TW202405187A - Kits and methods for detecting aspergillus infection - Google Patents

Abstract

Disclosed herein is a kit for detecting Aspergillus infection. According to embodiments of the present disclosure, the kit comprises a first primer pair, a first to a fourth probes, and polymerase chain reaction reagents. Also disclosed herein are methods of detecting Aspergillus infection by using the present kit.

Description

Kits and methods for detecting koji infection

This disclosure is in the area of detecting infections. More specifically, the present disclosure relates to a kit for detecting Aspergillus spp. infection and a method of using the kit to diagnose whether an individual is infected with Aspergillus spp.

Pogomycosis is a common fungal infection. According to the symptoms of the disease, it can be roughly divided into invasive aspergillosis (IA), non-invasive chronic pulmonary aspergillosis (CPA), and allergic bronchitis. Allergic bronchopulmonary aspergillosis (ABPA), among which IA infection is the most aggressive, often occurs in patients with immune deficiency, and the mortality rate of infected patients is as high as 30-85%. Studies have shown that antifungal drug treatment in the early stages of infection can significantly improve patient survival rates. Therefore, early diagnosis and appropriate treatment are the keys to improving patient survival rates.

There are currently many diagnostic methods (such as pathological sections, imaging analysis, serology tests, microbial culture and molecular biology-related diagnostic tools) used to detect six types of koji bacteria that mainly cause clinical infections, including Aspergillus fumigatus ), Aspergillus niger , Aspergillus flavus , Aspergillus terreus , Aspergillus nidulans and Aspergillus versicolor . However, these diagnostic methods have low sensitivity and low specificity in the early stages of infection. For example, pathological sections can be stained to observe Koji mold, but the characteristics of its hyphae are not easy to distinguish from those of other molds. Other inspection tools are needed to assist judgment.

After an individual is confirmed to be infected with Kojima, the main drugs currently used to treat Kojima infection are polyene drugs (for example, amphotericin B (amphotericin B, AMB), liposomal AMB, etc.) and azoles ( azole) drugs (for example, triazole, itraconazole, voriconazole, etc.), according to the guidelines released by the Infectious Diseases Society of America (IDSA) in 2016 Guidelines for diagnosis and treatment of koji infection. Azoles are the first choice drugs for treating koji infection. However, under the pressure of long-term screening of antifungal drugs, the tendency of infected patients to develop resistance to azole drugs is gradually increasing, resulting in less effective treatment than expected. Therefore, it is necessary to confirm whether Kojima is resistant to antibiotics as early as possible to adjust treatment strategies to ensure the effectiveness of clinical treatment.

In view of this, there is an urgent need in this field for a highly sensitive, rapid and specific detection method and/or kit for Kojima to assist clinical medical practitioners in diagnosis and accurate drug administration, so as to effectively improve the survival rate of patients.

This summary is intended to provide a simplified summary of the disclosure to provide the reader with a basic understanding of the disclosure. This summary is not an extensive overview of the disclosure and it is not intended to identify key/critical elements of the embodiments of the invention or to delineate the scope of the invention.

The first aspect of the present disclosure relates to a kit for detecting Kojima infection, including a first primer pair, a first probe, a second probe, a third probe, and a fourth probe. , and a polymerase chain reaction (PCR) reagent. According to some embodiments of the present disclosure, the first primer pair includes a first forward primer and a first reverse primer, wherein the first forward primer and the first reverse primer include cores with sequence numbers: 1 and 2 respectively. nucleotide sequence. In these embodiments, the first probe includes a first fluorophore and a first nucleic acid fragment, the second probe includes a second fluorophore and a second nucleic acid fragment, and the third probe includes a third fluorophore and The third nucleic acid fragment; the fourth probe includes a fourth fluorophore and a fourth nucleic acid fragment. In these embodiments, the first to fourth nucleic acid fragments respectively comprise the nucleotide sequences of SEQ ID NO: 3 to 6, and are respectively bonded to the first to fourth fluorophores. Preferably, the first to fourth fluorophores are different fluorophores.

According to certain embodiments of the present disclosure, the kit of the present invention further includes a fifth probe and a sixth probe. In these embodiments, the fifth probe includes a fifth fluorophore and a fifth nucleic acid fragment, and the sixth probe includes a sixth fluorophore and a sixth nucleic acid fragment. In these embodiments, the fifth and sixth nucleic acid fragments respectively comprise the nucleotide sequences of SEQ ID NO: 7 and 8, and are respectively bonded to the fifth and sixth fluorophores. Preferably, the first to sixth fluorophores are different fluorophores.

According to certain embodiments of the present disclosure, the kit of the present invention further includes a second primer pair, a seventh probe and an eighth probe. In these embodiments, the second primer pair includes a second forward primer and a second reverse primer, wherein the second forward primer and the second reverse primer include nucleotides of SEQ ID NO: 9 and 10 respectively. Sequence, the seventh probe includes the nucleotide sequence "CTGGCCGA", and the eighth probe includes the nucleotide sequence "CTGAGCCGA".

According to some embodiments of the present disclosure, the kit of the present invention further includes a third primer pair and a ninth probe. In these embodiments, the third primer pair includes a third forward primer and a third reverse primer, wherein the third forward primer and the third reverse primer include nucleotides of SEQ ID NO: 11 and 12 respectively. sequence, and the ninth probe includes the nucleotide sequence of SEQ ID NO: 13.

According to some embodiments of the present disclosure, the kit of the present invention further includes a fourth primer pair and a tenth probe. In these embodiments, the fourth primer pair includes a fourth forward primer and a fourth reverse primer, wherein the fourth forward primer and the fourth reverse primer include nucleotides of SEQ ID NO: 14 and 15 respectively. sequence, and the tenth probe includes the nucleotide sequence of SEQ ID NO: 16.

Another aspect of the present disclosure relates to a method of using the kit of the present invention to diagnose whether an individual is infected by Aspergillus spp. through a biological specimen of the individual, wherein the Aspergillus fumigatus is Aspergillus fumigatus ), Aspergillus niger , Aspergillus flavus or Aspergillus terreus . According to one embodiment of the disclosure, the method includes (1) extracting deoxyribonucleic acid (DNA) from the biological specimen; (2) combining the DNA extracted in step (1) with the first primer of the kit of the present invention Mix the first to fourth probes and PCR reagents to obtain a mixture; (3) Use real-time polymerase chain reaction (qPCR) to detect the fluorophores of the first to sixth fluorophores Light signal; (4) Diagnose whether the individual is infected by koji bacteria based on the detection result of step (3). According to the embodiment of the present disclosure, if the fluorescent signal of the first probe is detected, it means that the individual is infected by Kojima fumigatus; if the fluorescent signal of the second probe is detected, it means that the individual is infected by Kojima fumigatus. ; If the fluorescent signal of the third probe is detected, it means that the individual is infected with Koji mold; or if the fluorescent signal of the fourth probe is detected, it means that the individual is infected with Koji mold.

Yet another aspect of this disclosure relates to a method of using the kit of the present invention to diagnose whether an individual is infected by Aspergillus spp. through a biological specimen of the individual, wherein the Aspergillus spp. is Aspergillus fumigatus, Aspergillus spp. Aspergillus, Aspergillus flavus, Aspergillus terreus, Aspergillus nidulans or Aspergillus versicolor . According to an embodiment of the present disclosure, the method includes (1) extracting DNA from a biological specimen; (2) combining the DNA extracted in step (1) with the first primer pair and the first to sixth probes of the set of the present invention and PCR reagents to obtain a mixture; (3) use qPCR to detect the fluorescent signals of the first to sixth fluorophores; (4) diagnose whether the individual is infected with koji bacteria based on the detection results of step (3) Infect. According to the embodiment of the present disclosure, if the fluorescent signal of the first probe is detected, it means that the individual is infected by Kojima fumigatus; if the fluorescent signal of the second probe is detected, it means that the individual is infected by Kojima fumigatus. ; If the fluorescent signal of the third probe is detected, it means that the individual is infected by Aflatoxin; if the fluorescent signal of the fourth probe is detected, it means that the individual is infected by Aflatoxin; if the third probe is detected, it means that the individual is infected by Aflatoxin. When the fluorescent signal of the fifth probe is detected, it means that the individual is infected by Kojima nidulans; or if the fluorescent signal of the sixth probe is detected, it means that the individual is infected by Kojima versicolor.

According to certain exemplary embodiments of the present disclosure, the method of the present invention further includes using the second primer pair, the seventh probe and the eighth probe to detect whether the koji bacteria are resistant to antibiotics.

According to certain embodiments of the present disclosure, the method of the present invention further includes using the third primer pair and the ninth probe to detect whether the koji bacteria are resistant to antibiotics.

According to certain embodiments of the present disclosure, the method of the present invention further includes using the fourth primer pair and the tenth probe to detect whether the koji bacteria are resistant to antibiotics.

After referring to the following embodiments, those with ordinary knowledge in the technical field to which the present invention belongs can easily understand the basic spirit and other objectives of the present invention, as well as the technical means and implementation modes adopted by the present invention.

In order to make the description of the present disclosure more detailed and complete, the following provides an illustrative description of the implementation aspects and specific embodiments of the present invention; however, this is not the only form of implementing or using the specific embodiments of the present invention. The embodiments cover features of multiple specific embodiments as well as method steps and their sequences for constructing and operating these specific embodiments. However, other specific embodiments may also be used to achieve the same or equivalent functions and step sequences.

Unless otherwise defined in this specification, the scientific and technical terms used herein have the same meanings as commonly understood and customary by a person of ordinary skill in the art to which this invention belongs.

Unless there is conflict with the context, the singular form of a noun used in this specification shall include the plural form of the noun; and the plural form of the noun shall also include the singular form of the noun. In addition, in this specification and the scope of the patent application, the expressions "at least one" and "one or more" have the same meaning, and both of them mean that one, two, three or more are included. What’s more, in this specification and the scope of the patent application, “at least one of A, B and C”, “at least one of A, B or C” and “at least one of A, B and/or C” ” means covering only A, only B, only C, both A and B, both B and C, both and C, and three A, B and C.

Notwithstanding that the numerical ranges and parameters defining the broader scope of the invention are approximations, the relevant numerical values in the specific embodiments are presented as precisely as possible. Any numerical value, however, inherently contains the standard deviation resulting from the individual testing methods used. As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range. Alternatively, the word "about" means that the actual value falls within an acceptable standard error of the mean, as determined by a person of ordinary skill in the art to which this invention belongs. Except for experimental examples, or unless otherwise expressly stated, all ranges, quantities, numerical values and percentages used herein (such as to describe the amount of material, length of time, temperature, operating conditions, quantitative proportions and other similar ) are all modified by "covenant". Therefore, unless otherwise stated to the contrary, the numerical parameters disclosed in this specification and the accompanying patent claims are approximate values and may be changed as required. At a minimum, these numerical parameters should be understood to mean the number of significant digits indicated and the value obtained by applying ordinary rounding. Herein, numerical ranges are expressed from one endpoint to the other point or between two endpoints; unless otherwise stated, numerical ranges stated herein include the endpoints.

The term "gene" used in this article refers to a functional nucleotide sequence (including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)) that contains specific genetic information. It includes not only the DNA regions that encode gene products (RNA and proteins), but also regions used for regulation. For example, regulatory regions include promoters, terminators, and translational regulatory sequences (such as ribosome binding sites and internal ribosome entry sites (IRES)). , enhancer, silencer, insulator, boundary element, origins of replication, matrix binding sites and locus control region , LCR) etc. The term "gene" can also include all introns and other DNA sequences spliced from the mRNA transcript, as well as from alternative splicing sites, as well as various variants thereof. The term "gene" as used herein may include any part or all of a gene, particularly any part of the aforementioned DNA regions.

The term "primer" as used herein refers to an oligonucleotide that can hybridize with a target nucleic acid sequence (for example, a DNA template to be amplified) and can act as a polymerase The starting point for amplification reactions. "Primers" may include modified oligonucleotides, such as oligonucleotides modified by biotinylation, phosphorylation, or the addition of locked nucleic acids (LNA). The "lead" can be single strand or double strand. The "primer pair" used in this article refers to a set or a pair of primers, which includes a "forward primer" that is complementary and hybrid to the 5' upstream sequence of the sequence to be amplified. ) and a "reverse primer" that is complementary and hybridized to the downstream sequence at the 3' end of the sequence to be amplified. Those with ordinary knowledge in the art to which the present invention belongs should understand that the use of "forward primer" and "reverse primer" in this article is not intended to limit the primer, but only to provide exemplary directions.

The term "probe" as used herein refers to a single-stranded polynucleotide that can be hybridized with a complementary single-stranded target sequence to form a double-stranded molecule (hybrid). In certain embodiments of the present disclosure, a "probe" can hybridize to a complementary single-stranded amplified gene fragment. In this specification, "specific probe" refers to a probe that can specifically or specifically complementarily bind or hybridize to a single-stranded target sequence. In certain embodiments of the present disclosure, the specific probes are oligonucleotide fragments of about 5-30 nucleotides in length, preferably polynucleotide sequences of 9-26 nucleotides in length. .

The term "mutation" refers to any molecular-level and tissue-level changes in the gene sequence and the amino acid sequence encoded by the gene sequence. From a molecular level, mutations can be changes in the base pair composition or sequence of genes in their structure. These changes include point mutations, silent mutations, missense mutations, Nonsense mutation, deletion mutation, frameshift mutation, insertion mutation, splicing-site mutation, etc. In this specification, "mutation" includes homozygous mutation, heterozygous mutation, uniallelic or monoallelic mutation, and biallelic mutation. The term "mutant type" used herein includes all mutant types of genes and/or proteins mentioned above, as well as organisms or biological specimens containing these mutant genes and/or proteins.

In this disclosure, the term "subject" refers generally to a human subject (i.e., a male or female of any age, such as an infant, toddler, or adolescent pediatric subject, or a young, middle-aged, or elderly adult subject) . According to a preferred embodiment of the present invention, the individual may be an immunocompromised patient, a transplant patient, a patient after severe viral infection (eg, COVID-19), or a healthy individual without any symptoms.

As used herein, a "kit" may include a primer pair of the present invention, a probe and a container (such as a microcentrifuge tube, vial, ampoule, jar, syringe and/or dispenser package, or other suitable container). In certain embodiments of the present disclosure, a kit of the invention refers to various combinations of materials, reagents, and instructions necessary for the embodiments.

Detailed implementation

(I) Kit for detecting koji bacteria

Invasive aspergillosis (IA) easily occurs in immunocompromised patients and leads to extremely high mortality in infected patients. Currently, clinically, the survival rate of patients can only be improved through early diagnosis and administration of appropriate antifungal drugs. In order to enable early diagnosis of koji infection, the present invention aims to provide a kit for detecting koji infection. Specifically, the kit of the present invention uses a pair of specific primers to amplify genes that are highly conserved against Kojima bacteria (such as the benA gene that encodes the production of β-tubulin), and then uses a pair of Specific koji (such as Aspergillus fumigatus , Aspergillus flavus, Aspergillus terreus , Aspergillus niger , Aspergillus nidulans or Aspergillus variegated Aspergillus versicolor ) has a specific probe to detect and identify infectious koji bacteria.

Accordingly, a first aspect of the present disclosure relates to a kit for detecting koji infection. According to certain embodiments of the present disclosure, the kit includes a set of primer pairs, four probes and PCR reagents, wherein the primer pair (hereinafter referred to as the " benA primer pair") can be used to amplify koji bacteria (including Kojima fumigatus , Kojima fumigatus , Kojima flavus and Kojima terrarum), and the four probes (hereinafter referred to as "Mojog mold fumigatus probe", "Koji mold mold probe", "Koji mold mold probe" and "Mojo mold mold") Kojima probe") can specifically bind to the specific sequences in the benA gene of Kojima fumigatus, Kojima niger, Kojima flavus and Kojima terreus, thereby distinguishing different types of Kojima. According to another embodiment of the present disclosure, the kit further includes a probe specific for the benA gene of Kojima micronidans and Kojima versicolor (hereinafter referred to as the "Kojima micronidus probe" and "Micronidulans probe"). "Koji probe") to further distinguish infections caused by Kojima nidulans or Kojima versicolor.

Those with ordinary knowledge in the field of the present invention can imagine that the six probes (i.e., the above-mentioned Kojima fumigatus probe, Kojima niger probe, Kojima flavus probe, Kojima terrestris probe, and Kojima micronidus probe and A. versicolor probes) can be bonded to the same or different fluorophores. Preferably, the six probes are respectively bonded to six different fluorophores; in this way, a person with ordinary knowledge in the technical field of the present invention can identify the koji by detecting the fluorescent signals of different fluorophores. Types of bacteria.

According to certain preferred embodiments of the present disclosure, the benA primer pair of the present invention includes a forward primer and a reverse primer, which respectively include the nucleotide sequences of SEQ ID NO: 1 and 2, and the M. fumigatus probe, black The Kojima probe, Kojima flavus probe, Kojima terrestris probe, Kojima micronidus probe and Kojima versicolor probe respectively include the nucleotide sequences of sequence numbers: 3-8. Preferably, the forward primer and the reverse primer of the benA primer pair are composed of the nucleotide sequences of sequence numbers: 1 and 2 respectively, and the Kojima fumigatus probe, the Kojima niger probe, and the Kojima flavus probe , Kojima terrestris probe, Kojima nidulans probe and Kojima versicolor probe respectively consist of nucleotide sequences with sequence numbers: 3-8.

Exemplary fluorophores that can be combined with the probe of the present invention include, but are not limited to, coumarin, aminocoumarin, hydroxycoumarin, allophycocyanin, APC), cyanine dye 3 (CY3), CY5, CY7, APC-CY7 conjugate, fluorescein, carboxyfluorescein (FAM), 2'-chloro- 7'-phenyl-1,4-dichloro-6-carboxyfluorescein (2'-chloro-7'phenyl-1,4-dichloro-6-carboxy-fluorescein, also known as VIC ^TM ), fluorescent yellow (lucifer yellow), methoxycoumarin, [2-(4-nitro-2,1,3-benzodiazol-7-yl)amineethyl]trimethylammonium ([2-(4- nitro-2,1,3-benzoxadiazol-7-yl)aminoethyl]trimethylammonium, NBD-TMA), phycoerythrin (PE), PE-CY5 conjugate, PE-CY7 conjugate, tetramethylrodane Tetramethylrhodamine isothiocyanate (TRITC)-amines and Texas Red ^TM amines.

Optionally, the M. fumigatus probe, M. fumigatus probe, M. flavus probe, M. terreus probe, M. nidus probe and M. versicolor probe can be combined with a quencher (quencher). ) key. In this case, if the probe is in a free state, the quencher will absorb the fluorescent signal emitted by the fluorophore, making the detection instrument unable to detect the fluorescent signal; if the probe binds to the target fragment, the probe During the PCR amplification process, it will be hydrolyzed by enzymes, causing the fluorophore to separate from the quencher, so that the fluorescent signal of the fluorophore can be detected, thereby reducing non-specific fluorescent signals and improving detection accuracy. Accuracy.

Exemplary quenchers that can be combined with the probe of the present invention include, but are not limited to, tetramethylrhodamine (TAMRA), ^BHQ1® , 4-(4'dimethylaminophenylazo)benzoic acid ( 4-(4-dimethylaminophenylazo)benzoic acid, DAB), MGB Eclipse ^® , BHQ2 ^® and BBQ650 ^® . Preferably, the quenching agent is MGB ^® .

Optionally, the kit of the present invention may further include a DNA fragment as a positive control group. Specifically, the DNA fragment is used as a template, a benA primer pair is used for amplification, and then a non-specific fluorescent dye is used for detection; in this case, if the non-specific fluorescent dye can be detected The generation of a fluorescent signal indicates that the current PCR conditions can successfully amplify. If the fluorescent signal cannot be detected, it means that the amplification cannot be successful. The experimental conditions of the PCR need to be adjusted to confirm the feasibility of the PCR process. According to an exemplary embodiment of the present disclosure, the DNA fragment includes the nucleotide sequence of SEQ ID NO: 17.

According to certain embodiments of the present disclosure, the PCR reagents in the kit of the present invention include chemical substances required to perform PCR procedures, wherein the chemical substances include, but are not limited to, (i) an aqueous solution buffer (also known as PCR buffer) liquid), (ii) a water-soluble magnesium salt (e.g., MgCl ₂ ), (iii) at least four deoxyribonucleotide triphosphates (i.e., dNTPs, which include deoxythymidine triphosphate (thymidine triphosphate (dTTP)), deoxyadenosine triphosphate (dATP), deoxycitidine triphosphate (dCTP) and deoxyguanosine triphosphate (dGTP)) , and (iv) a polynucleotide polymerase, preferably a DNA polymerase, more preferably a thermostable DNA polymerase, i.e., can withstand between 90°C and 100°C for a total time of at least 10 minutes temperature without losing more than half of its activity. Depending on the desired purpose, these chemicals may contain one or more additional ingredients to improve the performance and/or specificity of the PCR process, such as betaine, ethylene glycol, and/or glycerol.

Optionally, the kit of the present invention may further include instructions for use to instruct the user on how to use the kit of the present invention to detect koji infection.

(II) Kit for detection of drug-resistant koji bacteria

Based on the widespread use of antifungal drugs as the main treatment strategy for koji infections, koji bacteria that are resistant to drugs have been observed in the pharmaceutical field, thus significantly reducing the effectiveness of treatment. In order to determine early whether the infected koji bacteria are drug-resistant so as to administer appropriate prescriptions to patients, a second aspect of the present disclosure provides a kit for detecting drug-resistant koji bacteria. According to certain embodiments of the present disclosure , a kit for detecting drug-resistant Kojima bacteria includes a set of primer pairs (hereinafter referred to as " cyp51A primer pair") and a probe that can specifically bind to the tandem repeat (TR) sequence of the cyp51A mutant gene (hereinafter referred to as the "TR probe"). As mentioned above, the TR probe is preferably bonded to a fluorophore, so that those skilled in the art can confirm whether the infected koji bacteria are resistant to antibiotics by detecting changes in the fluorescent signal of the probe.

According to certain embodiments of the present disclosure, the forward primer and the reverse primer of the cyp51A primer pair of the present invention include the nucleotide sequences of SEQ ID NO: 9 and 10 respectively, and the TR probe includes the nucleotide sequence of "CTGGCCGA". According to an exemplary embodiment, the forward and reverse primers of the cyp51A primer pair are composed of the nucleotide sequences of SEQ ID NO: 9 and 10 respectively, and the TR probe is composed of the nucleotide sequence of "CTGGCCGA" .

According to certain embodiments of the disclosure, the forward primer and the reverse primer of the cyp51A primer pair of the present invention include the nucleotide sequences of SEQ ID NO: 9 and 10 respectively, and the TR probe includes the nucleotide sequence of "CTGAGCCGA". According to an exemplary embodiment, the forward and reverse primers of the cyp51A primer pair are composed of the nucleotide sequences of SEQ ID NO: 9 and 10 respectively, and the TR probe is composed of the nucleotide sequence of "CTGAGCCGA" .

According to certain embodiments of the present disclosure, the forward primer and the reverse primer of the cyp51A primer pair of the present invention include the nucleotide sequences of SEQ ID NO: 11 and 12 respectively, and the TR probe includes the nucleotide sequence of SEQ ID NO: 13. . In an exemplary embodiment, the forward and reverse primers of the cyp51A primer pair are composed of the nucleotide sequence of SEQ ID NO: 11 and 12 respectively, and the TR probe is composed of the nucleotide sequence of SEQ ID NO: 13 composed of.

According to certain embodiments of the present disclosure, the forward primer and the reverse primer of the cyp51A primer pair of the present invention include the nucleotide sequence of SEQ ID NO: 14 and 15 respectively, and the TR probe includes the nucleotide sequence of SEQ ID NO: 16 . In an exemplary embodiment, the forward and reverse primers of the cyp51A primer pair are composed of the nucleotide sequence of SEQ ID NO: 14 and 15 respectively, and the TR probe is composed of the nucleotide sequence of SEQ ID NO: 16 composed of.

Preferably, the kit of the present invention may simultaneously include multiple sets of cyp51A primer pairs and TR probes of the present invention. According to some preferred embodiments of the present disclosure, the kit of the present invention can include two sets of cyp51A primer pairs and TR probes; for example, the two sets of cyp51A primer pairs are composed of the nucleotide sequences of SEQ ID NO: 9-12. The TR probes are composed of "CTGGCCGA" and/or "CTGAGCCGA" and the nucleotide sequence of sequence number: 13; the two sets of cyp51A primer pairs are composed of sequence numbers: 9, 10, 14 and 15 respectively. The TR probe is composed of "CTGGCCGA" and/or "CTGAGCCGA" and the nucleotide sequence of sequence number: 16; or the two sets of cyp51A primer pairs are composed of sequence number: It consists of the nucleotide sequences of 11, 12, 14 and 15, and the TR probe consists of the nucleotide sequences of sequence numbers: 13 and 16 respectively. Optimally, the kit of the present invention can include three sets of cyp51A primer pairs and TR probes; for example, the three sets of cyp51A primer pairs are composed of the nucleotide sequences of SEQ ID NO: 9-12, 14 and 15, and TR The probes are respectively composed of the nucleotide sequences of "CTGGCCGA" and/or "CTGAGCCGA", sequence numbers: 13 and 16.

Depending on the purpose of use, those skilled in the art can bond the TR probe with the quencher described in the first aspect of this disclosure, thereby improving detection accuracy. According to an operational embodiment, the 5' and 3' ends of the TR probe of the present invention are respectively bonded to a fluorophore and a quencher.

Optionally, the kit of the present invention may further include another instruction for use to instruct the user on how to use the kit of the present invention to detect drug-resistant koji bacteria.

(III) Methods for detecting koji infection

Based on the above, the third aspect of the present disclosure relates to a method for diagnosing whether an individual is infected by koji bacteria using the kit of the present invention. According to certain embodiments of the present disclosure, the method includes (1) extracting the DNA of the biological specimen; (2) combining the DNA extracted in step (1) with the benA primer pair and the M. fumigatus probe in the kit of the present invention , Koji mold probe, Koji mold probe, Koji mold probe and PCR reagent are mixed to obtain a mixture; (3) qPCR is used to detect the fluorescent signal of the fluorophore bonded to the probes. ; (4) Diagnose whether the individual is infected with koji bacteria based on the detection result of step (3).

According to the embodiments of the present disclosure, the biological specimen can be any specimen that is susceptible to koji infection, for example, serum, sputum, alveolar lavage fluid, nasal mucosa tissue, bronchial sections or lung sections. According to a preferred embodiment of the present disclosure, the biological specimen is alveolar lavage fluid.

First, in step (1), the purpose of extracting DNA from biological specimens is achieved by any conventional DNA extraction technology; for example, the phenol/chloroform method, and surfactants (for example, dodecane Sodium dodecyl sulfate (sodium dodecyl sulfate, TWEEN ^® -20, NP-40 and TRITON ^® X-100)/acetic acid method is used for extraction. On the other hand, the same DNA extraction purpose can also be achieved by using commercially available DNA extraction kits, such as DNeasy blood and tissue kit, Puregene blood kit, DNAzol ^TM reagent, PureLink ^TM genomic DNA mini kit, PureLink ^TM Genome DNA Purification Kit and InstaGene ^TM Matrix.

In step (2), the DNA extracted in step (1) is combined with the benA primer pair, M. fumigatus probe, M. fumigatus probe, M. flavus probe, M. terrestris probe and PCR reagent (i.e. The kit (I) of the present invention is uniformly mixed to obtain a mixture.

Next, in step (3), a qPCR process is used to amplify the DNA fragment and detect specific gene expression. qPCR utilizes the principle of double-stranded DNA replication to replicate specific DNA fragments in vitro, and uses non-specific fluorescent dyes (such as SYBR ^® Green) or specific probes to detect the total amount of product after each PCR cycle Methods. According to certain embodiments of the disclosure, the genomic DNA of the individual biological specimen (that is, the DNA extracted in step (1)) is used as the template for the amplification reaction. Basically, if the individual is not infected with Koji, no amplified fragments will be produced, and conceivably, no fluorescent signal from the probe will be detected. On the contrary, if an individual is infected by Koji, the benA primer pair can amplify the benA gene fragment of Koji from its biological sample, and the Koji probe, Koji probe, Koji probe or Koji probe The mold probe will bind to the amplified gene fragment and then emit the corresponding fluorescent signal. For example, when an individual is infected by Kojima fumigatus, only the Kojima fumigatus probe will bind to the amplified gene fragment and emit its corresponding fluorescent signal; in contrast, other probes will bind to the amplified gene fragment. The specific design will not bind to the amplified gene fragment, so its individual corresponding fluorescent signal cannot be detected. When the intensity of the fluorescent signal reaches the preset threshold after a certain cycle, the number of cycles at this time is called is the Ct (threshold cycle) value, and the detection result is represented by the Ct value.

Finally, in step (4), whether the individual is infected by koji bacteria is diagnosed based on the detection result of step (3). According to certain embodiments of the present disclosure, after the DNA of the biological specimen is analyzed by qPCR, if the Ct values of the Kojima fumigatus probe, Kojima niger probe, Kojima flavus probe or Kojima terrestris probe are all greater than or If the Ct value of the fluorescent signal of any probe is less than the specific cycle number, the individual is diagnosed as being infected with Kojima.

In certain embodiments of the present disclosure, it can be used to distinguish whether the individual is infected by Kojima fumigatus, Kojima niger, Kojima flavum, or Kojima terreus. In these embodiments, if the Ct value of the fluorescent signal emitted by the M. fumigatus probe is less than a specific cycle number, it means that the individual is infected by M. fumigatus; if the Ct value of the fluorescent signal emitted by the M. fumigatus probe is When the Ct value is less than a specific cycle number, it means that the individual is infected by Morphoderma niger; if the Ct value of the fluorescent signal emitted by the Morphoderma flavus probe is less than the specific cycle number, it means that the individual is infected by Morphoderma flavus; or if When the Ct value of the fluorescent signal emitted by the T. terrestris probe is less than a specific cycle number, it means that the individual is infected with T. terrestris.

According to an embodiment of the disclosure, the specific cycle number is 37, that is, if the Ct value of the fluorescent signal emitted by the M. fumigatus probe is less than 37 (for example, 36, 35, 34, 33, 32, 31, 30 , 29, 28, 27, 26, 25, 24, 23, 22, 21, 20 or less), it means that the individual is infected by M. fumigatus; if the Ct value of the fluorescent signal emitted by the M. fumigatus probe is less than If the Ct value of the fluorescent signal emitted by the A. flavus probe is less than 37, it means that the individual is infected with M. flavus; if the Ct value of the fluorescent signal emitted by the A. flavus probe is When the Ct value of the light signal is less than 37, it means that the individual is infected by T. Koji infection.

According to a preferred embodiment of the present disclosure, the probes are respectively bonded to different fluorophores to achieve the purpose of distinguishing different koji bacteria.

Alternatively, the purpose of detection can also be achieved by analyzing the melting curve of each probe.

The present disclosure also provides a method for diagnosing whether an individual is infected by Kojima fumigatus, Kojima niger, Kojima flavus, Kojima terrestris, Kojima micronidus, or Kojima versicolor using the kit of the present invention. The method for diagnosing infection by Kojima fumigatus, Kojima niger, Kojima flavus, Kojima terreus, Kojima nidulans or Kojima versicolor includes steps similar to the aforementioned method, except that step (2) is a step (1). ) extracted DNA and the benA primer pair, Kojima fumigatus probe, Kojima niger probe, Kojima flavus probe, Kojima terrestrial probe, Kojima micronidus probe, and Kojima variegated in the set of the present invention. Mix mold probes and PCR reagents; use the binding specificity of each probe to the benA gene of different bacterial species to detect Kojima fumigatus, Kojima niger, Kojima flavus, Kojima terrestris, Kojima micronidus or variegated Koji mold infection.

As mentioned above, the method for diagnosing infection by Kojima fumigatus, Kojima niger, Kojima flavus, Kojima terrarum, Kojima nidulans or Kojima versicolor is to pair the DNA extracted from the biological specimen with the benA primer, Specific probes for six species of Kojima (i.e. Kojima fumigatus probe, Kojima niger probe, Kojima flavus probe, Kojima terrestris probe, Kojima micronidus probe and Kojima versicolor probe ) and PCR reagents are mixed, and qPCR is used to amplify and detect the fluorescent signal of each probe. By analyzing the Ct value, it is determined whether the individual is infected by Kojima fumigatus, Kojima fumigatus, Kojima flavus, Kojima terrarum, Kojima nidus or Kojima versicolor infection.

Preferably, the probes are respectively combined with six different fluorophores. In this case, if the fluorescent signal emitted by the Kojima fumigatus probe, Kojima niger probe, Kojima flavus probe, Kojima terreus probe, Kojima micronidus probe or Kojima versicolor probe When the Ct value is less than 37, it means that the individual is infected by Kojima fumigatus, Kojima niger, Kojima flavus, Kojima terreus, Kojima micronidus or Kojima versicolor; or if the Ct values of these probes are all When it is greater than or equal to 37, it means that the individual is not infected by koji bacteria.

Alternatively, the purpose of detection can also be achieved by analyzing the melting curve of each probe.

(IV) Methods for detecting drug-resistant koji bacteria

It is conceivable that after diagnosing whether an individual is infected by Kojima based on the method described in Part (III) of this disclosure, if it is determined that the individual is infected by Kojima, the method described in Part (II) of this disclosure can be further used. The team will analyze whether the koji bacteria are resistant, so that appropriate drug-resistant treatment can be given to the individual immediately.

According to certain embodiments of the present disclosure, when analyzing whether the infected koji bacteria are resistant to antibiotics, the same steps as the method described in part (III) of the disclosure are used to conduct drug resistance detection. Specifically, the DNA extracted from the biological specimen is first mixed with the cyp51A primer pair, TR probe and PCR reagent (corresponding to step (2) of Part (III)), and then the qPCR process is performed to amplify the DNA contained in the cyp51A gene. Specify the fragment of the mutation site and detect the fluorescent signal of the TR probe (corresponding to step (3) of Part (III)), and then detect the infected koji bacteria based on the detection result (that is, the Ct value) Whether it is resistant (corresponding to step (4) in Part (III)); as mentioned above, if the Ct value is greater than or equal to the specific cycle number, it means that the koji bacteria is not resistant; if the Ct value is less than the specific cycle number , it means that the koji bacteria are resistant.

Alternatively, the purpose of detection can also be achieved by analyzing the melting curve of each probe.

According to an embodiment of the present disclosure, the individual is a human.

Multiple embodiments are provided below to illustrate certain aspects of the present disclosure to facilitate those with ordinary knowledge in the technical field to which the present invention belongs to practice the present invention. These examples should not be construed as limiting the scope of the invention. It is believed that a person of ordinary skill in the art to which the present invention belongs, after reading the description set forth herein, can fully utilize and practice the present invention without undue interpretation. All publications cited herein are hereby incorporated by reference in their entirety.

Example

Materials and methods

1. Koji bacteria culture

Commercially available Kojima fumigatus (MYA-4916 ^TM ), Kojima flavus (MYA-4921 ^TM ), Kojima terreus (1012 ^TM ) and Kojima niger (16888 ^TM ) were transformed into thioglycollate broth. , cultured under appropriate conditions for 48 hours to obtain the culture fluids of Kojima fumigatus, Kojima flavus, Kojima terreus and Kojima niger respectively.

2. DNA extraction

Use a commercially available nucleic acid extraction kit to extract the DNA of each koji bacteria from the culture broth of different koji bacteria described in Materials and Method 1. Obtain 0.5 ml of the DNA extraction solution of each koji bacteria, and take 200 μl of each for subsequent steps. detection.

3. Primer pairs and probes

Based on the nucleotide sequence of the Kojima benA gene (56 species in total), a benA forward primer and a benA reverse primer (ie, benA primer pair, sequence number: 1 and 2) were designed. Then, based on the benA gene of the bacterial species to be detected, the Kojima fumigatus probe, Kojima niger probe, Kojima flavus probe, Kojima terrestris probe, Kojima micronidus probe and Kojima versicolor probe are designed. Probe (sequence number: 3-8). The nucleotide sequences of the benA primer pair and the probe for specific Kojima species are summarized in Table 1.

Table 1 Nucleotide sequences of benA primer pair and Koji bacteria probe Serial number Name nucleotide sequence 1 benA primer pair Forward introduction TCGGTGTAGTGACCCTTGG 2 reverse primer GCTGGAGCGCATGAACGTCT 3 Kojima fumigatus probe CGGCAACATCTCACGATCTGACTCGC 4 Black mold probe ACTTCAGCAGGCTAGCGGTAACAAGT 5 Aflatoxin probe TGAAAACGCTTTGCAACTCCTGACCG 6 terreomyces probe ACCATCCTGGGACAGATTCTCCACGC 7 Kojima micronidus probe ATTCTTACGCGGTACGCTTATCGTT 8 M. versicolor probe TCGGCTTACTGCATTCAGCCATCAT

In addition, three pairs of universal primer pairs (i.e., cyp51A primer pairs -1 to -3, sequence numbers: 9-12, 14, and 15) were also designed for the mutation sites of the drug resistance gene cyp51A of Koji bacteria, and these mutation sites were Points have TR probes -1 to -4 with binding specificity. The nucleotide sequences of these cyp51A primer pairs and TR probes are summarized in Table 2.

Table 2 Nucleotide sequences of cyp51A primer pair and TR probe Serial number Name nucleotide sequence 9 cyp51A primer pair-1 Forward introduction ATGAGTGAATAATCGCAGCACC 10 reverse primer GTTAGGGTGTATGGTATGCTGG TR probe-1 CTGGCCGA TR probe-2 CTGAGCCGA 11 cyp51A primer pair-2 Forward introduction GAGCCGAATGAATCAC 12 reverse primer ACCAATATAGGTTCATAGGTAAGTAGATCTACC 13 TR probe-3 TTCCAGCATACCATACAC 14 cyp51A primer pair-3 Forward introduction CCGAATGAAAGTTGTCTAGAA 15 reverse primer ACCAATATAGGTTCATAGGTAAGTAGATCTACC 16 TR probe-4 TTCCAGCATACCATACAC

4. Real-time polymerase chain reaction (qPCR) detection

The DNA obtained in Materials and Method 2 is evenly mixed with the kit of the present invention to obtain a mixture, and then the mixture is placed in a qPCR detection instrument and subjected to the qPCR process. After the reaction is completed, the detection results are expressed as Ct values.

The reaction conditions for qPCR are set as follows: Stage 1: Separate the two DNA strands at 95°C for 25 seconds; Stage 2: At 58°C for 30 seconds to bind the DNA to the primer; Stage 3: At 72°C for 35 seconds The DNA is extended and the fluorescent signal is obtained; return to stage 1 and repeat 40 cycles; stage 4: cool to 4°C to complete the reaction.

Example 1 Koji bacteria detection

Use the methods described in Materials and Methods 1 and 2 to obtain the DNA extracts of Kojima fumigatus and Kojima flavus, and take 200 microliters of each, and perform qPCR amplification with the primer pairs and probes listed in Table 1 (reaction conditions are as follows: as described in Materials and Methods 4) and detection. If the Ct value is less than 37, it is judged as positive; if the Ct value is greater than 37 or equal to, it is judged as negative. The test results are summarized in Table 3.

Table 3 Test results strain positive negative false positive false negative Sensitivity specificity Kojima fumigatus 100 100 0 0 100% 100% black yeast mold 100 100 0 0 100% 100% Aflatoxin 100 100 0 0 100% 100% Kojima terrestris 100 100 0 0 100% 100% Kojima nidulans 96 100 0 4 96% 100% Aspergillus versicolor 98 100 0 2 98% 100%

The results in Table 3 show that the sensitivity of the kit of the present invention for detecting 6 common clinical pathogenic bacteria can reach more than 95%, and the specificity is 100%, indicating that the present invention is suitable for detecting koji infections.

Further, the DNA extracted from M. fumigatus and M. flavus was diluted with sterile water at appropriate multiples, and the absorbance values of the DNA samples at each dilution ratio were measured at wavelengths of 260 nanometers (nm) and 280 nm. The DNA concentration was calculated using the absorbance value at wavelength 260 nm, and the purity of DNA was judged by the ratio of absorbance values at wavelength 260 nm and 280 nm (data not shown). Next, the DNA concentration is diluted to 256 copies per microliter, and 2-fold serial dilutions are performed to detect the limit of detection (LOD) of the method of the present invention, where LOD is defined as more than 95% of the sample The lowest concentration that can be detected. According to the experimental results, the average Ct values measured for DNA samples of M. fumigatus and M. flavus diluted 16 times (equivalent to 16 copies per microliter) were 35.4 and 36.2 respectively (standard deviation = 0.8). It can be seen that the LOD of the method of the present invention is 16 copies per microliter.

Example 2 Clinical Testing

Collect 36 groups of alveolar lavage fluid samples from individuals diagnosed with IA infection, and use the method of the present invention to detect koji bacteria infection and drug resistance respectively.

The test results show that the method of the present invention can correctly determine 35 infected samples from 36 groups of infected individuals, and further detect that 4 groups of individuals are infected by Kojima containing mutations, that is, these individuals are infected with antibiotics. Drug-induced koji infection. According to the test results, it can be seen that the accuracy of the method of the present invention for detecting clinical specimens can reach 97%, it can effectively detect koji infections, and can also distinguish drug-resistant koji bacteria.

In summary, the present disclosure provides a kit for detecting koji infection. According to the embodiments of the present disclosure, the kit of the present invention uses a specific primer pair and probe of the benA gene and uses qPCR analysis to detect koji infection, and the detection is improved by combining the specific primer pair with a specific probe. Sensitivity and specificity. In addition, the kit of the present invention also provides a specific primer pair and probe for the drug resistance gene of Kojima (ie, cyp51A gene) to further detect whether the Kojima infected by the individual is drug-resistant. Based on this, clinical practitioners are provided with a rapid, sensitive and specific early detection tool, which can also identify drug-resistant strains to adjust treatment strategies and effectively improve patient survival rates.

Although the above embodiments disclose specific examples of the present invention, they are not intended to limit the present invention. Those with ordinary knowledge in the technical field to which the present invention belongs can, without departing from the principles and spirit of the present invention, Various changes and modifications can be made to it, so the protection scope of the present invention shall be defined by the appended patent application scope.

without

without

          Sequence Listing
          <![CDATA[<110> Baker Biomedical Co., Ltd.]]>
          <![CDATA[<120> Kits and methods for detecting koji infection]]>
          <![CDATA[<130> P4282-TW]]>
          <![CDATA[<160> 17]]>
          <![CDATA[<170> BiSSAP 1.3.6]]>
          <![CDATA[<210> 1]]>
          <![CDATA[<211> 19]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 1]]>
          tcggtgtagtgacccttgg 19
          <![CDATA[<210> 2]]>
          <![CDATA[<211> 20]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 2]]>
          gctggagcgc atgaacgtct 20
          <![CDATA[<210> 3]]>
          <![CDATA[<211> 26]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 3]]>
          cggcaacatc tcacgatctg actcgc 26
          <![CDATA[<210> 4]]>
          <![CDATA[<211> 26]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 4]]>
          acttcagcag gctagcggta acaagt 26
          <![CDATA[<210> 5]]>
          <![CDATA[<211> 26]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 5]]>
          tgaaaacgct ttgcaactcc tgaccg 26
          <![CDATA[<210> 6]]>
          <![CDATA[<211> 26]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 6]]>
          accatcctgg gacagattct ccacgc 26
          <![CDATA[<210> 7]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 7]]>
          attcttacgc ggtacgctta tcgtt 25
          <![CDATA[<210> 8]]>
          <![CDATA[<211> 25]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 8]]>
          tcggcttact gcattcagcc atcat 25
          <![CDATA[<210> 9]]>
          <![CDATA[<211> 22]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 9]]>
          atgagtgaat aatcgcagca cc 22
          <![CDATA[<210> 10]]>
          <![CDATA[<211> 22]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 10]]>
          gttagggtgt atggtatgct gg 22
          <![CDATA[<210> 11]]>
          <![CDATA[<211> 16]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 11]]>
          gagccgaatg aatcac 16
          <![CDATA[<210> 12]]>
          <![CDATA[<211> 33]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 12]]>
          accaatatag gttcataggt aagtagatct acc 33
          <![CDATA[<210> 13]]>
          <![CDATA[<211> 18]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 1]]>3
          ttccagcata ccataacac 18
          <![CDATA[<210> 14]]>
          <![CDATA[<211> 21]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 14]]>
          ccgaatgaaa gttgtctaga a 21
          <![CDATA[<210> 15]]>
          <![CDATA[<211> 33]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 15]]>
          accaatatag gttcataggt aagtagatct acc 33
          <![CDATA[<210> 16]]>
          <![CDATA[<211> 18]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 16]]>
          ttccagcata ccataacac 18
          <![CDATA[<210> 17]]>
          <![CDATA[<211> 276]]>
          <![CDATA[<212> DNA]]>
          <![CDATA[<213> artificial sequence]]>
          <![CDATA[<220> ]]>
          <![CDATA[<223> synthesis]]>
          <![CDATA[<400> 17]]>
          atcgtaagct ttcggtgtag tgacccttgg cccagccgaa gacgaagttg tcgggacgga 60
          cggtcaggag ttgcaaagcg ttttcagcac ggacaactca gggacggtgt gatctaacct 120
          catggtacgc gtggagaatc tgtcccagga tggtcgaacg gcacgaggta gcgagtcaga 180
          tcgtgagatg ttgccgaaat agtataaatc aagagacttg ttaccgctag cctgctgaag 240
          taaatagacg ttcatgcgct ccagcgagct catcgt 276
          
      

Claims (12)

A kit for detecting Aspergillus spp. infection, including: a first primer pair, which includes a first forward primer and a first reverse primer, wherein the first forward primer and the first reverse primer A reverse primer includes the nucleotide sequences of SEQ ID NO: 1 and 2 respectively; a first probe including a first fluorophore and a first nucleic acid fragment, wherein the first nucleic acid fragment includes SEQ ID NO: 3 The nucleotide sequence is bonded to the first fluorophore; a second probe, which includes a second fluorophore and a second nucleic acid fragment, wherein the second nucleic acid fragment includes SEQ ID NO: 4 A nucleotide sequence, and bonded to the second fluorophore; a third probe, which includes a third fluorophore and a third nucleic acid fragment, wherein the third nucleic acid fragment includes the nucleic acid sequence number: 5 The nucleotide sequence is bonded to the third fluorophore; a fourth probe, which includes a fourth fluorophore and a fourth nucleic acid fragment, wherein the fourth nucleic acid fragment includes the nucleoside of SEQ ID NO: 6 An acid sequence is bonded to the fourth fluorophore; and a polymerase chain reaction (PCR) reagent. The set as claimed in claim 1, wherein the first, second, third and fourth fluorophores are different fluorophores. The set as described in request item 1 further includes: A fifth probe, which includes a fifth fluorophore and a fifth nucleic acid fragment, wherein the fifth nucleic acid fragment includes the nucleotide sequence of SEQ ID NO: 7 and is bonded to the fifth fluorophore; and A sixth probe, which includes a sixth fluorophore and a sixth nucleic acid fragment, wherein the sixth nucleic acid fragment includes the nucleotide sequence of SEQ ID NO: 8 and is bonded to the sixth fluorophore. The set as claimed in claim 3, wherein the first, second, third, fourth, fifth and sixth fluorophores are different fluorophores. A set as described in request item 1 or 3, further including: A second primer pair, which includes a second forward primer and a second reverse primer, wherein the second forward primer and the second reverse primer respectively include the nucleotide sequences of SEQ ID NO: 9 and 10; a seventh probe comprising the nucleotide sequence of CTGGCCGA; and An eighth probe comprising the nucleotide sequence of CTGAGCCGA. A set as described in request item 1 or 3, further including: A third primer pair, which includes a third forward primer and a third reverse primer, wherein the third forward primer and the third reverse primer respectively include the nucleotide sequences of SEQ ID NO: 11 and 10; as well as A ninth probe, which includes the nucleotide sequence of SEQ ID NO: 13. A set as described in request item 1 or 3, further including: A fourth primer pair, which includes a fourth forward primer and a fourth reverse primer, wherein the fourth forward primer and the fourth reverse primer respectively include the nucleotide sequences of SEQ ID NO: 14 and 15; as well as A tenth probe, which includes the nucleotide sequence of SEQ ID NO: 16. A method for diagnosing whether an individual is infected by Aspergillus spp. through a biological specimen of the individual, wherein the Aspergillus fumigatus is Aspergillus fumigatus, Aspergillus niger , or Aspergillus flavus ( Aspergillus flavus ) or Aspergillus terreus , the method includes: (1) extracting the deoxyribonucleic acid (DNA) of the biological specimen; (2) combining the DNA extracted in step (1) with The first primer pair, the first to fourth probes and the PCR reagent of the set described in claim 2 are mixed to obtain a mixture; (3) Using real-time polymerase chain reaction, qPCR) to detect the fluorescent signals of the first to fourth fluorophores in the mixture; (4) Based on the detection results of step (3), diagnose whether the individual is infected with koji bacteria, where if it is detected When the fluorescent signal of the first probe is detected, it means that the individual is infected by the mold; if the fluorescent signal of the second probe is detected, it means that the individual is infected by the mold; if the fluorescent signal of the second probe is detected, it means that the individual is infected by the mold; When the fluorescent signal of the third probe is detected, it indicates that the individual is infected by the Aflatoxin; or when the fluorescent signal of the fourth probe is detected, it indicates that the individual is infected by the Aflatoxin. A method for diagnosing whether an individual is infected by Aspergillus spp. through a biological specimen of the individual, wherein the Aspergillus spp. is Aspergillus fumigatus, Aspergillus niger, Aspergillus flavus, Aspergillus terreus, or Aspergillus niduformis. Aspergillus nidulans or Aspergillus versicolor , the method includes: (1) extracting the DNA of the biological specimen; (2) combining the DNA extracted in step (1) with the method described in claim 4 The first primer pair, the first to sixth probes and the PCR reagent of the set are mixed to obtain a mixture; (3) qPCR is used to detect the fluorescence of the first to sixth fluorophores in the mixture signal; (4) Based on the detection result of step (3), diagnose whether the individual is infected by Kojima, wherein if the fluorescent signal of the first probe is detected, it means that the individual is infected by Kojima fumigatus ; If the fluorescent signal of the second probe is detected, it means that the individual is infected by the mold; if the fluorescent signal of the third probe is detected, it means that the individual is infected by the mold. ; If the fluorescent signal of the fourth probe is detected, it means that the individual is infected by the Koji mold; if the fluorescent signal of the fifth probe is detected, it means that the individual is infected by the Koji micron. Bacterial infection; or if the fluorescent signal of the sixth probe is detected, it means that the individual is infected by the M. versicolor. The method as described in claim 8 or 9, further comprising using a second primer pair, a seventh probe and an eighth probe to detect whether the koji bacteria are resistant, wherein The second primer pair includes a second forward primer and a second reverse primer, wherein the second forward primer and the second reverse primer respectively include the nucleotide sequences of SEQ ID NO: 9 and 10; The seventh probe includes the nucleotide sequence of CTGGCCGA; and The eighth probe contains the nucleotide sequence of CTGAGCCGA. The method as described in claim 8 or 9, further comprising using a third primer pair and a ninth probe to detect whether the koji bacteria are resistant, wherein The third primer pair includes a third forward primer and a third reverse primer, wherein the third forward primer and the third reverse primer respectively include the nucleotide sequences of SEQ ID NO: 11 and 12; and The ninth probe contains the nucleotide sequence of SEQ ID NO: 13. The method as described in claim 8 or 9, further comprising using a fourth primer pair and a tenth probe to detect whether the koji bacteria are resistant, wherein The fourth primer pair includes a fourth forward primer and a fourth reverse primer, wherein the fourth forward primer and the fourth reverse primer respectively include the nucleotide sequences of SEQ ID NO: 14 and 15; and The tenth probe includes the nucleotide sequence of SEQ ID NO: 16.