TW202409275A - Compositions and methods for inhibiting snca expression - Google Patents

Abstract

Oligonucleotides (e.g., RNAi oligonucleotides) are provided herein that inhibit SNCA gene expression, including oligonucleotides conjugated to a targeting ligand (e.g., GalNAC moiety or lipid moiety). Also provided are compositions including the same and uses thereof, particularly uses relating to treating diseases, disorders, and/or conditions associated with SNCA gene expression.

Description

Compositions and methods for inhibiting the manifestations of SNCA

This disclosure relates generally to biology and medicine, and more specifically this disclosure relates to oligonucleotides for inhibiting or reducing (i.e., modulating) expression of the alpha-synuclein ( SNCA ) gene. and compositions comprising such oligonucleotides, and their use for treating diseases and conditions associated with expression of the SNCA gene.

Synapses are functional compartments between cells where information is transmitted from one cell to another in the brain. SNCA is a protein found primarily in the brain that regulates synaptic vesicle trafficking and neurotransmitter release. Among other functions, SNCA acts as a molecular chaperone to assist in the folding of synaptic fusion components (e.g., SNAREs). Mutations in SNCA that alter SNCA function and expression (e.g., insertions and mispairing) or general abnormal expression of SNCA are known causes of several diseases that affect the CNS (e.g., Parkinson's disease and multiple system atrophy). Strategies that target the SNCA gene to prevent such diseases are needed.

The mammalian CNS is a complex system of tissues (including cells), fluids, and chemicals that interact synergistically to achieve a variety of functions, including movement, navigation, cognition, language, vision, and emotion. Unfortunately, a variety of CNS diseases and disorders (e.g., neurological disorders) are known and affect or disrupt some or all of these functions. Typically, treatments for CNS diseases and disorders have been limited to small molecule drugs, antibodies, and/or adaptive or behavioral therapies. There is a continuing need to develop treatments for CNS diseases and disorders associated with inappropriate gene expression.

To address this need, the present disclosure describes compositions and methods for treating diseases, conditions, or disorders associated with expression of the SNCA gene. The present disclosure is based, at least in part, on the discovery of RNAi oligonucleotides that effectively target and reduce SNCA gene expression in CNS tissue. Specifically, target sequences within SNCA mRNA are identified, and oligonucleotides are generated that bind to these target sequences and inhibit SNCA mRNA expression. As demonstrated herein, oligonucleotides inhibit human and non-human primate (NHP) SNCA gene expression in CNS tissue. Furthermore, lipid-conjugated SNCA- targeting oligonucleotides reduced SNCA mRNA expression in CNS tissues associated with Parkinson's disease or multiple system atrophy. Without being bound by theory, the oligonucleotides described herein may be used to treat diseases, conditions, or disorders associated with expression of the SNCA gene.

Thus, in some aspects, the present disclosure provides an RNAi oligonucleotide for reducing SNCA gene expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence of any one of SEQ ID NOs: 1683-2066, and wherein the complementary region is at least about 15 contiguous nucleotides in length.

In any of the foregoing or related aspects, the sense strand is from about 15 to about 50 nucleotides in length. In some aspects, the sense strand is from about 18 to about 36 nucleotides in length. In some aspects, the antisense strand is from about 15 to about 30 nucleotides in length. In some aspects, the antisense strand is 22 nucleotides in length, and the antisense strand and the sense strand form a duplex region, the duplex region is at least 19 nucleotides in length, optionally be at least 20 nucleotides. In some aspects, the complementary region is at least 19 contiguous nucleotides in length. In some aspects, the complementary region is at least 20 contiguous nucleotides in length.

In other aspects, the disclosure provides a double-stranded (ds) RNAi oligonucleotide for reducing SNCA gene expression, the oligonucleotide comprising: (i) a reverse RNAi oligonucleotide of 19-30 nucleotides in length; A sense strand, wherein the antisense strand comprises a nucleotide sequence containing a complementary region of the SNCA mRNA target sequence, wherein the complementary region is selected from SEQ ID NO: 2067-2450, and (ii) is 19-50 nucleotides in length The sense strand of an acid, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand and the sense strand are independent strands forming an asymmetric duplex region, the duplex region being in the antisense strand The 3' end has an overhang of 1-4 nucleotides.

In some embodiments, the 3' end of the sense strand comprises a stem loop as shown in S1-L-S2, wherein S1 and S2 complement each other, and wherein L forms a loop of 3-5 nucleotides in length between S1 and S2. In some embodiments, L is a tricyclic or tetracyclic loop. In some embodiments, L is a tetracyclic loop. In some embodiments, the tetracyclic loop comprises the sequence 5'-GAAA-3'. In some embodiments, the length of S1 and S2 is 1-10 nucleotides and has the same length. In some embodiments, the length of S1 and S2 is 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides. In some embodiments, the length of S1 and S2 is 6 nucleotides. In some embodiments, the stem loop comprises the sequence 5'-GCAGCCGAAAGGCUGC-3' (SEQ ID NO: 1680).

In other aspects, the oligonucleotide comprises a blunt end. In some aspects, the blunt end comprises the 3' end of the sense strand. In some aspects, the sense strand is 20 to 22 nucleotides. In some aspects, the sense strand is 20 nucleotides.

In any of the foregoing or related aspects, the antisense strand comprises a 3' overhang sequence of one or more nucleotides in length. In some aspects, the overhang contains purine nucleotides. In some aspects, the 3' overhang sequence is 2 nucleotides in length. In some aspects, the 3' overhang is selected from AA, GG, AG, and GA. In some versions, the drape is GG or AA. In some styles, the drape is GG.

In any of the foregoing or related aspects, the oligonucleotide comprises at least one modified nucleotide. In some aspects, the modified nucleotides comprise 2'-modifications. In some aspects, the 2'-modification is selected from 2'-aminoethyl, 2'-fluoro (2'-F), 2'-O-methyl (2'-OMe), 2'-O -Modification of methoxyethyl and 2'-deoxy-2'-fluoro-β-d-arabinose nucleic acid. In some aspects, the modification is a 2'-modification selected from 2'-F and 2'-OMe. In some aspects, about 18% to about 23%, or 18%, 19%, 20%, 21%, 22%, or 23% of the nucleotides in the sense stock comprise 2'-F modifications. In some forms, the proportion of equity shares is about 38-43%, 38%, 39%, 40%, 41%, 42% or 43% of the nucleotides contained 2'-F modification. In some aspects, from about 25% to about 35% or 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35% The nucleotides contain 2'-F modification. In some aspects, about 25% to about 35%, or 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% % of nucleotides contain 2'-F modification. In some aspects, about 35% to about 45%, or 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, or 45% % of nucleotides contain 2'-F modification. In some aspects, the sense strand includes 36 nucleotides from 5' to 3' at positions 1-36, wherein each of positions 3, 5, 8, 10, 12, 13, 15, and 17 Contains 2'-F modification. In some aspects, the sense strand includes 20 nucleotides from 5' to 3' at positions 1-20, wherein each of positions 3, 5, 8, 10, 12, 13, 15, and 17 Contains 2'-F modification. In some aspects, the antisense strand includes 22 nucleotides from 5' to 3' at positions 1-22, and wherein Each contains a 2'-F modification. In some aspects, the remaining nucleotides contain 2'-OMe modifications.

In any of the foregoing or related aspects, the oligonucleotide comprises at least one modified internucleotide linkage. In some aspects, at least one modified internucleotide linkage is a phosphorothioate linkage. In some aspects, the antisense strand includes phosphorothioate linkages (i) between positions 1 and 2 and between positions 2 and 3; or (ii) between positions 1 and 2, Between positions 2 and 3 and between positions 3 and 4, where the positions are numbered 1-4 from 5' to 3'. In some aspects, the antisense strand is 22 nucleotides in length, and the antisense strand includes a phosphorothioate linkage between positions 20 and 21 and between positions 21 and 22, wherein positions 5' to 3' is numbered 1-22. In some aspects, the sense strand includes a phosphorothioate linkage between positions 1 and 2, with positions numbered 1-2 from 5' to 3'. In some aspects, the sense strand is 20 nucleotides in length, and the sense strand includes a phosphorothioate linkage between positions 1 and 2, between positions 18 and 19, and between positions 19 and 20 , where the positions are numbered 1-20 from 5' to 3'.

In any of the foregoing or related aspects, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog. In some aspects, the phosphate analog is an oxymethylphosphonate, a vinylphosphonate, or a malonylphosphonate, where appropriate wherein the phosphate analog is a 4'-phosphate analog comprising a 4'-oxymethylphosphonate.

In any of the foregoing or related aspects, at least one nucleotide of the oligonucleotide is bound to one or more targeting ligands. In some aspects, each targeting ligand comprises a carbohydrate, an amino sugar, a lipid, cholesterol, or a polypeptide. In some aspects, the stem ring comprises one or more targeting ligands bound to one or more nucleotides of the stem ring. In some aspects, one or more targeting ligands are bound to one or more nucleotides of the ring. In some aspects, the ring comprises 4 nucleotides numbered 1-4 from 5' to 3', wherein the nucleotides at positions 2, 3, and 4 each comprise one or more targeting ligands, wherein the targeting ligands are the same or different. In some aspects, each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety. In some embodiments, the GalNAc moiety is a monovalent GalNAc moiety, a divalent GalNAc moiety, a trivalent GalNAc moiety, or a tetravalent GalNAc moiety. In some embodiments, up to 4 nucleotides of L of the stem ring are each bound to a monovalent GalNAc moiety.

。在一些態樣中，脂質部分結合至5'末端核苷酸之核糖環的2'碳。 In other aspects, one or more targeting ligands are lipid moieties. In some aspects, the lipid moiety is bound to the 5' terminal nucleotide of the sense strand. In some aspects, the lipid moiety is a hydrocarbon chain. In some aspects, the hydrocarbon chain is a C ₈ -C ₃₀ hydrocarbon chain. In some aspects, the hydrocarbon chain is a C ₁₆ hydrocarbon chain. In some aspects, the C ₁₆ hydrocarbon chain is represented by:

. In some aspects, the lipid moiety is bound to the 2' carbon of the ribose ring of the 5' terminal nucleotide.

In any of the foregoing or related aspects, the complementary region is fully complementary to the SNCA mRNA target sequence at nucleotide positions 2-8 of the antisense strand, where the nucleotide positions are numbered from 5' to 3'. In some aspects, the complementary region is completely complementary to the SNCA mRNA target sequence at nucleotide positions 2-11 of the antisense strand, with nucleotide positions numbered from 5' to 3'.

In any of the foregoing or related aspects, the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1537-1571 and 1681. In some aspects, the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1572-1606. In some aspects, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1537 and 1572, respectively; b) SEQ ID NOs: 1538 and 1573, respectively; c) SEQ ID NOs: 1539 and 1574, respectively; d) SEQ ID NOs: 1540 and 1575, respectively; e) SEQ ID NOs: 1541 and 1576, respectively; f) SEQ ID NOs: 1542 and 1577, respectively; g) SEQ ID NOs: 1543 and 1578, respectively; h) SEQ ID NOs: 1544 and 1579, respectively; i) SEQ ID NOs: 1545 and 1580, respectively; j) SEQ ID NOs: 1546 and 1581, respectively; k) SEQ ID NOs: 1547 and 1582, respectively; l) SEQ ID NOs: 1548 and 1583, respectively. NO: 1548 and 1583; m) are SEQ ID NO: 1549 and 1584; n) are SEQ ID NO: 1550 and 1585; o) are SEQ ID NO: 1551 and 1586; p) are SEQ ID NO: 1552 and 1587; q) are SEQ ID NO: 1553 and 1588; r) are SEQ ID NO: 1554 and 1589; s) are SEQ ID NO: 1555 and 1590; t) are SEQ ID NO: 1556 and 1591; u) are SEQ ID NO: 1557 and 1592; v) are SEQ ID NO: 1558 and 1593; w) are SEQ ID NO: 1559 and 1594; x) are SEQ ID NO: 1560 and 1595; y) are SEQ ID NO: 1561 and 1596; z) are SEQ ID NO: 1562 and 1597, respectively; aa) are SEQ ID NO: 1563 and 1598, respectively; bb) are SEQ ID NO: 1564 and 1599, respectively; cc) are SEQ ID NO: 1565 and 1600, respectively; dd) are SEQ ID NO: 1566 and 1601, respectively; ee) are SEQ ID NO: 1567 and 1602, respectively; ff) are SEQ ID NO: 1568 and 1603, respectively; gg) are SEQ ID NO: 1569 and 1604, respectively; hh) are SEQ ID NO: 1570 and 1605, respectively; ii) are SEQ ID NO: 1571 and 1606, respectively; and jj) are SEQ ID NO: 1681 and 1586, respectively.

In some aspects, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1540 and 1575, respectively; b) SEQ ID NOs: 1544 and 1579, respectively; c) SEQ ID NOs: 1546 and 1581, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1552 and 1587, respectively; f) SEQ ID NOs: 1553 and 1588, respectively; g) SEQ ID NOs: 1558 and 1594, respectively; h) SEQ ID NOs: 1560 and 1595, respectively; i) SEQ ID NOs: 1564 and 1599, respectively; j) SEQ ID NOs: 1565 and 1600, respectively; k) SEQ ID NOs: 1566 and 1601, respectively; l) SEQ ID NOs: 1561 and 1593, respectively. NO: 1570 and 1605; and m) are SEQ ID NO: 1681 and 1586 respectively.

In some aspects, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1553 and 1588, respectively; b) SEQ ID NO: 1560 and 1595, respectively; c) SEQ ID NO: 1564 and 1599 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1570 and 1605 respectively; and f) SEQ ID NO: 1681 and 1586 respectively.

In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1553 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1588. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1560 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1595. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1564 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1599. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1551 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1586. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1570 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1605. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1681 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1586.

In any of the foregoing or related aspects, the antisense strand is 22 nucleotides in length. In some aspects, the antisense strand comprises a nucleotide sequence comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1588, 1595, 1599, 1586, and 1605. In some aspects, the sense strand is 36 nucleotides in length. In some aspects, the sense strand comprises a nucleotide sequence comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1865, 1721, 1847, 1846, and 1955. In some aspects, the sense strand includes a nucleotide sequence selected from SEQ ID NO: 1553, 1560, 1564, 1551, and 1570.

In any of the foregoing or related aspects, the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1607-1641 and 1682. In some aspects, the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1642-1676.

In some aspects, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1607 and 1642, respectively; b) SEQ ID NO: 1608 and 1643, respectively; c) SEQ ID NO: 1609 and 1644 respectively; d) SEQ ID NO: 1610 and 1645 respectively; e) SEQ ID NO: 1611 and 1646 respectively; f) SEQ ID NO: 1612 and 1647 respectively; g) SEQ ID NO: 1613 and 1648 respectively; h) SEQ ID NO: 1614 and 1649 respectively; i) SEQ ID NO: 1615 and 1650 respectively; j) SEQ ID NO: 1616 and 1651 respectively; k) SEQ ID NO: 1616 and 1651 respectively; SEQ ID NO: 1617 and 1652; l) are SEQ ID NO: 1618 and 1653 respectively; m) are SEQ ID NO: 1619 and 1654 respectively; n) SEQ ID NO: 1620 and 1655 respectively; o) SEQ ID NO: 1621 and 1656 respectively; p) SEQ ID NO: 1622 and 1657 respectively; q) SEQ ID NO: 1623 and 1658 respectively; r) SEQ ID NO: 1624 and 1659 respectively; s) SEQ ID NO: 1625 and 1660 respectively; t) SEQ ID NO: 1626 and 1661 respectively; u) SEQ ID NO: 1627 and 1662 respectively; v) SEQ ID NO: 1627 and 1662 respectively; SEQ ID NOs: 1628 and 1663; w) are SEQ ID NOs: 1629 and 1664 respectively; x) are SEQ ID NOs: 1630 and 1665 respectively; y) are SEQ ID NOs: 1631 and 1666 respectively; z) are SEQ ID NOs respectively NO: 1632 and 1667; aa) are SEQ ID NO: 1633 and 1668 respectively; bb) are SEQ ID NO: 1634 and 1669 respectively; cc) are SEQ ID NO: 1635 and 1670 respectively; dd) are SEQ ID NO: 1636 and 1671; ee) are SEQ ID NO: 1637 and 1672 respectively; ff) are SEQ ID NO: 1638 and 1673 respectively; gg) are SEQ ID NO: 1639 and 1674 respectively; hh) are SEQ ID NO: 1640 and 1673 respectively. 1675; ii) SEQ ID NO: 1641 and 1676 respectively; and jj) SEQ ID NO: 1682 and 1656 respectively.

In some aspects, the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1610 and 1645, respectively; b) SEQ ID NOs: 1614 and 1649, respectively; c) SEQ ID NOs: 1616 and 1651, respectively; d) SEQ ID NOs: 1621 and 1656, respectively; e) SEQ ID NOs: 1622 and 1657, respectively; f) SEQ ID NOs: 1623 and 1658, respectively; g) SEQ ID NOs: 1629 and 1664, respectively; h) SEQ ID NOs: 1630 and 1665, respectively; i) SEQ ID NOs: 1634 and 1669, respectively; j) SEQ ID NOs: 1635 and 1670, respectively; k) SEQ ID NOs: 1636 and 1671, respectively; l) SEQ ID NOs: 1637 and 1638, respectively. NO: 1640 and 1675; and m) are SEQ ID NO: 1682 and 1656 respectively.

In some aspects, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1623 and 1658, respectively; b) SEQ ID NOs: 1630 and 1665, respectively; c) SEQ ID NOs: 1634 and 1669, respectively; d) SEQ ID NOs: 1621 and 1656, respectively; e) SEQ ID NOs: 1640 and 1675, respectively; and f) SEQ ID NOs: 1682 and 1656, respectively.

In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1623 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1658. In some forms, free stock packages Contains the nucleotide sequence as shown in SEQ ID NO:1630, and the antisense strand includes the nucleotide sequence as shown in SEQ ID NO:1665. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1634 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1669. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1621 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1656. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1640 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1676. In some aspects, the sense strand includes the nucleotide sequence set forth in SEQ ID NO:1682 and the antisense strand includes the nucleotide sequence set forth in SEQ ID NO:1656.

。 In some forms, the right shares include 5'-[mCs][mA][fG][mC][fA][mG][mU][fG][mA][fU][mU][fG][ fA][mA][fG][mU][fA][mU][mC][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ The sequence and all modifications of ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1623), and the antisense strand contains 5 '-[Me Phosphonate-4O-mUs][fGs][fA][fU][fA][mC][fU][mU][mC][fA][mA][mU][mC][fA ][mC][fU][mG][mC][fU][mGs][mGs][mG]-3' (SEQ ID NO: 1658) sequence and all modifications, where mC, mA, mG, mU= 2'-OMe ribonucleoside; fA, fC, fG, fU=2'-F ribonucleoside; s=phosphorothioate, and where ademA-GalNAc=

.

。 In some forms, the right stock contains 5'-[mAs][mG][fA][mG][fC][mA][mA][fG][mU][fG][mA][fC][ fA][mA][fA][mU][fG][mU][mU][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ The sequence and all modifications of ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1630), and the antisense strand contains 5 '-[Me Phosphonate-4O-mUs][fAs][fA][fC][fA][mU][fU][mU][mG][fU][mC][mA][mC][fU ][mU][fG][mC][mU][fC][mUs][mGs][mG]-3' (SEQ ID NO: 1665) sequence and all modifications, where mC, mA, mG, mU= 2'-OMe ribonucleoside; fA, fC, fG, fU=2'-F ribonucleoside; s=phosphorothioate, and where ademA-GalNAc=

.

。 In some forms, the right shares include 5'-[mAs][mG][fU][mC][fA][mU][mG][fA] [mC][fA][mU][fU][ fU][mC][fU][mC][fA][mA][mA][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ The sequence and all modifications of ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1634), and the antisense strand contains 5 '-[Me Phosphonate-4O-mUs][fUs][fU][fU][fG][mA][fG][mA][mA][fA][mU][mG][mU][fC ][mA][fU][mG][mA][fC][mUs][mGs][mG]-3' (SEQ ID NO: 1669) sequence and all modifications, where mC, mA, mG, mU= 2'-OMe ribonucleoside; fA, fC, fG, fU=2'-F ribonucleoside; s=phosphorothioate, and where ademA-GalNAc=

.

。 In some forms, the right shares include 5'-[mCs][mA][fG][mU][fC][mA][mU][fG][mA][fC][mA][fU][ fU][mU][fC][mU][fC][mA][mA][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ The sequence and all modifications of ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1621), and the antisense strand contains 5 '-[Me Phosphonate-4O-mUs][fUs][fU][fG][fA][mG][fA][mA][mA][fU][mG][mU][mC][fA ][mU][fG][mA][mC][fU][mGs][mGs][mG]-3' (SEQ ID NO: 1656) sequence and all modifications, where mC, mA, mG, mU= 2'-OMe ribonucleoside; fA, fC, fG, fU=2'-F ribonucleoside; s=phosphorothioate, and where ademA-GalNAc=

.

。 In some forms, the right stock contains 5'-[mAs][mG][fU][mU][fG][mU][mU][fA][mG][fU][mG][fA][ fU][mU][fU][mG][fC][mU][mA][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ The sequence and all modifications of ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1640), and the antisense strand contains 5 '-[Me Phosphonate-4O-mUs][fUs][fA][fG][fC][mA][fA][mA][mU][fC][mA][mC][mU][fA ][mA][fC][mA][mA][fC][mUs][mGs][mG]-3' (SEQ ID NO: 1675) sequence and all modifications, where mC, mA, mG, mU= 2'-OMe ribonucleoside; fA, fC, fG, fU=2'-F ribonucleoside; s=phosphorothioate, and where ademA-GalNAc=

.

。 In some versions, the sense stock contains 5'-[ademCs-C ₁₆ ][mA][fG][mU][fC][mA] [mU][fG][mA][fC][mA][ The sequence and all modifications of fU][fU][mU][fC][mU][fC][mAs][mAs][mA]-3' (SEQ ID NO: 1682), and the antisense strand contains 5' -[Me Phosphonate-4O-mUs][fUs][fU][fG][fA][mG][fA][mA][mA][fU][mG][mU][mC][fA] The sequence and all modifications of [mU][fG][mA][mC][fU][mGs][mGs][mG]-3' (SEQ ID NO: 1656), where mC, mA, mG, mU=2 '-OMe ribonucleoside; fA, fC, fG, fU=2'-F ribonucleoside; s=phosphorothioate, and [ademCs-C ₁₆ ]=

.

In some embodiments, the present disclosure provides a pharmaceutical composition comprising the RNAi oligonucleotide described herein and a pharmaceutically acceptable carrier, delivery agent or formulation.

In other aspects, the present disclosure provides a method for treating an individual suffering from a disease, condition, or disorder associated with expression of an SNCA gene, comprising administering to the individual a therapeutically effective amount of an RNAi oligo as described herein. nucleotides or pharmaceutical compositions thereof, thereby treating the individual.

In other aspects, the present disclosure provides a method for delivering an oligonucleotide to a subject, the method comprising administering to the subject a pharmaceutical composition described herein.

In other aspects, the present disclosure provides a method for reducing SNCA gene expression in a cell, cell population, or individual, the method comprising the steps of: i. Conjugating the cell or cell population with an RNAi oligo as described herein contact with a nucleotide or pharmaceutical composition; or ii. administer to the individual an RNAi oligonucleotide or pharmaceutical composition described herein.

In some aspects, reducing SNCA gene expression comprises reducing the amount or level of SNCA mRNA, the amount or level of SNCA protein, or both. In some aspects, the individual has a disease, disorder, or condition associated with SNCA gene expression. In some aspects, the disease, disorder, or condition associated with SNCA expression is multiple system atrophy, dementia with Lewy bodies, or Parkinson's disease.

In any of the foregoing or related aspects, the RNAi oligonucleotide or pharmaceutical composition described herein, SNCA gene expression is reduced in tissues of one or more CNS regions, wherein the tissue is associated with Parkinson's disease. In some aspects, the tissue associated with Parkinson's disease is selected from: putamen, midbrain tegmentum, substantia nigra, pons, and medulla. In some aspects, SNCA gene expression is reduced in tissues of one or more CNS regions, wherein the tissue is associated with multiple system atrophy. In some aspects, the tissue associated with multiple system atrophy is selected from: caudate nucleus, putamen, midbrain tegmentum, substantia nigra, pons, cerebellar cortex, cerebellar white matter, medulla, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord. In some aspects, SNCA gene expression is decreased in one or more CNS regions selected from the group consisting of: cervical spinal cord, thoracic spinal cord, lumbar spinal cord, frontal cortex, temporal cortex, cerebellum, midbrain, occipital cortex, parietal cortex, hippocampus, caudate nucleus, thalamus, brain stem, motor cortex, globus alba, tegmentum, substantia nigra, pons, cerebellar white matter, and cerebellar dentate nucleus. In some aspects, SNCA gene expression is decreased in one or more CNS regions selected from the group consisting of cervical spinal cord, thoracic spinal cord, lumbar spinal cord, frontal cortex, temporal cortex, cerebellum, midbrain, occipital cortex, parietal cortex, hippocampus, caudate nucleus, thalamus, brain stem, motor cortex, globus pallidus, midbrain tegmentum, substantia nigra, pons, cerebellar white matter, cerebellar dentate nucleus, L1 dorsal root ganglion (DRG), L2 DRG, L3 DRG, L4 DRG, L5 DRG, L6 DRG, putamen, midbrain tegmentum, substantia nigra, pons, medulla, cerebellar cortex, and cerebellar white matter.

In any of the foregoing or related aspects, the RNAi oligonucleotide or pharmaceutical composition is administered in combination with a second composition or therapeutic agent.

In other aspects, the present disclosure provides the use of the RNAi oligonucleotide or pharmaceutical composition described herein for the manufacture of a medicament for treating a disease, disorder or condition associated with SNCA gene expression.

In other aspects, the present disclosure provides the RNAi oligonucleotide or pharmaceutical composition described herein, which is used or suitable for treating a disease, disorder or condition associated with SNCA gene expression.

In some aspects, the disclosure provides a kit comprising an RNAi oligonucleotide described herein, optionally a pharmaceutically acceptable carrier, and a package insert comprising instructions for administration to a subject suffering from a disease, disorder, or condition associated with SNCA gene expression.

In any of the foregoing or related aspects, the disease, disorder or condition associated with SNCA gene expression is multiple system atrophy, dementia with Lewy bodies and Parkinson's disease.

Figures 1A and 1B provide graphs depicting the percentage (%) of human SNCA mRNA remaining in the livers of mice exogenously expressing human SNCA after treatment with GalNAc-conjugated SNCA oligonucleotides (hydrodynamic injection model) . CD-1 mice were administered subcutaneously 3 mg/kg of the designated GalNAc-binding SNCA targeting oligonucleotides formulated in PBS. Three days after dosing, mice were hydrodynamically injected (HDI) with DNA plasmids encoding human SNCA . Human SNCA mRNA levels were determined in livers collected after 24 hours. Hs-Mf= construct is specific for human and monkey SNCA . Hs-Mf-Mm= construct is specific for human, monkey and mouse SNCA . SNCA-291 was used as a baseline control.

Figures 2A and 2B provide graphs depicting the dose response of GalNAc-conjugated SNCA oligonucleotides selected based on the inhibitory efficacy shown in Figures 1A-1B . The percentage (%) of SNCA mRNA remaining in liver tissue was measured in CD-1 HDI mice as described in Figures 1A-1B . The percentage (%) of mRNA remaining was determined in both groups after injection of 0.3 mg/kg, 1.0 mg/kg or 3 mg/kg of the indicated GalNAc-conjugated SNCA oligonucleotides, Figures 2A and 2B . Hs-Mf = constructs are specific for human and monkey SNCA . Hs-Mf-Mm = constructs are specific for human, monkey and mouse SNCA .

Figures 3A-3S provide graphs depicting the percentage (%) of non-human primate (NHP; Mf) SNCA mRNA remaining in the CNS of NHPs after treatment with GalNAc-conjugated SNCA targeting oligonucleotides. NHPs were dosed by intracisternal (icm) injection of 50 mg of the indicated GalNAc-conjugated SNCA targeting oligonucleotides formulated in artificial cerebrospinal fluid (aCSF) on study days 0 and 7. SNCA mRNA levels were determined relative to the percentage (%) of SNCA mRNA remaining in aCSF-treated animals. The central nervous tissues measured included the frontal cortex ( Figure 3A ), caudate nucleus ( Figure 3B ), hippocampus ( Figure 3C ), midbrain ( Figure 3D ), parietal cortex ( Figure 3E ), occipital cortex ( Figure 3F ), thalamus ( Figure 3G ), temporal cortex ( Figure 3H ), cerebellum ( Figure 3I ), brain stem ( Figure 3J ), cervical spinal cord ( Figure 3K ), thoracic spinal cord ( Figure 3L ), lumbar spinal cord ( Figure 3M ), L1 dorsal root ganglion (DRG) ( Figure 3N ), L2 DRG ( Figure 3O ), L3 DRG ( Figure 3P ), L4 DRG ( Figure 3Q ), L5 DRG ( Figure 3R ) and L6 DRG ( Figure 3S ). GaLXC = GalNAc-conjugated SNCA targeting oligonucleotide.

Figures 4A-4B provide graphs depicting the percentage (%) of non-human primate (NHP; Mf) SNCA mRNA remaining in NHP CNS tissues associated with Parkinson's disease ( Figure 4A ) and the concentration of oligonucleotides ( Figure 4B ). NHPs were administered intrathecally with aCSF or SNCA-B15 bound to _C16 lipids. Tissues were collected and analyzed 28 days after oligonucleotide administration.

Figures 5A-5B provide a depiction of the percentage (%) of non-human primate (NHP; Mf) SNCA mRNA remaining in NHP CNS tissue associated with multiple system atrophy ( Figure 5A ) and the concentration of oligonucleotides ( Figure 5B ) picture. NHPs were administered intrathecally aCSF or SNCA-B15 conjugated to _C16 lipids. Tissue was collected and analyzed 28 days after oligonucleotide administration.

Cross-references to related applications

This application claims priority under 35 U.S.C. § 119(e) over U.S. Provisional Application No. 63/364,639, filed on May 13, 2022, which is incorporated herein by reference in its entirety.

According to some aspects, the disclosure provides oligonucleotides that reduce SNCA gene expression in the CNS. In some embodiments, the oligonucleotides provided herein are designed to treat diseases associated with SNCA expression in the CNS. In other embodiments, the disclosure provides methods for treating diseases associated with SNCA expression by reducing SNCA gene expression in cells (e.g., cells of the CNS).

Oligonucleotide inhibitors of SNCA expression

The present disclosure provides, inter alia, oligonucleotides (eg, RNAi oligonucleotides) that inhibit SNCA gene expression. In some embodiments, the oligonucleotides that inhibit SNCA gene expression target SNCA mRNA.

SNCA target sequence

In some embodiments, oligonucleotides (eg, RNAi oligonucleotides) herein target a target sequence comprising SNCA mRNA. In some embodiments, oligonucleotides described herein target target sequences within the SNCA mRNA sequence.

In some embodiments, the oligonucleotides described herein correspond to a target sequence within the SNCA mRNA sequence. In some embodiments, an oligonucleotide or a portion, fragment or strand thereof (e.g., an antisense strand or guide strand of a ds RNAi oligonucleotide) binds or tethers to a target sequence comprising SNCA mRNA, thereby inhibiting SNCA gene expression.

In some embodiments, the oligonucleotide targets a SNCA target sequence for the purpose of inhibiting SNCA gene expression in vivo. In some embodiments, the amount or degree to which an oligonucleotide targeting a SNCA target sequence inhibits SNCA gene expression is correlated with the efficacy of the oligonucleotide. In some embodiments, the amount or degree to which an oligonucleotide targeting a SNCA target sequence inhibits SNCA gene expression is correlated with the amount or degree of therapeutic benefit in an individual or patient suffering from a disease, disorder or condition associated with SNCA gene expression being treated with the oligonucleotide.

By examining the nucleotide sequences of SNCA-encoding mRNAs, including those from a number of different species (e.g., humans, cynomolgus monkeys, and mice; see, e.g., Example 1), and as a result of in vitro and in vivo testing (see, e.g., Example 1) Example 2-5), certain nucleotide sequences of SNCA mRNA have been found to be more susceptible to oligonucleotide-based inhibition than other nucleotide sequences and can therefore be used as target sequences for the oligonucleotides herein. In some embodiments, the sense strand of an oligonucleotide (eg, an RNAi oligonucleotide) described herein includes an SNCA target sequence. In some embodiments, a portion or region of the sense strand of a ds oligonucleotide described herein includes an SNCA target sequence. In some embodiments, the SNCA target sequence comprises or consists of the nucleotide sequence of any of SEQ ID NOs: 1683-2066. In some embodiments, the SNCA target sequence includes SEQ ID Nos: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, 1784, The nucleotide sequence of or consisting of any of 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973 and 1978. In some embodiments, the SNCA target sequence comprises or consists of the nucleotide sequence of any of SEQ ID Nos: 1798, 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864, and 1955. composition. In some embodiments, the SNCA target sequence comprises or consists of the nucleotide sequence of any of SEQ ID NOs: 1865, 1721, 1847, 1846, and 1955. In some embodiments, the SNCA target sequence includes the nucleotide sequence set forth in SEQ ID NO: 1865. In some embodiments, the SNCA target sequence includes the nucleotide sequence set forth in SEQ ID NO: 1721. In some embodiments, the SNCA target sequence includes the nucleotide sequence set forth in SEQ ID NO: 1847. In some embodiments, the SNCA target sequence includes the nucleotide sequence set forth in SEQ ID NO: 1846. In some embodiments, the SNCA target sequence includes the nucleotide sequence set forth in SEQ ID NO:1955.

SNCA targeting sequence

In some embodiments, the oligonucleotides herein have a complementary region to the SNCA mRNA (e.g., within a target sequence of the SNCA mRNA) for the purpose of targeting the mRNA in a cell and inhibiting its expression. In some embodiments, the oligonucleotides comprise a SNCA targeting sequence (e.g., the antisense strand or guide strand of a ds oligonucleotide) having a complementary region that binds or tethers to the SNCA target sequence by complementary (Watson-Crick) base pairing. The targeting sequence or complementary region generally has a suitable length and base content to enable the oligonucleotide (or its strand) to bind or tether to the SNCA mRNA for the purpose of inhibiting its expression. In some embodiments, the length of the targeting sequence or complementary region is at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 nucleotides. In some embodiments, the targeting sequence or complementary region is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides. In some embodiments, the length of the targeting sequence or complementary region is about 12 to about 30 (e.g., 12 to 30, 12 to 22, 15 to 25, 17 to 21, 18 to 27, 19 to 27, or 15 to 30) nucleotides. In some embodiments, the length of the targeting sequence or complementary region is about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the targeting sequence or complementary region is 18 nucleotides. In some embodiments, the length of the targeting sequence or complementary region is 19 nucleotides. In some embodiments, the length of the targeting sequence or complementary region is 20 nucleotides. In some embodiments, the length of the targeting sequence or complementary region is 21 nucleotides. In some embodiments, the length of the targeting sequence or complementary region is 22 nucleotides. In some embodiments, the length of the targeting sequence or complementary region is 23 nucleotides. In some embodiments, the length of the targeting sequence or complementary region is 24 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the sequence of any one of SEQ ID NOs: 1683-2066, and the length of the targeting sequence or complementary region is 18 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the sequence of any one of SEQ ID NOs: 1683-2066, and the length of the targeting sequence or complementary region is 19 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the sequence of any one of SEQ ID NOs: 1-384, and the length of the targeting sequence or complementary region is 20 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the sequence of any one of SEQ ID NOs: 1-384, and the length of the targeting sequence or complementary region is 21 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the sequence of any one of SEQ ID NOs: 1-384, and the length of the targeting sequence or complementary region is 22 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the sequence of any one of SEQ ID NOs: 1-384, and the length of the targeting sequence or complementary region is 23 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is complementary to the sequence of any one of SEQ ID NOs: 1-384, and the targeting sequence or the complementary region is 24 nucleotides in length.

In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the SNCA target sequence (e.g., the antisense strand or guide strand of a ds oligonucleotide). In some embodiments, the targeting sequence or complementary region is partially complementary to the SNCA target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is fully complementary to the sequence of any one of SEQ ID NOs: 1683-2066. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is partially complementary to the sequence of any one of SEQ ID NOs: 1683-2066. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is completely complementary to the sequence of any one of SEQ ID NOs: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973, and 1978. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a portion of the sequence of any one of SEQ ID NOs: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973, and 1978. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is fully complementary to the sequence of any one of SEQ ID NOs: 1798, 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864, and 1955. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to the sequence of any one of SEQ ID NOs: 1798, 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864, and 1955. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is fully complementary to the sequence of any one of SEQ ID NOs: 1865, 1721, 1847, 1846, and 1955. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to the sequence of any one of SEQ ID NOs: 1865, 1721, 1847, 1846, and 1955. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 1865. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 1721. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 1847. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 1846. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is fully complementary to the sequence set forth in SEQ ID NO: 1955. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to the sequence of any one of SEQ ID NO: 1865. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to the sequence of SEQ ID NO: 1721. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to the sequence of SEQ ID NO: 1847. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to the sequence of SEQ ID NO: 1846. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is partially complementary to the sequence of SEQ ID NO:1955.

In some embodiments, the oligonucleotides herein comprise a targeting sequence or a complementary region that is complementary to a contiguous nucleotide sequence comprising SNCA mRNA, wherein the contiguous nucleotide sequence is about 12 to about 30 nucleotides in length (e.g., 12 to 30, 12 to 28, 12 to 26, 12 to 24, 12 to 20, 12 to 18, 12 to 16, 14 to 22, 16 to 20, 18 to 20, or 18 to 19 nucleotides in length). In some embodiments, the oligonucleotides comprise a targeting sequence or a complementary region that is complementary to a contiguous nucleotide sequence comprising SNCA mRNA, wherein the contiguous nucleotide sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is complementary to a contiguous nucleotide sequence comprising SNCA mRNA, wherein the contiguous nucleotide sequence is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is complementary to a contiguous nucleotide sequence comprising SNCA mRNA, wherein the contiguous nucleotide sequence is 20 nucleotides in length.

In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is complementary to a contiguous nucleotide sequence of any one of SEQ ID NOs: 1683-2066, optionally wherein the contiguous nucleotide sequence is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to a contiguous nucleotide sequence of any one of SEQ ID NOs: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973, and 1978, optionally wherein the contiguous nucleotide sequence is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is complementary to a contiguous nucleotide sequence of any one of SEQ ID NOs: 1798, 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864, and 1955, where the length of the contiguous nucleotide sequence is 19 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or a complementary region that is complementary to a contiguous nucleotide sequence of SEQ ID NOs: 1865, 1721, 1847, 1846, and 1955, where the length of the contiguous nucleotide sequence is 19 nucleotides.

In some embodiments, the targeting sequence or complementary region of the oligonucleotide (e.g., RNAi oligonucleotide) is complementary to the contiguous nucleotide sequence set forth in any of SEQ ID NOs: 1683-2066 and Spanning the entire length of the antisense strand. In some embodiments, the targeting sequence or complementary region of the oligonucleotide is complementary to a contiguous nucleotide sequence as set forth in any of SEQ ID NOs: 1683-2066 and spans a portion of the entire length of the antisense strand . In some embodiments, the oligonucleotide comprises at least part of (e.g., completely) a contiguous stretch of nucleotides spanning nucleotides 1-20 of the sequence set forth in any of SEQ ID NOs: 1683-2066 Complementary complementary regions (e.g., on the antisense strand of a ds oligonucleotide). In some embodiments, the targeting sequence or complementary region of the oligonucleotide is complementary to the contiguous nucleotide sequence set forth in any of SEQ ID NOs: 1-384 and spans the entire length of the antisense strand. In some embodiments, the complementary region of the oligonucleotide is The contiguous nucleotide sequence as shown in any of SEQ ID NOs: 1-384 is complementary and spans a portion of the entire length of the antisense strand. In some embodiments, the oligonucleotide comprises at least part of (e.g., completely) a contiguous stretch of nucleotides spanning nucleotides 1 to 19 of the sequence set forth in any of SEQ ID NOs: 1-384 Complementary complementary regions (e.g., on the antisense strand of a ds oligonucleotide).

In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that has one or more base pair (bp) mismatches with a corresponding SNCA target sequence. In some embodiments, the targeting sequence or complementary region may have at most about 1, at most about 2, at most about 3, at most about 4, at most about 5, etc. mismatches with a corresponding SNCA target sequence, provided that the ability of the targeting sequence or complementary region to bind or attach to SNCA mRNA under appropriate hybridization conditions and/or the ability of the oligonucleotide to inhibit SNCA gene expression is maintained. Alternatively, in some embodiments, the targeting sequence or complementary region comprises no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding SNCA target sequence, provided that the ability of the targeting sequence or complementary region to bind or adhere to SNCA mRNA under appropriate hybridization conditions and/or the ability of the oligonucleotide to inhibit SNCA gene expression is maintained. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that has 1 mismatch with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that has 2 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that has 3 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that has 4 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region having 5 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region having more than one mismatch (e.g., 2, 3, 4, 5 or more mismatches) with the corresponding target sequence, wherein at least 2 (e.g., all) mismatches are located consecutively (e.g., 2, 3, 4, 5 or more mismatches in a row), or wherein the mismatches are dispersed at any position throughout the targeting sequence or complementary region. In some embodiments, an oligonucleotide comprises a targeting sequence or complementary region that has more than one mismatch (e.g., 2, 3, 4, 5 or more mismatches) with a corresponding target sequence, wherein at least 2 (e.g., all) of the mismatches are located consecutively (e.g., 2, 3, 4, 5 or more mismatches consecutively), or wherein at least one or more non-mismatched base pairs are located between the mismatches, or a combination thereof.

In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of any of SEQ ID NOs: 1683-2066, wherein the targeting sequence or complementary region can be identical to the corresponding SNCA The target sequence has at most about 1, at most about 2, at most about 3, at most about 4, at most about 5, etc. mismatches. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of any of SEQ ID NOs: 1683-2066, wherein the targeting sequence or complementary region can be identical to the corresponding SNCA The target sequence has no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches. In some embodiments, the oligonucleotides comprise SEQ ID NOs: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, A targeting sequence complementary to the continuous nucleotide sequence of any one of 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973 and 1978, or Complementary regions, wherein the targeting sequence or complementary region may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding SNCA target sequence. In some embodiments, the oligonucleotides comprise SEQ ID NOs: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, A targeting sequence complementary to the continuous nucleotide sequence of any one of 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973 and 1978, or Complementary regions, wherein the targeting sequence or complementary region may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding SNCA target sequence. In some embodiments, the oligonucleotide comprises the contiguous nucleotide sequence of any of SEQ ID NOs: 1798, 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864, and 1955 Complementary targeting sequence or complementary region, wherein the targeting sequence or complementary region may have at most about 1, at most about 2, at most about 3, at most about 4, at most about 5, etc. mismatches with the corresponding SNCA target sequence . In some embodiments, the oligonucleotide comprises the contiguous nucleotide sequence of any of SEQ ID NOs: 1798, 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864, and 1955 Complementary targeting sequence or complementary region, wherein the targeting sequence or complementary region may have no more than 1, no more than 2, no more than 3, no more than 4 or no more than the corresponding SNCA target sequence 5 mismatches. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of any of SEQ ID NOs: 1865, 1721, 1847, 1846, and 1955, wherein the targeting sequence or The complementary region may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding SNCA target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of any of SEQ ID NOs: 1865, 1721, 1847, 1846, and 1955, wherein the targeting sequence or The complementary region may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding SNCA target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1865, wherein the targeting sequence or complementary region may have up to about 1 nucleotide sequence with the corresponding SNCA target sequence. , at most about 2, at most about 3, at most about 4, at most about 5 mismatches, etc. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1865, wherein the targeting sequence or complementary region may have no more than 1 nucleotide sequence similarity with the corresponding SNCA target sequence. , no more than 2, no more than 3, no more than 4 or no more than 5 mismatches. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1721, wherein the targeting sequence or complementary region may have up to about 1 nucleotide sequence with the corresponding SNCA target sequence. , at most about 2, at most about 3, at most about 4, at most about 5 mismatches, etc. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1721, wherein the targeting sequence or complementary region may have no more than 1 nucleotide sequence similarity with the corresponding SNCA target sequence. , no more than 2, no more than 3, no more than 4 or no more than 5 mismatches. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1847, wherein the targeting sequence or complementary region may have up to about 1 nucleotide sequence with the corresponding SNCA target sequence. , at most about 2, at most about 3, at most about 4, at most about 5 mismatches, etc. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1847, wherein the targeting sequence or complementary region may have no more than 1 nucleotide sequence similarity with the corresponding SNCA target sequence. , no more than 2, no more than 3, no more than 4 or no more than 5 mismatches. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1846, wherein the targeting sequence or complementary region may have up to about 1 nucleotide sequence with the corresponding SNCA target sequence. , at most about 2, at most about 3, at most about 4, at most about 5 mismatches, etc. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1846, wherein the targeting sequence or complementary region may have no more than 1 nucleotide sequence similarity with the corresponding SNCA target sequence. , no more than 2, no more than 3, no more than 4 or no more than 5 mismatches. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1955, wherein the targeting sequence or complementary region may have up to about 1 nucleotide sequence with the corresponding SNCA target sequence. , at most about 2, at most about 3, at most about 4, at most about 5 mismatches, etc. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of SEQ ID NO: 1955, wherein the targeting sequence or complementary region may have no more than 1 nucleotide sequence similarity with the corresponding SNCA target sequence. , no more than 2, no more than 3, no more than 4 or no more than 5 mismatches.

Types of Oligonucleotides

A variety of oligonucleotide types and/or structures can be used to target SNCA mRNA in the methods herein, including but not limited to RNAi oligonucleotides, antisense oligonucleotides, miRNA, etc. Any type of oligonucleotide described herein or elsewhere is contemplated for use as a framework for incorporating the SNCA mRNA targeting sequences herein for the purpose of inhibiting SNCA gene expression.

In some embodiments, oligonucleotides herein inhibit SNCA gene expression by participating in the RNA interference (RNAi) pathway upstream or downstream of Dicer involvement (eg, RNAi oligonucleotides). For example, RNAi oligonucleotides have been developed in which each strand has a size of about 19 to about 25 nucleotides with at least one 3' overhang of about 1 to about 5 nucleotides (see, e.g., U.S. Patent No. No. 8,372,968). Longer oligonucleotides have also been developed that are processed by Dicer to produce active RNAi products (see, eg, US Pat. No. 8,883,996). Further work resulted in extended ds oligonucleotides in which at least one end of at least one strand extends beyond the duplex targeting region, including structures in which one strand includes a thermodynamically stable tetracyclic structure (see, e.g., U.S. Pat. Nos. 8,513,207 and No. 8,927,705, and International Patent Application Publication No. WO 2010/033225). Such structures may include single-strand (ss) extensions (on one or both sides of the molecule) as well as ds extensions.

In some embodiments, the oligonucleotide participates in the RNAi pathway downstream of Dicer involvement (e.g., Dicer cleavage). In some embodiments, the oligonucleotide has an overhang (e.g., 1, 2, or 3 nucleotides in length) at the 3' end of the sense strand. In some embodiments, the oligonucleotide (e.g., siRNA) comprises a 21 nucleotide antisense strand that is antisense to a target mRNA (e.g., SNCA mRNA) and a complementary passenger sense strand, wherein the two strands are fused to form a 19-bp duplex and a 2 nucleotide overhang at either or both 3' ends. Longer oligonucleotide designs are also contemplated, including oligonucleotides having a 23-nucleotide antisense strand and a 21-nucleotide passenger strand, where there is a blunt end on the right side of the molecule (3' sense strand/5' antisense strand) and a two-nucleotide 3' antisense strand overhang on the left side of the molecule (5' sense strand/3' antisense strand). In such molecules, there is a 21-bp duplex region. See, e.g., U.S. Patents Nos. 9,012,138, 9,012,621, and 9,193,753.

In some embodiments, the oligonucleotides herein comprise a sense strand and an antisense strand both ranging from about 17 to about 36 (e.g., 17 to 26, 20 to 25, or 21-23) nucleotides in length. In some embodiments, the oligonucleotides comprise an antisense strand of 19-30 nucleotides in length and a sense strand of 19-50 nucleotides in length, wherein the antisense strand and the sense strand are separate strands forming an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3' end of the antisense strand. In some embodiments, the oligonucleotides comprise a sense strand and an antisense strand both ranging from about 19 to about 22 nucleotides in length. In some embodiments, the sense strand and the antisense strand are equal in length. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand such that there is a 3' overhang on either or both the sense strand and the antisense strand. In some embodiments, the 3' overhang on the sense strand, the antisense strand, or both strands is 1 or 2 nucleotides in length for oligonucleotides having a sense strand and an antisense strand each ranging from about 21-23 nucleotides in length. In some embodiments, the oligonucleotide has an antisense strand of 22 nucleotides and a sense strand of 20 nucleotides, with a blunt end on the right side of the molecule (3' end of sense strand/5' end of antisense strand) and a 3' antisense strand overhang of 2 nucleotides on the left side of the molecule (5' end of sense strand/3' end of antisense strand). In such molecules, there is a 20-bp duplex region.

Other oligonucleotide designs for use in the compositions and methods herein include: 16-mer siRNA (see, e.g., NUCLEIC ACIDS IN CHEMISTRY AND BIOLOGY, Blackburn (ed.), Royal Society of Chemistry, 2006), shRNA (e.g., having a stem of 19 bp or less; see, e.g., Moore et al. (2010) METHODS MOL. BIOL. 629: 141-58), blunt siRNA (e.g., 19 bp in length; see, e.g., Kraynack and Baker (2006) RNA 12: 163-76), asymmetric siRNA (aiRNA; see, e.g., Sun et al. (2008) Nat. Biotechnol. 26: 1379-82), asymmetric shorter duplex siRNA (see, e.g., Chang et al. (2009) Mol. Ther. 17:725-732), forked siRNA (see, e.g., Hohjoh (2004) FEBS Lett. 557:193-98), single-stranded siRNA (Elsner (2012) Nat. Biotechnol. 30:1063), dumbbell-shaped loop siRNA (see, e.g., Abe et al. (2007) J. Am. Chem. Soc. 129:15108-09), and small internal segmented interfering RNA (siRNA; see, e.g., Bramsen et al. (2007) Nucleic Acids Res. 35:5886-97). Other non-limiting examples of oligonucleotide designs that can be used to reduce or inhibit SNCA gene expression in some embodiments are microRNA (miRNA), short hairpin RNA (shRNA), and short siRNA (see, e.g., Hamilton et al. (2002) EMBO J. 21:4671-79; see also U.S. Patent Application Publication No. 2009/0099115).

In addition, in some embodiments, the oligonucleotide used herein to reduce or inhibit SNCA gene expression is ss. Such structures may include, but are not limited to, ss RNAi molecules. Recent efforts have demonstrated the activity of ss RNAi molecules (see, e.g., Matsui et al. (2016) Mol. Ther. 24: 946-955). However, in some embodiments, the oligonucleotide is an antisense oligonucleotide (ASO). An antisense oligonucleotide is an ss oligonucleotide having a nucleobase sequence, and when written or depicted in the 5' to 3' direction, the nucleobase sequence comprises a reverse complement of a targeting segment of a specific nucleic acid and is appropriately modified (e.g., as a gapmer) to induce RNaseH-mediated cleavage of its target RNA in a cell or (e.g., as a mixmer) to inhibit the translation of a target mRNA in a cell. The ASOs used herein can be modified in any suitable manner known in the art, including, for example, as shown in U.S. Patent No. 9,567,587 (including, for example, changes in length, sugar moieties of nucleobases (pyrimidines, purines), and heterocyclic moieties of nucleobases). In addition, ASOs have been used for decades to reduce the expression of specific target genes (see, for example, Bennett et al. (2017) Annu. Rev. Pharmacol. 57: 81-105).

In some embodiments, the antisense oligonucleotide (ASO) shares a complementary region with the SNCA mRNA. In some embodiments, the ASO targets various regions of human SNCA identified as NM_000345.3. In some embodiments, the ASO is about 15 to about 50 nucleotides in length. In some embodiments, the ASO is 15-25 nucleotides in length. In some embodiments, the ASO is 22 nucleotides in length. In some embodiments, the ASO is complementary to any one of SEQ ID NOs: 1683-2066. In some embodiments, the ASO is at least 15 consecutive nucleotides in length. In some embodiments, the ASO is at least 19 consecutive nucleotides in length. In some embodiments, the ASO is at least 20 consecutive nucleotides in length. In some embodiments, the ASO differs from the target sequence by 1, 2, or 3 nucleotides.

Double-stranded RNAi oligonucleotides

In some aspects, the present disclosure provides ds RNAi oligonucleotides for targeting SNCA mRNA and inhibiting SNCA gene expression (e.g., via an RNAi pathway), such oligonucleotides comprising a sense strand (herein Also known as pass-through stocks) and anti-contra stocks (also known as leading stocks in this article). In some embodiments, the sense and antisense shares are separate shares and are not covalently linked. In some embodiments, the sense strand and antisense strand are covalently linked. In some embodiments, the sense and antisense strands form a duplex region in which the sense and antisense strands, or portions thereof, bind to each other in a complementary manner (e.g., via Watson-Crick base pairing) .

In some embodiments, the sense strand has a first region (R1) and a second region (R2), wherein R2 includes a first subregion (S1), a loop (L) (such as a tetraL ring (tetraL) or a tricyclic ring (R2)). triL)) and the second subregion (S2), which L is located between S1 and S2, and S1 and S2 form the second duplex (D2). D2 can be of various lengths. In some embodiments, D2 is about 1 to about 6 bp in length. In some embodiments, D2 is 2-6, 3-6, 4-6, 5-6, 1-5, 2-5, 3-5 or 4-5 bp in length. In some embodiments, D2 is 1, 2, 3, 4, 5, or 6 bp in length. In some embodiments, D2 is 6 bp in length.

In some embodiments, R1 of the sense strand and the antisense strand form a first duplex (D1). In some embodiments, the length of D1 is at least about 15 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides. In some embodiments, the length of D1 is in the range of about 12 to about 30 nucleotides (e.g., 12 to 30, 12 to 27, 15 to 22, 18 to 22, 18 to 25, 18 to 27, 18 to 30, or 21 to 30 nucleotides). In some embodiments, the length of D1 is at least 12 nucleotides (e.g., at least 12, at least 15, at least 20, at least 25, or at least 30 nucleotides in length). In some embodiments, D1 is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, D1 is 19 nucleotides in length. In some embodiments, D1 is 20 nucleotides in length. In some embodiments, D1 comprising a sense strand and an antisense strand does not span the entire length of the sense strand and/or the antisense strand. In some embodiments, D1 comprising a sense strand and an antisense strand spans the entire length of either or both of the sense strand or the antisense strand. In some embodiments, D1 comprising a sense strand and an antisense strand spans the entire length of both the sense strand or the antisense strand.

In some embodiments, the sense strand is 36 nucleotides in length and positions are numbered 1-36 from 5' to 3'. In some embodiments, the antisense strand is 22 nucleotides in length and positions are numbered 1-22 from 5' to 3'. In some embodiments, the position numbering described herein follows this numbering format.

In some embodiments, the oligonucleotide comprises a sense strand having the sequence of any of SEQ ID NOs: 1-384 and an antisense comprising the complementary sequence of any of SEQ ID NOs: 385-768 share. In some embodiments, the oligonucleotide comprises a sense strand having the sequence of SEQ ID NOs: 1683-2066 and an antisense strand comprising the complementary sequence of any of SEQ ID NOs: 2067-2450.

In some embodiments, the oligonucleotide comprises a sense strand having the sequence of any of SEQ ID NOs: 1537-1571 and an antisense comprising the complementary sequence of any of SEQ ID NOs: 1572-1606 share. In some embodiments, the oligonucleotide comprises a sense strand having the sequence of any of SEQ ID NOs: 1537-1571 and 1681 and a complement of the sequence of any of SEQ ID NOs: 1572-1606. Antisense stocks.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1537 and 1572, respectively; b) SEQ ID NOs: 1538 and 1573, respectively; c) SEQ ID NOs: 1539 and 1574, respectively; d) SEQ ID NOs: 1540 and 1575, respectively; e) SEQ ID NOs: 1541 and 1576, respectively; f) SEQ ID NOs: 1542 and 1577, respectively; g) SEQ ID NOs: 1543 and 1578, respectively; h) SEQ ID NOs: 1544 and 1579, respectively; i) SEQ ID NOs: 1545 and 1580, respectively; j) SEQ ID NOs: 1546 and 1581, respectively; k) SEQ ID NOs: 1547 and 1582, respectively; l) SEQ ID NOs: 1548 and 1583, respectively. NO: 1548 and 1583; m) are SEQ ID NO: 1549 and 1584; n) are SEQ ID NO: 1550 and 1585; o) are SEQ ID NO: 1551 and 1586; p) are SEQ ID NO: 1552 and 1587; q) are SEQ ID NO: 1553 and 1588; r) are SEQ ID NO: 1554 and 1589; s) are SEQ ID NO: 1555 and 1590; t) are SEQ ID NO: 1556 and 1591; u) are SEQ ID NO: 1557 and 1592; v) are SEQ ID NO: 1558 and 1593; w) are SEQ ID NO: 1559 and 1594; x) are SEQ ID NO: 1560 and 1595; y) are SEQ ID NO: 1561 and 1596; z) are SEQ ID NO: 1562 and 1597, respectively; aa) are SEQ ID NO: 1563 and 1598, respectively; bb) are SEQ ID NO: 1564 and 1599, respectively; cc) are SEQ ID NO: 1565 and 1600, respectively; dd) are SEQ ID NO: 1566 and 1601, respectively; ee) are SEQ ID NO: 1567 and 1602, respectively; ff) are SEQ ID NO: 1568 and 1603, respectively; gg) are SEQ ID NO: 1569 and 1604, respectively; hh) are SEQ ID NO: 1570 and 1605, respectively; ii) are SEQ ID NO: 1571 and 1606, respectively; and jj) are SEQ ID NO: 1681 and 1586, respectively.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from: a) SEQ ID NO: 1540 and 1575, respectively; b) SEQ ID NO: 1544 and 1579 respectively; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1552 and 1587 respectively; f) SEQ ID NO: 1553 and 1588 respectively; g) SEQ ID NO: 1558 and 1594 respectively; h) SEQ ID NO: 1560 and 1595 respectively; i) SEQ ID NO: 1564 and 1599 respectively; j) SEQ ID NO: 1565 and 1600 respectively; k) SEQ ID NO: 1566 and 1601 respectively; l) SEQ ID NO: 1566 and 1601 respectively; SEQ ID NO: 1570 and 1605; and m) are SEQ ID NO: 1681 and 1586 respectively.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from: a) SEQ ID NO: 1553 and 1588, respectively; b) SEQ ID NO: 1560 and 1595 respectively; c) SEQ ID NO: 1564 and 1599 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1570 and 1605 respectively; and f ) are SEQ ID NO: 1681 and 1586 respectively.

In some embodiments, the sense strand comprises the sequence of SEQ ID NO:1553 and the antisense strand comprises the sequence of SEQ ID NO:1588. In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1560 and the antisense strand comprises the sequence of SEQ ID NO: 1595. In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1564 and the antisense strand comprises the sequence of SEQ ID NO: 1599. In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1551 and the antisense strand comprises the sequence of SEQ ID NO: 1586. In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1570 and the antisense strand comprises The sequence of SEQ ID NO:1605. In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1681 and the antisense strand comprises the sequence of SEQ ID NO: 1586.

It will be appreciated that in some embodiments, reference may be made to the sequences presented in the sequence listing when describing the structure of an oligonucleotide (e.g., an RNAi oligonucleotide) or other nucleic acid. In such embodiments, the actual oligonucleotide or other nucleic acid may have one or more alternative nucleotides (e.g., RNA counterparts of DNA nucleotides or DNA counterparts of RNA nucleotides) and/or one or more modified nucleotides and/or one or more modified internucleotide linkages and/or one or more other modifications when compared to the specified sequence, while retaining complementary properties that are substantially identical or similar to the specified sequence.

In some embodiments, the RNAi oligonucleotides herein comprise a 25 nucleotide sense strand and a 27 nucleotide antisense strand that, when acted upon by Dicer, produces an antisense strand that is incorporated into the mature RNA-induced silencing complex (RISC). In some embodiments, the 25 nucleotide sense strand comprises a sequence selected from SEQ ID NOs: 1-384. In some embodiments, the 27 nucleotide antisense strand comprises a sequence selected from SEQ ID NOs: 385-768. In some embodiments, the sense strand is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides). In some embodiments, the sense strand is longer than 25 nucleotides (e.g., 26, 27, 28, 29, or 30 nucleotides). In some embodiments, the sense strand comprises a nucleotide sequence selected from SEQ ID NOs: 1683-2066, wherein the nucleotide sequence is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides). In some embodiments, the sense strand comprises a nucleotide sequence selected from SEQ ID NOs: 1683-2066, wherein the nucleotide sequence is longer than 25 nucleotides (e.g., 26, 27, 28, 29, or 30 nucleotides).

In some embodiments, the oligonucleotide has a 5' end that is thermodynamically less stable when compared to the other 5' end. In some embodiments, an asymmetric RNAi oligonucleotide is provided that comprises a blunt end at the 3' end of the sense strand and a 3' overhang at the 3' end of the antisense strand. In some embodiments, the 3' overhang on the antisense strand is about 1 to about 8 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length). Typically, the oligonucleotide has a two nucleotide overhang at the 3' end of the antisense strand. However, other overhangs are possible. In some embodiments, the overhang is a 3' overhang comprising a length of between 1 and 6 nucleotides, optionally 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 6, 3 to 5, 3 to 4, 4 to 6, 4 to 5, 5 to 6 nucleotides, or 1, 2, 3, 4, 5 or 6 nucleotides. In other embodiments, the overhang is a 5' overhang having a length between 1 and 6 nucleotides, optionally 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 6, 3 to 5, 3 to 4, 4 to 6, 4 to 5, 5 to 6 nucleotides, or 1, 2, 3, 4, 5 or 6 nucleotides.

In some embodiments, the two terminal nucleotides on the 3' end of the antisense strand are modified. In some embodiments, the two terminal nucleotides on the 3' end of the antisense strand are complementary to the target mRNA (eg, SNCA mRNA). In some embodiments, the two terminal nucleotides on the 3' end of the antisense strand are not complementary to the target mRNA. In some embodiments, the two terminal nucleotides on the 3' end of the antisense strand of the oligonucleotide are unpaired. In some embodiments, the two terminal nucleotides on the 3' end of the antisense strand of the oligonucleotide comprise unpaired GG. In some embodiments, the two terminal nucleotides on the 3' end of the antisense strand of the oligonucleotide are not complementary to the target mRNA. In some embodiments, the two terminal nucleotides on each 3' end of the oligonucleotide are GG. Typically, one or both of the two terminal GG nucleotides on the 3' end of each ds oligonucleotide are not complementary to the target mRNA. In some embodiments, the two terminal nucleotides on each 3' end of the oligonucleotide are GG. In some embodiments, one or both of the two terminal GG nucleotides on each 3' end of the oligonucleotide are not complementary to the target mRNA. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of any of SEQ ID NOs: 2067-2045, wherein 3 of the antisense strands of the oligonucleotide The two terminal nucleotides on the ' end contain unpaired GG. In some embodiments, the oligonucleotide comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NO: 2067-2450, wherein the antisense strand of the oligonucleotide The two terminal nucleotides on the 3' end of the strand contain unpaired GG. In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NO: 1683-2066; and an antisense strand comprising a nucleotide sequence selected from SEQ ID NO: 1683-2066 : A nucleotide sequence of 2067-2450, in which the two terminal nucleotides on the 3' end of the antisense strand of the oligonucleotide contain unpaired GG.

In some embodiments, there are one or more (eg, 1, 2, 3, 4, or 5) mismatches between the sense and antisense strands making up the oligonucleotides herein. If there is more than one mismatch between the sense and antisense strands, they may be located in a row (eg, 2, 3, or more in a row), or may be scattered throughout the complementary region. In some embodiments, the 3' end of the sense strand contains one or more mismatches. In one embodiment, two mismatches are incorporated at the 3' end of the sense strand. In some embodiments, base mismatching or destabilization of the 3' end of the sense strand of an oligonucleotide improves or increases the potency of the oligonucleotide.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from: a) SEQ ID NO: 1537 and 1572, respectively; b) SEQ ID NO: 1538 and 1573 respectively; c) SEQ ID NO: 1539 and 1574 respectively; d) SEQ ID NO: 1540 and 1575 respectively; e) SEQ ID NO: 1541 and 1576 respectively; f) are SEQ ID NO: 1542 and 1577 respectively; g) are SEQ ID NO: 1543 and 1578 respectively; h) are SEQ ID NO: 1544 and 1579 respectively; i) are SEQ ID NO: 1545 and 1580 respectively; j) are respectively SEQ ID NO: 1546 and 1581; k) SEQ ID NO: 1547 and 1582 respectively; l) SEQ ID NO: 1548 and 1583 respectively; m) are SEQ ID NO: 1549 and 1584 respectively; n) are SEQ ID NO: 1550 and 1585 respectively; o) are SEQ ID NO: 1551 and 1586 respectively; p) are SEQ ID NO: 1552 and 1587 respectively; q) SEQ ID NO: 1553 and 1588 respectively; r) SEQ ID NO: 1554 and 1589 respectively; s) SEQ ID NO: 1555 and 1590 respectively; t) SEQ ID NO: 1556 and 1591 respectively; u) respectively SEQ ID NO: 1557 and 1592; v) are SEQ ID NO: 1558 and 1593 respectively; w) are SEQ ID NO: 1559 and 1594 respectively; x) are SEQ ID NO: 1560 and 1595 respectively; y) are SEQ ID NO respectively NO: 1561 and 1596; z) are SEQ ID NO: 1562 and 1597 respectively; aa) are SEQ ID NO: 1563 and 1598 respectively; bb) are SEQ ID NO: 1564 and 1599 respectively; cc) are SEQ ID NO: 1565 and 1600; dd) are SEQ ID NO: 1566 and 1601 respectively; ee) are SEQ ID NO: 1567 and 1602 respectively; ff) are SEQ ID NO: 1568 and 1603 respectively; gg) are SEQ ID NO: 1569 and 1602 respectively. 1604; hh) are SEQ ID NO: 1570 and 1605 respectively; ii) are SEQ ID NO: 1571 and 1606 respectively; and jj) are SEQ ID NO: 1681 and 1586 respectively, There are one or more (eg, 1, 2, 3, 4 or 5) mismatches between the sense shares and the antisense shares.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from: a) SEQ ID NO: 1540 and 1575, respectively; b) SEQ ID NO: 1544 and 1579 respectively; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1552 and 1587 respectively; f) SEQ ID NO: 1553 and 1588 respectively; g) SEQ ID NO: 1558 and 1594 respectively; h) SEQ ID NO: 1560 and 1595 respectively; i) SEQ ID NO: 1564 and 1599 respectively; j) SEQ ID NO: 1564 and 1599 respectively; SEQ ID NO: 1565 and 1600; k) are SEQ ID NO: 1566 and 1601 respectively; l) are SEQ ID NO: 1570 and 1605 respectively; and m) are SEQ ID NO: 1681 and 1586 respectively, among which in the free shares There is one or more (eg, 1, 2, 3, 4 or 5) mismatches with the antisense stock.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand comprising sequences selected from: a) SEQ ID NO: 1553 and 1588, respectively; b) respectively are SEQ ID NO: 1560 and 1595; c) are SEQ ID NO: 1564 and 1599 respectively; d) are SEQ ID NO: 1551 and 1586 respectively; e) are SEQ ID NO: 1570 and 1605 respectively; and f) SEQ ID NOs: 1681 and 1586, respectively, in which there are one or more (eg, 1, 2, 3, 4 or 5) mismatches between the sense and antisense shares.

Antonymous stock

In some embodiments, the antisense strand of the oligonucleotide, termed the "guide strand," engages the RISC and binds to an Argonaute protein, such as Ago2, or engages or binds to one or more similar factors and directs the target gene of silence. In some embodiments, sense shares that are complementary to antisense shares are referred to as "passenger shares."

In some embodiments, the oligonucleotides comprise up to about 50 nucleotides in length (e.g., up to 50, up to 40, up to 35, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, up to 15 or up to 12 nucleotides) antisense strands. In some embodiments, the oligonucleotide comprises at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 22, at least 25, at least 27, at least 30, at least 35 or at least 38 nucleotides) antisense strands. In some embodiments, the antisense strands are from about 12 to about 40 strands in length (e.g., 12 to 40 strands, 12 to 36 strands, 12 to 32 strands, 12 to 28 strands, 15 to 40 strands, 15 to 36 strands). , 15 to 32, 15 to 30, 15 to 28, 17 to 22, 17 to 25, 19 to 27, 19 to 30, 20 to 40, 22 to 40, 25 to 40 or 32 to 40) nucleotides. In some embodiments, the oligonucleotide comprises antisense that is 15 to 30 nucleotides in length. In some embodiments, the length of the antisense strand of any of the oligonucleotides disclosed herein is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides. In some embodiments, the antisense strand is 22 nucleotides in length.

In some embodiments, the antisense strand comprises or consists of the sequence set forth in any of SEQ ID NOs: 1683-2066. In some embodiments, the antisense strands comprise at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 , at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotide sequences as shown in any one of SEQ ID NOs: 2067-2450. In some embodiments, the antisense strand comprises or consists of the sequence set forth in any of SEQ ID NOs: 385-768. In some embodiments, the antisense strands comprise at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotide sequences as shown in any one of SEQ ID NOs: 385-768. In some embodiments, the antisense strand comprises or consists of the sequence set forth in any of SEQ ID NOs: 1572-1606. In some embodiments, the antisense strands comprise at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotide sequences as shown in any one of SEQ ID NOs: 1572-1606. In some embodiments, the antisense strand comprises or consists of the sequence set forth in any of SEQ ID NOs: 2067-2450. In some embodiments, the antisense strands comprise at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotide sequences as shown in any one of SEQ ID NOs: 2067-2450. In some embodiments, the antisense strand comprises a sequence set forth in any of SEQ ID NOs: 1575, 1579, 1581, 1586, 1587, 1588, 1594, 1595, 1599, 1600, 1601, 1605, and 1586, or consists of. In some embodiments, the antisense strands comprise at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23) as any one of SEQ ID NO: 1575, 1579, 1581, 1586, 1587, 1588, 1594, 1595, 1599, 1600, 1601, 1605 and 1586 The contiguous nucleotide sequence is shown. In some embodiments, the antisense strand comprises or consists of the sequence set forth in any of SEQ ID NOs: 1588, 1595, 1599, 1586, and 1605. In some embodiments, the antisense strands comprise at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, to less than 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23) such as any one of SEQ ID NO: 1588, 1595, 1599, 1586 and 1605 The continuous nucleotide sequence shown.

Righteous shares

In some embodiments, the oligonucleotide comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 1683-2066. In some embodiments, the sense strand comprises at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotide sequences as set forth in any one of SEQ ID NOs: 1683-2066. In some embodiments, the sense strand comprises a sequence as set forth in any one of SEQ ID NOs: 1-384. In some embodiments, the sense strand comprises at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotide sequences as set forth in any one of SEQ ID NOs: 1-384. In some embodiments, the sense strand comprises a sequence as set forth in any one of SEQ ID NOs: 1537-1571. In some embodiments, the sense strand comprises a sequence as set forth in any one of SEQ ID NOs: 1537-1571 and 1681. In some embodiments, the sense strand is SEQ ID NO: 1681. In some embodiments, the sense strand comprises at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotide sequences as set forth in any one of SEQ ID NOs: 1537-1571. In some embodiments, the sense strand comprises a sequence as set forth in any one of SEQ ID NOs: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973, and 1978. In some embodiments, the sense strand comprises at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) sequences of SEQ ID NO: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973 and 1978. In some embodiments, the sense strand comprises a sequence as set forth in any one of SEQ ID NOs: 1540, 1544, 1546, 1551, 1552, 1553, 1558, 1560, 1564, 1565, 1566, and 1570. In some embodiments, the sense strand comprises at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotide sequences as set forth in any one of SEQ ID NOs: 1540, 1544, 1546, 1551, 1552, 1553, 1558, 1560, 1564, 1565, 1566, and 1570. In some embodiments, the sense strand comprises a sequence as set forth in any one of SEQ ID NOs: 1553, 1560, 1564, 1551, and 1570. In some embodiments, the sense strand comprises at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotide sequences as set forth in any one of SEQ ID NOs: 1553, 1560, 1564, 1551, and 1570.

In some embodiments, the oligonucleotide comprises an oligonucleotide as set forth in any of SEQ ID NOs: 1540, 1544, 1546, 1551, 1552, 1553, 1558, 1560, 1564, 1565, 1566, 1570, and 1681 Loyal stock sequence. In some embodiments, the shares comprise at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23) as shown in any one of SEQ ID NOs: 1540, 1544, 1546, 1551, 1552, 1553, 1558, 1560, 1564, 1565, 1566, 1570 and 1681 Nucleotide sequence. In some embodiments, the sense strand includes the sequence set forth in any of SEQ ID NOs: 1553, 1560, 1564, 1551, 1570, and 1681. In some embodiments, the shares comprise at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23) as any of SEQ ID NO: 1553, 1560, 1564, 1551, 1570 and 1681 The continuous nucleotide sequence shown in one.

In some embodiments, the sense strand is up to about 50 nucleotides in length (e.g., up to 50, up to 40, up to 36, up to 30, up to 27, up to 25, up to 21 in length). , up to 19, up to 17 or up to 12 nucleotides). In some embodiments, the sense strand is at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30 nucleotides in length). , at least 36 or at least 38 nucleotides). In some embodiments, the length of the sense strands is from about 12 to about 50 (e.g., 12 to 50, 12 to 40, 12 to 36, 12 to 32, 12 to 28, 15 to 40 , 15 to 36, 15 to 32, 15 to 28, 17 to 21, 17 to 25, 19 to 27, 19 to 30, 20 to 40, 22 to 40, 25 to 40 or 32 to 40) nucleotides. In some embodiments, the sense strand is 15 to 50 nucleotides in length. In some embodiments, the sense strand is 18 to 36 nucleotides in length. In some embodiments, the length of the sense strands is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. In some embodiments, the sense strand is 36 nucleotides in length.

In some embodiments, the sense strand comprises a stem-loop structure at its 3' end. In some embodiments, the stem-loop is formed by base pairing within the strand. In some embodiments, the sense strand comprises a stem-loop structure at its 5' end. In some embodiments, the stem of the stem-loop comprises a duplex of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 2 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 3 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 4 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 5 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 6 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 7 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 8 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 9 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 10 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 11 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 12 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 13 nucleotides in length. In some embodiments, the stem of the stem loop comprises a duplex of 14 nucleotides in length.

In some embodiments, the stem-loop provides protection of the oligonucleotide against degradation (e.g., enzymatic degradation), facilitates or improves targeting and/or delivery to target cells, tissues, or organs (e.g., liver or brain), or Both. For example, in some embodiments, a stem-loop loop provides a nucleotide comprising one or more modifications that promote, improve, or increase targeting of a target mRNA (e.g., SNCA mRNA), Inhibition of gene expression (eg, SNCA gene expression) and/or delivery to target cells, tissues, or organs (eg, CNS), or combinations thereof. In some embodiments, the stem loop itself or modifications to the stem loop do not substantially affect the inherent gene expression inhibiting activity of the oligonucleotide, but promote, improve, or increase stability (e.g., provide protection against degradation) and/or Delivery of oligonucleotides to target cells, tissues or organs (eg, CNS). In certain embodiments, the oligonucleotide comprises a sense strand comprising (e.g., at its 3' end) a stem-loop as follows: S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a single-stranded loop between S1 and S2 that is up to about 10 nucleotides in length (eg, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length). In some embodiments, loop (L) is 3 nucleotides in length (eg, tricyclic or triL). In some embodiments, loop (L) is 4 nucleotides in length (eg, tetraloop or tetraL). In some embodiments, loop (L) is 5 nucleotides in length (eg, pentaloop or pentaL). In some embodiments, loop (L) is 6 nucleotides in length (eg, hexaloop or hexaL). In some embodiments, loop (L) is 7 nucleotides in length (eg, heptaL or heptaL). In some embodiments, loop (L) is 8 nucleotides in length (eg, octaloop or octaL). In some embodiments, loop (L) is 9 nucleotides in length (eg, nonaL or nonaL). In some embodiments, loop (L) is 10 nucleotides in length (eg, decaL or decaL).

In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of any one of SEQ ID NOs: 1683-2066, and the oligonucleotide comprises a sense strand comprising (e.g., at its 3' end) a stem-loop as follows: S1-L-S2, wherein S1 and S2 are complementary, and wherein L forms an ss loop of up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length) between S1 and S2. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region that is complementary to the contiguous nucleotide sequence of any one of SEQ ID NOs: 1683-2066, and the oligonucleotide comprises a sense strand that comprises (e.g., at its 3' end) a stem-loop as follows: S1-L-S2, wherein S1 and S2 complement each other, and wherein L forms an ss loop of 4 nucleotides in length between S1 and S2. In some embodiments, the loop (L) of the stem-loop having the structure S1-L-S2 as described above is a tetraL as described in U.S. Patent No. 10,131,912 (e.g., within a nicked tetraloop structure), which is incorporated herein by reference. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region complementary to a contiguous nucleotide sequence of any one of SEQ ID NOs: 1683-2066 and tetraL. In some aspects, the tetraloop comprises the sequence 5'-GAAA-3'. In some aspects, the stem loop comprises the sequence 5'-GCAGCCGAAAGGCUGC-3' (SEQ ID NO: 1680).

In other embodiments, loop (L) is triL. In some embodiments, the oligonucleotide comprises a targeting sequence or complementary region complementary to a contiguous nucleotide sequence of any one of SEQ ID NOs: 1683-2066 and triL. In some embodiments, triL comprises ribonucleotides, deoxyribonucleotides, modified nucleotides, delivery ligands, and combinations thereof.

Double chain length

In some embodiments, the length of the duplex formed between the sense strand and the antisense strand is at least about 12 strands (e.g., at least 15 strands, at least 16 strands, at least 17 strands, at least 18 strands, at least 19 strands). , at least 20 or at least 21) nucleotides. In some embodiments, the length of the duplex ranges from about 12 to about 30 nucleotides (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25 nucleotides in length). , 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30 or 21 to 30 nucleotides). In some embodiments, the length of the duplex is 12, 13, 14, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 Nucleotides. In some embodiments, the duplex is 12 nucleotides in length. In some embodiments, the duplex is 13 nucleotides in length. In some embodiments, the duplex is 14 nucleotides in length. In some embodiments, the duplex is 15 nucleotides in length. In some embodiments, the duplex is 16 nucleotides in length. In some embodiments, the duplex is 17 nucleotides in length. In some embodiments, the duplex is 18 nucleotides in length. In some embodiments, the duplex is 19 nucleotides in length. In some embodiments, the duplex is 20 nucleotides in length. In some embodiments, the duplex is 21 nucleotides in length. In some embodiments, the duplex is 22 nucleotides in length. In some embodiments, the duplex is 23 nucleotides in length. In some embodiments, the duplex formed is 24 nucleotides in length. In some embodiments, the duplex is 25 nucleotides in length. In some embodiments, the duplex is 26 nucleotides in length. In some embodiments, the duplex is 27 nucleotides in length. In some embodiments, the duplex is 28 nucleotides in length. In some embodiments, the duplex is 29 nucleotides in length. In some embodiments, the duplex is 30 nucleotides in length. In some embodiments, the duplex does not span the entire length of the sense strand and/or antisense strand. In some embodiments, the duplex spans the entire length of either the sense or antisense strand. In some embodiments, the duplex spans the entire length of both the sense and antisense strands.

In some embodiments, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1537 and 1572, respectively; b) SEQ ID NO: 1538 and 1573, respectively; c) are SEQ ID NO: 1539 and 1574 respectively; d) are SEQ ID NO: 1540 and 1575 respectively; e) SEQ ID NO: 1541 and 1576 respectively; f) SEQ ID NO: 1542 and 1577 respectively; g) SEQ ID NO: 1543 and 1578 respectively; h) SEQ ID NO: 1544 and 1579 respectively; i) SEQ ID NO: 1545 and 1580 respectively; j) SEQ ID NO: 1546 and 1581 respectively; k) SEQ ID NO: 1547 and 1582 respectively; l) SEQ ID NO: 1548 and 1583 respectively; m) SEQ ID NO: 1548 and 1583 respectively; SEQ ID NO: 1549 and 1584; n) SEQ ID NO: 1550 and 1585 respectively; o) SEQ ID NO: 1551 and 1586 respectively; p) SEQ ID NO: 1552 and 1587 respectively; q) SEQ ID NO: 1552 and 1587 respectively; q) SEQ ID NO: 1551 and 1586 respectively; NO: 1553 and 1588; r) are SEQ ID NO: 1554 and 1589 respectively; s) are SEQ ID NO: 1555 and 1590 respectively; t) are SEQ ID NO: 1556 and 1591 respectively; u) are SEQ ID NO: 1557 and 1592; v) are SEQ ID NO: 1558 and 1593 respectively; w) are SEQ ID NO: 1559 and 1594 respectively; x) are SEQ ID NO: 1560 and 1595 respectively; y) are SEQ ID NO: 1561 and 1594 respectively. 1596; z) are SEQ ID NO: 1562 and 1597 respectively; aa) are SEQ ID NO: 1563 and 1598 respectively; bb) are SEQ ID NO: 1564 and 1599 respectively; cc) are SEQ ID NO: 1565 and 1600 respectively; dd) are SEQ ID NO: 1566 and 1601 respectively; ee) are SEQ ID NO: 1567 and 1602 respectively; ff) are SEQ ID NO: 1568 and 1603 respectively; gg) SEQ ID NO: 1569 and 1604 respectively; hh) SEQ ID NO: 1570 and 1605 respectively; ii) SEQ ID NO: 1571 and 1606 respectively; and jj) SEQ ID NO: 1681 and 1586 respectively, wherein The length of the duplex formed between the sense and antisense strands ranges from about 12 to about 30 nucleotides (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30 or 21 to 30 nucleotides).

In some embodiments, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1540 and 1575, respectively; b) SEQ ID NO: 1544 and 1579, respectively; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1552 and 1587 respectively; f) SEQ ID NO: 1553 and 1588 respectively; g) SEQ ID NO: 1558 and 1594 respectively; h) SEQ ID NO: 1560 and 1595 respectively; i) SEQ ID NO: 1564 and 1599 respectively; j) SEQ ID NO: 1565 and 1600 respectively; k) are SEQ ID NO: 1566 and 1601 respectively; l) are SEQ ID NO: 1570 and 1605 respectively; and m) are SEQ ID NO: 1681 and 1586 respectively, in which the sense shares and the antisense shares are formed. The length of the duplex ranges from about 12 to about 30 nucleotides (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30 or 21 to 30 nucleotides).

In some embodiments, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1570 and 1605, respectively; and f) SEQ ID NOs: 1571 and 1606, respectively. NO: 1681 and 1586, wherein the length of the duplex formed between the sense strand and the antisense strand is in the range of about 12 to about 30 nucleotides (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30, or 21 to 30 nucleotides in length).

oligonucleotide termini

In some embodiments, an oligonucleotide (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand, wherein the ends of either or both strands comprise a blunt end. In some embodiments, an oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are independent strands forming an asymmetric duplex region, wherein the duplex region has an overhang at the 3' end of the antisense strand. In some embodiments, an oligonucleotide comprises a sense strand and an antisense strand, wherein the ends of either or both strands comprise an overhang comprising one or more nucleotides. In some embodiments, one or more nucleotides constituting the overhang are unpaired nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 3' end of the sense strand and the 5' end of the antisense strand comprise a blunt end. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the 5' end of the sense strand and the 3' end of the antisense strand comprise blunt ends.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the 3' end of either or both strands comprises a 3' overhang comprising one or more nucleotides. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand comprises a 3' overhang comprising one or more nucleotides. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 3' overhang comprising one or more nucleotides. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein both the sense strand and the antisense strand comprise a 3' overhang comprising one or more nucleotides.

In some embodiments, the 3' overhang is about 1 to about 20 nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 in length , 13, 14, 15, 16, 17, 18, 19 or about 20 nucleotides). In some embodiments, the length of the 3' overhang is about 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3 or 1 to 2 nucleotides. In some embodiments, the 3' overhang is 1 nucleotide in length. In some embodiments, the 3' overhang is 2 nucleotides in length. In some embodiments, the 3' overhang is 3 nucleotides in length. In some embodiments, the 3' overhang is 4 nucleotides in length. In some embodiments, the 3' overhang is 5 nucleotides in length. In some embodiments, the 3' overhang is 6 nucleotides in length. In some embodiments, the 3' overhang is 7 nucleotides in length. In some embodiments, the 3' overhang is 8 nucleotides in length. In some embodiments, the 3' overhang is 9 nucleotides in length. In some embodiments, the 3' overhang is 10 nucleotides in length. In some embodiments, the 3' overhang is 11 nucleotides in length. In some embodiments, the 3' overhang is 12 nucleotides in length. In some embodiments, the length of the 3' overhang is 13 nucleotides. In some embodiments, the 3' overhang is 14 nucleotides in length. In some embodiments, the 3' overhang is 15 nucleotides in length. In some embodiments, the 3' overhang is 16 nucleotides in length. In some embodiments, the 3' overhang is 17 nucleotides in length. In some embodiments, the 3' overhang is 18 nucleotides in length. In some embodiments, the 3' overhang is 19 nucleotides in length. In some embodiments, the 3' overhang is 20 nucleotides in length.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NO, respectively: 1537 and 1572; b) SEQ ID NO: 1538 and 1573 respectively; c) SEQ ID NO: 1539 and 1574 respectively; d) SEQ ID NO: 1540 and 1575 respectively; e) SEQ ID NO: 1541 and 1574 respectively. 1576; f) SEQ ID NO: 1542 and 1577 respectively; g) SEQ ID NO: 1543 and 1578 respectively; h) SEQ ID NO: 1544 and 1579 respectively; i) SEQ ID NO: 1545 and 1580 respectively; j) SEQ ID NO: 1546 and 1581 respectively; k) SEQ ID NO: 1547 and 1582 respectively; l) SEQ ID NO: 1548 and 1583 respectively; m) SEQ ID NO: 1549 and 1584 respectively; n) SEQ ID NO: 1550 and 1585 respectively; o) SEQ ID NO: 1551 and 1586 respectively; p) SEQ ID NO: 1552 and 1587 respectively; q) SEQ ID NO: 1553 and 1588 respectively; r) are SEQ ID NO: 1554 and 1589 respectively; s) are SEQ ID NO: 1555 and 1590 respectively; t) are SEQ ID NO: 1556 and 1591 respectively; u) are SEQ ID NO: 1557 and 1592 respectively; v) SEQ ID NO: 1558 and 1593 respectively; w) SEQ ID NO: 1559 and 1594 respectively; x) SEQ ID NO: 1560 and 1595 respectively; y) SEQ ID NO: 1561 and 1596 respectively; z) SEQ ID NO: 1561 and 1596 respectively; SEQ ID NO: 1562 and 1597; aa) are SEQ ID NO: 1563 and 1598, respectively; bb) are SEQ ID NO: 1564 and 1599, respectively; cc) are SEQ ID NO: 1565 and 1600, respectively; dd) are SEQ ID NO: 1565 and 1600, respectively. NO: 1566 and 1601; ee) are SEQ ID NO: 1567 and 1602 respectively; ff) are SEQ ID NO: 1568 and 1603 respectively; gg) are SEQ ID NO: 1569 and 1604 respectively; hh) are SEQ ID NO: 1570 and 1605; ii) SEQ ID NOs: 1571 and 1606, respectively; and jj) SEQ ID NOs: 1681 and 1586, respectively, wherein the antisense strand comprises from about 1 to about 20 nucleotides in length (e.g., in length 3' overhang of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides) , optionally where the 3' overhang is 2 nucleotides in length.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NO: 1540 and 1575, respectively; b) SEQ ID NO: 1544 and 1579, respectively; c) SEQ ID NO: 1546 and 1581, respectively; d) SEQ ID NO: 1551 and 1586, respectively; e) SEQ ID NO: 1552 and 1587, respectively; f) SEQ ID NO: 1553 and 1588, respectively; g) SEQ ID NO: 1558 and 1594, respectively; h) SEQ ID NO: 1560 and 1595, respectively; i) SEQ ID NO: 1564 and 1599, respectively; j) SEQ ID NO: 1565 and 1600, respectively; k) SEQ ID NO: 1566 and 1601, respectively. NO: 1566 and 1601; l) are SEQ ID NO: 1570 and 1605, respectively; and m) are SEQ ID NO: 1681 and 1586, respectively, and wherein the antisense strand comprises a 3' overhang of about 1 to about 20 nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or about 20 nucleotides in length), optionally wherein the 3' overhang is 2 nucleotides in length.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1570 and 1605, respectively; and f) SEQ ID NOs: 1571 and 1606, respectively. NO: 1681 and 1586, wherein the antisense strand comprises a 3' overhang of about 1 to about 20 nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or about 20 nucleotides in length), optionally wherein the 3' overhang is 2 nucleotides in length.

In some embodiments, the oligonucleotide includes a sense strand and an antisense strand, wherein the sense strand includes a 5' overhang containing one or more nucleotides.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1540 and 1575, respectively; b) SEQ ID NOs: 1544 and 1579, respectively; c) SEQ ID NOs: 1546 and 1581, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1552 and 1587, respectively; f) SEQ ID NOs: 1553 and 1588, respectively; g) SEQ ID NOs: 1558 and 1594, respectively; h) SEQ ID NOs: 1560 and 1595, respectively; i) SEQ ID NOs: 1564 and 1599, respectively; j) SEQ ID NOs: 1565 and 1600, respectively; k) SEQ ID NOs: 1566 and 1601, respectively. NO: 1566 and 1601; l) are SEQ ID NO: 1570 and 1605, respectively; and m) are SEQ ID NO: 1681 and 1586, respectively, wherein the antisense strand comprises a 5' overhang of about 1 to about 20 nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or about 20 nucleotides in length), optionally wherein the 5' overhang is 2 nucleotides in length.

In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1570 and 1605, respectively; and f) SEQ ID NOs: 1564 and 1599, respectively. NO: 1681 and 1586, wherein the antisense strand comprises a 5' overhang of about 1 to about 20 nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or about 20 nucleotides in length), optionally wherein the 5' overhang is 2 nucleotides in length.

In some embodiments, one or more (e.g., 2, 3, 4, 5 or more) nucleotides at the 3' end or 5' end of the sense strand and/or antisense strand are modified. For example, in some embodiments, one or both terminal nucleotides at the 3' end of the antisense strand are modified. In some embodiments, the last nucleotide at the 3' end of the antisense strand is modified (e.g., comprises a 2' modification, such as 2'-O-methoxyethyl). In some embodiments, the last one or two terminal nucleotides at the 3' end of the antisense strand are complementary to the target. In some embodiments, the last one or two nucleotides at the 3' end of the antisense strand are not complementary to the target.

In some embodiments, the oligonucleotide includes a sense strand and an antisense strand, wherein the 3' end of the sense strand includes a stem loop as described herein and the 3' end of the antisense strand includes a 3' overhang. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand forming a nicked tetraL structure, wherein the 3' end of the sense strand comprises a stem loop, wherein loop (L) is tetraL as described herein , and wherein the 3' end of the antisense strand includes a 3' overhang as described herein. In some embodiments, the 3' overhang is 2 nucleotides in length. In some embodiments, both nucleotides forming the 3' overhang comprise guanine (G) nucleobases. Typically, one or both of the nucleotides making up the 3' overhang of the antisense strand are not complementary to the target mRNA.

Oligonucleotide modification

In some embodiments, the oligonucleotide comprises a modification. Oligonucleotides (e.g., RNAi oligonucleotides) can be modified in various ways to improve or control specificity, stability, delivery, bioavailability, resistance to nuclease degradation, immunogenicity, base pairing properties, RNA distribution and cellular uptake, and other characteristics relevant to therapeutic research uses.

In some embodiments, the modification is a modified sugar. In some embodiments, the modification is a 5' terminal phosphate group. In some embodiments, the modification is a modified internucleoside linkage. In some embodiments, the modification is a modified base. In some embodiments, the modification is a reversible modification. In some embodiments, an oligonucleotide may comprise any one of the modifications described herein or any combination thereof. For example, in some embodiments, an oligonucleotide comprises at least one modified sugar, a 5' terminal phosphate group, at least one modified internucleoside linkage, at least one modified base, and at least one reversible modification.

In some embodiments, an oligonucleotide comprises at least one modified sugar, a 5' terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base. In some embodiments, the sense strand and antisense strand of the oligonucleotide comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1537 and 1572, respectively; b) SEQ ID NOs: 1538 and 1573, respectively; c) SEQ ID NOs: 1539 and 1574, respectively; d) SEQ ID NOs: 1540 and 1575, respectively; e) SEQ ID NOs: 1541 and 1576, respectively; f) SEQ ID NOs: 1542 and 1577, respectively; g) SEQ ID NOs: 1543 and 1578, respectively; h) SEQ ID NOs: 1544 and 1579, respectively; i) SEQ ID NOs: 1545 and 1580, respectively; j) SEQ ID NOs: 1546 and 1581, respectively; k) SEQ ID NOs: 1547 and 1582, respectively; l) SEQ ID NO: 1548 and 1583; m) are SEQ ID NO: 1549 and 1584, respectively; n) are SEQ ID NO: 1550 and 1585, respectively; o) are SEQ ID NO: 1551 and 1586, respectively; p) are SEQ ID NO: 1552 and 1587, respectively; q) are SEQ ID NO: 1553 and 1588, respectively; r) are SEQ ID NO: 1554 and 1589, respectively; s) are SEQ ID NO: 1555 and 1590, respectively; t) are SEQ ID NO: 1556 and 1591, respectively; u) are SEQ ID NO: 1557 and 1592, respectively; v) are SEQ ID NO: 1558 and 1593, respectively; w) are SEQ ID NO: 1559 and 1594, respectively; x) are SEQ ID NO: 1560 and 1595, respectively; y) are SEQ ID NO: 1561 and 1596, respectively. NO: 1561 and 1596; z) are SEQ ID NO: 1562 and 1597, respectively; aa) are SEQ ID NO: 1563 and 1598, respectively; bb) are SEQ ID NO: 1564 and 1599, respectively; cc) are SEQ ID NO: 1565 and 1600, respectively; dd) are SEQ ID NO: 1566 and 1601, respectively; ee) are SEQ ID NO: 1567 and 1602, respectively; ff) are SEQ ID NO: 1568 and 1603, respectively; gg) are SEQ ID NO: 1569 and 1604, respectively; hh) are SEQ ID NO: 1570 and 1605, respectively; ii) are SEQ ID NO: 1571 and 1606, respectively; and jj) are SEQ ID NO: 1681 and 1586, wherein the oligonucleotide comprises at least one modified sugar, a 5' terminal phosphate group, at least one modified internucleotide bond and at least one modified base.

In some embodiments, the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1540 and 1575, respectively; b) SEQ ID NOs: 1544 and 1579, respectively; c) SEQ ID NOs: 1546 and 1581, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1552 and 1587, respectively; f) SEQ ID NOs: 1553 and 1588, respectively; g) SEQ ID NOs: 1558 and 1594, respectively; h) SEQ ID NOs: 1560 and 1595, respectively; i) SEQ ID NOs: 1564 and 1599, respectively; j) SEQ ID NOs: 1565 and 1600, respectively; k) SEQ ID NOs: 1566 and 1601, respectively; l) SEQ ID NOs: 1567 and 1603, respectively. NO: 1570 and 1605; and m) are SEQ ID NO: 1681 and 1586, respectively, wherein the oligonucleotide comprises at least one modified sugar, a 5' terminal phosphate group, at least one modified internucleotide bond and at least one modified base.

In some embodiments, the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1570 and 1605, respectively; and f) SEQ ID NOs: 1681 and 1586, respectively, wherein the oligonucleotide comprises at least one modified sugar, a 5' terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base.

The number of modifications on an oligonucleotide and the position of those nucleotide modifications may affect the properties of the oligonucleotide. For example, an oligonucleotide can be delivered in vivo by being included in a lipid nanoparticle (LNP) or a similar carrier. However, when an oligonucleotide is not protected by an LNP or a similar carrier, it may be advantageous for at least some nucleotides to be modified. Therefore, in some embodiments, all or substantially all nucleotides of an oligonucleotide are modified. In some embodiments, more than half of the nucleotides are modified. In some embodiments, less than half of the nucleotides are modified. In some embodiments, the sugar moieties of all nucleotides constituting an oligonucleotide are modified at the 2' position. Modifications may be reversible or irreversible. In some embodiments, the oligonucleotide has a sufficient number and type of modified nucleotides to promote desired characteristics (e.g., protection from enzymatic degradation, ability to target desired cells after in vivo administration, and/or thermodynamic stability).

Sugar Decoration

In some embodiments, the oligonucleotide comprises a modified sugar. In some embodiments, the modified sugar (also referred to herein as a sugar analog) comprises a modified deoxyribose or ribose moiety, for example, wherein one or more modifications occur at the 2', 3', 4' and/or 5' carbon position of the sugar. In some embodiments, the modified sugar may also include non-natural alternative carbon structures, such as those found in locked nucleic acids ("LNAs"; see, e.g., Koshkin et al. (1998) Tetrahedon 54:3607-30), unlocked nucleic acids ("UNAs"; see, e.g., Snead et al. (2013) Mol. Ther-Nucl. Acids 2:e103), and bridged nucleic acids ("BNAs"; see, e.g., Imanishi and Obika (2002) Chem Commun. (Camb) 21:1653-59).

In some embodiments, the nucleotide modification in the sugar includes a 2'-modification. In some embodiments, the 2'-modification can be 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-F, 2'-aminoethyl (EA), 2'-OMe, 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA) or 2'-deoxy-2'-fluoro-β-d-arabinonucleotide (2'-FANA). In some embodiments, the modification is 2'-F, 2'-OMe or 2'-MOE. In some embodiments, the modified sugar includes a modification of the sugar ring, which may include a modification of one or more carbons of the sugar ring. For example, modification of the sugar of a nucleotide may include the 2'-oxygen of the sugar being linked to the 1'-carbon or 4'-carbon of the sugar, or the 2'-oxygen being linked to the 1'-carbon or 4'-carbon via an ethylene or methylene bridge. In some embodiments, the modified nucleotide has an acyclic sugar lacking a 2'-carbon to 3'-carbon bond. In some embodiments, the modified nucleotide has a thiol group (e.g., at the 4'-position of the sugar).

In some embodiments, the oligonucleotide comprises at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30 , at least 35, at least 40, at least 45, at least 50, at least 55, at least 60 or more). In some embodiments, the sense strand of the oligonucleotide includes at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25 , at least 30, at least 35 or more). In some embodiments, the antisense strand of the oligonucleotide contains at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20 or more Piece).

In some embodiments, all nucleotides of the sense strand are modified. In some embodiments, all nucleotides of the antisense strand are modified. In some embodiments, all nucleotides (i.e., both the sense strand and the antisense strand) are modified. In some embodiments, the modified nucleotides include 2'-modifications (e.g., 2'-F or 2'-OMe, 2'-MOE, and 2'-deoxy-2'-fluoro-β-d-arabinonucleotides). In some embodiments, the modified nucleotides include 2'-modifications (e.g., 2'-F or 2'-OMe).

In some embodiments, the present disclosure provides oligonucleotides with different modification patterns. In some embodiments, the oligonucleotides include a sense strand sequence with a modification pattern as listed in the examples and sequence listing and an antisense strand with a modification pattern as listed in the examples and sequence listing.

In some embodiments, the oligonucleotides comprise antisense strands having 2'-F modified nucleotides. In other embodiments, the oligonucleotides comprise antisense strands having nucleotides modified with 2'-F and 2'-OMe. In some embodiments, the oligonucleotide comprises a sense strand having a 2'-F modified nucleotide. In other embodiments, the oligonucleotides comprise a sense strand having nucleotides modified with 2'-F and 2'-OMe.

In some embodiments, the oligonucleotide comprises a sense strand, wherein about 10% to about 15%, or 10%, 11%, 12%, 13%, 14%, or 15% of the nucleotides of the sense strand comprise a 2'-F modification. In some embodiments, the oligonucleotide comprises a sense strand, wherein about 18% to about 23%, or 18%, 19%, 20%, 21%, 22%, or 23% of the nucleotides comprise a 2'-F modification. In some embodiments, the oligonucleotide comprises a sense strand, wherein about 38% to about 43%, or 38%, 39%, 40%, 41%, 42%, or 43% of the nucleotides comprise a 2'-F modification. In some embodiments, about 11% of the nucleotides of the sense strand comprise a 2-F modification. In some embodiments, about 22% of the nucleotides of the sense strand comprise a 2-F modification. In some embodiments, about 40% of the nucleotides of the sense strand comprise a 2-F modification.

In some embodiments, the oligonucleotide comprises an antisense strand wherein about 25% to about 35% or 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides comprise a 2'-F modification. In some embodiments, about 32% of the nucleotides of the antisense strand comprise a 2'-F modification. In some embodiments, the oligonucleotide has about 15% to about 25% or 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25% of nucleotides comprising a 2'-F modification. In some embodiments, the oligonucleotide has about 35% to about 45% or 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, or 45% of nucleotides comprising a 2'-F modification. In some embodiments, about 19% of the nucleotides comprise a 2'-F modification. In some embodiments, about 29% of the nucleotides contain a 2'-F modification. In some embodiments, about 40% of the nucleotides contain a 2'-F modification.

In some embodiments, one or more of positions 8, 9, 10, or 11 of the 36-nucleotide sense strand is modified with a 2'-F group. In some embodiments, one or more of positions 8, 9, 10, or 11 of the sense strand comprising the stem loop is modified with a 2'-F group. In some embodiments, the sugar moiety at each of positions 1-7 and 12-20 of the 36-nucleotide sense strand is modified with 2'-OMe. In some embodiments, the sugar moiety at each of positions 1-7 and 12-20 of the sense strand comprising the stem loop is modified with 2'-OMe. In some embodiments, the sugar moiety at each of positions 1-7 and 12-36 in the sense strand is modified with 2'-OMe.

In some embodiments, one or more of positions 3, 5, 8, 10, 12, 13, 15, and 17 of the sense strand is modified with a 2'-F group.

In some embodiments, the antisense strand has 3 nucleotides modified with 2'-F at the 2'-position of the sugar moiety. In some embodiments, the sugar moieties at positions 2, 5, and 14 of the antisense strand and up to 3 nucleotides at positions 1, 3, 7, and 10, as appropriate, are modified with 2'-F. In some embodiments, the sugar moieties at positions 2, 5, and 14 of the antisense strand and up to 3 nucleotides at positions 3, 4, 7, and 10, as appropriate, are modified with 2'-F. In other embodiments, the sugar moieties at each of positions 2, 5, and 14 of the antisense strand are modified with 2'-F. In other embodiments, the sugar moieties at each of positions 1, 2, 5, and 14 of the antisense strand are modified with 2'-F. In other embodiments, the sugar moieties at each of positions 2, 4, 5, and 14 of the antisense strand are modified with 2'-F. In other embodiments, the sugar moiety at each of positions 1, 2, 3, 5, 7, and 14 of the antisense strand is modified with a 2'-F. In other embodiments, the sugar moiety at each of positions 2, 3, 4, 5, 7, and 14 of the antisense strand is modified with a 2'-F. In another embodiment, the sugar moiety at each of positions 1, 2, 3, 5, 10, and 14 of the antisense strand is modified with a 2'-F. In other embodiments, the sugar moiety at each of positions 2, 3, 4, 5, 10, and 14 of the antisense strand is modified with a 2'-F. In another embodiment, the sugar moiety at each of positions 2, 3, 5, 7, 10, and 14 of the antisense strand is modified with a 2'-F. In other embodiments, the sugar moiety at each of positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand that forms a duplex with the 36-nucleotide sense strand is 2'-F modified. In some embodiments, the sugar moiety at each of positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand that forms a duplex with the sense strand comprising a stem loop is 2'-F modified.

In some embodiments, the oligonucleotide comprises an antisense strand having at positions 2 and 14 sugar moieties modified with 2'-F. In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at positions 2, 5, and 14. In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at positions 1, 2, 5, and 14. In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at positions 2, 4, 5, and 14. In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at positions 1, 2, 3, 5, 7, and 14. In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at positions 2, 3, 4, 5, 7, and 14. In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at positions 1, 2, 3, 5, 10, and 14. In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at positions 2, 3, 4, 5, 10, and 14. In some embodiments, the oligonucleotide comprises a 36 nucleotide sense strand and an antisense strand, wherein the antisense strand comprises a 2' strand at positions 2, 3, 4, 5, 7, 10 and 14. -F modified sugar part. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand containing a stem loop, wherein the antisense strand comprises a 2'-F at positions 2, 3, 4, 5, 7, 10 and 14. Modified sugar part. In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at positions 2, 3, 4, 5, 7, 10, 14, 16, and 19.

In some embodiments, the oligonucleotide comprises an antisense strand having a sugar moiety modified with 2'-F at each nucleotide at positions 2, 5, and 14 and a sugar moiety modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA, and 2'-FANA at each remaining nucleotide of the antisense strand.

In some embodiments, the oligonucleotide comprises an antisense strand having a sugar moiety modified with 2'-F at each nucleotide at positions 1, 2, 5, and 14 and a sugar moiety modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA, and 2'-FANA at each remaining nucleotide of the antisense strand.

In some embodiments, the oligonucleotide comprises an antisense strand having at positions 2, 4, The sugar moiety of each nucleotide at positions 5 and 14 modified with 2'-F and each remaining nucleotide of the antisense strand with a sugar moiety modified by a modification selected from the group consisting of: 2'-O- Propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at each nucleotide at positions 1, 2, 3, 5, 7, and 14 and Each remaining nucleotide of the antisense strand is modified with a sugar moiety selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'- Ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises an antisense strand having a sugar moiety modified with 2'-F at each nucleotide at positions 2, 3, 4, 5, 7, and 14 and a sugar moiety modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA, and 2'-FANA at each remaining nucleotide of the antisense strand.

In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at each nucleotide at positions 1, 2, 3, 5, 10, and 14 and Each remaining nucleotide of the antisense strand is modified with a sugar moiety selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'- Ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises an antisense strand having a 2'-F modified sugar moiety at each nucleotide at positions 2, 3, 4, 5, 10, and 14 and Each remaining nucleotide of the antisense strand is modified with a sugar moiety selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'- Ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises an antisense strand having a sugar moiety modified with 2'-F at each nucleotide at positions 2, 3, 5, 7, 10, and 14 and a sugar moiety modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA, and 2'-FANA at each remaining nucleotide of the antisense strand.

In some embodiments, the oligonucleotide includes a 36 nucleotide sense strand and an antisense strand, wherein the antisense strand includes a 2'-F modified sugar moiety at positions 2, 3, 4, 5, 7, 10 and 14 and each remaining nucleotide of the antisense strand is selected from the group consisting of Modification: Modified sugar moiety: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'- O-NMA and 2'-FANA. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand containing a stem loop, wherein the antisense strand comprises a 2'-F at positions 2, 3, 4, 5, 7, 10 and 14. The modified sugar moiety and each remaining nucleotide of the antisense strand is modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amine base, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises an antisense strand having each nucleotide at positions 2, 3, 4, 5, 7, 10, 14, 16, and 19 followed by a 2'- The F-modified sugar moiety and each remaining nucleotide of the antisense strand is modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'- Amino, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises an antisense strand having at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10 , position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21 or position 22 modified sugar moiety with 2'-F.

In some embodiments, the oligonucleotide comprises an antisense strand having at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10 , position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21 or position 22 modified sugar moiety with 2'-OMe.

In some embodiments, the oligonucleotide comprises an antisense strand having at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10 , position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21 or position 22 sugar modified by a modification selected from the group consisting of Parts: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O- NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises a 36 nucleotide sense strand having a 2'-F modified sugar moiety at positions 8-11. In some embodiments, the oligonucleotide includes a sense strand that includes a stem loop and a 2'-F modified sugar moiety at positions 8-11. In some embodiments, the oligonucleotide comprises a 36 nucleotide sense strand having a 2'-OMe modified sugar moiety at positions 1-7 and 12-17 or 12-20. In some embodiments, the oligonucleotide comprises a sense strand comprising a stem loop and a 2'-OMe modified sugar moiety at positions 1-7 and 12-17 or 12-20. In some embodiments, the oligonucleotide comprises a 36 nucleotide sense strand having a 2'-OMe modification at positions 1-7 and 12-17, 12-20, or 12-22 The sugar part. In some embodiments, the oligonucleotide comprises a sense strand comprising a stem loop and a 2'-OMe modified sugar moiety at positions 1-7 and 12-17, 12-20 or 12-22 . In some embodiments, the oligonucleotide comprises a 36 nucleotide sense strand having each nucleotide at positions 1-7 and 12-17 or 12-20 of the sense strand A sugar moiety modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA. In some embodiments, the oligonucleotide includes a sense strand that includes a stem loop and has each nucleotide selected at positions 1-7 and 12-17 or 12-20 of the sense strand. Sugar moiety modified by modifications from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2'-OMe, 2' -MOE, 2'-O-NMA and 2'-FANA. In some embodiments, the oligonucleotide comprises a 36 nucleotide sense strand having each of the sense strands at positions 1-7 and 12-17, 12-20, or 12-22. A sugar moiety in which a nucleotide is modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2 '-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA. In some embodiments, the oligonucleotide comprises a sense strand comprising a stem loop and each nucleoside at positions 1-7 and 12-17, 12-20 or 12-22 of the sense strand A sugar moiety modified by an acid selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2'-OMe , 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises a sense strand having a 2'-F modified sugar moiety at positions 3, 5, 8, 10, 12, 13, 15, and 17. In some embodiments, the oligonucleotide comprises a sense strand having 2'-OMe modifications at positions 1, 2, 4, 6, 7, 9, 11, 14, 16, and 18-20 The sugar part. In some embodiments, the oligonucleotide comprises a sense strand having each of the sense strand at positions 1, 2, 4, 6, 7, 9, 11, 14, 16, and 18-20. A sugar moiety in which a nucleotide is modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2 '-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA. In some embodiments, the oligonucleotide comprises a sense strand having each nucleotide selected at positions 1-7 and 12-17, 12-20, or 12-22 of the sense strand. Sugar moiety modified by modifications from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2'-OMe, 2' -MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises a sense strand having a 2'-F modified sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27, position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36.

In some embodiments, the oligonucleotide comprises a sense strand having a sugar moiety modified with 2'-OMe at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27, position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36.

In some embodiments, the oligonucleotide comprises a sense strand having at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10 ,Bit Position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27 , a sugar moiety modified at position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36 with a modification selected from the group consisting of: 2'-O-propargyl base, 2'-O-propylamine, 2'-amino, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, an oligonucleotide comprises an antisense strand having a sugar moiety with each nucleotide at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand modified with a 2'-F modification and each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O- NMA and 2'-FANA; and a sense strand having a sugar moiety with each nucleotide at positions 8-11 of the sense strand modified with a 2'-F modification and each remaining nucleotide of the sense strand modified with a sugar moiety selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA. In some embodiments, the oligonucleotide comprises an antisense strand having a sugar moiety modified with a 2'-F at each nucleotide at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand and a sugar moiety modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA; and a sense strand having a stem loop and a sugar moiety modified with 2'-F at each nucleotide at positions 8-11 of the sense strand and a sugar moiety modified with a modification selected from the group consisting of 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, 2'-EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the oligonucleotide comprises an antisense strand having a sugar moiety modified with 2'-F at each nucleotide at positions 2, 3, 4, 5, 7, 10, 14, 16, and 19 of the antisense strand and a sugar moiety modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA, and 2 '-FANA; and a sense strand having a sugar moiety modified with 2'-F at each nucleotide at positions 3, 5, 8, 10, 12, 13, 15 and 17 of the sense strand and a sugar moiety modified with a modification selected from the group consisting of: 2'-O-propargyl, 2'-O-propylamine, 2'-amine, 2'-ethyl, EA, 2'-OMe, 2'-MOE, 2'-O-NMA and 2'-FANA.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1537 and 1572, respectively; b) SEQ ID NO: 1537 and 1572, respectively; : 1538 and 1573; c) SEQ ID NO: 1539 and 1574 respectively; d) SEQ ID NO: 1540 and 1575 respectively; e) SEQ ID NO: 1541 and 1576 respectively; f) SEQ ID NO: 1542 respectively and 1577; g) SEQ ID NO: 1543 and 1578 respectively; h) SEQ ID NO: 1544 and 1579 respectively; i) SEQ ID NO: 1545 and 1580 respectively; j) SEQ ID NO: 1546 and 1581 respectively. ; k) SEQ ID NO: 1547 and 1582 respectively; l) SEQ ID NO: 1548 and 1583 respectively; m) SEQ ID NO: 1549 and 1584 respectively; n) SEQ ID NO: 1550 and 1585 respectively; o ) are SEQ ID NO: 1551 and 1586 respectively; p) are SEQ ID NO: 1552 and 1587 respectively; q) are SEQ ID NO: 1553 and 1588 respectively; r) are SEQ ID NO: 1554 and 1589 respectively; s) are SEQ ID NO: 1555 and 1590 respectively; t) are SEQ ID NO: 1556 and 1591 respectively; u) are SEQ ID NO: 1557 and 1592 respectively; v) are SEQ ID NO: 1558 and 1593 respectively; w) SEQ ID NO: 1559 and 1594 respectively; x) SEQ ID NO: 1560 and 1595 respectively; y) SEQ ID NO: 1561 and 1596 respectively; z) SEQ ID NO: 1562 and 1597 respectively; aa) respectively SEQ ID NOs: 1563 and 1598; bb) are SEQ ID NOs: 1564 and 1599 respectively; cc) are SEQ ID NOs: 1565 and 1600 respectively; dd) are SEQ ID NOs: 1566 and 1601 respectively; ee) are SEQ ID NOs respectively. NO: 1567 and 1602; ff) are SEQ ID NO: 1568 and 1603 respectively; gg) are SEQ ID NO: 1569 and 1604 respectively; hh) are SEQ ID NO: 1570 and 1605 respectively; ii) are SEQ ID NO: 1571 and 1606; and jj) are SEQ ID NO: 1681 and 1586 respectively, in which one or more of positions 3, 5, 8, 10, 12, 13, 15 or 17 of the right stock is modified by a 2'-F group Group modification.

In some embodiments, the sense strand and antisense strand of the oligonucleotide comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NO: 1540 and 1575, respectively; b) SEQ ID NO: 1544 and 1579, respectively; c) SEQ ID NO: 1546 and 1581, respectively; d) SEQ ID NO: 1551 and 1586, respectively; e) SEQ ID NO: 1552 and 1587, respectively; f) SEQ ID NO: 1553 and 1588, respectively; g) SEQ ID NO: 1558 and 1594, respectively; h) SEQ ID NO: 1560 and 1595, respectively; i) SEQ ID NO: 1564 and 1599, respectively; j) SEQ ID NO: 1565 and 1600, respectively; k) SEQ ID NO: 1566 and 1601, respectively; l) SEQ ID NO: 1570 and 1605; and m) are SEQ ID NO: 1681 and 1586, respectively, wherein one or more of positions 3, 5, 8, 10, 12, 13, 15 or 17 of the sense strand are modified with a 2'-F group.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1553 and 1588, respectively; b) SEQ ID NO: 1553 and 1588, respectively; : 1560 and 1595; c) SEQ ID NO: 1564 and 1599 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1570 and 1605 respectively; and f) SEQ ID NO: 1681 and 1586, in which one or more of positions 3, 5, 8, 10, 12, 13, 15 or 17 of the sense strand is modified with a 2'-F group.

5'-terminal phosphate

In some embodiments, the oligonucleotides described herein (e.g., RNAi oligonucleotides) comprise a sense strand and an antisense strand, wherein the antisense strand comprises a 5' terminal phosphate. In some embodiments, the 5' terminal phosphate group enhances interaction with Ago2. However, oligonucleotides comprising a 5'-phosphate group may be susceptible to degradation by phosphatases or other enzymes, which may limit their in vivo bioavailability. In some embodiments, the oligonucleotides include a 5'-phosphate analog that is resistant to such degradation. In some embodiments, the phosphate analog is an oxymethylphosphonate, a vinylphosphonate, or a malonylphosphonate, or a combination thereof. In certain embodiments, the 5' end of the oligonucleotide strand is attached to a chemical moiety that mimics the electrostatic and steric properties of a natural 5'-phosphate group ("phosphate mimetic").

In some embodiments, the oligonucleotide has a phosphate analog at the 4'-carbon position of the sugar (termed a "4'-phosphate analog"). See, for example, International Patent Application Publication No. WO 2018/045317. In some embodiments, the oligonucleotide contains a 4'-phosphate analog at the 5' terminal nucleotide. In some embodiments, the phosphate analog is an oxymethylphosphonate in which the oxygen atom of the oxymethyl group is bonded to the sugar moiety (eg, at its 4'-carbon) or an analog thereof. In other embodiments, the 4'-phosphate analog is a thiomethylphosphonate or an aminomethylphosphonate, wherein the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is bonded to the sugar moiety or its Analogue 4'-carbon. In certain embodiments, the 4'-phosphate analog is an oxymethylphosphonate. In some embodiments, the oxymethylphosphonate is represented by the formula -O-CH2-PO(OH) ₂ , -O-CH2-PO(OR) ₂ , or -O-CH2-POOH(R), wherein R is Independently selected from H, _{CH3 , alkyl} , _CH2CH2CN , _CH2OCOC ( _CH3 ) ₃ , _CH2OCH2CH2Si ( _CH3 ) ₃ or _protecting group. In certain embodiments, alkyl is _{CH2CH3 .} More typically, R is independently selected from H, _{CH3 or CH2CH3} . In some embodiments, R is _CH3 . In some embodiments, the 4'-phosphate analog is 4'-oxymethylphosphonate. In some embodiments, the modified nucleotide with a 4'-phosphonate analog is uridine. In some embodiments, the modified nucleotide is 4'-O-monomethylphosphonate-2'-O-methyluridine.

In some embodiments, the sense strand and antisense strand of the oligonucleotide comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NO: 1537 and 1572, respectively; b) SEQ ID NO: 1538 and 1573, respectively; c) SEQ ID NO: 1539 and 1574, respectively; d) SEQ ID NO: 1540 and 1575, respectively; e) SEQ ID NO: 1541 and 1576, respectively; f) SEQ ID NO: 1542 and 1577, respectively; g) SEQ ID NO: 1543 and 1578, respectively; h) SEQ ID NO: 1544 and 1579, respectively; i) SEQ ID NO: 1545 and 1580, respectively; j) SEQ ID NO: 1546 and 1581, respectively; k) SEQ ID NO: 1547 and 1582, respectively; l) SEQ ID NO: 1548 and 1583; m) are SEQ ID NO: 1549 and 1584; n) are SEQ ID NO: 1550 and 1585; o) are SEQ ID NO: 1551 and 1586; p) are SEQ ID NO: 1552 and 1587; q) are SEQ ID NO: 1553 and 1588; r) are SEQ ID NO: 1554 and 1589; s) are SEQ ID NO: 1555 and 1590; t) are SEQ ID NO: 1556 and 1591; u) are SEQ ID NO: 1557 and 1592; v) are SEQ ID NO: 1558 and 1593; w) are SEQ ID NO: 1559 and 1594; x) are SEQ ID NO: 1560 and 1595; y) are SEQ ID NO: 1561 and 1596, respectively; z) is SEQ ID NO: 1562 and 1597, respectively; aa) is SEQ ID NO: 1563 and 1598, respectively; bb) is SEQ ID NO: 1564 and 1599, respectively; cc) is SEQ ID NO: 1565 and 1600, respectively; dd) is SEQ ID NO: 1566 and 1601, respectively; ee) is SEQ ID NO: 1567 and 1602, respectively; ff) is SEQ ID NO: 1568 and 1603, respectively; gg) is SEQ ID NO: 1569 and 1604, respectively; hh) is SEQ ID NO: 1570 and 1605, respectively; ii) is SEQ ID NO: 1571 and 1606, respectively; and jj) is SEQ ID NO: 1681 and 1586, wherein the oligonucleotide comprises a 5'-terminal phosphate, optionally a 5'-terminal phosphate analog.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1540 and 1575, respectively; b) SEQ ID NO: 1540 and 1575, respectively; : 1544 and 1579; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1552 and 1587 respectively; f) SEQ ID NO: 1553 respectively and 1588; g) are SEQ ID NO: 1558 and 1594 respectively; h) are SEQ ID NO: 1560 and 1595 respectively; i) are SEQ ID NO: 1564 and 1599 respectively; j) SEQ ID NO: 1565 and 1600 respectively; k) SEQ ID NO: 1566 and 1601 respectively; l) SEQ ID NO: 1570 and 1605 respectively; and m) SEQ ID NO: 1681 and 1586 respectively, wherein The oligonucleotide contains a 5'-terminal phosphate, optionally a 5'-terminal phosphate analog.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1553 and 1588, respectively; b) SEQ ID NO: 1553 and 1588, respectively; : 1560 and 1595; c) SEQ ID NO: 1564 and 1599 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1570 and 1605 respectively; and f) SEQ ID NO: 1681 and 1586, wherein the oligonucleotide includes a 5'-terminal phosphate, optionally a 5'-terminal phosphate analog.

4'-O-單甲基膦酸酯-2'-O-甲基尿苷硫代磷酸酯[Me膦酸酯-4O-mUs]。 In some embodiments, the oligonucleotide comprises an antisense strand comprising a 4'-phosphate analogue at the 5' terminal nucleotide, wherein the 5' terminal nucleotide comprises the following structure:

4'-O-Monomethylphosphonate-2'-O-methyluridine phosphorothioate [Mephosphonate-4O-mUs].

Modified internucleotide linkages

In some embodiments, an oligonucleotide (e.g., an RNAi oligonucleotide) comprises a modified internucleotide linkage. In some embodiments, a phosphate modification or substitution results in an oligonucleotide comprising at least about 1 (e.g., at least 1, at least 2, at least 3, at least 4, or at least 5) modified internucleotide linkages. In some embodiments, an oligonucleotide comprises about 1 to about 10 (e.g., 1 to 10, 2 to 8, 4 to 6, 3 to 10, 5 to 10, 1 to 5, 1 to 3, or 1 to 2) modified internucleotide linkages. In some embodiments, an oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide linkages.

The modified internucleotide linkages can be phosphorodithioate linkages, phosphorothioate linkages, phosphotriester linkages, thiocarbonylalkylphosphonate linkages, thiocarbonylalkylphosphotriester linkages, phosphoramidite linkages, phosphonate linkages, or boranophosphate linkages. In some embodiments, at least one modified internucleotide linkage is a phosphorothioate linkage.

In some embodiments, the oligonucleotide has a phosphorothioate linkage between one or more of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the oligonucleotide has a phosphorothioate linkage between each of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the oligonucleotide has a phosphorothioate linkage between each of: (i) positions 1 and 2 of the sense strand; and (ii) positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 20 and 21, and positions 21 and 22 of the antisense strand.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1537 and 1572, respectively; b) SEQ ID NO: 1537 and 1572, respectively; : 1538 and 1573; c) SEQ ID NO: 1539 and 1574 respectively; d) SEQ ID NO: 1540 and 1575 respectively; e) SEQ ID NO: 1541 and 1576 respectively; f) SEQ ID NO: 1542 respectively and 1577; g) SEQ ID NO: 1543 and 1578 respectively; h) SEQ ID NO: 1544 and 1579 respectively; i) SEQ ID NO: 1545 and 1580 respectively; j) SEQ ID NO: 1546 and 1581 respectively. ; k) SEQ ID NO: 1547 and 1582 respectively; l) SEQ ID NO: 1548 and 1583 respectively; m) SEQ ID NO: 1549 and 1584 respectively; n) SEQ ID NO: 1550 and 1585 respectively; o) SEQ ID NO: 1551 and 1586 respectively; p) SEQ ID NO: 1552 and 1587 respectively; q) SEQ ID NO: 1553 and 1588 respectively; r) SEQ ID NO: 1554 and 1589 respectively; s) SEQ ID NO: 1555 and 1590 respectively; t) SEQ ID NO: 1556 and 1591 respectively; u) SEQ ID NO: 1557 and 1592 respectively; v) SEQ ID NO: 1558 and 1593 respectively; w) SEQ ID NO: 1558 and 1593 respectively; SEQ ID NO: 1559 and 1594; x) are SEQ ID NO: 1560 and 1595 respectively; y) are SEQ ID NO: 1561 and 1596 respectively; z) are SEQ ID NO: 1562 and 1597 respectively; aa) are SEQ ID NO respectively NO: 1563 and 1598; bb) are SEQ ID NO: 1564 and 1599 respectively; cc) are SEQ ID NO: 1565 and 1600 respectively; dd) are SEQ ID NO: 1566 and 1601 respectively; ee) are SEQ ID NO: 1567 and 1602; ff) are SEQ ID NO: 1568 and 1603 respectively; gg) are SEQ ID NO: 1569 and 1604 respectively; hh) are SEQ ID NO: 1570 and 1605 respectively; ii) are SEQ ID NO: 1571 and 1604 respectively. 1606; and jj) are SEQ ID NOs: 1681 and 1586, respectively, wherein the oligonucleotide includes modified internucleotide linkages.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise a component selected from the following: The nucleotide sequences of the group: a) are SEQ ID NO: 1540 and 1575 respectively; b) are SEQ ID NO: 1544 and 1579 respectively; c) are SEQ ID NO: 1546 and 1581 respectively; d) are SEQ ID NO respectively NO: 1551 and 1586; e) SEQ ID NO: 1552 and 1587 respectively; f) SEQ ID NO: 1553 and 1588 respectively; g) SEQ ID NO: 1558 and 1594 respectively; h) SEQ ID NO: 1560 and 1595; i) SEQ ID NO: 1564 and 1599 respectively; j) SEQ ID NO: 1565 and 1600 respectively; k) SEQ ID NO: 1566 and 1601 respectively; l) SEQ ID NO: 1570 and 1600 respectively. 1605; and m) are SEQ ID NOs: 1681 and 1586, respectively, wherein the oligonucleotide comprises a modified internucleotide linkage.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1553 and 1588, respectively; b) SEQ ID NO: 1553 and 1588, respectively; : 1560 and 1595; c) SEQ ID NO: 1564 and 1599 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1570 and 1605 respectively; and f) SEQ ID NO: 1681 and 1586, wherein the oligonucleotide comprises modified internucleotide linkages.

Alkaline modification

In some embodiments, oligonucleotides (eg, RNAi oligonucleotides) herein have one or more modified nucleobases. In some embodiments, a modified nucleobase (also referred to herein as a base analog) is attached at the 1' position of the sugar moiety of the nucleotide. In certain embodiments, the modified nucleobase is a nitrogenous base. In certain embodiments, the modified nucleobase contains no nitrogen atoms. See, for example, US Patent Application Publication No. 2008/0274462. In some embodiments, modified nucleotides comprise universal bases. In some embodiments, the modified nucleotide contains no nucleobases (abase).

In some embodiments, the sense strand and antisense strand of the oligonucleotide comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1537 and 1572, respectively; b) SEQ ID NOs: 1538 and 1573, respectively; c) SEQ ID NOs: 1539 and 1574, respectively; d) SEQ ID NOs: 1540 and 1575, respectively; e) SEQ ID NOs: 1541 and 1576, respectively; f) SEQ ID NOs: 1542 and 1577, respectively; g) SEQ ID NOs: 1543 and 1578, respectively; h) SEQ ID NOs: 1544 and 1579, respectively; i) SEQ ID NOs: 1545 and 1580, respectively; j) SEQ ID NOs: 1546 and 1581, respectively; k) SEQ ID NOs: 1547 and 1582, respectively; l) SEQ ID NOs: 1548 and 1583, respectively. NO: 1548 and 1583; m) are SEQ ID NO: 1549 and 1584; n) are SEQ ID NO: 1550 and 1585; o) are SEQ ID NO: 1551 and 1586; p) are SEQ ID NO: 1552 and 1587; q) are SEQ ID NO: 1553 and 1588; r) are SEQ ID NO: 1554 and 1589; s) are SEQ ID NO: 1555 and 1590; t) are SEQ ID NO: 1556 and 1591; u) are SEQ ID NO: 1557 and 1592; v) are SEQ ID NO: 1558 and 1593; w) are SEQ ID NO: 1559 and 1594; x) are SEQ ID NO: 1560 and 1595; y) are SEQ ID NO: 1561 and 1596; z) are SEQ ID NO: 1562 and 1597, respectively; aa) are SEQ ID NO: 1563 and 1598, respectively; bb) are SEQ ID NO: 1564 and 1599, respectively; cc) are SEQ ID NO: 1565 and 1600, respectively; dd) are SEQ ID NO: 1566 and 1601, respectively; ee) are SEQ ID NO: 1567 and 1602, respectively; ff) are SEQ ID NO: 1568 and 1603, respectively; gg) are SEQ ID NO: 1569 and 1604, respectively; hh) are SEQ ID NO: 1570 and 1605, respectively; ii) are SEQ ID NO: 1571 and 1606, respectively; and jj) are SEQ ID NO: 1681 and 1586, respectively, wherein the oligonucleotide comprises one or more modified nucleobases.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1540 and 1575 respectively; b) SEQ ID NO: 1544 and 1579 respectively; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) are SEQ ID NO: 1552 and 1587 respectively; f) are SEQ ID NO: 1553 and 1588 respectively; g) are SEQ ID NO: 1558 and 1594 respectively; h) are SEQ ID NO: 1560 and 1595 respectively; i) are respectively SEQ ID NO: 1564 and 1599; j) SEQ ID NO: 1565 and 1600, respectively; k) SEQ ID NO: 1566 and 1601, respectively; l) SEQ ID NO: 1570 and 1605, respectively; and m) SEQ ID NO: 1565 and 1605, respectively. ID NOs: 1681 and 1586, wherein the oligonucleotide contains one or more modified nucleobases.

In some embodiments, the sense strand and antisense strand of the oligonucleotide comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1570 and 1605, respectively; and f) SEQ ID NOs: 1681 and 1586, respectively, wherein the oligonucleotide comprises one or more modified nucleobases.

In some embodiments, the universal base is a heterocyclic moiety located at the 1' position of the nucleotide sugar moiety in the modified nucleotide, or at an equivalent position in a nucleotide sugar moiety substitution, which, when present in a duplex, can be positioned relative to more than one type of base without substantially altering the structure of the duplex. In some embodiments, the ss nucleic acid containing the universal base forms a duplex with the target nucleic acid, and the T _m of the duplex is lower than that of the duplex formed with the complementary nucleic acid, compared to a reference ss nucleic acid (e.g., an oligonucleotide) that is completely complementary to the target nucleic acid. In some embodiments, a ss nucleic acid containing a universal base forms a duplex with a target nucleic acid that has a higher T _m than a duplex formed with a nucleic acid comprising a mismatched base when compared to a reference ss nucleic acid in which the universal base has been replaced by a base to produce a single mismatch.

Non-limiting examples of universal binding nucleotides include, but are not limited to, inosine, 1-β-D-ribofuranosyl-5-nitroindole and/or 1-β-D-ribofuranosyl-3-nitropyrrole (see U.S. Patent Application Publication No. 2007/0254362; Van Aerschot et al. (1995) Nucleic Acids Res. 23:4363-4370; Loakes et al. (1995) Nucleic Acids Res. 23:2361-66; and Loakes and Brown (1994) Nucleic Acids Res. 22:4039-43).

Targeting ligand

In some embodiments, it is desirable to target an oligonucleotide (eg, an RNAi oligonucleotide) to one or more cells or one or more organs. Such a strategy may help avoid undesirable effects in other organs or excessive loss of the oligonucleotide to cells, tissues or organs that would not benefit from the oligonucleotide. Thus, in some embodiments, oligonucleotides are modified to facilitate targeting and/or delivery to specific tissues, cells, or organs (eg, to facilitate delivery of the oligonucleotide to the CNS). In some embodiments, the oligonucleotide comprises at least one nucleotide bound to one or more targeting ligands (e.g., 1, 2, 3, 4, 5, 6 or more nucleotides ). In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1537 and 1572, respectively; b) SEQ ID NO: 1537 and 1572, respectively; : 1538 and 1573; c) SEQ ID NO: 1539 and 1574 respectively; d) SEQ ID NO: 1540 and 1575 respectively; e) SEQ ID NO: 1541 and 1576 respectively; f) SEQ ID NO: 1542 and 1577 respectively; g) SEQ ID NO: 1543 and 1578 respectively; h) SEQ ID NO: 1544 and 1579 respectively; i) SEQ ID NO: 1545 and 1580 respectively; j) SEQ ID NO: 1546 and 1581 respectively; k) SEQ ID NO: 1547 and 1582 respectively; l) SEQ ID NO: 1547 and 1582 respectively; SEQ ID NOs: 1548 and 1583; m) are SEQ ID NOs: 1549 and 1584 respectively; n) are SEQ ID NOs: 1550 and 1585 respectively; o) are SEQ ID NOs: 1551 and 1586 respectively; p) are SEQ ID NOs respectively NO: 1552 and 1587; q) are SEQ ID NO: 1553 and 1588 respectively; r) are SEQ ID NO: 1554 and 1589 respectively; s) are SEQ ID NO: 1555 and 1590 respectively; t) are SEQ ID NO: 1556 and 1591; u) are SEQ ID NO: 1557 and 1592 respectively; v) are SEQ ID NO: 1558 and 1593 respectively; w) are SEQ ID NO: 1559 and 1594 respectively; x) are SEQ ID NO: 1560 and 1593 respectively. 1595; y) are SEQ ID NO: 1561 and 1596 respectively; z) are SEQ ID NO: 1562 and 1597 respectively; aa) are SEQ ID NO: 1563 and 1598 respectively; bb) are SEQ ID NO: 1564 and 1599 respectively; cc) are SEQ ID NO: 1565 and 1600 respectively; dd) are SEQ ID NO: 1566 and 1601 respectively; ee) are SEQ ID NO: 1567 and 1602 respectively; ff) SEQ ID NO: 1568 and 1603 respectively; gg) SEQ ID NO: 1569 and 1604 respectively; hh) SEQ ID NO: 1570 and 1605 respectively; ii) SEQ ID NO: 1571 and 1606 respectively; and jj) respectively are SEQ ID NOs: 1681 and 1586, wherein the oligonucleotides comprise a targeting ligand bound to at least one nucleotide.

In some embodiments, the oligonucleotide comprises at least one nucleotide bound to one or more targeting ligands (e.g., 1, 2, 3, 4, 5, 6 or more nucleotides ). In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1540 and 1575, respectively; b) SEQ ID NO: 1540 and 1575, respectively; : 1544 and 1579; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1552 and 1587 respectively; f) SEQ ID NO: 1553 respectively and 1588; g) SEQ ID NO: 1558 and 1594 respectively; h) SEQ ID NO: 1560 and 1595 respectively; i) SEQ ID NO: 1564 and 1599 respectively; j) SEQ ID NO: 1565 and 1600 respectively. ; k) are SEQ ID NO: 1566 and 1601 respectively; l) SEQ ID NOs: 1570 and 1605, respectively; and m) SEQ ID NOs: 1681 and 1586, respectively, wherein the oligonucleotide comprises a targeting ligand bound to at least one nucleotide.

In some embodiments, the oligonucleotide comprises at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6 or more nucleotides) bound to one or more targeting ligands. In some embodiments, the sense strand and antisense strand of the oligonucleotide comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1570 and 1605, respectively; and f) SEQ ID NOs: 1681 and 1586, respectively, wherein the oligonucleotide comprises a targeting ligand bound to at least one nucleotide.

In some embodiments, the targeting ligand comprises a carbohydrate, an amino sugar, cholesterol, a peptide, a polypeptide, or a protein or a portion of a protein (e.g., an antibody or antibody fragment). In some embodiments, the targeting ligand is an aptamer. For example, the targeting ligand can be an RGD peptide for targeting tumor vasculature or neuroglioma cells, a CREKA peptide for targeting tumor vasculature or stoma, transferrin, lactoferrin, or an aptamer targeting transferrin receptor expressed on CNS vasculature, or an anti-EGFR antibody targeting EGFR on neuroglioma cells. In certain embodiments, the targeting ligand is one or more GalNAc moieties. In some embodiments, the targeting ligand is one or more lipid moieties.

In some embodiments, one or more (eg, 1, 2, 3, 4, 5, or 6) nucleotides of the oligonucleotide each bind to an independent targeting ligand. In some embodiments, each of 2 to 4 nucleotides of the oligonucleotide binds to a separate targeting ligand. In some embodiments, the targeting ligand binds to 2 to 4 nucleotides on either end of the sense or antisense strand (e.g., the targeting ligand binds to the sense or antisense strand). Two to four nucleotides overhang or extend from the 5' or 3' end of the sense strand) such that the targeting ligand resembles the bristles of a toothbrush and the oligonucleotide resembles a toothbrush. For example, the oligonucleotide can include a stem loop at either the 5' or 3' end of the sense strand, and 1, 2, 3, or 4 nucleotides of the stem loop can be individually bound to the targeting ligand. body. In some embodiments, the oligonucleotide includes a stem loop at the 3' end of the sense strand, wherein the loop of the stem loop includes triL or tetraL, and wherein 3 or 4 nucleotides constituting triL or tetraL are individually bound. to the targeting ligand. In some embodiments, an oligonucleotide includes a blunt end at its 3' end and one or more targeting ligands bound to at least one nucleotide. In some embodiments, an oligonucleotide contains a blunt end at its 3' end and one or more targeting ligands bound to the 5' terminal nucleotide of the sense strand.

GalNAc binding

GalNAc is a high affinity ligand for ASGPR, which is primarily expressed on the sinus surface of hepatocytes and plays a major role in the binding, internalization, and subsequent clearance of circulating glycoproteins (asialoglycoproteins) containing terminal galactose or GalNAc residues. Conjugation (indirect or direct) of a GalNAc moiety to an oligonucleotide herein (e.g., an RNAi oligonucleotide) can be used to target the oligonucleotide to an ASGPR expressed on a cell. In some embodiments, the oligonucleotide is conjugated to at least one or more GalNAc moieties, wherein the GalNAc moieties target the oligonucleotide to an ASGPR expressed on a human hepatocyte (e.g., a human hepatocyte). In some embodiments, the GalNAc moiety targets the oligonucleotide to the liver.

In some embodiments, the oligonucleotide binds directly or indirectly to monovalent GalNAc. In some embodiments, the oligonucleotide binds, directly or indirectly, to more than one monovalent GalNAc (i.e., to 2, 3, or 4 monovalent GalNAc moieties, and typically to 3 or 4 monovalent GalNAc moieties). In some embodiments, the oligonucleotide binds to one or more bivalent GalNAc, trivalent GalNAc, or tetravalent GalNAc moieties. In some embodiments, the divalent, trivalent, or tetravalent GalNAc moiety is bound to the oligonucleotide via a branched linker. In some embodiments, the monovalent GalNAc moiety is bound to the first nucleotide, and the divalent, trivalent, or tetravalent GalNAc moiety is bound to the second nucleotide via a branched linker.

In some embodiments, 1 or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of the oligonucleotide are each bound to a GalNAc moiety. In some embodiments, 2 to 4 nucleotides of tetraL are each bound to an independent GalNAc. In some embodiments, 1 to 3 nucleotides of triL are each bound to an independent GalNAc. In some embodiments, the targeting ligand is bound to 2 to 4 nucleotides at either end of the sense strand or antisense strand (e.g., the ligand is bound to 2 to 4 nucleotides overhanging or extending from the 5' or 3' end of the sense strand or antisense strand), such that the GalNAc moiety resembles the bristles of a toothbrush and the oligonucleotide resembles a toothbrush. In some embodiments, the GalNAc moiety is bound to the nucleotides of the sense strand. For example, four GalNAc moieties may be bound to nucleotides in tetraL of the sense strand, wherein each GalNAc moiety is bound to one nucleotide.

In some embodiments, the oligonucleotide comprises tetraL, wherein tetraL is any combination of adenine (A) and guanine (G) nucleotides. In some embodiments, tetraL comprises a monovalent GalNAc moiety attached to any one or more guanine (G) nucleotides of the tetracyclic ring via any linker described herein, as depicted below (X = heteroatom) :

In some embodiments, tetraL has a monovalent GalNAc attached to any one or more adenine nucleotides of tetraL via any linker described herein, as depicted below (X = heteroatom):

In some embodiments, the oligonucleotide comprises a monovalent GalNAc attached to a guanine (G) nucleotide, referred to as [ademG-GalNAc] or 2'-aminodiethoxycarbinol-guanine-GalNAc, as depicted below:

In some embodiments, the oligonucleotide comprises a monovalent GalNAc attached to an adenine (A) nucleotide, referred to as [ademA-GalNAc] or 2'-aminodiethoxymethanol-adenine-GalNAc, As depicted below:

用於描述與寡核苷酸股之附接點。 An example of such a conjugation is shown below for a loop comprising the nucleotide sequence GAAA from 5' to 3' (L = linker, X = heteroatom), wherein the stem attachment point is shown. Such a loop can be present, for example, at positions 27-30 of the sense strand of any of the sense strands listed in Tables 4 and 5. In the chemical formula,

Used to describe the point of attachment to an oligonucleotide strand.

為與寡核苷酸股之附接點：

，或

The targeting ligand can be linked to the nucleotide using an appropriate method or chemistry (e.g., click chemistry). In some embodiments, the targeting ligand is bound to the nucleotide using a click linker. In some embodiments, an acetal-based linker is used to bind the targeting ligand to the nucleotide of any one of the oligonucleotides described herein. Acetal-based linkers are disclosed in, for example, International Patent Application Publication No. WO 2016/100401. In some embodiments, the linker is an unstable linker. However, in other embodiments, the linker is stable. An example of a ring comprising nucleotides GAAA from 5' to 3' is shown below, in which an acetal linker is used to attach the GalNAc moiety to 3 or 4 nucleotides of the ring. Such a ring may be present at positions 27-30 of any one of the sense strands listed in, for example, Tables 4 and 5 . In the chemical formula,

For attachment points to the oligonucleotide strands:

,or

As mentioned, the targeting ligand can be linked to the nucleotide using various suitable methods or chemical synthesis techniques (e.g., click chemistry). In some embodiments, the targeting ligand is bound to the nucleotide using a click linker. In some embodiments, an acetal-based linker is used to bind the targeting ligand to the nucleotide of any of the oligonucleotides described herein. Acetal-based linkers are disclosed, for example, in International Patent Application Publication No. WO 2016/100401. In some embodiments, the linker is an unstable linker. However, in other embodiments, the linker is a stable linker.

In some embodiments, a duplex extension (e.g., up to 3, 4, 5, or 6 bp in length) is provided between the targeting ligand (e.g., a GalNAc moiety) and the RNAi oligonucleotide. In some embodiments, the oligonucleotide does not have GalNAc bound thereto.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1537 and 1572 respectively; b) SEQ ID NO: 1538 and 1573 respectively; c) SEQ ID NO: 1539 and 1574 respectively; d) SEQ ID NO: 1540 and 1575 respectively; e) SEQ ID NO: 1541 and 1576 respectively; f) SEQ ID NO: 1542 and 1577 respectively; g) SEQ ID NO: 1543 and 1578 respectively; h) SEQ ID NO: 1544 and 1579 respectively; i) SEQ ID NO: 1544 and 1579 respectively; SEQ ID NO: 1545 and 1580; j) are SEQ ID NO: 1546 and 1581 respectively; k) are SEQ ID NO: 1547 and 1582 respectively; l) are SEQ ID NO: 1548 and 1583 respectively; m) are SEQ ID NO respectively NO: 1549 and 1584; n) are SEQ ID NO: 1550 and 1585 respectively; o) are SEQ ID NO: 1551 and 1586 respectively; p) are SEQ ID NO: 1552 and 1587 respectively; q) are SEQ ID NO: 1553 and 1588; r) are SEQ ID NO: 1554 and 1589 respectively; s) are SEQ ID NO: 1555 and 1590 respectively; t) are SEQ ID NO: 1556 and 1591 respectively; u) are SEQ ID NO: 1557 and 1591 respectively. 1592; v) are SEQ ID NO: 1558 and 1593 respectively; w) are SEQ ID NO: 1559 and 1594 respectively; x) are SEQ ID NO: 1560 and 1595 respectively; y) are SEQ ID NO: 1561 and 1596 respectively; z) are SEQ ID NO: 1562 and 1597 respectively; aa) are SEQ ID NO: 1563 and 1598 respectively; bb) are SEQ ID NO: 1564 and 1599 respectively; cc) SEQ ID NO: 1565 and 1600 respectively; dd) SEQ ID NO: 1566 and 1601 respectively; ee) SEQ ID NO: 1567 and 1602 respectively; ff) SEQ ID NO: 1568 and 1603 respectively; gg) respectively. SEQ ID NO: 1569 and 1604; hh) are SEQ ID NO: 1570 and 1605 respectively; ii) are SEQ ID NO: 1571 and 1606 respectively; and jj) are SEQ ID NO: 1681 and 1586 respectively, wherein the oligonucleotide Contains at least one GalNAc moiety bound to a nucleotide.

In some embodiments, the sense and antisense strands of the oligonucleotide comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1540 and 1575, respectively; b) SEQ ID NO: 1540 and 1575, respectively; : 1544 and 1579; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1552 and 1587 respectively; f) SEQ ID NO: 1553 respectively and 1588; g) are SEQ ID NO: 1558 and 1594 respectively; h) are SEQ ID NO: 1560 and 1595 respectively; i) are SEQ ID NO: 1564 and 1599 respectively; j) SEQ ID NO: 1565 and 1600 respectively; k) SEQ ID NO: 1566 and 1601 respectively; l) SEQ ID NO: 1570 and 1605 respectively; and m) SEQ ID NO: 1681 and 1586 respectively, wherein The oligonucleotide contains at least one GalNAc moiety bound to the nucleotide.

In some embodiments, the sense strand and antisense strand of the oligonucleotide comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1570 and 1605, respectively; and f) SEQ ID NOs: 1681 and 1586, respectively, wherein the oligonucleotide comprises at least one GalNAc moiety bound to the nucleotide.

lipid binding

In some embodiments, one or more lipid moieties are bound to the 5' terminal nucleotide of the sense strand. In some embodiments, one or more lipid moieties are bound to an adenine nucleotide. In some embodiments, one or more lipid moieties are bound to a guanine nucleotide. In some embodiments, one or more lipid moieties are bound to a cytosine nucleotide. In some embodiments, one or more lipid moieties are bound to a thymine (T) nucleotide. In some embodiments, one or more lipid moieties are bound to a uracil (U) nucleotide.

In some embodiments, the lipid moiety is a hydrocarbon chain. In some embodiments, the hydrocarbon chain is saturated. In other embodiments, the hydrocarbon chain is unsaturated. In some embodiments, the hydrocarbon chain is a branched chain. In other embodiments, the hydrocarbon chain is straight. In some embodiments, the lipid moiety is a C ₈ -C ₃₀ hydrocarbon chain. In certain embodiments, the lipid moiety is C ₈ :0, C ₁₀ : 0, C ₁₁ : 0, C ₁₂ : 0, C ₁₄ : 0, C ₁₆ : 0, C ₁₇ : 0, C ₁₈ : 0, C ₁₈ : 1, C ₁₈ : 2, C ₂₂ : 5, C ₂₂ : 0, C ₂₄ : 0, C ₂₆ : 0, C ₂₂ : 6, C ₂₄ : 1, dicarboxylic acid C ₁₆ : 0 or dicarboxylic acid Base C ₁₈ :1. In some embodiments, the lipid moiety is a C ₁₆ hydrocarbon chain. In some embodiments, the C ₁₆ hydrocarbon chain is represented by:

In some embodiments, the sense strand is 20-22 nucleotides in length and the lipid moiety is bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the sense strand is 20-22 nucleotides in length and the alkyl chain is bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the sense strand is 20-22 nucleotides in length and the C ₁₄ -C ₂₂ alkyl chain is bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the sense strand is 20-22 nucleotides in length and the C ₁₆ alkyl chain is bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the sense strand is 20 nucleotides in length and the lipid moiety is bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the sense strand is 20 nucleotides in length and the alkyl chain is bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the sense strand is 20 nucleotides in length and the _C14 - _C22 alkyl chain is bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the sense strand is 20 nucleotides in length and the _C16 alkyl chain is bound to the 5' terminal nucleotide of the sense strand.

In some embodiments, the oligonucleotide includes (i) a sense strand that is 20-22 nucleotides in length; (ii) an antisense strand that includes a 3' overhang sequence that is one or more nucleotides in length. ; (iii) a blunt end comprising the 3' end of the sense strand; and (iv) a lipid moiety bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide includes (i) a sense strand that is 20-22 nucleotides in length; (ii) an antisense strand that includes a 3' overhang sequence that is one or more nucleotides in length. ; (iii) a blunt end comprising the 3' end of the sense strand; and (iv) a hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide includes (i) a sense strand that is 20-22 nucleotides in length; (ii) an antisense strand that includes a 3' overhang sequence that is one or more nucleotides in length. ; (iii) a blunt end comprising the 3' end of the sense strand; and (iv) a C ₁₄ -C ₂₂ hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide includes (i) a sense strand that is 20-22 nucleotides in length; (ii) an antisense strand that includes a 3' overhang sequence that is one or more nucleotides in length. ; (iii) a blunt end comprising the 3' end of the sense strand; and (iv) a C ₁₆ hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand.

In some embodiments, the oligonucleotide comprises (i) a sense strand that is 20 nucleotides in length; (ii) 22 nucleotides in length and includes a 3' overhang sequence that is two nucleotides in length. the antisense strand; (iii) a blunt end comprising the 3' end of the sense strand; and (iv) a lipid moiety that binds to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) a sense strand that is 20 nucleotides in length; (ii) 22 nucleotides in length and includes a 3' overhang sequence that is two nucleotides in length. the antisense strand; (iii) a blunt end comprising the 3' end of the sense strand; and (iv) a hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) a sense strand that is 20 nucleotides in length; (ii) 22 nucleotides in length and includes a 3' overhang sequence that is 2 nucleotides in length. the antisense strand; (iii) a blunt end comprising the 3' end of the sense strand; and (iv) a C ₁₄ -C ₂₂ hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) a sense strand that is 20 nucleotides in length; (ii) 22 nucleotides in length and includes a 3' overhang sequence that is 2 nucleotides in length. the antisense strand; (iii) a blunt end comprising the 3' end of the sense strand; and (iv) a C ₁₆ hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand.

In some embodiments, the oligonucleotide comprises (i) a 19-30 nucleotide antisense strand comprising a complementary region of the SNCA mRNA target sequence selected from SEQ ID NO: 1781 ,1782,1796,1798,1802,1808,1814,1817,1713,1718,1726,1830,1839,1742,1846,1852,1865,1784,1804,1721,1822,1840,1735,1847,1855,18 64 , 1901, 1902, 1938, 1947, 1955, 1964, 1973 and 1978; (ii) a sense strand of 19-25 nucleotides, the sense strand and the antisense strand forming a duplex region; and (iii) A lipid moiety that binds to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) a 19-30 nucleotide antisense strand comprising a complementary region of the SNCA mRNA target sequence selected from SEQ ID NO: 1798 , 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864 and 1955; (ii) a sense strand of 19-25 nucleotides, the sense strand and the antisense strand form a duplex region; and (iii) a lipid moiety that binds to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotides comprise (i) 19-30 Antisense strand of nucleotides, the antisense strand comprising the complementary region of the SNCA mRNA target sequence, the target sequence is selected from SEQ ID NO: 1865, 1721, 1847, 1846 and 1955; (ii) 19-25 nucleotides the sense strand of the acid, the sense strand and the antisense strand forming a duplex region; and (iii) a lipid moiety that binds to the 5' terminal nucleotide of the sense strand.

In some embodiments, the oligonucleotide comprises (i) a 19-30 nucleotide antisense strand comprising a complementary region of the SNCA mRNA target sequence selected from SEQ ID NO: 1781 ,1782,1796,1798,1802,1808,1814,1817,1713,1718,1726,1830,1839,1742,1846,1852,1865,1784,1804,1721,1822,1840,1735,1847,1855,18 64 , 1901, 1902, 1938, 1947, 1955, 1964, 1973 and 1978; (ii) a sense strand of 19-25 nucleotides, the sense strand and the antisense strand forming a duplex region; and (iii) A hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) a 19-30 nucleotide antisense strand comprising a complementary region of the SNCA mRNA target sequence selected from SEQ ID NO: 1798 , 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864 and 1955; (ii) a sense strand of 19-25 nucleotides, the sense strand and the antisense strand form a duplex region; and (iii) a hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) a 19-30 nucleotide antisense strand comprising a complementary region of the SNCA mRNA target sequence selected from SEQ ID NO: 1865 , 1721, 1847, 1846 and 1955; (ii) a sense strand of 19-25 nucleotides, which forms a duplex region with the antisense strand; and (iii) bound to the 5' of the sense strand Hydrocarbon chain of terminal nucleotides.

In some embodiments, the oligonucleotide comprises (i) an antisense strand of 19-30 nucleotides, the antisense strand comprising a complementary region to a SNCA mRNA target sequence selected from the group consisting of SEQ ID NOs: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973 and 1978; (ii) a sense strand of 19-25 nucleotides, the sense strand forming a duplex region with the antisense strand; and (iii) a C ₁₄ -C ₂₂ hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) an antisense strand of 19-30 nucleotides, the antisense strand comprising a complementary region to a SNCA mRNA target sequence selected from SEQ ID NOs: 1798, 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864, and 1955; (ii) a sense strand of 19-25 nucleotides, the sense strand and the antisense strand forming a duplex region; and (iii) a _C14 - _C22 hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) an antisense strand of 19-30 nucleotides, the antisense strand comprising a complementary region to a SNCA mRNA target sequence selected from SEQ ID NOs: 1865, 1721, 1847, 1846, and 1955; (ii) a sense strand of 19-25 nucleotides, the sense strand and the antisense strand forming a duplex region; and (iii) a C ₁₄ -C ₂₂ hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand.

In some embodiments, the oligonucleotide comprises (i) an antisense strand of 19-30 nucleotides, the antisense strand comprising a complementary region to a SNCA mRNA target sequence selected from the group consisting of SEQ ID NOs: 1781, 1782, 1796, 1798, 1802, 1808, 1814, 1817, 1713, 1718, 1726, 1830, 1839, 1742, 1846, 1852, 1865, 1784, 1804, 1721, 1822, 1840, 1735, 1847, 1855, 1864, 1901, 1902, 1938, 1947, 1955, 1964, 1973 and 1978; (ii) a sense strand of 19-25 nucleotides, the sense strand forming a duplex region with the antisense strand; and (iii) a _C16 hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) an antisense strand of 19-30 nucleotides, the antisense strand comprising a complementary region to a SNCA mRNA target sequence selected from SEQ ID NOs: 1798, 1817, 1718, 1846, 1852, 1865, 1804, 1721, 1847, 1855, 1864, and 1955; (ii) a sense strand of 19-25 nucleotides, the sense strand and the antisense strand forming a duplex region; and (iii) a _C16 hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises (i) an antisense strand of 19-30 nucleotides, the antisense strand comprising a complementary region to a SNCA mRNA target sequence selected from SEQ ID NOs: 1865, 1721, 1847, 1846, and 1955; (ii) a sense strand of 19-25 nucleotides, the sense strand and the antisense strand forming a duplex region; and (iii) a _C16 hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand.

In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence of SEQ ID NO: 1681 and an antisense strand comprising a nucleotide sequence of SEQ ID NO: 1586, wherein the sense strand comprises a lipid moiety bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence of SEQ ID NO: 1681 and an antisense strand comprising a nucleotide sequence of SEQ ID NO: 1586, wherein the sense strand comprises a hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence of SEQ ID NO: 1681 and an antisense strand comprising a nucleotide sequence of SEQ ID NO: 1586, wherein the sense strand comprises a C ₁₄ -C ₂₂ hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand. In some embodiments, the oligonucleotide comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 1681 and an antisense strand comprising the nucleotide sequence of SEQ ID NO: 1586, wherein the sense strand comprises a _C16 hydrocarbon chain bound to the 5' terminal nucleotide of the sense strand.

Exemplary SNCA-targeting RNAi oligonucleotides

In some embodiments, SNCA -targeting RNAi oligonucleotides for reducing SNCA gene expression comprise a sense strand and an antisense strand, wherein all nucleotides constituting the sense strand and antisense strand are modified, wherein the antisense strand The sense strand comprises a complementary region to the SNCA mRNA target sequence of any one of SEQ ID NOs: 1683-2066, and wherein the length of the complementary region is at least 15 contiguous nucleotides. In some embodiments, the 5' terminal nucleotide of the antisense strand comprises 4'-O-monomethylphosphonate-2'-O-methyluridine [Mephosphonate-4O-mU], such as described in this article. In some embodiments, the 5' terminal nucleotide of the antisense strand contains a phosphorothioate linkage. In some embodiments, the antisense and sense strands comprise one or more 2'-F modified and 2'-OMe modified nucleotides and at least one phosphorothioate linkage. In some embodiments, the antisense strand contains 4 phosphorothioate linkages and the sense strand contains 1 phosphorothioate linkage. In some embodiments, the antisense strand contains 5 phosphorothioate linkages and the sense strand contains 1 phosphorothioate linkage.

In some embodiments, the oligonucleotide comprises a sense strand having the sequence of any one of SEQ ID NOs: 1683-2066 and a complementary sequence selected from any of SEQ ID NOs: 2067-2450 Antisense stocks.

In some embodiments, the oligonucleotide comprises a sense strand having a sequence of any one of SEQ ID NOs: 1-384 and an antisense strand comprising a complementary sequence selected from any one of SEQ ID NOs: 385-768.

In some embodiments, the oligonucleotide comprises a sense strand having the sequence of any one of SEQ ID NOs: 1537-1571 and a complementary sequence selected from any of SEQ ID NOs: 1572-1606 Antisense stocks.

In some embodiments, the oligonucleotide comprises a sense strand having the sequence of any one of SEQ ID NOs: 1537-1571 and 1681 and comprising the complement of any one selected from SEQ ID NOs: 1572-1606 The antisense strand of the sequence.

In some embodiments, the oligonucleotide consists of a sense strand having a sequence of any one of SEQ ID NOs: 1537-1571 and an antisense strand comprising a complementary sequence selected from any one of SEQ ID NOs: 1572-1606.

In some embodiments, the oligonucleotide consists of a sense strand having a sequence of any one of SEQ ID NOs: 1537-1571 and 1681 and an antisense strand comprising a complementary sequence selected from any one of SEQ ID NOs: 1572-1606.

In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and includes: a 36 nucleotide sense strand comprised at positions 3, 5, 8, 10, 12, 13, 15 and 17 2'-F modified nucleotides; nucleosides modified with 2'-OMe at positions 1, 2, 4, 6, 7, 9, 11, 14, 16, 18-27 and 31-36 acid; GalNAc-bound nucleotides at positions 28, 29, and 30; and a phosphorothioate linkage between positions 1 and 2; and a 22-nucleotide antisense strand comprising Nucleotides modified with 2'-F at positions 2, 3, 4, 5, 7, 10, 14, 16 and 19; at positions 1, 6, 8, 9, 11, 12, 13, 15, 17 2'-OMe at , 18 and 20-22; phosphorothioate linkages between positions 1 and 2, positions 2 and 3, positions 20 and 21, and positions 21 and 22; and 5 at position 1 ' terminal nucleotide comprising a 4'-phosphate analogue, optionally wherein the 5' terminal nucleotide comprises 4'-O-monomethylphosphonate-2'-O-methyluridine [Me Phosphonate-4O-mU]; where positions 1-20 of the antisense strand and positions 1-20 of the sense strand form a duplex region, where positions 21-36 of the sense strand form a stem loop, and position 27- 30 forms a stem-loop ring, optionally wherein positions 27-30 comprise tetraL, wherein the antisense strand comprises an overhang at positions 21 and 22, and wherein the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of : a) SEQ ID NO: 1537 and 1572 respectively; b) SEQ ID NO: 1538 and 1573 respectively; c) SEQ ID NO: 1539 and 1574 respectively; d) SEQ ID NO: 1540 and 1575 respectively; e ) are SEQ ID NO: 1541 and 1576 respectively; f) are SEQ ID NO: 1542 and 1577 respectively; g) are SEQ ID NO: 1543 and 1578 respectively; h) are SEQ ID NO: 1544 and 1579 respectively; i) respectively are SEQ ID NO: 1545 and 1580; j) are SEQ ID NO: 1546 and 1581 respectively; k) are SEQ ID NO: 1547 and 1582 respectively; l) are SEQ ID NO: 1548 and 1583 respectively; m) are SEQ ID NO: 1548 and 1583 respectively; ID NO: 1549 and 1584; n) are SEQ ID NO: 1550 and 1585 respectively; o) are SEQ ID NO: 1551 and 1586 respectively; p) are SEQ ID NO: 1552 and 1587 respectively; q) are SEQ ID NO respectively. : 1553 and 1588; r) are SEQ ID NO: 1554 and 1589 respectively; s) are SEQ ID NO: 1555 and 1590 respectively; t) are SEQ ID NO: 1556 and 1591 respectively; u) are SEQ ID NO: 1557 respectively and 1592; v) are SEQ ID NO: 1558 and 1593 respectively; w) are SEQ ID NO: 1559 and 1594 respectively; x) are SEQ ID NO: 1560 and 1595 respectively; y) are SEQ ID NO: 1561 and 1596 respectively ; z) are SEQ ID NO: 1562 and 1597 respectively; aa) are SEQ ID NO: 1563 and 1598 respectively; bb) are SEQ ID NO: 1564 and 1599 respectively; cc) are SEQ ID NO: 1565 and 1600 respectively; dd ) are SEQ ID NO: 1566 and 1601 respectively; ee) are SEQ ID NO: 1567 and 1602 respectively; ff) are SEQ ID NO: 1568 and 1603 respectively; gg) are SEQ ID NO: 1569 and 1604 respectively; hh) respectively are SEQ ID NO: 1570 and 1605; and ii) are SEQ ID NO: 1571 and 1606 respectively.

In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and includes: a 36 nucleotide sense strand comprised at positions 3, 5, 8, 10, 12, 13, 15 and 17 2'-F modified nucleotides; nucleosides modified with 2'-OMe at positions 1, 2, 4, 6, 7, 9, 11, 14, 16, 18-27 and 31-36 acid; GalNAc-bound nucleotides at positions 28, 29, and 30; and a phosphorothioate linkage between positions 1 and 2; and a 22-nucleotide antisense strand, the antisense strand comprising Nucleotides modified with 2'-F at positions 2, 3, 4, 5, 7, 10, 14, 16 and 19; at positions 1, 6, 8, 9, 11, 12, 13, 15, 17 2'-OMe at , 18 and 20-22; phosphorothioate linkages between positions 1 and 2, positions 2 and 3, positions 20 and 21, and positions 21 and 22; and 5 at position 1 ' terminal nucleotide comprising a 4'-phosphate analogue, optionally wherein the 5' terminal nucleotide comprises 4'-O-monomethylphosphonate-2'-O-methyluridine [Me Phosphonate-4O-mU]; wherein positions 1-20 of the antisense strand and positions 1-20 of the sense strand form a duplex region, among which positions 21-36 of the sense strand form a stem loop, among which position 27- 30 forms a stem-loop ring, optionally wherein positions 27-30 comprise tetraL, wherein the antisense strand comprises an overhang at positions 21 and 22, and wherein the sense strand and antisense strand comprise a nucleotide sequence selected from the group consisting of : a) SEQ ID NO: 1540 and 1575 respectively; b) SEQ ID NO: 1544 and 1579 respectively; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e ) are SEQ ID NO: 1552 and 1587 respectively; f) are SEQ ID NO: 1553 and 1588 respectively; g) are SEQ ID NO: 1558 and 1594 respectively; h) are SEQ ID NO: 1560 and 1595 respectively; i) respectively are SEQ ID NO: 1564 and 1599; j) are SEQ ID NO: 1565 and 1600, respectively; k) are SEQ ID NO: 1566 and 1601, respectively; and l) are SEQ ID NO: 1570 and 1605, respectively.

In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and comprises: a 36-nucleotide sense strand comprising nucleotides modified with 2'-F at positions 3, 5, 8, 10, 12, 13, 15, and 17; nucleotides modified with 2'-OMe at positions 1, 2, 4, 6, 7, 9, 11, 14, 16, 18-27, and 31-36; nucleotides conjugated with GalNAc at positions 28, 29, and 30; and a phosphorothioate linkage between positions 1 and 2; and a 22-nucleotide antisense strand comprising nucleotides modified with 2'-F at positions 3, 5, 8, 10, 12, 13, 15, and 17; nucleotides modified with 2'-OMe at positions 1, 2, 4, 6, 7, 9, 11, 14, 16, 18-27, and 31-36; nucleotides conjugated with GalNAc at positions 28, 29, and 30; and a phosphorothioate linkage between positions 1 and 2. 2'-F modified nucleotides at positions 1, 6, 8, 9, 11, 12, 13, 15, 17, 18 and 20-22; phosphorothioate linkages between positions 1 and 2, positions 2 and 3, positions 20 and 21, and positions 21 and 22; and a 5'-terminal nucleotide at position 1 comprising a 4'-phosphate analog, optionally wherein the 5'-terminal nucleotide comprises 4'-O-monomethylphosphonate-2'-O-methyl wherein positions 1-20 of the antisense strand form a duplex region with positions 1-20 of the sense strand, wherein positions 21-36 of the sense strand form a stem loop, wherein positions 27-30 form a loop of the stem loop, optionally wherein positions 27-30 comprise a tetraL, wherein positions 21 and 22 of the antisense strand comprise an overhang, and wherein the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; and e) SEQ ID NOs: 1570 and 1605, respectively.

In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and includes: a 20 nucleotide sense strand comprised at positions 3, 5, 8, 10, 12, 13, 15 and 17 2'-F modified nucleotides; 2'-OMe modified nucleotides at positions 2, 4, 6, 7, 9, 11, 14, 16 and 18-20; binds to position 1 The C ₁₆ hydrocarbon chain of the nucleotide at The antisense strand contains 2'-F modified nucleotides at positions 2, 3, 4, 5, 7, 10, 14, 16 and 19; at positions 1, 6, 8, 9, 11, 2'-OMe at 12, 13, 15, 17, 18, and 20-22; phosphorothioate linkages between positions 1 and 2, positions 2 and 3, positions 20 and 21, and positions 21 and 22; and a 5' terminal nucleotide at position 1, which comprises a 4'-phosphate analogue, optionally wherein the 5' terminal nucleotide comprises 4'-O-monomethylphosphonate-2'-O -Methyluridine [Mephosphonate-4O-mU]; where positions 1-20 of the antisense strand and positions 1-20 of the sense strand form a duplex region, where positions 21 and 22 of the antisense strand include The sense strand and the antisense strand respectively comprise the nucleotide sequences of SEQ ID NO: 1681 and 1586.

In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and includes a sense strand containing the nucleotide sequence set forth in SEQ ID NO: 1553 and a nucleotide containing the nucleotide sequence set forth in SEQ ID NO: 1588 The antisense stock of the sequence. In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise a sense strand containing the nucleotide sequence set forth in SEQ ID NO: 1560 and a nucleotide containing the nucleotide sequence set forth in SEQ ID NO: 1595 The antisense stock of the sequence. In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and includes a sense strand containing the nucleotide sequence set forth in SEQ ID NO: 1564 and a nucleotide containing the nucleotide sequence set forth in SEQ ID NO: 1599 The antisense stock of the sequence. In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise a sense strand containing the nucleotide sequence set forth in SEQ ID NO: 1551 and a nucleotide containing the nucleotide sequence set forth in SEQ ID NO: 1586 The antisense stock of the sequence. In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise a sense strand containing the nucleotide sequence set forth in SEQ ID NO: 1570 and a nucleotide containing the nucleotide sequence set forth in SEQ ID NO: 1605 The antisense stock of the sequence. In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise a sense strand containing the nucleotide sequence set forth in SEQ ID NO: 1681 and a nucleotide containing the nucleotide sequence set forth in SEQ ID NO: 1586 The antisense stock of the sequence.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. a nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1865; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand The sense strand and sense strand are independent strands forming an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1721; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand The sense strand and sense strand are independent strands forming an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

In some embodiments, the oligonucleotide is used to reduce SNCA performance and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a core containing a complementary region of the SNCA mRNA target sequence The nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1847; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand The strand and sense strand are independent strands forming an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is set forth in SEQ ID NO: 1846; and (ii) a sense strand of 19-50 nucleotides in length, wherein the sense strand comprises a complementary region of the antisense strand, wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. a nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1955; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand The sense strand and sense strand are independent strands forming an asymmetric duplex region with a 1-4 nucleotide overhang at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1865; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand and 3' The stem loop at the end, wherein the stem loop is represented by S1-L-S2, wherein S1 and S2 are complementary, and wherein L forms a loop of 3 to 5 nucleotides in length between S1 and S2, in which the antisense strand And the sense strand is an independent strand forming an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1721; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand and 3' The stem loop at the end, wherein the stem loop is represented by S1-L-S2, wherein S1 and S2 are complementary, and wherein L forms a loop of 3 to 5 nucleotides in length between S1 and S2, in which the antisense strand And the sense strand is an independent strand forming an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1847; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand and 3' The stem loop at the end, wherein the stem loop is represented by S1-L-S2, wherein S1 and S2 are complementary, and wherein L forms a loop of 3 to 5 nucleotides in length between S1 and S2, in which the antisense strand And the sense strand is an independent strand forming an asymmetric duplex region with an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is as shown in SEQ ID NO: 1846; and (ii) a sense strand of 19-50 nucleotides in length, wherein the sense strand comprises the complementary region of the antisense strand and a stem loop at the 3' end, wherein the stem loop is as shown in S1-L-S2, wherein S1 and S2 are complementary, and wherein L forms a loop of 3 to 5 nucleotides in length between S1 and S2, wherein the antisense strand and the sense strand are independent strands that form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is as set forth in SEQ ID NO: 1955; and (ii) a sense strand of 19-50 nucleotides in length, wherein the sense strand comprises the complementary region of the antisense strand and a stem loop at the 3' end, wherein the stem loop is as set forth in S1-L-S2, wherein S1 and S2 are complementary, and wherein L forms a loop of 3 to 5 nucleotides in length between S1 and S2, wherein the antisense strand and the sense strand are independent strands that form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is set forth in SEQ ID NO: 1846; and (ii) a sense strand of 19-25 nucleotides in length, wherein the sense strand comprises a complementary region of the antisense strand, wherein the oligonucleotide comprises a blunt end comprising the 3' end of the sense strand, and wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. a nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1865; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand The complementary region of the sense strand is shown in SEQ ID NO: 2249, and the antisense strand and the sense strand are independent strands forming an asymmetric duplex region. The duplex region has 1 at the 3' end of the antisense strand. -4 nucleotide overhang.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1721; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand The complementary region of the sense strand is shown in SEQ ID NO: 2105, and the antisense strand and the sense strand are independent strands forming an asymmetric duplex region. The duplex region has 1 at the 3' end of the antisense strand. -4 nucleotide overhang.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1847; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand The complementary region of the sense strand is shown in SEQ ID NO: 2231, and the antisense strand and the sense strand are independent strands forming an asymmetric duplex region. The duplex region has 1 at the 3' end of the antisense strand. -4 nucleotide overhang.

In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is set forth in SEQ ID NO: 1846; and (ii) a sense strand of 19-50 nucleotides in length, wherein the sense strand comprises a complementary region of the antisense strand, wherein the complementary region of the antisense strand is set forth in SEQ ID NO: 2230, and wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1955; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand, wherein the antisense strand The complementary region of the sense strand is shown in SEQ ID NO: 2339, and the antisense strand and the sense strand are independent strands forming an asymmetric duplex region. The duplex region has 1 at the 3' end of the antisense strand. -4 nucleotide overhang.

In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is as shown in SEQ ID NO: 1865; and (ii) a sense strand of 19-50 nucleotides in length, wherein the sense strand comprises the complementary region of the antisense strand and a stem loop at the 3' end, wherein the complementary region of the antisense strand is as shown in SEQ ID NO: NO: 2249, wherein the stem loop is as shown in S1-L-S2, wherein S1 and S2 complement each other, and wherein L forms a loop of 3 to 5 nucleotides in length between S1 and S2, wherein the antisense strand and the sense strand are independent strands forming an asymmetric duplex region, and the duplex region has an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1721; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand and 3' The terminal stem loop, in which the complementary region of the antisense strand is as shown in SEQ ID NO: 2105, wherein the stem loop is as shown in S1-L-S2, wherein S1 and S2 are complementary, and wherein L is formed between S1 and S2 A loop of 3 to 5 nucleotides in length, in which the antisense and sense strands are independent strands forming an asymmetric duplex region with 1 to 4 nucleotides at the 3' end of the antisense strand Nucleotide overhang.

In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is as shown in SEQ ID NO: 1847; and (ii) a sense strand of 19-50 nucleotides in length, wherein the sense strand comprises the complementary region of the antisense strand and a stem loop at the 3' end, wherein the complementary region of the antisense strand is as shown in SEQ ID NO: NO: 2231, wherein the stem loop is as shown in S1-L-S2, wherein S1 and S2 complement each other, and wherein L forms a loop of 3 to 5 nucleotides in length between S1 and S2, wherein the antisense strand and the sense strand are independent strands forming an asymmetric duplex region, and the duplex region has an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence. A nucleotide sequence, wherein the complementary region is as shown in SEQ ID NO: 1846; and (ii) a sense strand of 19-50 nucleotides in length, the sense strand comprising the complementary region of the antisense strand and 3' The terminal stem loop, in which the complementary region of the antisense strand is as shown in SEQ ID NO: 2230, wherein the stem loop is as shown in S1-L-S2, wherein S1 and S2 are complementary, and wherein L is formed between S1 and S2 A loop of 3 to 5 nucleotides in length, in which the antisense and sense strands are independent strands forming an asymmetric duplex region with 1 to 4 nucleotides at the 3' end of the antisense strand Nucleotide overhang.

In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is as shown in SEQ ID NO: 1955; and (ii) a sense strand of 19-50 nucleotides in length, wherein the sense strand comprises the complementary region of the antisense strand and a stem loop at the 3' end, wherein the complementary region of the antisense strand is as shown in SEQ ID NO: NO: 2339, wherein the stem loop is as shown in S1-L-S2, wherein S1 and S2 complement each other, and wherein L forms a loop of 3 to 5 nucleotides in length between S1 and S2, wherein the antisense strand and the sense strand are independent strands forming an asymmetric duplex region, and the duplex region has an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is set forth in SEQ ID NO: 1846; and (ii) a sense strand of 19-25 nucleotides in length, wherein the sense strand comprises a complementary region of the antisense strand, wherein the complementary region of the antisense strand is set forth in SEQ ID NO: 2230, wherein the oligonucleotide comprises a blunt end comprising the 3' end of the sense strand, and wherein the antisense strand and the sense strand are separate strands that form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3' end of the antisense strand.

In some embodiments, an oligonucleotide is used to reduce SNCA gene expression and comprises a sense strand and an antisense strand according to the following: Sense strand: 5'-mX- S -mX-fX-mX-fX-mX-mX-fX-mX-fX-mX-fX-mX-fX-mX-fX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-[ademX-GalNAcl[ademX-GalNAc][ademX-GalNAc]-mX-mX-mX-mX-mX-mX-3'; hybridized to: Antisense strand: 5'-[Mephosphonate-4O-mX] -S -fX- S -fX-fX-fX-mX-fX-mX-mX-mX-mX-fX-mX-mX-fX-mX-fX-mX-fX-mX- S -mX- S -mX-3'; wherein mX = 2'-OMe modified nucleotide, fX = 2'-F modified nucleotide, -S- = phosphorothioate linkage, - = phosphodiester linkage, [Mephosphonate-4O-mX] = 4'-O-monomethylphosphonate-2'-O-methyl modified nucleotide, and ademX-GalNAc = GalNAc attached to the nucleotide.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and include sense and antisense according to the following: sense: 5'-[AdemX-L] -S -mX-fX-mX- fX-mX-mX-fX-mX-fX-mX-fX-fX-mX-fX-mX-fX-mX- S -mX- S -mX-3'; hybridize to: antisense strand: 5'-[ Me phosphonate-4O-mX]- S -fX- S -fX-fX-fX-mX-fX-mX-mX-fX-mX-mX-mX-fX-mX-fX-mX-mX-fX- mX- S -mX- S -mX-3'; where mX = 2'-OMe modified nucleotide, fX = 2'-F modified nucleotide, - S - = phosphorothioate linkage , -=phosphodiester linkage, [Mephosphonate-4O-mX]=nucleotide modified with 4'-O-monomethylphosphonate-2'-O-methyl, and ademX-L =lipid moiety attached to nucleotides.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and include sense and antisense according to the following: sense: 5'-[AdemX-C ₁₆ ] -S -mX-fX-mX -fX-mX-mX-fX-mX-fX-mX-fX-fX-mX-fX-mX-fX-mX- S -mX- S -mX-3'; hybridize to: antisense strand: 5'- [Me Phosphonate-4O-mX] -S -fX- S -fX-fX-fX-mX-fX-mX-mX-fX-mX-mX-mX-fX-mX-fX-mX-mX-fX -mX- S -mX- S -mX-3'; where mX = 2'-OMe modified nucleotide, fX = 2'-F modified nucleotide, - S - = phosphorothioate bond linkage, -=phosphodiester linkage, [Mephosphonate-4O-mX]=nucleotide modified with 4'-O-monomethylphosphonate-2'-O-methyl, and ademX- C ₁₆ = C ₁₆ hydrocarbon chain attached to a nucleotide.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from the group consisting of: a) SEQ ID NO: 1607 and 1642 respectively; b) SEQ ID NO: 1608 and 1643 respectively; c) SEQ ID NO: 1609 and 1644 respectively; d) SEQ ID NO: 1610 and 1645 respectively; e) SEQ ID NO: 1610 and 1645 respectively; SEQ ID NO: 1611 and 1646; f) SEQ ID NO: 1612 and 1647 respectively; g) SEQ ID NO: 1613 and 1648 respectively; h) SEQ ID NO: 1614 and 1649 respectively; i) SEQ ID NO: 1614 and 1649 respectively; i) SEQ ID NO: 1613 and 1648 respectively; NO: 1615 and 1650; j) are SEQ ID NO: 1616 and 1651 respectively; k) are SEQ ID NO: 1617 and 1652 respectively; l) are SEQ ID NO: 1618 and 1653 respectively; m) are SEQ ID NO: 1619 and 1654; n) are SEQ ID NO: 1620 and 1655 respectively; o) are SEQ ID NO: 1621 and 1656 respectively; p) are SEQ ID NO: 1622 and 1657 respectively; q) are SEQ ID NO: 1623 and 1656 respectively. 1658; r) are SEQ ID NO: 1624 and 1659 respectively; s) are SEQ ID NO: 1625 and 1660 respectively; t) are SEQ ID NO: 1626 and 1661 respectively; u) are SEQ ID NO: 1627 and 1662 respectively; v) SEQ ID NO: 1628 and 1663 respectively; w) SEQ ID NO: 1629 and 1664 respectively; x) SEQ ID NO: 1630 and 1665 respectively; y) SEQ ID NO: 1631 and 1666 respectively; z) SEQ ID NO: 1632 and 1667 respectively; aa) SEQ ID NO: 1633 and 1668 respectively; bb) SEQ ID NO: 1634 and 1669 respectively; cc) SEQ ID NO: 1635 and 1670 respectively; dd) respectively SEQ ID NO: 1636 and 1671; ee) are SEQ ID NO: 1637 and 1672, respectively; ff) are SEQ ID NO: 1638 and 1673, respectively; gg) are SEQ ID NO: 1639 and 1674, respectively; hh) are SEQ ID NO: 1639 and 1674, respectively. NO: 1640 and 1675; ii) SEQ ID NO: 1641 and 1676 respectively; and jj) SEQ ID NO: 1682 and 1656 respectively.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from the group consisting of: a) SEQ ID NO: 1610 and 1645 respectively; b) SEQ ID NO: 1614 and 1649 respectively; c) SEQ ID NO: 1616 and 1651 respectively; d) SEQ ID NO: 1621 and 1656 respectively; e) SEQ ID NO: 1621 and 1656 respectively; SEQ ID NO: 1622 and 1657; f) SEQ ID NO: 1623 and 1658, respectively; g) SEQ ID NO: 1629 and 1664, respectively; h) SEQ ID NO: 1630 and 1665, respectively; i) SEQ ID NO: 1629 and 1664, respectively. NO: 1634 and 1669; j) SEQ ID NO: 1635 and 1670 respectively; k) SEQ ID NO: 1636 and 1671 respectively; l) SEQ ID NO: 1640 and 1675 respectively; and m) SEQ ID NO respectively. :1682 and 1656.

In some embodiments, oligonucleotides are used to reduce SNCA gene expression and comprise a sense strand and an antisense strand, the sense strand and the antisense strand comprising a nucleotide sequence selected from the group consisting of: a) SEQ ID NO: 1623 and 1658 respectively; b) SEQ ID NO: 1630 and 1665 respectively; c) SEQ ID NO: 1634 and 1669 respectively; d) SEQ ID NO: 1621 and 1656 respectively; e) SEQ ID NO: 1621 and 1656 respectively; SEQ ID NO: 1640 and 1675; and f) are SEQ ID NO: 1682 and 1656 respectively.

In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises a sense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 1623 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 1658. In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises a sense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 1630 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 1665. In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises a sense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 1634 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 1669. In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises a sense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 1621 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 1656. In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises a sense strand comprising a nucleotide sequence as shown in SEQ ID NO: 1640 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 1675. In some embodiments, the oligonucleotide is used to reduce SNCA gene expression and comprises a sense strand comprising a nucleotide sequence as shown in SEQ ID NO: 1682 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 1656.

Preparation

A variety of formulations have been developed to facilitate the use of oligonucleotides. For example, oligonucleotides (e.g., RNAi oligonucleotides) can be delivered to an individual or cellular environment using formulations that minimize degradation, facilitate delivery and/or uptake, or provide another beneficial property to the oligonucleotide in the formulation. In some embodiments, the formulation is a composition comprising an oligonucleotide that reduces SNCA gene expression. Such compositions can be appropriately formulated so that when administered to the immediate environment of a target cell or systemically to an individual, a sufficient portion of the oligonucleotide enters the cell to reduce SNCA gene expression. Any type of suitable oligonucleotide formulation can be used to deliver an oligonucleotide for reducing SNCA gene expression. In some embodiments, the oligonucleotide is formulated in a buffered solution, such as a phosphate-buffered saline solution, a liposome, a colloid structure, and a capsid. In other embodiments, the oligonucleotide is formulated in a buffered solution, such as a phosphate-buffered saline solution.

Formulations of oligonucleotides and cationic lipids can be used to facilitate transfection of oligonucleotides into cells. For example, cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine) can be used. Suitable lipids include oligofectamine, lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc.; Boulder, CO), or FuGene 6 (Roche), all of which can be used according to the manufacturer's instructions. In some embodiments, the oligonucleotide is not formulated with a component that facilitates transfection into cells.

Thus, in some embodiments, the formulation comprises lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres or nanoparticles, or may be formulated in other ways for administration to cells, tissues, organs or bodies of individuals in need thereof (see, e.g., Remington: THE SCIENCE AND PRACTICE OF PHARMACY, 22nd edition, Pharmaceutical Press, 2013).

In some embodiments, the formulation comprises an excipient that imparts improved stability, improved absorption, improved solubility, and/or therapeutic enhancement of the active ingredient to the composition. In some embodiments, the excipient is a buffer (e.g., sodium citrate, sodium phosphate, tris alkali, or sodium hydroxide) or a vehicle (e.g., a buffer solution, wax, dimethyl sulfoxide, or mineral oil). In some embodiments, the oligonucleotide is lyophilized to extend its shelf life and then made into a solution prior to use (e.g., administration to a subject). Thus, the excipient may be a lyoprotectant (e.g., mannitol, lactose, polyethylene glycol or polyvinyl pyrrolidone) or a disintegration temperature regulator (e.g., dextran, Ficoll ^™ or gelatin).

In some embodiments, the formulation is a pharmaceutical composition that is compatible with its intended route of administration. Examples of routes of administration include, but are not limited to, parenteral (e.g., intravenous, intramuscular, intraperitoneal, intradermal, subcutaneous), oral (e.g., inhalation), transdermal (e.g., topical), transmucosal, and rectal administration.

In some embodiments, the formulations are formulated for administration into the CNS. In some embodiments, the formulations are formulated for administration into cerebrospinal fluid. In some embodiments, the formulations are formulated for administration to the spinal cord. In some embodiments, the formulations are formulated for intrathecal administration. In some embodiments, the formulations are formulated for administration to the brain. In some embodiments, the formulations are formulated for intracerebroventricular administration. In some embodiments, the formulations are formulated for use in the brainstem. In some embodiments, the formulations are formulated for in-pool administration.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL ^™ (BASF; Parsippany, NJ), or phosphate buffered saline (PBS). The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (eg, glycerin, propylene glycol, and liquid polyethylene glycols and the like) and suitable mixtures thereof. In many cases, it is preferred to include isotonic agents in the composition, for example, sugars, polyols (such as mannitol, sorbitol), sodium chloride. Sterile injectable solutions can be prepared by incorporating the oligonucleotide in the required amount in the solvent of choice with one or a combination of ingredients enumerated above, followed by filtered sterilization, if necessary.

In some embodiments, the formulation may contain at least about 0.1% oligonucleotide or more, but the percentage of active ingredient may range from about 1% to about 80% or more of the total composition weight or volume. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations will be anticipated by those skilled in the art of preparing such pharmaceutical formulations, and therefore a variety of dosages and treatment regimens may be required.

Instructions Reduce SNCA performance

In some embodiments, the method of contacting or delivering to a cell or cell population comprises administering an effective amount of an oligonucleotide (e.g., an RNAi oligonucleotide) to reduce SNCA gene expression. In some embodiments, the reduction in SNCA gene expression is determined by measuring a reduction in the amount or level of SNCA mRNA, SNCA protein, SNCA activity, or a combination thereof in the cell. Such methods include those described herein and those known to those of ordinary skill in the art.

In some embodiments, the method of reducing SNCA gene expression in the CNS comprises administering an effective amount of an oligonucleotide (e.g., an RNAi oligonucleotide) to reduce SNCA gene expression. In some embodiments, the CNS includes the brain and spinal cord. In some embodiments, SNCA gene expression is reduced in at least one brain region, including but not limited to the cervical spinal cord, thoracic spinal cord, lumbar spinal cord, frontal cortex, temporal cortex, cerebellum, midbrain, occipital cortex, parietal cortex, hippocampus, caudate nucleus, thalamus, and brain stem. In some embodiments, SNCA gene expression is reduced in at least one spinal cord region, including but not limited to the cervical spinal cord, thoracic spinal cord, and lumbar spinal cord. In some embodiments, SNCA gene expression is reduced in at least one brain region and at least one spinal cord region. In some embodiments, SNCA gene expression is decreased in at least one of the following: cervical spinal cord, thoracic spinal cord, lumbar spinal cord, frontal cortex, temporal cortex, cerebellum, midbrain, occipital cortex, parietal cortex, hippocampus, caudate nucleus, thalamus, brain stem, motor cortex, globus pallidus, midbrain tegmentum, substantia nigra, pons, cerebellar white matter, and cerebellar dentate nucleus. In some embodiments, SNCA gene expression is decreased in at least one of lumbar spinal cord, thoracic spinal cord, and cervical spinal cord. In some embodiments, SNCA gene expression is decreased in brain and/or spinal cord tissues associated with Parkinson's disease. In some embodiments, tissues associated with Parkinson's disease include, but are not limited to, putamen, midbrain tegmentum, substantia nigra, pons, and medulla. In some embodiments, SNCA gene expression is reduced in brain and/or spinal cord tissues associated with multiple system atrophy. In some embodiments, tissues associated with Parkinson's disease include, but are not limited to, the caudate nucleus, putamen, midbrain tegmentum, substantia nigra, pons, cerebellar cortex, cerebellar white matter, medulla, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord.

In some embodiments, the SNCA gene expression is reduced for about 1 week to about 12 weeks after administration of the oligonucleotide or formulation comprising the same. In some embodiments, SNCA gene expression is reduced for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks after administration of the oligonucleotide or formulation. In some embodiments, the SNCA gene expression is reduced for about 1 month to about 4 months after administration of the oligonucleotide or formulation. In some embodiments, the SNCA gene expression is reduced for about 1 month to about 6 months after administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression persists for 1, 2, 3, or 4 months following administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression persists for 1, 2, 3, 4, 5, or 6 months following administration of the oligonucleotide or formulation. In some embodiments, the SNCA gene expression is reduced for about 7 days to about 91 days after administration of the oligonucleotide or formulation. In some embodiments, SNCA gene expression is reduced for 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, or 91 days after administration of the oligonucleotide or formulation.

In some embodiments, the reduction in SNCA gene expression in at least one brain region and/or at least one spinal cord region persists for about 1 to about 12 weeks after administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression in at least one brain region and/or at least one spinal cord region persists for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks after administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression in at least one brain region and/or at least one spinal cord region persists for about 1 month to about 4 months after administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression in at least one brain region and/or at least one spinal cord region persists for about 1 month to about 6 months after administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression in at least one brain region and/or at least one spinal cord region persists for 1, 2, 3, or 4 months after administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression in at least one brain region and/or at least one spinal cord region persists for 1, 2, 3, 4, 5, or 6 months after administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression in at least one brain region and/or at least one spinal cord region persists for about 7 days to about 91 days after administration of the oligonucleotide or formulation. In some embodiments, the reduction in SNCA gene expression in at least one brain region and/or at least one spinal cord region persists for 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, or 91 days after administration of the oligonucleotide or formulation.

The methods herein can be used with any appropriate cell type. In some embodiments, the cell type is any cell that expresses SNCA mRNA (e.g., an oligodendrocyte). In some embodiments, the cell type is a primary cell obtained from an individual. In some embodiments, the primary cell has been passaged a limited number of times such that the cell substantially maintains its native phenotypic properties. In some embodiments, the cell to which the oligonucleotide is delivered is ex vivo or in vitro (i.e., can be delivered to a cell in culture or an organism in which the cell is located).

In some embodiments, oligonucleotides are delivered to cells or populations of cells using nucleic acid delivery methods known in the art, including, but not limited to, injection of a solution or pharmaceutical composition containing the oligonucleotide (i.e., formulations), bombardment with oligonucleotide-coated particles, exposure of cells or cell populations to a solution containing oligonucleotides, or electroporation of cell membranes in the presence of oligonucleotides. Other methods known in the art for delivering oligonucleotides to cells can be used, such as lipid-mediated carrier transport, chemically mediated transport, and cationic liposome transfection, such as calcium phosphate and others.

In some embodiments, reduction of SNCA gene expression is determined by an assay or technique that evaluates one or more molecules, properties, or characteristics of a cell or cell population that are associated with SNCA gene expression, or by an assay or technique that evaluates a molecule that directly indicates SNCA gene expression in a cell or cell population (e.g., SNCA mRNA or SNCA protein). In some embodiments, the extent to which an oligonucleotide reduces SNCA gene expression is assessed by comparing SNCA gene expression in a cell or cell population contacted with an oligonucleotide to a control cell or cell population (e.g., a cell or cell population not contacted with an oligonucleotide or contacted with a control oligonucleotide ). In some embodiments, a control amount or level of SNCA gene expression in a control cell or cell population is predetermined, such that the control amount or level need not be measured in every instance of performing an assay or technique. The predetermined level or value can take a variety of forms. In some embodiments, the predetermined level or value can be a single cutoff value, such as a median or mean.

In some embodiments, contacting an oligonucleotide with a cell or cell population or delivering an oligonucleotide to a cell or cell population results in a decrease in SNCA gene expression. In some embodiments, the decrease in SNCA gene expression is relative to a control amount or level of SNCA gene expression in a cell or cell population that has not been contacted with the oligonucleotide or has been contacted with a control oligonucleotide. In some embodiments, the reduction in SNCA gene expression is about 1% or less, about 5% or less, about 10% or less, about 15% or less, about 20% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, about 45% or less, about 50% or less, about 55% or less, about 60% or less, about 70% or less, about 80% or less, or about 90% or less relative to a control amount or level of SNCA gene expression. In some embodiments, a control amount or level of SNCA gene expression is the amount or level of SNCA mRNA and/or SNCA protein and/or SNCA activity/function in a cell or cell population that has not been exposed to an oligonucleotide. In some embodiments, the effect of delivering an oligonucleotide to a cell or cell population according to the methods herein is assessed after any finite period or amount of time (e.g., minutes, hours, days, weeks, months). For example, in some embodiments, SNCA gene expression is determined in a cell or a population of cells at least about 4 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours; or at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, about 56 days, about 63 days, about 70 days, about 77 days, or about 84 days or more after contacting the oligonucleotide with the cell or cell population or delivering the oligonucleotide to the cell or cell population. In some embodiments, SNCA gene expression is determined in a cell or a cell population at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, or about 6 months or more after contacting the oligonucleotide with or delivering the oligonucleotide to the cell or cell population.

In some embodiments, the oligonucleotide is delivered in the form of a transgene that is engineered to express the oligonucleotide or comprises strands of the oligonucleotide (e.g., its sense strand and antisense strand) in a cell. In some embodiments, the oligonucleotide is delivered using a transgene that is engineered to express any oligonucleotide. The transgene may be delivered using a viral vector (e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus) or a non-viral vector (e.g., plasmid or synthetic mRNA). In some embodiments, the transgene may be injected directly into an individual.

Treatment

Also provided are oligonucleotides (e.g., RNAi oligonucleotides) for use in or suitable for use in the treatment of individuals who would benefit from reduced expression of the SNCA gene (e.g., persons suffering from a disease, condition or disorder associated with expression of SNCA ). In some aspects, the present disclosure provides oligonucleotides useful or suitable for treating individuals suffering from a disease, condition or disorder associated with manifestations of SNCA . Also provided are oligonucleotides useful or suitable for use in the manufacture of medicaments or formulations/pharmaceutical compositions for the treatment of diseases, conditions or disorders associated with expression of the SNCA gene. In some embodiments, oligonucleotides used or adapted for use target SNCA mRNA and reduce SNCA gene expression (eg, via an RNAi pathway). In some embodiments, oligonucleotides used or adapted for use target SNCA mRNA and reduce the amount or level of SNCA mRNA, SNCA protein, and/or SNCA activity/function.

Additionally, in some embodiments of the methods herein, individuals who have or are susceptible to a disease, condition, or disorder associated with manifestations of SNCA are selected for treatment with an oligonucleotide or formulation. In some embodiments, the method includes selecting individuals who have markers (e.g., biomarkers) of, or are susceptible to, a disease, disorder, or disorder associated with expression of the SNCA gene, such as, but not Limited to SNCA mRNA, SNCA protein, SNCA activity/function, or combinations thereof. Likewise, and as described in detail below, some embodiments of the methods include steps such as measuring or obtaining a baseline value for a marker of SNCA gene expression and then comparing this obtained value to one or more other baseline values or at The values obtained after administration of oligonucleotides to individuals are compared to assess the effectiveness of the treatment.

Provided herein are methods of treating an individual having, suspected of having, or at risk of having a disease, disorder, or condition associated with SNCA gene expression with an oligonucleotide or formulation. In some aspects, provided herein are methods of using an oligonucleotide or formulation to treat a disease, disorder, or condition associated with SNCA gene expression or to reduce the onset or progression thereof. In other aspects, provided herein are methods of using an oligonucleotide or formulation to achieve one or more therapeutic benefits in an individual having a disease, disorder, or condition associated with SNCA gene expression. In some embodiments, the individual is treated by administering a therapeutically effective amount of any one or more of the oligonucleotides provided herein. In some embodiments, treatment comprises reducing SNCA gene expression. In some embodiments, the individual is treated therapeutically. In other embodiments, the individual is treated prophylactically.

In some embodiments of the methods herein, an oligonucleotide, or a pharmaceutical composition comprising the oligonucleotide, is administered to an individual suffering from a disease, disorder, or disorder associated with expression of SNCA such that the SNCA gene is expressed in the individual. reduce, thereby treating the individual. In some embodiments, the amount or level of SNCA mRNA is reduced in an individual. In some embodiments, the amount or level of SNCA protein is reduced in the subject. In other embodiments, the amount or level of SNCA activity/function is reduced in the subject.

In some embodiments, an oligonucleotide or a pharmaceutical composition/formulation comprising the oligonucleotide is administered to an individual suffering from a disease, disorder or condition associated with SNCA gene expression such that SNCA expression in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to SNCA expression prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments of the methods herein, an oligonucleotide or pharmaceutical composition is administered to an individual having a disease, disorder or condition associated with SNCA gene expression such that SNCA expression in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% for about 1 week to about 12 weeks, about 1 month to about 6 months, or about 7 days to about 91 days, as compared to SNCA expression prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, SNCA expression in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to SNCA expression in a subject that did not receive the oligonucleotide or pharmaceutical composition or received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject). In some embodiments, SNCA expression in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% for about 1 week to about 12 weeks, about 1 month to about 6 months, or about 7 days to about 91 days when compared to SNCA expression in a subject not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

In some embodiments of the methods herein, an oligonucleotide or pharmaceutical composition is administered to an individual suffering from a disease, disorder or condition associated with SNCA gene expression such that the amount or level of SNCA mRNA in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of SNCA mRNA prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments of the methods herein, an oligonucleotide or pharmaceutical composition is administered to an individual suffering from a disease, disorder or condition associated with SNCA gene expression such that the amount or level of SNCA mRNA in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% for about 1 week to about 12 weeks, about 1 month to about 6 months, or about 7 days to about 91 days, as compared to the amount or level of SNCA mRNA prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of SNCA mRNA in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of SNCA mRNA in a subject that did not receive the oligonucleotide or pharmaceutical composition or that received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject). In some embodiments, the amount or level of SNCA mRNA in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% for about 1 week to about 12 weeks, about 1 month to about 6 months, or about 7 days to about 91 days when compared to the amount or level of SNCA mRNA in a subject that did not receive the oligonucleotide or pharmaceutical composition or received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

In some embodiments of the methods herein, the oligonucleotide or pharmaceutical composition is administered to an individual suffering from a disease, disorder, or disorder associated with expression of the SNCA gene such that the oligonucleotide or pharmaceutical composition is administered to an individual. The amount or level of SNCA protein in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, About 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99% or greater than 99%. In some embodiments of the methods herein, the oligonucleotide or pharmaceutical composition is administered to an individual suffering from a disease, disorder, or disorder associated with expression of the SNCA gene such that the oligonucleotide or pharmaceutical composition is administered to an individual. The amount or level of SNCA protein in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, About 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99% or greater than 99%, lasting about 1 week to about 12 weeks, about 1 month to about 6 months or about 7 days to about 91 days. In some embodiments, when compared to the amount or level of SNCA protein in an individual that did not receive the oligonucleotide or pharmaceutical composition or that received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control individual) when the amount or level of SNCA protein in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75% %, about 80%, about 85%, about 90%, about 95%, about 99% or greater than 99%. In some embodiments, when compared to the amount or level of SNCA protein in an individual that did not receive the oligonucleotide or pharmaceutical composition or that received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control individual) when the amount or level of SNCA protein in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75% %, about 80%, about 85%, about 90%, about 95%, about 99% or greater than 99%, lasting about 1 week to about 12 weeks, about 1 month to about 6 months, or about 7 days to about 91 sky.

In some embodiments of the methods herein, the oligonucleotide or pharmaceutical composition is administered to an individual suffering from a disease, disorder, or disorder associated with expression of the SNCA gene such that the oligonucleotide or pharmaceutical composition is administered to an individual. The amount or level of SNCA activity/function in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, About 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99% or greater than 99%. In some embodiments of the methods herein, the oligonucleotide or pharmaceutical composition is administered to an individual suffering from a disease, disorder, or disorder associated with expression of the SNCA gene such that the oligonucleotide or pharmaceutical composition is administered to an individual. The amount or level of SNCA activity/function in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, About 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99% or greater than 99%, lasting about 1 week to about 12 weeks, about 1 months to about 6 months or about 7 days to about 91 days. In some embodiments, the amount or level of SNCA activity/function in an individual (e.g., a reference or control individual) that does not receive an oligonucleotide or pharmaceutical composition or that receives a control oligonucleotide, pharmaceutical composition, or treatment is determined when compared to The amount or level of SNCA activity/function in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70 %, about 75%, about 80%, about 85%, about 90%, about 95%, about 99% or greater than 99%. In some embodiments, the amount or level of SNCA activity/function in an individual (e.g., a reference or control individual) that does not receive an oligonucleotide or pharmaceutical composition or that receives a control oligonucleotide, pharmaceutical composition, or treatment is determined when compared to The amount or level of SNCA activity/function in the individual is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70 %, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99%, lasting about 1 week to about 12 weeks, about 1 month to about 6 months, or about 7 days to about 91 days.

Suitable methods for determining SNCA gene expression (such as SNCA expression), the amount or level of SNCA mRNA, the amount or level of SNCA protein, and/or the amount or level of SNCA activity/function in an individual or in a sample from an individual are described herein. is known in the art. Additionally, the examples set forth herein illustrate exemplary methods for determining SNCA gene expression.

In some embodiments, SNCA gene expression (e.g., SNCA expression), the amount or level of SNCA mRNA, the amount or level of SNCA protein, the amount or level of SNCA activity/function, or any combination thereof is reduced in a cell (e.g., oligodendrocyte), a cell population or a group of cells (e.g., an organoid), an organ (e.g., frontal cortex), blood or a portion thereof (e.g., plasma ), a tissue (e.g., brain tissue), a sample ( e.g. , a brain biopsy sample), or any other biological material obtained or isolated from an individual. In some embodiments, SNCA expression, the amount or level of SNCA mRNA, the amount or level of SNCA protein, the amount or level of SNCA activity/function, or any combination thereof is reduced in more than one type of cell (e.g., oligodendrocytes and one or more other types of cells), more than one tissue cell, more than one organ (e.g., brain and one or more other organs), more than one blood fraction (e.g., plasma and one or more other blood fractions), more than one type of tissue (e.g., brain tissue and one or more other types of tissue), more than one type of sample (e.g., a brain biopsy sample and one or more other types of biopsy samples) obtained or isolated from an individual. In some embodiments, SNCA expression, amount or level of SNCA mRNA, amount or level of SNCA protein, amount or level of SNCA activity/function, or any combination thereof, is decreased in one or more of the cervical spinal cord, thoracic spinal cord, lumbar spinal cord, frontal cortex, temporal cortex, cerebellum, midbrain, occipital cortex, parietal cortex, hippocampus, caudate nucleus, thalamus, brain stem, motor cortex, globus pallidus, midbrain tegmentum, substantia nigra, pons, cerebellar white matter, and cerebellar dentate nucleus. In some embodiments, SNCA expression, amount or level of SNCA mRNA, amount or level of SNCA protein, amount or level of SNCA activity/function, or any combination thereof, is decreased in brain and/or spinal cord tissues associated with Parkinson's disease. In some embodiments, tissues associated with Parkinson's disease include, but are not limited to, putamen, midbrain tegmentum, substantia nigra, pons, and medulla. In some embodiments, SNCA expression, amount or level of SNCA mRNA, amount or level of SNCA protein, amount or level of SNCA activity/function, or any combination thereof, is decreased in brain and/or spinal cord tissues associated with multiple system atrophy. In some embodiments, tissues associated with multiple system atrophy include, but are not limited to, caudate nucleus, putamen, midbrain tegmentum, substantia nigra, pons, cerebellar cortex, cerebellar white matter, medulla, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord.

Examples of diseases, disorders, or disorders associated with expression of the SNCA gene include multiple system atrophy, dementia with Lewy bodies, and Parkinson's disease.

Due to their high specificity, the oligonucleotides herein specifically target the SNCA mRNA of target genes in cells, tissues or organs (eg, brain). In preventing disease, the target gene may be a gene that is required to initiate or maintain a disease or that has been identified as being associated with a higher risk of infectious disease. In treating a disease, the oligonucleotide can be brought into contact with cells, tissues or organs (eg, the brain) that exhibit or are responsible for mediating the disease. For example, a cell or tissue type of interest can be contacted with an oligonucleotide that is substantially identical to all or part of a wild-type (i.e., native) or mutant gene associated with a disease, condition, or disorder associated with expression of the SNCA gene. (such as oligodendritic cells or other brain cells) or introduced therein.

In some embodiments, SNCA can be derived from any mammal, such as humans, and can be silenced according to the methods described herein.

The methods herein typically involve administering to an individual a therapeutically effective amount of an oligonucleotide, that is, an amount capable of producing the desired therapeutic result. A therapeutically acceptable amount may be an amount effective to treat the disease, condition, or disorder in accordance with the therapeutic regimen. The appropriate amount/dosage for any individual will depend on certain factors, including the individual's size, body surface area, age, the particular composition to be administered, the active ingredients in the composition, time and route of administration, and general health. conditions and concurrent administration of other medications.

In some embodiments, any of the oligonucleotides or compositions herein are administered to a subject enterally (e.g., orally, by a gastric tube, by a duodenal tube, by gastrostomy, or rectally), parenterally (e.g., subcutaneous injection, intravenous injection or infusion, intraarterial injection or infusion, intraosseous infusion, intramuscular injection, intracerebral injection, intraventricular injection, intrathecal), topically (e.g., epidermally, by inhalation, by eye drops, or transmucosal), or by direct injection into a target organ (e.g., the brain of a subject). Typically, the oligonucleotide or composition is administered intravenously or subcutaneously. In some embodiments, the oligonucleotide or composition is administered to the cerebrospinal fluid. In some embodiments, the oligonucleotide or composition is administered intrathecally. In some embodiments, the oligonucleotide or composition is administered intraventricularly. In some embodiments, the oligonucleotide or composition is administered by intracisternal injection.

As a set of non-limiting examples, oligonucleotides will typically be administered quarterly (once every three months), bimonthly (once every two months), monthly, or weekly. For example, oligonucleotides can be administered weekly or at two- or three-week intervals. Alternatively, the oligonucleotide can be administered daily. In some embodiments, an individual is administered one or more loading doses of an oligonucleotide, followed by one or more maintenance doses of an oligonucleotide.

In some embodiments, the subject to be treated is a human or non-human primate or other mammalian subject. Other exemplary subjects include domestic animals such as dogs and cats; livestock such as horses, cows, pigs, sheep, goats, and chickens; and animals such as mice, rats, guinea pigs, and hamsters.

set

In some embodiments, a kit comprising an oligonucleotide described herein (e.g., an RNAi oligonucleotide) and instructions for use thereof is provided. In some embodiments, the kit comprises an oligonucleotide and a package insert containing instructions for use of the kit and/or any of its components. In some embodiments, the kit comprises an oligonucleotide, one or more controls, and various buffers, reagents, enzymes, and other standard components well known in the art in a suitable container. In some embodiments, the container comprises at least one vial, well, test tube, flask, bottle, syringe, or other container tool, in which the oligonucleotide is placed and in some cases appropriately aliquoted. In some embodiments in which additional components are provided, the kit contains additional containers in which such components are placed. The kit may also include tools for containing oligonucleotides and any other reagents in a confined space for commercial sale. Such containers may include injection molded or blow molded plastic containers in which the desired vials are retained. The container and/or kit may include a label with instructions for use and/or warnings.

In some embodiments, the kit comprises an oligonucleotide and a pharmaceutically acceptable carrier or pharmaceutical composition and instructions for treating or delaying the progression of a disease, disorder or condition associated with SNCA gene expression in a subject in need thereof.

In some embodiments, the kit comprises an oligonucleotide and a pharmaceutically acceptable carrier or pharmaceutical composition, and instructions for administering the oligonucleotide or pharmaceutical composition to the cerebrospinal fluid to reduce SNCA gene expression in at least one brain region and/or at least one spinal cord region in a subject in need thereof.

Definition

As used herein, "approximately" or "about" when applied to one or more values of interest refers to values that are similar to the stated reference value. In certain embodiments, "approximately" refers to a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less) of the stated reference value, unless otherwise specified or otherwise apparent from the context (unless such a value would exceed 100% of the possible value).

As used herein, "administer/administering/administration" and similar terms refer to providing a substance (e.g., an oligonucleotide) to a subject in a manner that is pharmacologically useful (e.g., to treat a disease, disorder, or condition in the subject).

As used herein, "asialoglycoprotein receptor" or "ASGPR" refers to a bisected C-type lectin formed by a major 48 kDa subunit (ASGPR-1) and a minor 40 kDa subunit (ASGPR-2). ASGPR is primarily expressed on the sinusoidal surface of hepatocytes and plays a major role in the binding, internalization, and subsequent clearance of circulating glycoproteins (asialoglycoproteins) containing terminal galactose or GalNAc residues.

As used herein, "attenuate/attenuating/attenuation" and similar terms mean to reduce or effectively prevent. As a non-limiting example, one or more treatments herein may reduce or effectively prevent the onset or progression of a disease, disorder, or condition associated with SNCA gene expression in an individual. Such attenuation may be exemplified by, for example, a reduction in one or more aspects of the disease associated with expression of the SNCA gene (e.g., symptoms, tissue characteristics and cellular, inflammatory or immune activity, etc.) and no detection of the disease, condition or disorder. Progression (exacerbation) of one or more aspects of the disease, or the failure to detect in the individual aspects of the disease that might otherwise be expected.

As used herein, "complementarity" refers to a structural relationship between two nucleotides (e.g., on two opposing nucleic acids or on opposing regions of a single-stranded nucleic acid) that allows the two nucleotides to form bases for each other right. For example, purine nucleotides of one nucleic acid that are complementary to pyrimidine nucleotides of an opposing nucleic acid can base pair together by forming hydrogen bonds with each other. In some embodiments, complementary nucleotides may be base paired in a Watson-Crick manner or in any other manner that allows the formation of stable duplexes. In some embodiments, two nucleic acids can have regions of multiple nucleotides that are complementary to each other to form complementary regions, as described herein.

As used herein, "deoxyribonucleotide" refers to a nucleotide that has a hydrogen in place of a hydroxyl group at the 2' position of its pentose sugar when compared to a ribonucleotide. A modified deoxyribonucleotide is a deoxyribonucleotide that has one or more modifications or substitutions of atoms other than the 2' position, including modifications or substitutions within or within the sugar, phosphate group, or base group.

As used herein, "double-stranded oligonucleotide" or "ds oligonucleotide" refers to an oligonucleotide that is substantially in the form of a duplex. In some embodiments, complementary base pairing of duplex regions of a ds oligonucleotide is formed between antiparallel sequences of nucleotides in covalently separated nucleic acid strands. In some embodiments, complementary base pairing of duplex regions of a ds oligonucleotide is formed between antiparallel sequences of nucleotides in covalently linked nucleic acid strands. In some embodiments, complementary base pairing of duplex regions of a ds oligonucleotide is formed from single-stranded nucleic acids that are folded (e.g., via hairpins) to provide complementary antiparallel nucleotides that are base paired together. sequence. In some embodiments, a ds oligonucleotide comprises two strands of covalently separated nucleic acids that are complete duplexes with each other. However, in other embodiments, the ds oligonucleotide comprises two covalently separated nucleic acid strands that are partially a duplex (eg, with an overhang at one or both ends). In some embodiments, ds oligonucleotides comprise antiparallel sequences of partially complementary nucleotides, and thus may have one or more mismatches, which may include internal mismatches or terminal mismatches.

As used herein, "duplex" with respect to a nucleic acid (e.g., an oligonucleotide) refers to a structure formed by complementary base pairing of two antiparallel sequences of nucleotides.

As used herein, "excipient" refers to non-therapeutic agents that may be included in the composition, for example, to provide or contribute to a desired consistency or stabilizing effect.

As used herein, "labile linker" refers to a linker that is cleavable (eg, by acidic pH). "Relatively stable linker" refers to a non-cleavable linker.

As used herein, "loop" refers to an unpaired region of a nucleic acid (e.g., an oligonucleotide) flanked by two antiparallel regions of the nucleic acid that are sufficiently complementary to each other such that under appropriate hybridization conditions (e.g., in phosphate buffer, in a cell), the two antiparallel regions flanking the unpaired region hybridize to form a duplex (referred to as a "stem").

As used herein, a "modified internucleotide linkage" refers to an internucleotide linkage that has one or more chemical modifications when compared to a reference internucleotide linkage that includes a phosphodiester bond. In some embodiments, the modified nucleotides are non-naturally occurring linkages. Typically, a modified internucleotide linkage confers one or more desirable properties to the nucleic acid in which the modified internucleotide linkage is present. For example, modified nucleotides can improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, biological activity, reduced immunogenicity, and the like.

As used herein, "modified nucleotide" refers to a nucleotide that has one or more chemical modifications compared to a corresponding reference nucleotide selected from: adenine ribonucleotide, guanine ribonucleotide acid, cytosine ribonucleotides, uracil ribonucleotides, adenine deoxyribonucleotides, guanine deoxyribonucleotides, cytosine deoxyribonucleotides and thymidine deoxyribonucleotides acid. In some embodiments, the modified nucleotide is a non-naturally occurring nucleotide. In some embodiments, modified nucleotides have one or more chemical modifications in their sugar, nucleobase, and/or phosphate groups. In some embodiments, a modified nucleotide has one or more chemical moieties that bind to the corresponding reference nucleotide. Typically, modified nucleotides confer one or more desired properties to the nucleic acid in which the modified nucleotide is present. For example, Sutra Decorated nucleotides can improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, biological activity, reduced immunogenicity, etc.

As used herein, "nicked tetracyclic structure" or "nicked tetraL structure" refers to the structure of an oligonucleotide (e.g., an RNAi oligonucleotide) that is characterized by independent sense (passenger) strands and Antisense (lead) strands in which the sense strand has complementary regions of the antisense strand and at least one strand, typically the sense strand, has tetraL configured to stabilize adjacent stem regions formed within at least one strand.

As used herein, "oligonucleotide" refers to a short nucleic acid (e.g., less than about 100 nucleotides in length). An oligonucleotide may be ss or ds. An oligonucleotide may or may not have a duplex region. As a set of non-limiting examples, an oligonucleotide may be, but is not limited to, a small interfering RNA (siRNA), a microRNA (miRNA), a short hairpin RNA (shRNA), a Dicer substrate interfering RNA (dsiRNA), an antisense oligonucleotide, a short siRNA, or a ss siRNA. In some embodiments, the oligonucleotide is a ds oligonucleotide and is an RNAi oligonucleotide.

As used herein, "overhang" refers to a terminal non-basic paired nucleotide resulting from a strand or region extending beyond the end of a complementary strand that forms a duplex with the complementary strand. In some embodiments, the overhang comprises one or more unpaired nucleotides extending from the duplex region at the 5' end or 3' end of a ds oligonucleotide. In certain embodiments, the overhang is a 3' or 5' overhang on the antisense strand or sense strand of a ds oligonucleotide.

As used herein, "phosphate analog" refers to a chemical moiety that mimics the electrostatic and/or steric properties of a phosphate group. In some embodiments, the phosphate analog is located at the 5' terminal nucleotide of an oligonucleotide to replace the 5'-phosphate, which is often easily removed enzymatically. In some embodiments, the 5'-phosphate analog contains a phosphatase-resistant linkage. Examples of phosphate analogs include, but are not limited to, 5' phosphonates, such as 5' methylenephosphonate (5'-MP) and 5'-(E)-vinylphosphonate (5'-VP). In some embodiments, an oligonucleotide has a phosphate analog at the 4'-carbon position of the sugar at the 5' terminal nucleotide (referred to as a "4'-phosphate analog"). An example of a 4'-phosphate analog is an oxymethylphosphonate, in which the oxygen atom of the oxymethyl group is bound to the sugar moiety (e.g., at its 4'-carbon) or an analog thereof. See, e.g., U.S. Provisional Patent Application Nos. 62/383,207 (filed September 2, 2016) and 62/393,401 (filed September 12, 2016). Other modifications have been developed for the 5' end of oligonucleotides (see, e.g., International Patent Application No. WO 2011/133871; U.S. Patent No. 8,927,513; and Prakash et al. (2015) Nucleic Acids Res. 43:2993-3011).

As used herein, "SNCA" refers to synuclein alpha. SNCA is abundant in the brain and inhibits phospholipase D2. It plays a role in synaptic signaling and membrane trafficking. The mRNA encoding wild-type human SNCA is shown in SEQ ID NO: 1677. The mRNA encoding mouse SNCA is shown in SEQ ID NO: 1678. The mRNA encoding monkey SNCA is shown in SEQ ID NO: 1679.

As used herein, "reduced expression" of a gene (e.g., SNCA ) refers to a decrease in the amount or level of RNA transcripts (e.g., SNCA mRNA) or protein encoded by the gene and/or a decrease in the amount or level of activity/function of the gene and/or protein in a cell, cell population, sample or individual when compared to an appropriate reference (e.g., a reference cell, cell population, sample or individual). For example, the act of contacting a cell with an oligonucleotide (e.g., an oligonucleotide comprising an antisense strand having a nucleotide sequence complementary to a nucleotide sequence comprising SNCA mRNA, such as an RNAi oligonucleotide) can result in a decrease in the amount or level of SNCA mRNA, SNCA protein and/or SNCA activity/function (e.g., inactivation and/or degradation of SNCA mRNA via an RNAi pathway) when compared to a cell not treated with the oligonucleotide. Similarly, and as used herein, "reducing expression" refers to the act of causing the expression of a gene (e.g., SNCA ) to decrease.

As used herein, "decreased SNCA gene expression" means SNCA mRNA, SNCA protein, and/or SNCA protein in a cell, cell population, sample, or individual when compared to an appropriate reference (e.g., a reference cell, cell population, sample, or individual) Reduced amount or level of SNCA activity/function.

As used herein, "complementary region" refers to a sequence of nucleotides of a nucleic acid (e.g., a ds oligonucleotide) that is sufficiently complementary to an antiparallel sequence of nucleotides to allow hybridization between the two sequences of nucleotides under appropriate hybridization conditions (e.g., in phosphate buffer, in a cell, etc.). In some embodiments, the oligonucleotide comprises a targeting sequence having a complementary region of an mRNA target sequence.

As used herein, "ribonucleotide" refers to a nucleotide having a ribose in the form of a pentose, containing a hydroxyl group at its 2' position. "Modified ribonucleotide" refers to a ribonucleotide having one or more modifications or substitutions of atoms other than the 2' position, including modifications or substitutions within or within the ribose, phosphate group, or base group.

As used herein, "RNAi oligonucleotide" refers to (a) a ds oligonucleotide having a sense strand and an antisense strand, wherein the antisense strand or a portion of the antisense strand is endonucleated by Argonaute 2 (Ago2) nucleic acid The enzyme is used in the cleavage of a target mRNA (e.g., SNCA mRNA), or (b) an ss oligonucleotide with a single antisense strand, wherein the antisense strand (or a portion of the antisense strand) is endonucleated by Ago2 Enzymes are used in the cleavage of target mRNA (eg, SNCA mRNA).

As used herein, "strand" refers to a single contiguous sequence of nucleotides linked together by internucleotide bonds (e.g., phosphodiester bonds or phosphorothioate bonds). In some embodiments, a strand has two free ends (e.g., a 5' end and a 3' end).

As used herein, "subject" means any mammal, including mice, rabbits, and humans. In one embodiment, the individual is a human or NHP. In addition, "individual" or "patient" may be used interchangeably with "subject".

As used herein, "synthetic" refers to nucleic acids or other molecules that are artificially synthesized (e.g., using machines such as solid-state nucleic acid synthesizers) or otherwise not derived from the natural sources (e.g., cells or organisms) from which the molecules are typically produced.

As used herein, "targeting ligand" refers to a homologous molecule (e.g., a receptor) that selectively binds to a tissue or cell of interest and that can bind to another substance to achieve targeting of the other substance to the tissue or cell of interest. Molecules of interest (e.g., carbohydrates, amino sugars, cholesterol, or peptides) of interest to the tissue or cell. For example, in some embodiments, a targeting ligand can be bound to an oligonucleotide for the purpose of targeting the oligonucleotide to a specific tissue or cell of interest. In some embodiments, the targeting ligand selectively binds to cells cell surface receptors. Accordingly, in some embodiments, a targeting ligand, when bound to an oligonucleotide, selectively binds to a receptor expressed on the cell surface and includes the oligonucleotide, targeting ligand, and receptor. Internalization of the complex into cellular endosomes facilitates delivery of oligonucleotides to specific cells. In some embodiments, the targeting ligand is bound to the oligonucleotide via a linker that is cleaved after or during cellular internalization, allowing the oligonucleotide to be released from the targeting ligand in the cell.

As used herein, "tetraloop" or "tetraL" refers to a loop that increases the stability of adjacent duplexes formed by hybridization of flanking nucleotide sequences. The increase in stability is detectable because the melting temperature ( _Tm ) of the adjacent duplexes is increased above the _Tm that would be expected, on average, from a set of loops of comparable length and composed of randomly selected nucleotide sequences. For example, tetraL can impart a Tm of at least about 50°C, at least about 55°C, at least about 56°C, at least about 58°C, at least _about 60°C, at least about 65°C, or at least about 75°C to a hairpin comprising a duplex of at least 2 base pairs (bp) in length in 10 _{mM NaHPO4} . In some embodiments, tetraL can stabilize bp in adjacent stem duplexes by stacking interactions. Additionally, interactions between nucleotides in tetraL include, but are not limited to, non-Watson-Crick base pairing, stacking interactions, hydrogen bonding, and contact interactions (Cheong et al. (1990) Nature 346:680-682; and Heus and Pardi (1991) Science 253:191-94). In some embodiments, tetraL comprises or consists of 3 to 6 nucleotides and typically 4 to 5 nucleotides. In certain embodiments, tetraL comprises or consists of 3, 4, 5 or 6 nucleotides, which may or may not be modified (e.g., they may or may not bind to a targeting moiety). In certain embodiments, tetraL comprises or consists of 3, 4, 5 or 6 nucleotides, which may or may not be modified (e.g., they may or may not bind to a targeting ligand). In one embodiment, tetraL consists of 4 nucleotides. Any nucleotide may be used in tetraL, and the standard IUPAC-IUB symbols for such nucleotides may be used, as described in Cornish-Bowden (1985) Nucleic Acids Res. 13:3021-30. For example, the letter "N" can be used to mean that any base can be at that position, the letter "R" can be used to indicate that A (adenine) or G (guanine) can be at that position, and "B" can be used to indicate that C (cytosine), G (guanine), T (thymine), or U (uracil) can be at that position. Examples of tetracycles include the UNCG family of tetracycles (e.g., UUCG), the GNRA family of tetracycles (e.g., GAAA), and the CUUG tetracycle (Woese et al. (1990) Proc. Natl. Acad. Sci. USA 87:8467-71; and Antao et al. (1991) Nucleic Acids Res. 19:5901-05). Examples of DNA tetracycles include the d(GNNA) family of tetracycles (e.g., d(GTTA)), the d(GNRA) family of tetracycles, the d(GNAB) family of tetracycles, the d(CNNG) family of tetracycles, and the d(TNCG) family of tetracycles (e.g., d(TTCG)). See, e.g., Nakano et al. (2002) Biochem. 41:4281-92; Shinji et al. (2000) Nippon Kagakkai Koen Yokoshu 78:731. In some embodiments, tetraL is contained within a gapped tetraL structure.

As used herein, "treating" or "treatment" refers to the act of providing care to an individual in need thereof, for example by administering a therapeutic agent (e.g., an oligonucleotide herein, such as an RNAi oligonucleotide) to the individual for the purpose of improving the individual's health and/or well-being with respect to an existing condition (e.g., a disease, a disorder) or preventing or reducing the likelihood of the occurrence of a condition. In some embodiments, treatment involves reducing the frequency or severity of at least one sign, symptom, or contributing factor of a condition (e.g., a disease, a disorder) experienced by the individual.

Example Example 1: Preparation of RNAi oligonucleotides

Oligonucleotide synthesis and purification

The oligonucleotides described in the previous examples (i.e., RNAi oligonucleotides) were chemically synthesized using the methods described herein. Generally speaking, except for the use of known phosphoramidite synthesis (see, for example, Hughes and Ellington (2017) Cold Spring Harb Perspect Biol. 9(1): a023812; Beaucage and Caruthers (1981) Tetrahedron Lett. 22: 1859-62) Otherwise, solid-phase oligonucleotide synthesis methods are used as described for 19-23mer siRNA (see, e.g., Scaringe et al. (1990) Nucleic Acids Res. 18:5433-5441 and Usman et al. (1987) J. Am. Chem. .Soc. 109:7845-45; see also U.S. Patent Nos. 5,804,683, 5,831,071, 5,998,203, 6,008,400, 6,111,086, 6,117,657, 6,353,098, 6,362,323, 6,437 , No. 117 et seq. 6,469,158) to synthesize RNAi oligonucleotides. The dsRNAi oligonucleotide with a 19mer core sequence was formatted into a construct with a 25mer sense strand and a 27mer antisense strand to allow processing by the RNAi machine. The 19mer core sequence is complementary to a region in SNCA mRNA.

Individual RNA strands were synthesized and HPLC purified according to standard methods (Integrated DNA Technologies; Coralville, IA). For example, RNA oligonucleotides were synthesized using solid phase phosphoramidite chemistry, deprotected, and desalted on a NAP-5 column (Amersham Pharmacia Biotech; Piscataway, NJ) using standard techniques (Damha and Olgivie (1993) Methods Mol. Biol. 20:81-114; Wincott et al. (1995) Nucleic Acids Res. 23:2677-84). Oligos were purified using ion exchange high performance liquid chromatography (IE-HPLC) on an Amersham Source 15Q column (1.0 cm x 25 cm; Amersham Pharmacia Biotech) using a 15 min step linear gradient. The gradient varied from 90:10 buffer A:B to 52:48 buffer A:B, where buffer A was 100 mM Tris pH 8.5 and buffer B was 100 mM Tris pH 8.5, 1 M NaCl. Samples were monitored at 260 nm and peaks corresponding to full-length oligonucleotide species were collected, pooled, desalted on a NAP-5 column and lyophilized.

The purity of each oligomer was determined by capillary electrophoresis (CE) on a Beckman PACE 5000 (Beckman Coulter, Inc.; Fullerton, CA). CE capillaries have an inner diameter of 100 μm and contain ssDNA 100R gel (Beckman-Coulter). Typically, approximately 0.6 nmol of oligonucleotide is injected into a capillary, run in an electric field of 444 V/cm, and detected by UV absorbance at 260 nm. Denatured Tris-borate-7M-urea running buffer was purchased from Beckman-Coulter. Oligoribonucleotides were obtained that were at least 90% pure as assessed by CE for use in the experiments described below. Compound identity was verified by matrix-assisted laser desorption dissociation time-of-flight (MALDI-TOF) mass spectrometry on a Voyager DE ^TM biospectroscopy workstation (Applied Biosystems; Foster City, CA) following the manufacturer's recommended protocol. Obtain the relative molecular mass of all oligomers, usually within 0.2% of the expected molecular mass.

Preparation of double chain

Resuspend the ss RNA oligomer (e.g., at 100 μM concentration) in duplex buffer composed of 100 mM potassium acetate, 30 mM HEPES (pH 7.5). Mix the complementary sense and antisense strands in equimolar amounts to obtain a final solution of, e.g., 50 μM duplex. Heat the sample to 100°C in RNA buffer (IDT) for 5 minutes and cool to room temperature before use. Store RNAi oligonucleotides at -20°C. Freeze-dry the ss RNA oligomer at -80°C or store in nuclease-free water.

Example 2: Generation of SNCA -targeting RNAi oligonucleotides

SNCA encodes SNCA, a neuronal protein that inhibits phospholipase D2. SNCA is involved in the regulation of synaptic vesicle transport and neurotransmitter release. Abnormal manifestations of SNCA can lead to a variety of brain diseases, including but not limited to Parkinson's disease and multiple system atrophy. Identification and generation of oligonucleotides capable of inhibiting SNCA mRNA expression.

SNCA mRNA target sequence binding

To generate SNCA -targeting RNAi oligonucleotides, a computer-based algorithm was used to computationally identify SNCA mRNA target sequences suitable for assaying inhibition of SNCA expression by the RNAi pathway. The algorithm provided RNAi oligonucleotide antisense strand sequences, each of which had a complementary region of a suitable SNCA mRNA target sequence of human (Hs) or mouse (Mm) mRNA (e.g., SEQ ID NOs: 1677 and 1678, respectively; Table 1 ). Due to sequence conservation across species, some of the SNCA mRNA target sequences identified for human SNCA mRNA were homologous to corresponding SNCA mRNA target sequences of mouse (mM) SNCA mRNA (SEQ ID NO: 1678; Table 1 ; i.e., bi-generic) and/or monkey (Mf) SNCA mRNA (SEQ ID NO: 1679; Table 1 ; i.e., triply generic). SNCA -targeted RNAi oligonucleotides comprising a complementary region to a homologous SNCA mRNA target sequence having nucleotide sequence similarity are predicted to have the ability to target homologous SNCA mRNA (e.g., human SNCA and monkey SNCA mRNA).

RNAi oligonucleotides (formatted as DsiRNA oligonucleotides) were generated as described in Example 1 for in vitro evaluation. Each DsiRNA was generated with the same modification pattern and each had a unique guide strand with a complementary region of the SNCA target sequence identified by the algorithm. Modifications for sense and antisense DsiRNAs included the following ( X - any nucleotide; m - 2'-OMe modified nucleotide; r - ribosyl modified nucleotide): Sense strand: 5' rXmXrXmXrXrXrXrXrXrXrXrXrXrXmXrXrXrXrXrXrXrXrXXX 3' Antisense strand: 3' mXmXrXmXrXrXrXrXrXrXrXrXrXrXrXmXrXrXrXrXrXrXmXmXmX 5'

In vitro cell-based assay

An in vitro cell-based assay was used to quantify the ability of each modified DsiRNA in Table 2 to reduce SNCA mRNA. Briefly, separate wells of multiwell cell culture plates were transfected with each DsiRNA listed in Table 2 at 0.5 nM (stage 1) or selected DsiRNA at 0.5 nM, 0.1 nM, and 0.02 nM (stage 2). Human Huh7 cells (liver cell line) expressing endogenous human SNCA . Cells were maintained for 24 hours after transfection with modified DsiRNA and the amount of remaining SNCA mRNA from transfected cells was determined using a TAQMAN®-based qPCR assay using the following primers: Forward: AGG GTG TTC TCT ATG TAG GCT (SEQ ID NO: 2451); reverse: ACT GCT CCT CCA ACA TTT GTC (SEQ ID NO: 2452); probe: TGCTCTTTG/ZEN/GTCTTCTCAG CCACTG (SEQ ID NO: 2453). As shown in Table 2 , the remaining mRNA % of primer pairs was assayed. DsiRNA "hits" should be considered when DsiRNA results in less than or equal to 13% of SNCA mRNA remaining in DsiRNA-transfected cells when compared to mock-transfected cells. A Huh7 cell-based assay to evaluate the ability of the DsiRNAs listed in Table 2 to inhibit SNCA gene expression identified several candidate DsiRNAs.

Taken together, these results show that DsiRNA designed to target human SNCA mRNA inhibits SNCA gene expression in cells, as determined by a reduction in the amount of SNCA mRNA in DsiRNA-transfected cells relative to control cells. These results demonstrate that nucleotide sequences containing DsiRNA can be used to generate RNAi oligonucleotides to inhibit SNCA gene expression. Furthermore, these results demonstrate that multiple SNCA mRNA target sequences are suitable for RNAi-mediated inhibition of SNCA gene expression.

Example 3: GalNAc-conjugated SNCA- targeted RNAi oligonucleotides inhibit human SNCA mRNA expression in vivo

The in vitro screening assay in Example 2 demonstrates the ability of SNCA -targeting RNAi oligonucleotides to knock down target SNCA mRNA. To further evaluate the ability of SNCA- targeting RNAi oligonucleotides to inhibit SNCA mRNA expression, GalNAc-conjugated SNCA- targeting RNAi oligonucleotides were generated to confirm in vivo knockdown.

Specifically, a subset of the DsiRNAs identified in Example 2 were used to generate corresponding ds RNAi oligonucleotides containing nicked tetraL GalNAc with a 36-mer passenger strand and a 22-mer leader ( Tables 4 and 5 ) Binding structure (referred to herein as "GalNAc-bound SNCA oligonucleotide" or "GalNAc -SNCA oligonucleotide"). In addition, the nucleotide sequences comprising the sense and antisense strands have different patterns of modified nucleotides and phosphorothioate linkages. Three tetraL-containing nucleotides were each bound to the GalNAc moiety (CAS#14131-60-3). The modification mode is explained as follows:

Interested shares: 5'-mX- S -mX-fX-mX-fX-mX-mX-fX-mX-fX-mX-fX-fX-mX-fX-mX-fX-mX-mX-mX-mX -mX-mX-mX-mX-mX-mX-[ademX-GalNAc][ademX-GalNAc][ademX-GalNAc]-mX-mX-mX-mX-mX-mX-3' Hybridize to: Antisense: 5'-Me Phosphonate-4O-mX- S -fX- S -fX-fX-fX-mX-fX-mX-mX-fX-mX-mX-mX-fX-mX-fX-mX-mX- fX-mX- S -mX- S -mX-3' (modification key: Table 3 ). Or, expressed as: right shares: 5'-[mXs][mX][fX][mX][fX][mX][mX][fX][mX][fX][mX][fX][fX ][mX][fX][mX][fX][mX][mX][mX][mX][mX][mX][mX][mX][mX][mX][ademX-GalNAc][ademX -GalNAc][ademX-GalNAc][mX][mX][mX][mX][mX][mX]-3' Hybridized to: antisense strand: 5'-[Mephosphonate-4O-mXs][ fXs][fX][fX][fX][mX][fX][mX][mX][fX][mX][mX][mX][fX][mX][fX][mX][mX] [fX][mXs][mXs][mX]-3' (modification key: Table 3 ).

GalNAc-conjugated SNCA targeting oligonucleotides were used in a hydrodynamic injection (HDI) mouse model to confirm the ability of RNAi oligonucleotides to knock down SNCA gene expression in vivo. The GalNAc-conjugated SNCA targeting oligonucleotides listed in Tables 4 and 5 were evaluated in mice engineered to transiently express human SNCA mRNA in hepatocytes of the mouse liver. Briefly, female CD-1 mice aged 6-8 weeks were subcutaneously administered a 3 mg/kg dose of the indicated GalNAc-conjugated SNCA targeting oligonucleotides formulated in PBS. Control groups of mice (n=5) were administered PBS only. Three days (72 hours) later, mice were subjected to HDI with DNA plasmids encoding intact human SNCA (SEQ ID NO: 1677) (10 μg) under the control of the ubiquitous cytomegalovirus (CMV) promoter sequence. One day after introduction of the DNA plasmids, liver samples from HDI mice were collected. Total RNA from these HDI mice was subjected to qRT-PCR analysis to determine human SNCA mRNA levels as described in Example 2. These values were normalized for transfection efficiency using the NeoR gene included on the DNA plasmids. The benchmark control SNCA-291 was used to confirm successful knockdown.

The results in Figures 1A and 1B demonstrate that GalNAc-conjugated SNCA oligonucleotides designed to target human SNCA mRNA (as shown in Tables 4 and 5 , respectively) successfully inhibited human SNCA mRNA expression in HDI mice, as determined by the reduced amount of human SNCA mRNA expression in liver samples of HDI mice treated with GalNAc-conjugated SNCA oligonucleotides relative to control HDI mice treated with PBS alone.

Example 4: GalNAc-conjugated SNCA RNAi oligonucleotides inhibit human SNCA gene expression in a dose-dependent manner

To further evaluate the ability of GalNAc-conjugated SNCA RNAi oligonucleotides to inhibit SNCA expression, dose response studies were performed. Specifically, in independent treatment groups, selected GalNAc-conjugated SNCA RNAi oligonucleotides ( Tables 6 and 7 ) were formulated in PBS and administered subcutaneously to CD-1 mice at a dose of 0.3 mg/kg, 1 mg/kg, or 3 mg/kg. As described in Example 3 , human SNCA DNA expression plasmids were administered to mice 3 days after oligonucleotide administration, and livers were collected 24 hours later for qRT-PCR analysis. As shown in Figures 2A and 2B , all tested GalNAc-conjugated SNCA RNAi oligonucleotides inhibited human SNCA gene expression in a dose-dependent manner. Potent GalNAc-binding SNCA oligonucleotides (i.e., SNCA-244, SNCA-429, SNCA-751, SNCA-752, SNCA-800, SNCA-801, and SNCA1003) reduced SNCA mRNA by about 50% or more at 1 mg/kg and even further at 3 mg/kg. The selected constructs were selected for further studies in non-human primates.

Example 5: Inhibition of SNCA gene expression in NHP CNS by RNAi oligonucleotides

The inhibitory effects of potent GalNAc-binding SNCA targeting oligonucleotides identified in HDI mouse studies on NHP were assayed. Specifically, the GalNAc-binding SNCA targeting oligonucleotides listed in Table 8 were evaluated in non-naive cynomolgus monkeys ( Macaca fascicularis ). There are 2 male and 2 female individuals in each group. GalNAc-conjugated SNCA targeting oligonucleotides were administered via intracisternal (icm) injection at a dose of 50 mg in 1.6 mL of artificial cerebrospinal fluid (aCSF) on study days 0 and 7.

On study day 14, CNS tissue was collected and qRT-PCR analysis was performed to measure SNCA mRNA in oligonucleotide-treated monkeys relative to those treated with equivalent volumes of aCSF. To normalize the data, measurements were made relative to two reference genes, RPL23 and GAPDH (the geometric The average value is used as the set point for the target KD). The following SYBR assays purchased from Integrated DNA Technologies were used to evaluate gene expression: forward: ACAGTGG CTGAGAAGACCCAA (SEQ ID NO: 2454), reverse: CTCCCTCCACTGTCTTCTGG (SEQ ID NO: 2455); and probe: ACCCGTCACCACCGCTCCTCC (SEQ ID NO: 2456).

As shown in Figures 3A-3S (day 14), treatment of NHPs with GalNAc-conjugated SNCA -targeting oligonucleotides inhibited SNCA gene expression in several CNS regions, as determined by brain samples from oligonucleotide-treated NHPs The amount of SNCA mRNA in was determined relative to the reduction in NHP treated with aCSF. Several GalNAc-binding SNCA targeting oligonucleotides reduce SNCA gene expression throughout the CNS. SNCA-801 and SNCA-751 are particularly effective in the frontal cortex, hippocampus, parietal cortex, occipital cortex, temporal cortex, brainstem, cervical spinal cord, thoracic spinal cord and lumbar spinal cord and reduce SNCA mRNA by at least 50%. These results demonstrate that treatment of NHPs with GalNAc-conjugated SNCA targeting oligonucleotides reduces the amount of SNCA mRNA in the CNS.

Example 6: Lipid-bound RNAi oligonucleotides targeting SNCA reduce gene expression in NHP CNS

To further investigate the efficacy of oligonucleotides targeting SNCA , lipid-bound oligonucleotides were evaluated in NHPs. Specifically, SNCA-0751 was selected based on the above studies, and the sense strand was formatted as a 20mer sense strand with lipid bound to the 5' terminal nucleotide. This construct, referred to as SNCA-B15, has a 20mer sense strand and a 22mer antisense strand (SEQ ID NOs: 1682 and 1656, respectively). The chemical modification pattern of the lipid-bound oligonucleotide is provided below:

Sense strand: 5'-[ademX-C ₁₆ ]- S -mX-fX-mX-fX-mX-fX-mX-fX-mX-fX-mX-fX-fX-mX-fX-mX-fX-mX- S -mX- S -mX- 3' Hybridized to: Antisense strand: 5'-[Mephosphonate-4O-mX]- S -fX- S -fX-fX-fX-mX-fX-mX-fX-mX-fX-mX-fX-mX-fX-mX-fX-mX-fX-mX- S -mX- S -mX3' (Modification keywords: Table 3 ). Alternatively, it can be expressed as: sense strand: 5'-[ademXs-C ₁₆ ][mX][fX][mX][fX][mX][fX][mX][fX][mX][fX][mX][fX][mX][fX][mX][fX][mXs][mXs][mX]-3' hybridized to: antisense strand: 5'-[Mephosphonate-4O-mXs][fXs][fX][fX][mX][fX][mX][mX][fX][mX][mX][fX][mX][mX][fX][mX][mX][fX][mXs][mX]-3' (Modification keywords: Table 3 ).

Lipid binding

Lipid-bound blunt-ended oligonucleotides were synthesized using standard procedures known in the literature for oligonucleotide synthesis using phosphoramidite chemistry on synthesizers (see Matteucci and Caruthers (1981) Tetrahedron Lett. 21:719-22 ¹ ; Beaucage and Caruthers (1981) Tetrahedron Lett. 22: 1859-62 ² ).

¹ Matteucci MD, Caruthers MH. The synthesis of oligodeoxypyrimidines on a polymer support. Tetrahedron Lett. 1980; 21(8): 719-722.

² Beaucage SL, Caruthers MH. Deoxynucleoside phosphoramidites-A new class of key intermediates for deoxypolynucleotides. Tetrahedron Lett. 1981;22(20):1859-1862.

Conjugation of the lipid moiety to the SNCA targeting oligonucleotide was performed using the phosphoramidite synthesis shown below:

Synthesis of 2-(2-((((6aR,8R,9R,9aR)-8-(6-benzamido-9H-purin-9-yl)-2,2,4,4-tetraisopropyltetrahydro-6H-furo[3,2-f][1,3,5,2,4]trioxadiazolooctan-9-yl)oxy)methoxy)ethoxy)ethyl-1-ammonium(1-6) formate

A solution of compound 1-1 (25.00 g, 67.38 mmol) in 20 mL of DMF was treated with pyridine (11 mL, 134.67 mmol) and tetraisopropyldisiloxane dichloride (22.63 mL, 70.75 mmol) at 10°C. The resulting mixture was stirred at 25°C for 3 hours and quenched with 20% citric acid (50 mL). The aqueous layer was extracted with EtOAc (3×50 mL), and the combined organic layers were concentrated in vacuo. The crude residue was recrystallized from a mixture of MTBE and n-heptane (1:15, 320 mL) to give compound 1-2 (37.20 g, 90%) as a white oily solid.

A solution of compound 1-2 (37.00 g, 60.33 mmol) in 20 mL of DMSO was treated with AcOH (20 mL, 317.20 mmol) and Ac ₂ O (15 mL, 156.68 mmol). The mixture was stirred at 25 °C for 15 hours. The reaction was diluted with EtOAc (100 mL) and quenched with saturated K ₂ CO ₃ (50 mL). The aqueous layer was extracted with EtOAc (3×50 mL). The combined organic layers were concentrated and recrystallized with ACN (30 mL) to give compound 1-3 (15.65 g, 38.4%) as a white solid.

A solution of compound 1-3 (20.00 g, 29.72 mmol) in 120 mL of DCM was treated with Fmoc-amino-ethoxyethanol (11.67 g, 35.66 mmol) at 25 °C. The mixture was stirred to give a clear solution, which was then treated with 4Å molecular sieves (20.0 g), N -iodosuccinimide (8.02 g, 35.66 mmol) and TfOH (5.25 mL, 59.44 mmol). The mixture was stirred at 30 °C until HPLC analysis indicated >95% consumption of compound 1-3 . The reaction was quenched with TEA (6 mL) and filtered. The filtrate was diluted with EtOAc, washed with saturated NaHCO ₃ (2×100 mL), saturated Na ₂ SO ₃ (2×100 mL) and water (2×100 mL) and concentrated in vacuo to give crude compound 1-4 (26.34 g, 93.9%) as a yellow solid, which was used directly in the next step without further purification.

A solution of compound 1-4 (26.34 g, 27.62 mmol) in a mixture of DCM/water (10:7, 170 mL) was treated with DBU (7.00 mL, 45.08 mmol) at 5°C. The mixture was stirred at 5-25°C for 1 hour. The organic layer was then separated, washed with water (100 mL), and diluted with DCM (130 mL). The solution was treated with fumaric acid (7.05g, 60.76mmol) and 4Å molecular sieves (26.34g) in four portions. The mixture was stirred for 1 hour, concentrated, and recrystallized from a mixture of MTBE and DCM (5:1) to give compound 1-6 (14.74g, 62.9%) as a white solid: ¹ H NMR (400MHz, d ₆ - DMSO)8.73(s,1H),8.58(s,1H),8.15-8.02(m,2H),7.65-7.60(m,1H),7.59-7.51(m,2H),6.52(s,2H), 6.15(s,1H),5.08-4.90(m,3H),4.83-4.78(m,1H),4.15-3.90(m,3H),3.79-3.65(m,2H),2.98-2.85(m,6H ),1.20-0.95(m,28H).

Synthesis of (2R,3R,4R,5R)-5-(6-benzamide-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl)methyl Oxy)methyl)-4-((2-(2-[lipid]-acylamidoethoxy)ethoxy)methoxy)tetrahydrofuran-3-yl(2-cyanoethyl)diiso Propylphosphonite (2-4a to 2-4e)

A solution of compound 1-6 (50.00 g, 59.01 mmol) in 150 mL of 2-methyltetrahydrofuran was washed with ice-cold _{aqueous K2HPO4} (6%, 100 mL) and brine (20%, 2X100 mL). The organic layer was separated and treated with caproic acid (10.33 mL, 82.61 mmol), HATU (33.66 g, 88.52 mmol) and DMAP (10.81 g, 147.52 mmol) at 0°C. The resulting mixture was warmed to 25°C and stirred for 1 hour. The solution was washed with water (2X100 mL), brine (100 mL), and concentrated in vacuo to give a crude residue. Silica gel flash chromatography (1:1 hexane/acetone) gave compound 2-1a (34.95g, 71.5%) as a white solid.

A mixture of compound 2-1a (34.95 g, 42.19 mmol) and TEA (9.28 mL, 126.58 mmol) in 80 mL THF was treated dropwise with triethylamine trihydrofuride (20.61 mL, 126.58 mmol) at 10°C. The mixture was warmed to 25°C and stirred for 2 hours. The reaction was concentrated, dissolved in DCM (100 mL) and washed with saturated _NaHCO3 (5X20 mL) and brine (50 mL). The organic layer was concentrated in vacuo to give crude compound 2-2a (24.72 g, 99%), which was used directly in the next step without further purification.

A solution of compound 2-2a (24.72 g, 42.18 mmol) in 50 mL of DCM was treated with N -methylmorpholine (18.54 mL, 168.67 mmol) and DMTr-Cl (15.69 g, 46.38 mmol). The mixture was stirred at 25 °C for 2 hours and quenched with saturated NaHCO ₃ (50 mL). The organic layer was separated, washed with water, and concentrated to give a slurry of crude material. Silica gel flash chromatography (1:1 hexanes/acetone) gave compound 2-3a (30.05 g, 33.8 mmol, 79.9%) as a white solid.

A solution of compound 2-3a (25.00 g, 28.17 mmol) in 50 mL of DCM was treated with N -methylmorpholine (3.10 mL, 28.17 mmol) and tetrazole (0.67 mL, 14.09 mmol) under nitrogen atmosphere. Bis(diisopropylamino)chlorophosphine (9.02 g, 33.80 mmol) was added dropwise to the solution, and the resulting mixture was stirred at 25° C. for 4 hours. The reaction was quenched with water (15 mL), and the aqueous layer was extracted with DCM (3×50 mL). The combined organic layers were washed with saturated NaHCO ₃ (50 mL) and concentrated to obtain a crude solid, which was recrystallized from a mixture of DCM/MTBE/n-hexane (1:4:40) to obtain compound 2-4a (25.52 g, 83.4%) as a white solid: ¹ H NMR (400 MHz, d ₆ -DMSO) 11.25 (s, 1H), 8.65-8.60 (m, 2 H), 8.09-8.02 (m, 2H), 7.71 (s, 1H), 7.67-7.60 (m, 1H), 7.59-7.51 (m, 2H), 7.38-7.34 (m, 2H), 7.30-7.25 (m, 7H), 6.85-6.79 (m, 4H), 6.23-6.20 (m, 1H), 5.23-5.14 (m, 1H), 4.80-4.69 (m, 3H), 4.33-4.23 (m, 2H), 3.9 3H), 3.08-3.54 (m, 2H), 3.01-3.77 (m, 1H), 3.05-3.82 (m, 1H), 3.06-3.09 (m, 2H), 3.04-3.10 (m, 1H), 3.05-3.83 (m, 2H), 3.04-3.12 (m, 1H), 3.08-3.13 (m, 1H), 3.05-3.70 (m, 1H), 3.06-3.09 (m, 2H), 3.08-3.09 (m, 1H), 3.05-3.09 (m, 2H), 3.06-3.09 (m, 1H), 3.05-3.09 (m, 2H), 3.05-3.09 (m, 3H); ^31P NMR (162 MHz, d6 _- DMSO) 149.43, 149.18.

Compounds 2-4b, 2-4c, 2-4d and 2-4e were prepared using a similar procedure as described above for compound 2-4a . Compound 2-4b (25.50 g, 85.4%) was obtained as a white solid: ¹ H NMR (400 MHz, d ₆ -DMSO) 11.23 (s, 1H), 8.65-8.60 (m, 2 H), 8.05-8.02 (m, 2H), 7.73-7.70 (m, 1H), 7.67-7.60 (m, 1H), 7.59-7.51 (m, 2H), 7.38-7.34 (m, 2H), 7.30-7.25 (m, 7H), 6.89-6.80 (m, 4H), 6.21-6.15 (m, 1H), 5.23-5.17 (m, 1H), 4.80-4.69 (m, 3H), 4.40-4.21 (m, 2H), 3.91-3.80 (m, 1H), 3.74 (s, 6H), 3.74-3.52 (m, 3H), 3.50-3.20 (m, 6H), 3.14-3.09 (m, 2H), 3.09 (s, 1H), 2.83-2.79 (m, 1H), 2.68-2.62 (m, 1H), 2.05-1.97 (m, 2H), 1.50-1.38 (m, 2H), 1.31-1.10 (m, 18H), 1.08-1.05 (m, 2H), 0.85-0.78 (m, 3H); ³¹ P NMR (162 MHz, d ₆ -DMSO) 149.43, 149.19.

Compound 2-4c was obtained as an off-white solid (36.60g, 66.3%): ¹ H NMR (400MHz, d ₆ -DMSO) 11.22 (s, 1H), 8.64-8.59 (m, 2H), 8.05-8.00 (m ,2H),7.73-7.70(m,1H),7.67-7.60(m,1H),7.59-7.51(m,2H),7.38-7.34(m,2H),7.30-7.25(m,7H),6.89 -6.80(m,4H),6.21-6.15(m,1H),5.25-5.17(m,1H),4.80-4.69(m,3H),4.40-4.21(m,2H),3.91-3.80(m, 1H),3.74(s,6H),3.74-3.50(m,3H),3.50-3.20(m,6H),3.14-3.09(m,2H),3.09(s,1H),2.83-2.79(m, 1H),2.68-2.62(m,1H),2.05-1.99(m,2H),1.50-1.38(m,2H),1.33-1.12(m,38H),1.08-1.05(m,2 H),0.86 -0.80 (m, 3H); ³¹ P NMR (162MHz, d ₆ -DMSO) 149.42, 149.17.

Compound 2-4d (26.60 g, 72.9%) was obtained as an off-white solid: ¹ H NMR (400 MHz, d ₆ -DMSO) 11.22 (s, 1H), 8.64-8.59 (m, 2H), 8.05-8.00 (m, 2H), 7.73-7.70 (m, 1H), 7.67-7.60 (m, 1H), 7.59-7.51 (m, 2H), 7.38-7.33 (m, 2H), 7.30-7.25 (m, 7H), 6.89-6.80 (m, 4H), 6.21-6.15 (m, 1H), 5.22-5.17 (m, 1H), 4.80-4.69 (m, 3H), 4 .40-4.21 (m, 2H), 3.91-3.80 (m, 1H), 3.74 (s, 6H), 3.74-3.52 (m, 3H), 3.50-3.20 (m, 6H), 3.14-3.09 (m, 2H), 3.09 (s, 1H), 2.83-2.79 (m, 1H), 2.68-2.62 (m, 1H), 2.05-1.99 (m, 2H), 1.50-1.38 (m, 2H), 1.35-1.08 (m, 38H), 1.08-1.05 (m, 2 H), 0.85-0.79 (m, 3H); ³¹ P NMR (162 MHz, d ₆ -DMSO) 149.47, 149.22.

Compound 2-4e (38.10g, 54.0%) was obtained as a white solid: ¹ H NMR (400MHz, d ₆ -DMSO) 11.21 (s, 1H), 8.64-8.59 (m, 2H), 8.05-8.00 (m ,2H),7.73-7.70(m,1H),7.67-7.60(m,1H),7.59-7.51(m,2H),7.38-7.34(m,2H),7.30-7.25(m,7H),6.89 -6.80(m,4H),6.21-6.15(m,1H),5.23-5.17(m,1H),4.80-4.69(m,3H),4.40-4.21(m,2H),3.91-3.80(m, 1H),3.73(s,6H),3.74-3.52(m,3H),3.47-3.22(m,6H),3.14-3.09(m,2H),3.09(s,1H),2.83-2.79(m, 1H),2.68-2.62(m,1H),2.05-1.99(m,2H),1.50- 1.38(m,2H),1.35-1.06(m,46H),1.08-1.06(m,2 H),0.85 -0.77 (m, 3H); ³¹ P NMR (162MHz, d ₆ -DMSO) 149.41, 149.15.

NHP Research

NHPs (n=4) were administered 37.5 mg of lipid-conjugated SNCA-B15 intrathecally via L1 lumbar infusion ( see Table 9 ). aCSF was used as control.

Twenty-eight days after administration, CNS tissue was collected to determine the concentration of oligonucleotides and the level of SCNA gene expression. Parkinson's disease (PD) is a movement disorder characterized by tremors, slow movement, muscle stiffness, unsteady walking, and/or loss of balance, while multiple system atrophy (MSA) is a rare condition that affects autonomic nervous system functions such as blood pressure , respiratory and bladder control, and motor function. Therefore, CNS tissue associated with PD or MSA was analyzed independently.

As shown in FIG. 4A , using lipid-bound SNCA-B15, SNCA gene expression was reduced in AD-associated tissues including putamen, midbrain tegmentum, substantia nigra, pons, and medulla. SNCA gene expression was determined as described in the above examples. FIG. 4B shows the concentration of lipid-bound SNCA-B15 in tissues after 28 days. These results indicate that lipid-bound SNCA targeting oligonucleotides have enhanced efficacy in PD-associated tissues.

Likewise and as shown in Figure 5A , using lipid-conjugated SNCA-B15, SNCA gene expression was reduced in MSA-associated tissues including putamen, midbrain tegmentum, substantia nigra, pons, cerebellar white matter, Medulla, cervical spinal cord, thoracic spinal cord and lumbar spinal cord. SNCA gene expression was determined as described in the Examples above. Figure 5B shows the concentration of lipid-bound SNCA-B15 in tissues after 28 days. These results indicate enhanced efficacy of lipid-bound SNCA targeting oligonucleotides in MSA-associated tissues.

sequence list

The following nucleic acid and/or amino acid sequences are mentioned in this disclosure and are provided below for reference.

TW202409275A_112117718_SEQL.xml

Claims (114)

An RNAi oligonucleotide for reducing SNCA gene expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a complementary region of the SNCA mRNA target sequence of any one of SEQ ID NOs: 1683-2066, and wherein the complementary region has a length of at least 15 consecutive nucleotides. The RNAi oligonucleotide of claim 1, wherein the length of the sense strand is 15 to 50 nucleotides. For example, the RNAi oligonucleotide of claim 1 or 2, wherein the length of the sense strand is 18 to 36 nucleotides. An RNAi oligonucleotide as claimed in any one of claims 1 to 3, wherein the antisense strand has a length of 15 to 30 nucleotides. The RNAi oligonucleotide of any one of claims 1 to 4, wherein the length of the antisense strand is 22 nucleotides, and the antisense strand and the sense strand form a duplex region, and the double strand The length of the body region is at least 19 nucleotides, and optionally at least 20 nucleotides in length. An RNAi oligonucleotide as claimed in any one of claims 1 to 5, wherein the length of the complementary region is at least 19 consecutive nucleotides. The RNAi oligonucleotide of any one of claims 1 to 6, wherein the length of the complementary region is at least 20 consecutive nucleotides. A double-stranded RNAi oligonucleotide for reducing SNCA gene expression, the oligonucleotide comprising: (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a complementary region of a SNCA mRNA target sequence, wherein the complementary region is selected from SEQ ID NOs: 2067-2450, and (ii) a sense strand of 19-50 nucleotides in length, wherein the sense strand comprises a complementary region of the antisense strand, wherein the antisense strand and the sense strand are independent strands forming an asymmetric duplex region, wherein the duplex region has an overhang of 1-4 nucleotides at the 3' end of the antisense strand. The RNAi oligonucleotide of any one of claims 1 to 8, wherein the 3' end of the sense strand comprises a stem loop as shown in S1-L-S2, wherein S1 and S2 complement each other, and wherein L forms a loop of 3-5 nucleotides in length between S1 and S2. The RNAi oligonucleotide of claim 9, wherein L is a tricyclic or tetracyclic ring. The RNAi oligonucleotide of claim 10, wherein L is a tetracyclic ring. The RNAi oligonucleotide of claim 11, wherein the tetraloop comprises the sequence 5'-GAAA-3'. The RNAi oligonucleotide of any one of claims 9 to 12, wherein the length of S1 and S2 is 1-10 nucleotides and has the same length. Such as the RNAi oligonucleotide of claim 13, wherein the length of S1 and S2 is 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides or 10 nucleotides. Such as the RNAi oligonucleotide of claim 14, wherein the length of S1 and S2 is 6 nucleotides. The RNAi oligonucleotide of any one of claims 9 to 15, wherein the stem loop comprises the sequence 5'-GCAGCCGAAAGGCUGC-3' (SEQ ID NO: 1680). An RNAi oligonucleotide as claimed in any one of claims 1 to 8, wherein the oligonucleotide comprises a blunt end. The RNAi oligonucleotide of claim 17, wherein the blunt end comprises the 3' end of the sense strand. The RNAi oligonucleotide of any one of claims 17 to 18, wherein the sense strand is 20-22 nucleotides. Such as the RNAi oligonucleotide of claim 19, wherein the sense strand is 20 nucleotides. An RNAi oligonucleotide as claimed in any one of claims 1 to 20, wherein the antisense strand comprises a 3' overhang sequence of one or more nucleotides in length. The RNAi oligonucleotide of claim 21, wherein the overhang includes purine nucleotides. The RNAi oligonucleotide of claim 21 or 22, wherein the length of the 3' overhang sequence is 2 nucleotides. The RNAi oligonucleotide of claim 23, wherein the 3' overhang is selected from AA, GG, AG and GA. The RNAi oligonucleotide of claim 24, wherein the overhang is GG or AA. The RNAi oligonucleotide of claim 25, wherein the overhang is GG. The RNAi oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises at least one modified nucleotide. The RNAi oligonucleotide of claim 27, wherein the modified nucleotide comprises a 2'-modification. The RNAi oligonucleotide of claim 28, wherein the 2'-modification is selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, and 2'-O-methoxyethyl and 2'-deoxy-2'-fluoro-β-d-arabinose nucleic acid modification. The RNAi oligonucleotide of any one of claims 28 to 29, wherein the modification is a 2'-modification selected from 2'-fluoro and 2'-O-methyl. For example, the RNAi oligonucleotide of any one of claims 29 to 30, wherein about 18% to about 23% or 18%, 19%, 20%, 21%, 22% or 23% of the core of the positive shares The nucleotide contains this 2'-fluoro modification. The RNAi oligonucleotide of any one of claims 29 to 30, wherein about 38% to about 43% or 38%, 39%, 40%, 41%, 42% or 43% of the nucleotides of the sense strand comprise the 2'- fluorine modification. The RNAi oligonucleotide of any one of claims 29 to 32, wherein about 25% to about 35% or 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35% of the nucleotides of the antisense strand contain the 2'-fluoro modification. Such as the RNAi oligonucleotide of any one of claims 29 to 33, wherein about 25% to about 35% or 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34% or 35% of the nucleotides contain the 2'-fluoro modification. An RNAi oligonucleotide as claimed in any one of claims 29 to 33, wherein about 35-45%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44% or 45% of the nucleotides of the oligonucleotide contain the 2'-fluoro modification. The RNAi oligonucleotide of any one of claims 29 to 35, wherein the sense strand contains 36 nucleotides from 5' to 3' at positions 1-36, wherein positions 3, 5, 8, and 10 Each of , 12, 13, 15 and 17 includes the 2'-fluoro modification. The RNAi oligonucleotide of any one of claims 29 to 35, wherein the sense strand comprises 20 nucleotides at positions 1-20 from 5' to 3', wherein each of positions 3, 5, 8, 10, 12, 13, 15 and 17 comprises the 2'-fluoro modification. The RNAi oligonucleotide of any one of claims 29 to 37, wherein the antisense strand comprises 22 nucleotides at positions 1-22 from 5' to 3', and wherein each of positions 2, 3, 4, 5, 7, 10, 14, 16 and 19 comprises the 2'-fluoro modification. An RNAi oligonucleotide as claimed in any one of claims 31 to 38, wherein the remaining nucleotides contain the 2'-O-methyl modification. An RNAi oligonucleotide as claimed in any of the preceding claims, wherein the oligonucleotide comprises at least one modified internucleotide bond. The RNAi oligonucleotide of claim 40, wherein the at least one modified nucleoside The inter-acid linkage is a phosphorothioate linkage. The RNAi oligonucleotide of claim 41, wherein the antisense strand includes the phosphorothioate linkage: (i) between positions 1 and 2 and between positions 2 and 3; or (ii) Between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4, and the positions are numbered 1-4 from 5' to 3'. The RNAi oligonucleotide of claim 41 or 42, wherein the antisense strand is 22 nucleotides in length, and wherein the antisense strand comprises the phosphorothioate linkage between positions 20 and 21 and between positions 21 and 22, and wherein positions are numbered 1-22 from 5' to 3'. The RNAi oligonucleotide of any one of claims 41 to 43, wherein the sense strand comprises the phosphorothioate linkage between positions 1 and 2, and wherein positions are numbered 1-2 from 5' to 3'. The RNAi oligonucleotide of any one of claims 41 to 43, wherein the length of the sense strand is 20 nucleotides, wherein the sense strand is between positions 1 and 2, and between positions 18 and 19 And the phosphorothioate linkage is included between positions 19 and 20, and the positions are numbered 1-20 from 5' to 3'. The RNAi oligonucleotide of any one of the preceding claims, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand contains a phosphate analog. The RNAi oligonucleotide of claim 46, wherein the phosphate analog is an oxymethylphosphonate, a vinylphosphonate or a malonylphosphonate, optionally wherein the phosphate analog includes 4 4'-phosphate analog of '-oxymethylphosphonate. The RNAi oligonucleotide of any one of the preceding claims, wherein at least one nucleotide of the oligonucleotide is bound to one or more targeting ligands. As in claim 48, the RNAi oligonucleotide, wherein each targeting ligand comprises a carbohydrate, an amino sugar, a lipid, cholesterol or a polypeptide. An RNAi oligonucleotide as claimed in any one of claims 9 to 16 and 21 to 49, wherein the stem loop comprises one or more targeting ligands bound to one or more nucleotides of the stem loop. The RNAi oligonucleotide of claim 50, wherein the one or more targeting ligands bind to one or more nucleotides of the loop (L). The RNAi oligonucleotide of claim 51, wherein the loop (L) comprises 4 nucleotides numbered 1-4 from 5' to 3', wherein the nucleotides at positions 2, 3 and 4 each comprise one or more targeting ligands, and wherein the targeting ligands are the same or different. As claimed in claim 52, the RNAi oligonucleotide, wherein each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety. As in claim 53, the RNAi oligonucleotide, wherein the GalNac portion is a monovalent GalNAc portion, a divalent GalNAc portion, a trivalent GalNAc portion, or a tetravalent GalNAc portion. An RNAi oligonucleotide as claimed in any one of claims 9 to 16 and 21 to 54, wherein up to 4 nucleotides of the ring (L) of the stem loop are each bound to a monovalent GalNAc moiety. An RNAi oligonucleotide as claimed in any one of claims 17 to 48, wherein the one or more targeting ligands are lipid moieties. The RNAi oligonucleotide of claim 56, wherein the lipid moiety is bound to the 5' terminal nucleotide of the sense strand. The RNAi oligonucleotide of claim 56 or 57, wherein the lipid portion is a hydrocarbon chain. The RNAi oligonucleotide of claim 58, wherein the hydrocarbon chain is a C ₈ -C ₃₀ hydrocarbon chain. The RNAi oligonucleotide of claim 58 or 59, wherein the hydrocarbon chain is a C ₁₆ hydrocarbon chain. For example, the RNAi oligonucleotide of claim 60, wherein the C ₁₆ hydrocarbon chain is expressed as:

The RNAi oligonucleotide of any one of claims 56 to 61, wherein the lipid moiety is bound to the 2' carbon of the ribose ring of the 5' terminal nucleotide. The RNAi oligonucleotide of any one of claims 1 to 62, wherein the complementary region is completely complementary to the SNCA mRNA target sequence at nucleotide positions 2-8 of the antisense strand, and wherein the nucleotide positions are numbered from 5' to 3'. The RNAi oligonucleotide of any one of claims 1 to 62, wherein the complementary region is fully complementary to the SNCA mRNA target sequence at nucleotide positions 2-11 of the antisense strand, and wherein nucleotide positions are numbered from 5' to 3'. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 1537-1571 and 1681. The RNAi oligonucleotide of any one of claims 1 to 65, wherein the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 1572-1606. The RNAi oligonucleotide of any one of claims 1 to 66, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1537 and 1572; b) SEQ ID NO: 1538 and 1573 respectively; c) SEQ ID NO: 1539 and 1574 respectively; d) SEQ ID NO: 1540 and 1575 respectively; e) SEQ ID NO: 1541 and 1576 respectively; f) SEQ ID NO: 1542 and 1577 respectively; g) SEQ ID NO: 1543 and 1578 respectively; h) SEQ ID NO: 1544 and 1579 respectively; i) SEQ ID NO: 1545 and 1580 respectively; j) SEQ ID NO: 1546 and 1581 respectively; k) SEQ ID NO: 1547 and 1582 respectively; l) SEQ ID NO: 1548 and 1583 respectively; m) are SEQ ID NO: 1549 and 1584 respectively; n) are SEQ ID NO: 1550 and 1585 respectively; o) are SEQ ID NO: 1551 and 1586 respectively; p) are SEQ ID NO: 1552 and 1587 respectively; q) SEQ ID NO: 1553 and 1588 respectively; r) SEQ ID NO: 1554 and 1589 respectively; s) SEQ ID NO: 1555 and 1590 respectively; t) SEQ ID NO: 1556 and 1591 respectively; u) respectively SEQ ID NO: 1557 and 1592; v) are SEQ ID NO: 1558 and 1593 respectively; w) are SEQ ID NO: 1559 and 1594 respectively; x) are SEQ ID NO: 1560 and 1595 respectively; y) are SEQ ID NO respectively NO: 1561 and 1596; z) are SEQ ID NO: 1562 and 1597 respectively; aa) are SEQ ID NO: 1563 and 1598 respectively; bb) are SEQ ID NO: 1564 and 1599 respectively; cc) are SEQ ID NO: 1565 and 1600; dd) are SEQ ID NO: 1566 and 1601 respectively; ee) are SEQ ID NO: 1567 and 1602 respectively; ff) are SEQ ID NO: 1568 and 1603 respectively; gg) are SEQ ID NO: 1569 and 1602 respectively. 1604; hh) are SEQ ID NO: 1570 and 1605 respectively; ii) are SEQ ID NO: 1571 and 1606 respectively; and jj) are SEQ ID NO: 1681 and 1586 respectively. The RNAi oligonucleotide of any one of claims 1 to 66, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1540 and 1575; b) SEQ ID NO: 1544 and 1579 respectively; c) SEQ ID NO: 1546 and 1581 respectively; d) SEQ ID NO: 1551 and 1586 respectively; e) SEQ ID NO: 1552 and 1587 respectively; f) SEQ ID NO: 1553 and 1588 respectively; g) SEQ ID NO: 1558 and 1594 respectively; h) SEQ ID NO: 1560 and 1595 respectively; i) SEQ ID NO: 1564 and 1599 respectively; j) SEQ ID NO: 1565 and 1600, respectively; k) SEQ ID NO: 1566 and 1601, respectively; l) SEQ ID NO: 1570 and 1605, respectively; and m) SEQ ID NO: 1681 and 1586, respectively. The RNAi oligonucleotide of any one of claims 1 to 66, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1553 and 1588, respectively; b) SEQ ID NOs: 1560 and 1595, respectively; c) SEQ ID NOs: 1564 and 1599, respectively; d) SEQ ID NOs: 1551 and 1586, respectively; e) SEQ ID NOs: 1570 and 1605, respectively; and f) SEQ ID NOs: 1681 and 1586, respectively. For example, the RNAi oligonucleotide according to any one of claims 1 to 66, wherein the sense strand contains Contains the nucleotide sequence as shown in SEQ ID NO: 1553, and wherein the antisense strand includes the nucleotide sequence as shown in SEQ ID NO: 1588. The RNAi oligonucleotide of any one of claims 1 to 66, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1560, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1595. The RNAi oligonucleotide of any one of claims 1 to 66, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1564, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1599. The RNAi oligonucleotide of any one of claims 1 to 66, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1551, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1586 The nucleotide sequence is shown. The RNAi oligonucleotide of any one of claims 1 to 66, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1570, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1605 The nucleotide sequence is shown. The RNAi oligonucleotide of any one of claims 1 to 66, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1681, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1586 The nucleotide sequence is shown. An RNAi oligonucleotide as claimed in any one of claims 1 to 64, wherein the antisense strand is 22 nucleotides in length. The RNAi oligonucleotide of claim 76, wherein the antisense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1588, 1595, 1599, 1586 and 1605. The RNAi oligonucleotide of any one of claims 1 to 64 and 76 to 77, wherein the sense strand comprises a nucleotide sequence selected from SEQ ID NO: 1865, 1721, 1847, 1846 and 1955. The RNAi oligonucleotide of any one of claims 1 to 64 and 76 to 78, wherein the length of the sense strand is 36 nucleotides. The RNAi oligonucleotide of claim 79, wherein the sense strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1553, 1560, 1564, 1551 and 1570. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 1607-1641 and 1682. The RNAi oligonucleotide of any one of claims 1 to 64 and 81, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1642-1676. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NOs: 1607 and 1642, respectively; b) SEQ ID NOs: 1608 and 1643, respectively; c) SEQ ID NOs: 1609 and 1644, respectively; d) SEQ ID NOs: 1610 and 1645, respectively; e) SEQ ID NOs: 1611 and 1646, respectively; f) SEQ ID NOs: 1612 and 1647, respectively; g) SEQ ID NOs: 1613 and 1648, respectively; h) SEQ ID NOs: 1614 and 1649, respectively; i) SEQ ID NOs: 1615 and 1650, respectively; j) SEQ ID NOs: 1616 and 1651, respectively; k) SEQ ID NOs: 1617 and 1618, respectively. NO: 1617 and 1652; l) SEQ ID NO: 1618 and 1653; m) SEQ ID NO: 1619 and 1654; n) SEQ ID NO: 1620 and 1655; o) SEQ ID NO: 1621 and 1656; p) SEQ ID NO: 1622 and 1657; q) SEQ ID NO: 1623 and 1658; r) SEQ ID NO: 1624 and 1659; s) SEQ ID NO: 1625 and 1660; t) SEQ ID NO: 1626 and 1661; u) SEQ ID NO: 1627 and 1662; v) SEQ ID NO: 1628 and 1663; w) SEQ ID NO: 1629 and 1664; x) SEQ ID NO: 1630 and 1665; y) are SEQ ID NO: 1631 and 1666, respectively; z) are SEQ ID NO: 1632 and 1667, respectively; aa) are SEQ ID NO: 1633 and 1668, respectively; bb) are SEQ ID NO: 1634 and 1669, respectively; cc) are SEQ ID NO: 1635 and 1670, respectively; dd) are SEQ ID NO: 1636 and 1671, respectively; ee) are SEQ ID NO: 1637 and 1672, respectively; ff) are SEQ ID NO: 1638 and 1673, respectively; gg) are SEQ ID NO: 1639 and 1674, respectively; hh) are SEQ ID NO: 1640 and 1675, respectively; ii) are SEQ ID NO: 1641 and 1676, respectively; and jj) are SEQ ID NO: 1682 and 1656, respectively. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1610 and 1645, respectively; b) SEQ ID NO: 1614 and 1649, respectively; c) SEQ ID NO: 1616 and 1651, respectively; d) SEQ ID NO: 1621 and 1656, respectively; e) SEQ ID NO: 1622 and 1657, respectively; f) SEQ ID NO: 1623 and 1658, respectively; g) SEQ ID NO: 1629 and 1664, respectively; h) SEQ ID NO: 1630 and 1665, respectively; i) SEQ ID NO: 1634 and 1669, respectively; j) SEQ ID NO: 1635 and 1670, respectively; k) SEQ ID NO: 1636 and 1671, respectively; NO: 1636 and 1671; l) are SEQ ID NO: 1640 and 1675 respectively; and m) are SEQ ID NO: 1682 and 1656 respectively. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand and the antisense strand comprise nucleotide sequences selected from the group consisting of: a) SEQ ID NO: 1623 and 1658; b) SEQ ID NO: 1630 and 1665 respectively; c) SEQ ID NO: 1634 and 1669 respectively; d) SEQ ID NO: 1621 and 1656 respectively; e) SEQ ID NO: 1640 and 1675 respectively; and f) are SEQ ID NO: 1682 and 1656 respectively. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1623, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1658 The nucleotide sequence is shown. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1630, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1665. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1634, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1669 The nucleotide sequence is shown. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand includes the nucleotide sequence shown in SEQ ID NO: 1621, and wherein the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 1656 The nucleotide sequence is shown. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand includes the nucleotide sequence shown in SEQ ID NO: 1640, and wherein the antisense strand includes the nucleotide sequence shown in SEQ ID NO: 1676 The nucleotide sequence is shown. The RNAi oligonucleotide of any one of claims 1 to 64, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1682, and wherein the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 1656. Such as the RNAi oligonucleotide of claim 1, wherein the sense strand includes the sequence 5'-[mCs][mA][fG][mC][fA][mG][mU][fG][mA][fU ][mU][fG][fA][mA][fG][mU][fA][mU][mC][mA][mG][mC][mA][mG][mC][mC][ mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1623), wherein the antisense The strand contains the sequence 5'-[Mephosphonate-4O-mUs][fGs][fA][fU][fA][mC][fU][mU][mC][fA][mA][mU][ mC][fA][mC][fU][mG][mC][fU][mGs][mGs][mG]-3' (SEQ ID NO: 1658), and where mC, mA, mG, mU= 2'-OMe ribonucleoside; fA, fC, fG, fU=2'-F ribonucleoside; s=phosphorothioate, and where ademA-GalNAc=

. The RNAi oligonucleotide of claim 1, wherein the sense strand comprises the sequence 5'-[mAs][mG][fA][mG][fC][mA][mA][fG][mU][fG][mA][fC][fA][mA][fA][mU][fG][mU][mU][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1630), wherein the antisense strand comprises the sequence 5'-[Me phosphonate-4O-mUs][fAs][fA][fC][fA][mU][fU][mU][mG][fU][mC][mA][mC][fU][mU][fG][mC][mU][fC][mUs][mGs][mG]-3' (SEQ ID NO: 1665), and wherein mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'-F ribonucleoside; s = phosphorothioate, and wherein ademA-GalNAc =

. As claimed in claim 1, the RNAi oligonucleotide, wherein the sense strand comprises the sequence 5'- [mAs][mG][fU][mC][fA][mU][mG][fA][mC][fA][mU][fU][fU][mC][fU][mC][fA ][mA][mA][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][ mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1634), wherein the antisense strand contains the sequence 5'-[Mephosphonate-4O-mUs][fUs][fU ][fU][fG][mA][fG][mA][mA][fA][mU][mG][mU][fC][mA][fU][mG][mA][fC][ mUs][mGs][mG]-3' (SEQ ID NO: 1669), and wherein mC, mA, mG, mU=2'-OMe ribonucleoside; fA, fC, fG, fU=2'-F ribose Nucleoside; s=phosphorothioate, and where ademA-GalNAc=

. The RNAi oligonucleotide of claim 1, wherein the sense strand comprises the sequence 5'-[mCs][mA][fG][mU][fC][mA][mU][fG][mA][fC][mA][fU][fU][mU][fC][mU][fC][mA][mA][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1621), wherein the antisense strand comprises the sequence 5 ' -[Me phosphonate-4O-mUs][fUs][fU][fG][fA][mG][fA][mA][mA][fU][mG][mU][mC][fA][mU][fG][mA][mC][fU][mGs][mGs][mG]-3' (SEQ ID NO: 1656), and wherein mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'-F ribonucleoside; s = thiophosphate, and wherein ademA-GalNAc =

. The RNAi oligonucleotide of claim 1, wherein the sense strand comprises the sequence 5'-[mAs][mG][fU][mU][fG][mU][mU][fA][mG][fU][mG][fA][fU][mU][fU][mG][fC][mU][mA][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]-3' (SEQ ID NO: 1640), wherein the antisense strand comprises the sequence 5'-[Me phosphonate-4O-mUs][fUs][fA][fG][fC][mA][fA][mA][mU][fC][mA][mC][mU][fA][mA][fC][mA][mA][fC][mUs][mGs][mG]-3' (SEQ ID NO: 1675), and wherein mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'-F ribonucleoside; s = thiophosphate, and wherein ademA-GalNAc =

. The RNAi oligonucleotide of claim 1, wherein the sense strand comprises the sequence 5'-[ademCs-C ₁₆ ][mA][fG][mU][fC][mA][mU][fG][mA][fC][mA][fU][fU][mU][fC][mU][fC][mAs][mAs][mA]-3' (SEQ ID NO: 1682), wherein the antisense strand comprises the sequence 5'-[Me phosphonate-4O-mUs][fUs][fU][fG][fA][mA][mA][fU][mG][mU][mC][fA][mU][fG][mA][mC][fU][mGs][mGs][mG]-3' (SEQ ID NO: 1684). NO: 1656), wherein mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'-F ribonucleoside; s = thiophosphate, and [ademCs-C ₁₆ ] =

. A pharmaceutical composition comprising an RNAi oligonucleotide as claimed in any one of claims 1 to 97, and a pharmaceutically acceptable carrier, delivery agent or formulation. A method for treating a patient suffering from a disease, disorder or condition associated with SNCA gene expression A method for an individual, the method comprising administering to the individual a therapeutically effective amount of an RNAi oligonucleotide according to any one of claims 1 to 97 or a pharmaceutical composition according to claim 98, thereby treating the individual. A method for delivering an oligonucleotide to an individual, the method comprising administering to the individual a pharmaceutical composition as claimed in claim 98. A method for reducing SNCA gene expression in a cell, cell population or individual, the method comprising the following steps: i. making the cell or cell population with an RNAi oligonucleotide as claimed in any one of claims 1 to 97 Or contact with the pharmaceutical composition of claim 98; or ii. Administer the RNAi oligonucleotide of any one of claims 1 to 97 or the pharmaceutical composition of claim 98 to the individual. The method of claim 101, wherein reducing SNCA gene expression includes reducing the amount or level of SNCA mRNA, the amount or level of SNCA protein, SNCA activity/function, or a combination thereof. The method of claim 101 or 102, wherein the individual suffers from a disease, condition or disorder associated with expression of the SNCA gene. The method of claim 99 or 103, wherein the disease, condition or disorder associated with SNCA gene expression is multiple system atrophy, dementia with Lewy bodies or Parkinson disease. The method of any one of claims 99 to 104, wherein SNCA gene expression is reduced in tissue in one or more regions of the central nervous system (CNS), and wherein the tissue is associated with Parkinson's disease. The method of claim 105, wherein the tissue associated with Parkinson's disease is selected from: putamen, midbrain tegmentum, substantia nigra, pons, and medulla. The method of any one of claims 99 to 104, wherein SNCA gene expression is reduced in tissues in one or more regions of the central nervous system (CNS), and wherein the tissues are associated with multisystem atrophy Contraction related. The method of claim 107, wherein the tissue associated with multiple system atrophy is selected from: caudate nucleus, putamen, midbrain tegmentum, substantia nigra, pons, cerebellar cortex, cerebellar white matter, medulla, cervical spinal cord, thoracic spinal cord and lumbar spinal cord. The method of any one of claims 99 to 104, wherein SNCA gene expression is reduced in one or more regions of the central nervous system (CNS), and the one or more regions are selected from: cervical spinal cord, thoracic spinal cord, lumbar spinal cord, Spinal cord, frontal cortex, temporal cortex, cerebellum, midbrain, occipital cortex, parietal cortex, hippocampus, caudate nucleus, thalamus, brainstem, motor cortex, globus pallidus, midbrain tegmentum, substantia nigra, pons , cerebellar white matter and cerebellar dentate nucleus. The method of any one of claims 99 to 109, wherein the RNAi oligonucleotide or the pharmaceutical composition is administered in combination with a second composition or therapeutic agent. Use of an RNAi oligonucleotide as claimed in any one of claims 1 to 97 or a pharmaceutical composition as claimed in claim 98 for the manufacture of a medicament for the treatment of diseases, disorders or disorders associated with SNCA gene expression . The RNAi oligonucleotide according to any one of claims 1 to 97 or the pharmaceutical composition according to claim 98, which is used or suitable for treating diseases, disorders or disorders related to SNCA gene expression. A kit comprising the RNAi oligonucleotide of any one of claims 1 to 97, optionally a pharmaceutically acceptable carrier, and a package insert comprising instructions for administration to a subject suffering from a disease, disorder or condition associated with SNCA gene expression. Such as the use of claim 111, the RNAi oligonucleotide or pharmaceutical composition for use or suitable for use as in claim 112, or the set of claim 113, wherein the disease, disorder or disorder associated with SNCA gene expression For multiple system atrophy, Lewy body dementia and Parkinson's disease.