TW383304B - 1-(3-aminoindazol-5-yl)-3-butyl-cyclic urea useful as a HIV protease inhibitor, and pharmaceutical compositions and kits thereof - Google Patents

Abstract

The present invention relates to compounds of formula I or pharmaceutically acceptable salt forms or prodrugs thereof, which are useful as inhibitors of HIV protease, and to pharmaceutical compositions and diagnostic kits comprising the same, and methods of using the same for treating viral infection or as an assay standard or reagent.

Description

Patent Supplement No. 80116676 Chinese Supplementary Specification (December 1987)

Announced that the virus group of DuPont Merck Pharmaceutical Co., Ltd. has tested the compound of formula I and the example in U.S. Patent No. 5,610,294 (see below): potency of the compound against the following HXV viruses: wild type, I84V mutant, and dual Mutant (Ι84ν / ν82ρ).

Table I contains two values of two compounds against three test viruses. Table 1 (亳 micron unit;) Compound wild type I84V double mutant strain I 56 436 1800 Formula 15DF 1100 1100 1400 ㈣ 明 之 _Newman test to test its activity against wild-type virus. Known to use low yield analysis method to test compounds against lin mutants and double mutants (1 attached ~ Gang (potency. How to conduct low yield analysis method) It is as follows. The gangliolytic plaque method is used to determine the disease valence of offspring scales produced with or without test compounds. Addition is called poison (approximately 5 plaque forming units / ml) to hemp 2 cells (5 > < _Payment, card U \ Ή ΡΕ1Π C Ci \ 2684G-i 〇 () 〇. HVC \ Scope of the invention In general, the invention is related to the application of HIV protease inhibitors! _ (3-Aminopyrazole _5_yl) _3_ Butyl-cyclourea, pharmaceutical compositions and diagnostic kits containing the compound, and methods of using the compound to treat viral infections or as analytical standards or reagents. Background of the invention Two different reverse green viruses: human immunodeficiency virus (HIV) L-type or 2_type (HIV_2) is associated with immunosuppressive diseases] Acquired immune deficiency syndrome (AIDS). Individuals with HIV-positive response in the serum have no symptoms at first, but typical aids-related complications occur after AIDS (ARC). Affected individuals have severe immunosuppressive effects, and are vulnerable to sorrow. Finally, they suffer from fatal opportunistic infections. The Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs prints AIDS disease as HIV-2 or HIV-2 virus The final result after its own complex life cycle. At the beginning of the life cycle of the virion, the virion itself uses the glycoprotein on the surface of the virion's protective cover and the CD4 hearing protein on the lymphocytes to attach to the host human _4 Lymphocyte immune cells. Once connected, the virus particles take off their glycoprotein coats, penetrate into the membrane of the host cell, and remove the outer sheath of their RNA. Viral pre-enzymes, which are reverse transcriptases, direct RNA Transcribed into a single strand of DNA. The virus RNa decays, creating a second DNA strand. This double-stranded DNA is then integrated into the genes of human cells, and these genes are used for cell reproduction. At this time, human cells use their own r Ν Α assembly enzymes to reproduce, and the integrated DNA is transcribed into viral RNA. The viral RNA is then translated into the precursor gag-ρ 丨 fusion polyprotein. Polyprotein is broken down by ΗIV protease Chengcheng-4- --- This paper size applies to Chinese national standard Xin (CNS ί A4 specification (2 丨 〇 X 297)) 5. Description of the invention (Α7 Β7 Economic 'Deng Central Standards Bureau staff consumer cooperatives Viral protein. Therefore, 'negative expensive HIV protease that regulates a series of cleavage processes can lead to virion maturation' to form a fully infectious virus. Since most of the life cycle of virions passes through the incubation period in immune cells, the typical human immune system response, that is, killing invasions < virions will be destroyed. In addition, the virus reverse green enzyme, the enzyme used to make new virions, is not highly specific and produces transcription errors, which together change the glycoproteins on the surface of the virus protective sleeve. This lack of specificity reduces the effectiveness of the immune system, as antibodies raised against one glycoprotein may have no effect on another glycoprotein, thereby reducing the number of carcasses that can fight the virus. The virus continues to multiply, and the immune response system continues to decline. Finally, HIV has a greater advantage than the body's immune system, allowing opportunistic infections to take advantage of it, and death without antiviral agents, immunomodulators, or both. There are at least three key points in the life cycle of the virus. These three points have become possible targets for antiviral agents: When prion particles first attach to the τ_4 lymphoid giant cell location, (2) the viral RND is transcribed into viral DNA (reverse transcription) Enzyme, RT), and the combination of prion virus particles during reproduction (eg, urnic acid protease or HIV protease). The protease coded by the genome of the retrovirus is responsible for proteolytic treatment of one or more poly (albumin) bodies (eg, P0 丨 and gag gene products). See WelUnk Arch V., Sulfur, 4 pts. 8 (1) (1988). Retroviral proteases were removed and treated with g a & anecdote, 4 ·,, ^^ t g to form the core protein, and also the P0 precursor precursors, horses, retroviruses and retroviral proteases. Precursor polyproteins must be properly processed by the anti-hantian anti-green chlorophyll mother protease,

-: -------- seed coat-< '-(Please read the notes on the back before writing this page), 11 ------ Μ ---! A7 B7 Warp Department The central standard a Μ industrial consumer f printed by the cooperative V. Invention description (3) can be combined into infectious virus particles. It has been found that the mutagenesis of in vitro production of protease-deficient viruses results in immature core forms lacking infectivity. See Crawford et al., J. VirO1 Red 8 9 9 (19 8 5); Katoh et al., Virology, 28 (1985). Therefore, inhibition of reverse chloroproteinases can provide an attractive target as an antiviral therapy. See Mitsuya, Nature 321 775 (1987). The ability to inhibit viral proteases can provide a method for blocking viral replication, so it can more effectively treat viral diseases, such as AI Ds, and has lower side effects than current therapies, making it less prone to drug resistance. Therefore, three HIV protease inhibitors are currently on the market. _ Roche, ss-aquinavir, and Abbott, s Indinavir, and many potential protein inhibitors have been used in clinical trials, such as Vertex 2W 478, Agouron Nifinavir (㈤ "KNI-2 72 from Japan Energy and Geigy from Ciba Cocoon Pharmaceuticals) CGP 6 I 7 5 5. 1 3 'From the current market and clinical trials Protease Inhibition Used 尨 Many compounds that have been studied have potential as ㈣protease inhibition 'and the core is cyclic urea. For example, pcT Patent Ann' 94/19329, Lam et al. Ring-shaped menstrual urine

This tonic scale is in accordance with Chinese national standard (CNS> A4 specification (210X 297 mm) .. I —------ ^ ------ '玎 ---- I. F%意 意 事 ^ Fill in this page again 』line -----------

Α7 Β7, invention description (4 printed by the Central Standards Bureau of the Ministry of Economic Affairs, printed by the shellfish consumer capital cooperative ^ ^ 4- Ίυ Fan Yuan, but it is not clearly stated. Even if it has been successfully used τ iaa ^ T ^ ti Μ π Θ enzyme inhibitors, but ΗI V has been found to be resistant to early protease inhibitors. Therefore, two proteases 对抗 #j are resistant to mv infection. In addition, the development of fjg is intended to provide new particles. Protease inhibitors.- Compounds: It contains medical extracts! Pharmaceutical group #, sigma 17 with a white enzyme inhibitory activity and a therapeutically effective amount of at least one or two compounds of the invention or a pharmaceutically acceptable salt or pro The drug form of the present invention is also provided by another item of the present invention, which includes a ten-day injection to a host in need of the treatment: == new method invention servant # + # 仪 ”/ 口 潦 is effective, and at least one of this month's chemical, physical or Its pharmaceutically acceptable salt or prodrug type. Another item of the present invention is to provide-which includes a novel method for treating HIV infection, compound II and a therapeutically effective amount of ⑷-a kind of protease inhibitor. Satoshi ^ 1 V Liu Xie 卩 preparation and Η I V method The purpose of I is to provide a method and method for inhibiting HIV in a body fluid sample. Two or more compounds of the present invention can be used to treat a body fluid sample. The set or container of the substance has at least one compound of the present invention-"Benefit".弋 Earth soil or reagents for training the ancient, 1-3 horseshoe or knife analysis method <standard, Η. Yes, there is a power of the ability to inhibit H (v protease, HIV growth or both) This temple and other purposes will be explained in detail below, and have been published by this post (Please read the precautions on the back before writing this page ------- &gt; II-this paper scale coffee towel 'A7 A7 Η3 (&gt; ^ person

Description of the invention

Or a pharmaceutically acceptable salt thereof ^ i Ma Youzheng &lt; a protease inhibitor. (Details of the examples) Therefore, the present invention-Item 2, 77:-. Eighth, to provide a novel compound of formula I

6h Ph or its pharmaceutically acceptable salt or prodrug form. The specific embodiment provides a pharmaceutical composition of Xinlai, medicine: can be: a carrier of Γ and a therapeutically effective amount of the compound of formula 1 or its medicament is provided with an intensive foot salt or a prodrug type. The embodiment provides a novel compound for treating HIV infection or: medically. The host to be treated is administered a therapeutically effective amount of Formula I, a salt or prodrug form that can be incinerated. Methods: Four specific embodiments provide a new human for treating HIV infection, "including administering a therapeutically effective amount of the following group to a host in need thereof. (A) a compound of formula I; and V reverse transcriptase inhibitor and H 丨 v protease inhibitor gutter (please read the precautions on the back before filling this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (&lt;: milk) 6 4 specifications (210 '乂 297 mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs. 5. Compound of the invention (6). In another preferred embodiment, the green record enzyme inhibitor is reversed. ... P preparation In another preferred embodiment for nucleoside inversion, nucleoside inversion: AZT, 3TC, ddl, ddC, and d4T, and the egg. The inhibitor is selected from the group consisting of kanaviridenavir (enzyme inhibitor ㈣ 1 隹 (ritonavir), Indinavir, VX_478, Nefinavir, Innernavel | 4 (nelflnavir), CGP-6 1755, and U-103017. -272, other-more specific embodiments Chinese nucleoside reverses AZT and 3TC, and the protease inhibitor is selected from the group consisting of Indinavir. In another preferred embodiment of Navavi and Littonavi, the 'nuclear reverse transcriptase inhibitor is milk. In another preferred embodiment, the protease inhibitor is indinavir. The fifth specific In an embodiment, the present invention provides a medical kit suitable for treating coffee infections, which comprises one or more beneficial bacteria. Effective amount: No.,... Contains (a) a compound of formula I; and (b) ) To y compounds selected from the group consisting of H1 V reverse transcriptase inhibitor and 蛋白酶 IV protease inhibitor. In a sixth specific embodiment, the present invention provides a method for inhibiting Η in a body fluid sample, which comprises an effective amount formula [ Compounds treat body fluid samples.

In the seventh specific embodiment, the present invention provides a new shout kit or container containing a formula compound, the content of which can be used as a standard or reagent for testing or analysis, for the determination of potential drugs for inhibition.丨 V protease, ^ ^ V (please read the notes on the back before filling this page)-Pack. 'Ίτ -9- A7 B7 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs The following terms and expressions used in this article are as follows: －Under the meaning. It is understood that the compounds of the present invention contain asymmetric substitutions + η ^ for a long time, and can be separated into a sexual form or a &amp;. It is known in the related arts to prepare optically active forms. Analytical racemic form 'A is synthesized from an optically active starting material. Unless a specific stereochemical or isomeric form is specified in another month ^ is also processed ..., · The "portal configuration" may include all para palmar, diastereomeric, racemic, and all geometric isomeric forms. The "mv reverse green enzyme inhibitor I" used herein refers to the Ηv reverse transcriptase ( RT) nucleoside and non-nucleoside inhibitors. Nuclear: yrRT inhibitors Including (but not limited to) AZT, ddC, d4T and 3TC. Non-nuclear fen RT inhibitors include (but are not limited to): Viviradine (pharma ^ and Upjohn U90152S), TIBO derivatives , Bi_rg_ 5 8 7 'Nevirapine' L-697, 661, LY 73497 and RoM93 (Roche). The "HI V protease inhibitor" used herein refers to inhibition A compound of η I v protease. Examples include (but are not limited to): Sanconavir (Rockwell Pharmaceuticals, R03_ 8 9 5 9), Rittenavir (Albert Pharmaceuticals, a BT- 5 3 8), Indinavir (Merck Pharmaceuticals, MK-63 9) '' VX-4 7 8 (Vertex / Glaxo Wellcome), Nifinavir (Aigen Long Pharmaceutical factory, Yaba (3_ 1343), KNI-272 (Japan Energy Pharmaceutical Factory), CGP-61755 (Ciba-Gage Pharmaceutical Salt) and U-1 0 3 0 1 7 (Pu Qiang Pharmaceutical Factory). Others Examples include cyclic protease inhibitors disclosed in WO 93/07128, WO 94/19329, WO 94/22 840, and PCT Application No. US 9 6/0 3 4 2 6. This paper is applicable to China Standard (CNS) A4 specification (210X297) ) ---, ----- \ 于 ------ 1T ------ 0 I * (#First read the f-side note * -items again ^ write this page) A7 B7 Economy Printed by the Central Bureau of Standards, Shellfish Consumer Cooperative, V. Description of the invention ("Medicine acceptable salt I" used in this article: Sheng Er, the parent compound is modified to its acid or: salt uncovered: =

Examples of R salts include (but are not limited to) residues (such as === organic acid residues (such as diffuse acid) or organic salts; etc.); H: then η includes the parent compound-like non-toxic salts Or for example, those who are naturally toxic inorganic or organic acids. For example, these are the salts that are derived from inorganic acids such as hydrochloric acid, hydroxamic acid, rhodium, amino acids, and linoleic acid. 'Nitric acid, etc .; and salts made from organic acids such as ... propionic acid, succinic acid to acetic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamGi㈣id, Malay, Zhaoji maleic acid, phenylacetic acid, glutamic acid 'stupic acid, salicylic acid' hypochlorous acid: 2-, oxybenzoic acid, fumaric acid, toluene acid, formic acid, ethylene glycol Acid, oxalic acid, diethylacetic acid, etc. The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound containing a basic or acidic moiety according to general chemical methods. Generally, these salts can be prepared by such methods The free acid or basic form is reacted with a stoichiometric appropriate base or acid in water or an organic / mixture, or a mixture of the two. ; Normally non-aqueous medium is preferred, such as: ether, ethyl acetate, ethanol, isopropanol, or acetonitrile. A list of suitable salts can be found in Remington, s pharmaceutical

Sciences), 17th edition, Mack Publishing Company, Easton, PA-, 1985, p. 14 1 8; this disclosure is incorporated herein by reference. &quot; Pharmaceutically acceptable '' means that in reasonable medical judgment, it is suitable for contact with human and animal body tissues, without excessive toxicity, irritation, and allergies. 11-This paper applies Chinese national standard _ (CNS) A4 specifications (210 &gt; &lt; 297 mm), clothing -------- II ------ ^ (Please read the precautions on the back before writing this page) A7 B7 Economy Printed by the Consumer Standards Cooperative of the Ministry of Standards of the People's Republic of China. 5. Description of Invention (9) Reactions or other problems or complications, and the benefits / hazard ratios are consistent with the products, materials, compositions, and / or dosage forms. ° &quot; Prodrug &quot; refers to any covalently bonded carrier. When this temple of Erji is happy to be administered to a mammalian individual, it can be released in vivo according to the formula of the invention or other chemical formulas or compounds. Active parent drug. The prodrug method of the compound of the present invention (for example, formula 丨) is to modify the functional group in the compound so that it can be interpreted in routine operation or in vivo to explain the parent compound. Prodrugs include hydroxy or amine groups in the compounds of the present invention that are bonded to any group. When prodrugs are administered to mammalian individuals, they can be cleaved to form free hydroxyl or amine groups, respectively. Examples of prodrugs include, but are not limited to: acetate, formate or benzoate derivatives of alcohol and amine functional groups in compounds of formula I; phosphate esters, dimethyl glycan of alcohol functional groups in compounds of formula I Urethanes, amine alkyl esters, amine alkyl esters and carboxyalkyl esters, and the like. Other examples include the combination of two hydroxyl groups in a compound of formula I to form an epoxide; -0CH2SCH20-: -0C (= 0) 0-; -0CH20-;-0C (= S) 0-; -0C (= 0) C ( = 0) 0-; .0C (CH3) 20-; -〇C ((CH2) 3NH2) (CH3) 〇-. · -0C (0CH3) (CH2CH2CH3) 0-; or -0S (= 0) 0- . "Stable compound" and "Stable structural formula" means that the compound is sufficiently strong to be successfully isolated from the reaction mixture to a suitable purity, and can be formulated into a therapeutic agent with medicinal effects. The present invention only includes stable compounds 11 The term "substituted" refers to the use of "substituted" to indicate that one or more hydrogens in a designated atom have been replaced by a designated group-subject to the condition that the designated atom is the normal price Do not exceed 'and the replacement results should be stable compounds. When the substituent is keto (ie, = 0), two hydrogens on the atom are replaced. &quot; Therapeutic effective amount &quot; refers to the amount of the compound of the present invention or the applied patent 12- This paper size is applicable to Chinese national standards (CNS> A4 specification (2 丨 0X297 mm) Binding ----- line (please (Please read the notes on the back before filling in this page) A7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, ---__________ B7 V. Description of the Invention (i〇) ~~~ 'Weight = the amount of compound can effectively inhibit mv㈣ or The treatment of infection is described as "Symptoms of Two Hundred Kings". The combination of compounds is a combination of multiplying effects. As described in Talalay, Adv EnzymeRegui = 55 (1984), the effect when the compound combination is administered (this When qp city] Η I V replication) is greater than the additive result of the compound when it is administered alone, the multiplication effect appears in Table π. Generally, when the compound is less than the most suitable concentration, the multiplication effect is most clearly demonstrated. The multiplicative effect may be manifested in lower cytotoxicity, enhanced technical viral effects, or certain other beneficial effects which appear in comparison with individual ingredients.-The description of the following specific examples will better understand other features of the present invention. These examples are only used to illustrate the present invention and are not limited. Examples The abbreviations used in the examples are defined as follows: &quot; .c &quot; refers to Celsius temperature, &quot; d ,, refers to doublet, &quot; dd &quot; refers Double doublet, 〃 eq 〃 refers to the number of equivalents, "g |. Refers to the number of grams, &quot; mg &quot; refers to the number of milligrams ,, mL &quot; refers to the number of milliliters, &quot; η &quot; refers to hydrogen, &quot; hr &quot; refers to the number of hours' "M &quot; refers to multi-split peaks, and M &quot; refers to the volumetric mole concentration, &quot; min &quot; refers to the number of minutes, Μ Η z 4 means megahertz," MS refers to the mass spectrum '|, nmr I, or μ Ν μ “r” refers to nuclear magnetic resonance spectrum, “t” refers to triple split, and “TL c” refers to thin layer chromatography. Example 1 (4R, 5S, 6S, 7R) -tt Lice-l- [5 -(3 -Amino group "^ 丨 olfactory" methyl] _3_butyl-5,6-diademyl_4,7-bis [benzyl] _2 ^ 1,3_diazepine-2_one (1) Method-13- This paper size applies to China National Standard (CNS) A4 (210X 297mm). ------ ¢ ------ 1T ------ 0 ( (Please read the notes on the back before discussing this page) 5. Description of the invention (11

A A7 B7

MeOTf, DCE Upflow OMe0 ^ 0 Compound A was prepared according to known methods. For example, the preparation method of Compound A is shown in Figure 1 in Rossano et al. (Tetr. Lett. 1995, 36 (28) '4967, 4968), which is incorporated herein by reference. Another method for preparing Compound A is shown in Example 6 of U.S. Patent No. 5,530,124, the contents of which are incorporated herein by reference. Item A: Add methyl trifluorosulfonium sulfonate (34 ml, 30 mmol) to 1,2-digasethane (1 0-10 g; 2 7 · 3 mmol) containing compound 1 100 ml) suspension. After refluxing overnight, the reaction was washed with saturated NaHC03, saturated NaCh, dehydrated (NazSO4) and evaporated to yield 1 2.5 g of a yellow oil. Column chromatography (flash chromatography 8; 02; 25/0 £ 108 (: / hexane)) yielded 7.86 g of compound 2 as a pale yellow oil that crystallized on standing (yield 75 / 〇) .mp = 97_1〇 (rc.MH + = 38l)

----------- # ------ ΪΤ ------ ^ (Please read the precautions on the back before filling out this page) Printed by the Staff Consumer Cooperative of the Central Bureau of Standards, Ministry of Economic Affairs Item B: Add sodium hydride (1.58 g, 65-8 millimoles) to a solution of (1) (100 g '2 6.3 millimoles) in anhydrous DMF (30 milliliters). After the reaction mixture was stirred at room temperature for 4 5 minutes, a solution of 1-butane ((9.88 g, 5 2 · 6 mmol)) in anhydrous DMF (10 ml) was added dropwise. After the addition, continued Stir overnight at room temperature. The reaction mixture is cooled to 0 ° C, methanol (5 ml) is added, and the Chinese standard (CNS _) A4 specification (2 丨 0X 297 mm) is used at medium -14-sheet scale. Economic A 7 * __ 一 ____B7 printed by the Ministry of Standards and Technology ’s Consumer Cooperatives V. Invention Description (i2) Stop the reaction of excess sodium hydride. Distribute the mixture between ethyl acetate (200 ml) and water (1 5 0 ml). The organic phase was separated, washed with water (4 x 00 ml), brine (100 ml), and dried over sodium sulfate. Purified by flash chromatography (250 / 〇Eto Ac / hexane) Alkanes) to produce n-butylisourea (2) (0.5 g, yield 92%): MS (NH3-CI / DDIP) (M + H +) 437.2 (100%); [H NMR (300 MHz , CDC13, 25〇C) ci7.23 (m, 10H), 4.19 (m, 3H), 3.64 (m, 1H), 3.44 (s, 3H), 3.36 (m, 1H), 3.02 (m, 2H) , 2.76 (m, 2H), 2-.04 (m, 1H), 1.52 (s, 3H), 1.49 (s, 3H), 1.21 (m, 4H), 0.82 (t, J = 7.0 Hz, 3H). Item C: (4R, 5S, 6S, 7R) -Hexahydro- l- [(3 -cyano-4-fluorophenyl) fluorenyl] -5,6- 0-isopropylidene-4,7-bis- (4-phenylfluorenyl) -3-benzylmethyl-2H-1,3-diazafluoren-2-one (3)

F

Add 4-fluoro-3-cyanobenzyl bromide (3.68 g, 17.25 mmol) to an acetonitrile (40 ml) solution containing (2) (5-0 g, 1 1.5 mmol). The reaction mixture was refluxed overnight. After the solvent was removed under reduced pressure, the residue was purified using flash chromatography (35% £ 1; 08 (: / 1 ^ \.)) To give a cyclic urea (3) as a white solid (4.5 g, 71o / 〇yd) : MS (NH3-CI / DDIP) (M + H +) (556.3 (100%); 1H NMR (300 MHz, CDC13, 25〇C) tf 7.41 (m, 1H), 7.28 (m, 7H), 7.13 (d, J = 9.2 Hz, 2H), 7.05 (t, J = 8.8 Hz, 1H), 6.95 (d, J-9.2 -15- This paper size applies to China National Standard (CNS) A4 specifications (210X297 mm) ----.----- Equipment ------ ir ------. ^ (Please read the notes on the back before filling out this page) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs ______ Β7 V. Description of the Invention (13)

Hz, 2H), 4.50 (d, 1 = 14.0 Hz, 1H), 4.07 (m, 2H), 3.70 (m, 3H), 3.44 (t, J = 7.7 Hz, 1H), 2.90 (m, 4H), 2.12 (m, 1H), 1.50 (s, 6H), 1.26 (m, 4H), 0.83 (t, J = 7.0 Hz, 3H). Item ：: (4R, 5S, 6S, 7R) -hexahydro-l- [5_ (3_aminoe also) methyl] _3-butyl-5,6-dilightyl-4,7-bis ( Phenylfluorenyl) -2 ^ 1-1,3_diazafluorene-2_ hydrazone (I) Add hydrazine hydrate (0.81 g, 16,2 mmol) to (3) (45 especially, 8 · 1 1 mol) in n-butanol (20 ml). The mixture was refluxed for 6 hours. The solvent and excess tritium were eliminated under reduced pressure. After the residue was dissolved in anhydrous methanol (20 ml), 4M HC 1 in dioxolane solution (2 ml) was added. The reaction mixture was stirred at room temperature for 2 hours. The methanol was eliminated and the residue was distributed between ethyl acetate (80 mL) and saturated sodium bicarbonate (50 mL). The organic phase was separated, washed with water (2x50 ml), and dried over (anhydrous) sodium sulfate. Purification by flash chromatography,

Yield (1) (3.0 g, yield 72%) as a white solid: MP 129-131. (:. MS (NH3-CI / DDIP) (M + H +) 528.3 (100%); HRMS

C31H37N5〇3 + l Calculated 値 528.2975, found 値 528.2958; 4 NMR (300 MHz, CD3OD, 25〇C) i 7.19 (m, 12H), 6.98 (d, J-1.5 Hz 2H), 4.74 (d, J- 13.9 Hz, 1H), 3.85 (dd, 1 = 10.25, 4.76 Hz 1H), 3.65 (m, 1H), 3.56 (m, 4H), 3.15 (m, 2H), 2.96 (m, 3H) 2.07 (m, 2H), 1.37 (m, 2H), 1.22 (m, 2H), 0.84 (t J = 7.0, 3H). — 'Use The compound of formula I has ΗIV protease inhibitor activity and is therefore suitable as an antiviral agent for the treatment of Η 1V infection and related diseases. The compound of formula 〖H〗 v protein-16- This paper size is applicable to Chinese Gardener's Standard (CNS) Λ4 specification (210X 297 male Chu) '----- -----: ----- pull clothes- -----, 玎 ------ line (please read the notes on the back &quot; and then write this page) A7 A7 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of invention (Μ) Enzyme Inhibitor activity, and can inhibit virus growth or salt-stained v growth. Decomposition of the compounds of the present invention for virogenic HD: The standard analytical method for maternal growth or infectivity was reversed using the analytical method described below. The compounds of the formula I of the present invention are also suitable for inhibiting HIVH entry in HIV-containing or in vitro specimens, and the path to HIV. Therefore, the compounds of the present invention can be used for inhibition. Presence of HIV in bodily fluids (samples) containing or exposed to HIV. Blood β or essence and the compounds provided by the present invention are also suitable as test or reference compounds. The determination of howling 1 quasi-quasi-H1V with sulfur "is used to inhibit virus replication and / or protease U, for example: used in medicine The study = substance can be used as a control or reference for these analytical methods: physical cause = or reference compound in a commercial kit or container: in use ... Standards Since the compounds of the present invention are specific to HIV proteases, the compounds are also suitable In order to detect the ecstasy of a protease in a diagnostic assay for detecting HIV protease1, if the egg property in the assay (eg, the assay described herein) is inhibited by the compound of the present invention, it means that it contains Η 醢 or HIV virus. Protein§ As used in this article, &quot; g "means micrograms, &quot; mg" means milligrams, &quot; g, &quot; l "means microliters &quot; mL &quot; means milliliter, and '&quot; means liter , Refers to nanovolume Moore concentration refers to microvolume Moore concentration = nanovolume Moore concentration, &quot; M "refers to volume molar concentration, early, W, refers to milliV: Slgma &quot; stands for St. Louis, Montana Sigma-AIdrich Corp_. Division A -17- This paper is applicable to siii ^ 7CNS) A4 size (210χ29 ^--Seed clothing-(Please read the precautions on the back before filling this page) Threading --.------ Central Ministry of Economic Affairs A 7 '__B7 printed by the Consumer Cooperatives of the Standards Bureau V. Description of the invention (15) HIV RNA analysis DNA plastids and RN / V transcription in test tubes:

According to Erickson_viitanen and others, AIDS

Research and Human Retroviruses 1989, 5,577 Preparation of a plastid p D A B 7 2 containing two sequences of gag and pol of BH10 (bp 113-1816) which has been cloned into PTZ 19R. After plastids were linearized by b a m η I, Riboprobe Gemini system Π kit (promi) was used to generate in-tube RNA transcripts with T7 RNA polymerase. The synthesized rNA was treated with D N A enzyme (Pulmeca) without R A N enzyme, purified by phenol-aerobic extraction, and ethanol precipitation. RNA transcripts were dissolved in water and stored at -70 ° C. RNA concentration was determined by A260. Purification of probe biotinylated capture probes was performed on an Applied Biosystems (Foster City, CA) DN A synthesizer on an oligonucleotide to 5. Biotin synthesis was added at the end, followed by HPLC purification using a biotin-phosphoimide reagent of Cocuzza et al., Tet. Lett. 1989, 30, 6287. The gag biotinylated capture probe (5 -Biotin-CTaGCTCCCTGCTTGCCCATACTA 3,) is complementary to the nucleus of HXB2 ^ § ^ 889-912, and the pol biotinylated capture probe (5'-Biotin_CCCTATCATTTTTGGTTTCCAT 3 ') Complementary with the nuclear 4 acid 2 3 7 4-2 3 9 5 of HXB2. The alkaline phosphatase conjugated spring nucleotides used as reporters were prepared by Syngene, San Piego CA. Po1 reporter reporter probe (5 'CTGTCTTACTTTGATAAAACCTC 3,) is complementary to nucleotides 240 3 -242 5 of HXB2. gag reporter probe (5, -18- this paper standard Laijia Xiajia County (CNS) Λ4 specification (21 () &gt; &lt; 297 Gongchu) —-, ------ equipment ---- --1T ------ ^ (Please read the notes on the back before filling out this page) Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs A 7,. _______B7 V. Description of Invention (16) — CCCAGTATTTGTCTACAGCCTTCT 3 ') Complementary to HXB2 #glycolic acid 9 5-0-9 7 3. All nuclear: y: acid positions are in the GenBank Genetic Sequence Data Bank (GeneBank Genetic Sequence Data Bank) using genetic computer group sequence analysis suite software (Genetics c⑽puter Gr〇up Sequ = Je

Analysis Software Package) (Devereau, Nucleic

Acids Research 1984, 12, 387). The reporter probe was prepared in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M THs pH 8.8, and 1 mg / ml BSA to make a 05 &quot; M preservation solution. Biotinylated capture probes were prepared in water. King_streptavidin culture plate A streptavidin-coated culture plate was obtained from Du Pont Biotechnology Systems (Boston, MA). Cells and virus preservation solution MT-2 and MT-4 cells were maintained at 5% fetal calf serum (FCS) supplementation (for MT_2 cells) or 10% fetal calf serum (FCS) supplementation (for MT-4 cells) RPMI 1 640, 2 mM L-chrysamine, and 50 μg / ml gentamycin (both from Gibco). HI V-1 RF is propagated in MT-4 cells in the same medium. About 10 days after MT-4 cells were acutely infected, a virus preservation solution was prepared and divided into aliquots and stored at _ 70 ° C. Η The infection titer of IV-1 (RF) preservation solution is 1 to 3 X 1 0 7 PFU (plaque-forming unit ml, which is measured by plaque analysis on MT-2 cells (see below). Each One virus preservation solution for infection can only be thawed once. 0 When evaluating the antiviral efficacy, the cells to be infected should be performed one day before the infection. -19- This paper applies Chinese National Standard (CNS) Λ4 specification (2iGX 297) );. Thread (please read the note t on the back before filling this page) Printed by the tM Industrial and Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 _____B7 __ V. Description of the invention (17) Subculture. On the day of infection, the cells were treated according to 5 x 丨 〇5 cells, ml resuspended in RPMI 1640, 5% FCS for overall infection, or resuspended at 2x106 cells / ml in DulbeccoS modified Eagles with 5% FCS medium) to facilitate infection on microtiter plates. Add virus and continue incubation at 37 ° C for 3 days. HI V RNA segmentation method to obtain cell lysates or purified R n contained in 3 M or 5 MGED A mixed with 5 MGED and capture probe The final concentration of guanidinium cyanate cyanate is 3M ′ and the final concentration of biotin oligonucleotide is 30nM. In a sealed U-bottom 96-well tissue culture plate (Nunc or Costar) The company) performed hybridization at 37 ° C for 16 to 20 hours. The rnA hybridization reaction was diluted twice with deionized water so that the final concentration of guanidinium diisocyanate was 1M, and 150 microliters were transferred to the coating. Streptavidin microtiter plate recesses. The binding of capture probe and capture probe · RN A hybrid to immobilized streptavidin was allowed to proceed for 2 hours at room temperature, and then DuPont Is a plate washing buffer (phosphate buffered saline (PBS), 0.05% Tween 20) washes the foot plate 6 times. Reporter probes and immobilized capture probes and target RN A for hybridization The second hybridization process of the complex was performed in the washed wells of Coated avidin, and 20 microliters containing 4 X ssc, 0.66% Triton X 100, 6.66% deionized. Phenylamine, summer mg / ml BSA and: &gt; η M reporter probe hybrid hard liquor solution. After 1 hour of down-hybridization, the titration plate was washed 6 more times, and 100 microliters of a buffer solution containing 0.2 mM 4-methylmycolyl phosphate (MUBp, jbl Scientific) buffer β ( 2.5M: ethanolamine pH 89 (jbl technology-20- This paper size applies to Chinese national standards (cns) ^^ 77 ^ 297mm) ---- = ----- ^: ------ ir- ------. ^-^ ------ (Please read the notes on the back before filling out this page) Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 1 B7 V. Invention Description (18) Company), 10 mM MgCl2, 5 mM zinc acetate dihydrate, and 5 mM N-ethyl-ethylenediamine-triacetic acid) 'to test the immobilized experimental leucinase activity. Titrate plates are incubated at 37 ° C. A microplate fluorometer (Dynateck) was used to excite at 365 nm and measure fluorescence at 450 nm. Microplate-based compound analysis in mt IV-2 infected cells IV-1: Dissolve the compound to be analyzed in DM SO and dilute it in the medium to twice the highest concentration to be tested , And the highest DMS 0 concentration is 2%. Directly on a U-bottom microtiter plate (Nuk company), a series of diluted compounds were diluted 3 times with the medium. After diluting the compound, MT-2 cells (50 microliters) were added to a final concentration of 5 X 105 cells / ml (1 X 105 cells / well). Cells and compounds were incubated in a CO 2 incubator at 37 ° C for 30 minutes. When analyzing the antiviral efficacy, add appropriately diluted ΗI V-1 (R F) virus preservation solution (50 µl) to culture wells containing cells and test compound dilutions. The final volume of each well was 2000 microliters. Eight wells were left uninfected on each plate, and 50 microliters of medium was added instead of virus. Another eight wells were infected without any antiviral compounds. To assess chemical toxicity, virus-free plates were also cultured in parallel. After incubation at 37 ° C for 3 days in a high-humidity co2 incubator, the medium was removed from the HIV-infected plate, leaving only 25 microliters of medium per well. Add 3 7 microliters of 5 M biotinylated capture needle sense GED to the wells containing the sedimented cells and the remaining medium, so that the final concentration in each well is 3M &lt; 3 £] :) and 30 nM capture probes . The hybridization of the capture probe with the HIV RN-8 in the cell lysate was performed in the same microtiter plate wells raised by the sick mother. It was sealed with a titer plate sealer (Costa) at 37 Incubate 16 to -21 in ° C incubator----- _ ^ ,, batch thread-. (Please read the note on the back & fill in this page before filling in this page) Preparation A7 B7 V. Description of the invention (19) 20 hours. Distilled water was then added to each well, and the hybridization reaction was diluted 3 times. I 50 liters of this diluted mixture was transferred to a microtiter plate coated with avidin. HIV RNA was quantified as described above. For each microtiter plate, a known amount of p DAB 7 2 RNA transcript was added to a well containing uninfected cells that had been lysed to prepare a standard curve to determine the amount of viral RNA produced during infection. The virus inoculum used to analyze the antiviral activity of the compounds was selected, and a virus dilution was selected that would cause the dideoxycytosine nucleus: y: (ddc) to reach 0.2 micrograms / ml; I c 9 〇値 refers to the compound when the amount of ΗI VRNA is reduced by 90%; I C 9 G of other antiviral compounds (including those with higher or lower potency than d d 〇) can be reproduced in this way using several types of I V-1 (R F) preservation solution. This virus concentration is equivalent to ~ 3 X 105 p F υ per assay well (determined by lytic plaque analysis on MT-2 cells), and any inoculated virus typically produces approximately the maximum amount of viral RN A 75%. 9 IC 9 of IV RN Α analysis is based on the net signal of RN A analysis (signal from self-infected cell sample minus signal from uninfected cell sample) relative to the same culture plate (8 wells Average 値) Decreased percentage of net signal reduction in infected but untreated cells. The effectiveness of each infection and RNA analysis test was determined based on three criteria. It requires that the viral infection should result in an RNA analysis signal equal to or greater than the signal generated by the RNA transcript in a 2 nanogram PDAB 72 tube. The IC90 of ddC measured in each analysis should be between 0.1 and 0.3 μg / ml. In the last item, the peak amount of virus RN A produced by an effective protease inhibitor should be less than 10% of the yield achieved by an uninhibited infection. This compound is considered to be active if its I C 9 0 is above &quot; M. -22- The size of this paper is applicable to Chinese National Standard (CNS) A4 (21 × 297 mm) ---- I--clothing ------------ τ ------ m vg .. ¾ intend to fill in this page) A7

V. Description of the invention (20) All operations performed on the microtiter plate in the anti-disease efficacy test printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, and the subsequent addition of the 2X concentration compound solution to the pits for the first time The process uses Perkin Emma / Hitus (Perkin 1 claw 〇1 &quot; / 匸 "1 ^) of 1 &gt; 1 * 〇1 &gt; deduction 6 for 0 doses and preparations of the organic viral compounds of the present invention It can be administered in any form that can bring the active agent into contact with the active site of the agent in the mammalian body (ie, viral protease) for the treatment of viral infections. It can be used as a single therapeutic agent in a manner commonly used in medicine. Or it can be administered as a combination of therapeutic agents. It can be administered alone ^ but it is best to be administered according to the selected route of administration and the drug carrier selected by standard medical operation methods. The dosage will of course depend on known factors, such as the drug of a specific agent Dynamic characteristics and the mode and route of administration; the age and health of the recipient] the nature and extent of the symptoms; the types of concurrent treatments; the frequency of treatment; and = expected effects. Each of the active ingredients The dosage should be about 0.001 to about mg / kg body weight, preferably about 0.001 to about 30 mg / kg body weight. The dosage form of the composition suitable for administration contains about 1 g to about 100 mg of activity per unit Ingredients. In these pharmaceutical compositions, the amount of active ingredient is about 0.5 to 95% by weight based on the total weight of the composition. The active ingredient can be a solid agent, such as a capsule, a bonding agent and a powder, or a liquid. Dosage forms such as: _ 'sugar_' solution can be administered orally. It can also be administered as a sterile liquid, parenterally. 1: Containing, capsules and powdered carriers such as: lactose ... It can be used with similar diluents to make compression hinges. Both mirrors and capsules can be made into continuous release products. This paper scale towels are closed ^ Read the note on the back &quot; 'Fill in this page and fill in this page again.' Sugar-coated or film-coated 'to mask any unpleasant taste' and protect the lozenge from the atmosphere, bite It is an enteric coated tablet for selective disintegration in the gastrointestinal tract. Liquid formulations for oral administration may contain colorants or fragrances to improve patient acceptance. Generally, the carrier suitable for parenteral solutions is water, Suitable oils, saline, dextrose (glucose) water 'solution, and related sugar solutions and glycols such as · propanol or polyethylene glycol. Solutions for parenteral administration preferably contain Water-soluble salts of ingredients, suitable stabilizers, and buffer substances if necessary. Antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid are suitable stabilizers whether used alone or in combination. Lemons can also be used Acids and their salts with sodium EDTA. In addition, parenteral solutions may contain preservatives, such as: ammonium paraben, ethyl or para-benzoate, and butyl butanol. Suitable pharmaceutical carriers have been described in the aforementioned document: Ray's Pharmaceutical Sciences, which is a standard reference book in this field. The medicinal dosage forms suitable for administering the compounds of the present invention can be described as follows. Capsules:. A large number of unit capsules are prepared by filling a standard two-stage hard capsule with 100 mg of powdered active ingredient and 150 mg of lactose each. , 50 mg of cellulose and 6 mg of magnesium stearate. Soft Ming capsules take active ingredients in edible oils such as: soybean oil, cotton stalk oil, or olive oil to make a mixture, and use positive displacement pump filling human capsule 卞 to form soft Ming capsules containing 丄 ⑽ guk active ingredients . The capsules should then be washed and dried. Ointment tablets ... ° -24- -------- Γ Seed Clothing I ί f Please read the precautions on the back before filling out this page) Order ---- Consumption by the Central Bureau of the Ministry of Economic Affairs A7 printed by the cooperative V. Description of the invention (22 A large number of lozenges can be prepared according to the general manufacturing method, so that each measuring unit contains 10 [mg active ingredient, 0.2 mg colloidal silicon dioxide, 5 mg magnesium stearate, 2 7 5 Mg of microcrystalline cellulose, η mg of starch and 988 mg of lactose. Suitable coatings can be applied to improve palatability or delay absorption. Suspensions Prepare aqueous suspensions for oral administration such that each 5 ml contains 25 mg of micro-divided mashed active ingredient, 200 mg of sodium carboxymethylcellulose, 5 mg of sodium carboxymethylcellulose '1.0 g of sorbitol solution, usp, and 025 mg of vanillin. The preparation method of the parenteral composition of the medicine is to take 1 _ $% by weight of the active ingredient in 10% by volume of propylene glycol and stir in water. The solution is sterilized by commonly used techniques. Granules (a) and Γ b); each treatment of the present invention The ingredients can be in any dosage form, such as: Administered in various ways, such as: those described above. In the following description, the ingredient (b) represents the aforementioned one or more agents. Therefore, if the ingredients um (b) are subjected to the same treatment or separately processed separately, each ingredient (b) i medicament may also be treated the same or separately. The ingredients ⑷ and (b) of the present invention can be jointly formulated into a single-dose unit (ie, ugly combination: capsules, bonding agents, powders, liquids, etc.) into groups: 田田 成 f 刀 ⑷ and (b ) When not co-adjusted-formulated into a single-dose unit (a) may be administered at the same time as ingredients (b) or the ingredients may be specified in any order. May be administered first, and then ingredients (b),: This medicine. If ingredient (b) contains more than one agent, 5 meshes are injected in reverse order, such as: an RT inhibitor 25- This paper applies the Chinese National Standard (CNS) Α4 standard;

V. Description of the invention (23 Μ7 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs and a protease inhibitor, these agents can be administered together or in any order. When administered at different times, ingredients (a) and (b) The interval of administration is preferably no more than about 1 hour. The route of administration of ingredients (3) and (13) is preferably oral. The term "oral compound", "oral compound", etc. used in this article represents oral administration. Compound. Although ingredient (a) and ingredient (b) are best administered by the same route (ie, for example: both are administered orally) or in the same dosage form, they can be administered separately through different routes (ie, for example: Ingredients-can be administered orally, and another ingredient is administered intravenously) or in different dosage forms. Medical experts in related arts understand that the dosage of the combination therapy of the present invention can vary with various factors, such as the above-mentioned specific pharmaceutical drugs Dynamic characteristics, and the mode and route of administration, the age, health and weight of the recipient, the nature and extent of symptoms, the type of concurrent treatment, the frequency of treatment, The proper dosage of the ingredients (a) and (b) of the present invention can easily be determined by the medical experts of related arts according to this description. According to the general principle, a typical daily dose can be about 100 mg to each ingredient. Approximately 15 grams. If ingredient (b) represents more than one compound, the typical daily dose of each medicament of ingredient (b) may be from about 100 ¾ grams to about 1.5 grams. According to general principles, if the ingredients (a ) And the component (b), the dosage of each component may be about 70 to 8% lower than the general dosage of the compound when used alone as a medicine for treating ΗIV infection. Although the preparation method of the combination product of the present invention combines the active ingredients in In single-dose units, the physical contact between the active ingredients is still minimized. In order to minimize the degree of contact, for example, if the product is administered orally, the-$ active ingredient can be coated with an enteric coating. When enteric coating is applied to one of the active ingredients, not only the degree of contact between the active ingredients of the combination, please read the back-5 i 'matter and then fill in this page gutter -26 ·

B7 V. Description of the invention (24) is minimized, and it can also be controlled. Therefore, the release of these ingredients-absent in the field and in the stomach wins, please read the back first-note the above and then fill the% -... In the embodiment, V is required. —A kind of active ingredient is coated with continuous release material :::: ΐ 时 ’which is released, and the combined active ingredient can also have a low performance in the mind. In addition, the sustained release of 4 rational contact was reduced to the most gastric belching (the ingredients can be coated with intestines and released only in the intestines. Another He, G coat 'makes this ingredient-a kind of ingredient covering and holding two Γ involved The combination product is formulated, in which the ceremonial style has been waiting for% release and / or enteric release component, and also coated with polymer, such as: low dryness nail: other suitable materials known in the second technology to further divide == Or related polymer coatings can open up and cause other injuries. 泫 he barrier to the interaction between ㈣ and other ingredients. In each formulation, Ruoli ~ human tile ⑷ also m, other materials barrier ingredients ^, () ( 'In case of contact,' it can also prevent ingredients (b) in the dosage form of the joint product between the pharmaceuticals. 'Among them enteric coatings are active. The central standard bureau of the Ministry of Economic Affairs, Shellfish Consumer Cooperative Co., Ltd. prints the main key agent. Form 'combines the ingredients of the enteric coating with other active ingredients, and then compresses them into tablets, or compresses the ingredients of the enteric coating into a layer of tablets, and then compresses the other active ingredients into another layer. Tablets. Vision: May contain one or more additional placebos for comfort The layer is interposed between the active ingredient layers to further separate the two layers. In addition, the dosage form of the present invention may be in the form of a capsule, in which one of the active ingredients I is shrunk into tablets or a plurality of small micro tablets, pellets, pellets or non-perih, It is then coated and enteric-coated. These enteric-coated tablets, pellets, pellets, or non-perils are then placed in capsules' or compressed into capsules together with particles of other active ingredients. -27 The size of this paper is applicable to China National Material (CNS) Λ4 specification (21 () &gt; &lt; 297 Gongchu) V. Description of the invention (25 These and other methods to make the hair lower, ^ 一 = 产品 成 k The degree of contact between them is reduced in the same way. The two dosage forms are administered or separated 'but at the same time or-and imitated. 々 Related art experts can prepare the composition according to this description, which is: 1 :::; Contains a therapeutically effective amount of medicines and compounds. Crying m π rm is also in the present invention park. Cheng Guang /, Know how to use the sterilization method known by relevant technical experts: 1 seedling?) Can be in the same In a container or in separate sterile containers. Multiple ... may contain Open container, or as many as necessary. Ingredients can be separated or physically combined into a package i :::: dosage form or dosage unit. If necessary, these sets can be re-colored Or a variety of conventional pharmaceutical kit components,%, such as ― etc.! A pharmaceutically acceptable carrier for other vials for mixing ingredients, Temple: This is a person skilled in related arts. The kit also includes inner pages or The standard specification, 'Describe the dosage of the ingredients to be administered', is the principle of administration, and / ::: the principle of ingredients. Σ According to the above description, the present invention can obviously be modified and changed in many ways. It is understood that, within the scope of the appended patent application, the present invention does not have to operate as explicitly described above. -28- The paper size of this paper §Postal wealth (CNS.) (2) Qx 297 male thin) Patent application No. 80116676 No. Chinese supplementary specification (December 1987)

Announced that the virus group of DuPont Merck Pharmaceutical Co., Ltd. has tested the compound of formula I and the example in U.S. Patent No. 5,610,294 (see below): potency of the compound against the following HXV viruses: wild type, I84V mutant, and dual Mutant (Ι84ν / ν82ρ).

Table I contains two values of two compounds against three test viruses. Table 1 (亳 micron unit;) Compound wild type I84V double mutant strain I 56 436 1800 Formula 15DF 1100 1100 1400 ㈣ 明 之 _Newman test to test its activity against wild-type virus. Known to use low yield analysis method to test compounds against lin mutants and double mutants (1 attached ~ Gang (potency. How to conduct low yield analysis method) It is as follows. The gangliolytic plaque method is used to determine the disease valence of offspring scales produced with or without test compounds. Addition is called poison (approximately 5 plaque forming units / ml) to hemp 2 cells (5 &gt; &lt; _In the compensation, the card U \ Ή ΡΕ1Π C Ci \ 2684G-i 〇 () 〇. HVC \ cultures were centrifuged 1-minutes above the surface and placed in suspension containing non-adherent disease Shen Dian block suspended in fresh with appropriate test compound concentration Enter the C '4% co2 incubator. Make the virus replicate for 3 days. The culture is centrifuged below the surface, and there are cells at the time of collection. The secret transfer shoot Weng __ Zhuan, each and milliliters of riding fluid were added to 9 fine τ · 2 cells. Cells and disease county 36t under cultivation The virus was allowed to effectively attach to the cells for 3 hours. Each cell was identified as a cell-free age in a double-recessed well of a six-well culture plate of _polyxin_acid and cultured at 36 C '4% C02-night. First Drain the liquid and unattached cells, then add 1.5 ml of a medium containing a. Seapiaque agarose and yak serum. The plate is cultured for 3 days, and then covered with a second layer of agarose. In 3 generations, after 3 days of cultivation at 4% CO2 for 3 days, the last layer was covered with 075% siglapaglipidose and 1 mg / ml 3 (4,5--methyl sial-2- Based) -2,5_diphenyltetralins bromide (MTT) indicator dye-buffered saline culture plate culture—night. Calculate clear plaques' on a purple background and calculate virus plaques for each sample Axes are recorded. The expression of antiviral secretion is the concentration at which the virus yield is reduced by 90% compared with that of X-infected but untreated control cultures. It can be seen from page 22 of this specification that IC90 is a reduction in HTV RNA content. The degree of conversion required at 90% is high. Therefore, it is desirable to obtain a low ICgo value, because this indicates a strong anti-fflv inhibitory effect. It can be seen from Table 1. In the fight against wild-type virus and 184 \ ^ mutant strains, the compound of formula 〖is far superior to DOC \ example coffee. This superiority was not expected or anticipated by related techniques. When this case was put forward, it was not known to replace with butyl. The amino group is not the same as the wild-type%. It can reduce the wild-type% by more than 2 and decrease the IC84 of the I84V mutant by more than two times. The above data may represent the compounds that are currently patented in the aforementioned applications. The compounds of the patents applied for in this application have been tested and, as expected, are superior to those of the most similar structure in the US patent case! ^ 0.5.610,294 (ie, Example 15) 〇1 :). The different salts and prodrugs for which patents are filed in the application mentioned above should have similar anti-brother properties to the test compound. U \ TYPE \ HYC \ G \ 26S4G-l.D〇a HYC \ 8

Claims (1)

Patent application No. 86116676 Chinese amendments to the scope of patent application (June of the following year) 88. 6. Sixth, the scope of patent application Hachidotai | Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 1. A compound of formula I: Or a pharmaceutically acceptable salt or prodrug form thereof. 2_ The compound according to item 1 of the patent scope of Shensing or a pharmaceutically acceptable salt or prodrug form thereof, wherein the compound is as follows. 3. A pharmaceutical composition for treating HIV infection, comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound according to item 丨 of the scope of application for a patent, or a pharmaceutically acceptable salt or prodrug thereof. 4. A composition according to item 3 of the scope of patent application, wherein the compound is a pharmaceutical composition for treating HIV infection, such as Formula 5 ·, which comprises a therapeutically effective amount of a compound of Formula I Or a pharmaceutically acceptable salt or prodrug form thereof. 6. · According to the patent application, the pharmaceutical composition of item 5 wherein the formula I. 7.-A pharmaceutical composition for the treatment of HIV infection 'which contains a therapeutically effective amount of -1-I paper scale home standard (CNS) centimeters) ---__- __——————-- clothing ----- —, 11 (Please read the precautions on the back before filling out this page) No. 86116676 Patent Application Chinese Application for Amendment of Patent Scope (June of the following year) 88. 6. VI. Application for Patent Scope Hachidotai | Ministry of Economic Affairs Printed by Standard Bureau Consumers Cooperative 1. A compound of formula I: Or a pharmaceutically acceptable salt or prodrug form thereof. 2_ The compound according to item 1 of the patent scope of Shensing or a pharmaceutically acceptable salt or prodrug form thereof, wherein the compound is as follows. 3. A pharmaceutical composition for treating HIV infection, comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound according to item 丨 of the scope of application for a patent, or a pharmaceutically acceptable salt or prodrug thereof. 4. A composition according to item 3 of the scope of patent application, wherein the compound is a pharmaceutical composition for treating HIV infection, such as Formula 5 ·, which comprises a therapeutically effective amount of a compound of Formula I Or a pharmaceutically acceptable salt or prodrug form thereof. 6. · According to the patent application, the pharmaceutical composition of item 5 wherein the formula I. 7.-A pharmaceutical composition for the treatment of HIV infection 'which contains a therapeutically effective amount of -1-I paper scale home standard (CNS) centimeters) ---__- __——————-- clothing ----- —, 11 (Please read the notes on the back before filling this page) (a) Compound of Formula I -Oh ph Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs = its pharmaceutically acceptable salt or prodrug type; and made from: HIV reverse transcriptase inhibitors and egg custards 8 · ^ Patent scope 7 The pharmaceutical composition, wherein the compound ^ 9: 1: the pharmaceutical composition in the scope of patent application No. 7, wherein the reverse transcriptase 4 is a nucleoside reverse transcriptase inhibitor. 1〇_ The pharmaceutical composition according to item 9 of the scope of the patent application, wherein the nucleoside inversion 3 enzyme inhibitor is selected from the group consisting of ^ '^, 、, 丁丁', and ^ enzyme inhibitor is selected from the group consisting of: three grams Victoria (saquinavir), Littonna! (ritonavir) 'indinavir, νχ_478, Nefina; (nelfinavir), KNI-272, CGP-61755, and U-103017. 11. According to the pharmaceutical composition with the scope of patent application No. 丨 0, wherein the nucleoside inverse enzyme inhibitor is selected from the group consisting of: AZT and 3 TC, and the protein is inhibited ~ the formulation is selected. Tunnawi, and Indinawi. 12. The pharmaceutical composition according to item 范围 i of the scope of patent application, wherein the nucleoside reverse enzyme inhibitor is AZ T. 2- This paper size applies to Chinese National Standards &lt; CNS) A4 specification (21 × 297mm) C Please read the notes on the back before filling in this page} Order A8 B8 C8 D8 383304 VI. Scope of patent application 丨 3 _ Root. According to item n of the patent application, the pharmaceutical group preparation is indinavir. Protease inhibitors 14.-A pharmaceutical kit suitable for HIV infection, which contains a therapeutically effective amount of (a) a compound according to item 1 of the scope of the patent application in each of the aerobic bacteria containers; and (b) At least 'species are selected from the group consisting of: a ΗIV reverse transcriptase inhibitor and a ΗIV protease inhibitor. 15. The kit according to item 4 of the scope of patent application, wherein component (a) is a compound of formula I. I. ^ 1. ^ 1 n ll — ϊ _ | (Jing first read the note on the back and fill in this page) Ordering the paper size of the printed paper by the Central Standards Bureau of the Ministry of Economic Affairs of the Shellfish Consumer Cooperatives applies the Chinese National Standard (CNS) A4 specifications (210X297 mm)