TW200528120A - Novel microorganism strain gm-020 of lactobacillus rhamnosus and its use for treating obesity - Google Patents

Abstract

The present invention provides an isolated microorganism strain, Lactobacillus rhamnosus GM-020, which is found to be effective in treating obesity and a complication thereof. The use of the Lactobacillus rhamnosus GM-020 in treating obesity and a complication thereof is also provided.

Description

200528120 _ ⑴ 玖, Description of the invention: [Technical field to which the invention belongs] The present invention mainly relates to a novel microbial strain Lactobacillus rhamnosus GM-020 and its use for treating obesity or its scurvy. [Previous technology] Obesity is the body fat usually caused by changes in physiological or biochemical functions

Fat excess, which can significantly harm health. Fat usually includes neutral lipids, phospholipids, and cholesterol. Weight gain depends on a person's energy intake being greater than energy expenditure. There are two types of obesity: (a) simpie obesity, and (b) second obesity. Simple obesity can be divided into idiopathic obesity and aCqUired obesity, which can account for more than 95% of obesity. Congenital obesity is caused by a large number of adipocytes, and is common in childhood obesity. Acquired obesity is caused by the larger size of adipocytes and is common in adult obesity. Secondary obesity is also called symptomatic obesity, and it is usually caused by endocrine or metabolic diseases. Obesity is associated with several chronic diseases such as diabetes, cardiopathy, hypertension, stroke, biliary calculus, gout and certain cancers. There are currently five strategies for treating obesity: diet reduction, exercise, behavioral therapy, medication, and therapeutic operation. Depending on the patient's health risk factors, and the speed and effect of weight loss, you can choose or combine this net to treat obese patients. The speed and effect of weight loss are affected by factors such as age, body size, family history, and risk factors. And other factors. The mechanisms of drug treatment include appetite suppression, increased energy expenditure, stimulation of fat movement,

O: \ 84 \ 84198.DOC

200528120 (2) Decrease the synthesis of trimethyl glycerol and inhibit fat absorption. Examples of these drugs are phenylpropanolamine (PPA), Rolistan (XenicalTM), and sibutramine (ReductilTM). However, treating obesity with natural substances rather than drugs has become a new trend. In the prior art, it has been found that some strains of microorganisms can be used to treat obesity, or its morbidity. For example, it was found that Lactobacillus gasseri (丄 gawer /) SBT0270 has the ability to reduce the concentration of cholesterol related to the debinding of bile acids ((Usman, B. and Hosono, A. (2001), "Lacciella gassii like g ( 2Ma / jSBT0270 Causes Hypocholesterolemic effect of Lactobacillus gasseri SBT0270 in rats fed a cholesterol-enriched diet, J. Dairy Res. 68: 617-624) The mechanism of treating obesity is: the free form bile acid is absorbed by Lactobacillus garnerii and excreted by feces (because the excreted bile acid cannot be recycled back to the liver, and new bile needs to be synthesized from cholesterol Acid) to reduce the solubility of this decomposed bile acid. In addition, it was found that Lactobacillus gaurensis can be combined with bile acids and cholesterol to achieve excretion. Lactobacillus rhamnosus is considered to be a potential immune enhancing property Probiotic Lactobacillus. Safety assessment of Lactobacillus rhamnosus has also been investigated. Zhou et al. Revealed the administration of rhamnose lactic acid Bacteria and hematologic parameters in mice (red blood cell and platelet count, hemoglobin concentration, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin and the concentration), different white blood cell count, blood biochemistry (plasma total protein,

O: \ 84 \ 84198.DOC

200528120 (3) Albumin, cholesterol, and glucose), histology of mucosa (epithelial cell height, mucosal thickness, and villus height), and bacterial displacement to extra-intestinal tissues (blood, liver, spleen, kidney, and mesenteric lymph nodes) , Showing a similar profile to control mice (Zhou, J.S., Shu, Q., Rutherfurd, KJ, Prasad, J., Birtles, M.J., Gopal, P.K. and Gill, HS (2000), "Safety Assessment of Potential Probiotic Lactobacillus Rhamnosus HN001, Lactobacillus Acidophilus HN017, and Bifidobacterium HN019 in BALB / c Rats" assessment of potential probiotic lactic acid bacterial strains Lactobacillus rhamnosus HN001, Lb. acidophilus HN017, and Bifidobacterium lactis HN019 in BALB / c mice) »International Journal of Food 8/7 to 6 ^ / 6 ^ 6 ^ 756: 87-96). At the same time, Agerholm-Larsen et al. Revealed that yoghurt fermented with Lactobacillus rhamnosus fermented did not change low-density lipoprotein (LDL) -cholesterol, but only significantly reduced systolic blood pressure (Agerholm-Larsen, L. , Raben, A., Haulrik N., Hansen, AS, Manders, M., and Astrup A. (2000), "Effect of 8 week on the risk factors of cardiovascular disease" intake of probiotic milk products on risk factors for cardiovascular diseases), Eur J Clin Nutr. 54 (4): 288-97). Therefore, it can be shown that the conventional rhamnosylbacillus strain does not change total cholesterol and LDL-cholesterol. In addition, no change in body weight was observed when the conventional rhamnolide strain was administered. [Summary of the Invention]

O: \ 84 \ 84198.DOC 200528120 _ (4) The present invention provides a novel microorganism strain Lactobacillus rhamnosus GM-020. In another aspect, the present invention provides a method for treating obesity and eruption in a subject, the method comprising administering to the subject a combination comprising a microorganism strain Lactobacillus rhamnosus GM-020 Wherein, the eruption is preferably selected from the group consisting of hypercholesterolemia, atherosclerosis and coronary heart disease. In yet another aspect, the present invention provides a method for treating obesity and eruption in a subject, the method comprising administering to the subject a lactobacillus rhamnosus GM-020 containing a microorganism strain and Auricularia polytricha strain composition; wherein the eruption is preferably selected from the group consisting of hypercholesterolemia, atherosclerosis, coronary heart disease, fatty liver and diabetes. [Embodiment] The present invention provides a novel microorganism strain Lactobacillus rhamnosus GM-020, which can treat obesity. The GM-020 strain was deposited at the Food Industry Research and Development Institute (FIRDI) accession number BCRC910236 on November 18, 2003. Lactobacillus rhamnosus GM -020 is isolated from human stomach. The following shows the fungal characteristics of Lactobacillus rhamnosus GM-020: (a) Morphological characteristics (1) Cell shape and size: When the cells are cultured overnight in MRS medium at 37Y, 'Cinnamomum camphora' Bacteria which have round

O: \ 84 \ 84198.DOC 200528120 _ (5) A rod-like shape with an edge. (2) Motility: Inactive (3) Flagella: None (4) Spore formation: No spore formation (5) Gram staining: positive (b) Culture characteristics: (1) Medium: MRS medium (DIFCO® 0881 ) (As shown in Table 1), the final pH is 6.5 ± 0.2 Table 1 Component g / L Protein (Proteose peptone) 10.0 Beef Extrac 10.0 Yeast Extract 5.0 Dextrose 20.0 Polysorbate 80 1.0 Ammonium citrate 2.0 Sodium acetate 5.0 Sulfate sulfate 0.1 Sulfate sulfate · 0.05 Dipotassium Phosphate 2.0 (2) Culture conditions: anaerobic culture at 37 ° C (anaerobic culture) or aerobic culture (c) physiological characteristics: (1) catalase: negative (2) oxidase: negative (3) API 50 CHL test: use API 50 CHL system to identify Lactic acid O: \ 84 \ 84198.DOC -10-

200528120 (6) bacteria. By testing the reaction of a series of enzymes, the character of the lactic acid can be determined. Table 2 shows the results of API 50 CHL test of GM-020: Table 2 Enzyme reaction Enzyme reaction 1 Enzyme reaction Glycerol-Mannitol + D-Tagatos + Erythritol-Yamanashi Alcohol (Sorbitol) + 5 ketogluconic acid D-arabin bran-α-methyl-D-glucoside + 2 ketoglucofuranoic acid L-arabinose-N acetamidine glucosamine + gluconic acid-ribamangoside + L-Arabitol-D-Xylose Arbutine + D-Arabitol-L- Xylose-Esculine + L-Fucose-Adonitol Salicine ) + D-fucose- / 3-fluorenyl-xylosin- cellobiose + D-lyxose D-glucose + galactose + anuline scale D-fructose + lactose + Sucrose-D-Mannose + α-Lino-D-Mannoside-Glycogene L-Sorbose + Melezitose + Xylitol-Rhamnoside + D-Raffinose (D- Raffinose / 3 Gentiobiose-Dulcitol-Amidon-D-Turanose Inositol-Maltose-Melose -Trehalose-(d) Genetic characteristics: The 16S rDNA sequence analysis of GM-020 was determined by the Food Industry Development Institute of Hsinchu, Taiwan, as shown in SEQ ID NO: 1. End O: \ 84 \ 84198.DOC -11-

200528120 Capsules show that GM-020 can be highly homologous with other rhamnose lactobacillus strains, with a similarity of more than 99%. (e) GM-020 cell wall protein: GM-020 cell wall protein showed a specific pattern when compared with other known rhamnolide rod strains. Figure 2 shows the SDS-PAGE pattern of the cell wall protein of GM-020. The total protein of GM-020 can withstand 2-D electrophoresis, and the pattern shown in Figure 3 is specific. (f) Standardized detection system for identifying GM-020: A standard detection system that can be used to identify microorganisms is disclosed in US Patent Application No. 10 / 446,781, filed on May 29, 2003. The system uses The difference in gene expression between a given cell culture and a test cell line without a given cell culture is used as a marker for identification. Table 3 lists the genes tested. Table 3 Gene—tFL number transduction and transcription activator ~~ 1 (Signal transducer and activator of transcription) 3____ orel ~ ---- growth related protein 43 --- N-myc — '~ ----IGF binding protein 1 — One " "-IL-16 '" ---- Two lymphotoxin a (Lymphotoxin α) (previous tumor if death factor 0) " ~ Interferon-inducing protein 9-27,-1 g Associated Tissue Growth Factor --------- Interleukin 10 Receptor '---- calpamodulin mRNA ~ --- I-Peptin Crosslinking Enzyme (UbcH8) mRNA Compound (comp) ~-

O: \ 84 \ 84198.DOC -12- 200528120

Hyundai (1 " 1〇1110 53 卩 丨 6115) protein kinase human binding protein eight 1 ^ \? 11〇1111 ^ eight, completely 0 (15 propionate dehydrogenase kinase, isoenzyme 4 — ~ 0 ratio 哆Jun (0-pyridoxine, vitamin B6) kinase '~ MAP kinase-serine / threonine kinase 1 ~~ leukocyte tyrosine kinase_ " neurotrophic tyramine Acid Kinase, Receptor, Type 3 (TrkC) ~ " 'Pyruvate dehydrogenase kinase isoenzyme 3 (PDK3) mRNA, complete cds " human diacylglycerol kinase zeta) mRNA, complete cds ^ Leukokinase C, α Deoxyguanosine kinase ΐglycoside kinase " 1-p isomerase (DNA) II / 3 (180kD) ^ " IkB kinase / 5 subunit mRNA stat5a (Signal Transduction and Transcription Activating Factor 5A) — ^ stimulating factor 1 (M-CSF) — HGF ^ iL-1 receptor type 1 'interleukin 7 i thioprotein IB gene leukin 6 (B cell stimulating factor 2) — Small inducible cytokine A2 (monocyte chemotactic protein 1, _ ^ Proteasome 26S subunit, ATPase, 3-1) Cross-linking enzyme E2A (RAD6 homologue) One thymus, thymidine kinase l, soluble _ complex amino acid kinase 2 glutamic acid / glycine protein-kinase ~ Transforming growth factor / 3 (Transforming growth factor beta) -activated kinase 1__ ^ Fms-associated tyrosine kinase ~ acid kinase B ^ 1 serine / glycine kinase stk2 — stress-activated protein kinase 3 (SAPK3) Mma · " ~ Human adenylate ^ 2 (adk2) mRNA, complete cds — $ AC-α serine / threonine kinase — ~ hexokinase "" " iDC28 protein 1 number enzyme 2 (CKS2) mRNA-superoxidation Mitogenase 2, mitochondrial tumor necrosis factor receptor 2 growth-associated protein 43__ is related to 涵 53 ^ gene ~ ^ O: \ 84 \ 84198.DOC -13-

200528120 ⑼ CD30__ i belongs to thioprotein-in '' interleukin 4 receptor ~ " 7-interferon-inducible protein φ-30 precursor interferon-α / / 3 receptor alpha chain precursor ^ " " ^ ¥ phase growth response protein 1 " " Leukin-13 receptor mRNA, complete cds ~~ Protease inhibitor 12 (PI 12; neuroserpin) Serine / glycine protein kinase KKIALRE ~ 'Phosphorylase (kinase), yS-based amino acid / threonine kinase 9 serine / threonine kinase 10 · Protein kinase mitogen-activated 8 (MAP kinase) Focal adhesion kinase (focal adhesion kinase) kinase (FAK) mRNA, complete cds__ human activated p21cdc42Hs kinase (ack) mRNA, complete cds — human integrin-linked kinase (ILK) mRNA, complete cds human guanylate kinase (GUK1) mRNA, complete cds " ~~ BMK1 alpha kinase mRNA, complete cds 'flavin-containing monooxygenase 5 (FM05) mRNA' pyruvate kinase, liver "-transcription elongation factors S-II, hS-II-T nitric oxide synthase 3 ( Endothelial cells)

Bcl2, p53-binding protein Bbp / 53BP2 (BBP / 53BP2) mRNA, telomere DNA sequence " " " — stat-like protein (Fe65) mRNA, complete cds — IL-5 receptor a 'EGF ~ ~ " 'FGF2 —-interleukin 2 receptor τ chain " " a CC chemokine receptor type 2 " a

Guanylate Binding Protein 1, Interferon Inducible, 67kD Mitochondria ^ Processing Peptidase / 3 -Subunit '' syntaxin 8___ Cytokine inhibits anti-inflammatory drug binding protein 1 (p38 MAP kinase) ~ protein tyrosine kinase 6 " ~ --- Branched-chain α-keto acid dehydrogenase kinase-Serine Si / Tyrosine kinase 2--Protein kinase 'mitogen-activated 4 (^ 1 into 卩 kinase 4: Mouth 63) (卩] ^^ [4) 111] ^ Octatyrosine-protein kinase SYK ~ " —Putative) Serine / Su Su ^ White kinase PRK (prk) mRNA, complete cds

O: \ 84 \ 84198.DOC -14- 200528120 (10)

Adenylate kinase isoenzyme 1_ hematopoietic cell kinase glycerol kinase tyrosine-protein kinase CSK general transcription factor IIB ~~ interleukin 6 signal transduction (gpl30, oncostatin M receptor) caspase- 8 (apoptotic cysteine protease mch5 (mach-α-1)) _ tumor protein p53 transforming growth factor, / 3 receptor 111 (/ 3 glycan, 3 ~ IFN-g transforming growth factor, / 33 TGF- / 3 protein superfamily, complete Fibroblast growth factor 7 (keratinocyte growth factor) — inducible small molecule cytokine A4 (same line as mouse Mip-lb) — hepatocyte growth factor activator inh_ ubiquitin Carboxy-terminal hydrolase isoenzyme 11 serine / threonine kinase 11 (Cyclin-dependent kinase inhibitor 3 (CDK2-related bispecific phosphatase) of pigmented polyp syndrome) Pyruvate dehydrogenase kinase, isoenzyme 3, carnitine palmitoyltransferase I, liver protein kinase mitogen-activated 7 (MAP kinase) _ human protein tyrosine kinase mRNA, complete cds protein-tyrosine kinase 7 Lymphocyte-specific protein tyrosine kinase ribosomal protein s6 kinase_ src-like kinase (sl k) mRNA, complete cds Nucleoside diphosphate kinase a Cyclin-dependent stress 2-STATAa / j8 Angiopoietin-1 Phospholipase C STAT2 (Signal transduction and transcription activation factor 2) ~ c-src pathway Amino acid kinase IL-15 TGFb receptor-related protein 1 Annexin (Amiexin) V (lipidin V; integrin II) — interferon regulator 5 interferon-T receptor alpha bond precursor _ transition growth factor , / 3 receptor 11 (70-801 ^ 0) O: \ 84 \ 84198.DOC -15- 200528120 (11) Modern human apoptotic protease activating factor 1 (Apaf-l) ubiquitin cross-linking enzyme E2B CRAD6 homologue ) ~ MAP / ERK kinase kinase 3 _ phosphorylase kinase, α2 (liver), glycogen storage ^ Serine / Glycine kinase 4 'Glucosamine-6-phosphate deaminase ~: Methacene Kinase (Mevalonate kinase) glucokinase (hexokinase 4 'maturity onset diabetes of the young 2) _ deoxycytosine kinase urokinase type cytosinogen activator ~ human mitochondrial creatine kinase (CKMT) Gene, complete cds bile kinase — " ~ 53K isoform of human phospholipid muscle 4-phosphate 5-kinase (PIPK) type IlmRNA, complete cdS white blood Adhesin / 3 subunits '~ c-fos " " ~ apoptotic cysteine protease mch4 "' ~ monocyte chemotactic protein 1 " ~ transcription factor AP-4 (activation-enhancing factor- Binding Protein '~ Interleukin-1 Receptor, ^ 1 Precursor ~-Caspase-10 (Human> Weekly Cysteine Protease mch4) _ Human Kinase (TTK) mRNA, Completely cds j- 2 adrenergic receptor ~ '' ^ hormonal transcriptase (ste) ~ " '^ transduction and transcription activation factor 6, induced by S-4' 's white kinase clkl — " ileukin-8 Precursor — 'A 1¾ generation human FAST kinase mRNA ~~ " ^ Interferon_T receptor alpha bond precursor " ~ ¥ page insulin growth factor I receptor pre ~~ mitochondrial transcription termination factor' signal transduction And transcription activator 3 (acute-ph ^ generation human protein kinase CKlmRNf ~ — Imap kinase-activated protein kinase f — ^ leukokinase clk3 '' ~ iNF-b — — &#; 7 transcription factor iis, PDGF B chain — I-actin — O: \ 84 \ 84198.DOC -16- 200528120 (12) Glutathione S-transferase Ml-IL-lb-i AP / ERK kinase kinase 3 — INF-b ~ " EGR-1 ~-glutathione S- transferase enzyme peptide 12 (microsomes) for identifying GM-020 of the standard detection systems Hep G2 cell line as the test cell line. When the representation patterns of cultured Hep G2 cell lines with or without GM-020 are compared, the set of genes listed in Table 4 can be significantly different. Table 4 _ ______ & __ 0_ interleukin 10 receptor —IL-16 —-~ EGF —- lymphotoxin α (previous tumor necrosis factor / 5) interferon regulatory factor 5 T fibroblast growth factor 7 (keratin Cell growth factor) protein disintegration 26S subunit, ATPase, 3 calpamodulin mRNA_ 1 deficient hormone carboxyl-terminal hydrolase isoenzyme LI " hexokinase 1 ^ " human phospholipid inositol-4-phosphate 5-kinase (PIPK) 53 of isotype II mRNA, complete cds_ ^ loaded mitochondrial transcription terminal factor-STAT-la // 3 ^ urokinase-type cytosinogen activating factor human adenylate kinase 2 (adk2) mRNA , Complete cds — protein kinase C, α ~ a proto-oncogene tyrosine-protein kinase FES / FPS human mitochondrial creatine kinase (CKMT) gene, complete Cds protein tyrosine kinase 6 serine / serine kinase 9 "

Kinase / 3 subunit mRNA = caspase-8 (apoptotic cysteine protease! NCh5 (mach-a-l)) O: \ 84 \ 84I98.DOC -17- 200528120 (13)

Bcl2, p53-binding protein Bbp / 53BP2 (BBP / 53BP2) mRNA, growth-associated protein ^ ~ ^ protein kinase clk3 " ~ 'tumor necrosis factor-inducible protein TSG-6 precursor insulin-like growth factor [receptor precursor — Monocyte chemotactic protein 1 leukocyte adhesion protein subunit __

Sis, PDGF B bond-~

Humig mRNA CD27L receptor __——

Retinoic acid and interferon-inducible 58K protein RI IRF-1 — The present invention provides a method for treating obesity and eruption in a subject, the method comprising administering the drug to the subject A composition comprising GM-020. In the present invention, it was surprisingly found that even if a subject ingests a high-energy food, the strain GM-020 has the ability to suppress the weight gain of the subject, and can suppress the body weight. In one embodiment according to the present invention, ICR mice treated with strain GM-020 and fed with high energy foods that can cause obesity, compared to the untreated control group, 'can maintain weight without any increase. It was also found in the present invention that the GM-020 strain is effective in regulating the ratio of cholesterol to lipoprotein. In one embodiment of the present invention, obese mice and hamsters fed with cholesterol-rich foods that can cause hypercholesterolemia are treated with the GM-020 strain to reduce the total cholesterol in their serum and liver. concentration. It can also lower the serum concentration of low-density lipoprotein-cholesterol (LDL-C). In addition, the ratio of LDL-C to high-density lipoprotein cholesterol (HDL_C) (LDL-C / HDL-C) in the serum can be reduced. In summary, GM-020 strain is used to treat hypercholesterolemia and reduce the incidence of atherosclerosis and coronary heart disease O: \ 84 \ 84198.DOC -18- 200528120

(14) Aspects are valid. That is, the GM_02 strain can be used to prepare a composition for treating obesity and its onset (such as hypercholesterolemia) and reducing the incidence of atherosclerosis and coronary heart disease. The present invention also provides a method for treating obesity and eruption in a subject, the method comprising administering to the subject a composition comprising a microbial strain Lactobacillus rhamnosus GM-020 and a black fungus strain; The eruption is preferably selected from the group consisting of hypercholesterolemia, atherosclerosis, coronary heart disease, fatty liver, and diabetes. It has been found in the present invention that the GM_020 strain combined with black fungus (Auricularia auricula) can provide amazing results in the treatment of obesity compared to the black fungus or GM_020 strain alone. Black fungus, commonly known as fungus, tree ear, etc., are colloidal, odorless, edible fungi. It is closely related to black fungus grown in Asia and has been consumed for a long time. It is found that black fungus can be wild on conifers and sometimes on deciduous trees in spring and winter. Black fungus is usually dried for consumption. When edible black fungus is consumed, the edible fiber can stretch about 8 to 10 times after absorbing water. Consumers may feel full and eat less. In addition, it has been reported that the polysaccharides in Auricularia auriculae have the effect of reducing the total cholesterol serum concentration in rabbits. In one embodiment according to the present invention, the weight of an obese animal model treated by a combination of black fungus and GM_020 can be reduced; on the contrary, the administration of pure black fungus or GM-020 can only suppress weight gain. It was found in the present invention that compared to the control group, the group of Auricularia auricula and GM-020 strain. It has the ability to reduce total cholesterol and trisyl in serum and liver of this animal model O: \ 84 \ 84198.DOC -19-

200528120 (15) The ability of the concentration of glycerol. In summary, a combination of black fungus and GM-020 strain can be used to prepare a composition for treating hypercholesterolemia, fatty liver, diabetes, and reducing the incidence of atherosclerosis and coronary heart disease. In one embodiment according to the present invention, the effect of treating obesity and hypercholesterolemia and reducing the incidence of atherosclerosis and coronary heart disease is directly proportional to the dose of black fungus. Normally, the recommended daily dose (IX) of black fungus for adults is 6 g X 0.0026 X surface area. In one embodiment of the present invention, a 10 X black fungus has a better effect than a 1 X black fungus. According to the present invention, only the GM-020 strain and the combination of GM-020 and black fungus do not cause damage to the liver and kidneys. In animal models, when monitoring the amount of glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), uric acid, and creatinine (creatinine), the liver The functional system is normal, which can indicate that the administration of only GM-020 strain, or the combination of GM-020 strain and black fungus is a safe way to treat obesity and its onset. It has also been found in the present invention that after treatment with a combination of GM-020 and Auricularia auricular, trisomylglycerol in the serum was reduced. The following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Example 1: Isolation of Rhamnosyl Lactate Rod® GM · 020 A piece of human stomach tissue taken out by an endoscope was cultured in 2 mL of Lactobacillus] ViRS medium (DIFCO®0881). The culture medium containing the tissue was laid flat on selective agar of Lactobacillus and incubated at 37 ° C for one day. Select individual colonies grown on the plate and accept them for Gram

O: \ 84 \ 84198.DOC -20-

200528120 (16) Staining. Gram-yang bacteria were then selected. Pick a single strain called Lactobacillus rhamnosus GM-020. Example 2 Cell Wall Protein Extraction and Analysis of GM-020 24-hour-old cells of Mesophilic Lactobacillus harvested in MRS medium (Difco®) were harvested in 0.05 M Tris-HCl (ρΗ7 ·) containing 0.1 M CaCl2 5) Rinse twice, and resuspend in 1 ml of the same buffer at 10.0. After centrifugation at 8,000 > < 8 for 5 minutes, 1.0 ml of extraction buffer (pH 8.0) containing 0.01% of butyl butadiene, 0.01M NaCl, and 2% (wt / vol) SDS was used. Cell wall proteins can be extracted from these pellets. The suspension was stored at room temperature for 60 minutes, heated at 100 ° C for 5 minutes and at 4 ° C. (: Centrifuge at 11,600 X g for 10 minutes. The supernatant was analyzed by 12% SDS-PAGE and stained with Comassie blue. Example 3 2-D total protein electrophoresis of GM-020 together with 0.5mL of dissolution buffer C (7M urea, 4 ° / 〇CHAPS, 2M thiourea, 40mM trihydroxyaminomethane, 0.5% IPG buffer and 5mM TBP) and 100 L glass beads, and then 10mg GM-020 was added. The solution was subjected to ultrasonic degradation and centrifuged at 10,000 rpm for 30 minutes. Total protein can be determined by Bio_rad PlusOne ™ protein assay, and then subjected to 2-D electrophoresis at pH 3 to 10 IEF. By 10% The gel was run at 40 mA / gel for 4 hours as designed in Table 5. The gel was then fixed with 10% ferment and 7% acetic acid for 30 minutes. After fixing, stained with sypro ruby Agent to color the gel for 5 hours, and then decolorize the gel with 10% methanol and 7% acetic acid for 6 hours. The results are shown in Figure 3. O: \ 84 \ 84198.DOC -21-

200528120 (17) Table 5 30 V 12 hr 100 V 0:10 hr 250 V 0:10 hr 500 V 0:10 hr 1000 V 0:30 hr 4000 V 0:30 hr 6000 V 60 KVhr Example 4 is used to identify GM The standardized detection system of -020 is used for the preparation of GM-020 of standardized detection system: In rabbit MRS medium (DIFCO®0881), cells of strain GM-020 are cultivated to a stationary phase. After centrifugation at 3,000 g for 15 minutes, the culture was washed with 2 mL and 1 mL of 1 × PBS (phosphate buffered saline, pH 7.2), and then suspended in 1 mL of PBS (IX) In which, the cell concentration was adjusted to 1 × 109 CFU / mL. The cultures were stored at -20oC. W splash: Hep G2 cells can be refreshed by adding fresh medium and incubating for 16 hours. Subsequently, the cells were divided into two groups, and one group was used for culturing with lactic acid bacteria and the other group was used for culturing without lactic acid bacteria. When the cell concentration reached 1 X 107/10 mL, the cells were stimulated with lx 107 GM-020 or without 1 X 107 GM-020 for 24 hours. After stimulation, the cells were collected, washed twice with PBS, and used for RNA isolation.

See also 4 points and # notes. · According to the manufacturer's instructions, Trizol reagent (Life Technologies®, Gaithersburg, Md.) Was used to extract ^ 8 from the cells. 8]: 10 ^ (10 / ^) was thoroughly mixed with 2 1 ^ oligo (1 butyl (12-1811 ^, 0.1§ / 1 ^) and kept at 70 ° C for 10 minutes, and then by ice Cool for 2 minutes. In the dark, mix the RNA with reverse transcription labeling solution and 3 L Cy5-dUTP O: \ 84 \ 84198.DOC -22- 200528120 (18) (1 mM), 2 L SuperScriptll (200 U / L ) And RNasin (1 L). The mixture was incubated for 2 hours at 42QC for reverse transcription, and the reaction was stopped by addition of 5 L of 20 mM EDTA. After labeling, RNA was removed by NaOH treatment And neutralized by HC1. CDNA was quickly purified by the STRATAGENE ™ PCR purification kit. Carbobiban · Made by polymerase chain reaction to amplify hundreds of selected genes, and It was quantified by a 260 nm spectrophotometry. All purified PCR products were adjusted to a concentration of 0.1 pg / pL in 50% dimethyl sulfoxide and spotted in duplicate (Spots) on UltraGAPSTM ™ coated slides (Corning®, Inc., Corning, N · Υ ·). After printing, the microarrays were stored at room temperature at Ultraviolet cross-linking at 300 mJoulesand in a slide container in a desiccator. The genes are listed in Table 3. Prima y # 爻 · • At 100 ° C, fluorescently labeled The cDNA was denatured in a hybridization solution (5xSSC, 0.1% SDS and 25% formamidine) for 5 minutes, cooled to ambient temperature and stored on a glass slide. Hybridization was performed at 42 ° C for 18 hours. Hybridization Thereafter, the slides were washed in low-stringency (lxSSC and 0.1% SDS), medium-stringency (0.1 xSSC and 0.1% SDS), and high-stringency (0.1x SSC) buffers in that order. And finally dried by compressed N2.

药 捃 广 洗 β 穿 稃 分 # ·· Immediately on a GenePix®4000B scanner (Axon Instruments®, Inc.) with the same laser power and photomultiplier sensitivity level for each slide Scanning the load dried by N2 O: \ 84 \ 84198DOC -23-

200528120 (19) Slide. Raw fluorescence data (10-nm resolution) is available, and subsequent processing and data visualization is performed in Microsoft Excel ™. To compare the results of independent hybridization experiments, the local background signal was subtracted from the hybridization signal at each independent point, and then divided by the housekeeping gene iS-actin. The average of duplicates is used to represent the final expression of each gene. Then, the gene expression profile (eXpreSsion profile) of Hep G2 cells cultured without GM-020 and GM-020 can be obtained. A group of genes in Hep G2 cultured by GM-020 was selected to be adjusted upward or downward by more than two folds compared to Hep G2 cultured without the bacteria. The results are shown in Table 4. Example 5 GM-020 for treatment of obesity ## 麦: Male ICR mice can be purchased from the National Laboratory Animal Center in Taiwan, at a temperature of 25 ° C to 1 ° C and a temperature of 60 ± 5% Under humidity, they were kept alone in the light for 12 hours and in the dark for 12 hours. Get enough food and water. The mice were divided into two groups. One group was the normal control group and the other group was the high energy group. The normal control group was fed a normal diet and the high-energy group was fed a high-energy diet containing 48% dry feed, 8% corn oil, and 44% concentrated milk. The weight of the mice was measured every week. According to the treatment, the high energy group is further divided into the groups listed below: (a) black fungus of 1 X, (b) black fungus of 1 X combined with GM-020, (c) GM-020, (d) 10X black fungus, (e) 10X black fungus combined with GM-020, (f) negative control treated with normal saline, and (g) positive control treated with PPA. Table 6 shows the weight difference between before and after feeding on a high-energy diet, where ** stands for O: \ 84 \ 84198.DOC -24-

200528120 (20) ρ <0.01; a for negative control; b for positive control; c for black fungus of IX; d for 10X black fungus; e for GM-020; and IX for the combination of Gebiao and GM-020 Black fungus; and g represents 10X black fungus in combination with GM-020. Table 6 Group weight (%) Normal control 12.25 + 1.80 Negative control 20.93 ± 2.27 Positive control 20.43 ± 1.35 IX black fungus 22.45 ± 1.46 10X black fungus 18.45 ± 1.03 GM-020 19.23 + 1.75 IX in combination with GM-020 Black fungus 21.37 + 1.05 10X black fungus 22.78 ± 0.67 combined with GM-020 P value 0, 000, b, c, d'e, "The data can be analyzed by Kruskal Wallisis test, and the normal control group is used as Dunnett Baseline for testing. After 4 weeks, the average weight of the high-energy group was significantly higher than the average weight of the normal control group (p < 0.01). Take a normal diet. Administer treatment twice a day. The dosage of each PPA is 4.875 mg. In a black fungus diet of IX, 15.6 mg of black fungus is contained in a 3 g diet, and in a 10X black fungus diet, There is 156mg of black fungus in a 3g diet. The dose of GM-020 is 109CFU / mL. 媸 Weight J different · After 4 weeks of treatment, blood samples were collected from the tail for biochemical testing. Analysis by Kruskal Wallis Η test Data, and use the normal control group as Dunnett The baseline of the test. The results are shown in Figure 4. After 1 week of treatment, the 10X black fungus group combined with GM-020 significantly reduced body weight compared to the negative control group. After 2 weeks, the positive control group and GM-020 Group O: \ 84 \ 84198.DOC -25-

200528120 (21) The 1X black fungus group and the 10X black fungus group combined with GM-020 significantly reduced body weight compared with the negative control group. After 3 weeks, the positive control group, the black fungus group of IX, the GM-020 group, the black fungus group of IX combined with GM-020, and the black fungus group of 10 X combined with GM-020 were more than the negative control Significant weight loss. These results demonstrate that GM-020 and black fungus are effective in treating obesity. J Jiang from Bie Mei Si Zhi Waste Group 废 重 #: Kill the rats, and extract the lipid tissue around the testicles and weigh them. Data were analyzed by the Kruskal Wallis (R) test, and the data from the normal control group was used as the baseline for the Dunnett test. The results are shown in Figure 5. According to Fig. 5, only the positive control group and the 10X black fungus group combined with GM-020 showed a significant decrease compared to the negative control group. J. I., who shoveled the rotten eyebrow, killed the mouse, and extracted the lipid tissue around the kidney and weighed it. The Kruskal Wallis (R) test was used to analyze the data, and the data of the normal control group was used as the baseline of the Dunnett test. The results are shown in Fig. 6. According to Fig. 6, the black fungus group of IX, the black fungus group of 10 X, the black fungus group of 1 X in combination with GM-020, and the black fungus group of 10 X in combination with GM-020 have a significant difference over the negative control group. Reduction. On the other hand, the positive control group, the GM-020 group, and the negative control group showed small differences.廯 瓞 # 锹 # 的 血 潦潦 彦 ·· A blood sample was collected from the tail for biochemical testing. The blood sample was allowed to stand at room temperature for 1 hour, and centrifuged at 2,500 rpm for 10 minutes. Take the upper serum for verification. O: \ 84 \ 84198.DOC -26-

200528120 (22) TRIGLYCERIDES GP〇 LIQUID REAGENT ™ (ASK®, Taiwan) was used to test the concentration of tris-glycerol (TG) in each group, and the absorption was measured by Autoanalyzer Hitachi ™ 7150. CHOLESTEROL LIQUID REAGENT ™ (ASK®, Taiwan) was used to determine the total cholesterol (CHOL) concentration, and the Autoanalyzer Hitachi ™ 7150 was used to measure the absorption effect. The concentration of HDL-C and LDL-C was determined by a selective inhibition method and an enzyme assay (Unichem®), and the absorption was measured by the Auto analyzer Hitachi ™ 7150. Data were analyzed by the Kruskal Wallis (R) test, and the data from the normal control group was used as the baseline for the Dunnett test. The results are shown in Table 7: where " represents ρ < 0 · 01; 3 represents a negative control; b represents a positive control; e represents black fungus of IX; d represents black fungus of 10X; e represents GM-020; f represents GM-020 black fungus in combination with IX; and § stands for 10 X black fungus in combination with GM-020. Table 7 Group CHOL TG HDL LDL negative control 232.00 ± 16.88 86.60 ± 22.40 126.39 ± 7.37 11.21 ± 1.40 Normal control 135.80 ± 6.67 120.00 ± 20.35 86.90 ± 3.14 4 · 22 ± 0.56 Positive control 219.08 ± 11.22 75.83 ± 9.93 123.19 ± 4.20 10.04 0.93 IX black fungus 18.25 82.08 82.08 soil 7.32 100.57 soil 3.58 12.39 soil 1.03 10X rage ear 176.83 soil 9.84 63.92 soil 4.62 93.51 ± 6.02 9.74 taxi 1.07 GM-020 204.75 soil 8.90 96.56 soil 10.20 121.64 soil 8.47 14.04 soil 3.10 and GM -020 combination of black fungus 190.08 ± 4.85 55.75 ± 4.38 105.38 soil 3.10 10.83 soil 1.51 10X black fungus combined with GM-020 164.20 ± 8.64 57.30 soil 4.61 97.93 soil 5.42 8.04 soil 0.94 P value ~ 0 · 00〇Ί_ 0.000 0 · 000 ， '_ 0.014-a The IX black agaric group combined with GM-020 and the 10 X black agaric group combined with GM-020 have three times lower than the negative control group. Serum concentration of glycerol is O: \ 84 \ 84198.DOC -27- 200528120, _ (23) degrees. On the other hand, the black fungus group of IX, the black fungus group of 10X, and the GM-020 group had small differences compared with the negative control group. In addition, the black fungus group of IX, the black fungus group of 10X, the black fungus group of 1 X combined with GM-020, and the black fungus group of 10X combined with GM-020 have lower total cholesterol and HDL-C. Serum concentration. Regarding the concentration of LDL-C, each group except the normal control group showed a small difference.瓞 瓞 / C 谢 # 's Kaifei Danyan • Kill the rat and take the right lobe liver. Fat is extracted according to conventional methods. For each sample, the concentrations of trimethylglycerol (TG) and total cholesterol (CHOL) can be determined as described above. Data were analyzed by the Kruskal Wallis (R) test, and data from the normal control group were used as the baseline for the Dunnett test. The results are shown in Table 8: where "represents p <0.01; a represents a negative control; \ table positive control; e represents the black fungus of IX; d represents the black fungus of 10X; e represents GM-020; f represents the same as GM- Black fungus of IX in combination with 020; and § stands for 10 X of black fungus in combination with GM-020. Table 8 Group CHOL TG negative control 25.75 soil 2.17 135.00 soil 11.92 normal control 21.80 soil 0.58 65.60 soil 6.56 positive control 26.75 soil 1.48 103.58 Soil 11.41 IX black fungus 20.75 soil 0.85 85.50 ± 3.76 10X black fungus 22.00 soil 0.72 84.83 soil 8.56 GM-020 19.44 soil 0.85 88 · 56 soil 6.41 IX black fungus 21.25 soil 0.70 83.25 soil 6.27 with GM-020 GM-020 combination of 10X black fungus 20.90 soil 0.81 77.50 soil 7.82 P value 0.000, 'La Γ 0.004-a, c, d, e, r, g IX black fungus group, GM-020 group, and GM-020 Kuroki O of the combined IX: \ 84 \ 84198.DOC -28-

200528120 (24) ears, and the 10X black fungus group in combination with GM-020 each had a lower serum concentration of total cholesterol. In terms of triglycerol, each of the black fungus group of IX, the black fungus group of 10X, the black fungus group of 1 X combined with GM-020, and the black fungus group of 10 X combined with GM-020 One was significantly reduced.牙 腐 和 jf 腐 功 处 ## • Process the blood sample as described above. For each sample, the concentration of creatine Sf can be determined according to the Jaffe reaction method (Unichem®, Japan), and the absorption effect can be measured by Autoanalyzer Hitachi ™ 7150. GOT (ASAT) IFCC mod ™ (HUMAN®, Germany) was used to determine the concentration of GOT, and the absorption effect was measured by Autoanalyzer Hitachi ™ 7150. The GPT (ALAT) IFCC mod ™ (HUMAN®, Germany) was used to determine the concentration of GPT, and the absorption effect was measured by the Auto analyzer Hitachi ™ 7150. The uric acid-peroxidase method (Unichem®, Japanese version) was used to determine the concentration of uric acid (U A), and the absorption was measured by Au to analyzer Hitachi ™ 7150. Data were analyzed by the Kruskal Wallis (R) test, and the data from the normal control group was used as the baseline for the Dunnett test. The results are shown in Table 9 ... "where" represents p <0.01; a represents a negative control; b represents a positive control; e represents black fungus of IX; d represents black fungus of 10X; e represents GM-020; f represents GM-020 -020 black fungus with IX combination; and § represents 10 X black fungus with GM-020 combination. Table 9 Group GOT GPT Creatinine UA Normal control group 134.00 soil 23.11 72 · 67 soil 6.98 0 · 52 soil 0.04 2.66 soil 0.92 Negative control 79.20 ± 6.22 49.00 ± 9.18 0.52 ± 0.02 3.90 ± 1.33 Positive control 117.50 ± 12.95 47-00 ± 6. 17 0.56 ± 0.03 2.42 ± 0.50 IX black fungus 107.00 ± 14.77 37.33 ± 2.77 0.47 ± 0.02 5.20 ± 0.91 O: \ 84 \ 84198.DOC -29- 200528120 (25) 10 X black fungus 120.00 soil 15.78 57.42 soil 5.68 0.46 soil 0.02 2.88 soil 0.57 GM-020 109.67 person 17.30 36.22 soil 3.05 0.47 person 0.03 1.96 person 0.40 and GM-020 combination of black fungus 150.00 soil 21.71 44.91 ± 3.93 0.45 soil 0.02 2.12 ± 0.48 10X black fungus combined with GM-020 76.40 soil 13.5 37.50 soil 3.95 0.39 soil 0.03 2 · 10 ± 0.36 P value 0.072 0.002 Well 0.002 ^ 0.006 in this group The difference in results was not significant. It showed that the liver and kidney function indexes were not affected after treatment with GM-020 and / or black fungus. Example 6: GM-020 for the treatment of hypercholesterolemia 费 ## 麦: Male hamsters were purchased from the National Laboratory Animal Center in Taiwan, and were kept alone in the light for 12 hours at a temperature of 25 ° C to 1 ° C and a humidity of 60% to 5%, and kept in the dark for 12 hours. Fully supplemented with food and The rats were divided into two groups: one group was a normal control (NC) group and the other group was a cholesterol-rich diet group. The normal control group was fed a normal diet and the cholesterol-rich diet The group was fed a 2% cholesterol-rich diet containing 24% protein, 14% fat, 2% cholesterol, 48% carbohydrates, 6% cellulose, and 6% minerals and vitamin mixtures. • The normal control group was continuously fed a normal diet. The treatment is given twice a day. The cholesterol-rich diet group was further divided into the groups listed below according to the treatment: (a) Lactobacillus gasseri, (b) GM-020, (c) Lactobacillus sporogenes (Z ·, and (d) Negative control (Control) treated with normal saline. Each dose is 109CFU / mL. Bijingdanyan of sugarcane 4 concentrated # • Before and after treatment, blood samples were collected from the orbital veins for use in biology Chemical test. Leave the blood sample at room temperature for 1 hour and centrifuge at 2,500 rpm for 10 minutes. Take the upper serum for O: \ 84 \ 84198.DOC -30- 200528120 _ (26) for the test. For each test For samples, the concentrations of total cholesterol (CHOL), HDL-C, LDL-C, and tris-glycerol (TG) can be determined as described above. The data is analyzed by the Kruskal Wallis (R) test, and the normal control The data of the group is used as the baseline of the Dunnett test. The difference in fat content between before and after a cholesterol-rich diet is shown in Table 10, where # represents p <0.1;

Table ρ <0.05; represents ρ <0.01; a represents a negative control; b represents a Lactobacillus garnerii; e represents GM-020; and d represents a scar through different hinge #window. Table 10 HDL-C 0 HDL-C 4 LDL-C 0 LDL-C 4 CHOL 0 CHOL 4 TG 0 TG 4 NC 117.6 + 10.8 119.5 ± lT.5 105.4 ± € .4 243.6 ± 25.2 398.8 + 3Ϊ.2 485.5 ± 70.4 421.0 ± 59.9 365.8 + 65.9 Control 70.5 + 3.6 64.9 + 5.0 23.5 ± 1.3 20.8 + 1.8 104.0 ± 4.1 96.8 ± 5.3 224.0 ± 23.1 180.7 14.8 Lactobacillus gasseri 141.3 + 10.5 103.1 + 3.8 179 · 4 ± 21.2 211.2 ± 23.9 531.6 ± 32.9 653.0 ± 45.1 585.8 ± 103.0 822.6 ± 59.1 GM-020 108.8 ± 14.2 118.7 + 8.4 106.9 + 9.0 136.5 + 19.8 412.0 + 63.0 420.4 + 53.0 483.3 ± 67.5 760.5 ± 98.7 L. bacillus 104.9 ± 23.7 82.8 ± 3.0 127.1 ± 6 · 6 202.3 ± 11.6 414.5 ± 18.1 541.5 ± 51.9 439.5 ± 42.0 687.8 ± 131.0 P value 0.008a ^ (λ000— 0.000 ^^ o.oo〇w (λ00 (Τ ”0,000 ^ 0.008a” 0.0001 ^ … According to the results, after 4 weeks of feeding a cholesterol-rich diet, the cholesterol-rich diet group showed a significant increase in CHOL, HDL-C, LDL-C, and TG compared to the normal control group, and these The subgroups of cholesterol-rich diets showed little difference from each other. * In the case of TG, after 4 weeks of treatment, all of these cholesterol-rich diets The subgroup of food showed significantly larger TG than the normal control group. For CHOL, after 4 weeks of treatment, the Lactobacillus garneri group, Lactobacillus sp The group had significantly larger CHOL. On the other hand, the GM-020 group showed a small increase compared to the normal control group. Figure 7 shows the difference between (CHOL_0 before treatment) and (CHOL-4) after treatment. . Shows that GM-020 has a total cholesterol reduction of O: \ 84 \ 84198.DOC -31-200528120

(27) Ability to serum concentration. In the case of HDL-C, after 4 weeks of treatment, the blister group showed significantly lower HDL-C for the preselection group than the normal control group. However, the Lactobacillus gasseri group, the GM-020 group, and the negative control group showed small differences. For LDL-C, serum concentrations are shown in FIG. 8. The GM-020 group showed a significantly lower LDL-C than the normal control group (p < 0.1). In addition, after 4 weeks of treatment, the Lactobacillus garnerii group and the Herpes moth select group showed significantly lower (L < 0.05) LDL-C than the normal control group (see Fig. 9). It shows that GM-020 has the ability to reduce the serum concentration of total cholesterol. For LDL-C / HDL / C, the ratio is shown in Table 11 and Figure 10, where + represents ρ < 〇 · 1; " represents p <0.05; represents p <0.01; & represents negative Control; b represents Lactobacillus gasseri; e represents GM-020; Data can be analyzed by the Kruskal Wallis (R) test, and the data from the normal control group can be used as the baseline for the Dunnett test. Table 11 LDL-C / HDL-C 0 LDL-C / HDL-C 4 NC 0.98 ± 0.07 2.13 ± 0.47 Control 0 · 33 ± 0 · 02 0.32 + 0.01 Lactobacillus garnerii · 27 ± 0 · 13 2.08 + 0.27 GM-020 0 · 90 ± 0 · 13 1.20 + 0.27 Lactobacillus spores 1.46 ± 0.42 2.44 + 0.14 P value 0.003a " 0.000a, ^ GM-020 group is more than the normal control group (ρ < 0 · 001), showing Significant reduction. It shows that GM-020 has the ability to reduce LDL-C / HDL-C. Although the embodiments of the present invention have been illustrated and described, those skilled in the art can make various modifications and improvements. It is not intended to limit the invention to the ones illustrated: O: \ 84 \ 84198.DOC -32- 200528120

(28) is a special form, and all modifications that do not depart from the spirit and scope of the present invention fall within the scope defined in the scope of the attached patent application. [Schematic description] Figure 1 illustrates the 1000X micrograph of GM-020. Figure 2 illustrates the cell wall proteins of GM-020 and the conventional rhamnosus lactobacillus strains; where M represents the molecular weight of the protein; Lane 1 represents Lactobacillus rhamnosus (commercial Antibiophilus); lane 2 represents Lactobacillus rhamnosus gM -〇2〇; Lane 3 represents Lactobacillus rhamnosus ATCC9595; Lane 4 represents Lactobacillus rhamnosus ATCC10940; and Lane 5 represents Lactobacillus rhamnosus ATcci4029. Figure 3 illustrates the 2-D total protein electrophoresis of GM-020. Figure 4 illustrates the difference in body weight of animal models treated with GM_02 or / and black fungus (wod) according to Example 5; where ** represents ρ <0.001; a represents a negative control and represents a positive Control; e stands for black fungus of 1X; d stands for special fungus of 10 ×, which stands for GM-020; f stands for black fungus of 1X combined with GM-020; and § stands for black fungus of 10X combined with GM-020. Figure 5 illustrates the difference in the weight of lipid tissue around testes in an animal model treated with GM-020 or / and black fungus according to Example 5; where ** represents ρ < 0.01, & represents a negative control; 5 represents a positive Control: 1 represents black fungus 1; d represents 10X black fungus; e represents GM-020; f represents IX black fungus combined with GM-020; and g represents 10X black fungus combined with GM-020. Figure 6 Explain the difference in weight of lipid tissue around the kidney of the animal model treated with GM-020 or / and black fungus according to Example 5; where * * represents P < 0 · 01; 3 represents a negative control; b represents a positive control; .Represents Mu Yier; d O: \ 84 \ 84198.DOC -33- 200528120

(29) represents 10X black fungus; e represents GM_〇2〇; f represents χ black fungus in combination with GM_〇2〇, and g represents 10 × black fungus in combination with GM-020. Figure 7 illustrates the difference between serum concentrations of total cholesterol before treatment (CHOL-0) and after treatment (CHOL-4) according to Example 6; where * represents ρ < 0 · 1; ρ < 0 · 05; ρ < 0 · 0 1. FIG. 8 illustrates the sera of the LDL-C before treatment (LDL-C-0) and after treatment (LDL_C-4) according to Example 6; / *; where * represents ρ <〇.ι; ρ < 0 · 05; ... represents ρ <0.01; Figure 9 illustrates the difference in serum concentration of LDL_C before treatment (LDL-C-0) and after treatment (LDL-C-4) according to Example 6; where * represents pcoj; " stands for p <0.05; ... stands for p < 0.01. Figure 10 illustrates the difference in serum concentration of LDL-C / HDL-C before treatment (LDL-C / HDL_C_0) and after treatment (LDL-C / HDL-C-4) according to Example 6; where * represents ρ < 〇 · 1; "Representing ρ < 〇 · 〇5; Representing ρ < 0.01. O: \ 84 \ 84198.DOC -34- 200528120 (30)

HHHHBHHHHBHHR Sequence Listing <110> Jingyue Biotechnology Co., Ltd. <120> New Microorganism Strain Qi Li Tangdao 丨 4 ## Fatty Uses Breast Hand Common Pore § Yi Bacillus GM-020 and Its Treatment Fertilizers ; 130> None &lt; 160 &gt; 1 &lt; 170> Patentln version 3.2 &lt; 210 &gt; 1 &lt; 211> 501

&Lt; 212 &gt; DNA &lt; 213> Lactobacillus rhamnosus &lt; 400 &gt; 1 tcaggatgaa cgctggcggc gtgcctaata catgcaagtc gaacgagttc tgattattga 6 aaggtgcttg catcttgatt taattttgaa cgagtggcgg acgggtgagt aacacgtggg 12 0 taacctgccc 11 aagtgggggataacat: 11 ggaaacagatgctaataccgc at ai a ai tcc 180 agaaccgcat ggttcttggc tgaaagatgg cgtaagctat cgcttttgga tggacccgcg 240 gcgtattagc tagttggtga ggtaacggct caccaaggca atgatacgta gccgaactga 3 0 0 gaggttgatc ggccacattg ggactgagac acggcccaaa ctcctacggg aggcagcagt 3 6 0 agggaatctt ccacaatgga cgcaagtctg atggagcaac gccgcgtgag tgaagaaggc 420 tttcgggtcg taaaactctg ttgttggaga agaatggtcg gcagagtaac tgttgtcggc gtgacggt at ccaaccagaa a O: \ 84 \ 84198.DOC -35-

Claims (1)

200528120 Pick up and apply for patent Fangu: 1. An isolated microbial strain, Lactobacillus rhamnosus GM_020, deposited with the Food Industry Development Research Institute of Hsinchu, Taiwan, deposit number BCRC910236 〇2 · Composition of the microorganism strain of item 1. 3. The composition according to item 2 of the patent application, which is used to treat obesity and its onset. 4. The composition of claim 3, wherein the composition further comprises black fungus. 5. The composition of claim 3, wherein the composition can be selected from the group consisting of hypercholesterolemia, atherosclerosis and coronary heart disease. 6. A composition for treating obesity and its complications in a subject, comprising a microbial strain and black fungus as described in the first patent application. 7. The composition according to item 6 of the patent application, wherein the onset is selected from the group consisting of hypercholesterolemia, atherosclerosis, coronary heart disease, fatty liver, and diabetes. 8_ The composition according to item 6 of the patent application, wherein the onset is selected from the group consisting of hypercholesterolemia, atherosclerosis and coronary heart disease. O: \ 84 \ 84198.DOC