 X combined with GM-020, and the black fungus group of 10 X combined with GM-020 were significantly lower than the negative control group. Reduction. On the other hand, the positive control group, the GM-020 group, and the negative control group showed small differences.宽潦捍费#的▲潦淡产··Collect blood samples from the tail for biochemical verification. The blood sample was allowed to stand at room temperature for 1 hour, and centrifuged at 2,500 rpm for 10 minutes. The upper serum was taken for verification. O:\84\84198.DOC -26- 1283268

The concentration of trimethyl glycerol (TG) in each group was determined by TRIGLYCERIDES GPO LIQUID REAGENTTM (ASK®, Taiwan) and the absorption was measured by Autoanalyzer HitachiTM 7150. The total cholesterol (CHOL) concentration was determined by CHOLESTEROL LIQUID REAGENTTM (ASK®, Taiwan) and the absorption was measured by Autoanalyzer HitachiTM 7150. The concentrations of HDL_C and LDL_C were determined according to a selective inhibition method and an enzyme assay (Unichem®, transcript), and the absorption was measured by Autoanalyzer HitachiTM 7150. Data were analyzed by the Kmskal Wallis test and the data from the normal control group was used as a baseline for the Dunnett test. The results are shown in Table 7: where " represents ρ<0·01; a represents a negative control; a table positive control; e represents black fungus of IX; d represents 10X black fungus; e represents GM_020; f represents GM-020 Combined black fungus of IX; and g represents 10 X black fungus combined with GM-020. Table 7 Group CHOL TG HDL LDL Negative control 232.00±16.88 86.60±22.40 126.39士7·37 11.21士L40 Normal control 135.80 soil 6.67 120.00±20.35 86.90 soil 3·14 4.22 ± 0.56 Positive control 219.08±11.22 75.83±9.93 123.19 Soil 4.20 10.04 Soil 0.93 IX black fungus 182.50 soil 8.24 82.08 ± 7.32 100.57 ± 3.58 12.39 ± 1.03 10X anger ear 176.83 soil 9.84 63.92 soil 4.62 93.51 ± 6.02 9.74 soil 1.07 GM-020 204.75 soil 8.90 96.56 ± 10.20 121 · 64 ± 8 · 47 14.04 Soil 3.10 Black fungus IX with GM-020 190.08 soil 4.85 55.75 soil 4.38 105.38±3.10 10.83 Soil 1.51 10X black fungus combined with GM-020 164.20±8.64 57.30 soil 4.61 97.93 soil 5.42 8.04±0.94 P value 0·000,, _ 0.000 0·000,, _ 0.014, a black fungus group of IX combined with GM-020 and 10× black fungus group combined with GM-020 are lower than the negative control group. Serum Concentration of Tridecyl Glycerol O:\84\84198.DOC -27-

1283268 (23) degrees. On the other hand, the black fungus group of IX, the black fungus group of 10X, and the GM-020 group had a small difference compared with the negative control group. In addition, the 1X black fungus group, the 10X black fungus group, the 1 X black fungus group combined with GM-020, and the 10X black fungus group combined with GM-020 have lower total cholesterol and HDL-C. Serum concentration. As for the concentration of LDL-C, each group except the normal control group showed a small difference.廯游/f费# The tooth rot is lightly produced •• Kill the mouse and take the right lobe liver. The fat is extracted according to a conventional method. For each sample, the concentrations of trimethyl glycerol (TG) and total cholesterol (CHOL) can be determined as described above. Data were analyzed by the Kruskal Wallis® test and the data from the normal control group was used as the baseline for the Dunnett test. The results are shown in Table 8: wherein "represents ρ <0·01; a represents a negative control; b represents a positive control; c represents black fungus of IX; d represents 10X black fungus; e represents GM-020; f represents GM -020 combination of black fungus IX; and § represents 10 X black fungus combined with GM-020. Table 8 Group CHOL TG negative control 25.75 ± 2.17 135.00 soil 11.92 normal control 21.80 soil 0.58 65.60 soil 6.56 positive control 26.75 soil 1.48 103.58 soil 11.41 IX black fungus 20.75±0.85 85.50 士3.76 10X black fungus 22.00 soil 0.72 84.83 soil 8.56 GM-020 19.44 soil 0.85 88.56 士6.41 IX black fungus combined with GM-020 21.25 士 0.70 83.25士6·27 10X black fungus 20.90 soil 0.81 77.50 soil 7.82 P value 0.000, 啦 0.004, _ such as IX black fungus group, GM-020 group, and GM-020 combination black wood O: \84 combined with GM-020 \84198.DOC -28-

1283268 (24) Each of the ear and the 10X black fungus group combined with GM-020 has a serum concentration of lower total cholesterol. In the case of triterpene glycerol, each of the blackwood group of IX, the black fungus group of 10X, the black fungus group of IX combined with GM-020, and the black fungus group of 10X combined with GM-020 One is significantly reduced. The rot and the shovel are considered to be • Treat the blood sample as described above. For each sample, the concentration of creatinine was determined according to the method of Jaffe reaction (Unichem®, Japan), and the absorption was measured by Autoanalyzer HitachiTM 7150. The GOT concentration was determined by GOT (ASAT) IFCC modTM (HUMAN®, Germany) and the absorption was measured by Autoanalyzer HitachiTM 7150. The GPT concentration was determined by GPT (ALAT) IFCC modTM (HUMAN®, Germany) and the absorption was measured by Autoanalyzer HitachiTM 7150. The concentration of uric acid (UA) was determined according to the uricase peroxidase method (Unichem®, Japan), and the absorption was measured by Autoanalyzer HitachiTM 7150. Data were analyzed by the Kruskal Wallis(R) test and the data from the normal control group was used as a baseline for the Dunnett test. The results are shown in Table 9: wherein "represents ρ <0·01;& represents a negative control; b represents a positive control; e represents black fungus of IX; d represents 10X black fungus; e represents GM-020; Black fungus of IX combined with GM-020; and 8 represents 10 X black fungus combined with GM-020. Table 9 Group GOT GPT Creatinine - UA ~ Normal control group 134.00 Shi 23.11 72.67 Soil 6.98 0·52 Soil 0.04 2.66 ±0.92 Negative control 79.20 soil 6.22 49.00 soil 9.18 0·52 soil 0·02 3·90±1·33 positive control 117.50 ± 12.95 47.00 soil 6· 17 0·56 soil 0·03 2·42±0·50 IX Black fungus 107.00 soil 14.77 37.33 soil 2.77 0.47 soil 0.02 5.20 ± 0.91 O: \84\84198.DOC -29-

1283268 10 X black fungus 120.00 soil 15.78 57.42 ± 5.68 0.46 soil 0.02 2.88 soil 0.57 GM-020 109.67 soil 17.30 36.22 soil 3.05 0.47 soil 0.03 1.96 soil 0.40 GM black fungus combined with GM_020 150.00 soil 21.71 44.91 soil 3.93 0.45 soil 0.02 2.12 Soil 0.48 combined with GM-020 10X black fungus 76.40 ± 13.5 37.50 soil 3.95 0.39 soil 0.03 2.10 ± 0.36 P value 0.072 0.002, c, e, f, g 0.002" g 0.006 Differences in the results of these groups Not significant. Indicates that the index of liver and kidney function has not been affected after treatment with GM-020 and/or black fungus. Example 6: GM-020 for the treatment of hyperbilirubinemia ##麦:Male The hamsters were purchased from the National Laboratory Animal Center in Taiwan and were kept in the light for 12 hours and kept in the dark for 12 hours at a temperature of 1 °C and a humidity of 60 ± 5%. The food and water were fully replenished. The rats were divided into two groups: one group was the normal control (NC) group and the other group was the cholesterol-rich diet group. The normal control group was fed a normal diet and the group of the cholesterol-rich diet. Feed with 24% egg a 2% cholesterol-rich diet with 14% fat, 2% cholesterol, 48% carbohydrates, 6% cellulose, and 6% minerals and a mixture of vitamins. Killed by the bath • Continuously fed to the normal control group Take a normal diet. Treat twice a day. The group that enriches the cholesterol-rich diet according to the treatment is further divided into the following groups: (a) Lactobacillus gasseri, (b) GM-020, (c) Lactobacillus sphaeroides (Z., and (d) a negative control (Control) treated with saline. Each dose is 1〇9 CFU/mL. Guang Yan/fc·故#“ώ净!! Before and after treatment, blood samples were collected from the periorbital vein for biochemical assays. The blood samples were allowed to stand at room temperature for 1 hour and centrifuged at 2,500 rpm for 10 minutes. The upper serum was taken at O:\84 \84198.DOC -30·

1283268 (26) For verification. For each sample, the concentrations of total cholesterol (CHOL), HDL-C, LDL-C, and tridecylglycerol (TG) can be assayed as described above. Data were analyzed by the Knxskal Wallis(R) test and the data from the normal control group was used as the baseline for the Dunnett test. Table 10 shows the difference in fat content between before and after feeding a cholesterol-rich diet, where # represents ρ<〇·1;"

Table ρ <0·05 ; represents ρ < 〇 · 〇 1 ; 3 represents a negative control; b represents Lactobacillus gargle; e represents GM-020; 0 represents blister wear 鑀 #磨. Table 10 HDL-C 0 HDL-C 4 LDL-C 0 LDL-C 4 CHOL 0 CHOL 4 TG 0 TG 4 NC 117.6 Soil 10.8 119.5+11.5 105.4± 8.4 243.6±25.2 398.8±31.2 485.5±70.4 421·0±59 ·9 365.8±65.9 Control 70.5+3.6 64.9±5.0 23.5+1.3 20.8±1.8 104.0+4.1 96.8±5.3 224.0±23.1 180·7±14·8 Calcium lactic acid-like 谪141.3±10.5 103.1±3.8 179.4±21.2 211.2± 23.9 531. 6±32.9 653.0±45.1 585.8±103.0 822·6±59·1 GM-020 108.8±14.2 118.7±8.4 106.9+9.0 136.5±19.8 412.0±63.0 420.4±53.0 483.3+67.5 760.5±98.7 Shovel 104.9±23.7 82.8±3.0 127.1±6.6 202.3±11.6 414.5±18.1 541·5±51·9 439·5±42·0 687.8±131.0 P value 0.0088 “0.00(^- 0·000— 0.000 private one o .oooaw o.oooa"- 0.008a^ 〇.〇〇〇,-

According to the results, after 4 weeks of feeding the cholesterol-rich diet, the group rich in cholesterol showed a significant increase in CHOL, HDL-C, LDL-C, and TG compared with the normal control group, and the rich Subgroups of cholesterol-containing diets show small differences between each other. In the case of TG, all of these cholesterol-rich diet subgroups exhibited significantly greater TG than the normal control group after 4 weeks of treatment. In the case of CHOL, after 4 weeks of treatment, the Lactobacillus faecalis group, the Lactobacillus sp., and the negative control group exhibited significantly greater CHOL than the normal control group. On the other hand, the GM-020 group showed a small increase compared to the normal control group. The difference between (CHOL_0 before treatment) and after treatment (CHOL_4) is shown in Figure 7. It shows that GM-020 has a lower total cholesterol O:\84\84198.DOC -31 - 1283268

(27) The ability of serum concentration. In the case of HDL-C, after 4 weeks of treatment, the blistering axe group showed significantly lower HDL-C than the normal control group. However, the Lactobacillus kawaii group, the GM-020 group, and the negative control group showed small differences. For LDL-C, serum concentrations are shown in Figure 8. The GM-020 group exhibited a significantly reduced Ldl-C compared to the normal control group (p < 〇 1). Further, after 4 weeks of treatment, the 'Lactobacillus calerphin group and the blister axe group showed a LDL-C which was significantly lower than the normal control group (Ρ <〇·05) (see Fig. 9). It is shown that GM-020 has the ability to lower the serum concentration of total cholesterol. In the case of LDL-C/HDL/C, the ratio is shown in Table 11 and Figure 1,, where + represents ρ<0·1;" represents p<〇.〇5;... represents ρ<0·01;" represents a negative control; b represents Lactobacillus gargle; e represents GM-020; d represents blister #裒鑀#遨. Data can be analyzed by the Kruskal Wallis® test and the data from the normal control group is used as a baseline for the Dunnett test. Table 11 LDL-C/HDL-C 0 LDL-C/HDL-C 4 NC 0.98±0.07 2·13±0·47 Control 0.33±0.02 0.32±0.01 Lactobacillus kawaii 1·27±0·13 2.08±0.27 GM-020 0·90±0·13 1.20±0.27 Lactobacillus sp. 1.46±0·42 2.44±0.14 P value 0.003^ (X000a, cw GM-020 group compared with the normal control group (ρ<0·001), A significant reduction is shown, indicating that GM-020 has the ability to reduce LDL-C/HDL-C. While embodiments of the invention have been illustrated and described, various modifications and improvements can be made by those skilled in the art. It is intended that the invention be limited as described by O:\84\84198.DOC -32- 1283268

The particular form of (28), and all modifications that do not depart from the spirit and scope of the invention, are within the scope defined by the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates a 1000X micrograph of GM-020. Figure 2 illustrates the cell wall proteins of GM-020 and the conventional L. rhamnosus strain; wherein Μ represents the molecular weight of the protein; Lane 1 represents Lactobacillus rhamnosus (commercial Antibiophilus); and lane 2 represents Lactobacillus rhamnosus gm -020; Dao 3 represents Lactobacillus licheniformis ATCC9595; Lane 4 represents Lactobacillus rhamnosus ATCC 10940; and Lane 5 represents Lactobacillus rhamnosus ATcci4〇29. Figure 3 illustrates the 2_D total protein electrophoresis of GM-020. Figure 4 illustrates the difference in body weight of an animal model treated by GM_〇2〇 or/and black fungus (w〇〇d ear) according to Example 5; wherein ** represents p<〇〇1; a represents a negative control; b represents a positive control; c represents a black fungus of 1χ; d represents a black fungus; e represents GM-020; f represents a black fungus of lx combined with GM-020; and § represents a combination with GM-020 Black Fungus. Figure 5 illustrates the difference in lipid tissue weight around the testicles of the animal model treated with gm-020 or/and black fungus according to Example 5; wherein ** represents ρ <0·01;& represents a negative control; b represents Positive control; e for black fungus; for 10X black fungus; e for GM_020; f for black fungus combined with (}]^_〇2〇, and g for ι〇χ零木 combined with GM-020. Figure 6 illustrates the difference in weight of lipid tissue around the kidneys of an animal model treated with GM_〇2〇 or/and black fungus according to Example 5 (4)·Heartwear 1 (4) (4) photos; ζ = ear represents d O: \84\84198.DOC -33-

1283268 represents 10X black fungus; e represents GM-020; f represents 1 X black fungus combined with GM-020; and 8 represents 10X black fungus combined with GM_020. Figure 7 illustrates the difference between the serum concentrations of total cholesterol before (CHOL_0) and after treatment (CHOL-4) according to Example 6; where 'represents ρ<0·1;" represents ρ<0·05; represents ρ<;0·01. Figure 8 illustrates serum concentrations of LDL-C before treatment (LDL-C-0) and after treatment (LDL_C_4) according to Example 6; wherein * represents ρ <0·1; "represents ρ <0.05; ... represents ρ < Figure 9 illustrates the difference in serum concentrations of LDL-C between before treatment (LDL-C _0) and after treatment (LDL-C_4) according to Example 6; where * represents ρ <0.1;" represents Ρ <〇·〇5; represents ρ<0·01. Figure 10 illustrates LDL-C/HDL- before treatment (LDL-C/HDL-C_0) and after treatment (LDL-C/HDL-C_4) according to Example 6. The difference in serum concentration of C; where # represents Ρ<〇·1;" represents ρ<〇·〇5;... represents p<0.01. O:\84\84198.DOC -34- 1283268 (so) Sequence Listing <;110〉 Jingyue Biotechnology Co., Ltd. <120〉 Novel microbial strain Lactobacillus rhamnosus GM-020 and its use for treating pain p fat /, / mouth fat fertilizer < 130> no <160> 1 <170〉 Patentln version 3.2 <210> 1 <211> 501

≪ 212 > DNA < 213> Lactobacillus rhamnosus < 400 > 1 tcaggatgaa cgctggcggc gtgcctaata catgcaagtc gaacgagttc tgattattga 6 〇aaggtgcttg catcttgatt taattttgaa cgagtggcgg acgggtgagt aacacgtggg 120 taacctgccc ttaagtgggggataacattt ggaaacagat gctaataccg cataaatcca 180 agaaccgcat ggttcttggc tgaaagatgg cgtaagctat cgcttttgga tggacccgcg 240 gcgtattagc tagttggtga ggtaacggct caccaaggca atgatacgta gccgaactga 3 0 0 gaggttgatc ggccacattg ggactgagac acggcccaaa ctcctacggg aggcagcagt 360 agggaatctt ccacaatgga cgcaagtctg atggagcaac gccgcgtgag tgaagaaggc 420 tttcgggtcg taaaactctg ttgttggaga agaatggtcg gcagagtaac tgttgtcggc 480 gtgacggt at ccaaccagaa a 501 35-

O:\84\84198.DOC

Claims (1)

1283黛你Bl〇3635 Patent Application Year> Month'Vr'々/宝)f This Chinese patent application scope replacement replacement (February 1996) ' '八〜一~f 拾, apply for patent garden: 1. An isolated microbial strain, Lactobacillus rhamnosus (Z^ctoZ^cz7/(10)r/^mwoms*) GM_020, deposited at the Food Industry Development Research Institute of Hsinchu, Taiwan, under the accession number BCRC910236. 2. A composition comprising a microorganism strain according to claim 1 of the patent application. 3. A composition as claimed in claim 2 for use in the treatment of obesity and its onset. 4. The composition of claim 3, wherein the composition further comprises a ticket, an auricularia polytricha. 5. The composition of claim 3, wherein the complication is selected from the group consisting of hypercholesterolemia, atherosclerosis, and coronary heart disease. 6. A composition for treating obesity and a complication thereof in a subject, comprising a microorganism strain as claimed in claim 1 and an Auricularia polytricha 〇 7. as claimed in claim 6 The composition of the present invention, wherein the complex is selected from the group consisting of hypercholesterolemia, atherosclerosis, coronary heart disease, fatty liver, and diabetes. 8. The composition of claim 6, wherein the sputum is selected from the group consisting of hypercholesterolemia, atherosclerosis, and coronary heart disease. 9. Use of a microorganism strain as claimed in claim 1 for the preparation of a medicament for the treatment of obesity and its complications. 10. The use of claim 9 wherein the complication is selected from the group consisting of hypercholesterolemia, atherosclerosis and coronary heart disease. 11. A use of the composition of claim 4, for use in the manufacture of K:\PUB\temporary SCAN file, !^, issue\960209\841980A1 amendment (replacement). DOC I283i68i〇3635 Patent Application Chinese Patent Application Replacement Replacement (February 1996) Preparation of drugs for the treatment of obesity and its complications. 12. The use of claim 11, wherein the syndrome is selected from the group consisting of hypercholesterolemia, atherosclerosis, coronary heart disease, fatty liver, and diabetes. 13. The composition of claim 12, wherein the syndrome is selected from the group consisting of hypercholesterolemia, atherosclerosis, and coronary heart disease. Recall. \扒! "\斩左5广众\1检\[卩1\偷力"\<)60200\84〗卯0六1修7^巷抱太,00(^ - 2 -