TW202317601A - Compositions and methods for modulating myc expression - Google Patents

Abstract

The present disclosure relates to compositions and methods for reducing expression of MYC gene in a cell. In some embodiments, an expression repressor comprises a targeting moiety that binds a MYC promoter, anchor sequence, or super-enhancer. In some embodiments, the expression repressor comprises an effector moiety that represses transcription or methylates DNA. Systems comprising two expression repressors are also disclosed. The compositions can be used, for example, to treat cancers such as HCC or NSCLC.

Description

Compositions and methods for modulating MYC expression

Aberrant regulation of gene expression is an underlying cause of many diseases such as neoplasms, neurological disorders, metabolic disorders and obesity in mammals such as humans. Dysregulation of the transcription factor MYC plays a major role in various human tumors and chronic liver diseases. The MYC protein is considered "undruggable" due to a number of factors, such as the lack of a defined ligand-binding site that is necessary for physiological functions to maintain normal tissues. Technologies suitable for modulating the expression of the MYC gene provide viable alternatives for the treatment of these diseases. Novel tools, systems and methods are needed to stably alter (eg, reduce) the expression of disease-associated genes such as MYC.

In particular, the present invention provides expression suppressors and expression suppression systems useful for modulating (eg, reducing) the expression of a target gene (eg, MYC).

In some aspects, the invention provides an expression suppressor comprising a targeting moiety that binds to a target gene promoter (e.g., the MYC promoter) and optionally an effector moiety, wherein the expression suppressor is capable of reducing the target gene ( such as MYC) performance.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety that binds to a target locus (e.g., MYC) and an effector portion comprising MQ1, or a fragment or variant thereof, wherein the expression suppressor is capable of reducing the target Gene (eg MYC) expression.

In some aspects, the invention provides an expression inhibitor comprising: a targeting moiety and optionally an effector moiety that binds to a regulatory element located in a super-enhancer region of MYC, wherein the expression inhibitor is capable of reducing MYC Performance.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety and an effector moiety (such as KRAB or MQ1, or fragment or variant), wherein the expression suppressor is capable of reducing the expression of a target gene (eg MYC).

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety that binds a regulatory element located in a super-enhancer region of a target gene (e.g., MYC), wherein the targeting moiety comprises a zinc finger domain, wherein The expression suppressor is capable of reducing the expression of a target gene (eg MYC).

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety that binds a regulatory element located in a super-enhancer region of MYC, wherein the targeting moiety comprises a zinc finger domain or a TAL effector domain; and an effector Part, wherein the effector part comprises a transcriptional repressor (such as KRAB or a fragment or variant thereof) or a DNA methyltransferase (such as MQ1 or a fragment or variant thereof); wherein the expression repressor is capable of reducing MYC expression.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety that binds to a target locus (e.g., MYC), wherein the targeting moiety comprises a zinc finger domain, wherein the expression suppressor is capable of reducing the target gene ( such as MYC) performance.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety that binds to a gene body locus comprising SEQ ID NO: 1, 3, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 109, 110 or at least 14, 15, 16, 17, 18, 19 or 20 of the sequence of 75, 76, 78, 79, 80, 81, 84, 85, 86 Nucleotides, wherein the expression inhibitor is capable of reducing MYC expression.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety that binds to a gene body locus comprising at least 16, 17 of the sequence of SEQ ID NO: 2 or 77, 82, 83 , 18, 19 or 20 nucleotides, and wherein the expression suppressor is capable of reducing expression of a target gene (eg MYC). In some embodiments, the expression suppressor comprises an effector moiety.

In some aspects, the invention provides expression suppressors comprising a targeting moiety, wherein the targeting moiety binds to a gene body locus within 1400 nt upstream or downstream of SEQ ID NO:4.

In some aspects, the invention provides an expression inhibitor comprising a targeting moiety, wherein the targeting moiety binds at least 14, 15, 16, 17, 18 of a sequence comprising SEQ ID NO: 4, 77, 82, or 83 , 19 or 20 nucleotide gene body loci.

In some aspects, the invention provides an expression inhibitor comprising a targeting moiety, wherein the targeting moiety binds at least 14, 15, 16, 17, 18, 19 of a sequence comprising SEQ ID NO: 83, 96 or 108 or 20 nucleotide gene body loci.

In some aspects, the invention provides a system comprising: a first expression inhibitor comprising a first targeting moiety and optionally a first effector moiety, wherein the first expression inhibitor is bound to an operably linked To a translational regulatory element (such as a promoter or transcriptional start (TSS)) of a target gene (such as MYC), or to a sequence in close proximity to a translational regulatory element; and comprising a second targeting moiety and optionally a second effector moiety wherein the second expression suppressor binds to an anchor sequence in an anchor sequence-mediated adapter (ASMC) comprising a target gene (e.g., MYC), or to an anchor sequence in close proximity to the anchor sequence sequence.

In some aspects, the invention provides a system comprising: a first expression inhibitor comprising a first targeting moiety and optionally a first effector moiety, wherein the first expression inhibitor is bound to an operably linked To a translational regulatory element (such as a promoter or transcriptional start (TSS)) of a target gene (such as MYC), or to a sequence in close proximity to a translational regulatory element; and comprising a second targeting moiety and optionally a second effector moiety wherein the second expression suppressor binds to a gene body locus located in a super-enhancer region of a target gene (eg, MYC).

In certain embodiments, the first targeting moiety specifically binds a first DNA sequence and the second targeting moiety specifically binds a second DNA sequence different from the first DNA sequence. In certain embodiments, the first effect moiety is different than the second effect moiety.

In some aspects, the invention provides an expression repressor comprising: binding to a translational regulatory element (such as a promoter or transcription start (TSS)) operably linked to a target gene (such as MYC) or binding to the A targeting portion of a sequence in close proximity to the translational regulatory element, the targeting portion comprising a CRISPR/Cas molecule, for example comprising a catalytically inactive CRISPR/Cas protein; and an effector portion comprising MQ1 or a functional variant or fragment thereof.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety comprising CRISPR/Cas that binds to a gene body locus located in a super-enhancer region of a target gene (e.g., MYC) Molecules, for example comprising a catalytically inactive CRISPR/Cas protein; and effector moieties comprising KRAB, MQ1 or functional variants or fragments thereof, wherein the expression suppressor is capable of reducing expression of a target gene (eg MYC).

In some aspects, the invention provides an expression suppressor comprising: binding to an anchor sequence in an anchor sequence-mediated adapter (ASMC) comprising a target gene (eg, MYC) or binding to an anchor sequence A targeting moiety of adjacent sequences, the targeting moiety comprising a CRISPR/Cas molecule, for example comprising a catalytically inactive CRISPR/Cas protein; and an effector moiety comprising KRAB or a functional variant or fragment thereof.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety comprising a zinc finger molecule that binds to a translational regulatory element (eg, a promoter or transcriptional start (TSS)) or to a sequence in close proximity to the translational regulatory element; and an effector portion comprising MQ1 or a functional variant or fragment thereof.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety comprising a zinc finger molecule that binds to an anchor sequence-mediated adapter (ASMC) comprising a target gene (eg, MYC) ), or bind to a sequence in close proximity to the anchor sequence; and an effector portion comprising KRAB or a functional variant or fragment thereof.

In some aspects, the invention provides an expression suppressor comprising: a targeting moiety comprising a zinc finger molecule that binds to a gene body locus located in a super-enhancer region of a target gene (eg, MYC) ; and an effector portion comprising KRAB or a functional variant or fragment thereof.

In some aspects, the invention relates to a nucleic acid encoding a first suppressor of expression, a second suppressor of expression, both, or a component thereof (eg, gRNA, mRNA). In some embodiments, the nucleic acid encoding the expression suppression system is a polycistronic sequence. In some embodiments, the polycistronic sequence is a dicistronic sequence.

In some aspects, the invention relates to a vector comprising a nucleic acid, system or expression suppressor described herein. In another aspect, the present invention relates to a lipid nanoparticle comprising the vector, nucleic acid, system or expression inhibitor described herein. In another aspect, the invention relates to a reaction mixture comprising the expression inhibitors, systems, nucleic acids, vectors or lipid nanoparticles described herein. In another aspect, the present invention relates to a pharmaceutical composition comprising the expression inhibitor, system, nucleic acid, vector, lipid nanoparticle or reaction mixture described herein.

In some aspects, the invention relates to a method of reducing expression of a target gene comprising providing an expression suppressor or expression suppression system as described herein and enabling the target gene and/or one or more operably linked transcriptional control elements Exposure to an expression suppressor or expression suppression system, thereby reducing expression of the target gene.

In some aspects, the invention relates to a method of treating a condition associated with overexpression of a target gene (eg, MYC) in an individual comprising administering to the individual an expression inhibitor or system, nucleic acid or vector described herein , to treat the condition.

In some aspects, the invention relates to a method of treating a condition in an individual that is associated with aberrant regulation of a target gene (e.g., MYC), comprising administering to the individual an expression inhibitor, system, nucleic acid, or expression inhibitor described herein. carrier, whereby the condition is treated.

In some aspects, the invention provides a method of reducing expression of a target gene (eg, MYC) in a cell, the method comprising: contacting the cell with a system whereby expression of the target gene (eg, MYC) in the cell is decreased expression, the system comprising: a first expression repressor comprising a first targeting moiety and optionally a first effector moiety, wherein the first expression repressor binds to a translational expression operably linked to a target gene (e.g., MYC) a regulatory element (such as a promoter or a transcription start (TSS)); and a second expression repressor comprising a second targeting moiety and optionally a second effector moiety, wherein the second expression repressor binds to a gene comprising the target gene ( For example, the anchor sequence in the anchor sequence-mediated adapter (ASMC) of MYC) or binds to a sequence in close proximity to the anchor sequence.

In some aspects, the invention provides a method of reducing expression of a target gene (eg, MYC) in a cell, the method comprising: contacting the cell with a system whereby expression of the target gene (eg, MYC) in the cell is decreased expression, the system comprising: a first expression repressor comprising a first targeting moiety and optionally a first effector moiety, wherein the first expression repressor binds to a translational expression operably linked to a target gene (e.g., MYC) a regulatory element (such as a promoter or a transcription start (TSS)); and a second expression repressor comprising a second targeting moiety and optionally a second effector moiety, wherein the second expression repressor binds to a gene located on the target gene ( For example, a gene body locus in the super-enhancer region of MYC).

The invention additionally provides in part a kit comprising: a) a container comprising a composition comprising an expression suppressor comprising a targeting moiety that binds to a target gene, a promoter (eg MYC) and capable of an effector portion that modulates (eg reduces) expression of a target gene (eg MYC); and b) a set of instructions comprising at least one method of modulating expression of a target gene (eg MYC) in a cell using the composition.

The invention additionally provides, in part, a kit comprising: a) a container comprising a composition comprising an expression suppressor comprising a gene that binds to a super-enhancer region located in a target gene (eg, MYC) A targeting moiety of a locus and an effector moiety capable of modulating (e.g. reducing) the expression of a target gene (e.g. MYC); and b) a set of instructions comprising at least one method for regulating the expression of a target gene (e.g. MYC) in a cell with the composition a way.

In some aspects, the kit comprises a) a container comprising a composition comprising a system comprising two expression inhibitors comprising a first targeting moiety and optionally a first effector moiety. An expression repressor, wherein the first expression repressor binds to a translational regulatory element (e.g., a promoter or a transcriptional start (TSS)) operably linked to a target gene (e.g., MYC) or to a sequence in close proximity to a translational regulatory element and an expression suppressor comprising a second targeting moiety and optionally a second effector moiety, wherein the second expression suppressor binds to an anchor sequence-mediated adapter (ASMC) comprising a target gene (eg, MYC) anchor sequence or binds to a sequence in close proximity to the anchor sequence.

In some aspects, the kit comprises a) a container comprising a composition comprising a system comprising two expression inhibitors comprising a first targeting moiety and optionally a first effector moiety. An expression repressor, wherein the first expression repressor binds to a translational regulatory element (e.g., a promoter or a transcriptional start (TSS)) operably linked to a target gene (e.g., MYC) or to a sequence in close proximity to a translational regulatory element and an expression suppressor comprising a second targeting moiety and optionally a second effector moiety, wherein the second expression suppressor binds to a gene body locus located in a super-enhancer region of a target gene (eg, MYC).

In some embodiments, the kit further comprises b) a set of instructions comprising at least one method of using the composition to treat a disease or modulate (eg, reduce) the expression of a target gene (eg, MYC) in a cell. In some embodiments, the kit optionally includes a delivery vehicle (eg, lipid nanoparticles) for the composition. The agent may be provided suspended in the excipient and/or delivery vehicle, or the agent may be provided as a separate component which may then be combined with the excipient and/or delivery vehicle. In some embodiments, the kit optionally contains other therapeutic agents co-administered with the composition to affect desired target gene expression, eg, modulate MYC gene expression. While instructional material is typically written or printed material, it is not limited to such. The present invention contemplates any medium capable of storing and communicating such instructions to the end user. Such media include, but are not limited to, electronic storage media (eg, magnetic disks, tapes, cartridges, wafers), optical media (eg, CD ROM), and the like. Such media may include addresses to Internet sites that provide such instructional materials.

Additional features of any of the foregoing methods or compositions include one or more of the embodiments listed below.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The examples listed below are intended to cover such equivalents.

All publications, patent applications, patents, and other references (eg, sequence database reference numbers) mentioned herein are incorporated by reference in their entirety. For example, all GenBank, Unigene and Entrez sequences mentioned herein (eg, in any table herein) are incorporated by reference. Unless otherwise indicated, serial deposit numbers specified herein (including in any tables herein) refer to database entries as of December 15, 2020. When multiple sequence accession numbers are mentioned for a gene or protein, all sequence variants are covered.

Examples listed CLAIMS 1. An expression suppressor comprising: a targeting moiety bound to a MYC promoter, and optionally an effector moiety, wherein the expression suppressor is capable of reducing MYC expression. 2. The expression suppressor of embodiment 1, wherein the targeting moiety binds to a gene body locus within 1400, 1200, 1000, 800, 600, 400 or 200 nt upstream or downstream of SEQ ID NO: 4, 199 or 201. 3. The expression suppressor of embodiment 1, wherein the gene body locus to which the targeting moiety binds comprises at least 14, 15, 16, 17 of the sequence SEQ ID NO: 4, 77, 82, 83, 85, 199 or 201 , 18, 19 or 20 nucleotides. 4. An expression suppressor comprising: a targeting moiety whose combined gene body locus comprises the sequence SEQ ID NO: 3, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107 , 109, 110, 75, 76, 78, 79, 80, 81, 84, 85, 86, 190, 191, 192, 200 or 202 at least 14, 15, 16, 17, 18, 19 or 20 nucleosides acid; and optionally an effector moiety, wherein the expression inhibitor is capable of reducing MYC expression. 5. An expression suppressor comprising: a targeting moiety whose combined gene body locus comprises at least 16, 17, 18, 19 or 20 of the sequence SEQ ID NO: 2, 77, 82, 83, 199 or 201 Nucleotides, and optionally an effector moiety, wherein the expression inhibitor is capable of reducing MYC expression. 6. An expression suppressor comprising: a targeting moiety that binds to a MYC locus, and an effector moiety comprising MQ1 or a fragment or variant thereof, wherein the expression suppressor is capable of reducing MYC expression. 7. An expression suppressor comprising: a targeting moiety, which binds to a locus in the MYC super-enhancer region, an optionally effector portion, such as an effector portion comprising DNA methyltransferase, wherein optionally, the The effector moiety comprises MQ1 or a fragment or variant thereof, wherein the expression suppressor is capable of reducing MYC expression. 8. An expression repressor comprising: a targeting moiety, which binds to a locus in the MYC super-enhancer region, an effector portion comprising a transcriptional repressor, wherein as appropriate, the effector portion comprises KRAB or a fragment or variant thereof, Wherein the expression suppressor is capable of reducing MYC expression. 9. The expression suppressor of embodiment 7 or 8, wherein the gene body locus to which the targeting moiety binds comprises at least 14, 15 of the sequence of any one of SEQ ID NO: 96-110, 83, 199, 201 , 16, 17, 18, 19 or 20 nucleotides. 10. The expression suppressor according to any one of embodiments 7 to 9, wherein the gene body locus to which the targeting moiety binds comprises at least 14, 15, 16 of the sequence GRCh37:chr8:129162465-129212140 using the hg19 reference gene body , 17, 18, 19 or 20 nucleotides. 11. The expression suppressor according to any one of embodiments 7 to 10, wherein the gene body locus to which the targeting moiety binds comprises at least 14, 15, 16, 17, 18, 19 of the sequence SEQ ID NO: 96 or 108 or 20 nucleotides. 12. The expression suppressor according to any one of embodiments 7 to 11, wherein the targeting moiety comprises a zinc finger domain or a TAL effector domain. 13. An expression suppressor comprising: a targeting moiety that binds a locus, such as the MYC locus, a first effector moiety comprising EZH2 or a fragment or variant thereof, and a second effector moiety comprising KRAB or a fragment or variant thereof An effector moiety, wherein the expression suppressor is capable of reducing expression of the locus, eg, reducing MYC expression. 14. The expression suppressor of embodiment 13, wherein the targeting moiety binds to the MYC promoter, super-enhancer region or anchor sequence. 15. The expression inhibitor according to embodiment 13 or 14, wherein the targeting moiety comprises a TAL effector domain, a CRISPR/Cas domain or a zinc finger domain. 16. The expression inhibitor according to any one of embodiments 13 to 15, wherein the first effector moiety is located at the N-terminus of the second effector moiety, or wherein the first effector moiety is located at the C-terminus of the second effector moiety. 17. An expression suppressor comprising: a targeting moiety that binds a MYC locus, wherein the targeting moiety comprises a zinc finger domain, and optionally an effector moiety, wherein the expression suppressor is capable of reducing MYC expression. 18. An expression suppressor comprising: a targeting moiety comprising a CRISPR/Cas domain, for example comprising a catalytically inactive CRISPR/Cas protein, the targeting moiety is bound to a translational regulatory element operably linked to the MYC gene ( Such as a promoter, enhancer, super-enhancer or transcription start (TSS)) or a sequence close to the translational regulatory element; and an effector portion comprising MQ1 or a functional variant or fragment thereof. 19. An expression suppressor comprising: a targeting moiety comprising a CRISPR/Cas domain, for example comprising a catalytically inactive CRISPR/Cas protein, the targeting moiety is bound to a translational regulatory element operably linked to the MYC gene ( Such as a promoter, enhancer or transcription start (TSS)) or a sequence close to the translational regulatory element; and an effector portion comprising MQ1 or a functional variant or fragment thereof. 20. An expression suppressor comprising: a targeting moiety comprising a CRISPR/Cas domain, for example comprising a catalytically inactive CRISPR/Cas protein, the targeting moiety is bound to a translation regulatory element operably linked to the MYC gene ( such as a promoter, enhancer or transcription start (TSS)) or a sequence close to the translational regulatory element; and an effector portion comprising KRAB or a functional variant or fragment thereof. 21. An expression suppressor comprising: a targeting moiety comprising a CRISPR/Cas domain, for example comprising a catalytically inactive CRISPR/Cas protein, which binds to an anchor sequence-mediated adapter (ASMC) comprising a MYC gene An anchor sequence for, or a sequence that binds to the anchor sequence; and an effector portion comprising KRAB or a functional variant or fragment thereof. 22. An expression suppressor comprising: a targeting moiety comprising a zinc finger domain that binds to a translational regulatory element (such as a promoter, enhancer or transcription start (TSS)) operably linked to the MYC gene or a sequence close to the translational regulatory element; and an effector portion comprising MQ1 or a functional variant or fragment thereof. 23. An expression suppressor comprising: a targeting moiety comprising a zinc finger domain that binds to a translational regulatory element (such as a promoter, enhancer or transcription start (TSS)) operably linked to the MYC gene or a sequence close to the translational regulatory element; and an effector portion comprising KRAB or a functional variant or fragment thereof. 24. An expression suppressor comprising: a targeting moiety that binds to a mouse genome locus comprising at least 14, 15, 16, 17, 18, 19 or 20 nucleotides; and optionally an effector moiety, wherein the expression inhibitor is capable of reducing MYC expression. 25. The expression suppressor according to technical solution 24, wherein the effector part comprises a DNA methyltransferase, such as MQ1 or a fragment or variant thereof. 26. The expression inhibitor according to embodiment 24 or 25, wherein the targeting moiety comprises a TAL effector domain, a CRISPR/Cas domain, a zinc finger domain, a tetR domain, a meganuclease domain or an oligonucleotide. 27. The expression suppressor according to any one of embodiments 24 to 26, wherein the targeting moiety comprises a zinc finger domain or a TAL effector domain. 28. The expression inhibitor as in any one of embodiments 24 to 27, wherein the expression inhibitor comprises an amino acid sequence selected from any one of SEQ ID NO: 160-165, or at least 80, 85, 90 thereof , 95, 99, or 100% identical sequences, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, A sequence of 5, 4, 3, 2 or 1. 29. The expression inhibitor as in any one of embodiments 24 to 28, wherein the expression inhibitor is encoded by the following: a nucleotide sequence selected from any one of SEQ ID NO: 166-168, or at least 80% thereof , 85, 90, 95, 99 or 100% identical sequences, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, A sequence of 7, 6, 5, 4, 3, 2 or 1. 30. The expression inhibitor according to any one of embodiments 24 to 29, wherein the targeting moiety comprises an amino acid sequence according to any one of SEQ ID NO: 154-156, or at least 80, 85, 90, 95, 99 or 100% identical sequence, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5 , 4, 3, 2 or 1 sequence. 31. The expression suppressor as in any one of embodiments 24 to 30, wherein the targeting moiety comprises a nucleic acid sequence according to any one of SEQ ID NO: 157-159, or at least 80, 85, 90, 95, 99 or 100% identical sequence, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4 , 3, 2 or 1 sequence. 32. The expression inhibitor according to any one of embodiments 24 to 31, wherein the effector moiety is a persistent effector moiety. 33. The expression inhibitor according to any one of embodiments 24 to 32, wherein the effector moiety is a transient effector moiety. 34. The expression inhibitor according to any one of embodiments 24 to 33, wherein the expression inhibitor is a fusion molecule. 35. The expression suppressor of any one of embodiments 24 to 34, wherein the targeting moiety comprises a zinc finger domain, and the effector moiety comprises an epigenetic modification moiety, such as a DNA methyltransferase, such as MQ1 or a fragment thereof or variant. 36. The expression suppressor according to any one of embodiments 18 to 20, 22 or 23, wherein the regulatory element is part of a chain of regulatory elements. 37. The expression suppressor of any one of embodiments 18-20, 22 or 23, wherein the regulatory element is located in a non-coding region. 38. The expression suppressor according to any one of embodiments 18 to 20, 22 or 23, wherein the regulatory element is a distal enhancer, for example a distal enhancer located at least 1,000 nt away from a target gene promoter (eg MYC) . 39. The expression suppressor according to any one of embodiments 18-20, 22, 23 or 36-38, wherein the regulatory element enhances expression of a target gene (eg MYC). 40. The expression suppressor according to any one of embodiments 18-20, 22, 23 or 36-39, wherein the regulatory element contains one or more mutations. 41. The expression suppressor according to any one of embodiments 18-20, 22, 23 or 36-40, wherein the regulatory element comprises at least one disease-associated single nucleotide polymorphism (SNP). 42. The expression suppressor according to any one of embodiments 18-20, 22, 23 or 36-41, wherein the transcriptional regulatory element interacts with the promoter of a target gene (eg MYC) via an enhancer docking site. 43. The expression suppressor of embodiment 42, wherein the enhancer docking site comprises a nucleotide sequence according to any one of SEQ ID NO: 71-74. 44. An expression suppressor comprising: a targeting moiety comprising a zinc finger domain that binds to or in close proximity to an anchor sequence comprising an anchor sequence mediated adapter (ASMC) of the MYC gene the sequence of the anchor sequence; and an effector portion comprising KRAB or a functional variant or fragment thereof. 45. The expression inhibitor according to any one of embodiments 1 to 23 or 36 to 43, wherein the expression inhibitor is selected from among SEQ ID NO: 22-37, 129, 133, 134, 139-149 or 177-186 The amino acid sequence of any one of them, or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, A sequence of 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 46. The expression inhibitor according to any one of embodiments 1 to 23 or 36 to 45, wherein the expression inhibitor is encoded by any of SEQ ID NO: 55-70, 130, 189 or 193-197 The nucleotide sequence of one, or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or differs from it by no more than 20, 19, 18, 17, 16, 15, 14, A sequence of 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 47. The expression inhibitor of any one of embodiments 1 to 23 or 36 to 46, wherein the targeting moiety comprises an amino acid sequence according to any one of SEQ ID NO: 5-16 or 169-172, or A sequence that is at least 80, 85, 90, 95, 99, or 100% identical to, or differs from, no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9 positions , 8, 7, 6, 5, 4, 3, 2 or 1 sequence. 48. The expression inhibitor of any preceding embodiment, wherein the effector moiety comprises an amino acid sequence according to SEQ ID NO: 18, 19 or 87, or is at least 80, 85, 90, 95, 99 or 100% identical thereto , or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence. 49. The expression inhibitor according to any one of embodiments 1 to 12, 17 to 19, 22, 36 to 42 or 44 to 47, wherein the effector moiety is a persistent effector moiety. 50. The expression inhibitor according to any one of embodiments 1 to 23 or 36 to 48, wherein the effector moiety is a transient effector moiety. 51. The expression suppressor according to any one of embodiments 1 to 12, 17 to 19, 22, 36 to 42 or 44 to 48, wherein the effector moiety comprises a DNA methyltransferase, such as MQ1 or a fragment or variant thereof. 52. The expression suppressor according to any one of embodiments 1 to 23, 36 to 47 or 49, wherein the effector moiety comprises a transcriptional repressor, for example comprising KRAB or a fragment or variant thereof. 53. The expression suppressor of any preceding embodiment, wherein the targeting moiety comprises a TAL effector domain, a CRISPR/Cas domain, a zinc finger domain, a tetR domain, a meganuclease domain, or an oligonucleotide. 54. The expression suppressor of embodiment 53, wherein the CRISPR/Cas domain binds a gRNA, for example, the bound gene body locus comprises at least 14, 15, 16, A gRNA of 17, 18, 19 or 20 nucleotides, e.g., wherein the gRNA comprises at least 14, 15, 16, 17, 18, 19 or 20 cores comprising a sequence of any one of SEQ ID NO: 1-4 sequence of nucleotides. 55. The expression suppressor of embodiment 53, wherein the CRISPR/Cas domain binds a gRNA, for example, the bound gene body locus comprises at least 14, 15, 16, 16, A gRNA of 17, 18, 19 or 20 nucleotides, e.g., wherein the gRNA comprises at least 14, 15, 16, 17, 18, 19 or 20 cores comprising a sequence of any one of SEQ ID NOs: 96-110 sequence of nucleotides. 56. The expression suppressor according to any one of embodiments 53 to 55, wherein the CRISPR/Cas domain comprises a Cas protein or a Cpf1 protein selected from Table 1 or a variant (such as a mutant) of any one thereof. 57. The expression suppressor according to any one of embodiments 53 to 56, wherein the CRISPR/Cas domain comprises a catalytically inactive CRISPR/Cas protein, such as dCas9. 58. The expression suppressor of embodiment 53, wherein the gene body locus to which the zinc finger domain binds comprises at least 14, 15, 16, 17, 18, 19, or 20 nucleotides, for example wherein the gRNA comprises a sequence comprising at least 14, 15, 16, 17, 18, 19 or 20 nucleotides of the sequence of any one of SEQ ID NO: 96-110. 59. The expression suppressor according to any one of embodiments 17, 22, 26 to 53 or 57, wherein the zinc finger domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 zinc fingers (and no more than 11, 10, 9, 8, 7, 6 or 5 zinc fingers as appropriate). 60. The expression suppressor according to any one of embodiments 17, 22, 26 to 53, 57 or 58, wherein the zinc finger domain comprises 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3- 10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8- 10, 8-9 or 9-10 zinc fingers. 61. The expression suppressor according to any one of embodiments 17, 22, 26-53 or 57-59, wherein the zinc finger domain comprises 3 or 9 zinc fingers. 62. The expression inhibitor of any preceding embodiment, which is a fusion molecule. 63. The expression inhibitor of any preceding embodiment, comprising a linker between the targeting domain and the effector domain, optionally wherein the linker comprises an amine group according to SEQ ID NO: 137 or SEQ ID NO: 138 sequence. 64. The expression suppressor of any one of embodiments 1 to 17, 20, 21, 23, 44 to 48, 50 or 52 to 57, wherein the targeting moiety comprises a catalytically inactive CRISPR/Cas domain (eg dCas9) And the effector portion comprises a transcriptional repressor, such as KRAB or a fragment or variant thereof. 65. The expression suppressor of any one of embodiments 1 to 17, 20, 21, 23, 44 to 48, 50, 52, or 53 to 64, wherein the targeting moiety comprises a zinc finger domain and the effector moiety comprises a transcriptional Inhibitors, such as KRAB or fragments or variants thereof. 66. The expression inhibitor of any one of embodiments 17, 36-43, 45-47, 53, or 58-63, wherein the targeting moiety comprises a zinc finger domain and the expression inhibitor does not comprise an effector moiety. 67. The expression suppressor of any one of embodiments 1 to 12, 18 to 19, 22, 36 to 43, 45 to 49, 51 or 53 to 57, wherein the targeting moiety comprises a catalytically inactive CRISPR/Cas domain (eg dCas9) and the effector moiety comprises an epigenetic modification moiety, such as a DNA methyltransferase, such as MQ1 or a fragment or variant thereof. 68. The expression suppressor of any one of embodiments 1 to 12, 17 to 19, 22, 36 to 43, 45 to 49, 51, 53, or 58 to 63, wherein the targeting moiety comprises a zinc finger domain, and the Effector moieties comprise epigenetic modifying moieties, such as DNA methyltransferases, such as MQ1 or fragments or variants thereof. 69. The expression inhibitor according to any preceding embodiment, which comprises the amino acid sequence of any one of SEQ ID NO: 22-37, 129, 133, 134, 139-149 or 177-186, or at least 80% thereof %, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical sequences. 70. The expression suppressor of any preceding embodiment, which: (i) comprises one or more nuclear localization signal sequences (NLS), or (ii) does not comprise a NLS. 71. The expression suppressor according to any preceding embodiment, comprising a first NLS at the N-terminus, for example, wherein the first NLS has the sequence SEQ ID NO: 88. 72. The expression suppressor according to any preceding embodiment, comprising a C-terminal NLS, eg a second NLS, eg having the sequence SEQ ID NO: 89. 73. The expression suppressor of any preceding embodiment, wherein the first NLS and the second NLS have the same sequence. 74. The expression suppressor according to any one of embodiments 71 to 73, wherein the first NLS and the second NLS have different sequences. 75. The expression suppressor of any preceding embodiment comprising an epitope tag. 76. The expression suppressor of embodiment 75, wherein the epitope tag is an HA tag. 77. The expression suppressor of any preceding embodiment, wherein the anchor sequence comprises the sequence SEQ ID NO: 71 or 72, or has no more than 8, 7, 6, 5, 4, 3, 2 or 1 relative thereto a sequence of changes. 78. The expression suppressor according to any one of embodiments 1 to 77, wherein the anchor sequence comprises a sequence according to SEQ ID NO: 73 or 74, or has no more than 8, 7, 6, 5, 4, Sequence of 3, 2 or 1 variation. 79. The expression suppressor of any preceding embodiment, wherein the anchor sequence is located on the same chromosome as the MYC gene. 80. The expression suppressor of any preceding embodiment, wherein the anchor sequence is located upstream of the MYC gene (eg upstream of the TSS or upstream of the promoter). 81. The expression suppressor of any preceding embodiment, wherein the anchor sequence is at least 1, 5, 10, 50, 100 or 1000 kilobases apart from the MYC gene (eg, the TSS or promoter of the MYC gene). 82. The expression suppressor of any preceding embodiment, wherein the anchor sequence is 0.1-0.5, 0.1-1, 0.1-5, 0.1-10, 0.1- 50, 0.1-100, 0.1-500, 0.1-1000, 0.5-1, 0.5-5, 0.5-10, 0.5-50, 0.5-100, 0.5-500, 0.5-1000, 1-5, 1-10, 1-50, 1-100, 1-500, 1-1000, 5-10, 5-50, 5-100, 5-500, 5-1000, 10-50, 10-100, 10-500, 10- 1000, 50-100, 50-500, 50-1000, 100-500, 100-1000 or 500-1000 kilobases. 83. The expression suppressor according to any one of embodiments 1 to 79 or 81 to 82, wherein the target sequence is located downstream of the MYC gene (eg downstream of TSS or downstream of the promoter). 84. The expression suppressor of any preceding embodiment, wherein the targeting moiety binds to a sequence located at or near the following chromosomal coordinates: 128746342-128746364, 128746321-128746343, 128746525-128746547, 128748014-128748036, 1291888 78 -129188900, 129188958-129188980, 129188960-129188982, 129189067-129189089, 129189457-129189479, 129189554-129189576, 129189679-1 29189701, 129209511-129209533, 129209643-129209665, 129209658-129209680, 129209856-129209878, 129189452-129189474, 129189190-1291 89212 129189274-129189296, 129189421-129189443, 128746405-128746425, 128748069-128748089, 129188825-129188845 or 1291888229188842. 85. The expression suppressor of any preceding embodiment, wherein binding of the expression suppressor to the target locus (eg MYC) renders the target locus ( For example, methylation of sites in MYC) is increased by 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100%, for example as measured by ELISA or as in any of Examples 7 or 28 As described in an example, wherein optionally, the site analyzed for methylation is chr8: 129188693-129189048 according to the hg19 reference gene body, for example comprising the sequence according to SEQ ID NO: 123. 86. The expression suppressor of any preceding embodiment, wherein binding of the expression suppressor to a target locus (eg, MYC) increases methylation of a site in the target locus (eg, MYC) for a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days , or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cell divisions, e.g. as described in Example 28. 87. The expression suppressor of any preceding embodiment, wherein binding of the expression suppressor to the MYC locus reduces MYC expression in the cell compared to expression in the absence of the expression suppressor 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100%, for example as measured by ELISA or as described in any of Examples 2-7 or 9. 88. The expression suppressor of any preceding embodiment, wherein the expression suppressor binds to the MYC locus to significantly reduce MYC expression for the following period of time: at least 1, 2, 3, 4, 5, 6, 7, 8, 9 , 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cell divisions, eg as measured by ELISA or as described in any of Examples 2-7 or 9. 89. The expression suppressor of any preceding embodiment, wherein at the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 10th, 12th, 16th, 20th, 24th, 28th, 32nd, Binding of the expression suppressor to the MYC locus significantly attenuates MYC expression at 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, 80, or 96 hours. 90. The expression suppressor of any one of embodiments 1 to 23 or 36 to 89, wherein the targeting moiety binds to a human genome locus. 91. The expression suppressor of any one of embodiments 24 to 43, 49, 51, 53, 56 to 57, 59 to 62, 66 to 68, 70 to 89, wherein the targeting moiety binds to the mouse genome gene seat. 92. The expression suppressor of any preceding embodiment, wherein binding of the expression suppressor to the MYC locus reduces the survival rate of cells comprising the MYC locus, eg cancer cells. 93. The expression suppressor of any preceding embodiment, wherein contacting the plurality of cells with the expression suppressor or a nucleic acid encoding the expression suppressor reduces the survival rate of the plurality of cells. 94. The expression suppressor of any preceding embodiment, wherein survival is reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 compared to survival in the absence of the first expression suppressor %, for example as measured by CellTiter Glo or as described in any one of Examples 2-7. 95. The expression suppressor of any preceding embodiment, wherein administration of the expression suppressor results in at least 5%, 6%, 7%, 8%, 9%, 10%, Apoptosis occurred in 12%, 15%, 17%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, and 75%. 96. The expression suppressor of any preceding embodiment, wherein the plurality of cells comprises a plurality of cancer cells and a plurality of non-cancer cells and/or a plurality of infected cells and a plurality of uninfected cells. 97. The expression suppressor of any preceding embodiment, wherein contacting the plurality of cells with the expression suppressor or nucleic acid encoding the expression suppressor reduces the survival rate of the plurality of cancer cells by more than it reduces the survival of the plurality of non-cancer cells The decrease in cell viability achieved. 98. The expression suppressor of any preceding embodiment, wherein contacting the plurality of cells with the expression suppressor or nucleic acid encoding the expression suppressor reduces the survival rate of the plurality of cancer cells by more than it reduces the survival of the plurality of non-cancer cells 1.05x (i.e., 1.05x), 1.1x, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x reduction in cell viability achieved , 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20x, 50x, or 100x. 99. The expression suppressor according to any one of embodiments 92 to 97, wherein the cancer cells are lung cancer cells, gastric cancer cells, gastrointestinal cancer cells, colorectal cancer cells, pancreatic cancer cells or liver cancer cells. 100. The expression suppressor according to any one of embodiments 92 to 99, wherein the cancer is hepatocellular carcinoma (HCC), fibrolamellar hepatocellular carcinoma (FHCC), cholangiocarcinoma, angiosarcoma, secondary liver cancer, lung cancer, non- Small cell lung cancer (NSCLC), adenocarcinoma, small cell lung cancer (SCLC), large cell (undifferentiated) carcinoma, triple negative breast cancer, gastric adenocarcinoma, endometrial cancer, or pancreatic cancer. 101. The expression inhibitor of any preceding embodiment, which, when in contact with a plurality of infected cells and a plurality of uninfected cells, reduces the survival rate of the plurality of infected cells by more than it reduces the survival rate of the plurality of uninfected cells The rate of reduction achieved. 102. The expression suppressor of any preceding embodiment, wherein the infection is a viral infection. 103. The expression suppressor of embodiment 102, wherein the viral infection is hepatitis, such as hepatitis B. 104. The expression suppressor according to any one of embodiments 92 to 103, wherein the infected cells are human hepatocytes. 105. The expression suppressor of any preceding embodiment, by using LNP to deliver mRNA encoding the expression suppressor in an assay of cancer cell (e.g. HCC cell) survival (e.g. in an assay according to Example 12 Medium) with an EC50 of 0.04-0.4, 0.04-0.1, 0.1-0.2, 0.2-0.3 or 0.3-0.4 µg/mL when tested. 106. The expression suppressor according to any one of embodiments 1 to 104, by using LNP to deliver the mRNA encoding the expression suppressor, the expression suppressor in the survival rate analysis of cancer cells (such as lung cancer cells) (for example, according to the example 18) when tested with EC50 of 0.1-2.5, 0.5-2.2, 1.0-1.5, 1.2-2 µg/mL. 107. The expression suppressor of any preceding embodiment, by using LNP to deliver mRNA encoding the expression suppressor in an assay for reducing MYC mRNA levels in cancer cells (e.g., HCC cells) (e.g. Has an EC50 of 0.004-0.08, 0.004-0.01, 0.01-0.02, 0.02-0.04 or 0.04-0.08 μg/mL when tested in the assay according to Example 12). 108. The expression suppressor of any preceding embodiment, by using LNP to deliver mRNA encoding the expression suppressor in an assay for reducing MYC mRNA levels in cancer cells (e.g., lung cancer cells) (e.g. With an EC50 of 0.04-0.1, 0.04-0.09, 0.05-0.09 or 0.06-0.8 μg/mL when tested in the assay according to Example 18). 109. The expression suppressor of any preceding embodiment, which reduces the level of a protein encoded by a target gene (e.g., MYC) in the cell by at least 10%, at least 20% compared to the protein level in an untreated cell %, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. 110. The expression suppressor of any preceding embodiment, which is capable of reducing tumor volume, eg in a human subject or a mammalian model. 111. The expression inhibitor of any preceding embodiment, wherein the expression inhibitor is capable of reducing tumor volume to a degree similar to or greater than that of a chemotherapeutic agent, for example in a mammalian model, for example when the 20th day after initiation of treatment When measured daily, for example, wherein the expression inhibitor is administered at a dose of 3 mg/kg every 5 days. 112. The expression suppressor of any preceding embodiment, wherein the expression suppressor is capable of reducing tumor volume compared to a PBS control, e.g. in a mammalian model, e.g. when measured at day 20 after initiation of treatment , for example wherein the expression inhibitor is administered in 4 doses, every 5 days, followed by 3 doses: 1 mg/kg, 1.5 mg/kg or 3 mg/kg, every 3 days. 113. The expression suppressor of any preceding embodiment, wherein tumor volume is reduced by at least about 10%, 20%, 30% or 40% compared to a PBS-treated control group, e.g., on day 20 after initiation of treatment . 114. The expression suppressor according to any one of embodiments 111 to 113, wherein the chemotherapeutic agent is sorafenib or cisplatin. 115. The expression suppressor of any preceding embodiment, wherein the system is capable of reducing tumor volume to a degree similar to or greater than that of a small molecule MYC inhibitor. 116. The expression suppressor of embodiment 115, wherein the small molecule MYC inhibitor is MYCi975, wherein optionally, tumor volume is reduced by at least about 10%, 20%, 30%, or 40% compared to a MYCi975-treated control group , for example on the 20th day after the start of treatment. 117. The expression suppressor of any preceding embodiment, which does not reduce body weight, or which reduces body weight by less than 3%, 2% or 1% compared to the beginning of treatment. 118. A system comprising: the first expression inhibitor of any preceding embodiment, and a second expression inhibitor, such as a second expression inhibitor described herein, such as the second expression inhibitor of any preceding embodiment . 119. A system comprising: a first expression repressor comprising a first targeting moiety and optionally a first effector moiety, wherein the first expression repressor binds to a transcriptional regulator operably linked to the MYC gene An element (such as a promoter, enhancer, or transcription start (TSS)) or a sequence bound to the transcriptional regulatory element in close proximity; and a second expression repressor comprising a second targeting moiety and optionally a second effector moiety , wherein the second expression suppressor binds to an anchor sequence in an anchor sequence-mediated adapter complex (ASMC) comprising the MYC gene or binds to a sequence close to the anchor sequence. 120. The system of embodiment 118 or 119, wherein the transcriptional regulatory element comprises a promoter, and wherein the anchor sequence comprises a CTCF binding motif. 121. The system of any one of embodiments 118-120, wherein the second expression inhibitor binds to a downstream region adjacent to the CTCF binding motif. 122. The system of any one of embodiments 118-120, wherein the second expression inhibitor binds to an upstream region adjacent to the CTCF binding motif. 123. The system of any one of embodiments 118 to 122, wherein the first expression suppressor comprises a targeting moiety that binds to a gene body locus comprising the sequences SEQ ID NO: 2, 3, 4, 71 to 86 or at least 16, 17, 18, 19 or 20 nucleotides from 200 to 206; and the second expression suppressor comprises a targeting moiety that binds to a gene body locus comprising the sequence SEQ ID NO: At least 16, 17, 18, 19 or 20 nucleotides of 2, 3, 4, 71 to 86 or 200 to 206. 124. The system of any one of embodiments 118 to 123, wherein the first expression inhibitor comprises a targeting moiety that binds at least 16, 17, 18, 18, Gene body loci of 19 or 20 nucleotides. 125. The system according to any one of embodiments 118 to 124, wherein the first expression suppressor comprises a targeting moiety, and the gene body locus to which the targeting moiety binds comprises the sequences SEQ ID NO: 71, SEQ ID NO: 72 or at least 16, 17, 18, 19 or 20 nucleotides of SEQ ID NO: 83; and the second expression suppressor comprises a targeting moiety that binds to a gene body locus comprising the sequence SEQ ID NO At least 16, 17, 18, 19 or 20 nucleotides of :77. 126. A system comprising: a first expression suppressor comprising a first targeting moiety and optionally a first effector moiety, wherein the first expression suppressor binds to a promoter operably linked to a MYC gene or to a sequence close to the promoter, and a second expression repressor comprising a second targeting moiety and optionally a second effector moiety, wherein the second expression repressor binds to the enhancer of the MYC gene ( such as super-enhancers). 127. The system of embodiment 126, wherein the first expression suppressor comprises a targeting moiety that binds to a gene body locus comprising at least 16, 17, 18, 19 or 20 nucleotides of the sequence SEQ ID NO:204 , and the second expression suppressor comprises a targeting moiety that binds to a gene body locus comprising at least 16, 17, 18, 19 or 20 nucleotides of the sequence of any one of SEQ ID NO: 199 or 201 . 128. A system for reducing MYC expression comprising: a) a first expression inhibitor comprising: i) a first targeting moiety having an amino acid sequence according to SEQ ID NO: 13 or at least with it 80, 85, 90, 95, 99, or 100% identical sequences, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8 , 7, 6, 5, 4, 3, 2 or 1, and ii) a first effector moiety having an amino acid sequence according to SEQ ID NO: 19 or 87 or at least 80, 85, 90, 95 thereof , 99 or 100% identical sequence, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, The sequence of 4, 3, 2 or 1; and b) a second expression inhibitor comprising: i) a second targeting moiety having an amino acid sequence according to SEQ ID NO: 7, 169 or 171 or at least therewith 80, 85, 90, 95, 99, or 100% identical sequences, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8 , the sequence of 7, 6, 5, 4, 3, 2 or 1, and ii) a second effector moiety having an amino acid sequence according to SEQ ID NO: 18 or at least 80, 85, 90, 95, 99 thereof Or 100% identical sequence, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, A sequence of 3, 2 or 1. 129. The system of embodiment 128, wherein the first expression inhibitor further comprises a first nuclear localization signal, such as SV40 NLS, for example according to the sequence of SEQ ID NO: 135 or at least 80, 85, 90, 95, 99 or A 100% identical sequence, for example at the N-terminus of the first targeting moiety. 130. The system of embodiment 128 or 129, wherein the first expression inhibitor further comprises a second nuclear localization signal, such as nucleoplasmic protein NLS, for example according to the sequence of SEQ ID NO: 136 or at least 80, 85, 90, A 95, 99 or 100% identical sequence, for example at the C-terminus of the first effector moiety. 131. The system according to any one of embodiments 128 to 130, wherein the second expression suppressor further comprises a first nuclear localization signal, such as SV40 NLS, for example according to the sequence of SEQ ID NO: 135 or at least 80, 85, A 90, 95, 99 or 100% identical sequence, for example at the N-terminus of the second targeting moiety. 132. The system of any one of embodiments 128 to 131, wherein the second expression inhibitor further comprises a second nuclear localization signal, such as a nucleoplasmic protein NLS, for example according to the sequence of SEQ ID NO: 136 or at least 80, 85, A 90, 95, 99 or 100% identical sequence, for example at the C-terminus of the second effector moiety. 133. The system of any one of embodiments 128 to 132, wherein the first expression inhibitor further comprises a first linker positioned between the first targeting moiety and the first effector moiety, wherein optionally, the first linker has The amino acid sequence according to SEQ ID NO: 137 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 134. The system of any one of embodiments 128 to 133, wherein the second expression inhibitor further comprises a second linker between the second targeting moiety and the second effector moiety, wherein optionally, the second linker has The amino acid sequence according to SEQ ID NO: 138 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 135. The system according to any one of embodiments 128 to 134, wherein the first expression inhibitor further comprises an amino acid sequence at the C-terminus of the first effector moiety, for example a sequence of at most 30, 25, 20 or 18 amino acids, For example a sequence according to SEQ ID NO: 126 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 136. The system according to any one of embodiments 128 to 132, wherein the second expression inhibitor further comprises an amino acid sequence at the N-terminus of the second targeting moiety, for example a sequence of at most 30, 25, 20 or 18 amino acids , for example a sequence according to SEQ ID NO: 128 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 137. The system according to any one of embodiments 128 to 136, wherein the first expression inhibitor has an amino acid sequence according to SEQ ID NO: 30 or 129, or at least 80, 85, 90, 95, 99 or 100 thereof % consistent sequence. 138. The system according to any one of embodiments 128 to 137, wherein the second expression inhibitor has an amino acid sequence according to SEQ ID NO: 24 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto . 139. The system according to any one of embodiments 128 to 137, wherein the second targeting moiety comprises an amino acid sequence according to SEQ ID NO: 169 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto . 140. The system according to any one of embodiments 128 to 137, wherein the second targeting moiety comprises an amino acid sequence according to SEQ ID NO: 171 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto . 141. The system according to any one of embodiments 128 to 140, wherein the second expression inhibitor has an amino acid sequence according to SEQ ID NO: 177 or 183 or is at least 80, 85, 90, 95, 99 or 100% identical thereto the sequence of. 142. The system according to any one of embodiments 128 to 140, wherein the second expression inhibitor has an amino acid sequence according to SEQ ID NO: 179, 185 or is at least 80, 85, 90, 95, 99 or 100% identical thereto the sequence of. 143. A nucleic acid encoding the first expression suppressor and the second suppressor in the system of any one of embodiments 128-142. 144. A nucleic acid encoding a system for reducing MYC expression, comprising: a) a first region encoding a first expression inhibitor comprising: i) a first targeting moiety having The amino acid sequence according to SEQ ID NO: 13 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15 , 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and ii) a first effector moiety having a sequence according to SEQ ID NO: 19 or 87 Amino acid sequence or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, The sequence of 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and b) a second region encoding a second expression suppressor comprising: i) a second expression suppressor A targeting moiety having an amino acid sequence according to SEQ ID NO: 7 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a number of positions that differ therefrom by no more than 20, 19, 18 , 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and ii) a second effector moiety having a sequence according to SEQ ID NO: The amino acid sequence of 18 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, A sequence of 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 145. The nucleic acid of embodiment 144, wherein the first region is located 5' of the second region. 146. The nucleic acid of embodiment 144, wherein the first region is located 3' of the second region. 147. The nucleic acid of embodiment 145 or 146, wherein the first region further comprises a nucleotide sequence, the nucleotide sequence encodes a first nuclear localization signal, such as SV40 NLS, for example according to the sequence of SEQ ID NO: 135 or at least therewith 80, 85, 90, 95, 99 or 100% identical sequence, for example at the N-terminus of the first targeting moiety. 148. The nucleic acid of any one of embodiments 145 to 147, wherein the first region further comprises a nucleotide sequence encoding a second nuclear localization signal, such as nucleoplasmic protein NLS, for example according to SEQ ID NO: 136 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, for example at the C-terminus of the first effector moiety. 149. The nucleic acid of any one of embodiments 145 to 148, wherein the second region further comprises a nucleotide sequence encoding a first nuclear localization signal, such as SV40 NLS, for example according to the sequence of SEQ ID NO: 135 Or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, for example at the N-terminus of the second targeting moiety. 150. The nucleic acid of any one of embodiments 145 to 149, wherein the second region further comprises a nucleotide sequence encoding a second nuclear localization signal, such as nucleoplasmic protein NLS, for example according to SEQ ID NO: 136 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, for example at the C-terminus of the second effector moiety. 151. The nucleic acid of any one of embodiments 145 to 150, wherein the first region further comprises a nucleotide sequence encoding a first linker, the first linker is located between the first targeting moiety and the first effector moiety Between, wherein optionally, the first linker has an amino acid sequence according to SEQ ID NO: 137 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 152. The nucleic acid of any one of embodiments 145 to 151, wherein the second region further comprises a nucleotide sequence encoding a second linker, the second linker is located between the second targeting moiety and the second effector moiety, Wherein optionally, the second linker has an amino acid sequence according to SEQ ID NO: 138 or a sequence at least 80%, 85%, 90%, 95%, 99% or 100% identical thereto. 153. The nucleic acid of any one of embodiments 145 to 152, wherein the first region further comprises a nucleotide sequence encoding an amino acid sequence at the C-terminus of the first effector portion, for example at most 30, 25, 20 Or a sequence of 18 amino acids, eg according to SEQ ID NO: 126 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 154. The nucleic acid as in any one of embodiments 145 to 153, wherein the second region further comprises a nucleotide sequence encoding the amino acid sequence at the N-terminal of the second targeting moiety, for example at most 30, 25, A sequence of 20 or 18 amino acids, eg according to SEQ ID NO: 128 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 155. The nucleic acid according to any one of embodiments 145 to 154, wherein the first expression inhibitor has an amino acid sequence according to SEQ ID NO: 30 or 129 or at least 80, 85, 90, 95, 99 or 100% thereof consistent sequence. 156. The nucleic acid according to any one of embodiments 145 to 155, wherein the second expression inhibitor has an amino acid sequence according to SEQ ID NO: 24 or is at least 80, 85, 90, 95, 99 or 100% identical thereto sequence. 157. The nucleic acid of any one of embodiments 145 to 156, wherein the first region comprises a nucleotide sequence encoding a first targeting moiety, wherein the nucleotide sequence encoding a first targeting moiety comprises a sequence according to SEQ ID NO: 46 or the sequence of 131 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, A sequence of 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 158. The nucleic acid of any one of embodiments 145 to 157, wherein the first region comprises a nucleotide sequence encoding a first effector portion, wherein the nucleotide sequence encoding a first effector portion comprises a sequence according to SEQ ID NO: 52 or 132 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, A sequence of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 159. The nucleic acid of any one of embodiments 145 to 158, wherein the second region comprises a nucleotide sequence encoding a second targeting moiety, wherein the nucleotide sequence encoding a second targeting moiety comprises a sequence according to SEQ ID NO: 40 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, A sequence of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 160. The nucleic acid of any one of embodiments 145 to 159, wherein the first region comprises a nucleotide sequence encoding a first effector portion, wherein the nucleotide sequence encoding a first effector portion comprises a sequence according to SEQ ID NO: 51 Or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or differs from it by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, A sequence of 9, 8, 7, 6, 5, 4, 3, 2 or 1. 161. The nucleic acid of any one of embodiments 145 to 160, wherein the first region comprises a nucleotide sequence according to SEQ ID NO: 63 or 130 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto , or the number of positions differing therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 Sequences, where polyA sequences are optionally present. 162. The nucleic acid of any one of embodiments 145 to 161, wherein the second region comprises a nucleotide sequence according to SEQ ID NO: 57 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or A sequence whose number of positions differing from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, wherein polyadenylic acid sequences are optionally present. 163. A nucleic acid whose encoding is used to reduce a system for MYC expression, the nucleic acid comprising: a) a first region encoding a first expression inhibitor comprising: i) a first targeting moiety having The amino acid sequence according to SEQ ID NO: 13 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15 , 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and ii) a first effector moiety having a sequence according to SEQ ID NO: 19 or 87 Amino acid sequence or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, The sequence of 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and b) a second region encoding a second expression suppressor comprising: i) a second A targeting moiety having an amino acid sequence according to SEQ ID NO: 169 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20, 19, 18 positions differing therefrom , 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and ii) a second effector moiety having a sequence according to SEQ ID NO: The amino acid sequence of 18 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, A sequence of 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 164. A nucleic acid whose encoding is used to reduce a system for MYC expression, the nucleic acid comprising: a) a first region encoding a first expression inhibitor comprising: i) a first targeting moiety having The amino acid sequence according to SEQ ID NO: 13 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15 , 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and ii) a first effector moiety having a sequence according to SEQ ID NO: 19 or 87 Amino acid sequence or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, The sequence of 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and b) a second region encoding a second expression suppressor comprising: i) a second expression suppressor A targeting moiety having an amino acid sequence according to SEQ ID NO: 171 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or the number of positions differing therefrom by no more than 20, 19, 18 , 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and ii) a second effector moiety having a sequence according to SEQ ID NO: The amino acid sequence of 18 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, A sequence of 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 165. The nucleic acid of embodiment 163 or 164, wherein the first region is located 5' to the second region. 166. The nucleic acid of embodiment 163 or 164, wherein the first region is located 3' to the second region. 167. The nucleic acid of any one of embodiments 163 to 166, wherein the first region further comprises a nucleotide sequence encoding a first nuclear localization signal, such as SV40 NLS, for example according to the sequence of SEQ ID NO: 135 Or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, for example at the N-terminus of the first targeting moiety. 168. The nucleic acid of any one of embodiments 163 to 167, wherein the first region further comprises a nucleotide sequence encoding a second nuclear localization signal, such as nucleoplasmic protein NLS, for example according to SEQ ID NO: 136 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, for example at the C-terminus of the first effector moiety. 169. The nucleic acid of any one of embodiments 163 to 168, wherein the second region further comprises a nucleotide sequence encoding a first nuclear localization signal, such as SV40, for example according to the sequence of SEQ ID NO: 135 or A sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, for example at the N-terminus of the second targeting moiety. 170. The nucleic acid of any one of embodiments 163 to 169, wherein the second region further comprises a nucleotide sequence encoding a second nuclear localization signal, such as nucleoplasmic protein NLS, for example according to SEQ ID NO: 136 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, for example at the C-terminus of the second effector moiety. 171. The nucleic acid of any one of embodiments 163 to 170, wherein the first region further comprises a nucleotide sequence encoding a first linker, the first linker is located between the first targeting moiety and the first effector moiety, Wherein optionally, the first linker has an amino acid sequence according to SEQ ID NO: 137 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 172. The nucleic acid of any one of embodiments 163 to 171, wherein the second region further comprises a nucleotide sequence encoding a second linker, the second linker is located between the second targeting moiety and the second effector moiety, Wherein optionally, the second linker has an amino acid sequence according to SEQ ID NO: 138 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 173. The nucleic acid of any one of embodiments 163 to 171, wherein the first region further comprises a nucleotide sequence encoding an amino acid sequence at the C-terminus of the first effector portion, for example at most 30, 25, 20 Or a sequence of 18 amino acids, eg according to SEQ ID NO: 126 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 174. The nucleic acid of any one of embodiments 163 to 173, wherein the second region further comprises a nucleotide sequence encoding the amino acid sequence at the N-terminal of the second targeting moiety, for example at most 30, 25, A sequence of 20 or 18 amino acids, eg according to SEQ ID NO: 128 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 175. The nucleic acid of any one of embodiments 163 to 174, wherein the first expression inhibitor has an amino acid sequence according to SEQ ID NO: 30 or 129, or at least 80, 85, 90, 95, 99 or 100% thereof consistent sequence. 176. The nucleic acid of any one of embodiments 144 to 175, wherein the second expression inhibitor has an amino acid sequence according to SEQ ID NO: 177 or 183, or at least 80, 85, 90, 95, 99 or 100% thereof consistent sequence. 177. The nucleic acid of any one of embodiments 144 to 176, wherein the second expression inhibitor has an amino acid sequence according to SEQ ID NO: 179 or 185, or at least 80, 85, 90, 95, 99 or 100% thereof consistent sequence. 178. The nucleic acid according to any one of embodiments 144 to 177, wherein the first expression inhibitor comprises an amino acid sequence according to SEQ ID NO: 30 or 129 or is at least 80, 85, 90, 95, 99 or 100% identical thereto and the second expression suppressor has an amino acid sequence according to SEQ ID NO: 24, 141, 177, 179, 183 or 185 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto. 179. The nucleic acid of any one of embodiments 144 to 178, wherein the first region comprises a nucleotide sequence encoding a first targeting moiety, wherein the nucleotide sequence encoding a first targeting moiety comprises a sequence according to SEQ ID NO: 46 or the sequence of 131 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, A sequence of 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 180. The nucleic acid of any one of embodiments 144 to 179, wherein the first region comprises a nucleotide sequence encoding a first effector portion, wherein the nucleotide sequence encoding a first effector portion comprises a sequence according to SEQ ID NO: 52 or 132 or sequences that are at least 80, 85, 90, 95, 99 or 100% identical to them, or differ from them by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, A sequence of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 181. The nucleic acid of any one of embodiments 144 to 180, wherein the second region comprises a nucleotide sequence according to SEQ ID NO: 173 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or A sequence whose number of positions differing from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, wherein polyadenylic acid sequences are optionally present. 182. The nucleic acid of any one of embodiments 144 to 181, wherein the second region comprises a nucleotide sequence according to SEQ ID NO: 175 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or A sequence whose number of positions differing from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, wherein polyadenylic acid sequences are optionally present. 183. The nucleic acid of any one of embodiments 144 to 182, wherein the second region comprises a nucleotide sequence encoding a second effector portion, wherein the nucleotide sequence encoding a second effector portion comprises a sequence according to SEQ ID NO: 51 Or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or differs from it by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, A sequence of 9, 8, 7, 6, 5, 4, 3, 2 or 1. 184. The nucleic acid of any one of embodiments 144 to 183, wherein the first region comprises a nucleotide sequence according to SEQ ID NO: 63 or 130 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto , or the number of positions differing therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 Sequences, where polyA sequences are optionally present. 185. The nucleic acid of any one of embodiments 144 to 184, wherein the second region comprises a nucleotide sequence according to SEQ ID NO: 189 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or A sequence whose number of positions differing from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, wherein polyadenylic acid sequences are optionally present. 186. The nucleic acid of any one of embodiments 144 to 185, wherein the second region comprises a nucleotide sequence according to SEQ ID NO: 194 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or A sequence whose number of positions differing from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, wherein polyadenylic acid sequences are optionally present. 187. The nucleic acid of any one of embodiments 144 to 186, wherein the first region comprises a nucleotide sequence encoding a first effector portion, wherein the nucleotide sequence encoding a first effector portion comprises a sequence according to SEQ ID NO: 52 or 132 or sequences that are at least 80, 85, 90, 95, 99 or 100% identical to them, or differ from them by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, A sequence of 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 188. The nucleic acid of any one of embodiments 144 to 187, wherein the first region comprises a nucleotide sequence encoding a first targeting moiety, wherein the nucleotide sequence encoding a first targeting moiety comprises a sequence according to SEQ ID NO: 46 or the sequence of 131 or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, A sequence of 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 189. The nucleic acid of any one of embodiments 144 to 188, wherein the second region comprises a nucleotide sequence encoding a second effector portion, wherein the nucleotide sequence encoding a second effector portion comprises a sequence according to SEQ ID NO: 51 Or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or differs from it by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, A sequence of 9, 8, 7, 6, 5, 4, 3, 2 or 1. 190. The nucleic acid of any one of embodiments 144 to 189, wherein the second region comprises a nucleotide sequence according to SEQ ID NO: 189 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or A sequence that differs therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 191. The nucleic acid of any one of embodiments 144 to 190, wherein the second region comprises a nucleotide sequence according to SEQ ID NO: 194 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or A sequence that differs therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 192. The nucleic acid of any one of embodiments 144 to 191, which has a nucleotide sequence according to SEQ ID NO: 93, 112 or a sequence at least 80, 85, 90, 95, 99 or 100% consistent with it, or its Sequences in which the number of differing positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 193. The nucleic acid of any one of embodiments 144 to 192, which has a nucleotide sequence according to SEQ ID NO: 196 or 197 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or Sequences in which the number of differing positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 194. The system or nucleic acid of any one of embodiments 118-193, wherein the first expression inhibitor comprises a first effector moiety. 195. The system or nucleic acid of any one of embodiments 118-194, wherein the second expression inhibitor comprises a second effector moiety. 196. The system or nucleic acid of any one of embodiments 118-195, wherein the first effector moiety has a different amino acid sequence than the second effector moiety. 197. The system or nucleic acid of any one of embodiments 118-196, wherein the first effector moiety is a persistent effector moiety. 198. The system or nucleic acid of any one of embodiments 118-125 or 144-197, wherein the first effector moiety is a transient effector moiety. 199. The system or nucleic acid of any one of embodiments 118-198, wherein the first effector moiety is an epigenetic modification moiety. 200. The system or nucleic acid of any one of embodiments 118-143, 163-197 or 199, wherein the first effector moiety comprises a histone methyltransferase. 201. The system or nucleic acid of embodiment 200, wherein the first effector portion comprises a protein selected from the group consisting of: SETDB1, SETDB2, EHMT2 (ie, G9A), EHMT1 (ie, GLP), SUV39H1, EZH2, EZH1, SUV39H2 , SETD8, SUV420H1, SUV420H2, or a functional variant or fragment of any of them, such as the SET domain of any of them. 202. The system or nucleic acid according to any one of embodiments 118-143, 163-197 or 199, wherein the first effector moiety comprises a histone demethylase (eg, lysine demethylase). 203. The system or nucleic acid of embodiment 202, wherein the first effector portion comprises a protein selected from the group consisting of: KDM1A (ie, LSD1), KDM1B (ie, LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D , KDM4B, NO66 (or a functional variant or fragment of any of them). 204. The system or nucleic acid of any one of embodiments 118-143, 163-197, or 199, wherein the first effector moiety comprises a histone deacetylase. 205. The system or nucleic acid of embodiment 204, wherein the first effector portion comprises a protein selected from the group consisting of: HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3 , SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, or a functional variant or fragment of any of them. 206. The system or nucleic acid of any one of embodiments 118-197 or 200, wherein the first effector moiety comprises a DNA methyltransferase. 207. The system or nucleic acid of embodiment 206, wherein the first effector portion comprises a protein selected from the group consisting of: MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L or any one thereof Functional variants or fragments. 208. The system or nucleic acid according to any one of embodiments 118-143, 160-196 or 198, wherein the first effector moiety is a transcriptional repressor moiety, for example comprising a transcriptional repressor. 209. The system or nucleic acid of embodiment 198 or 199, wherein the first effector moiety comprises a protein selected from KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 or a functional variant or fragment of any of them. 210. The system or nucleic acid according to any one of embodiments 118 to 209, wherein the first effector moiety promotes epigenetic modification of the transcriptional regulatory element or sequences close thereto. 211. The system or nucleic acid of any one of embodiments 118 to 210, wherein the first effector moiety catalyzes the epigenetic modification of the transcriptional regulatory element or sequences proximate thereto. 212. The system or nucleic acid of any one of embodiments 118-125, 194, or 197-211, wherein the second expression inhibitor does not comprise an effector moiety. 213. The system or nucleic acid of any one of embodiments 118-212, wherein the second effector moiety is a transient effector moiety. 214. The system or nucleic acid of any one of embodiments 118-125 or 194-211, wherein the second effector moiety is a persistent effector moiety. 215. The system or nucleic acid of any one of embodiments 118-211 or 214, wherein the second effector moiety is an epigenetic modification moiety. 216. The system or nucleic acid of any one of embodiments 118-125, 194-211 or 214-215, wherein the second effector moiety comprises a histone methyltransferase. 217. The system or nucleic acid of embodiment 216, wherein the second effector portion comprises a protein selected from the group consisting of: SETDB1, SETDB2, EHMT2 (ie, G9A), EHMT1 (ie, GLP), SUV39H1, EZH2, EZH1, SUV39H2 , SETD8, SUV420H1, SUV420H2, or a functional variant or fragment of any of them, such as the SET domain of any of them. 218. The system or nucleic acid of any one of embodiments 118-125, 194-211 or 214-215, wherein the second effector moiety comprises a histone demethylase (eg, lysine demethylase). 219. The system or nucleic acid of embodiment 218, wherein the second effector portion comprises a protein selected from the group consisting of: KDM1A (ie, LSD1), KDM1B (ie, LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D , KDM4B, NO66 (or a functional variant or fragment of any of them). 220. The system or nucleic acid of any one of embodiments 118-125, 194-211 or 214-215, wherein the second effector moiety comprises a histone deacetylase. 221. The system or nucleic acid as in embodiment 220, wherein the second effector portion comprises a protein selected from the group consisting of: HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3 , SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, or a functional variant or fragment of any of them. 222. The system or nucleic acid of any one of embodiments 118-125, 194-211 or 214-215, wherein the second effector moiety comprises a DNA methyltransferase. 223. The system or nucleic acid of embodiment 222, wherein the second effector portion comprises a protein selected from the group consisting of: MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L or any of them Functional variants or fragments. 224. The system or nucleic acid of any one of embodiments 118-211 or 213, wherein the second effector moiety is a transcriptional repressor moiety. 225. The system or nucleic acid of embodiment 224, wherein the second effector moiety facilitates epigenetic modification of the anchor sequence or sequences proximate thereto. 226. The system or nucleic acid of embodiment 223 or 224, wherein the second effector moiety binds to one or more endogenous epigenetic modifier proteins or one or more endogenous transcriptional modifier proteins. 227. The system or nucleic acid according to any one of embodiments 223 to 226, wherein the second effector moiety comprises KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional variant or fragment thereof. 228. The system or nucleic acid of any one of embodiments 118-197, 199-207, 210-211, 213, or 224-227, wherein: the first effector moiety is a persistent effector moiety, and the second effector moiety is a transient effector moiety . 229. The system or nucleic acid of embodiment 228, wherein the first effector moiety is an epigenetic modification moiety. 230. The system or nucleic acid of embodiment 227 or 228, wherein the second effector moiety is a transcriptional repressor moiety. 231. The system or nucleic acid of any one of embodiments 227 to 230, wherein: the first effector moiety comprises histone methyltransferase, histone demethylase, histone deacetylase, DNA methyltransferase , a functional variant or fragment of any of them, or a combination of any of them, and the second effector portion comprises a transcriptional repressor or a functional variant or fragment of any of them. 232. The system or nucleic acid of any one of embodiments 118-125, 194, 197, 199-207, 210-212 or 190, wherein: the first effector moiety comprises histone methyltransferase, histone demethylation enzyme, histone deacetylase, DNA methyltransferase, a functional variant or fragment of any of them, or a combination of any of them, and the second expression inhibitor does not comprise a second effector moiety. 233. The system or nucleic acid of any one of embodiments 118 to 125, 199 to 207, 210 to 211, 213 to 214, or 224 to 231, wherein: the first effector moiety comprises SETDB1, SETDB2, EHMT2 (i.e., G9A ), EHMT1 (ie, GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KDM1A (ie, LSD1), KDM1B (ie, LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, a functional variant or fragment of any of them, or a combination of any of them, and the second effector moiety comprises KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, functional variants or fragments of any of them, or combinations of any of them. 234. The system or nucleic acid of any one of embodiments 118-197, 199, 206-207, 210-211, 213, 215, 224-231 or 233, wherein: the first effector moiety comprises a DNA methyltransferase, And the second effector moiety comprises a transcriptional repressor. 235. The system or nucleic acid of any one of embodiments 118-125, 194, 197, 200, 206-207, 210-212, or 232, wherein: the first effector moiety comprises a DNA methyltransferase, and the second Expression suppressors do not contain a second effector moiety. 236. The system or nucleic acid of any one of embodiments 118 to 125, 200, 206 to 207, 210 to 235, wherein the first effector portion comprises MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, A functional variant or fragment of DNMT3B6, DNMT3L, or either. 237. The system or nucleic acid of any one of embodiments 118 to 211, 214, 224 to 234 or 236, wherein the second effector moiety comprises functions of KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 or any of them variant or fragment. 238. The system or nucleic acid of any one of embodiments 118-211, 199, 206-207, 210-211, 213, 224-234, or 236-237, wherein: the first effector moiety comprises MQ1 or any one thereof A functional variant or fragment of KRAB, and the second effector comprises a functional variant or fragment of KRAB or either. 239. The system or nucleic acid of any one of embodiments 118 to 125, 194, 197, 199 to 207, or 210 to 212, 229, 232, 235 or 236, wherein: the first effector moiety comprises MQ1 or any of them A functional variant or fragment thereof, and the second expression suppressor does not comprise a second effector moiety. 240. The system or nucleic acid of any one of embodiments 118 to 200, wherein the first expression inhibitor comprises a sequence selected from SEQ ID NO: 22-37, 129, 133, 134, 139-149, 177-180 or 183-186 The amino acid sequence of any one of them or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, A sequence of 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 241. The system or nucleic acid according to any one of embodiments 118 to 198, 200, 206 to 211, 213 to 216, 222 to 223, 236 to 237 or 240, wherein the second expression inhibitor comprises a group selected from the group consisting of SEQ ID NO: 22 - the amino acid sequence of any one of 37, 129, 133, 134, 139-149, 177-180 or 183-186, or a sequence at least 80, 85, 90, 95 or 99% identical thereto, or Sequences in which the number of differing positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 242. The system or nucleic acid of any one of embodiments 118 to 198, 200, 206 to 211, 213 to 216, 222 to 223, 236 to 237 or 240 to 241, wherein the first expression inhibitor comprises the amino acid sequence SEQ ID NO: 30, 129, 133, or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13 , 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and the second expression suppressor comprises the amino acid sequence SEQ ID NO: 24, 134, 141, 177, 179, 183, or 185, or a sequence at least 80, 85, 90, 95, or 99% identical thereto, or a sequence that differs therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, A sequence of 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 243. The system or nucleic acid of any one of embodiments 118-198, 200, 206-211, 213-216, 222-223, 236-237 or 240-242, wherein the first expression inhibitor is encoded by: A nucleotide sequence of SEQ ID NO: 63 or 130, or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15 , 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and the second expression inhibitor is encoded by the following: the second nucleotide sequence SEQ ID NO: 57, 189 or 194, or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, A sequence of 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 244. The system or nucleic acid according to any one of embodiments 118 to 198, 200, 206 to 211, 213 to 216, 222 to 223, 236 to 237 or 240 to 243, wherein the first inhibitor and the second inhibitor are composed of the following Coding: Nucleic acid sequence SEQ ID NO: 93, 94, 112, 113, 196 or 197, or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or the number of positions that differ from it does not exceed 20, 19, The sequence of 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 245. The system or nucleic acid according to embodiment 244, which comprises the amino acid sequence of SEQ ID NO: 91, 92, 121, 122, 181, 182, 187 or 188, or at least 80, 85, 90, 95 or 99% thereof Consistent sequence, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or a sequence of 1s. 246. The system or nucleic acid of any one of embodiments 118 to 197, 199, 206 to 207, 210 to 211, 213, 215, 224 to 231, 233 to 234, 236 to 237 or 240 to 244, wherein: the An expression suppressor comprising from N-terminus to C-terminus: (i) a first nuclear localization signal, for example SV40 NLS; for example a sequence according to SEQ ID NO: 135; (ii) a first targeting moiety, for example a zinc finger binding domain, For example ZF9; for example a sequence according to SEQ ID NO: 13; (iii) a first effector moiety, for example a DNA methyltransferase, for example MQ1; for example a sequence according to SEQ ID NO: 19 or 87; (iv) a second nuclear localization A signal, such as a nucleoplasmic protein NLS; for example according to the sequence of SEQ ID NO: 136; and the second expression suppressor comprises from N-terminus to C-terminus: (v) a third nuclear localization signal, such as SV40NLS; for example according to SEQ ID NO : 135; (vi) a second targeting moiety, such as a zinc finger binding domain, such as ZF3; for example a sequence according to SEQ ID NO: 7; (vii) a second effector moiety, such as KRAB, for example according to SEQ ID NO: 18; and (viii) a fourth nuclear localization signal, such as nucleoplasmic protein NLS, for example according to the sequence of SEQ ID NO: 136. 247. The system or nucleic acid according to any one of embodiments 118 to 197, 199, 206 to 207, 210 to 211, 213, 215, 224 to 231, 233 to 234, 236 to 237 or 240 to 244, wherein: the An expression suppressor comprising from N-terminus to C-terminus: (i) a first nuclear localization signal, for example SV40 NLS; for example a sequence according to SEQ ID NO: 135; (ii) a first targeting moiety, for example a zinc finger binding domain, For example ZF9; for example a sequence according to SEQ ID NO: 13; (iii) a first effector moiety, for example a DNA methyltransferase, for example MQ1; for example a sequence according to SEQ ID NO: 19 or 87; (iv) a second nuclear localization A signal, such as a nucleoplasmic protein NLS; for example according to the sequence of SEQ ID NO: 136; and the second expression suppressor comprises from N-terminus to C-terminus: (v) a third nuclear localization signal, such as SV40NLS; for example according to SEQ ID NO : 135; (vi) a second targeting moiety, such as a zinc finger binding domain, such as ZF54; for example a sequence according to SEQ ID NO: 169; (vii) a second effector moiety, such as KRAB, for example according to SEQ ID NO: 18; and (viii) a fourth nuclear localization signal, such as nucleoplasmic protein NLS, for example according to the sequence of SEQ ID NO: 136. 248. The system or nucleic acid according to any one of embodiments 118 to 197, 199, 206 to 207, 210 to 211, 213, 215, 224 to 231, 233 to 234, 236 to 237 or 240 to 244, wherein: the An expression suppressor comprising from N-terminus to C-terminus: (i) a first nuclear localization signal, for example SV40 NLS; for example a sequence according to SEQ ID NO: 135; (ii) a first targeting moiety, for example a zinc finger binding domain, For example ZF9; for example a sequence according to SEQ ID NO: 13; (iii) a first effector moiety, for example a DNA methyltransferase, for example MQ1; for example a sequence according to SEQ ID NO: 19 or 87; (iv) a second nuclear localization A signal, such as a nucleoplasmic protein NLS; for example according to the sequence of SEQ ID NO: 136; and the second expression suppressor comprises from N-terminus to C-terminus: (v) a third nuclear localization signal, such as SV40NLS; for example according to SEQ ID NO : 135; (vi) a second targeting moiety, such as a zinc finger binding domain, such as ZF67; for example a sequence according to SEQ ID NO: 171; (vii) a second effector moiety, such as KRAB, for example according to SEQ ID NO: 18; and (viii) a fourth nuclear localization signal, such as nucleoplasmic protein NLS, for example according to the sequence of SEQ ID NO: 136. 249. The system of any one of embodiments 118 to 248, wherein the system is capable of reducing MYC expression to a greater extent than either the first inhibitor of expression alone or the second inhibitor of expression alone. 250. The system according to any one of embodiments 128 to 194 or 242 to 249, wherein the system is capable of reducing MYC expression to a greater extent than the expression inhibition of SEQ ID: 22, 23, 25-29, 31-37 alone or in combination any of the sons. 251. The system of any one of embodiments 118 to 250, which is capable of reducing tumor volume, eg in a human subject or in a mammalian model. 252. The system of any one of embodiments 128 to 193 or 242 to 209, wherein the system is capable of reducing tumor volume to a degree similar to or greater than that of chemotherapeutic agents, e.g., in a mammalian model, e.g. Measured at day 20, for example where the expression inhibitor is administered at a dose of 3 mg/kg every 5 days, for example in a model system as described in Example 15. 253. The system of any one of embodiments 128 to 193 or 242 to 252, wherein the system is capable of reducing tumor volume to a greater extent than chemotherapeutic agents, e.g., in a mammalian model, e.g., when at day 15 after initiation of treatment Measured, for example, where the expression inhibitor is administered at a dose of 6 mg/kg every 5 days, for example in a model system as described in Example 14. 254. The system of any one of embodiments 128-193 or 242-253, wherein tumor volume is reduced by at least about 10%, 20%, 30%, 40%, 50%, or 60% compared to a PBS-treated control group %, for example on day 20 after the start of treatment. 255. The system of embodiment 254, wherein the chemotherapeutic agent is sorafenib or cisplatin. 256. The system of any one of embodiments 128-193 or 242-253, wherein the system is capable of reducing tumor volume to a degree similar to or greater than that of a small molecule MYC inhibitor. 257. The system of embodiment 256, wherein the small molecule MYC inhibitor is MYCi975, wherein optionally, tumor volume is reduced by at least about 10%, 20%, 30% or 40% compared to a MYCi975-treated control group, e.g. On the 20th day after the start of treatment. 258. The system of any one of embodiments 118 to 257, which does not cause a decrease in body weight, or causes a decrease in body weight of less than 3%, 2% or 1% compared to the start of treatment. 259. The system or nucleic acid according to any one of embodiments 118 to 258, wherein the first targeting moiety is an oligonucleotide selected from TAL effector domain, CRISPR/Cas domain, zinc finger domain, tetR domain, meganuclease. 260. The system or nucleic acid according to any one of embodiments 11 to 260, wherein the second targeting moiety is selected from a TAL effector domain, a CRISPR/Cas domain, a zinc finger domain, a tetR domain, a meganuclease or an oligonucleotide. 261. The system or nucleic acid of any one of embodiments 118-260, wherein the first targeting moiety comprises a CRISPR/Cas domain (eg, a first CRISPR/Cas domain). 262. The system or nucleic acid of any one of embodiments 118-261, wherein the second targeting moiety comprises a second CRISPR/Cas domain (eg, a second CRISPR/Cas domain). 263. The system or nucleic acid of embodiment 262, wherein: i) the first CRISPR/Cas domain binds a first guide RNA, ii) the second CRISPR/Cas domain binds a second guide RNA, or iii) (i) and (ii) ) both. 264. The system or nucleic acid of embodiment 262 or 263, wherein the first CRISPR/Cas domain does not bind the second guide RNA or with a K of at least 10, 20, 50, 100, 1000 or 10,000 nM _D. binds, and the second CRISPR/Cas domain does not bind the first guide RNA or with a K of at least 10, 20, 50, 100, 1000, or 10,000 nM _D. combined. 265. The system or nucleic acid of any one of embodiments 260 to 264, wherein the first CRISPR/Cas domain comprises a different amino acid sequence than the second CRISPR/Cas domain. 266. The system or nucleic acid of any one of embodiments 260 to 265, wherein the first or second CRISPR/Cas domain comprises a Cas protein or a Cpf1 protein or a variant (such as a mutant) selected from Table 1 ) amino acid sequence. 267. The system or nucleic acid of any one of embodiments 260 to 266, wherein the first CRISPR/Cas domain comprises an amine selected from the Cas protein or the Cpf1 protein of Table 1 or a variant (e.g., mutant) of any of them amino acid sequence, and the second CRISPR/Cas domain comprises an amino acid sequence selected from different Cas proteins or Cpf1 proteins of Table 1 or variants (eg, mutants) of any of them. 268. The system or nucleic acid of any one of embodiments 118-260, wherein the first targeting moiety comprises a zinc finger domain (eg, a first zinc finger domain). 269. The system or nucleic acid of any one of embodiments 118-260 or 268, wherein the second targeting moiety comprises a zinc finger domain (eg, a second zinc finger domain). 270. The system or nucleic acid of any one of embodiments 118-261 or 268-269, wherein the first targeting moiety comprises a first zinc finger domain and the second targeting moiety comprises a second zinc finger domain. 271. The system or nucleic acid according to any one of embodiments 268 to 270, wherein the first zinc finger domain and the second zinc finger domain bind to the same gene body locus, eg have the same amino acid sequence. 272. The system or nucleic acid of any one of embodiments 268-271, wherein the first zinc finger domain and the second zinc finger domain have different amino acid sequences or bind to different gene body loci. 273. The system or nucleic acid of any one of embodiments 118-261 or 267-272, wherein the first zinc finger molecule comprises at least 1, 2, 3, 4, 5, 7, 8, 9 or 10 zinc fingers (and No more than 11, 10, 9, 8, 7, 6 or 5 zinc fingers as appropriate). 274. The system or nucleic acid of any one of embodiments 267 to 273, wherein the first zinc finger molecule comprises 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4 , 1 to 3, 1 to 2, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3 to 4, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, 4 to 5, 5 to 10, 5 to 9 , 5 to 8, 5 to 7, 5 to 6, 6 to 10, 6 to 9, 6 to 8, 6 to 7, 7 to 10, 7 to 9, 7 to 8, 8 to 10, 8 to 9 or 9 to 10 zinc fingers. 275. The system or nucleic acid of any one of embodiments 268-274, wherein the first zinc finger domain comprises 3 or 9 zinc fingers. 276. The system or nucleic acid of any one of embodiments 268 to 275, wherein the second zinc finger domain comprises at least 1, 2, 3, 4, 5, 7, 8, 9 or 10 zinc fingers (and optionally no more than 11, 10, 9, 8, 7, 6 or 5 fingers). 277. The system or nucleic acid of any one of embodiments 268 to 276, wherein the second zinc finger domain comprises 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4 , 1 to 3, 1 to 2, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3 to 4, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, 4 to 5, 5 to 10, 5 to 9 , 5 to 8, 5 to 7, 5 to 6, 6 to 10, 6 to 9, 6 to 8, 6 to 7, 7 to 10, 7 to 9, 7 to 8, 8 to 10, 8 to 9 or 9 to 10 zinc fingers. 278. The system or nucleic acid of any one of embodiments 268-277, wherein the second zinc finger domain comprises 3 or 9 zinc fingers. 279. The system or nucleic acid of any one of embodiments 11 to 278, wherein the first targeting moiety comprises a TAL effector domain (eg, a first TAL effector domain). 280. The system or nucleic acid of any one of embodiments 118-260 or 279, wherein the second targeting moiety comprises a TAL effector domain (eg, a second TAL effector domain). 281. The system or nucleic acid according to any one of embodiments 279 or 280, wherein the first TAL effector domain comprises at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38 or 40 center repeats (and no more than 45, 40, 35, 30, 25, 20, 15 or 10 center repeats as appropriate). 282. The system or nucleic acid according to any one of embodiments 279 to 281, wherein the first TAL effector domain comprises 2 to 40, 5 to 40, 10 to 40, 15 to 40, 20 to 40, 25 to 40, 30 to 40 , 35 to 40, 2 to 35, 5 to 35, 10 to 35, 15 to 35, 20 to 35, 25 to 35, 30 to 35, 2 to 30, 5 to 30, 10 to 30, 15 to 30, 20 to 30, 25 to 30, 2 to 25, 5 to 25, 10 to 25, 15 to 25, 20 to 25, 2 to 20, 5 to 20, 10 to 20, 15 to 20, 2 to 15, 5 to 15 , 10 to 15, 2 to 10, 5 to 10, or 2 to 5 center repeats. 283. The system or nucleic acid according to any one of embodiments 279 to 282, wherein the second TAL effector domain comprises at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38 or 40 center repeats (and no more than 45, 40, 35, 30, 25, 20, 15 or 10 center repeats as appropriate). 284. The system or nucleic acid according to any one of embodiments 279 to 283, wherein the second TAL effector domain comprises 2 to 40, 5 to 40, 10 to 40, 15 to 40, 20 to 40, 25 to 40, 30 to 40 , 35 to 40, 2 to 35, 5 to 35, 10 to 35, 15 to 35, 20 to 35, 25 to 35, 30 to 35, 2 to 30, 5 to 30, 10 to 30, 15 to 30, 20 to 30, 25 to 30, 2 to 25, 5 to 25, 10 to 25, 15 to 25, 20 to 25, 2 to 20, 5 to 20, 10 to 20, 15 to 20, 2 to 15, 5 to 15 , 10 to 15, 2 to 10, 5 to 10, or 2 to 5 center repeats. 285. The system or nucleic acid of any one of embodiments 118-284, wherein the first targeting moiety comprises a nucleic acid (eg, a first nucleic acid). 286. The system of any one of embodiments 129-285, wherein the second targeting moiety comprises a nucleic acid (eg, a second nucleic acid). 287. The system or nucleic acid of any one of embodiments 129-286, wherein the first targeting moiety comprises a polypeptide (eg, a first polypeptide). 288. The system or nucleic acid of any one of embodiments 129-287, wherein the second targeting moiety comprises a polypeptide (eg, a second polypeptide). 289. The system of embodiment 287 or 288, wherein the nucleic acid is covalently linked to the polypeptide. 290. The system of embodiment 288 or 289, wherein the nucleic acid is non-covalently bound to the polypeptide. 291. The system or nucleic acid according to any one of embodiments 275 to 290, wherein the nucleic acid comprises a sequence complementary to the transcriptional regulatory element or a sequence adjacent to it, or relative to the transcriptional regulatory element or a sequence adjacent to it, comprising no more than 10 , 9, 8, 7, 6, 5, 4, 3, 2, or 1 mismatches. 292. The system or nucleic acid according to any one of embodiments 275 to 291, wherein the nucleic acid comprises a sequence complementary to the anchor sequence or a sequence adjacent to it, or relative to the anchor sequence or a sequence adjacent to it, comprising no more than 10 , 9, 8, 7, 6, 5, 4, 3, 2, or 1 mismatches. 293. The system of any one of embodiments 275 to 292, wherein the nucleic acid comprises DNA, peptide nucleic acid (PNA), peptide-oligonucleotide conjugates, locked nucleic acid (LNA), bridging nucleic acid (BNA), polyamide amines, triplex forming oligonucleotides, antisense oligonucleotides, tRNA, mRNA, rRNA, miRNA, gRNA, siRNA or other RNAi molecules. 294. The system of any one of embodiments 275-293, wherein the nucleic acid comprises gRNA. 295. The system of any one of embodiments 275 to 294, wherein the nucleic acid comprises a sequence at least 80, 85, 90, 95, 99 or 100% identical to any of SEQ ID NO: 1-4, or The number of positions with differences shall not exceed 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. 296. The system of any one of embodiments 275 to 295, wherein the first nucleic acid comprises a sequence at least 80, 85, 90, 95, 99 or 100% identical to any of SEQ ID NO: 1-4 or The number of positions differing is no more than 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, and the second nucleic acid comprises at least 80, 85, No more than 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 sequences that are 90, 95, 99 or 100% identical or differ therefrom. 297. The system of any one of embodiments 275 to 295, wherein the first nucleic acid comprises a sequence at least 80, 85, 90, 95, 99 or 100% identical to any one of SEQ ID NOs: 96-110 or a sequence identical to any one of SEQ ID NO: 96-110 The number of positions differing is no more than 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, and the second nucleic acid comprises at least 80, 85, No more than 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 sequences that are 90, 95, 99 or 100% identical or differ therefrom. 298. The system of any one of embodiments 118-297, wherein the transcriptional regulatory element comprises a promoter. 299. The system of any one of embodiments 118-298, wherein the transcriptional regulatory element comprises an enhancer; such as a super enhancer. 300. The system of any one of embodiments 118-299, wherein the anchor sequence comprises a CTCF binding motif. 301. The system of any one of embodiments 118-300, wherein the anchor sequence comprises a YY1 binding motif. 302. The system of any one of embodiments 118 to 301, wherein the anchor sequence comprises the sequence SEQ ID NO: 71 or 72, or has no more than 8, 7, 6, 5, 4, 3, 2 or relative thereto 1 sequence of changes. 303. The system of any one of embodiments 118 to 302, wherein the anchor sequence comprises a sequence according to SEQ ID NO: 73 or 74, or has no more than 8, 7, 6, 5, 4, 3, 2 or 1 sequence of variations. 304. The system according to any one of embodiments 118 to 303, wherein the anchor sequence is located on the same chromosome as the MYC gene. 305. The system according to any one of embodiments 118 to 304, wherein the anchor sequence is located upstream of the MYC gene (eg upstream of TSS or upstream of the promoter). 306. The system of any one of embodiments 118-305, wherein the anchor sequence is at least 1, 5, 10, 50, 100 or 1000 kilobases apart from the MYC gene (eg, the TSS or promoter of the MYC gene). 307. The system of any one of embodiments 118 to 306, wherein the anchor sequence is 0.1 to 0.5, 0.1 to 1, 0.1 to 5, 0.1 to 10, 0.1 away from the MYC gene (such as the TSS or promoter of the MYC gene) to 50, 0.1 to 100, 0.1 to 500, 0.1 to 1000, 0.5 to 1, 0.5 to 5, 0.5 to 10, 0.5 to 50, 0.5 to 100, 0.5 to 500, 0.5 to 1000, 1 to 5, 1 to 10 , 1 to 50, 1 to 100, 1 to 500, 1 to 1000, 5 to 10, 5 to 50, 5 to 100, 5 to 500, 5 to 1000, 10 to 50, 10 to 100, 10 to 500, 10 to 1000, 50 to 100, 50 to 500, 50 to 1000, 100 to 500, 100 to 1000 or 500 to 1000 kilobases. 308. The system according to any one of embodiments 118 to 303 or 305 to 307, wherein the anchor sequence and the MYC gene are located on different chromosomes. 309. The system of any one of embodiments 118 to 308, wherein the second targeting moiety binds to the anchor sequence or a sequence in close proximity to the anchor sequence with an affinity sufficient to compete with an endogenous polypeptide (eg, CTCF or YY1 ) for binding. 310. The system of any one of embodiments 118 to 309, wherein the first targeting moiety binds to a sequence at or near the following chromosomal coordinates: 128746342-128746364, 128746321-128746343, or 128746525-128746547. 311. The system according to any one of embodiments 118 to 309, wherein the first targeting moiety binds to a sequence at or close to the following chromosomal coordinates: 128746405-128746425, 128748069-128748089, 129188825-129188845, or 129188822-129188842. 312. The system according to any one of embodiments 118 to 311, wherein the second targeting moiety binds to the sequence at or near chromosomal coordinates 128748014-128748036. 313. The system according to any one of embodiments 118 to 311, wherein the second targeting moiety binds to a sequence at or near the following chromosomal coordinates: 128746405-128746425, 128748069-128748089, 129188825-129188845, or 129188822-129188842. 314. The system of any one of embodiments 118 to 314, wherein the first expression inhibitor is a fusion molecule. 315. The system of any one of embodiments 118-314, wherein the second expression inhibitor is a fusion molecule. 316. The system of any one of embodiments 118 to 315, wherein the first expression inhibitor comprises a linker. 317. The system of any one of embodiments 118 to 316, wherein the second expression suppressor comprises a linker. 318. The system of any one of embodiments 118 to 267 or 285 to 317, wherein: the first expression inhibitor comprises: a targeting moiety comprising a first CRISPR/Cas molecule, for example comprising a catalytically inactive first CRISPR/Cas a Cas protein; and an effector moiety comprising an epigenetic modification moiety; and a second expression suppressor comprising: a targeting moiety comprising a second CRISPR/Cas molecule, for example comprising a catalytically inactive second CRISPR/Cas protein; and An optional effector moiety comprising a transcriptional repressor. 319. The system of any one of embodiments 118-260, 268-278, or 285-317, wherein: the first expression suppressor comprises a targeting moiety comprising a first zinc finger domain and an effector moiety comprising an epigenetic modification moiety and the second expression repressor comprises a targeting moiety comprising a second zinc finger domain and optionally an effector moiety comprising a transcriptional repressor. 320. The system of any one of embodiments 118-120, 262, 268, or 275-318, wherein: the first expression inhibitor comprises: a targeting moiety comprising a CRISPR/Cas molecule, for example comprising a catalytically inactive CRISPR/Cas a Cas protein; and an effector portion comprising an epigenetic modification portion; and a second expression repressor comprising a targeting portion comprising a zinc finger domain and optionally an effector portion comprising a transcriptional repressor. 321. The system of any one of embodiments 118-260, 268, or 275-318, wherein: the first expression suppressor comprises a targeting moiety comprising a zinc finger domain and an effector moiety comprising an epigenetic modification moiety; and the second Two expression suppressors comprise: a targeting moiety comprising a CRISPR/Cas domain, eg comprising a catalytically inactive CRISPR/Cas protein; and an optional effector moiety comprising a transcriptional repressor. 322. The system of any one of embodiments 260, 268-278, or 275-318, wherein the zinc finger domain (eg, the first or second zinc finger domain) comprises 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4 , 2 to 3, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3 to 4, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, 4 to 5, 5 to 10, 5 to 9, 5 to 8, 5 to 7, 5 to 6, 6 to 10, 6 to 9, 6 to 8, 6 to 7, 7 to 10, 7 to 9 , 7 to 8, 8 to 10, 8 to 9 or 9 to 10 zinc fingers, eg 3 or 9 zinc fingers. 323. The system of any one of embodiments 322, wherein the epigenetic modification moiety comprises a DNA methyltransferase. 324. The system of any one of embodiments 118 to 323, wherein the epigenetic modification portion comprises MQ1 or a functional variant or fragment thereof. 325. The system of any one of embodiments 118-324, wherein the second expression repressor comprises an effector moiety comprising a transcription repressor. 326. The system of any one of embodiments 118-323, wherein the transcriptional repressor comprises KRAB or a functional variant or fragment thereof. 327. The system of any one of embodiments 118 to 326, wherein the first expression inhibitor comprises the amino acid sequence of any one of SEQ ID NO: 28-33 or 35-37, 145-149, 151, 152 , or a sequence that is at least 80, 85, 90, 95, 99, or 100% identical to, or differs from, the number of positions not exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 , 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence. 328. The system of any one of embodiments 118 to 327, wherein the second expression inhibitor comprises any one of SEQ ID NOs: 22-27, 34, 139-144, 150, 177-180, 183-186 Amino acid sequence, or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or differs from it by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12 positions , 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence. 329. The system according to any one of embodiments 118 to 328, wherein the first expression suppressor binds to the transcriptional regulatory element or a sequence close thereto reduces the expression of MYC in the cell. 330. The system of embodiment 327, wherein the system achieves a performance reduction of 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% compared to performance in the absence of the first performance inhibitor , eg as measured by QPCR or ELISA. 331. The system of embodiment 326 or 327, wherein the first expression repressor binds to the transcriptional regulatory element to significantly reduce MYC expression for the following period of time: at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cell divisions, eg as measured by QPCR or ELISA. 332. The system of any one of embodiments 329 to 331, wherein the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 10th, 12th, 16th, 20th, 24th, 28th, 32nd , 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, 80, or 96 hours, binding of the first expression repressor to the transcriptional regulatory element significantly reduces MYC expression. 333. The system of any one of embodiments 328 to 332, wherein the binding of the second expression inhibitor to the anchor sequence or a sequence close thereto reduces the expression of MYC in the cell. 334. The system of embodiment 333, wherein the system achieves a performance reduction of 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% compared to performance in the absence of the second performance inhibitor , eg as measured by QPCR or ELISA. 335. The system of embodiment 333 or 334, wherein the second expression inhibitor is bound to the anchor sequence or a sequence close to it to reduce MYC expression for the following periods of time: at least 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cell divisions, eg as measured by QPCR or ELISA. 336. The system of any one of embodiments 334 to 335, wherein the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 10th, 12th, 16th, 20th, 24th, 28th, 32nd , 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, 80, or 96 hours, binding of the second expression suppressor to the anchor sequence or a sequence in close proximity thereto significantly reduces MYC expression. 337. The system of any one of embodiments 329 to 336, wherein the first expression repressor binds to the transcriptional regulatory element or a sequence close to it and the second expression repressor binds to the anchor sequence or a sequence close to it reduces MYC in the cell in the performance. 338. The system of any one of embodiments 329 to 337, wherein the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 10th, 12th, 16th, 20th, 24th, 28th, 32nd , 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, 80, or 96 hours, the first expression repressor binds to the transcriptional regulatory element or a sequence adjacent to it and the second expression repressor binds Sequences to or in close proximity to the anchor sequence significantly reduced MYC expression. 339. The system of any one of embodiments 337 or 338, wherein the system achieves a performance reduction of 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100%, eg as measured by QPCR or ELISA. 340. The system of any one of embodiments 329 to 339, wherein the binding of the first expression repressor to the transcriptional regulatory element or a sequence adjacent thereto and the binding of the second expression repressor to the anchor sequence or a sequence adjacent thereto renders expression of MYC reduce the following periods of time: at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or at least 1, 2, 3, 4, 5, 6, 7 days , 8, 9 or 10 cell divisions, eg as measured by QPCR or ELISA. 341. The system of any one of embodiments 329 to 340, wherein the binding of the first expression suppressor to the transcriptional regulatory element or a sequence close to it and the binding of the second expression suppressor to the anchor sequence or a sequence close to it causes expression The reduction is greater than the reduction in expression caused individually by the binding of the first expression suppressor to or in proximity to the transcriptional regulatory element or the binding of the second expression suppressor to or in proximity to the anchor sequence. 342. The system of embodiment 341, wherein the first expression suppressor binds to the transcriptional regulatory element or a sequence close to it and the second expression suppressor binds to the anchor sequence or a sequence close to it to reduce expression by Binding of the first expressed repressor to the transcriptional regulatory element or a sequence in close proximity thereto or binding of the second expressed repressor to the anchor sequence or a sequence in close proximity thereto elicited a reduction of 1.05x (i.e., 1.05-fold), 1.1x, respectively , 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x , 9x, 10x, 20x, 50x or 100x, eg as measured by QPCR or ELISA. 343. The system according to any one of embodiments 329 to 342, wherein compared to the sequence bound to or adjacent to the transcriptional regulatory element by the first expression inhibitor or the sequence bound to the anchor sequence or adjacent to the second expression inhibitor The reduction in expression caused individually by the binding of the first expression repressor to the transcriptional regulatory element or a sequence in close proximity thereto and the binding of the second expression repressor to the anchor sequence or a sequence in close proximity to it is maintained for a longer period of time (e.g. more hours, days, or cell divisions). 344. The system as in embodiment 343, wherein the first expression repressor binds to the transcriptional regulatory element or a sequence close to it and the second expression repressor binds to the anchor sequence or a sequence close to it to reduce expression, and the time for expression reduction is 1.05x (i.e., 1.05-fold) times the time for reduction in expression caused by binding of the first expression repressor to or in close proximity to the transcriptional regulatory element or binding of the second expression repressor to or in proximity to the anchor sequence, respectively, 1.1x, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x , 8x, 9x, 10x, 20x, 50x or 100x, eg as measured by QPCR or ELISA. 345. The system of any one of embodiments 329 to 344, wherein the binding of the first expression suppressor to the promoter or a sequence close to it and the binding of the second expression suppressor to a super enhancer or a sequence close to it reduces MYC expression by below Period: at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 hours or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cell divisions, eg as measured by QPCR or ELISA. 346. The system of any one of embodiments 329 to 345, wherein the binding of the first expression suppressor to the promoter or a sequence close to it and the binding of the second expression suppressor to a super-enhancer or a sequence close to it causes a decrease in expression Greater than the reduction in expression caused individually by the binding of the first expression suppressor to the promoter or a sequence in proximity thereto or the binding of the second expression suppressor to a super-enhancer or sequence in proximity thereto. 347. The system of embodiment 346, wherein the binding of the first expression suppressor to the promoter or a sequence close to it and the binding of the second expression suppressor to a super enhancer or a sequence close to it reduces expression by an amount determined by the second Binding of one expression repressor to the promoter or a sequence proximate thereto or binding of a second repressor of expression to a super-enhancer or a sequence proximate to it elicited reductions of 1.05x (i.e., 1.05-fold), 1.1x, 1.15x, respectively x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x , 10x, 20x, 50x or 100x, eg as measured by QPCR or ELISA. 348. The system of any one of embodiments 329 to 347, wherein compared to the sequence bound to the promoter or adjacent to the promoter by the first expression suppressor or the sequence bound to the super enhancer or adjacent to the second expression suppressor individually The reduction in expression caused by the binding of the first expression suppressor to the promoter or a sequence close to it and the binding of the second expression suppressor to a super-enhancer or a sequence close to it is maintained for a longer period of time (e.g., more number of hours, days, or cell divisions). 349. The system of embodiment 348, wherein the binding of the first expression suppressor to the promoter or a sequence close to it and the binding of the second expression suppressor to the super-enhancer or a sequence close to it reduces expression by the first expression Binding of a suppressor to a promoter or a sequence in proximity thereto or binding of a second expression suppressor to a super-enhancer or a sequence in proximity thereto causes 1.05x (i.e., 1.05-fold), 1.1x, 1.15x the time to reduction in expression, respectively , 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20x, 50x or 100x long (eg measured in hours, days or number of cell divisions), eg as measured by QPCR or ELISA. 350. The system of any one of embodiments 329 to 349, wherein performance decreases significantly indefinitely (eg, greater than an experimentally measurable period of time). 351. The system of any one of embodiments 329 to 350, wherein the binding of the first expression repressor to the transcriptional regulatory element or a sequence adjacent thereto reduces the survival rate of cells comprising the transcriptional regulatory element or a sequence adjacent thereto. 352. The system of any one of embodiments 329 to 351, wherein contacting a plurality of cells with a first expression inhibitor or a nucleic acid encoding a first expression inhibitor reduces the viability of the plurality of cells, optionally wherein the plurality of cells Including cancer cells and non-cancer cells and/or infected cells and uninfected cells. 353. The system of embodiment 352, wherein the survival rate achieved by the system is reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100%, eg as measured by CellTiter Glo. 354. The system of any one of embodiments 329-353, wherein administration of the first expression inhibitor results in at least 5%, 6%, 7%, 8%, 9% 10% of target cells (e.g., cancer cells) , 12%, 15%, 17%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 75% of cells undergo apoptosis. 355. The system of any one of embodiments 329 to 354, wherein binding of the second expression inhibitor to the anchor sequence or a sequence proximate thereto reduces viability of cells comprising the anchor sequence or a sequence proximate thereto. 356. The system of any one of embodiments 329 to 355, wherein contacting the plurality of cells with a second suppressor of expression or a nucleic acid encoding a second suppressor of expression reduces survival of the plurality of cells. 357. The system of any one of embodiments 329 to 356, wherein binding of the second expression suppressor to the super-enhancer or sequences adjacent thereto reduces survival of cells comprising the transcriptional regulatory element or sequences adjacent thereto. 358. The system of any one of embodiments 329 to 357, wherein contacting a plurality of cells with a second expression inhibitor or a nucleic acid encoding a first expression inhibitor reduces the viability of the plurality of cells, optionally wherein the plurality of cells Including cancer cells and non-cancer cells and/or infected cells and uninfected cells. 359. The system of embodiment 358, wherein the system achieves a reduction in survival rate by 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100%, eg as measured by CellTiter Glo. 360. The system of any one of embodiments 329-359, wherein administration of the second expression inhibitor results in at least 5%, 6%, 7%, 8%, 9%, 10% of target cells (e.g., cancer cells) %, 12%, 15%, 17%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, and 75% of cells undergo apoptosis. 361. The system of any one of embodiments 329 to 360, wherein the first expression repressor binds to the transcriptional regulatory element or a sequence adjacent thereto and the second expression repressor binds to the anchor sequence or a sequence adjacent thereto such that the anchor The survival rate of the cells of the sequence or its close sequence is reduced. 362. The system of any one of embodiments 329 to 361, wherein the binding of the first inhibitor of expression to the promoter or a sequence adjacent to it and the binding of the second inhibitor of expression to a super enhancer or a sequence adjacent to it reduces cell viability . 363. The system of any one of embodiments 329-362, wherein contacting the plurality of cells with the system or a nucleic acid encoding the system reduces the viability of the plurality of cells. 364. The system of embodiments 329 to 363, wherein the system achieves a reduction in survival rate by 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 compared to the survival rate in the absence of the system %, eg as measured by CellTiter Glo. 365. The system of any one of embodiments 329 to 364, wherein the first expression repressor is bound to the transcriptional regulatory element or a sequence adjacent thereto and the second expression repressor is bound to the anchor sequence or a sequence adjacent thereto. The decrease in survival rate is greater than the decrease in survival rate caused individually by the binding of the first expressed repressor to the transcriptional regulatory element or a sequence in close proximity thereto or the binding of the second expressed repressor to the anchor sequence or a sequence in close proximity thereto. 366. The system of any one of embodiments 329 to 365, wherein the survival rate caused by the binding of the first expression suppressor to the promoter or a sequence close to it and the binding of the second expression suppressor to a super enhancer or a sequence close to it The reduction is greater than the reduction in survival caused individually by binding of the first suppressor of expression to the promoter or a sequence in proximity thereto or binding of the second suppressor of expression to a super-enhancer or sequence in proximity thereto. 367. The system of embodiment 366, wherein the binding of the first expression repressor to the transcriptional regulatory element or a sequence close to it and the binding of the second expression repressor to the anchor sequence or a sequence close to it reduces the survival rate by Binding of one expressed repressor to a transcriptional regulatory element or a sequence proximate thereto or a second expressed repressor bound to an anchor sequence or a sequence proximate thereto caused a 1.05x (i.e., 1.05-fold), 1.1x reduction in survival, respectively , 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x , 9x, 10x, 20x, 50x or 100x, eg as measured by CellTiter Glo. 368. The system of embodiment 366 or 367, wherein the binding of the first expression suppressor to the promoter or a sequence close to it and the binding of the second expression suppressor to a super enhancer or a sequence close to it reduces the survival rate by Binding of the first expressed repressor to the promoter or a sequence in close proximity thereto or binding of the second expressed repressor to a super-enhancer or a sequence in close proximity thereto caused 1.05x (i.e., 1.05-fold), 1.1x reductions in the magnitude of survival, respectively , 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x , 9x, 10x, 20x, 50x or 100x, eg as measured by CellTiter Glo. 369. The system of any one of embodiments 329-368, wherein administration of the first expression inhibitor and the second expression inhibitor results in at least 5%, 6%, 7%, 8% of target cells (e.g., cancer cells) %, 9%, 10%, 12%, 15%, 17%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 75% apoptosis . 370. The system of embodiments 329-369, wherein the plurality of cells comprises a plurality of cancer cells and a plurality of non-cancer cells. 371. The system of embodiment 370, wherein contacting the plurality of cells with the system or a nucleic acid encoding the system reduces the survival rate of the plurality of cancer cells by more than it reduces the survival rate of the plurality of non-cancer cells. 372. The system of embodiment 370 or 371, wherein contacting the plurality of cells with the system or a nucleic acid encoding the system reduces the survival rate of a plurality of cancer cells by the amount that reduces the survival rate of a plurality of non-cancer cells 1.05x (i.e., 1.05x), 1.1x, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x , 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20x, 50x, or 100x. 373. The expression inhibitor or system according to any preceding embodiment, which reduces the survival rate of non-cancerous cells (eg primary hepatocytes) by no more than 5, 10, 15 or 20%, eg when analyzed according to Example 29. 374. The expression inhibitor or system of embodiment 320, wherein survival is assayed 72 hours after cells have been contacted with the expression inhibitor or system. 375. The expression inhibitor or system of embodiment 374, wherein the assay comprises contacting non-cancerous cells with 2.5, 2, 1.25, 1, 0.6 or 0.5 μg/ml of the expression inhibitor or system. 376. The system of any one of embodiments 352 to 375, which, when in contact with a plurality of infected cells and a plurality of uninfected cells, reduces the survival rate of the plurality of infected cells more than it reduces the survival rate of the plurality of uninfected cells and/or reduce the survival rate of a plurality of cancer cells more than it reduces the survival rate of a plurality of non-cancer cells. 377. The system of any one of embodiments 352 to 376, wherein the cancer is hepatocellular carcinoma (HCC), fibrolamellar hepatocellular carcinoma (FHCC), cholangiocarcinoma, angiosarcoma, secondary liver cancer, non-small cell lung cancer ( NSCLC), adenocarcinoma, small cell lung cancer (SCLC), large cell (undifferentiated) carcinoma, triple negative breast cancer, gastric adenocarcinoma, endometrial cancer, or pancreatic cancer. 378. The system according to any one of embodiments 352 to 377, wherein the cancer cells are lung cancer cells, gastric cancer cells, gastrointestinal cancer cells, colorectal cancer cells, pancreatic cancer cells or liver cancer cells. 379. The system of any one of embodiments 352-378, wherein the cells are human lung epithelial cells or human lung fibroblasts. 380. The system of any one of embodiments 352-379, wherein the infection is a viral infection. 381. The expression suppressor of embodiment 380, wherein the viral infection is hepatitis, such as hepatitis B. 382. The system of any one of embodiments 378-381, wherein the infected cells are human hepatocytes. 383. The system of any one of embodiments 352-382, wherein the viral infection is a chronic infection. 384. A fusion protein comprising: a first amino acid region comprising a sequence encoding a first expression inhibitor in the system of any one of embodiments 118-383; and a second amino acid region comprising A sequence encoding a second expression suppressor in the system of any one of Examples 118-383. 385. The fusion protein of embodiment 384, comprising a third amino acid region, wherein the third amino acid region is located between the first amino acid region and the second amino acid region. 386. The fusion protein according to embodiment 385, wherein the third amino acid region comprises a protease cleavage peptide sequence, such as a self-cleavage peptide sequence, such as a T2A self-cleavage peptide sequence, such as the sequence according to SEQ ID NO: 120. 387. The fusion protein of embodiment 386, wherein the third amino acid region comprises a protease cleavage peptide sequence, such as a self-cleaving peptide sequence, such as a tandem 2A peptide sequence, such as a tPT2A sequence, such as the sequence according to SEQ ID NO: 124. 388. The fusion protein of embodiment 385, wherein the peptide sequence comprises a T2A peptide sequence and a P2A peptide sequence. 389. The fusion protein according to any one of embodiments 384 to 388, wherein: the first expression inhibitor comprises an amino acid sequence according to SEQ ID NO: 30 or 129, or at least 80, 85, 90, 95 or 99 thereof % identical sequence; and the second expression suppressor comprises an amino acid sequence according to SEQ ID NO: 24 or 142 or a sequence at least 80, 85, 90, 95 or 99% identical thereto. 390. The fusion protein of any one of embodiments 384 to 388, wherein: the first expression inhibitor comprises an amino acid sequence according to SEQ ID NO: 30 or 129 or at least 80, 85, 90, 95 or 99% thereof an identical sequence; and the second expression suppressor comprises an amino acid sequence according to SEQ ID NO: 177 or 183 or a sequence at least 80, 85, 90, 95 or 99% identical thereto. 391. The fusion protein according to any one of embodiments 384 to 388, wherein: the first expression inhibitor comprises an amino acid sequence according to SEQ ID NO: 30 or 129 or at least 80, 85, 90, 95 or 99% thereof an identical sequence; and the second expression suppressor comprises an amino acid sequence according to SEQ ID NO: 179 or 185 or a sequence at least 80, 85, 90, 95 or 99% identical thereto. 392. The fusion protein of any one of embodiments 384 to 391, which comprises an amino acid sequence of SEQ ID NO: 91, 92, 121 or 122, or a sequence at least 80, 85, 90, 95 or 99% identical thereto, or sequences differing therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 . 393. The fusion protein of any one of embodiments 384 to 392, which comprises an amino acid sequence of SEQ ID NO: 181, 182, 187 or 188, or a sequence at least 80, 85, 90, 95 or 99% identical thereto, or sequences differing therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 . 394. A nucleic acid comprising a sequence encoding the system of any one of embodiments 118-393. 395. A nucleic acid comprising a sequence encoding the system of embodiment 394. 396. The nucleic acid of embodiment 394 or 395, comprising: a first region comprising a sequence encoding a first expression inhibitor in the system of any one of embodiments 118-393; and a second region comprising a sequence encoding The sequence of the second expression inhibitor in the system of any one of embodiments 118-393. 397. The nucleic acid of any one of embodiments 394 to 396, comprising a third region, wherein the third region is located between the first region and the second region. 398. The nucleic acid of any one of embodiments 394 to 397, wherein the third region encodes a ribosomal skip sequence. 399. The nucleic acid according to embodiment 397 or 398, wherein the third region encodes a tPT2A peptide sequence, such as the sequence according to SEQ ID NO: 124. 400. The nucleic acid according to any one of embodiments 397 to 399, wherein the third region encodes a protease cleavage peptide sequence, such as a self-cleavage peptide sequence, such as a T2A self-cleavage peptide sequence, such as the sequence according to SEQ ID NO: 95. 401. The nucleic acid of any one of embodiments 397 to 400, wherein the third region encodes a protease cleavage peptide sequence, such as a self-cleaving peptide sequence, such as a tandem 2A peptide sequence, such as a tPT2A peptide sequence, such as according to SEQ ID NO: 124 sequence. 402. The nucleic acid of any one of embodiments 394 to 401, wherein the first expression inhibitor comprises an amino acid sequence according to SEQ ID NO: 30 or 129 or at least 80, 85, 90, 95 or 99% identical thereto sequence; and the second expression suppressor comprises an amino acid sequence according to SEQ ID NO: 24, 142 or a sequence at least 80, 85, 90, 95 or 99% identical thereto. 403. The nucleic acid of any one of embodiments 394 to 401, wherein the first expression inhibitor comprises an amino acid sequence according to SEQ ID NO: 30, 129 or at least 80, 85, 90, 95 or 99% identical thereto sequence; and the second expression suppressor comprises an amino acid sequence according to SEQ ID NO: 177, 179, 183 or 185 or a sequence at least 80, 85, 90, 95 or 99% identical thereto. 404. The nucleic acid of any one of embodiments 394 to 403, which encodes the amino acid sequence of SEQ ID NO: 91, 92, 121, 122 or a sequence at least 80, 85, 90, 95 or 99% identical thereto, or A sequence that differs therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 405. The nucleic acid of any one of embodiments 394 to 404, which encodes an amino acid sequence of SEQ ID NO: 181, 182, 187, 188, or a sequence at least 80, 85, 90, 95 or 99% identical thereto, or A sequence that differs therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 406. The nucleic acid of any one of embodiments 394 to 405, which comprises a nucleotide sequence of SEQ ID NO: 93, 94, 112 or 113 or a sequence at least 80, 85, 90, 95 or 99% identical thereto, or a sequence identical thereto Sequences in which the number of differing positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 407. The nucleic acid of any one of embodiments 394 to 406, which comprises the nucleotide sequence SEQ ID NO: 196, 197, or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or has a difference therefrom A sequence whose number of positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 408. A nucleic acid comprising a sequence encoding an expression inhibitor or expression inhibition system according to any one of embodiments 1-407. 409. The nucleic acid according to any one of embodiments 394 to 408, which is RNA, such as mRNA. 410. The nucleic acid according to any one of embodiments 394 to 409, comprising N7 methylated guanosine, eg linked to the 5' end of the RNA, eg via a reverse 5' to 5' triphosphate linkage. 411. The nucleic acid of any one of embodiments 394 to 410, comprising a 5' UTR. 412. The nucleic acid according to any one of embodiments 394 to 411, comprising a Kozak sequence, for example between the 5' UTR and the sequence encoding the expression suppressor. 413. A system comprising: a first nucleic acid comprising a sequence encoding a first expression inhibitor in the system of any one of embodiments 118-393; and a second nucleic acid comprising a sequence encoding a second expression inhibitor ( For example, the sequence of the second expression inhibitor in the system of any one of embodiments 118-393). 414. The system of embodiment 413, wherein the first nucleic acid has a nucleotide sequence of SEQ ID NO: 63, 130, or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or a position that is different from it A sequence whose number does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and the second nucleic acid Have the nucleotide sequence of SEQ ID NO: 57, or a sequence at least 80, 85, 90, 95 or 99% identical to it, or have no more than 20, 19, 18, 17, 16, 15, 14 positions that differ therefrom , 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 415. The system of embodiment 414, wherein the first nucleic acid has a nucleotide sequence of SEQ ID NO: 63, 130, or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or a position that is different from it A sequence whose number does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and the second nucleic acid Have a nucleotide sequence of SEQ ID NO: 189 or 194, or a sequence at least 80, 85, 90, 95 or 99% identical thereto, or differ from it by no more than 20, 19, 18, 17, 16, 15 positions , 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 416. The system of embodiment 415, wherein the first nucleic acid has a nucleotide sequence of SEQ ID NO: 189, 194, or a sequence that is at least 80, 85, 90, 95 or 99% identical to it, or a position that is different from it A sequence whose number does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, and the second nucleic acid Have a nucleotide sequence of SEQ ID NO: 63 or 130, or a sequence at least 80, 85, 90, 95 or 99% identical thereto, or have no more than 20, 19, 18, 17, 16, 15 positions that differ therefrom , 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. 417. The nucleic acid or system of any one of embodiments 394 to 416, wherein the nucleic acid comprises mRNA. 418. A vector comprising a nucleic acid encoding a system or expression suppressor as in any preceding embodiment. 419. A lipid nanoparticle comprising the system, nucleic acid, mRNA or carrier of any preceding embodiment. 420. The lipid nanoparticle of embodiment 419, comprising ionizable lipids, such as cationic lipids, such as MC3, SSOP. 421. The lipid nanoparticle of embodiment 419 or 420, further comprising one or more of the following: neutral lipids, ionizable amine-containing lipids, biodegradable alkynylated lipids, steroids, phospholipids, polysaccharides Saturated lipids, structured lipids (eg, sterols), PEG, cholesterol, or polymer-conjugated lipids. 422. A reaction mixture comprising an expression inhibitor, system, nucleic acid, carrier or lipid nanoparticle of any preceding embodiment. 423. The reaction mixture of embodiment 422, further comprising cells. 424. A pharmaceutical composition comprising the expression inhibitor, system, nucleic acid, vector, lipid nanoparticle or reaction mixture of any preceding embodiment. 425. A method for reducing the expression of the MYC gene in a cell, the method comprising: making the cell (such as a cancer cell) and an expression inhibitor, system, one or more encoding the system or expression as in any one of embodiments 1 to 424 The inhibitor nucleic acid, vector, lipid nanoparticle or pharmaceutical composition is contacted, thereby reducing MYC gene expression in the cell. 426. A method of treating cancer in an individual in need thereof, the method comprising: administering to the individual an expression inhibitor, system, nucleic acid, vector, lipid nanoparticle, or pharmaceutical composition of any one of embodiments 1-424 , thereby treating the individual's cancer. 427. A method of reducing tumor growth in an individual in need thereof, the method comprising: administering to the expression inhibitor, system, nucleic acid, vector, lipid nanoparticle, or pharmaceutical composition of any one of embodiments 1-424 an individual, thereby reducing the size of the tumor in the individual. 428. The method of embodiment 427, wherein the reduction in tumor growth comprises a reduction in tumor volume compared to the tumor volume at the beginning of the treatment. 429. The method of embodiment 428, wherein the individual has a greater reduction in tumor growth than an untreated individual. 430. A method of enhancing or restoring the sensitivity of a cancer to a kinase inhibitor (eg, sorafenib), the method comprising administering to an individual having the cancer an expression inhibitor or system described herein. 431. The method of embodiment 430, wherein administration of the expression inhibitor or system increases the IC of the kinase inhibitor ₅₀ A reduction of 10%, 20%, 30% or 40%, for example in an assay of cancer cell survival, for example in an assay according to Example 38. 432. The method of embodiment 430 or 431, wherein the kinase inhibitor inhibits one or more (eg, all) of VEGFR, PDGFR or RAF kinases. 433. A method of enhancing or restoring sensitivity of cancer to a bromodomain inhibitor (e.g., a BET inhibitor, such as JQ1 ), the method comprising expressing an inhibitor described herein (e.g., any of embodiments 1 to 423), Systematic or nucleic acid administration to an individual with the cancer, wherein optionally, the expression inhibitor or systemic administration results in an IC of the bromodomain inhibitor ₅₀ A reduction of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%, for example in an assay of cancer cell survival, for example in an assay according to Example 39. 434. The method of embodiment 433, wherein the bromodomain inhibitor is or comprises JQ1, BET672 or birabresib. 435. A method of enhancing or restoring sensitivity of a cancer to a MEK inhibitor (e.g., Trametinib), the method comprising expressing an inhibitor described herein (e.g., any one of embodiments 1 to 423), Systematic or nucleic acid administration to an individual with the cancer, wherein optionally, administration of the expression inhibitor or system results in an IC of the MEK inhibitor ₅₀ A reduction of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%, for example in an assay of cancer cell survival, for example in an assay according to Example 51. 436. The method of any one of embodiments 427-435, wherein the subject has a reduction in tumor growth greater than or similar to the reduction in tumor size when the subject is treated with a chemotherapeutic agent or a small molecule MYC inhibitor. 437. The method of embodiment 436, wherein the chemotherapeutic agent is sorafenib or cisplatin. 438. The method of embodiment 437, wherein the small molecule MYC inhibitor is MYCi975. 439. A method of reducing the size of a tumor in an individual in need thereof, the method comprising: administering to the individual an expression inhibitor, system, nucleic acid, vector, lipid nanoparticle, or pharmaceutical composition of 1 to 424, wherein the tumor The reduction in size is greater than or similar to the reduction in tumor size when the individual is treated with a chemotherapeutic agent. 440. The method as in 439, wherein the chemotherapeutic agent is Sorafenib or Cisplatin. 441. The method of any preceding embodiment, wherein the subject does not experience any significant side effects compared to when treated with a chemotherapeutic agent or a small molecule MYC inhibitor. 442. The method of any one of embodiments 436-441, wherein the chemotherapeutic agent is sorafenib or cisplatin. 443. The method of embodiment 442, wherein the small molecule MYC inhibitor is MYCi975. 444. The method of any one of embodiments 426 to 443, wherein the cancer is a stage I, stage II, stage III or stage IV cancer. 445. The method of any preceding embodiment, wherein the subject's body weight remains approximately the same before and after treatment. 446. The method of any one of the preceding embodiments, wherein the subject has not experienced a decrease in body weight, or wherein the subject's body weight has decreased by less than 3%, 2% or 1% compared to the start of treatment. 447. The method of any one of the preceding embodiments, wherein the subject does not experience a decrease or gain in body weight after treatment compared to the subject's body weight before treatment. 448. A method of treating liver disease in an individual in need thereof, the method comprising: administering to the individual an expression inhibitor, wherein the expression inhibitor comprises a targeting moiety that binds a MYC locus (e.g., a MYC transcribed region, MYC promoter, or an anchor sequence in an anchor sequence-mediated adapter (ASMC) comprising the MYC gene or a sequence close to the anchor sequence); and an effector portion optionally present, such as an effector as described herein a portion; whereby the liver disease in the individual is treated. 449. The method of embodiment 447, further comprising administering to the individual a second expression suppressor comprising: a targeting moiety that binds to an anchor comprising a target gene (eg, MYC) An anchor sequence in a sequence-mediated adapter (ASMC); and an optional second effector moiety, such as an effector moiety described herein, such as KRAB; thereby treating the individual's liver disease. 450. A method of treating liver disease in an individual in need thereof, the method comprising: administering to the individual an expression inhibitor, system, nucleic acid, vector, lipid nanoparticle, or pharmaceutical composition of any one of embodiments 1-424 , thereby treating the liver disease in the individual. 451. The method of embodiment 450, wherein the liver disease is chronic liver disease. 452. The method of embodiment 450 or 451, wherein the liver disease is virus or alcohol related. 453. The method of any one of embodiments 450-452, wherein the liver disease is hepatitis or hepatocellular carcinoma. 454. The method of embodiment 453, wherein the hepatocellular carcinoma is selected from HCC subtype S1, HCC subtype S2, or HCC subtype S3. 455. The method of embodiment 453 or 454, wherein the hepatocellular carcinoma is HCC S1. 456. The method of embodiment 453 or 454, wherein the hepatocellular carcinoma is HCC S2. 457. The method of any one of embodiments 450-456, wherein the liver disease is caused by hepatitis B virus or hepatitis C virus. 458. A method of treating a lung disease in an individual in need thereof, the method comprising: administering to the individual an expression inhibitor, wherein the expression inhibitor comprises a targeting moiety that binds a MYC locus (e.g., a MYC transcribed region, MYC promoter, or an anchor sequence in an anchor sequence-mediated adapter (ASMC) comprising the MYC gene or a sequence close to the anchor sequence); and an effector portion optionally present, such as an effector as described herein part; thereby treating the lung disease in the subject. 459. The method of embodiment 458, further comprising administering to the individual a second expression suppressor comprising: a targeting moiety that binds to a hyperenhancer located at a target gene (eg, MYC) a gene body locus in a subregion; and optionally a second effector moiety, eg, an effector moiety described herein, eg, KRAB; thereby treating the lung disease in the individual. 460. A method of treating a lung disease in an individual in need thereof, the method comprising: administering to the individual an expression inhibitor, system, nucleic acid, vector, lipid nanoparticle, or pharmaceutical composition of any one of embodiments 1-424 , thereby treating the lung disease in the individual. 461. The method according to embodiment 459 or 460, wherein the lung disease is cancer, such as lung cancer, such as lung cancer, such as non-small cell lung cancer or small cell lung cancer. 462. The method of any one of embodiments 425-461, wherein contacting or administering comprises intravenously administering to a subject. 463. The method of any one of embodiments 425-462, wherein the contacting or administering comprises intratumoral delivery (eg, injection). 464. The method of any one of embodiments 425 to 463, wherein the cancer is characterized by increased MYC expression relative to a reference level (e.g. MYC expression relative to a reference cell, e.g. an otherwise similar non-cancerous cell in the individual) . 465. The method of any one of embodiments 426 to 464, wherein the cancer is characterized by a partial or complete duplication of the MYC gene. 466. The method of any one of embodiments 426 to 465, wherein the cancer is selected from colorectal cancer, breast cancer, AML, prostate cancer, neuroblastoma, lung cancer, endometrial cancer, liver cancer, lymphoma (such as primary Kitt lymphoma), cervical or gastric cancer. 467. The method of any one of embodiments 426 to 466, wherein the cancer is a human chorionic gonadotropin (hCG) secreting cancer. 468. The method of any one of embodiments 426-467, wherein the cancer is liver cancer. 469. The method of any one of embodiments 426 to 468, wherein the cancer is non-reactive cancer, such as non-reactive liver cancer. 470. The method of any one of embodiments 426-469, wherein the cancer is non-small cell lung cancer or small cell lung cancer. 471. The method of any one of embodiments 426 to 470, wherein the cancer overexpresses alpha-fetoprotein (AFP) (eg, relative to AFP expression of a reference cell, eg, an otherwise similar non-cancerous cell in the individual). 472. The method of any one of embodiments 431 to 471, wherein the cancer cells are characterized by the presence of a super-enhancer, for example comprising a MYC gene or comprising an anchor sequence-mediated adapter comprising a MYC gene, wherein optionally, The cancer is selected from liver cancer, colorectal cancer, breast cancer, AML, prostate cancer, neuroblastoma, lung cancer or endometrial cancer. 472. The method of embodiment 471, wherein the expression suppressor (e.g., a second expression suppressor) binds to an anchor sequence in an anchor sequence-mediated adapter (ASMC) comprising the MYC gene or binds close to the The sequence of the anchor sequence. 473. The method of any one of embodiments 426-472, wherein the cancer cells are characterized by the absence of a super-enhancer comprising the MYC gene or comprising an anchor sequence-mediated adapter comprising the MYC gene. 474. The method of embodiment 473, wherein the expression repressor (eg, the first expression repressor) binds to a MYC promoter. 475. The method of any one of embodiments 426-474, wherein the cancer comprises: a cell comprising a super-enhancer comprising a MYC gene or comprising an anchor sequence-mediated adapter comprising a MYC gene; and not A cell comprising a super-enhancer comprising a MYC gene or comprising an anchor sequence-mediated adapter comprising a MYC gene. 476. The method of any one of claims 426 to 475, wherein the cancer comprises an increase in MYC expression relative to a reference level (e.g. MYC expression relative to a reference cell, e.g. an otherwise similar non-cancerous cell in the individual) as Characterized cells, and cells not characterized (e.g., have normal MYC expression) by increased MYC expression relative to a reference level (e.g., MYC expression relative to a reference cell, e.g., an otherwise similar non-cancerous cell in the individual). 477. The method of any one of embodiments 426-476, wherein the expression inhibitor, system, nucleic acid, vector, lipid nanoparticle or pharmaceutical composition is administered as a monotherapy. 478. The method of any one of embodiments 426-477, comprising administering to the individual a plurality of doses of the expression inhibitor, system, nucleic acid, vector, lipid nanoparticle or pharmaceutical composition, for example at least 2, 3 , 4, 5 or 6 doses. 479. The method of any one of embodiments 426-479, comprising administering to the individual multiple doses of the expression inhibitor, system, nucleic acid, vector, lipid nanoparticle, or pharmaceutical composition at intervals of 5 days. 480. The method of any one of embodiments 426-479, comprising: a) first administering to the individual a first plurality of doses of an expression inhibitor described herein (e.g., any one of embodiments 1-424) or A system wherein, optionally, each subsequent dose of the first plurality of doses is administered 5 days after the previous dose of the first plurality of doses; b) secondly, administration of the expression inhibitor or system is discontinued for a period of time ("drug holiday"), such as about 2 weeks, and c) third, administering a second plurality of doses of the expression inhibitor or system to the individual, wherein, optionally, one prior to the second plurality of doses On day 5 following the dose, the last dose of the second plurality of doses is administered. 481. The method of embodiment 480, wherein the first plurality of doses comprises 4 doses. 482. The method of embodiment 479 or 480, wherein the second plurality of doses comprises 2 doses. 483. The method of any one of embodiments 480-482, wherein the individual receives no therapeutic agent at all during the drug holiday. 484. The method of any one of embodiments 480-483, wherein the individual receives the second therapeutic agent during the drug holiday. 485. The method of any one of embodiments 480-484, wherein the drug holiday is at least twice as long as the time between administration of doses of the first plurality of doses. 486. The method of any one of embodiments 480-486, wherein the drug holiday is at least twice the time between administrations of doses of the second plurality of doses. 487. The method of any one of embodiments 426-486, wherein following the expression inhibitor or systemic treatment, tumor volume is reduced to undetectable levels. 488. The method of any one of claims 426 to 487, after cessation of the expression inhibitor or systemic treatment, tumor volume is reduced (eg, to an undetectable level). 489. The method of any one of embodiments 425 to 488, wherein the cancer is not resistant to the expression suppressor or system, or the expression is suppressed over a period of 10, 20, 30, 40, 50 or 60 days The sub or system is not resistant. 490. The method of any one of embodiments 425-489, wherein the cancer cells have a functional apoptotic pathway. 491. The method of any one of embodiments 425-490, wherein the cancer cells have functional caspase 3. 492. The method of embodiment 491, wherein after the expression inhibitor or system is administered to the individual, caspase 3 in cancer cells is upregulated. 493. The method according to any one of embodiments 425 to 492, wherein after the expression inhibitor or system is administered to the individual, Ki67 in cancer cells is down-regulated. 494. The method of any one of embodiments 425-493, wherein after the expression inhibitor or system is administered to the subject, cancer cell proliferation is attenuated. 495. The method of any one of embodiments 425-494, wherein the method further comprises a. contacting the cell with a second therapeutic agent, or b. administering a second therapeutic agent to the individual. 496. The method of embodiment 495, wherein the second therapeutic agent is not an expression suppressor that binds to the MYC promoter. 497. The method of embodiment 495 or 496, wherein the second therapeutic agent is not an expression inhibitor, system, fusion protein, nucleic acid, vector, reaction mixture, pharmaceutical composition or lipid as in any one of embodiments 1-424 nanoparticles. 498. The method of any one of embodiments 494 to 496, wherein the second therapeutic agent is an expression inhibitor, system, fusion protein, nucleic acid, carrier, reaction mixture, pharmaceutical composition as in any one of embodiments 1 to 424 or lipid nanoparticles. 499. The method of any one of embodiments 495-497, wherein the second therapeutic agent is one or both of immunotherapy, immune checkpoint and anti-vascular endothelial growth factor therapy, systemic chemotherapy, tyrosine Kinase inhibitors (e.g. sorafenib), mitogen-activated protein kinase inhibitors (MEK inhibitors) (e.g. trametinib), or bromodomain inhibitors (e.g. BET inhibitors, e.g. JQ1, e.g. Coxib). 500. The method of any one of embodiments 495-499, wherein the second therapeutic agent is a tyrosine kinase inhibitor, such as sorafenib. 501. The method of any one of embodiments 495-499, wherein the second therapeutic agent is a bromodomain inhibitor, such as a BET inhibitor, such as JQ1, binacoxib or BET 672. 502. The method of any one of embodiments 495-499, wherein the second therapeutic agent is a mitogen-activated protein kinase kinase inhibitor (MEK inhibitor), such as trametinib. 503. The method of any one of embodiments 495-502, wherein the method further comprises administering to the individual another therapy. 504. The method of embodiment 504, wherein the other therapy comprises surgical resection of an orthotopic liver transplant, radiofrequency ablation, photodynamic therapy (PDT), laser therapy, brachytherapy, radiation therapy, transcatheter arterial chemoembolization, or radiation Embolization, or stereotactic radiation therapy. 505. The method of any one of embodiments 495-504, wherein the second therapeutic agent is selected from a checkpoint inhibitor or a small molecule. 506. The method of any one of embodiments 495 to 505, wherein the second therapeutic agent is a chemotherapeutic agent, such as a kinase inhibitor or a bromodomain inhibitor, such as a BET inhibitor. 507. The method according to embodiment 505 or 506, wherein the second therapeutic agent is selected from sorafenib, JQ1, BET672, benacoxib, or trametinib. 508. The method of any one of embodiments 495-506, wherein the expression inhibitor, system or nucleic acid is administered concurrently with the second therapeutic agent. 509. The method of any one of embodiments 495-508, wherein the expression inhibitor, system or nucleic acid and the second therapeutic agent are administered sequentially. 509. The method of any one of embodiments 503-509, wherein another therapy is administered concurrently. 511. The method of any one of embodiments 503-510, wherein the other therapy is administered sequentially. 512. The method of any one of embodiments 495-511, wherein the second therapeutic agent reacts with the expression inhibitor, system, nucleic acid, vector, lipid nanoparticle, pharmaceutical composition or reaction of any one of embodiments 1-424 The mixture is administered simultaneously. 513. The method of any one of embodiments 495-512, wherein the second therapeutic agent reacts with the expression inhibitor, system, nucleic acid, vector, lipid nanoparticle, pharmaceutical composition or reaction of any one of embodiments 1-424 The mixture is administered consecutively. 514. The method of any one of embodiments 495-513, wherein the expression inhibitor, system or nucleic acid is administered intravenously and the second therapy is administered orally. 515. The method of any preceding embodiment, wherein the cancer is a drug-resistant or refractory cancer. 516. The method of any preceding embodiment, wherein the cancer is resistant or refractory to a kinase inhibitor, such as a kinase inhibitor that inhibits one or more of VEGFR, PDGFR, or RAF kinases, such as sorafenib . 517. The method of any preceding embodiment, wherein the individual has amplified MYC super-enhancers. 518. A kit comprising: a container comprising a composition comprising an expression inhibitor, system, one or more nucleic acids encoding the system or expression inhibitor, a vector, A lipid nanoparticle, a reaction mixture, or a pharmaceutical composition; and a set of instructions comprising at least one method of using the composition to modulate (eg, reduce) MYC gene expression in cells.

Definitions A (A/an) , the (the) : As used herein, the singular forms "a" and "the" include plural referents unless the context clearly dictates otherwise.

Agent : As used herein, the term "agent" may be used to refer to any chemical class of compounds or entities including, for example, polypeptides, nucleic acids, sugars, lipids, small molecules, metals, or combinations or complexes thereof. As will be apparent to those skilled in the art from the context, in some embodiments, the term may be used to refer to an entity that is or comprises a cell or organism, or a portion, extract or component thereof. Alternatively or additionally, in some embodiments, the term may be used to refer to a natural product found in and/or obtained from nature, as those skilled in the art will appreciate from the context. In some embodiments, again as those skilled in the art will understand from the context, the term may be used to refer to one or more man-made entities that are designed, engineered, and/or produced by human manipulation and/or are found in nature Not found. In some embodiments, the agent may be used in isolated or pure form; in some embodiments, the agent may be used in crude form. In some embodiments, potential agents may be provided as a collection or library, eg, that may be screened to identify or characterize the active agents therein. In some embodiments, the term "agent" may refer to a compound or entity that is or comprises a polymer; in some embodiments, the term may refer to a compound or entity comprising one or more polymer moieties. In some embodiments, the term "agent" may refer to a compound or entity that is not a polymer and/or is substantially free of any polymer and/or is substantially free of one or more specific polymeric moieties. In some embodiments, the term may refer to a compound or entity that lacks or is substantially free of any polymeric moieties.

Anchor sequence : As used herein, the term "anchor sequence" refers to a nucleic acid sequence that is recognized by a nucleating agent that binds sufficiently to form an anchor sequence-mediated adapter, eg, a complex. In some embodiments, the anchor sequence comprises one or more CTCF binding motifs. In some embodiments, the anchor sequence is not located within the coding region of the gene. In some embodiments, the anchor sequence is located within an intergenic region. In some embodiments, the anchor sequence is not located within an enhancer or promoter. In some embodiments, the anchor sequence is located at least 400 bp, at least 450 bp, at least 500 bp, at least 550 bp, at least 600 bp, at least 650 bp, at least 700 bp, at least 750 bp, at least 800 bp from any transcription start , at least 850 bp, at least 900 bp, at least 950 bp, or at least 1 kb. In some embodiments, the anchor sequence is located within a region that is not associated with gene body imprinting, single allele expression, and/or single allele epigenetic marks. In some embodiments, the anchor sequence has one or more functions selected from binding an endogenous nucleating polypeptide (eg, CTCF), interacting with a second anchor sequence to form an anchor sequence-mediated adapter, or Sequesters anchor sequence-mediated enhancers outside of the adapter. In some embodiments of the invention, there are provided binding motifs that can specifically target one or more specific anchor sequences but not other anchor sequences (for example, in different contexts may contain nucleating agents such as CTCF). sequences); such targeted anchor sequences may be referred to as "target anchor sequences". In some embodiments, modulation of the sequence and/or activity of a target anchor sequence without modulation may be present in the same system as the target anchor sequence (e.g., in the same cell and/or in some embodiments, The sequence and/or activity of one or more other anchor sequences present on the same nucleic acid molecule (eg, the same chromosome). In some embodiments, the anchor sequence comprises or is a nucleating polypeptide binding motif. In some embodiments, the anchor sequence is adjacent to the nucleating polypeptide binding motif.

Anchor sequence-mediated adapters : As used herein, the term "anchor sequence-mediated adapters" refers to DNA structures, and in some cases complexes, which are linked via one or more polypeptides (such as nucleating polypeptides) or one or more proteins and/or nucleic acid entities (such as RNA or DNA) to the physical interaction or combination of at least two anchor sequences in DNA to exist and/or maintain, the one or more polypeptides or one or more proteins and and/or nucleic acid entities bind anchor sequences to enable spatial proximity and functional association between the anchor sequences (see eg Figure 1).

Related : As the term is used herein, two events or entities are "related" to each other if the existence, level, form and/or function of one is related to the other. For example, in some embodiments, if the presence, level, form and/or function of a particular entity (e.g., polypeptide, genetic marker, metabolite, microorganism, etc.) is associated with the incidence and/or A susceptibility to a disease, disorder or condition is associated (eg, across a related population) then the particular entity is considered to be associated with the disease, disorder or condition. In some embodiments, two or more entities are physically "associated" with each other if they interact, directly or indirectly, such that they are in and/or remain in physical proximity to each other. In some embodiments, two or more entities that are physically associated with each other are covalently linked to each other; in some embodiments, two or more entities that are physically associated with each other are not covalently linked to each other , while being associated in a non-covalent manner, such as by means of hydrogen bonding, van der Waals interactions, hydrophobic interactions, magnetic forces, and combinations thereof. In some embodiments, when the nucleic acid is at least partially within a target gene body or transcription complex and the formation or disruption of the target gene body or transcription complex has an effect on the expression of the gene in the DNA sequence, the DNA sequence and the target The target gene body or transcription complex is "associated".

Domain : As used herein, the term "domain" means a segment or portion of an entity. In some embodiments, a "domain" relates to specific structural and/or functional characteristics of an entity such that when a domain is physically separated from the rest of its parent entity, it substantially or completely retains the specific structural and/or functional characteristics. or functional characteristics. Alternatively or additionally, in some embodiments, a domain may be or comprise a portion of an entity which, when separated from the (parent) entity and connected to a different (recipient) entity, substantially retains and/or confers acceptance One or more structural and/or functional characteristics of the parent entity that characterize it in the parent entity. In some embodiments, a domain is or comprises a segment or portion of a molecule (eg, small molecule, carbohydrate, lipid, nucleic acid, polypeptide, etc.). In some embodiments, a domain is or comprises a stretch of a polypeptide. In some such embodiments, the domains are characterized by specific structural elements (e.g., specific amino acid sequences or sequence motifs, alpha-helical features, beta-sheet features, coiled-coil features, random helical features, etc.), and/or Or specific functional characteristics (eg, binding activity, enzymatic activity, folding activity, signaling activity, etc.).

Effector portion : As used herein, the term “effector portion” refers to a domain that, when localized at the appropriate site in the nucleus, is capable of altering the expression of a target gene. In some embodiments, the effector moiety recruits components of the transcription machinery. In some embodiments, the effector moiety inhibits the recruitment of components of transcription factors or expression repressors. In some embodiments, the effector moiety comprises an epigenetic modification moiety (eg, epigenetically modifies a target DNA sequence).

Epigenetic modification moiety : As used herein, "epigenetic modification moiety" refers to a domain that, when an epigenetic modification moiety is properly positioned on a nucleic acid (eg, by a targeting moiety), alters: i) the domain of chromatin structure, such as two-dimensional structure; and/or ii) epigenetic marks (such as DNA methylation, histone methylation, histone acetylation, histone microubiquitination, histone phosphorylation, and RNA one or more of the associated silences). In some embodiments, the epigenetic modification moiety comprises an enzyme or functional fragment or variant thereof that affects (eg, increases or decreases the level of) one or more epigenetic markers. In some embodiments, the epigenetic modification moiety comprises a DNA methyltransferase, a histone methyltransferase, a CREB binding protein (CBP), or a functional fragment of any thereof.

Expression control sequence : As used herein, the term "expression control sequence" refers to a nucleic acid sequence that increases or decreases transcription of a gene and includes, but is not limited to, promoters and enhancers. "Enhancer sequence" refers to a subtype of expression control sequence and increases the likelihood of gene transcription. A "silencing or suppressor sequence" refers to a subtype of a sequence that expresses a control sequence and reduces the likelihood of gene transcription.

Expression suppressor: As used herein, the term "expression suppressor" refers to an agent or entity having one or more functions that reduces the expression of a target gene in a cell and that specifically binds to a DNA sequence (e.g., with a target gene or operably DNA sequences associated with transcriptional control elements linked to target genes). Expression suppressors comprise at least one targeting moiety and optionally an effector moiety.

Expression suppression system : As used herein, the term "expression suppression system" refers to a plurality of expression suppressors that reduce the expression of a target gene in a cell. In some embodiments, the expression suppression system comprises a first expression inhibitor and a second expression inhibitor, wherein the first expression inhibitor and the second expression inhibitor (or nucleic acids encoding the first expression inhibitor and the second expression inhibitor ) are present together in a single composition, mixture or pharmaceutical composition. In some embodiments, the expression suppression system comprises a first expression inhibitor and a second expression inhibitor, wherein the first expression inhibitor and the second expression inhibitor (or nucleic acids encoding the first expression inhibitor and the second expression inhibitor ) is present in the respective composition or pharmaceutical composition. In some embodiments, the first suppressor of expression is present in the same cell as the second suppressor of expression. In some embodiments, the first suppressor of expression and the second suppressor of expression are not present in the same cell at the same time, eg, they are present sequentially. For example, a first expressed suppressor can be present in the cell for a first period of time, and then a second expressed suppressor can be present in the cell for a second period of time, wherein the first and second periods of time may or may not overlap.

Fusion molecule : As used herein, the term "fusion molecule" refers to a compound comprising two or more moieties covalently linked, eg, a targeting moiety and an effector moiety. Fusion molecules and portions thereof can comprise polypeptides, nucleic acids, glycans, small molecules, or any combination of other components described herein (eg, targeting moieties can comprise nucleic acids and effector moieties can comprise polypeptides). In some embodiments, fusion molecules are fusion proteins, eg, comprising one or more polypeptide domains covalently linked via peptide bonds. In some embodiments, the fusion molecule is a conjugate molecule comprising a targeting moiety and an effector moiety linked by a covalent bond other than a peptide bond or a phosphodiester bond (e.g., a targeting moiety comprising a nucleic acid and a targeting moiety comprising The effector moieties of the polypeptides are linked by covalent bonds other than peptide bonds or phosphodiester bonds). In some embodiments, the expression inhibitor is or comprises a fusion molecule.

Genome complex : As used herein, the term "genome complex" is a complex that makes one or more The combination of two gene body sequence elements spaced apart from each other on a chromosome. In some embodiments, the gene body sequence element is an anchor sequence to which one or more protein components of the complex bind. In some embodiments, a gene body complex may comprise an anchor sequence-mediated adapter. In some embodiments, a gene body sequence element can be or comprise a CTCF binding motif, a promoter and/or an enhancer. In some embodiments, genomic sequence elements include at least one or both of a promoter and/or regulatory sites (eg, enhancers). In some embodiments, complex formation nucleates at the genome sequence element and/or is nucleated by binding of one or more protein components to the genome sequence element. As will be appreciated by those skilled in the art, in some embodiments, colocalization (e.g., conjugation) of gene body loci via complex formation causes DNA topology at or near sequence elements of the gene body (in some embodiments, , including the DNA topology in between) changes. In some embodiments, the gene body complex comprises an anchor sequence-mediated adapter comprising one or more loops. In some embodiments, a gene body complex as described herein is nucleated by a nucleating polypeptide such as CTCF and/or cohesin. In some embodiments, a gene body complex as described herein may include, for example, one or more of: CTCF, cohesin, non-coding RNA (e.g., eRNA), transcription machinery proteins (e.g., RNA polymerase, one or Various transcription factors, e.g. selected from the group consisting of: TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, etc.), transcriptional regulatory factors (e.g., mediators, P300s, enhancer binding proteins, repressor binding proteins, histone modifiers etc. In some embodiments, a gene body complex as described herein includes one or more polypeptide components and/or one or more nucleic acid components (e.g., one or more RNA components), which, in some embodiments, can interact with each other Interact and/or interact with one or more genome sequence elements (e.g., anchor sequences, promoter sequences, regulatory sequences (e.g., enhancer sequences)) in order to constrain a section of genome DNA into a topological configuration (e.g., ring), which does not assume a topological configuration when not forming a complex.

Moiety : As used herein, the term "moiety" refers to a defined chemical group or entity that has a specific structure and/or activity as described herein.

Modulator : As used herein, the term "modulator" refers to an agent comprising one or more targeting moieties and one or more effector moieties, which is capable of altering (eg enhancing or decreasing) the expression of a target gene (eg MYC).

MYC : As used herein, the term "MYC locus" refers to a portion of the human genome that encodes a MYC polypeptide (such as the polypeptide disclosed in NCBI Accession No. NP002458.2, or a mutant thereof), operably linked to the MYC promoter ("MYC promoter"), and an anchor sequence that forms ASMCs comprising the MYC gene. In some embodiments, the MYC locus encodes a nucleic acid having NCBI Accession No. NM-002467. In some embodiments, the MYC gene is a proto-oncogene, and in some embodiments, the MYC gene is an oncogene. In certain instances, the MYC gene is found on chromosome 8 at 8q24.21. In certain instances, the MYC gene begins at 128,816,862 bp from the end of the short arm and ends at 128,822,856 bp from the end of the short arm. In certain instances, the MYC gene is about 6 kb. In certain instances, the MYC gene encodes at least eight distinct mRNA sequences: 5 alternate splice variants and 3 non-splice variants.

Nucleic acid : As used herein, the term "nucleic acid" in its broadest sense refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, nucleic acids are compounds and/or substances that are incorporated or can be incorporated into oligonucleotide chains via phosphodiester linkages. As will be understood from the context, in some embodiments, " nucleic acid " refers to individual nucleic acid residues (e.g., nucleotides and /or nucleosides); oligonucleotide chain. In some embodiments, a " nucleic acid " is or comprises RNA; in some embodiments, a " nucleic acid " is or comprises DNA. In some embodiments, the nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, the nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, nucleic acid analogs differ from nucleic acids in that they do not utilize a phosphodiester backbone. For example, in some embodiments, the nucleic acid is, comprises, or consists of one or more " peptide nucleic acids " known in the art and having peptide bonds in the backbone instead of phosphodiester bonds, both of which are referred to as deemed to be within the scope of the present invention. Alternatively or additionally, in some embodiments, the nucleic acid has one or more phosphorothioate linkages and/or 5'-N-aminophosphite linkages instead of phosphodiester linkages. In some embodiments, the nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) composition. In some embodiments, the nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5- Methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxo base adenosine, 8-side oxyguanosine, 0(6)-methylguanine, 2-thiacytidine, methylated base, inserted base and combinations thereof). In some embodiments, the nucleic acid comprises one or more modified sugars (eg, 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to the sugars in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from natural sources, enzymatic synthesis (in vivo or in vitro) by polymerization based on complementary templates, replication in recombinant cells or systems, and chemical synthesis. synthesis. In some embodiments, the nucleic acid has at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 ,80,85,90,95,100,110,120,130,140,150,160,170,180,190,20,225,250,275,300,325,350,375,400,425,450 , 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues in length. In some embodiments, the nucleic acid is partially or fully single-stranded; in some embodiments, the nucleic acid is partially or fully double-stranded. In some embodiments, a nucleic acid has a nucleotide sequence comprising at least one element that encodes a polypeptide or is the complement of a sequence encoding a polypeptide. In some embodiments, the nucleic acid has enzymatic activity.

Nucleating Polypeptide : As used herein, the term "nucleating polypeptide" or, as used herein, "adaptor nucleating polypeptide" refers to a polypeptide that associates directly or indirectly with an anchor sequence and can nucleate with one or more adapters. Proteins that interact with polypeptides (may interact with anchor sequences or other nucleic acids) to form dimers (or higher ordered structures) comprising such adapter nucleating polypeptides that may or may not be identical to each other . When adapter nucleating polypeptides associated with different anchor sequences associate with each other such that the different anchor sequences are maintained in physical proximity to each other, the resulting structure is an anchor sequence-mediated adapter. That is, one nucleating polypeptide-anchor sequence interacts with another nucleating polypeptide-anchor sequence in close physical proximity, resulting in an anchor sequence-mediated adapter that begins and ends at the anchor sequence (e.g. In some cases, DNA circles). Those skilled in the art will immediately understand upon reading this specification that terms such as "nucleating polypeptide", "nucleating molecule", "nucleating protein", "conjugate nucleating protein" and the like are sometimes used to refer to conjugate nucleating polypeptides . Those skilled in the art will similarly immediately understand upon reading this specification that a composite collection of two or more adapter-nucleating polypeptides (which in some embodiments may include multiple copies of the same agent and/or in some In embodiments, one or more or each of the plurality of different agents may be referred to as a "complex", "dimer", "multimer" and the like.

Operably linked : As used herein, the phrase "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A transcriptional control element " operably linked " to a functional element (eg, a gene) is associated in such a way that expression and/or activity of the functional element (eg, gene) is achieved under conditions compatible with the transcriptional control element. In some embodiments, an " operably linked " transcriptional control element is adjacent (eg, covalently linked) to a coding element of interest (eg, a gene); in some embodiments, an operably linked transcriptional control element is relative to A functional element of interest (eg, a gene) functions in trans or otherwise at a distance from it. In some embodiments, operably linked means comprising two nucleic acid sequences on the same nucleic acid molecule. In another embodiment, operably linked may further mean that two nucleic acid sequences are in proximity to each other on the same nucleic acid molecule, for example within 1000, 500, 100, 50 or 10 base pairs of each other or directly adjacent to each other.

Peptide, polypeptide, protein : As used herein, the terms "peptide", "polypeptide" and "protein" refer to a compound comprising amino acid residues covalently linked by peptide bonds or by means other than peptide bonds . A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can make up a protein or peptide sequence. Polypeptides include any peptide or protein comprising two or more amino acids linked to each other by peptide bonds or by means other than peptide bonds. As used herein, the term refers to short chains (which are also commonly referred to in the art as, for example, peptides, oligopeptides, and oligomers) and long chains (which are commonly referred to in the art as proteins, which exist in various types ).

Pharmaceutical composition : As used herein, the term "pharmaceutical composition" refers to an active agent (eg, modulator, eg, disruptor) formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in the therapeutic regimen in an amount suitable for administration in a unit dosage that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those forms adapted for oral administration, such as drenches (aqueous or non-aqueous solutions or suspensions), lozenges ( e.g. lozenges for buccal, sublingual and systemic absorption), boluses, powders, granules, pastes for tongue application; parenteral administration, e.g. subcutaneous, intramuscular, intravenous or epidural injection, For example, as a sterile solution or suspension, or a sustained-release formulation; topical application, for example, to the skin, lungs or mouth in the form of a cream, ointment, or controlled-release patch or spray; intravaginal or rectal administration, for example, to the uterus In the form of pads, creams, or foams; sublingually; ocularly; transdermally; or on nasal, pulmonary, and/or other mucosal surfaces.

Proximity : As used herein, "proximity" refers to the proximity of two sites (e.g., nucleic acid sites) such that binding of an expression inhibitor at the first site and/or modification of the first site by the expression inhibitor has no effect on the other. Combining and/or modifying at one site will produce the same or substantially the same effect. For example, a targeting moiety can bind to a first site proximate to an enhancer (second site), and an effector moiety associated with the targeting moiety can epigenetically modify the first site so as to regulate The effect of the enhancer on the expression of the target gene is thus substantially the same as the second site (enhancer sequence) that has been incorporated and/or modified. In some embodiments, the target gene is located in close proximity to a target gene (such as an exon, an intron, or a splice site within a target gene), close to a transcriptional control element operably linked to a target gene (such as MYC), or close to a The location of the anchor sequence is less than 5000, 4000, 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, or 25 base pairs (and, optionally, distance from the target gene (e.g., exons, introns, or splice sites within the target gene) , transcriptional control elements or anchor sequences of at least 20, 25, 50, 100, 200 or 300 base pairs).

Specificity: Those skilled in the art will understand that, as used herein, the term "specificity" when referring to an active agent means that the agent differentiates between potential target entities or states. For example, in some embodiments, an agent is said to "specifically" bind to a target if it binds preferentially to its target in the presence of one or more competing alternative targets. In some embodiments, specific interactions depend on the presence of specific structural features (eg, epitopes, clefts, binding sites) of the target entity. It will be appreciated that specificity need not be absolute. In some embodiments, specificity can be assessed as the specificity of a binding agent for one or more other potential target entities (eg, competitors). In some embodiments, specificity is assessed as a reference to the specificity of a specific binding agent. In some embodiments, specificity is assessed as a reference to the specificity of a non-specific binding agent. In some embodiments, the agent or entity does not detectably bind to a competing surrogate target under conditions that bind to its target entity. In some embodiments, a binding agent binds to its target entity with a higher on-rate, lower off-rate, increased affinity, decreased dissociation, and/or increased stability compared to a competing surrogate target.

Specific binding : As used herein, the term "specific binding" refers to the ability to distinguish between possible binding partners in the context in which binding occurs. In some embodiments, a binding agent that interacts with one particular target in the presence of other potential targets is said to " specifically bind " to the target with which it interacts. In some embodiments, specific binding is assessed by detecting or measuring the degree of association between the binding agent and its partner; in some embodiments, by detecting or measuring the dissociation of the binding agent-partner complex. to assess specific binding. In some embodiments, specific binding is assessed by detecting or determining the ability of a binding agent to compete with an alternative interaction between its partner and another entity. In some embodiments, specific binding is assessed by performing such detection or determination over a range of concentrations.

Substantially : As used herein, the term "substantially" refers to the qualitative condition of exhibiting the total or nearly total degree or level of the characteristic or characteristic of interest. Those of ordinary skill will appreciate that biological and chemical phenomena seldom, if ever, proceed to completion and/or proceed to completion or rarely achieve or avoid an absolute result. Thus, the term "substantially" may be used in some embodiments herein to capture a potential lack of integrity inherent in a variety of biological and chemical phenomena.

Reduction of symptoms : As used herein, the phrase "reduction of symptoms" may be used when the magnitude (eg, intensity, severity, etc.) and/or frequency of one or more symptoms of a particular disease, disorder, or condition is reduced. In some embodiments, a delay in the onset of a particular symptom is considered a form of decreased frequency of symptoms.

Target : An agent or entity is considered to "target" another agent or entity according to the present invention if it specifically binds to the targeting agent or entity under conditions where they are in contact with each other. In some embodiments, for example, an antibody (or antigen-binding fragment thereof) targets its cognate epitope or antigen. In some embodiments, a nucleic acid having a specific sequence targets a nucleic acid that is substantially complementary to the sequence.

Target gene : As used herein, the term "target gene" means a gene that is targeted for regulation (eg, modulation of expression). In some embodiments, the target gene is part of a target gene body complex (e.g., a gene whose gene body sequence is part of a target gene body complex, e.g., within an anchor sequence-mediated adapter ), one or more modulators as described herein target the gene body complex. In some embodiments, modulating comprises suppressing expression of a target gene. In some embodiments, the target gene is regulated by contacting the target gene, or a transcriptional control element operably linked to the target gene, with an expression repression system described herein (eg, an expression repressor). In some embodiments, the target gene is aberrantly expressed (eg, overexpressed) in a cell, such as a cell of an individual (eg, a patient).

Targeting moiety : As used herein, the term "targeting moiety" means an agent or entity that specifically targets (eg, binds to) a gene body sequence element (eg, an expression control sequence or an anchor sequence). In some embodiments, the gene body sequence element is in proximity to and/or is operably linked to a target gene (eg, MYC).

Therapeutic agent : As used herein, the phrase "therapeutic agent" refers to an agent that, when administered to a subject, has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect. In some embodiments, a therapeutic agent is one that is useful in alleviating, ameliorating, alleviating, inhibiting, preventing, delaying the onset of, reducing the severity of, and/or reducing one or more symptoms or characteristics of a disease, disorder, and/or condition. incidence of any substance. In some embodiments, the therapeutic agent comprises an expression inhibition system described herein, eg, an expression inhibitor. In some embodiments, a therapeutic agent comprises a nucleic acid encoding an expression suppression system (eg, an expression inhibitor) described herein. In some embodiments, the therapeutic agent comprises a pharmaceutical composition described herein.

Therapeutically effective amount : As used herein, the term "therapeutically effective amount" means an amount of a substance (eg, a therapeutic agent, composition and/or formulation) that elicits a desired biological response when administered as part of a treatment regimen. In some embodiments, a therapeutically effective amount of a substance is sufficient to treat, diagnose, prevent the disease, disorder and/or condition and/or when administered to an individual suffering from or susceptible to a disease, disorder and/or condition Amount to delay its onset. As will be appreciated by those of ordinary skill in the art, effective amounts of a substance may vary depending on factors such as the desired biological endpoint, the substance to be delivered, the target cell or tissue, and the like. For example, in some embodiments, the effective amount of the compound in the formulation to treat the disease, disorder and/or condition is to relieve, ameliorate, alleviate, inhibit, prevent the disease, disorder and/or condition, delay its onset, An amount that reduces its severity and/or reduces the incidence of one or more symptoms or characteristics thereof. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

CROSS REFERENCE TO RELATED APPLICATIONS This application claims U.S. Provisional Application 63/212,991 filed June 21, 2021, U.S. Provisional Application 63/281,022 filed November 18, 2021, and U.S. Provisional Application 63/281,022 filed December 15, 2021. Priority to Patent Cooperation Treaty Application PCT/US21/10059, the entire contents of which are incorporated herein by reference.

SEQUENCE LISTING This application contains a Sequence Listing, which has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety. This ASCII copy created on December 6, 2021 is named O2057-7029WO_SL.txt and is 624,274 bytes in size.

The present invention provides techniques for modulating (eg, reducing) the expression of a target gene (eg, MYC) in a cell (eg, a cell in an individual or patient) through the use of the expression suppressors or systems described herein.

Dysregulation of gene expression can lead to a variety of diseases and syndromes, including cancer, autoimmunity, cardiovascular disease and obesity. In particular, overexpression of transcription factors has long been known to contribute to tumorigenesis, and recent studies have shown that overexpression of oncogenic transcription factors can alter core autoregulatory circuits of the cell.

The transcription factor and master cellular regulator MYC is frequently dysregulated in more than 50% of human cancers and plays a central role in nearly every aspect of the tumorigenic process. In addition to early response genes, MYC typically upregulates gene expression. MYC is the most frequently amplified oncogene, and elevated expression of its gene product correlates with tumor aggressiveness and adverse clinical outcome. Elevated levels of c-MYC promote tumorigenesis in a variety of tissues. The growth and proliferation of most tumor cells depend on the transcription factor c-MYC. MYC overexpression is also associated with chronic liver diseases, such as viral and alcohol-related liver diseases. The amount of MYC overexpression varies across specific cancer subtypes. Without wishing to be bound by theory, modulating (eg, reducing) MYC levels in an individual (eg, an entire individual, or a specific target tissue or tissues) suffering from a MYC dysregulated disorder is believed to reduce or eliminate symptoms of the MYC dysregulated disorder.

The present invention provides, in part, an expression suppressor comprising: a targeting moiety that binds to a target gene promoter (such as the MYC promoter or is operably linked to a target gene, such as the MYC gene), and when positioned by the targeting moiety is an effector moiety capable of modulating (eg, reducing) the expression of a target gene (eg, MYC). In some embodiments, an expression suppressor disclosed herein specifically binds to an expression control element (e.g., a promoter or enhancer, repressor, or silencer) operably linked to a target gene (e.g., MYC) via a targeting moiety , and the effector moiety regulates the expression of target genes such as MYC. In some embodiments, the expression suppressor disclosed herein specifically binds to or binds to an anchor sequence in an anchor sequence-mediated adapter (ASMC) comprising a target gene (eg, MYC) via a targeting moiety. Proximate sequences, and effector moieties regulate the expression of target genes such as MYC. In some embodiments, an expression suppressor disclosed herein specifically binds to a gene body locus located in a super-enhancer region of a target gene (eg, MYC), and the effector moiety modulates expression of the target gene (eg, MYC).

The invention additionally provides in part an expression inhibition system comprising two or more expression inhibitors each comprising a targeting moiety and optionally an effector moiety. In some embodiments, the targeting moiety targets two or more different sequences (eg, each expression inhibitor can target a different sequence). In some embodiments, the first expression repressor binds to a translational regulatory element (e.g., a promoter or transcription start (TSS)) operably linked to a target gene (e.g., MYC), and the second expression repressor binds to a gene comprising the target Anchor sequence in the anchor sequence-mediated adapter complex (ASMC) of a gene such as MYC. In some embodiments, the first expression repressor binds to a translational regulatory element (e.g., a promoter or transcription start (TSS)) operably linked to a target gene (e.g., MYC), and the second expression repressor binds to an operably linked Expression control elements (such as enhancers, super-enhancers, suppressors, or silencers) that are positively linked to target genes (such as MYC). In some embodiments, a first expression suppressor binds to an anchor sequence in an anchor sequence-mediated adapter (ASMC) comprising a target gene (e.g., MYC), and a second expression suppressor binds to an operably linked Expression control elements (eg, enhancers, super-enhancers, suppressors, or silencers) to target genes. In general, modulation of expression of a target gene (eg, MYC) by an expression repression system involves binding a first expression repressor and a second expression repressor to first and second DNA sequences, respectively. The combination of the first and second DNA sequences localizes the function of the first and second effector moieties to those sites. Without wishing to be bound by theory, in some embodiments, the function of the first and second repressor moieties is utilized to stably inhibit a gene linked to or comprising the first and/or second DNA sequence. Expression of a target gene, eg, wherein the first and/or second DNA sequence is or comprises the sequence of the target gene or one or more operably linked transcriptional control elements. In some embodiments, the expression suppression system is encoded by a bicistronic nucleic acid sequence.

The present invention further provides nucleic acids encoding the expression inhibitors and/or expression inhibitor systems, compositions comprising the expression inhibitors and/or expression inhibitor systems, and methods of delivering the nucleic acids. Further provided are methods of enhancing expression of a target gene (eg, MYC gene expression) in a cell using the expression suppressors or expression suppression systems described herein.

Expression Suppressors As described herein, the present invention provides, in part, expression suppressors for modulating (e.g., reducing) the expression of a target gene (e.g., MYC). In some embodiments, an expression suppressor may comprise a targeting moiety that binds to a target gene promoter (eg, the MYC promoter) and optionally an effector moiety. In some embodiments, the targeting moiety specifically binds to a target DNA sequence, such as a MYC DNA sequence, thereby localizing the expression suppressor function to the DNA sequence. In some embodiments, the expression suppressor comprises a targeting moiety and an effector moiety. In some embodiments, the expression inhibitor comprises a targeting moiety and a plurality of effector moieties (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20 or more effector domains (and optionally, fewer than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 or 2 effector fields)).

An expression suppressor may comprise a plurality of effector moieties, wherein each effector moiety comprises a different function than the other effector moieties. For example, an expression repressor can comprise two effector moieties, wherein a first effector moiety comprises a DNA methylase function and a second effector moiety comprises a transcription repressor function. In some embodiments, the expression suppressor comprises effector moieties that have functions that are complementary to each other in reducing expression of a target gene (e.g., MYC), wherein the functions together are capable of inhibiting expression and optionally do not inhibit expression or when present individually Inhibition of performance is negligible. In some embodiments, the expression suppressor comprises a plurality of effector moieties, wherein each effector moiety is complementary to each other effector moiety, each effector moiety reduces expression of a target gene (eg, MYC).

In some embodiments, the expression suppressor comprises a combination of effector moieties that function synergistically with each other in reducing the expression of a target gene (eg, MYC). Without wishing to be bound by theory, in some embodiments, epigenetic modifications to gene body loci accumulate as multiple individual transcriptional activation epigenetic markers (e.g., multiple different types of epigenetic markers and/or A wider range of markers of a given type) together are more effective in suppressing a representation than the individual modifications alone (eg, a greater reduction in the representation and/or a longer-lasting reduction in the representation). In some embodiments, the expression suppressor comprises a plurality of effector moieties, wherein each effector moiety is complementary to each other effector moiety, eg, each effector moiety reduces expression of a target gene (eg, MYC). In some embodiments, an expression suppressor comprising a plurality of effector moieties that act synergistically with each other is more effective at inhibiting expression of a target gene (eg, MYC) than an expression suppressor comprising individual effector moieties. In some embodiments, an expression suppressor comprising the plurality of effector moieties is at least 1.05x (i.e., 1.05-fold) less effective at reducing expression of a target gene (e.g., MYC) than an expression suppressor comprising individual effector moieties. 1.1x, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.55x, 1.6x, 1.65x, 1.7x, 1.75x, 1.8x, 1.85x, 1.9x , 1.95x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, or 100x.

In some embodiments, the expression suppressor comprises one or more targeting moieties, such as a Cas domain, a TAL effector domain, or a Zn finger domain. In one embodiment, when the expression inhibition system comprises two or more targeting moieties of the same type (eg, two or more Cas domains), the targeting moieties specifically bind two or more different sequence. For example, in an expression suppression system comprising two or more Cas domains, two or more Cas domains can be selected or altered such that they only significantly bind gRNAs corresponding to their target sequences (e.g., corresponding to Binding to the target of another Cas domain was not evident).

In some embodiments, an expression inhibitor comprises a targeting moiety and an effector moiety covalently linked (eg, by a peptide bond). In some embodiments, the targeting moiety and the effector moiety are on the same polypeptide chain, eg, linked by one or more peptide bonds and/or a linker. In some embodiments, the expression inhibitor is or comprises a fusion molecule, for example comprising a targeting moiety and an effector moiety linked by a peptide bond and/or a linker. In some embodiments, the expression inhibitor comprises a targeting moiety disposed N-terminal to the effector moiety on the same polypeptide chain. In some embodiments, the expression inhibitor comprises a targeting moiety disposed C-terminal to the effector moiety on the same polypeptide chain. In some embodiments, the expression inhibitor comprises a targeting moiety and an effector moiety covalently linked by a non-peptide bond. In some embodiments, targeting moieties and effector moieties are coupled via non-peptide bonds. In some embodiments, the expression inhibitor comprises a targeting moiety and a plurality of effector moieties, wherein the targeting moiety is covalently linked to the plurality of effector moieties, such as by peptide bonds (eg, the targeting moiety is covalently linked to the plurality of effector moieties). The moieties are all linked by a series of covalent bonds, but each individual moiety may not share a covalent bond with every other effector moiety).

In other embodiments, the expression inhibitor comprises a targeting moiety and an effector moiety that are non-covalently linked (eg, non-covalently bound to each other). In some embodiments, the expression inhibitor comprises a targeting moiety non-covalently bound to the effector moiety or vice versa. In some embodiments, the expression inhibitor comprises a targeting moiety and a plurality of effector moieties, wherein the targeting moiety is non-covalently linked to at least one effector moiety, such as to each other, and wherein the targeting moiety is non-covalently linked to at least one other The effector moiety is covalently linked, eg, by a peptide bond.

In general, an expression suppressor as described herein binds (eg, via a targeting moiety) to a gene body sequence element in close proximity to and/or operably linked to a target gene (eg, MYC). In some embodiments, binding of a gene body sequence element by an expression suppressor modulates (eg, reduces) expression of a target gene (eg, MYC). For example, binding of an expression suppressor comprising an effector moiety that recruits or inhibits the recruitment of a component of the transcriptional machinery to a gene body sequence element can modulate (eg, decrease) the expression of a target gene (eg, MYC). As another example, the incorporation of an expression suppressor comprising an effector moiety having enzymatic activity (eg, an epigenetic modification moiety) can modulate (eg, decrease) the expression of a target gene (eg, MYC) via localization of the enzymatic activity of the effector moiety. As another example, binding of an expression repressor to a gene body sequence element and localization of the enzymatic activity of the expression repressor can contribute to the resulting modulation (eg, reduction) in the expression of a target gene (eg, MYC).

In some embodiments, the expression suppressor comprises an effector portion, wherein the effector portion comprises a protein selected from the group consisting of MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (ie, LSD1), KDM1B (ie, LSD2 ), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (ie, G9A), EHMT1 (ie, GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KRAB (eg KRAB domain), MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 or functional variants or fragments thereof.

In some embodiments, the expression suppressor comprises a first effector moiety and a second effector moiety, wherein the first effector moiety comprises a protein selected from the group consisting of: MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5 , DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (i.e., LSD1), KDM1B (ie, LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (ie, G9A), EHMT1 (ie, GLP), SUV39H1, EZH2 , EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KRAB (e.g. KRAB domain), MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 or a functional variant or fragment thereof, and the second effector moiety comprises a different protein selected from: MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (aka LSD1), KDM1B (aka LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 ( i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KRAB (eg, KRAB domain), MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or functional variants thereof body or fragment.

In some embodiments, the present invention provides nucleic acid sequences encoding expression inhibitors, expression inhibition systems, targeting moieties and/or effector moieties as described herein. The nucleic acid sequence of RNA is known to those skilled in the art to be identical to the corresponding DNA sequence, but in which thymine (T) is typically replaced by uracil (U). It should be understood that when a nucleotide sequence is represented by a DNA sequence (such as comprising, A, T, G, C), the present invention also provides a corresponding RNA sequence (such as comprising A, U, G, C), wherein "U" Replace "T". Conventional symbols are used herein to describe polynucleotide sequences: the left end of a single-stranded polynucleotide sequence is the 5' end; the left direction of a double-stranded polynucleotide sequence is referred to as the 5' direction.

Those skilled in the art will appreciate that due to the degeneracy of the genetic code, a variety of nucleotide sequences encoding expression inhibitors comprising targeting moieties and/or effector moieties as described herein can be generated, some of which are similar to those disclosed herein. The nucleic acid sequences have similarity, such as 90%, 95%, 96%, 97%, 98% or 99% identity. For example, the codons AGA, AGG, CGA, CGC, CGG, and CGU all encode the amino acid arginine. Thus, at each position in the nucleic acid molecules of the invention, where arginine is specified by a codon, the codon can be changed to any of the corresponding codons described above without altering the encoded polypeptide.

In some embodiments, the cohesiveness of a nucleic acid encoding an expression suppressor comprising a targeting moiety and/or an effector moiety may be codon-optimized in a coding region (optimized according to codon usage in mammals, such as humans). part or all. In some embodiments, the cohesion of the nucleic acid encoding the targeting moiety and/or the effector moiety is codon-optimized to enhance protein expression and/or increase the duration of protein expression. In some embodiments, the protein produced by the codon-optimized nucleic acid sequence is at least 1%, at least 2%, at least 5%, at least 10% higher than the level of the protein when encoded by the non-codon-optimized nucleic acid sequence %, at least 15%, at least 20%, at least 30%, at least 40%, or at least 50%.

Expression Inhibition System The expression inhibition system of the present invention may comprise two or more expression inhibitors. In some embodiments, the expression suppression system comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more expression suppressors (and optionally no more than 15, 14, 13 , 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 or 2). In some embodiments, the expression suppression system targets two or more different sequences (e.g., 1st and 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th , No. 11, No. 12 and/or other DNA sequences, and not exceeding No. 20, No. 19, No. 18, No. 17, No. 16, No. 15, No. 14, No. 13, No. 12, No. 11, No. 10 as the case may be , 9th, 8th, 6th, 5th, 4th, 3rd or 2nd sequence). In some embodiments, the expression suppression system comprises a plurality of expression suppressors, wherein each member of the plurality of expression suppressors is undetectable, eg, does not bind, another member of the plurality of expression suppressors. In some embodiments, the expression suppression system comprises a first expression inhibitor and a second expression inhibitor, wherein binding of the first expression inhibitor to the second expression inhibitor is undetectable, eg, does not bind.

In some embodiments, the expression inhibitory systems of the invention comprise two or more expression inhibitors, wherein the expression inhibitors are present together in a composition, pharmaceutical composition or mixture. In some embodiments, the expression inhibitory systems of the invention comprise two or more expression inhibitors, wherein one or more expression inhibitors are not mixed with at least one other expression inhibitor. For example, an expression inhibitory system can comprise a first expression inhibitor and a second expression inhibitor, wherein the presence of the first expression inhibitor in the nucleus of a cell is different from the presence of the second expression inhibitor in the nucleus of the same cell. Overlap, wherein the expression repression system achieves a reduction in MYC gene expression through the non-overlapping presence of first and second expression repressors. In some embodiments, the expression suppression system achieves a reduction in MYC gene expression that is greater than the reduction in MYC gene expression achieved by the first or second expression suppressor alone.

In some embodiments, the expression inhibitors in the expression inhibition system each comprise a different targeting moiety (eg, the first, second, third or other expression inhibitors each comprise a different targeting moiety from the other). For example, an expression suppression system can comprise a first expression inhibitor and a second expression inhibitor, wherein the first expression inhibitor comprises a first targeting moiety (e.g., a Cas9 domain, a TAL effector domain, or a Zn finger domain), and the second The two-expression suppressor comprises a second targeting moiety (eg Cas9 domain, TAL effector domain or Zn finger domain) different from the first targeting moiety. In some embodiments, different may mean comprising different types of targeting moieties, for example a first targeting moiety comprising a Cas9 domain and a second DNA targeting moiety comprising a Zn finger domain. In other embodiments, different may mean different variants comprising the same type of targeting moiety, for example a first targeting moiety comprising a first Cas9 domain (e.g. from a first species) and a second targeting moiety comprising a second Cas9 domain (eg from a second species). In one embodiment, when the expression inhibition system comprises two or more targeting moieties of the same type (eg, two or more Cas9 or ZF domains), the targeting moieties specifically bind two or more different sequence. For example, in an expression suppression system comprising two or more Cas9 domains, two or more Cas9 domains can be selected or altered such that they only significantly bind gRNAs corresponding to their target sequences (e.g., those corresponding to Binding of the target of another Cas9 domain was not evident). In another example, in an expression inhibition system comprising two or more effector moieties, the two or more effector moieties can be selected or altered such that they only significantly bind to their target sequence (e.g., with another binding of the target sequence of the effector moiety was not evident).

In some embodiments, the expression inhibition system comprises three or more expression inhibitors and the two or more expression inhibitors comprise the same targeting moiety. For example, an expression inhibitory system may comprise three expression inhibitors, wherein the first and second expression inhibitors both comprise a first targeting moiety and the third expression inhibitor comprises a different second targeting moiety. In another example, the expression inhibitory system can comprise four expression inhibitors, wherein the first and second expression inhibitors each comprise a first targeting moiety and the third and fourth expression inhibitors comprise a different second targeting moiety . In another example, the expression inhibitory system may comprise five expression inhibitors, wherein the first and second expression inhibitors each comprise a first targeting moiety, and the third and fourth expression inhibitors each comprise a different second targeting moiety. moiety, and the fifth expression suppressor comprises a different third targeting moiety. As mentioned above, different can mean comprising different types of targeting moieties or comprising different variants of the same type of targeting moieties.

In some embodiments, the expression inhibitors in the expression inhibition system each bind to a different DNA sequence (eg, the first, second, third, or other expression inhibitors each bind to a different DNA sequence from the other). For example, an expression inhibitory system can comprise a first expression inhibitor and a second expression inhibitor, wherein the first expression inhibitor binds to a first DNA sequence and the second expression inhibitor binds to a second DNA sequence. In some embodiments, differing may mean that there is at least one position of discordance between the DNA sequence bound by one expression inhibitor and the DNA sequence bound by another expression inhibitor, or that the DNA sequence bound by an expression inhibitor At least one position present in is not present in the DNA sequence to which another expression suppressor binds.

In some embodiments, the first DNA sequence can be located on a first genome DNA strand and the second DNA sequence can be located on a second genome DNA strand. In some embodiments, the first DNA sequence can be located on the same genomic DNA strand as the second DNA sequence.

In some embodiments, the expression suppression system comprises three or more expression suppressors and the two or more expression suppressors comprise the same DNA sequence. For example, the expression suppression system may comprise three expression suppressors, wherein the first and second expression suppressors both comprise a first DNA sequence and the third expression suppressor comprises a second, different DNA sequence. In another example, the expression suppression system can comprise four expression suppressors, wherein both the first and second expression suppressors bind to a first DNA sequence and the third and fourth expression suppressors both bind to a second DNA sequence. In another example, the expression suppression system can comprise five expression suppressors, wherein the first and second expression suppressors both bind to a first DNA sequence, the third and fourth expression suppressors both bind to a second DNA sequence, and the first The five-expression suppressor binds a third DNA sequence. As mentioned above, different can mean: there is at least one position of discord between the DNA sequence bound by one expression inhibitor and the DNA sequence bound by another expression inhibitor, or in the DNA sequence bound by one expression inhibitor. At least one position present is absent in the DNA sequence to which another expression suppressor binds.

In some embodiments, the expression suppression system comprises two or more (eg, two) expression inhibitors and the plurality (eg, two) of the expression inhibitors comprises targeting moieties that bind to different DNA sequences. In such embodiments, the first targeting moiety can bind to a first DNA sequence and the second DNA targeting moiety can bind to a second DNA sequence, wherein the first and second DNA sequences are different and non-overlapping. In some such embodiments, the first DNA sequence is separated from the second DNA sequence by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 base pairs (and, as the case may be, not More than 500, 400, 300, 200, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, or 50 base pairs). In some such embodiments, the first DNA sequence is separated from the second DNA sequence by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 base pairs (and optionally, base-free base pair, e.g. the first and second sequences are directly adjacent to each other).

In some embodiments, the expression inhibitors in the expression inhibition system each comprise a different targeting moiety (eg, the first, second, third or other expression inhibitors each comprise a different effector moiety from the other). For example, an expression repression system can comprise a first expression repressor and a second expression repressor, wherein the first expression repressor comprises a first effector moiety (e.g., comprising a DNA methyltransferase or a functional fragment thereof), and the second expression repressor The repressor comprises a second effector moiety different from the first effector moiety (eg comprising a transcriptional repressor (eg KRAB) or a functional fragment thereof). In some embodiments, different may mean comprising different types of effector moieties. In other embodiments, different may mean different variants comprising the same type of effector moiety, e.g. a first effector moiety comprising a first DNA methyltransferase (e.g. having a first site specificity or amino acid sequence) and The second effector moiety comprises a second DNA methyltransferase (eg, having a second site specificity or amino acid sequence).

In some embodiments, the expression inhibition system comprises a first expression inhibitor comprising a first effector moiety and a second expression inhibitor comprising a second effector moiety, wherein the first effector moiety comprises a protein selected from the group consisting of: MQ1, DNMT1 , DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5 , SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (ie, LSD1), KDM1B (ie, LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (ie, G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or functional variants or fragments thereof; and the second effector Portion comprising different proteins selected from: MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10 , HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (aka LSD1), KDM1B (aka LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B , NO66, SETDB1, SETDB2, EHMT2 (ie, G9A), EHMT1 (ie, GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 or a functional variant or fragment thereof.

In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity (e.g., the function of MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, or any of them variant or fragment, and the other effector portion comprises transcriptional repression activity (e.g. KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12 or a functional variant or fragment of any of them), and the first or second effector portion comprising histone methyltransferase activity and another effector moiety comprising histone deacetylase activity (e.g. HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, or a functional variant or fragment thereof). In some embodiments, the first or second effector moiety comprises histone methyltransferase activity and the other The effector moiety comprises DNA methyltransferase activity (e.g., MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, or a functional variant or fragment of any of them). In some embodiments , the first or second effector moiety comprises DNA methyltransferase activity and the other effector moiety comprises transcriptional repression activity. In some embodiments, the first or second effector moiety comprises histone methyltransferase activity and the other effector moiety comprises The moiety comprises transcriptional repressive activity (e.g., KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional variant or fragment of any of them). In some embodiments, the first or second effector moiety comprises transcriptional repressive activity And another effector moiety comprises different transcriptional repression activities. In some embodiments, the first or second effector moiety comprises DNA methyltransferase activity and another effector moiety comprises the same DNA methyltransferase activity. In some implementations In some embodiments, the first or second effector moiety comprises DNA methyltransferase activity and the other effector moiety comprises histone deacetylase activity. In some embodiments, the first or second effector moiety comprises histone demethylation enzymatic activity and the other effector moiety comprises DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises histone methyltransferase activity and the other effector moiety comprises DNA demethylase activity. In In some embodiments, the first or second effector moiety comprises histone demethylase activity and the other effector moiety comprises transcriptional repression activity. In some embodiments, the first or second effector moiety comprises histone demethylase activity and another effector moiety comprising different histone demethylase activities. In some embodiments, the first or second effector moiety comprises histone demethylase activity and the other effector moiety comprises the same histone demethylase activity. In some embodiments, the first or second effector moiety comprises histone deacetylase activity and the other effector moiety comprises DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises histone deacetylase activity and the other effector moiety comprises DNA demethylase activity. In some embodiments, the first or second effector moiety comprises histone deacetylase activity and the other effector moiety comprises transcriptional repression activity. In some embodiments, the first or second effector moiety comprises a histone deacetylase activity and the other effector moiety comprises a different histone deacetylase activity. In some embodiments, the first or second effector moiety comprises histone deacetylase activity and the other effector moiety comprises the same histone deacetylase activity. In some embodiments, the first or second effector moiety comprises DNA methyltransferase activity and the other effector moiety comprises DNA demethylase activity. In some embodiments, the first or second effector moiety comprises DNA demethylase activity and the other effector moiety comprises transcriptional repression activity. In some embodiments, the first or second effector moiety comprises a DNA methyltransferase activity and the other effector moiety comprises a different DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises DNA methyltransferase activity and the other effector moiety comprises the same DNA methyltransferase activity. In some embodiments, the first or second effector moiety comprises DNA demethylase activity and the other effector moiety comprises transcriptional repression activity. In some embodiments, the first or second effector moiety comprises DNA demethylase activity and the other effector moiety comprises a different DNA demethylase activity. In some embodiments, the first or second effector moiety comprises DNA demethylase activity and the other effector moiety comprises the same DNA demethylase activity. In some embodiments, the first or second effector moiety comprises transcriptional repression activity and the other effector moiety comprises a different transcriptional repression activity. In some embodiments, the first or second effector moiety comprises transcriptional repression activity and the other effector moiety comprises the same transcriptional repression activity.

In some embodiments, the expression suppression system comprises three or more expression suppressors and the two or more expression suppressors comprise the same DNA targeting moiety. For example, an expression inhibitory system may comprise three expression inhibitors, wherein a first and a second expression inhibitor both comprise a first effector moiety and a third expression inhibitor comprises a different second effector moiety. In another example, the expression inhibitory system may comprise four expression inhibitors, wherein the first and second expression inhibitors each comprise a first effector moiety and the third and fourth expression inhibitors comprise a different second effector moiety. In another example, the expression inhibitory system may comprise five expression inhibitors, wherein the first and second expression inhibitors each comprise a first effector moiety, the third and fourth expression inhibitors each comprise a different second effector moiety, And the fifth expression suppressor comprises a different third effector moiety. As mentioned above, different can mean comprising different types of effector moieties or comprising different variants of the same type of effector moieties.

In some embodiments, two or more (eg, all) of the expression inhibitors in the expression inhibition system are not covalently bound to each other, eg, each expression inhibitor is not covalently bound to any other expression inhibitor. In another embodiment, two or more expression inhibitors in the expression inhibition system are covalently bound to each other. In one embodiment, the expression inhibition system comprises a first expression inhibitor and a second expression inhibitor disposed on the same polypeptide, for example in the form of a fusion molecule, linked for example by a peptide bond and optionally by a linker. In some embodiments, the peptide is a self-cleaving peptide, such as a T2A self-cleaving peptide. In one embodiment, the expression inhibitory system comprises a first expression inhibitor and a second expression inhibitor linked (eg, coupled to each other) by a non-peptide bond.

Linker An expression suppressor or expression suppressor system as disclosed herein may comprise one or more linkers. A linker can link a targeting moiety to an effector moiety, an effector moiety to another effector moiety, or a targeting moiety to another targeting moiety. A linker can be a chemical bond, such as one or more covalent or non-covalent bonds. In some embodiments, linkers are covalent. In some embodiments, linkers are non-covalent. In some embodiments, the linker is a peptide linker. Such linkers can be 2-30, 5-30, 10-30, 15-30, 20-30, 25-30, 2-25, 5-25, 10-25, 15-25, 20- 25, 2-20, 5-20, 10-20, 15-20, 2-15, 5-15, 10-15, 2-10, 5-10, or 2-5 amino acids, or a length greater than or Equal to 2, 5, 10, 15, 20, 25 or 30 amino acids (and optionally up to 50, 40, 30, 25, 20, 15, 10 or 5 amino acids in length). In some embodiments, a linker can be used to separate a first domain or moiety from a second domain or moiety, eg, a DNA targeting moiety from an effector moiety. In some embodiments, for example, a linker can be positioned between the DNA targeting moiety and the effector moiety, eg, to provide molecular flexibility for secondary and tertiary structure. Linkers can comprise flexible, rigid and/or cleavable linkers as described herein. In some embodiments, the linker includes at least one glycine, alanine, and serine amino acids to provide flexibility. In some embodiments, the linker is a hydrophobic linker, such as comprising a negatively charged sulfonate group, a polyethylene glycol (PEG) group, or a pyrophosphodiester group. In some embodiments, the linker is cleavable to selectively release moieties (eg, polypeptides) from the modulator, but is sufficiently stable to prevent premature cleavage.

In some embodiments, one or more moieties and/or domains in the expression inhibitors described herein are linked via one or more linkers. In some embodiments, expression inhibition may comprise a linker positioned between the targeting moiety and the effector moiety. In some embodiments, the linker may have the sequence of ASGSGGGSGGARD (SEQ ID NO: 137) or ASGSGGGSGG (SEQ ID NO: 138). In some embodiments, a system comprising a first and a second inhibitor can comprise a first linker between the first targeting moiety and the first effector moiety and a second targeting moiety and the second effector moiety. the second linker. In some embodiments, the first and second linkers can be the same. In some embodiments, the first and second linkers can be different. In some embodiments, the first linker can comprise an amino acid sequence according to SEQ ID NO: 137 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, and the second linker can comprise an amino acid sequence according to The amino acid sequence of SEQ ID NO: 138 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto.

As known to those skilled in the art, commonly used flexible linkers have a sequence consisting essentially of stretches of Gly and Ser residues ("GS" linkers). Flexible linkers may be suitable for linking domains/moieties that require some degree of movement or interaction and may include small, non-polar (eg Gly) or polar (eg Ser or Thr) amino acids. Incorporation of Ser or Thr may also maintain the stability of the linker in aqueous solution by forming hydrogen bonds with water molecules, and thus reduce adverse interactions between the linker and the moiety/domain. In some embodiments, the linker is a GS linker or a variant thereof, such as G4S (SEQ ID NO: 207).

Rigid linkers are suitable for maintaining a fixed distance between domains/parts and maintaining their independent functions. Rigid linkers may also be suitable when the spatial separation of the domains is critical to maintaining the stability or biological activity of one or more components in the fusion. The rigid linker can have an α-helical structure or a Pro-rich sequence (XP) _n , where X represents any amino acid, preferably Ala, Lys or Glu.

Cleavable linkers release free functional domains in vivo. In some embodiments, linkers are cleavable under specific conditions, such as in the presence of reducing reagents or proteases. In vivo cleavable linkers can take advantage of the reversible nature of disulfide bonds. An example includes a thrombin sensitive sequence (eg PRS) between two Cys residues. In vitro thrombin treatment of CPRSCs causes cleavage of the thrombin-sensitive sequence, while the reversible disulfide bonds remain intact. Such linkers are known and described, for example, in Chen et al., 2013. Fusion Protein Linkers: Property, Design and Functionality. Adv Drug Deliv Rev. 65(10): 1357-1369. In vivo cleavage of linkers in fusions can also be performed by proteases that are expressed in vivo under certain conditions, in specific cells or tissues, or restricted to certain cellular compartments. The specificity of various proteases results in slower cleavage of linkers in defined compartments. In some embodiments, the cleavable linker may be a self-cleavable linker, such as a T2A peptide linker. In some embodiments, a linker may comprise a "ribosomal skipping" sequence, such as a tPT2A linker.

Examples of molecules suitable for use in the linkers described herein include negatively charged sulfonate groups; lipids, such as poly(-- _CH2-- ) hydrocarbon chains, such as polyethylene glycol (PEG) groups, unsaturated A variant, a hydroxylated variant thereof, an amidated variant thereof, or another N-containing variant; a non-carbon linker; a carbohydrate linker; a phosphodiester linker, or two or more capable of expressing an inhibitor Other molecules to which various components are covalently linked. Also included are non-covalent linkers, such as hydrophobic lipid globules, such as leucine, isoleucine, valine or A series of residues that may also be rich in alanine, phenylalanine or even tyrosine, methionine, glycine or other hydrophobic residues. Components in the expression suppressor can be linked using charge-based chemistry such that a positively charged component in the expression suppressor is linked to another negatively charged component.

Targeting Moieties The invention provides, for example, expression suppressors comprising a targeting moiety that specifically targets (e.g., binds) a gene body sequence element (e.g., a promoter, TSS or anchor) in close proximity to and/or operably linked to a target gene. sequence). A targeting moiety can specifically bind a DNA sequence, such as a DNA sequence associated with a target gene (eg, MYC). Any molecule or compound that specifically binds a DNA sequence can be used as a targeting moiety.

In some embodiments, a targeting moiety targets (eg, binds to) a component in a gene body complex (eg, ASMC). In some embodiments, a targeting moiety targets (eg, binds to) an expression control sequence (eg, a promoter or enhancer) operably linked to a target gene. In some embodiments, a targeting moiety targets (eg, binds to) a target gene or a portion of a target gene. The target of a targeting moiety can be referred to as its targeting component. A targeting component can be any gene body sequence element operably linked to a target gene or the target gene itself, including (but not limited to) promoters, enhancers, anchor sequences, exons, introns, UTR coding sequence, splice site or start of transcription. In some embodiments, a targeting moiety specifically binds to one or more target anchor sequences (eg, within a cell) and does not bind to non-target anchor sequences (eg, within the same cell).

In some embodiments, a targeting moiety can be or comprise a CRISPR/Cas domain, a TAL effector domain, a Zn finger domain, a peptide nucleic acid (PNA), or a nucleic acid molecule. In some embodiments, the expression suppressor comprises an effector moiety. In some embodiments, the expression inhibitor comprises a plurality of targeting moieties, wherein binding of each targeting moiety to another targeting moiety is undetectable, eg, does not bind. In some embodiments, the expression inhibition system comprises a plurality of expression inhibitors, wherein each member of the plurality of expression inhibitors comprises a targeting moiety, wherein binding of each targeting moiety to another targeting moiety is undetectable, e.g. Not combined. In some embodiments, the expression inhibition system comprises a first expression inhibitor comprising a first targeting moiety and a second expression inhibitor comprising a second targeting moiety, wherein binding of the first targeting moiety to the second targeting moiety Not detectable, eg, not bound. In some embodiments, the expression inhibition system comprises a first expression inhibitor comprising a first targeting moiety and a second expression inhibitor comprising a second targeting moiety, wherein the first targeting moiety is opposite to the other first targeting moiety. The binding of the second targeting moiety is undetectable, eg, does not bind, and the binding of the second targeting moiety to another second targeting moiety is undetectable, eg, does not bind. In some embodiments, targeting moieties used in the compositions and methods described herein function (eg, bind to DNA sequences) in the monomeric (eg, non-dimeric) state.

In some embodiments, binding of a targeting moiety to a target component reduces the binding affinity of the target component for another transcription factor, component of a gene body complex, or sequence element of a gene body. In some embodiments, the targeting moiety binds to its target sequence with a _KD less than or equal to 500, 450, 400, 350, 300, 250, 200, 150, 100, 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02, 0.01, 0.005, 0.002, or 0.001 nM (and, optionally, a _K of at least 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.9, 0.8, 0.7 , 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02, 0.01, 0.005, 0.002 or 0.001 nM). In some embodiments, the targeting moiety binds to its target sequence with a _KD of 0.001 nM to 500 nM, such as 0.1 nM to 5 nM, such as about 0.5 nM. In some embodiments, the targeting moiety binds to a non-target sequence with a _KD of at least 500, 600, 700, 800, 900, 1000, 2000, 5000, 10,000, or 100,000 nM (and optionally, for the non-target sequence combination is not obvious). In some embodiments, targeting moieties do not bind to non-target sequences.

In some embodiments, the targeting moiety comprises a nucleic acid sequence complementary to a target component, eg, a regulatory element (eg, a promoter or enhancer) of a target gene (eg, MYC). In some embodiments, the targeting moiety comprises at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% %, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% complementary nucleic acid sequences.

In some embodiments, the targeting moiety can be or comprise a CRISPR/Cas domain, a TAL effector domain, a Zn finger domain, or a nucleic acid molecule.

In some embodiments, the targeting moiety in the expression suppressor comprises no more than 100, 90, 80, 70, 60, 50, 40, 30 or 20 nucleotides (and optionally at least 10, 20, 30, 40, 50, 60, 70, 80 or 90 nucleotides). In some embodiments, the expression inhibitor or effector moiety in the fusion molecule comprises no more than 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500 , 400, 300, 200 or 100 amino acids (and optionally at least 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800 or 1900 amino acids). In some embodiments, the expression inhibitor or effector moiety in the fusion molecule comprises 100-2000, 100-1900, 100-1800, 100-1700, 100-1600, 100-1500, 100-1400, 100-1300, 100 -1200, 100-1100, 100-1000, 100-900, 100-800, 100-700, 100-600, 100-500, 100-400, 100-300, 100-200, 200-2000, 200-1900 , 200-1800, 200-1700, 200-1600, 200-1500, 200-1400, 200-1300, 200-1200, 200-1100, 200-1000, 200-900, 200-800, 200-700, 200 -600, 200-500, 200-400, 200-300, 300-2000, 300-1900, 300-1800, 300-1700, 300-1600, 300-1500, 300-1400, 300-1300, 300-1200 , 300-1100, 300-1000, 300-900, 300-800, 300-700, 300-600, 300-500, 300-400, 400-2000, 400-1900, 400-1800, 400-1700, 400 -1600, 400-1500, 400-1400, 400-1300, 400-1200, 400-1100, 400-1000, 400-900, 400-800, 400-700, 400-600, 400-500, 500-2000 , 500-1900, 500-1800, 500-1700, 500-1600, 500-1500, 500-1400, 500-1300, 500-1200, 500-1100, 500-1000, 500-900, 500-800, 500 -700, 500-600, 600-2000, 600-1900, 600-1800, 600-1700, 600-1600, 600-1500, 600-1400, 600-1300, 600-1200, 600-1100, 600-1000 , 600-900, 600-800, 600-700, 700-2000, 700-1900, 700-1800, 700-1700, 700-1600, 700-1500, 700-1400, 700-1300, 700-1200, 700 -1100, 700-1000, 700-900, 700-800, 800-2000, 800-1900, 800-1800, 800-1700, 800-1600, 800-1500, 800-1400, 800-1300, 800-1200 , 800-1100, 800-1000, 800-900, 900-2000, 900-1900, 900-1800, 900-1700, 900-1600, 900-1500, 900-1400, 900-1300, 900-1200, 900 -1100, 900-1000, 1000-2000, 1000-1900, 1000-1800, 1000-1700, 1000-1600, 1000-1500, 1000-1400, 1000-1300, 1000-1200, 1000-1100, 1100-20 00 ,1100-1900,1100-1800,1100-1700,1100-1600,1100-1500,1100-1400,1100-1300,1100-1200,1200-2000,1200-1900,1200-1800,1200-1700, 1200 -1600, 1200-1500, 1200-1400, 1200-1300, 1300-2000, 1300-1900, 1300-1800, 1300-1700, 1300-1600, 1300-1500, 1300-1400, 1400-2000, 1400-1 900 ,1400-1800,1400-1700,1400-1600,1400-1500,1500-2000,1500-1900,1500-1800,1500-1700,1500-1600,1600-2000,1600-1900,1600-1800, 1600 - 1700, 1700-2000, 1700-1900, 1700-1800, 1800-2000, 1800-1900 or 1900-2000 amino acids.

A system expressing a suppressor or comprising a suppressor as disclosed herein may comprise a nucleic acid, eg, one or more nucleic acids. The term "nucleic acid" refers to any compound that is or can be incorporated into an oligonucleotide chain. In some embodiments, nucleic acids are compounds and/or substances that are incorporated or can be incorporated into oligonucleotide chains via phosphodiester linkages. As will be understood from the context, in some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and/or nucleosides); oligonucleotide chain. In some embodiments, a "nucleic acid" is or comprises RNA; in some embodiments, a "nucleic acid" is or comprises DNA. In some embodiments, the nucleic acid is or comprises more than 50% ribonucleotides and is referred to herein as ribonucleic acid (RNA). In some embodiments, the nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, the nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, nucleic acid analogs differ from nucleic acids in that they do not utilize a phosphodiester backbone. For example, in some embodiments, the nucleic acid is, comprises, or consists of one or more "peptide nucleic acids" known in the art and having a peptide in the backbone linkages other than phosphodiester linkages and are considered within the scope of the present invention. Alternatively or additionally, in some embodiments, the nucleic acid has one or more phosphorothioate linkages and/or 5'-N-aminophosphite linkages instead of phosphodiester linkages. In some embodiments, the nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) composition. In some embodiments, the nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5- Methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxo base adenosine, 8-side oxyguanosine, 0(6)-methylguanine, 2-thiacytidine, methylated base, inserted base and combinations thereof). In some embodiments, the nucleic acid comprises one or more modified sugars (eg, 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to the sugars in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from natural sources, enzymatic synthesis (in vivo or in vitro) by polymerization based on complementary templates, replication in recombinant cells or systems, and chemical synthesis. synthesis. As used herein, "recombinant" when used to describe a nucleic acid refers to any nucleic acid that does not occur in nature. In some embodiments, the nucleic acid has at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 ,80,85,90,95,100,110,120,130,140,150,160,170,180,190,20,225,250,275,300,325,350,375,400,425,450 , 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues in length. In some embodiments, the nucleic acid can have a length of about 2 to about 5000 nts, about 10 to about 100 nts, about 50 to about 150 nts, about 100 to about 200 nts, about 150 to about 250 nts, about 200 to about 300 nts , about 250 to about 350 nts, about 300 to about 500 nts, about 10 to about 1000 nts, about 50 to about 1000 nts, about 100 to about 1000 nts, about 1000 to about 2000 nts, about 2000 to about 3000 nts, A length of about 3000 to about 4000 nts, about 4000 to about 5000 nts, or any range therebetween. In some embodiments, the nucleic acid is partially or fully single-stranded; in some embodiments, the nucleic acid is partially or fully double-stranded. In some embodiments, a nucleic acid has a nucleotide sequence comprising at least one element that encodes a polypeptide or is the complement of a sequence encoding a polypeptide. In some embodiments, the nucleic acid has enzymatic activity.

In some embodiments, the targeting moiety comprises or is a nucleic acid sequence, protein, protein fusion, or membrane translocating polypeptide. In some embodiments, the targeting moiety is selected from an exogenous engaging nuclear molecule, a nucleic acid encoding an engaging nuclear molecule, or a fusion of a sequence-targeting polypeptide and an engaging nuclear molecule. Engaging nucleating molecules can be, for example, CTCF, cohesin, USF1, YY1, TATA-box binding protein-associated factor 3 (TAF3), ZNF143 binding motifs. In some embodiments, the targeting moiety comprises or is a polymer or polymeric moiety, such as a nucleotide polymer (such as an oligonucleotide), a peptide nucleic acid, a peptide-nucleic acid hybrid, a peptide or polypeptide, a polyamide, carbohydrates etc.

In some embodiments, targeting moieties comprise or are nucleic acids. In some embodiments, an effector moiety comprises or is a nucleic acid. In some embodiments, nucleic acids that may be included in a portion can be or include DNA, RNA and/or artificial or synthetic nucleic acids or nucleic acid analogs or mimetics. For example, in some embodiments, the nucleic acid can be or include one or more of the following: genomic DNA (gDNA), complementary DNA (cDNA), peptide nucleic acid (PNA), peptide-nucleic acid hybrids, peptide - oligonucleotide conjugates, locked nucleic acid (LNA), bridged nucleic acid (BNA), polyamide, triplex forming oligonucleotides, antisense oligonucleotides, tRNA, mRNA, rRNA, miRNA, siRNA or other RNAi molecules (eg, targeting non-coding RNA as described herein and/or targeting the expression product of a specific gene associated with a target gene body complex as described herein), and the like. Nucleic acid sequences suitable for modulators may include modified oligonucleotides (eg, chemical modifications, such as modifications that alter backbone linkages, sugar molecules, and/or nucleic acid bases) and/or artificial nucleic acids. In some embodiments, nucleic acid sequences include, but are not limited to, genomic DNA, cDNA, peptide nucleic acid (PNA) or peptide-oligonucleotide conjugates, locked nucleic acid (LNA), bridged nucleic acid (BNA), polyamide Amines, triplex-forming oligonucleotides, modified DNA, antisense DNA oligonucleotides, tRNA, mRNA, rRNA, modified RNA, miRNA, gRNA, and siRNA or other RNA or DNA molecules. In some embodiments, a nucleic acid may include one or more residues that are not naturally occurring DNA or RNA residues, may include one or more linkages that are not phosphodiester bonds (such as may be, for example, phosphorothioate ester bond, etc.), and/or may include one or more modifications, such as a 2'O modification, such as 2'-OmeP. A variety of nucleic acid structures suitable for use in the preparation of synthetic nucleic acids are known in the art (see eg WO2017/0628621 and WO2014/012081), and those skilled in the art will appreciate that such nucleic acid structures can be utilized in accordance with the present invention.

Some examples of nucleic acids include, but are not limited to, nucleic acids (such as gRNA or antisense ssDNA as described elsewhere herein) that hybridize to a target gene (such as MYC), nucleic acids that hybridize to exogenous nucleic acids (such as viral DNA or RNA) , nucleic acids that hybridize to RNA, nucleic acids that interfere with gene transcription, nucleic acids that interfere with RNA translation, nucleic acids that stabilize or destabilize RNA (such as by targeting for degradation), interfere with DNA or RNA binding factors (by interfering with their expression or its functions), nucleic acids that link to intracellular proteins or protein complexes and regulate their functions, etc.

In some embodiments, the expression suppressor comprises one or more nucleoside analogs. In some embodiments, the nucleic acid sequence may additionally or alternatively comprise one or more natural nucleosides, such as purines or pyrimidines, such as adenine, cytosine, guanine, thymine, and uracil; one or more nucleoside analogs; . In some embodiments, the nucleic acid sequence includes one or more nucleoside analogs. Nucleoside analogs may include, but are not limited to, nucleoside analogs such as: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-ethyl Acylcytosine, 4-methylbenzimidazole, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil , dihydrouracil, dihydrouridine, β-D-galactosyl Q nucleoside, inosine, N6-prenyl adenine, 1-methylguanine, 1-methylinosine, 2 ,2-Dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5 -Methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyl Q nucleoside, 5'-methoxycarboxymethyluracil, 5 -Methoxyuracil, 2-methylthio-N6-prenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, Q nucleoside (queosine), 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl uracil-5-oxyacetate , uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w , 2,6-diaminopurine, 3-nitropyrrole, inosine, thiouridine, Q nucleoside (queuosine), wyosine (wyosine), diaminopurine, isoguanine, isocytosine, Diaminopyrimidine, 2,4-difluorotoluene, isoquinoline, pyrrolo[2,3-β]pyridine, and any other nucleoside analog that can base pair with a purine or pyrimidine side chain.

CRISPR/Cas domains In some embodiments, the targeting moiety is or comprises a CRISPR/Cas domain. A CRISPR/Cas protein can comprise a CRISPR/Cas effector and optionally one or more other domains. CRISPR/Cas domains typically share structural and/or functional similarities to proteins involved in the Clustered Regulatory Interspersed Short Palindromic Repeat (CRISPR) system, such as Cas proteins. The CRISPR/Cas domain optionally includes a guide RNA, such as a single guide RNA (sgRNA). In some embodiments, the gRNA contained by the CRISPR/Cas domain is non-covalently bound by the CRISPR/Cas domain.

The CRISPR system is an adaptive defense system originally discovered in bacteria and archaea. CRISPR systems utilize RNA-guided nucleases known as CRISPR-associated endonucleases or “Cas” endonucleases (such as Cas9 or Cpf1) to cleave foreign DNA. For example, in a typical CRISPR/Cas system, an endonuclease is guided to a target nucleotide sequence (such as a gene site in the body where the sequence will be edited). Three classes (I-III) of CRISPR systems have been identified. Class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). A class II CRISPR system includes type II Cas endonucleases, such as Cas9, CRISPR RNA ("crRNA"), and trans-activating crRNA ("tracrRNA"). crRNA contains a "guide RNA," typically an RNA sequence of about 20 nucleotides corresponding to a target DNA sequence. crRNA also contains a region that binds to tracrRNA to form a partially double-stranded structure that is cleaved by RNase III, resulting in a crRNA/tracrRNA hybrid. The crRNA/tracrRNA hybrid then directs the Cas9 endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence must generally be contiguous to a "protospacer adjacent motif" ("PAM") that is characteristic of a given Cas endonuclease; however, PAM sequences occur throughout a given gene body. CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; examples of PAM sequences include 5'-NGG (Streptococcus pyogenes), 5'-NNAGAA (Streptococcus thermophilus thermophilus) CRISPR1), 5'-NGGNG (Streptococcus thermophilus CRISPR3) and 5'-NNNGATT (Neisseria meningiditis). Some endonucleases (e.g. Cas9 endonuclease) associate with a G-rich PAM site (e.g. 5'-NGG) and target at a position 3 nucleotides upstream (5') from the PAM site DNA was subjected to blunt-end cleavage. Another class II CRISPR system includes the type V endonuclease Cpf1, which is smaller than Cas9; examples include AsCpf1 (from Acidaminococcus sp.) and LbCpf1 (from Lachnospiraceae sp. ). CRISPR arrays associated with Cpf1 are processed into mature crRNA without the need for tracrRNA; in other words, the Cpf1 system requires only Cpf1 nuclease and crRNA to cleave the target DNA sequence. The Cpf1 endonuclease associates with T-rich PAM sites such as 5'-TTN. Cpf1 also recognizes the 5'-CTA PAM motif. Cpf1 cleaves target DNA by introducing offset or staggered double-stranded breaks with 4 or 5 nucleotide 5' overhangs, e.g., 18 nucleotides downstream (3') of the PAM site on the coding strand and 23 nucleotides downstream of the PAM site on the complementary strand, the target DNA is cleaved by 5 nucleotide offset cleavage or staggered cleavage; the 5 nucleotide overhang generated by such offset cleavage allows Homologous recombination, gene body editing by DNA insertion, is more precise than insertion at blunt-end cleaved DNA. See eg Zetsche et al. (2015) Cell, 163:759-771.

Various CRISPR-associated (Cas) genes or proteins can be used in the technology provided by the present invention, and the selection of Cas protein depends on the specific conditions of the method. Specific examples of Cas proteins include class II systems, including Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cpf1, C2C1 or C2C3. In some embodiments, the Cas protein (eg, Cas9 protein) can be from any of a variety of prokaryotic species. In some embodiments, a particular Cas protein (eg, a particular Cas9 protein) is selected to recognize a particular protospacer adjacent motif (PAM) sequence. In some embodiments, the DNA targeting moiety comprises a sequence targeting polypeptide, such as a Cas protein, eg Cas9. In certain embodiments, Cas proteins (eg, Cas9 proteins) can be obtained from bacteria or archaea or synthesized using known methods. In certain embodiments, the Cas protein can be from gram-positive bacteria or gram-negative bacteria. In certain embodiments, the Cas protein may be from Streptococcus (eg, Streptococcus pyogenes or Streptococcus thermophilus), Francisella (eg, F. novicida), Staphylococcus (eg, Staphylococcus aureus (S. aureus)), Aminococcus (e.g. Aminococcus BV3L6), Neisseria (e.g. Neisseria meningitidis (N. meningitidis)), Cryptococcus ( Cryptococcus), Corynebacterium, Haemophilus, Eubacterium, Pasteurella, Prevotella, Veillonella ) or Marinobacter.

In some embodiments, the Cas protein requires the presence or proximity of a protospacer adjacent motif (PAM) in the target DNA sequence for the Cas protein to bind and/or function. In some embodiments, the PAM from 5' to 3' is or comprises NGG, YG, NNGRRT, NNNRRT, NGA, TYCV, TATV, NTTN, or NNNGATT, wherein N represents any nucleotide, Y represents C or T, and R represents A or G, and V represents A or C or G. In some embodiments, the Cas protein is a protein listed in Table 1. In some embodiments, the Cas protein comprises one or more mutations that alter its PAM. In some embodiments, the Cas protein comprises E1369R, E1449H, and R1556A mutations or similar substitutions for the amino acids corresponding to these positions. In some embodiments, the Cas protein comprises E782K, N968K, and R1015H mutations or similar substitutions for the amino acids corresponding to these positions. In some embodiments, the Cas protein comprises D1135V, R1335Q, and T1337R mutations or similar substitutions for the amino acids corresponding to these positions. In some embodiments, the Cas protein comprises S542R and K607R mutations or similar substitutions for the amino acids corresponding to these positions. In some embodiments, the Cas protein comprises S542R, K548V, and N552R mutations or similar substitutions for the amino acids corresponding to these positions. Table 1 name enzyme bacteria Aas number PAM Mutations that alter PAM recognition mutation causing catalytic failure FnCas9 Cas9 Francis the New Murderer 1629 5'-NGG-3' wt D11A/H969A/N995A FnCas9 RHA Cas9 Francis the New Murderer 1629 5'-YG-3' E1369R/E1449H/R1 556A D11A/H969A/N995A SaCas9 Cas9 Staphylococcus aureus 1053 5'-NNGRRT-3' wt D10A/H557A SaCas9 KKH Cas9 Staphylococcus aureus 1053 5'-NNNRRT-3' E782K/N968K/R101 5H D10A/H557A SpCas9 Cas9 Streptococcus pyogenes 1368 5'-NGG-3' wt D10A/D839A/H840A/N863A SpCas9 VQR Cas9 Streptococcus pyogenes 1368 5'-NGA-3' D1135V/R1335Q/T1 337R D10A/D839A/H840A/N863A AsCpf1 RR Cpf1 Aminococcus sp. BV3L6 1307 5'-TYCV-3' S542R/K607R E993A AsCpf1 RVR Cpf1 Aminococcus sp. BV3L6 1307 5'-TATV-3' S542R/K548V/N552R E993A FnCpf1 Cpf1 Francis the New Murderer 1300 5'-NTTN-3' wt D917A/E1006A/D1255A NmCas9 Cas9 Neisseria meningitidis 1082 5'-NNNGATT-3' wt D16A/D587A/H588A/N611A

In some embodiments, the Cas protein is modified to inactivate nucleases, eg, Cas lacking nucleases. In some embodiments, the Cas protein is a Cas9 protein. While wild-type Cas9 produces double-stranded breaks (DSBs) at the specific DNA sequence targeted by the gRNA, a variety of CRISPR endonucleases with modified functions are available, e.g. a "nickase" version of Cas9 that produces only single strands Fragmentation; Catalytically inactive Cas9 (“dCas9”) does not cleave target DNA. In some embodiments, dCas binding to a DNA sequence can interfere with transcription at that site through steric hindrance. In some embodiments, the DNA targeting moiety is or comprises a catalytically inactive Cas, such as dCas. Various catalytically inactive Cas proteins are known in the art. In some embodiments, dCas9 comprises mutations in each endonuclease domain of the Cas protein, such as D10A and H840A mutations.

In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises a D11A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the H969A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the N995A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the D11A, H969A, and N995A mutations or similar substitutions for the amino acids corresponding to these positions.

In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises a D10A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the H557A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the D10A and H557A mutations or similar substitutions for the amino acids corresponding to these positions.

In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises a D839A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the H840A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the N863A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises D10A, D839A, H840A, and N863A mutations or similar substitutions for the amino acids corresponding to these positions.

In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the E993A mutation or similar substitution for the amino acid corresponding to this position.

In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises a D917A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the E1006A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises a D1255A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the D917A, E1006A, and D1255A mutations or similar substitutions for the amino acids corresponding to these positions.

In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises a D16A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises a D587A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the H588A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the N611A mutation or similar substitution for the amino acid corresponding to this position. In some embodiments, the catalytically inactive Cas9 protein (eg, dCas9) comprises the D16A, D587A, H588A, and N611A mutations or similar substitutions for the amino acids corresponding to these positions.

In another aspect, the invention relates to an expression inhibitor or polypeptide comprising one or more (eg, one) targeting moieties and one or more effector moieties, wherein one or more targeting moieties are or comprise A CRISPR/Cas domain comprising a Cas protein, such as a catalytically inactive Cas9 protein, such as dCas9, or a functional variant or fragment thereof. In some embodiments, dCas9 comprises the amino acid sequence of SEQ ID NO: 17:

In some embodiments, dCas9 is encoded by the nucleic acid sequence SEQ ID NO: 50:

In some embodiments, a targeting moiety can comprise a Cas domain comprising or linked (eg, covalently linked) to a gRNA. gRNAs are short synthetic RNAs that consist of a "scaffold" sequence necessary for Cas protein binding and user-defined ~20 nucleotide targeting sequences for gene body targets. In practice, guide RNA sequences are usually designed to have a length of 17 to 24 nucleotides (eg, 19, 20 or 21 nucleotides) and are complementary to the target nucleic acid sequence. Custom gRNA generators and algorithms for designing efficient guide RNAs are commercially available. Gene editing has also been achieved using chimeric "single-guide RNA" ("sgRNA"), which mimics the naturally occurring crRNA-tracrRNA complex and contains tracrRNA (for binding nucleases) and at least one crRNA (for binding A single RNA molecule engineered (synthesized) by a nuclease that guides to a target sequence for editing. Chemically modified sgRNAs have also been shown to be effective for Cas proteins; see eg Hendel et al. (2015) Nature Biotechnol., 985-991. Exemplary guide RNA sequences are disclosed in Table 2 and Table 13.

In some embodiments, the gRNA comprises a nucleic acid sequence complementary to a DNA sequence associated with a target gene. In some embodiments, the DNA sequence is, comprises, or overlaps with an expression control element operably linked to a target gene. In some embodiments, the gRNA comprises a nucleic acid sequence that is at least 90, 95, 99, or 100% complementary to a DNA sequence associated with a target gene. In some embodiments, the gRNA used in combination with a DNA targeting moiety comprising a Cas molecule is an sgRNA.

chr8:128746342- 128746364 + GD-28859 CTCF

chr8:128746321- 128746343 - GD-28862 CTCF

chr8:128746525- 128746547 + GD-28617 啟動子

chr8:128748014- 128748036 + 表13.例示性gRNA序列 嚮導名稱 靶序列 基因體座標 GD-29833

GRCh37: chr8:129188878-129188900 GD-29834

GRCh37: chr8:129188958-129188980 GD-29835

GRCh37: chr8:129188960-129188982 GD-29836

GRCh37: chr8:129189067-129189089 GD-29837

GRCh37: chr8:129189457-129189479 GD-29838

GRCh37: chr8:129189554-129189576 GD-29839

GRCh37: chr8:129189679-129189701 GD-29840

GRCh37: chr8:129209511-129209533 GD-29841

GRCh37: chr8:129209643-129209665 GD-29842

GRCh37: chr8:129209658-129209680 GD-29843

GRCh37: chr8:129209856-129209878 GD-29844

GRCh37: chr8:129189452-129189474 GD-29914

GRCh37: chr8:129189190-129189212 GD-29915

GRCh37: chr8:129189274-129189296 GD-29916

GRCh37: chr8:129189421-129189443 GD-28662

GRCh37: chr19:55627120-55627139 In some embodiments, the gRNA used in conjunction with the CRISPR/Cas domain specifically binds a target sequence associated with CTCF. In some embodiments, a gRNA used in conjunction with a CRISPR/Cas domain specifically binds a target sequence associated with a promoter. In some embodiments, the gRNA binds a target sequence listed in Table 2 or Table 13. In some embodiments, the expression inhibitors described herein bind to a target sequence listed in Table 2 or Table 13. Table 2: Exemplary gRNA sequences wizard name target target sequence genome coordinates share GD-28616 CTCF

chr8:128746342-128746364 + GD-28859 CTCF

chr8:128746321-128746343 - GD-28862 CTCF

chr8:128746525-128746547 + GD-28617 Promoter

chr8:128748014-128748036 + Table 13. Exemplary gRNA sequences wizard name target sequence genome coordinates GD-29833

GRCh37: chr8:129188878-129188900 GD-29834

GRCh37: chr8:129188958-129188980 GD-29835

GRCh37: chr8:129188960-129188982 GD-29836

GRCh37: chr8:129189067-129189089 GD-29837

GRCh37: chr8:129189457-129189479 GD-29838

GRCh37: chr8:129189554-129189576 GD-29839

GRCh37: chr8:129189679-129189701 GD-29840

GRCh37: chr8:129209511-129209533 GD-29841

GRCh37: chr8:129209643-129209665 GD-29842

GRCh37: chr8:129209658-129209680 GD-29843

GRCh37: chr8:129209856-129209878 GD-29844

GRCh37: chr8:129189452-129189474 GD-29914

GRCh37: chr8:129189190-129189212 GD-29915

GRCh37: chr8:129189274-129189296 GD-29916

GRCh37: chr8:129189421-129189443 GD-28662

GRCh37: chr19:55627120-55627139

In some embodiments, the expression suppression system comprises a first expression suppressor comprising a first DNA targeting moiety and a second expression suppressor comprising a second DNA targeting moiety, wherein the first DNA targeting moiety comprises or is a second DNA targeting moiety. a CRISPR/Cas domain and the second DNA targeting moiety comprises or is a second CRISPR/Cas domain. In some embodiments, the first CRISPR/Cas domain comprises a first CRISPR/Cas protein and a first guide RNA, and the second CRISPR/Cas domain comprises a second CRISPR/Cas protein and a second guide RNA. In some embodiments, the first CRISPR/Cas protein binds insignificantly (e.g., does not bind) to the second guide RNA, e.g., with a KD of at least 10, 20, 50, 100, 1000, or 10,000 nM, and the second CRISPR The Cas protein binds insignificantly (eg, does not bind) to the first guide RNA, eg, with a _KD of at least 10, 20, 50, 100, 1000, or 10,000 nM.

TAL effector domains In some embodiments, the DNA targeting moiety is or comprises a TAL effector domain. A TAL effector domain, e.g., a TAL effector domain that specifically binds a DNA sequence, comprises a plurality of TAL effector repeats or fragments thereof, and optionally one or more other portions of a naturally occurring TAL effector repeat (e.g., a plurality of N-terminal and/or C-terminal of TAL effector domain), wherein each TAL effector repeat sequence recognizes nucleotides. A TAL effector protein may comprise a TAL effector domain and optionally one or more other domains. A variety of TAL effector domains are known to those skilled in the art and are commercially available, eg, from Thermo Fisher Scientific.

TALEs are natural effector proteins secreted by various species of bacterial pathogens, including the phytopathogen Xanthomonas that modulate gene expression in host plants and promote bacterial colonization and survival. The specific binding of TAL effectors is based on a central repeat domain, which is a tandem arrangement of typically 33 or 34 amino acids, nearly identical repeat sequences (repeat-variable diresidue, RVD domains).

Members of the TAL effector family differ mainly in the number and order of their repeats. The number of repeats ranges from 1.5 to 33.5 repeats and the C-terminal repeats are usually of shorter length (eg, about 20 amino acids) and are generally referred to as "half-repeats." Each repeat in a TAL effector is characterized by an association of one repeat to one base pair, where different repeat types exhibit different base pair specificities (one repeat recognizes one base pair on the target gene sequence). In general, the smaller the number of repeats, the weaker the protein-DNA interaction. A number of 6.5 repeats has been shown to be sufficient to activate transcription of the reporter gene (Scholze et al., 2010).

Variations between repeat sequences are predominantly present at amino acid positions 12 and 13, which are therefore termed "hypervariable" and are responsible for the specificity of interaction with the target DNA promoter sequence, as exemplified by the repeat variable double residue The base (RVD) and its correspondence with nucleic acid base targets are shown in Table 3. Table 3 - RVD and Nucleic Acid Base Specificity Target Possible RVD Amino Acid Combinations A NI NN CI HI KI G NN GN SN VN LN DN QN EN HN RH NK AN FN C HD RD KD ND AD T NG HG VG IG EG MG YG AAA EP VA QG KG RG

Accordingly, repetitive sequences in TAL effectors can be modulated to target specific DNA sequences. Other studies have shown that RVD NKs can target G. The targets of TAL effectors also tend to include a T flanking the 5' base targeted by the first repeat, but the exact mechanism of this recognition is unknown. More than 113 TAL effector sequences are known to date. Non-limiting examples of TAL effectors from Xanthomonas include Hax2, Hax3, Hax4, AvrXa7, AvrXa10, and AvrBs3.

Correspondingly, the TAL effector repeat sequence in the TAL effector domain of the present invention can be derived from any bacterial species (such as Xanthomonas oryzae pv . Oryzae strains) (Yu et al. 2011), Xanthomonas campestris pv . raphani strain 756C and Xanthomonas oryzae pv . Oryzicola strain BLS256 (Bogdanove et al. 2011 )) TAL effectors. As used herein, a TAL effector domain according to the invention comprises a RVD domain and flanking sequences (sequences on the N-terminal and/or C-terminal side of the RVD domain) also from naturally occurring TAL effectors. It may contain more or fewer repeats than RVDs in naturally occurring TAL effector domains. The TAL effector domains of the present invention are designed to target specified DNA sequences based on the codes described above and others known in the art. The number of TAL effector repeats (eg, monomers or modules) and their specific sequences are selected based on the desired DNA target sequence. For example, TAL effector repeats can be removed or added to suit a particular target sequence. In one embodiment, the TAL effector domain of the invention comprises 6.5 to 33.5 TAL effector repeats. In one embodiment, the TAL effector domain of the present invention comprises 8 to 33.5 TAL effector repeats, such as 10 to 25 TAL effector repeats, such as 10 to 14 TAL effector repeats.

In some embodiments, the TAL effector domain comprises a TAL effector repeat sequence corresponding to an exact match to the DNA target sequence. In some embodiments, mismatches between the repeat sequence and a target base pair on the DNA target sequence are allowed as long as they enable the function of an expression repression system (eg, an expression repressor comprising a TAL effector domain). In general, TALE binding is inversely correlated with the number of mismatches. In some embodiments, the TAL effector domain in the expression suppressor of the invention comprises no more than 7 mismatches, 6 mismatches, 5 mismatches, 4 mismatches, 3 mismatches relative to the target DNA sequence match, 2 mismatches or 1 mismatch, and no mismatch as appropriate. Without wishing to be bound by theory, in general, the smaller the number of TAL effector repeats in a TAL effector domain, the smaller the number of mismatches tolerated and still allow expression suppression systems (e.g., expression suppressors comprising TAL effector domains) to function. Function. Binding affinity is thought to depend on the sum of matched repeat-DNA combinations. For example, a TAL effector domain with 25 or more TAL effector repeats can tolerate up to 7 mismatches.

In addition to TAL effector repeats, the TAL effector domains of the invention may comprise other sequences derived from naturally occurring TAL effectors. The C-terminal and/or N-terminal sequences included on each side of the TAL effector repeat in the TAL effector domain can vary in length and can be selected by those skilled in the art, eg based on the work of Zhang et al. (2011). Zhang et al. have identified various C- and N-terminal truncation mutants of Hax3-derived TAL effector-based proteins and have identified key elements that contribute to optimal binding to target sequences and thus transcriptional activation. In general, transcriptional activity was found to be inversely correlated with N-terminal length. For the C-terminus, elements important for DNA binding residues within the first 68 amino acids of the Hax 3 sequence were identified. Accordingly, in some embodiments, the TAL effector domain of the expression inhibitor of the present invention includes the first 68 amino acids on the C-terminal side of the TAL effector repeat sequence in naturally occurring TAL effectors. Accordingly, in one embodiment, the TAL effector domain of the present invention comprises: 1) one or more TAL effector repeat sequences derived from naturally occurring TAL effectors; 2) derived from naturally occurring TAL effectors, located in TAL At least 70, 80, 90, 100, 110, 120, 130, 140, 150, 170, 180, 190, 200, 220, 230, 240, 250, 260, 270, 280 of the N-terminal side of the effector repeat sequence and/or 3) at least 68, 80, 90, 100, 110, 120, 130, 140 on the C-terminal side of the TAL effector repeat from a naturally occurring TAL effector , 150, 170, 180, 190, 200, 220, 230, 240, 250, 260 or more amino acids.

In some embodiments, the modulator comprises a targeting moiety comprising an engineered DNA binding domain (DBD), such as a TAL effector comprising a TAL effector repeat that binds to the target Sequences, e.g., a promoter or transcription start (TSS) sequence operably linked to a target gene (e.g., MYC), e.g., sequences in close proximity to translational regulatory elements, e.g., an anchor sequence comprising a target gene (e.g., MYC) to mediate ligation An anchor sequence in a body (ASMC), such as a sequence that is in close proximity to the anchor sequence. In some embodiments, TAL effector domains can be engineered to deliver epigenetic effector moieties to the target.

Zn finger domains In some embodiments, the DNA targeting moiety is or comprises a Zn finger domain. A Zn finger domain comprises a Zn finger, such as a naturally occurring Zn finger, such as a naturally occurring Zn finger or an engineered Zn finger, or a fragment thereof. Various Zn fingers are known to those skilled in the art and are commercially available, for example from Sigma-Aldrich. Generally, a Zn finger domain comprises a plurality of Zn fingers, wherein each Zn finger recognizes three nucleotides. A Zn finger protein may comprise a Zn finger domain and optionally one or more other domains.

In some embodiments, the Zn finger molecule comprises a non-naturally occurring Zn finger protein engineered to bind to a selected target DNA sequence. See eg Beerli et al., (2002) Nature Biotechnol. 20:135-141; Pabo et al., (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al., (2001) Nature Biotechnol. 19:656 -660; Segal et al., (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al., (2000) Curr. Opin. Struct. Biol. 10:411-416; 6,534,261, 6,599,692, 6,503,717, 6,689,558, 7,030,215, 6,794,136, 7,067,317, 7,262,054, 7,070,934, 7,361,635, 7 , 253,273 and US Patent Publication No. 2005/ No. 0064474, No. 2007/0218528, and No. 2005/0267061, all of which are incorporated herein by reference in their entirety.

The engineered Zn fingers can have novel binding specificities compared to naturally occurring Zn fingers. Engineering methods include, but are not limited to, rational design and selection of various types. Rational design includes, for example, the use of a database comprising triplet (or quadruplet) nucleotide sequences and individual Zn finger amino acid sequences, wherein each triplet or quadruple nucleotide sequence is associated with a particular triplet or quadruple. One or more amino acid sequences of the zinc fingers of the body sequence are related. See, eg, US Patent Nos. 6,453,242 and 6,534,261, which are incorporated herein by reference in their entirety.

Exemplary selection methods, including phage display and two-hybrid systems, are disclosed in US Pat. and International Patent Publication Nos. WO 98/37186, WO 98/53057, WO 00/27878, WO 01/88197 and GB 2,338,237. Additionally, enhancement of binding specificity for zinc finger proteins has been described, for example, in International Patent Publication No. WO 02/077227.

In addition, as disclosed in these and other references, zinc fingers and/or multi-finger zinc finger domains may be linked using any suitable linker sequence, including, for example, linkers of 5 or more amino acids in length. Together. See also US Patent Nos. 6,479,626, 6,903,185 and 7,153,949 for exemplary linker sequences of 6 or more amino acids in length. The proteins described herein can include any combination of suitable linkers between individual zinc fingers of the protein. Additionally, enhancement of binding specificity for zinc finger binding domains has been described, for example, in co-owned International Patent Publication No. WO 02/077227.

Zn fingers and methods for designing and constructing fusion proteins (and polynucleotides encoding them) are known to those skilled in the art and are described in detail in U.S. Pat. Nos. 6,140,0815, 789,538, 6,453,242 No. 6,534,261, 5,925,523, 6,007,988, 6,013,453 and 6,200,759; International Patent Publication Nos. WO 95/19431, WO 96/06166, WO 98/53057, WO 98 /54311, WO 00/27878, WO 01/60970, WO 01/88197, WO 02/099084, WO 98/53058, WO 98/53059, WO 98/ 53060, WO 02/016536 and WO 03/016496.

In certain embodiments, a DNA targeting moiety comprises a Zn finger domain comprising an engineered zinc finger that binds (in a sequence-specific manner) to a target DNA sequence. In some embodiments, the Zn finger domain comprises a Zn finger or a fragment thereof. In some embodiments, the Zn finger domain comprises a plurality of Zn fingers (or fragments thereof), such as 2, 3, 4, 5, 6 or more Zn fingers (and optionally no more than 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 or 2 Zn fingers). In some embodiments, the Zn finger domain comprises at least three Zn fingers. In some embodiments, the Zn finger domain contains four, five or six Zn fingers. In some embodiments, the Zn finger domain comprises 8, 9, 10, 11 or 12 Zn fingers. In some embodiments, a Zn finger domain comprising three Zn fingers recognizes a target DNA sequence comprising 9 or 10 nucleotides. In some embodiments, a Zn finger domain comprising four Zn fingers recognizes a target DNA sequence comprising 12 to 14 nucleotides. In some embodiments, a Zn finger domain comprising six Zn fingers recognizes a target DNA sequence comprising 18 to 21 nucleotides.

In some embodiments, the targeting domain comprises a two-handed Zn finger protein. Two-handed zinc finger proteins are those proteins in which the two clusters of zinc fingers are separated by an intermediate amino acid, such that the two zinc finger domains bind to two discrete target DNA sequences. An example of a two-handed zinc finger binding protein is SIP1, in which a cluster of four zinc fingers is located at the amino terminus of the protein and a cluster of three Zn fingers is located at the carboxy terminus (see Remade et al. (1999) EMBO Journal 18(18) :5073-5084). Each cluster of zinc fingers in these domains is capable of binding to a unique target sequence and the spacing between two target sequences can comprise multiple nucleotides.

ZF2 (aa) 6

ZF3 (aa) 7

ZF4 (aa) 8

ZF5 (aa) 9

ZF6 (aa) 10

ZF7 (aa) 11

ZF8 (aa) 12

ZF9 (aa) 13

ZF10 (aa) 14

ZF11 (aa) 15

ZF12 (aa) 16

ZF54 (aa) 169

ZF61 (aa) 170

ZF67 (aa) 171

ZF68 (aa) 172

表 5 ： 例示性靶向部分之核苷酸序列 名稱 SEQ ID NO. 序列 ZF1 (nt) 38

ZF2 (nt) 39

ZF3 (nt) 40

ZF4 (nt) 41

ZF5 (nt) 42

ZF6 (nt) 43

ZF7 (nt) 44

ZF8 (nt) 45

ZF9 (nt) 46

ZF10 (nt) 47

ZF11 (nt) 48

ZF12 (nt) 49

ZF12 (nt) 全長 115

ZF9 131

ZF54 173

ZF61 174

ZF67 175

ZF68 176

In some embodiments, the expression suppressor comprises a targeting moiety comprising an engineered DNA binding domain (DBD), e.g., a Zn finger domain comprising a Zn finger (ZFN), which binds to a target sequence, e.g., can Operably linked to the promoter or transcriptional start (TSS) of a target gene (e.g., MYC), e.g., a sequence in close proximity to translational regulatory elements, e.g., in an anchor sequence-mediated adapter (ASMC) comprising the target gene (e.g., MYC) An anchor sequence, such as a sequence that is close to the anchor sequence. In some embodiments, ZFNs can be engineered to deliver epigenetic effector molecules to a target site. In some embodiments, the targeting moiety comprises a Zn finger domain comprising 2, 3, 4, 5, 6, 7 or 8 zinc fingers. The amino acid sequences of exemplary targeting moieties disclosed herein are listed in Table 4. Nucleotide sequences encoding exemplary targeting moieties disclosed herein are listed in Table 5. In some embodiments, an expression suppressor or system described herein comprises a sequence having the sequence shown in Table 4 or at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% thereof Targeting portion of the consensus sequence. In some embodiments, a nucleic acid described herein comprises a sequence shown in Table 5, or a sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. Table 4: Amino acid sequences of exemplary targeting moieties name SEQ ID NO. sequence ZF1 (aa) 5

ZF2 (aa) 6

ZF3 (aa) 7

ZF4 (aa) 8

ZF5 (aa) 9

ZF6 (aa) 10

ZF7 (aa) 11

ZF8 (aa) 12

ZF9 (aa) 13

ZF10 (aa) 14

ZF11 (aa) 15

ZF12 (aa) 16

ZF54 (aa) 169

ZF61 (aa) 170

ZF67 (aa) 171

ZF68 (aa) 172

Table 5 : Nucleotide sequences of exemplary targeting moieties name SEQ ID NO. sequence ZF1 (nt) 38

ZF2 (nt) 39

ZF3 (nt) 40

ZF4 (nt) 41

ZF5 (nt) 42

ZF6 (nt) 43

ZF7 (nt) 44

ZF8 (nt) 45

ZF9 (nt) 46

ZF10 (nt) 47

ZF11 (nt) 48

ZF12 (nt) 49

ZF12 (nt) full length 115

ZF9 131

ZF54 173

ZF61 174

ZF67 175

ZF68 176

ZF16(a a) 155

ZF17(a a) 156

表 15 ： 例示性小鼠特異性靶向部分之核苷酸序列 名稱 SEQ ID NO. 序列 ZF15 nt 157

ZF16 nt 158

ZF17 nt 159

In some embodiments, the expression suppression system comprises a targeting moiety comprising an engineered DNA binding domain (DBD), such as a Zn finger domain comprising a Zn finger (ZFN), which binds to a target sequence, such as can A promoter or transcription start (TSS) sequence operably linked to a target gene (e.g. MYC), e.g., a sequence in close proximity to a translational regulatory element, e.g., an anchor sequence-mediated adapter (ASMC) comprising a target gene (e.g., MYC) An anchor sequence in, for example, a sequence that is in close proximity to an anchor sequence in the mouse genome. In some embodiments, ZFNs can be engineered to deliver epigenetic effector molecules to a target. In some embodiments, the targeting moiety comprises a Zn finger domain comprising 2, 3, 4, 5, 6, 7 or 8 zinc fingers. The amino acid sequences of exemplary targeting moieties disclosed herein are listed in Table 14. Nucleotide sequences encoding exemplary targeting moieties disclosed herein are listed in Table 15. In some embodiments, an expression suppressor or system described herein comprises a sequence having the sequence shown in Table 14 or at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% thereof Targeting portion of the consensus sequence. In some embodiments, a nucleic acid described herein comprises a sequence shown in Table 15, or a sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. Table 14: Amino acid sequences of exemplary mouse-specific targeting moieties name SEQ ID NO. sequence ZF15 (aa) 154

ZF16(a a) 155

ZF17(a a) 156

Table 15 : Nucleotide sequences of exemplary mouse-specific targeting moieties name SEQ ID NO. sequence ZF15 nt 157

ZF16 nt 158

ZF17 nt 159

Nucleic Acid Molecules In some embodiments, the targeting moiety is or comprises a DNA binding domain from a nuclease. For example, known homing endonucleases and meganucleases (such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, Recognition sequences of I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII and I-TevIII). See also U.S. Patent Nos. 5,420,032, 6,833,252; Belfort et al., (1997) Nucleic Acids Res. 25:3379-3388; Dujon et al., (1989) Gene 82:115-118; Perler et al., (1994) Nucleic Acids Res. 22:1125-1127; Jasin (1996) Trends Genet. 12:224-228; Gimble et al., (1996); J. Mol. Biol. 263:163-180; Argast et al., (1998) J. Mol. Biol. 280:345-353 and New England Biolabs catalog. In addition, the DNA binding specificities of homing endonucleases and meganucleases can be engineered to bind non-natural targets. See, for example, Chevalier et al., (2002) Molec. Cell 10:895-905; Epinat et al., (2003) Nucleic Acids Res. 31:2952-2962; Ashworth et al., (2006) Nature 441:656-659; Paques et al., (2007) Current Gene Therapy 7:49-66; US Patent Publication No. 2007/0117128.

In some embodiments, a DNA targeting moiety comprises or is a nucleic acid. In some embodiments, nucleic acids that can be included in a DNA targeting moiety can be or comprise DNA, RNA and/or artificial or synthetic nucleic acids or nucleic acid analogs or mimetics. For example, in some embodiments, the nucleic acid can be or include one or more of: genomic DNA (gDNA), complementary DNA (cDNA), peptide nucleic acid (PNA), peptide-oligonucleotide Conjugates, locked nucleic acids (LNA), bridged nucleic acids (BNA), polyamides, triplex-forming oligonucleotides, antisense oligonucleotides, tRNA, mRNA, rRNA, miRNA, gRNA, siRNA, or other RNAi Molecules (eg targeting non-coding RNAs as described herein and/or targeting expression products of specific genes associated with target gene body complexes as described herein) and the like. In some embodiments, a nucleic acid may include one or more residues that are not naturally occurring DNA or RNA residues, may include one or more linkages that are not phosphodiester bonds (such as may be, for example, phosphorothioate ester bond, etc.), and/or may include one or more modifications, such as a 2'O modification, such as 2'-OmeP. A variety of nucleic acid structures suitable for use in the preparation of synthetic nucleic acids are known in the art (see eg WO2017/0628621 and WO2014/012081), and those skilled in the art will appreciate that such nucleic acid structures can be utilized in accordance with the present invention.

Nucleic acids suitable for expression of inhibitors (e.g., DNA targeting moieties) can include, but are not limited to, DNA, RNA, modified oligonucleotides (e.g., chemical modifications, such as altering backbone linkages, sugar molecules, and/or nucleic acid base modification), and artificial nucleic acids. In some embodiments, nucleic acids include, but are not limited to, gene body DNA, cDNA, peptide nucleic acid (PNA) or peptide-oligonucleotide conjugates, locked nucleic acid (LNA), bridged nucleic acid (BNA), polyamide , triplex forming oligonucleotides, modified DNA, antisense DNA oligonucleotides, tRNA, mRNA, rRNA, modified RNA, miRNA, gRNA, and siRNA or other RNA or DNA molecules.

In some embodiments, the DNA targeting moiety comprises a length of about 15-200, 20-200, 30-200, 40-200, 50-200, 60-200, 70-200, 80-200, 90-200, 100-200, 110-200, 120-200, 130-200, 140-200, 150-200, 160-200, 170-200, 180-200, 190-200, 215-190, 20-190, 30- 190, 40-190, 50-190, 60-190, 70-190, 80-190, 90-190, 100-190, 110-190, 120-190, 130-190, 140-190, 150-190, 160-190, 170-190, 180-190, 15-180, 20-180, 30-180, 40-180, 50-180, 60-180, 70-180, 80-180, 90-180, 100- 180, 110-180, 120-180, 130-180, 140-180, 150-180, 160-180, 170-180, 15-170, 20-170, 30-170, 40-170, 50-170, 60-170, 70-170, 80-170, 90-170, 100-170, 110-170, 120-170, 130-170, 140-170, 150-170, 160-170, 15-160, 20- 160, 30-160, 40-160, 50-160, 60-160, 70-160, 80-160, 90-160, 100-160, 110-160, 120-160, 130-160, 140-160, 150-160, 215-150, 20-150, 30-150, 40-150, 50-150, 60-150, 70-150, 80-150, 90-150, 100-150, 110-150, 120- 150, 130-150, 140-150, 15-140, 20-140, 30-140, 40-140, 50-140, 60-140, 70-140, 80-140, 90-140, 100-140, 110-140, 120-140, 130-140, 15-130, 20-130, 30-130, 40-130, 50-130, 60-130, 70-130, 80-130, 90-130, 100- 130, 110-130, 120-130, 215-120, 20-120, 30-120, 40-120, 50-120, 60-120, 70-120, 80-120, 90-120, 100-120, 110-120, 15-110, 20-110, 30-110, 40-110, 50-110, 60-110, 70-110, 80-110, 90-110, 100-110, 15-100, 20- 100, 30-100, 40-100, 50-100, 60-100, 70-100, 80-100, 90-100, 15-90, 20-90, 30-90, 40-90, 50-90, 60-90, 70-90, 80-90, 15-80, 20-80, 30-80, 40-80, 50-80, 60-80, 70-80, 15-70, 20-70, 30- 70, 40-70, 50-70, 60-70, 15-60, 20-60, 30-60, 40-60, 50-60, 15-50, 20-50, 30-50, 40-50, A nucleic acid of 15-40, 20-40, 30-40, 15-30, 20-30 or 15-20 nucleotides or any range therebetween.

Effector Moieties In some embodiments, the expression inhibitors of the invention comprise one or more effector moieties. In some embodiments, the effector moiety, when used as part of an expression suppressor or expression suppression system described herein, reduces the expression of a target gene in a cell.

In some embodiments, the effector moiety has a function independent of binding of the targeting moiety. For example, an effector moiety can target (eg, bind to) a gene body sequence element targeted by a targeting moiety or a component of a gene body complex in proximity to the gene body sequence element, or recruit a transcription factor. As another example, an effector moiety may comprise enzymatic activity, such as a gene modification function.

In some embodiments, the effector moiety comprises an epigenetic modification moiety. In some embodiments, the effector moiety comprises a DNA modifying function, such as a DNA methyltransferase. In some embodiments, the effector moiety is or comprises a protein selected from MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, or a functional variant or fragment of any of them .

In some embodiments, the effector moiety comprises a transcriptional repressor. In some embodiments, transcriptional repressors block the recruitment of factors that stimulate or promote, for example, transcription of a target gene. In some embodiments, a transcriptional repressor recruits factors that inhibit, for example, transcription of a target gene. In some embodiments, the effector moiety (eg, transcriptional repressor) is or comprises a protein selected from KRAB, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional variant or fragment of any of them.

In some embodiments, the effector moiety promotes an epigenetic modification, eg, directly or indirectly. For example, effector moieties can indirectly contribute to epigenetic modification by recruiting endogenous proteins that epigenetically modify chromatin. The effector moiety can directly promote epigenetic modification by catalyzing the epigenetic modification, wherein the effector moiety comprises enzymatic activity and places the epigenetic mark directly on the chromatin.

In some embodiments, the effector moiety comprises a histone modifying function, eg, histone methyltransferase, histone demethylase, or histone deacetylase activity. In some embodiments, the effector moiety is or comprises a protein selected from the group consisting of: KDM1A (ie, LSD1), KDM1B (ie, LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, or Functional variants or fragments of either. In some embodiments, the effector moiety is or comprises a protein selected from the group consisting of: HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6 , SIRT7, SIRT8, SIRT9, or a functional variant or fragment of any of them.

In some embodiments, the effector moiety comprises a protein having a function described herein. In some embodiments, the effector moiety is or comprises a protein selected from: KRAB (e.g., according to NP_056209.2 or a protein encoded by NM_015394.5); a SET domain (e.g., a SET domain in: SETDB1 (e.g., according to NP_001353347. 1 or a protein encoded by NM_001366418.1); EZH2 (for example according to NP-004447.2 or a protein encoded by NM_004456.5); G9A (for example according to NP_001350618.1 or a protein encoded by NM_001363689.1); or SUV39H1 (for example according to NP_003164.1 or a protein encoded by NM_003173.4)); histone demethylase LSD1 (eg according to NP_055828.2 or a protein encoded by NM_015013.4); FOG1 (eg N-terminal residues of FOG1) (eg according to NP_722520.2 or a protein encoded by NM_153813.3); or KAP1 (eg, according to NP_005753.1 or a protein encoded by NM_005762.3); a functional fragment or variant of any of them, or a sequence at least the same as any of the above sequences 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical polypeptides. In some embodiments, the effector moiety is or comprises a protein selected from: DNMT3A (e.g., human DNMT3A) (e.g., according to NP_072046.2 or a protein encoded by NM_022552.4); DNMT3B (e.g., according to NP_008823.1 or by NM_006892. 4 encoded protein); DNMT3L (e.g. according to NP_787063.1 or protein encoded by NM_175867.3); DNMT3A/3L complex bacterial MQ1 (e.g. according to CAA35058.1 or P15840.3); functional fragments of any of them, Or a polypeptide whose sequence is at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical to any of the above sequences.

In another aspect, the invention relates to expression inhibitors or polypeptides comprising one or more (e.g., one) targeting moieties and one or more effector moieties, wherein one or more effector moieties are or comprise a Krueppel-associated cassette (KRAB), eg the protein according to NP_056209.2 or encoded by NM_015394.5, or a functional variant or fragment thereof. In some embodiments, the KRAB is a synthetic KRAB construct. In some embodiments, KRAB comprises the amino acid sequence of SEQ ID NO: 18:

In some embodiments, the KRAB effector portion is encoded by the nucleotide sequence of SEQ ID NO: 51. In some embodiments, the nucleotide sequences described herein comprise the sequence SEQ ID NO: 51 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differ therefrom by no more than 20 positions , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1.

In some embodiments, the KRAB used in the polypeptides or expression inhibitors described herein is a variant, eg, a variant comprising one or more mutations relative to the KRAB sequence of SEQ ID NO: 18. In some embodiments, the KRAB variant comprises one or more amino acid substitutions, deletions or insertions relative to SEQ ID NO: 18.

In some embodiments, the polypeptide or expression inhibitor is a fusion protein comprising an effector moiety (being or comprising KRAB) and a DNA targeting moiety. In some embodiments, the targeting moiety is or comprises a zinc finger domain, a TAL domain or a CRISPR/Cas domain, eg comprising a CRISPR/Cas protein, eg a dCas9 protein. In some embodiments, the polypeptide or expression inhibitor comprises other moieties described herein. In some embodiments, the polypeptide or expression suppressor reduces the expression of a target gene (eg, MYC). In some embodiments, the polypeptide or inhibitor of expression can be used in a method of modulating (e.g., reducing) gene expression, in a method of treating a condition, or in making epigenetic modifications to a target gene (e.g., MYC) or a transcriptional control element described herein (e.g. in place of performance suppression systems). In some embodiments, the expression inhibition system comprises two or more (e.g., two, three or four) expression inhibitors, wherein the first expression inhibitor comprises an effector moiety comprising a sequence of SEQ ID NO: 18. KRAB sequences or functional variants or fragments thereof.

In another aspect, the invention relates to expression inhibitors or polypeptides comprising one or more (e.g. one) targeting moieties and one or more effector moieties, wherein one or more effector moieties are or comprise MQ1, e.g. Bacterial MQ1, or a functional variant or fragment thereof. In some embodiments, MQ1 is Mollicutes spiroplasma MQ1. In some embodiments, MQ1 is Spiroplasma monobiae MQ1. In some embodiments, the MQ1 is a MQ1 from strain ATCC 33825 and/or corresponding to Uniprot ID P15840. In some embodiments, MQ1 comprises the amino acid sequence of SEQ ID NO: 19. In some embodiments, MQ1 comprises the amino acid sequence of SEQ ID NO: 87. In some embodiments, an effector domain described herein comprises SEQ ID NO: 19 or 87, or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto, or differs therefrom in no more than 20 positions , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1.

In some embodiments, MQ1 is encoded by the nucleotide sequence of SEQ ID NO: 52 or 132. In some embodiments, the nucleic acids described herein comprise the sequence of SEQ ID NO: 52, 132, or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto, or differ therefrom by no more than A sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1.

In some embodiments, the MQ1 used in the polypeptides or expression suppressors described herein is a variant, eg, comprising one or more mutations relative to wild-type MQ1 (eg, SEQ ID NO: 19). In some embodiments, the MQ1 variant comprises one or more amino acid substitutions, deletions or insertions relative to wild-type MQ1, eg, MQ1 of SEQ ID NO: 19. In some embodiments, the MQ1 variant comprises a K297P substitution. In some embodiments, the MQ1 variant comprises a N299C substitution. In some embodiments, the MQ1 variant comprises an E301Y substitution. In some embodiments, the MQ1 variant comprises a Q147L substitution (eg, has reduced DNA methyltransferase activity relative to wild-type MQ1 ). In some embodiments, the MQ1 variant comprises K297P, N299C, and E301Y substitutions (eg, has reduced DNA binding affinity relative to wild-type MQ1 ). In some embodiments, the MQ1 variant comprises Q147L, K297P, N299C, and E301Y substitutions (eg, has reduced DNA methyltransferase activity and DNA binding affinity relative to wild-type MQ1 ).

In some embodiments, the polypeptide or expression inhibitor is a fusion protein comprising an effector portion and a targeting portion, the effector portion being or comprising MQ1, and the targeting portion being or comprising a zinc finger domain, a TAL domain or a CRISPR/Cas domain , dCas9 domain. In some embodiments, the polypeptide or expression inhibitor comprises other moieties described herein. In some embodiments, the polypeptide or expression suppressor reduces the expression of a target gene (eg, MYC). In some embodiments, the polypeptide or inhibitor of expression can be used in a method of modulating (e.g., reducing) gene expression, in a method of treating a condition, or in making epigenetic modifications to a target gene (e.g., MYC) or a transcriptional control element described herein (e.g. in place of performance suppression systems). In some embodiments, the expression suppression system comprises two or more (e.g., two, three or four) expression suppressors, wherein the first expression suppressor comprises an effector moiety comprising MQ1, such as bacterial MQ1, or a functional variant or fragment thereof.

In another aspect, the invention relates to expression inhibitors or polypeptides comprising one or more (e.g. one) targeting moieties and one or more effector moieties, wherein one or more effector moieties are or comprise DNMT1, e.g. Human DNMT1, or a functional variant or fragment thereof. In some embodiments, DNMT1 is human DNMT1, eg, corresponding to Gene ID 1786, eg, corresponding to UniProt ID P26358.2. In some embodiments, DNMT1 comprises the amino acid sequence of SEQ ID NO: 20. In some embodiments, the effector domain described herein comprises a sequence according to SEQ ID NO: 20 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differs therefrom by no more than 20 positions , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 sequence:

In some embodiments, DNMT1 is encoded by the nucleotide sequence of SEQ ID NO: 53. In some embodiments, a nucleic acid described herein comprises the sequence SEQ ID NO: 53 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differs therefrom by no more than 20, 19, Sequence of 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1

In some embodiments, the DNMT1 used in the polypeptides or expression inhibitors described herein is a variant, eg, comprising one or more mutations relative to the DNMT sequence of SEQ ID NO: 20. In some embodiments, the effector domain comprises one or more amino acid substitutions, deletions or insertions relative to wild-type DNMT1. In some embodiments, the polypeptide is a fusion protein comprising an inhibitory domain that is or comprises DNMT1 and a targeting moiety. In some embodiments, the targeting moiety is or comprises a zinc finger domain, a TAL domain, or a CRISPR/Cas domain, such as a dCas9 domain. In some embodiments, the expression suppression system comprises two or more (e.g., two, three or four) expression suppressors, wherein the first expression suppressor comprises an effector moiety comprising DNMT1, or a functional variant thereof body or fragment.

In another aspect, the invention relates to expression inhibitors or polypeptides comprising one or more (eg, one) targeting moieties and one or more effector moieties, wherein the one or more effector moieties are or comprise DNMT3a/ 3L complex, or a functional variant or fragment thereof. In some embodiments, the DNMT3a/3L complex is a fusion construct. In some embodiments, the DNMT3a/3L complex comprises DNMT3A (eg, human DNMT3A) (eg, a protein according to NP_072046.2 or encoded by NM_022552.4). In some embodiments, the DNMT3a/3L complex comprises DNMT3L (eg, a protein according to NP_787063.1 or encoded by NM_175867.3). In some embodiments, DNMT3a/3L comprises the amino acid sequence of SEQ ID NO: 21 or SEQ ID NO: 114. In some embodiments, an effector domain described herein comprises SEQ ID NO: 21 or SEQ ID NO: 114, or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto, or a position that differs therefrom A sequence of numbers not exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1.

In some embodiments, DNMT3a/3L is encoded by the nucleotide sequence of SEQ ID NO: 54. In some embodiments, the nucleic acids described herein comprise the sequence SEQ ID NO: 54 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differ therefrom by no more than 20, 19, The sequence of 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1.

In some embodiments, the DNMT3a/3L used in the polypeptides or expression inhibitors described herein is a variant, e.g., comprising one or more mutations relative to DNMT3a/3L of SEQ ID NO: 21 or SEQ ID NO: 114 . In some embodiments, the DNMT3a/3L variant comprises one or more amino acid substitutions, deletions or insertions relative to SEQ ID NO: 21 or SEQ ID NO: 114. In some embodiments, the polypeptide or expression inhibitor is a fusion protein comprising an effector moiety (being or comprising DNMT3a/3L) and a targeting moiety. In some embodiments, the targeting moiety is or comprises a zinc finger domain, a TAL domain, or a CRISPR/Cas domain, such as a dCas9 domain. In some embodiments, the expression suppression system comprises two or more (e.g., two, three or four) expression suppressors, wherein the first expression suppressor comprises an effector moiety comprising DNMT3a/3L, or Functional variants or fragments.

In some embodiments, the effector moiety is or comprises a polypeptide. In some embodiments, an effector moiety is or comprises a nucleic acid. In some embodiments, the effector moiety is a chemical reagent, such as a chemical reagent that modulates cytosine I or adenine (A) (eg, sodium bisulfite, ammonium bisulfite). In some embodiments, the effector moiety has enzymatic activity (eg, methyltransferase, demethylase, nuclease (eg, Cas9), or deaminase activity). The effector moiety can be or comprise one or more of the following: small molecules, peptides, nucleic acids, nanoparticles, aptamers, or pharmaceutical agents with undesirable PK/PD.

In some embodiments, effector moieties may comprise peptide ligands, full-length proteins, protein fragments, antibodies, antibody fragments, and/or targeting aptamers. In some embodiments, proteins can bind receptors, such as extracellular receptors, neuropeptides, hormone peptides, peptide drugs, toxic peptides, viral or microbial peptides, synthetic peptides, or agonist or antagonist peptides.

In some embodiments, the effector moiety may comprise an antigen, an antibody, an antibody fragment (such as a single domain antibody), a ligand, or a receptor, such as glucagon-like peptide-1 (GLP-1 ), GLP-2 receptor 2 , cholecystokinin B (CCKB) or somatostatin receptors; peptide therapeutics, such as those that bind to specific cell surface receptors such as G protein-coupled receptors (GPCRs) or ion channels; synthetic peptides or Peptide analogs from natural bioactive peptides, antimicrobial peptides, pore-forming peptides, tumor-targeting or cytotoxic peptides, or degradative or self-destructive peptides, such as apoptosis-inducing peptide signaling or photosensitive peptides.

Peptides or protein moieties as used in effector moieties as described herein may also include small antigen-binding peptides, such as antigen-binding antibodies or antibody-like fragments, such as single-chain antibodies, nanobodies (see e.g. Steeland et al., 2016. Nanobodies as therapeutics: big opportunities for small antibodies. Drug Discov Today: 21(7):1076-113). Such small antigen-binding peptides can bind cytosolic, nuclear or intracellular antigens.

In some embodiments, the effector moiety comprises a dominant negative component (e.g., a dominant negative portion), e.g., a recognition and binding sequence (e.g., an anchor sequence, e.g., a CTCF binding motif), but has an inactive (e.g., mutated) dimerization domains (such as dimerization domains that cannot form functional anchor sequence-mediated adapters), or proteins that bind to components of gene body complexes (such as transcription factor subunits, etc.), thereby preventing the formation of functional transcription factors, etc. . For example, the zinc finger domain of CTCF can be altered so that it binds specific anchor sequences (by adding zinc fingers that recognize flanking nucleic acids), while the homodimerization domain can be altered to prevent the engineered CTCF from interacting with endogenous Interactions occur between forms of CTCF. In some embodiments, the dominant-negative component comprises a synthetic nucleating polypeptide that has a selected binding affinity for the anchor sequence within the target anchor sequence-mediated adapter. In some embodiments, the binding affinity is comparable to at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or higher or lower. A synthetic nucleating polypeptide may have 30-90%, 30-85%, 30-80%, 30-70%, 50-80%, 50-90% amino acid sequence identity to a corresponding endogenous nucleating polypeptide. A nucleating polypeptide can modulate (eg, disrupt) eg, compete with an endogenous nucleating polypeptide for binding to its anchor sequence via, for example, competitive binding.

In some embodiments, the effector moiety comprises an antibody or fragment thereof. In some embodiments, target gene (eg, MYC) expression is altered through the use of effector moieties that are or comprise one or more antibodies or fragments thereof. In some embodiments, gene expression is altered through the use of effector moieties that are or comprise one or more antibodies (or fragments thereof) and dCas9.

In some embodiments, the antibody or fragment thereof used in the effector portion may be monoclonal. Antibodies can be fusions, chimeric antibodies, non-humanized antibodies, partially or fully humanized antibodies, and the like. As will be appreciated by those skilled in the art, the format of the antibody used may be the same or different, depending on the intended target.

In some embodiments, the effector moiety comprises an engaging nucleating molecule, a nucleic acid encoding an engaging nucleating molecule, or a combination thereof. The conjugative nucleating molecule can be, for example, CTCF, cohesin, USF1, YY1, TATA box-binding protein-associated factor 3 (TAF3), ZNF143 binding motif, or another polypeptide that facilitates anchor sequence-mediated conjugate formation. Engaging nuclear molecules can be endogenous polypeptides or other proteins, such as transcription factors, such as autoimmune regulatory element (AIRE), another factor, such as X-inactivation-specific transcripts (XIST), or engineered polypeptides , the polypeptide is engineered to recognize a specific DNA sequence of interest, for example with zinc fingers, leucine zippers or bHLH domains for sequence recognition. The conjugating nuclear molecule can modulate DNA interactions in or around the anchor sequence-mediated conjugator (eg, associated with or comprising a gene body sequence element targeted by the targeting moiety). For example, conjugation nucleases can recruit other factors to anchor sequences that alter anchor sequence-mediated conjugate formation or fragmentation.

Conjugated nucleating molecules may also have homodimeric or heterodimeric dimerization domains. One or more conjugating nucleating molecules (eg, engineered endogenous conjugating nucleating molecules) can interact to form an anchor sequence-mediated adapter. In some embodiments, the conjugative nucleating molecule is engineered to further comprise a stabilizing domain, such as a cohesive interaction domain, that stabilizes the anchor sequence-mediated conjugator. In some embodiments, engaging nucleosynthetic molecules are engineered to bind a target sequence, eg, modulate target sequence binding affinity. In some embodiments, the conjugative nucleating molecule is selected or engineered to have a selected binding affinity for the sequence to be anchored within the anchor sequence-mediated conjugator.

Conjugated nucleogenic molecules and their corresponding anchor sequences can be identified by using cell and chromosome conformation capture methods containing inactivating mutations in CTCF or 3C-based methods such as Hi-C or high-throughput sequencing to examine topology Related domains, such as topological interactions between distal DNA regions or loci in the absence of CTCF. Long-range DNA interactions can also be identified. Other assays may include ChIA-PET analysis using baits such as cohesin, YY1 or USF1, ZNF143 binding motifs, and MS to identify complexes associated with baits.

In some embodiments, the effector moiety comprises the DNA binding domain of a protein. In some embodiments, the DNA binding domain in the effector moiety enhances or alters the targeting of the modulator, but does not alone achieve full targeting of the modulator (eg, the targeting moiety is still required to achieve targeting of the modulator). In some embodiments, the DNA binding domain enhances targeting of the modulator. In some embodiments, the DNA binding domain enhances the efficacy of the modulator. DNA binding proteins have different structural motifs known to those skilled in the art, which play an important role in binding DNA. In some embodiments, the DNA binding domain comprises a helix-turn-helix (HTH) motif, a common DNA recognition motif in repressor proteins. Such motifs comprise two helices, one of which recognizes the DNA whose side chain provides binding specificity (also known as the recognition helix). Such motifs are commonly used to regulate proteins involved in developmental processes. Sometimes, more than one protein competes for the same sequence or recognizes the same DNA segment. Different proteins may differ in their affinity for the same sequence or DNA conformation via hydrogen bonds, salt bridges and Van der Waals interactions, respectively.

In some embodiments, the DNA binding domain comprises a helix-hairpin-helix (HhH) motif. DNA-binding proteins with the HhH structural motif can be involved in non-sequence-specific DNA binding via hydrogen bond formation between protein backbone nitrogens and DNA phosphate groups.

In some embodiments, the DNA binding domain comprises a helix-loop-helix (HLH) motif. DNA-binding proteins with the HLH structural motif are transcriptional regulatory proteins and are primarily associated with a wide range of developmental processes. In terms of residues, the HLH structural motif is longer than the HTH or HhH motifs. Many of these proteins interact to form homodimers and heterodimers. The structural module system consists of two long helical regions, where the N-terminal helix binds to DNA, and the composite region allows protein dimerization.

In some embodiments, the DNA binding domain comprises a leucine zipper motif. In some transcription factors, a leucine zipper is formed against the dimer binding site of DNA. This motif includes two amphipathic helices (one from each subunit) that interact with each other to generate a left-handed coiled-coil supersecondary structure. A leucine zipper is an interleaving junction of regularly spaced leucine residues in one helix with leucine from an adjacent helix. The helices involved in the leucine zipper mostly exhibit a heptad sequence (abcdefg) where residues a and d are hydrophobic and the others are hydrophilic. The leucine zipper motif can mediate homodimer or heterodimer formation.

In some embodiments, the DNA binding domain comprises a Zn finger domain where the Zn ⁺⁺ ion is coordinated to 2 Cys and 2 His residues. Such transcription factors include large trimers with stoichiometry ββ'α. The apparent effect of Zn ⁺⁺ coordination is to stabilize the small complex structure rather than the hydrophobic core residues. Each Zn finger interacts in a conformationally identical manner with consecutive triple base pair segments in the larger groove of the duplex. Protein-DNA interactions are determined based on two factors: (i) hydrogen-bonding interactions between α-helices and DNA segments, mostly between Arg residues and guanine bases. (ii) Interact with the H-bonds of the DNA phosphate main chain, mostly with the H-bonds of Arg and His. An alternative Zn finger motif chelates Zn ⁺⁺ with 6 Cys.

In some embodiments, the DNA binding domain comprises a TATA box binding protein (TBP). TBP was originally identified as a component of the class II initiation factor TFIID. These binding proteins are involved in the transcription of all three nuclear RNA polymerases, serving as subunits in each of them. The TBP structure shows two α/β domains of 89-90 amino acids. The C-terminal or core region of TBP binds with high affinity to the TATA consensus sequence (TATAa/tAa/t, SEQ ID NO: 210), which recognizes minor groove determinants and promotes DNA bending. TBP resembles a molecular saddle. The bonding side is lined with the central 8 strands of 10 antiparallel β-sheets. The upper surface contains four α-helices and binds to various components of the transcription machinery.

In some embodiments, the DNA binding domain is or comprises a transcription factor. A transcription factor (TF) can be a modular protein that contains a DNA-binding domain responsible for specific recognition of base sequences and one or more effector domains that can activate or repress transcription. TFs interact with chromatin and recruit protein complexes that act as either co-activators or co-repressors.

In some embodiments, the effector moiety comprises one or more RNAs (eg, gRNAs) and dCas9. In some embodiments, one or more RNAs are targeted to a genome sequence element via dCas9 and a target-specific guide RNA. As will be appreciated by those skilled in the art, the RNAs used for targeting may be the same or different, depending on the designated target. The effector moiety may comprise an aptamer, such as an oligonucleotide aptamer or a peptide aptamer. The aptamer portion is an oligonucleotide or peptide aptamer.

The effector portion may comprise an oligonucleotide aptamer. Oligonucleotide aptamers are single-stranded DNA or RNA (ssDNA or ssRNA) molecules that can bind to preselected targets, including proteins and peptides, with high affinity and specificity.

Oligonucleotide aptamers are nucleic acid species that can be engineered to bind to various molecular targets, such as Small molecules, proteins, nucleic acids, and even cells, tissues, and organisms. Aptamers provide differential molecular recognition and can be produced by chemical synthesis. In addition, aptamers have desirable storage properties and elicit little or no immunogenicity in therapeutic applications.

Both DNA and RNA aptamers display robust binding affinities for a variety of targets. For example, DNA and RNA aptamers have been selected for tlysozyme, thrombin, human immunodeficiency virus trans-acting response element (HIV TAR), hemin, interferon gamma, vascular endothelial growth factor (VEGF), prostate Specific antigen (PSA), dopamine, and the nonclassical oncogene heat shock factor 1 (HSF1).

Diagnostic techniques for aptamer-based plasma protein profiling include aptamer plasma proteomics. This technology could enable multi-biomarker protein quantification in the future, which could help to diagnostically differentiate disease from healthy states.

The effector portion may comprise a peptide aptamer portion. Peptide aptamers have one (or more) variable short peptide domains, including peptides with low molecular weights of 12-14 kDa. Peptide aptamers can be designed to specifically bind to and interfere with protein-protein interactions within cells.

Peptide aptamers are artificial proteins that are selected or engineered to bind specific target molecules. These proteins include one or more peptide complexes of variable sequences. They are typically isolated from combinatorial libraries and often subsequently improved by directed mutagenesis or rounds of variable region mutagenesis and selection. Peptide aptamers can bind cellular protein targets in vivo and exert biological effects, including interfering with normal protein interactions of their target molecules with other proteins. In particular, variable peptide aptamer complexes linked to transcription factor binding domains are screened against target proteins linked to transcription factor activation domains. In vivo binding of peptide aptamers to their targets via this selection strategy is detected based on the expression of downstream yeast marker genes. Such experiments identify the specific proteins to which the aptamer binds, and the protein interactions that fragment the aptamer to produce a defined phenotype. In addition, peptide aptamers derivatized with appropriate functional moieties can induce specific post-translational modification of their target proteins, or alter the subcellular localization of targets. Peptide aptamers can also recognize targets in vitro. It has been used to replace antibodies in biosensors and to detect active isoforms of proteins in populations containing inactive and active protein forms. Derivatives called tadpoles (in which the peptide aptamer "head" is covalently linked to a unique sequence double-stranded DNA "tail") allow quantification by PCR (using, for example, quantitative real-time polymerase chain reaction) of their DNA tails Rare target molecules in a mixture.

Peptide aptamer selection can be performed using different systems, but the yeast two-hybrid system is currently most commonly used. Peptide aptamers can also be selected from combinatorial peptide libraries constructed by phage display and other surface display techniques such as mRNA display, ribosome display, bacterial display and yeast display. These experimental procedures are also known as biopannings. Among peptides obtained from biopanning, mimotopes can be considered as a type of peptide aptamer. Peptides panned from combinatorial peptide libraries have been deposited in a special database called MimoDB.

Exemplary effector moieties may include, but are not limited to: ubiquitin, bicyclic peptides as ubiquitin ligase inhibitors, transcription factors, DNA and protein modifying enzymes such as topoisomerases; topoisomerase inhibitors, such as topotecan; DNA methyltransferases such as the DNMT family (e.g. DNMT3A, DNMT3B, DNMT3a/3L, MQ1); protein methyltransferases (e.g. viral lysine methyltransferase (vSET), Protein-lysine N-methyltransferase (SMYD2), deaminases (e.g. APOBEC, UG1), histone methyltransferases such as enhancer of zeste homolog 2 (EZH2), PRMT1, histone-lysine Amino acid-N-methyltransferase (Setdb1), Histone methyltransferase (SET2), Euchromatin histone-lysine N-methyltransferase 2 (G9a), Histone-lysine N - Methyltransferases (SUV39H1) and G9a); histone deacetylases (eg HDAC1, HDAC2, HDAC3), enzymes with DNA demethylation (eg catalyzing the oxidation of 5-methylcytosine to 5-hydroxy TET family enzymes of methylcytosine and higher oxidized derivatives); protein demethylases such as KDM1A and lysine-specific histone demethylase 1 (LSD1); helicases such as DHX9, deethylase Acylases (such as sirtuins 1, 2, 3, 4, 5, 6, or 7), kinases, phosphatases, DNA intercalators (such as ethidium bromide, SYBR green, and proflavine); Efflux pump inhibitors such as peptidomimetics such as phenylalanine arginyl β-naphthylamide or quinoline derivatives; nuclear receptor activators and inhibitors, proteasome inhibitors, Competitive inhibitors of diseased enzymes, protein synthesis inhibitors, nucleases (e.g. Cpf1, Cas9, zinc finger nucleases), specific domains from proteins (such as KRAB domains), fusions of one or more thereof (e.g. dCas9-DNMT, dCas9-MQ1, dCas9-KRAB).

In some embodiments, candidate domains suitable for use as effector moieties can be determined by methods known to those skilled in the art. For example, a candidate effector moiety can be tested by assay whether the candidate effector moiety is present in the nucleus and appropriately localized (e.g. localized to a target gene or operably linked to a transcriptional control element of the target gene, e.g. via a target candidate effector portion) reduces expression of the target gene in the cell, such as reducing the level of RNA transcripts encoded by the target gene (as measured, for example, by RNASeq or northern blotting) or reducing the protein encoded by the target gene levels (eg as measured by ELISA).

In some embodiments, the expression inhibitor comprises a plurality of effector moieties, wherein each effector moiety has no detectable binding to another effector moiety, eg, does not bind. In some embodiments, the expression inhibition system comprises a first expression inhibitor comprising a first effector moiety and a second expression inhibitor comprising a second effector moiety, wherein binding of the first effector moiety to the second effector moiety is undetectable , such as not binding.

In some embodiments, the expression inhibition system comprises a plurality of expression inhibitors, wherein each member of the plurality of expression inhibitors comprises an effector moiety, wherein each effector moiety is undetectable, eg, does not bind, another effector moiety. In some embodiments, the expression inhibition system comprises a first expression inhibitor comprising a first effector moiety and a second expression inhibitor comprising a second effector moiety, wherein binding of the first effector moiety to the second effector moiety is undetectable , such as not binding. In some embodiments, the expression inhibition system comprises a first expression inhibitor comprising a first effector moiety and a second expression inhibitor comprising a second effector moiety, wherein binding of the first effector moiety to another first effector moiety is detected does not, eg does not bind, and the binding of the second effector moiety to another second effector moiety is undetectable, eg does not bind. In some embodiments, effector moieties used in the compositions and methods described herein function in the monomeric (eg, non-dimeric) state.

In some embodiments, the effector moiety is or comprises an epigenetic modifying moiety, eg, an epigenetic modifying moiety that modulates the two-dimensional structure of chromatin (ie, modulates chromatin structure in a manner that alters its two-dimensional presentation).

Epigenetic modification moieties suitable for use in the methods and compositions of the invention include agents that affect epigenetic markers such as DNA methylation, histone methylation, histone acetylation, histone ubiquitin Histone phosphorylation, histone phosphorylation, and RNA-associated silencing. Exemplary epigenetic enzymes that can target sequence elements of the genome as described herein include DNA methylases (e.g. DNMT3a, DNMT3b, DNMT3a/3L, MQ1), DNA demethylation (e.g. TET family), tissue Protein methyltransferase, histone deacetylase (e.g. HDAC1, HDAC2, HDAC3), longevity protein 1, 2, 3, 4, 5, 6 or 7, lysine-specific histone demethylase 1 ( LSD1), histone-lysine-N-methyltransferase (Setdb1), euchromatin histone-lysine N-methyltransferase 2 (G9a), histone-lysine N-methyltransferase Transferase (SUV39H1), enhancer of zeste homolog 2 (EZH2), viral lysine methyltransferase (vSET), histone methyltransferase (SET2), and protein-lysine N-methyltransferase Enzyme (SMYD2). Examples of such epigenetic regulators are described, eg, in de Groote et al., Nuc. Acids Res. (2012): 1-18.

In some embodiments, an expression suppressor useful herein (e.g., an expression suppressor comprising an epigenetic modification moiety) comprises or is a construct described in Koferle et al., Genome Medicine 7.59 (2015): 1-3, This document is incorporated herein by reference. For example, in some embodiments, the expression inhibitor comprises or is a construct found in Table 1 of Koferle et al., such as histone deacetylase, histone methyltransferase, DNA demethylation or H3K4 and/or H3K9 histone demethylases (eg dCas9-p300, TALE-TET1, ZF-DNMT3A or TALE-LSD1).

In some embodiments, the effector moiety comprises a component of a gene editing system, such as a CRISPR/Cas domain, such as a Zn finger domain, such as a TAL effector domain. In some embodiments, the epigenetic modification moiety may comprise a polypeptide (e.g., a peptide or protein moiety) linked to a gRNA and a target nuclease, e.g., Cas9, e.g., wild-type Cas9, nickase Cas9 (e.g., Cas9 D10A), Catalytically inactive Cas9 (dCas9), eSpCas9, Cpf1, C2C1, or C2C3, or a nucleic acid encoding such a nuclease.

As used herein, a "biologically active portion of an effector domain" is a portion that maintains the function (eg, fully, partially, minimally) of an effector domain (eg, a "minimal" or "core" domain). In some embodiments, dCas9 is combined with an epigenetic modifier such as a DNA methylase or an enzyme with DNA demethylation, e.g., DNMT3a, DNMT3b, DNMT3L, DNMT inhibitors, combinations thereof, TET family enzymes, proteins Acetyltransferase or deacetylase, dCas9-DNMT3a/3L, dCas9-DNMT3a/3L/KRAB, dCas9/VP64) fusion of all or part of one or more effector domains to form a chimeric protein linked to Polypeptides and are suitable for use in the methods described herein. Effector portions comprising such chimeric proteins are referred to as genetically modified portions (due to their use of the gene editing system component Cas9) or epigenetically modified portions (due to their use of effector domains of epigenetic modifiers).

In some embodiments, provided techniques comprising a gRNA specifically targeting a target gene are described. In some embodiments, the target gene is an oncogene, a tumor suppressor, or a gene associated with a disorder in which MYC is abnormally regulated. In some embodiments, the target gene is MYC.

In some embodiments, the technologies provided herein include methods of delivering one or more genetic modification moieties described herein (e.g., components of a CRISPR system) to an individual, e.g., to the nucleus or tissue of an individual, by This is accomplished by linking such moieties to the targeting moiety as part of a fusion molecule. In some embodiments, the techniques provided herein include incorporating one or more genetic modification moieties described herein by encapsulating one or more genetic modification moieties (e.g., components of a CRISPR system) in lipid nanoparticles A method of delivery (eg, a component of a CRISPR system) to an individual (eg, to a nucleus or a tissue of an individual).

Other Moieties The expression suppressor may further comprise one or more other moieties (eg, in addition to one or more targeting moieties and one or more effector moieties). In some embodiments, the additional moiety is selected from a labeling or monitoring moiety, a cleavable moiety (e.g., between a DNA targeting moiety and an effector moiety, or at the N-terminal or C-terminal multiple cleavable moiety of a polypeptide), small molecules, Membrane translocation polypeptides, or pharmaceutical agent moieties.

Exemplary Expression Inhibitors The following exemplary expression inhibitors are shown for illustrative purposes only and are not intended to be limiting.

In some embodiments, the expression suppressor comprises a targeting moiety comprising dCas9 (eg, S. aureus dCas9) and an effector moiety comprising MQ1 (eg, bacterial MQ1). In some embodiments, the expression suppressor is encoded by the nucleic acid sequence of SEQ ID NO: 68 (eg, nucleic acid (eg, cDNA) encoding the expression suppressor). In some embodiments, the expression suppressor is encoded by the nucleic acid sequence of SEQ ID NO: 119. In some embodiments, the nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 68, 119 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or the number of positions differing therefrom is no more than 20 , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence.

dCas9-MQ1 nucleotide sequence:

In some embodiments, the expression suppressor comprises the amino acid sequence of SEQ ID NO: 35 or 151. In some embodiments, the expression suppressor described herein comprises the amino acid sequence SEQ ID NO: 35, 151 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differs therefrom A sequence whose number of positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1.

dCas9-MQ1 protein sequence:

In some embodiments, the expression suppressor comprises a targeting moiety comprising dCas9 (eg, S. pyogenes dCas9) and an effector moiety comprising KRAB (eg, a KRAB domain). In some embodiments, the expression suppressor is encoded by the nucleic acid sequence of SEQ ID NO: 67 (eg, nucleic acid (eg, cDNA) encoding the expression suppressor). In some embodiments, the nucleic acid described herein comprises the nucleic acid sequence SEQ ID NO: 67 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or the number of positions differing therefrom is no more than 20, 19 , 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1.

dCas9-KRAB nucleotide sequence:

In some embodiments, the expression suppressor comprises the amino acid sequence of SEQ ID NO: 34 or 150. In some embodiments, a nucleic acid described herein comprises the amino acid sequence of SEQ ID NO: 34, 150, or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto, or differs therefrom in an infinite number of positions. More than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence.

dCas9-KRAB protein sequence:

In some embodiments, the expression suppressor comprises a DNA targeting moiety comprising dCas9 (eg, S. aureus dCas9) and an effector moiety comprising DNMT1 (eg, human DNMT1). In some embodiments, the expression inhibitor is encoded by the nucleic acid sequence of SEQ ID NO: 69 (eg, a nucleic acid (eg, cDNA) encoding an expression inhibitor). In some embodiments, the nucleic acid described herein comprises the nucleic acid sequence SEQ ID NO: 69 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or the number of positions differing therefrom is no more than 20, 19 , 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 position sequence.

dCas9-DNMT1 nucleotide sequence

In some embodiments, the expression suppressor comprises the amino acid sequence of SEQ ID NO: 36 or 152. In some embodiments, the expression suppressor described herein comprises the amino acid sequence of SEQ ID NO: 36, 152 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a position different therefrom A sequence of numbers not exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1.

dCas9-DNMT1 protein sequence:

In some embodiments, the expression suppressor comprises a DNA targeting moiety comprising dCas9 (eg, S. aureus dCas9) and an effector moiety comprising DNMT13a/3L. In some embodiments, the expression inhibitor is encoded by the nucleic acid sequence of SEQ ID NO: 70 (eg, a nucleic acid (eg, cDNA) encoding an expression inhibitor). In some embodiments, the nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 70 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or the number of positions differing therefrom is no more than 20, 19 , 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1.

dCas9-DNMT3a/3L nucleotide sequence

In some embodiments, the expression suppressor comprises the amino acid sequence of SEQ ID NO: 37 or 153. In some embodiments, the expression inhibitors described herein comprise the amino acid sequence of SEQ ID NO: 37 or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto, or differ therefrom in an infinite number of positions. More than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence.

dCas9-DNMT3a/3L protein sequence

ZF2-KRAB (nt) 56

ZF3-KRAB (nt) 57

ZF4-KRAB (nt) 58

ZF5-KRAB (nt) 59

ZF6-KRAB (nt) 60

ZF54-KRAB 189

ZF61-KRAB 193

ZF67-KRAB 194

ZF68-KRAB 195

In some embodiments, the expression suppressor comprises a targeting moiety comprising a Zn finger domain and an effector moiety comprising a KRAB (eg, a KRAB domain). In some embodiments, the expression inhibitor is composed of the nucleic acid sequence of any one of SEQ ID NO: 55, 56, 57, 58, 59, 60, 189, 194, 195 and 196 (such as a nucleic acid encoding an expression inhibitor (e.g. cDNA)) encoding. The nucleic acid sequences of these exemplary expression suppressors are disclosed in Table 6. In some embodiments, the nucleic acids described herein comprise the nucleic acid sequence of any one of SEQ ID NOs: 55-60, 189, 194-196, or are at least 80, 85, 90, 95, 99 or 100% identical thereto , or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence. In some embodiments, the nucleic acid sequence comprises a polyA sequence, and in other embodiments, the nucleic acid lacks a polyA sequence. Table 6 : Nucleotide sequences of exemplary ZF - KRAB effectors name SEQ ID NO. sequence ZF1-KRAB (nt) 55

ZF2-KRAB (nt) 56

ZF3-KRAB (nt) 57

ZF4-KRAB (nt) 58

ZF5-KRAB (nt) 59

ZF6-KRAB (nt) 60

ZF54-KRAB 189

ZF61-KRAB 193

ZF67-KRAB 194

ZF68-KRAB 195

ZF2-KRAB (aa) 23

ZF3-KRAB (aa) 24

ZF4-KRAB (aa) 25

ZF5-KRAB (aa) 26

ZF6-KRAB (aa) 27

tPT2A片段3+ZF3-KRAB 134

不含HA的ZF1-KRAB (aa) 139

不含HA的ZF2-KRAB (aa) 140

不含HA的ZF3-KRAB (aa) 141

不含HA的ZF4-KRAB (aa) 142

不含HA的ZF5-KRAB (aa) 143

不含HA的ZF6-KRAB (aa) 144

ZF54-KRAB aa 177

ZF61-KRAB aa 178

ZF67-KRAB aa 179

ZF68-KRAB aa 180

不含HA標記的ZF54-KRAB aa 183

不含HA標記的ZF61-KRAB aa 184

不含HA標記的ZF67-KRAB aa 185

不含HA標記的ZF68-KRAB 186

In some embodiments, the expression suppressor comprises a targeting moiety comprising a Zn finger domain (e.g., having an amino acid sequence according to any of SEQ ID NOs: 5-10 or 169-172) and a KRAB-containing (e.g., amine amino acid sequence SEQ ID NO: 18) (for example, the effector portion of the KRAB domain). In some embodiments, an expression suppressor described herein comprises the amine sequence of any one of SEQ ID NOs: 22, 23, 24, 25, 26, 27, 139-144, 177-180, or 183-186 . The protein sequences of these exemplary expressed suppressors are disclosed in Table 7. In some embodiments, the expression suppressor described herein comprises the amino acid sequence of any one of SEQ ID NO: 22-27, 139-144, 177-180, 183-186 or at least 80, 85, 90, 95, 99 or 100% identical sequence, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6 , 5, 4, 3, 2 or 1 sequence. Table 7: Amino acid sequences of exemplary zinc finger-KRAB effectors name SEQ ID NO. sequence ZF1-KRAB (aa) twenty two

ZF2-KRAB (aa) twenty three

ZF3-KRAB (aa) twenty four

ZF4-KRAB (aa) 25

ZF5-KRAB (aa) 26

ZF6-KRAB (aa) 27

tPT2A Fragment 3 + ZF3-KRAB 134

ZF1-KRAB without HA (aa) 139

ZF2-KRAB without HA (aa) 140

HA-free ZF3-KRAB (aa) 141

HA-free ZF4-KRAB (aa) 142

HA-free ZF5-KRAB (aa) 143

HA-free ZF6-KRAB (aa) 144

ZF54-KRAB aa 177

ZF61-KRAB aa 178

ZF67-KRAB aa 179

ZF68-KRAB aa 180

ZF54-KRAB aa without HA tag 183

ZF61-KRAB aa without HA tag 184

ZF67-KRAB aa without HA tag 185

ZF68-KRAB without HA tag 186

ZF8-MQ1 (nt) 62

ZF9-MQ1 (nt) 63

ZF10-MQ1 (nt) 64

ZF11-MQ1 (nt) 65

ZF12-MQ1 (nt) 66

ZF10-MQ1 (nt) 全長 116

ZF11-MQ1 (nt) 全長 117

ZF12-MQ1 (nt) 全長 118

不含HA的ZF9-MQ1 130

In some embodiments, the expression suppressor comprises a targeting moiety comprising a Zn finger domain (eg, a Zn finger domain encoded by a nucleotide sequence of any one of SEQ ID NOs: 44-49 or 115) and a targeting moiety comprising an MQ1 ( For example the effector portion of bacterial MQ1 (eg bacterial MQ1 encoded by the nucleotide sequence SEQ ID NO: 52). In some embodiments, the expression suppressor is encoded by the nucleic acid sequence of SEQ ID NO: 61, 62, 63, 64, 65, 66, 116, 117, 118 or 130. The nucleic acid sequences of these exemplary expression suppressors are disclosed in Table 8. In some embodiments, the nucleic acid described herein comprises the nucleic acid sequence of any one of SEQ ID NO: 61-66, 116-118, 130 or at least 80, 85, 90, 95, 99 or 100% identical thereto sequence, or the number of positions differing therefrom not exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 the sequence of. In some embodiments, the nucleic acid sequence comprises a polyA sequence, and in other embodiments, the nucleic acid lacks a polyA sequence. For example, in some embodiments, a nucleic acid described herein comprises a sequence according to any one of SEQ ID NOs: 61-66, 116-118 or 130 (or at least 80, 85, 90, 95, 99 Or 100% identical sequence, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1), but lacks a 3' polyA sequence or contains a shorter 3' polyA sequence. Table 8: Nucleotide sequences of exemplary ZF-MQ1 effectors name SEQ ID NO. sequence ZF7-MQ1 (nt) 61

ZF8-MQ1 (nt) 62

ZF9-MQ1 (nt) 63

ZF10-MQ1 (nt) 64

ZF11-MQ1 (nt) 65

ZF12-MQ1 (nt) 66

ZF10-MQ1 (nt) full length 116

ZF11-MQ1 (nt) full length 117

ZF12-MQ1 (nt) full length 118

ZF9-MQ1 without HA 130

ZF8-MQ1 (aa) 29

ZF9-MQ1 (aa) 30

ZF10-MQ1 (aa) 31

ZF11-MQ1 (aa) 32

ZF12-MQ1 (aa) 33

不含HA的ZF9-MQ1 129

ZF9-MQ1 + tPT2A的片段1 (aa) 133

不含HA的ZF7-MQ1 (aa) 145

不含HA的ZF8-MQ1 (aa) 146

不含HA的ZF10-MQ1 (aa) 147

不含HA的ZF11-MQ1 (aa) 148

不含HA的ZF12-MQ1 (aa) 149

In some embodiments, the expression suppressor comprises a targeting moiety comprising a Zn finger domain (e.g., the amino acid sequence of any one of SEQ ID NOs: 11-14) and a targeting moiety comprising MQ1 (e.g., bacterial MQ1 (e.g., SEQ ID NO: : the effect part of 19)). In some embodiments, the expression suppressor comprises the amine sequence of any one of SEQ ID NOs: 28, 29, 30, 31, 32, 33, 129, and 145-149. The protein sequences of these exemplary expressed suppressors are disclosed in Table 9. In some embodiments, the expression inhibitors described herein comprise the amino acid sequence of any one of SEQ ID NOs: 28-33, 129 or are at least 80, 85, 90, 95, 99, or 100% identical thereto sequence, or the number of positions differing therefrom not exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 the sequence of. Table 9. Amino acid sequences of exemplary ZF-MQ1 effectors name SEQ ID NO. sequence ZF7-MQ1 (aa) 28

ZF8-MQ1 (aa) 29

ZF9-MQ1 (aa) 30

ZF10-MQ1 (aa) 31

ZF11-MQ1 (aa) 32

ZF12-MQ1 (aa) 33

ZF9-MQ1 without HA 129

Fragment 1 (aa) of ZF9-MQ1 + tPT2A 133

ZF7-MQ1 without HA (aa) 145

ZF8-MQ1 without HA (aa) 146

ZF10-MQ1 without HA (aa) 147

ZF11-MQ1 without HA (aa) 148

ZF12-MQ1 without HA (aa) 149

In some embodiments, the expression suppressor comprises a targeting moiety comprising a Zn finger domain (eg, having the amino acid sequence of any one of SEQ ID NOs: 11-14) and a targeting moiety comprising MQ1 (eg, bacterial MQ1 (eg, SEQ ID NO: 11-14) NO: 87)) Effects section.

ZF16-MQ1 nt 167

ZF17-MQ1 nt 168

In some embodiments, the expression suppressor comprises a targeting moiety comprising a Zn finger domain (eg, a Zn finger domain encoded by a nucleotide sequence of any one of SEQ ID NOs: 166-168) and a targeting moiety comprising an MQ1 (eg, bacterial The effector portion of MQ1 (eg bacterial MQ1 encoded by the nucleotide sequence SEQ ID NO: 52). In some embodiments, the expression suppressor is encoded by the nucleic acid sequence of SEQ ID NO: 157, 158 or 159. The nucleic acid sequences of these exemplary expression suppressors are disclosed in Table 16. In some embodiments, the nucleic acid described herein comprises the nucleic acid sequence of any one of SEQ ID NO: 166-168 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or has a difference therefrom A sequence whose number of positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. In some embodiments, the nucleic acid sequence comprises a polyA sequence, and in other embodiments, the nucleic acid lacks a polyA sequence. For example, in some embodiments, a nucleic acid described herein comprises a sequence according to any one of SEQ ID NOs: 166-168 (or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto , or the number of positions differing therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence), but lacks a 3' polyA sequence or contains a 3' polyA sequence of shorter length. Table 16: Nucleotide sequences of exemplary mouse-specific ZF-MQ1 effectors name SEQ ID NO. sequence ZF15-MQ1 nt 166

ZF16-MQ1 nt 167

ZF17-MQ1 nt 168

ZF16-MQ1 aa 161

ZF17-MQ1 aa 162

不含HA標記的ZF15-MQ1 aa 163

不含HA標記的ZF16-MQ1 aa 164

不含HA標記的ZF17-MQ1 aa 165

In some embodiments, the expression suppressor comprises a targeting moiety comprising a Zn finger domain (such as the amino acid sequence of any one of SEQ ID NO: 154-156) and a targeting moiety comprising MQ1 (such as bacterial MQ1 (such as SEQ ID NO : the effect part of 19)). In some embodiments, the expression suppressor comprises the amine sequence of any one of SEQ ID NOs: 160-165. The protein sequences of these exemplary expressed suppressors are disclosed in Table 17. In some embodiments, the expression suppressor described herein comprises the amino acid sequence of any one of SEQ ID NO: 160-165 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, Or a sequence whose number of positions differing from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 . Table 17: Amino acid sequences of exemplary ZF-MQ1 effectors name SEQ ID NO. sequence ZF15-MQ1 aa 160

ZF16-MQ1 aa 161

ZF17-MQ1 aa 162

ZF15-MQ1 aa without HA tag 163

ZF16-MQ1 aa without HA tag 164

ZF17-MQ1 aa without HA tag 165

In some embodiments, the present invention provides an expression inhibition system comprising: a first targeting moiety comprising a first ZF, a first effector moiety comprising a DNA methyltransferase (e.g., MQ1 or a functional fragment thereof), comprising a second a second targeting portion of a ZF, and a second effector portion comprising KRAB (eg, a KRAB domain). In some embodiments, the expression suppression system is encoded by a first nucleic acid encoding a first targeting moiety and a first effector moiety, wherein expression is driven by a first promoter or IRES; and encoding a second targeting moiety and a second The second nucleic acid of the effector portion, wherein expression is driven by a second promoter or IRES. In some embodiments, monocistronic sequences are used. In some embodiments, the nucleic acid encoding the expression suppression system is a polycistronic sequence. In some embodiments, the polycistronic sequence is a dicistronic sequence. In some embodiments, the polycistronic sequence comprises a sequence encoding a first expression suppressor and a sequence encoding a second expression suppressor. In some embodiments, the polycistronic sequence encodes a self-cleavable peptide sequence, eg, a 2A peptide sequence, eg, a T2A peptide sequence, a P2A sequence. In some embodiments, the polycistronic sequence encodes a T2A peptide sequence and a P2A peptide sequence. In some embodiments, the polycistronic sequence encodes a tandem 2A sequence, such as a tPT2A sequence. In some embodiments, the polycistronic construct encodes from 5' to 3': (i) a first nuclear localization signal, such as SV40 NLS; (ii) a first targeting moiety, such as a DNA binding domain, such as a zinc finger Binding domains, such as ZF-9; (iii) first effector moieties, such as DNA methyltransferases, such as MQ1; (iv) secondary nuclear localization signals, such as nucleoplasmin NLS; (v) linkers, such as tPT2A linkers (vi) a third nuclear localization signal, such as SV40NLS; (vii) a second targeting moiety, such as a DNA binding domain, such as a zinc finger binding domain, such as ZF-3; (viii) a second effector moiety, such as transcriptional repression Moieties, such as KRAB; and (ix) a fourth nuclear localization signal, such as the nucleoplasmic protein NLS. In some embodiments, the bicistronic construct further comprises a polyA tail. In some embodiments, following transcription of the bicistronic gene construct, a single mRNA transcript encoding a first repressor of expression and a second repressor of expression is generated that is cleaved post-translationally, e.g., within a 2A peptide. The glycine residues are then cleaved, yielding the first and second expression suppressors as two separate proteins. In some embodiments, the first and second expression suppressors are separated by "ribosome skipping". In some embodiments, the first expression suppressor and/or the second expression suppressor retains a fragment of the 2A peptide after ribosomal skipping. In some embodiments, the first and second expressed inhibitors are expressed in equal amounts. In some embodiments, the first and second expressed inhibitors are expressed in different amounts. In some embodiments, the protein level of the first expressed suppressor is within (greater than or less than) 1%, 2%, 5% or 10% of the protein level of the second expressed suppressor.

In some embodiments, a system encoded by a bicistronic nucleic acid enables expression of a target gene (e.g., MYC) in a cell as compared to an otherwise similar system in which the first and second expression suppressors are encoded by a monocistronic nucleic acid. Performance is reduced by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%.

In some embodiments, the bicistronic sequence encodes the amino acid of SEQ ID NO: 91, 92, 121, 122, 181, 182, 187, 188, or at least 80, 85, 90, 95, 99, or 100 % Consistent sequence, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, A sequence of 2 or 1. In some embodiments, the expression inhibition system comprises a targeting moiety comprising a Zn finger domain (eg, comprising the amino acid sequence of any one of SEQ ID NO: 7 or 13) and a targeting moiety comprising MQ1 (eg, bacterial MQ1 (eg, SEQ ID NO: 7 or 13) NO: 19) or KRAB, such as the effector portion of a KRAB domain (eg, SEQ ID NO: 18). In some embodiments, the expression suppressor comprises SEQ ID NO: 91, 92, 121, 122, 181, 182, 187, 188. The protein sequences of these exemplary expression inhibition systems are disclosed in Table 10. In some embodiments, the expression inhibition systems described herein comprise SEQ ID NOs: 91-92, 121 - The amino acid sequence of any one of 122, 181, 182, 187, 188, or a sequence that is at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions that differ from it does not exceed 20 , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1.

ZF3- KRAB+Z F9- MQ1(aa) 92

ZF9- MQ1+ZF 3-KRAB (nt) 93

ZF3- KRAB+Z F9-MQ1 (nt) 94

ZF9- MQ1+ZF 3-KRAB 完整nt 序列 112

ZF3- KRAB+Z F9-MQ1 完整nt序列 113

ZF09- MQ1- tPT2A- ZF54- KRAB nt 196

ZF54- KRAB- tPT2A- ZF09- MQ1 nt 197

ZF9- MQ1+ZF 3-KRAB (aa) 121

ZF3- KRAB+Z F9- MQ1(aa) 122

ZF09- MQ1- tPT2A- ZF54- KRAB aa 181

ZF54- KRAB- tPT2A- ZF09- MQ1 aa 182

不含HA標記的ZF09- MQ1- tPT2A- ZF54- KRAB aa    187

不含HA標記的ZF54- KRAB- tPT2A- ZF09- MQ1 aa 188

In some embodiments, the bicistronic sequence comprises a nucleic acid sequence of SEQ ID NO: 93 or 112 (e.g., a nucleic acid encoding an expression suppressor (e.g., cDNA)) or SEQ ID NO: 94 or 113 (e.g., a nucleic acid encoding an expression inhibitor (eg cDNA)). In some embodiments, the bicistronic sequence comprises a nucleic acid sequence of SEQ ID NO: 196 (such as a nucleic acid (such as a cDNA) encoding an expression inhibitor) or SEQ ID NO: 197 (such as a nucleic acid (such as a cDNA) encoding an expression inhibitor ). In some embodiments, a nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 93, 94, 112, 113, 196, or 197, or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto, or A sequence that differs therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. Nucleic acid sequences encoding these exemplary expression suppression systems are disclosed in Table 10. In some embodiments, the nucleic acid sequence comprises a polyA sequence, and in other embodiments, the nucleic acid lacks a polyA sequence. Table 10. Amino Acid Sequences of Exemplary Expression Inhibition Systems and Nucleic Acid Sequences Encoding Exemplary Expression Inhibition Systems name SEQ ID NO: sequence ZF9-MQ1+ZF 3-KRAB (aa) 91

ZF3- KRAB+Z F9- MQ1(aa) 92

ZF9-MQ1+ZF 3-KRAB (nt) 93

ZF3-KRAB+Z F9-MQ1 (nt) 94

ZF9-MQ1+ZF3-KRAB complete nt sequence 112

ZF3-KRAB+Z F9-MQ1 complete nt sequence 113

ZF09-MQ1-tPT2A-ZF54-KRABnt 196

ZF54-KRAB-tPT2A-ZF09-MQ1 nt 197

ZF9-MQ1+ZF 3-KRAB (aa) 121

ZF3- KRAB+Z F9- MQ1(aa) 122

ZF09-MQ1-tPT2A-ZF54-KRAB aa 181

ZF54-KRAB-tPT2A-ZF09-MQ1 aa 182

ZF09-MQ1-tPT2A-ZF54-KRAB aa without HA tag 187

ZF54-KRAB-tPT2A-ZF09-MQ1 aa without HA tag 188

In some embodiments, the expression suppressor comprises a nuclear localization sequence (NLS). In some embodiments, the expression suppressor comprises an NLS, for example comprising a SV40 NLS at the N-terminus. In some embodiments, the expression suppressor comprises an NLS, eg, a nucleoplasmin NLS at the C-terminus. In some embodiments, the expression suppressor comprises a first NLS at the N-terminus and a second NLS at the C-terminus. In some embodiments, the first and second NLS have the same sequence. In some embodiments, the first and second NLS have different sequences. In some embodiments, the expression suppressor comprises a SV40 NLS, eg, the expression suppressor comprises a sequence according to PKKKRK (SEQ ID NO: 135). In some embodiments, the N-terminal sequence comprises an NLS and a spacer, for example having a sequence according to MAPKKKRKVGIHGVPAAGSSGS (SEQ ID NO: 88). In some embodiments, the expression suppressor comprises a C-terminal sequence comprising one or more (e.g., any two or all three) of: a spacer, a nucleoplasmin nuclear localization sequence, and an HA tag: e.g., SGGKRPAATKKAGQAKKKGSYPYDVPDYA (SEQ ID NO: 89). In some embodiments, the expression suppressor comprises an epitope tag, eg, HA tag: YPYDVPDYA (SEQ ID NO: 90). For example, an expression suppressor can comprise two copies of an epitope tag.

Although epitope tags are useful in a variety of research settings, it is sometimes necessary to omit epitope tags in therapeutic settings. Accordingly, in some embodiments, the expression suppressor lacks an epitope tag. In some embodiments, an expression inhibitor described herein comprises a sequence provided herein (or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto, or differs therefrom by no more than 20, 19 , 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1), but it lacks the HA of SEQ ID NO: 90 Label. In some embodiments, a nucleic acid described herein comprises a sequence provided herein (or a sequence at least 80, 85, 90, 95, 99, or 100% identical thereto, or differs therefrom by no more than 20, 19, 18 positions). , 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1), but it lacks the HA tag encoding SEQ ID NO: 90 Area. In some embodiments, the expression suppressor comprises nucleoplasmic protein NLS, for example, the expression suppressor comprises the sequence of KRPAATKKAGQAKKK (SEQ ID NO: 136). In some embodiments, the expression suppressor does not comprise NLS. In some embodiments, the expression suppressor does not comprise an epitope tag. In some embodiments, the expression suppressor does not comprise an HA tag. In some embodiments, the expression suppressor does not comprise the HA tag sequence according to SEQ ID NO:90.

In some embodiments, the invention provides expression inhibition systems comprising self-cleaving peptides. Self-cleaving peptides, originally found in picornaviruses, are peptides between 19 and 22 amino acids in length and are usually found between two proteins in some members of the picornavirus family. Picornaviruses are able to utilize multiple genes at equimolar levels from self-cleaved proteins, produced from the same mRNA. Such self-cleaving proteins are known to be found in other species of viruses, and those skilled in the art can readily determine suitable substitutions for the self-cleaving proteins disclosed herein, if desired, based on the information provided herein. In some embodiments, the expression inhibition system comprises a self-cleaving peptide, such as a 2A self-cleaving peptide. In some embodiments, the 2A peptide comprises a single cleavage site, eg, a 2A peptide, eg, a P2A, T2A, E2A or F2A peptide. In some embodiments, a self-cleaving peptide (eg, a 2A peptide) comprises two cleavage sites, eg, pPT2A or P2A-T2A-E2A. In some embodiments, the expression inhibition system comprises a self-cleaving peptide containing multiple cleavage sites, such as a T2A self-cleaving peptide and a P2A self-cleaving peptide. In some embodiments, the 2A peptide is cleaved after translation. In some embodiments, a self-cleaving peptide produces two or more fragments upon cleavage. In some embodiments, the 2A peptide fragment comprises the sequence of SEQ ID NO: 126-128. In some embodiments, the 2A self-cleaving peptide comprises the sequence of SEQ ID NO: 120, 124, 125 or derivatives thereof. In some embodiments, SEQ ID NO: 95 comprises a self-cleaving peptide sequence.

It will of course be understood that although a 2A sequence such as a tPT2A sequence (e.g. according to SEQ ID NO: 124) may be referred to as a self-cleaving peptide in the scientific literature and herein, this is by non-limiting theory. According to another non-limiting theory, In some embodiments, the 2A sequence functions via ribosomal skipping. For example, an mRNA encoding a 2A sequence can induce ribosome skipping, wherein the ribosome fails to form a peptide bond while simultaneously translating the 2A region, resulting in a translation product The first part of the translation product is released. The ribosome then produces the second part of the translation product. Overall, it has been clearly established that the 2A sequence placed between the first sequence and the second sequence causes a first protein comprising the first sequence and a protein comprising the second Respective second proteins of the two sequences are produced.The present invention is not bound by any particular theory as to the molecular mechanism by which this is achieved.

Functional Features The expression suppressors or systems of the invention can be used to reduce the expression of a target gene (eg, MYC) in a cell. In general, an expression suppressor or system as described herein binds (eg, via a targeting moiety) in proximity to and/or is operably linked to a gene body sequence element of a target gene (eg, MYC). In some embodiments, binding of a gene body sequence element by an expression suppressor or system modulates (eg, reduces) the expression of a target gene (eg, MYC). For example, target gene (eg, MYC) expression can be modulated (eg, reduced) by expression suppressors or systemic binding to gene body sequence elements comprising an effector moiety that inhibits the recruitment of components of the transcriptional machinery. As another example, the combination of an expression suppressor or system comprising an effector moiety having enzymatic activity (e.g., an epigenetic modification moiety) can modulate (e.g., reduce) the expression of a target gene (e.g., MYC) via localization of the effector moiety's enzymatic activity . As another example, binding of an expression repressor or system to a gene body sequence element and localization of the enzymatic activity of the expression repressor or system can result in a resulting modulation (eg, reduction) in the expression of a target gene (eg, MYC).

In some embodiments, reducing expression comprises reducing the level of RNA (eg, mRNA) encoded by a target gene (eg, MYC). In some embodiments, reducing expression comprises reducing the level of a protein encoded by a target gene (eg, MYC). In some embodiments, reducing expression comprises reducing the levels of mRNA and protein encoded by a target gene (eg, MYC). In some embodiments, exposure to an expression suppressor or expression suppression system disclosed herein is compared to the expression of a target gene in a cell that has not been exposed to or does not comprise an expression suppressor or expression suppression system disclosed herein, and is exposed to an expression suppressor or expression suppression system disclosed herein. Expression suppressors or expression suppression systems or cells comprising expression suppressors or expression suppression systems disclosed herein reduce target gene expression by at least 1.05x (i.e., 1.05-fold), 1.1x, 1.15x, 1.2x, 1.25x , 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.55x, 1.6x, 1.65x, 1.7x, 1.75x, 1.8x, 1.85x, 1.9x, 1.95x, 2x, 3x, 4x, 5x , 6x, 7x, 8x, 9x, 10x, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, or 100x. Expression of a target gene (eg, MYC) can be analyzed by methods known to those skilled in the art, including RT-PCR, ELISA, Western blotting, and the methods of Examples 2-9. The expression level of a target gene (such as MYC) in an individual, such as a patient, such as suffering from MYC abnormality, can be assessed by evaluating the level of the target gene (such as MYC) in blood (such as whole blood), such as by the method in the following literature Patients with a modulating disorder, such as patients with liver disease, patients with neoplastic and/or viral or alcohol-related liver diseases, such as patients with liver cancer, such as patients with liver cancer subtype S1 or liver cancer subtype S2 : Oglesbee et al., Clin Chem. 2013 Oct;59(10):1461-9. Digital Object ID: 10.1373/clinchem.2013.207472 or Deutsch et al., J Neurol Neurosurg Psychiatry. 2014 Sep;85(9 ):994-1002. Digital Object Identification Number: 10.1136/jnnp-2013-306788, the contents of which are incorporated herein by reference in their entirety.

The expression suppressors or systems of the invention can be used to reduce the expression of a target gene (eg, MYC) in a cell over a certain period of time. In some embodiments, contacting the expression suppressor or system or a target gene (e.g., MYC) in a cell comprising the expression suppressor or system significantly reduces expression by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or at least 1, 2, 3, 4, 5, 6, 7, 10 , 14 or 15 days, or at least 1, 2, 3, 4, or 5 weeks, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, or at least 1 , 2, 3, 4 or 5 years (eg indefinitely). Optionally, exposure to the expression suppressor or system or a target gene (e.g. MYC) expression in cells comprising the expression suppressor or system significantly reduces expression by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 year. In some embodiments, the target gene (e.g., MYC) in contact with the expressed suppressor or system or a cell comprising the expressed suppressor or system is expressed at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or Significantly decreased during 10 cell divisions. The expression suppressor or system of the invention can be used to methylate CpG nucleotides in a target promoter, such as the MYC promoter. In some embodiments, the transcriptional change in MYC expression correlates with percent CpG methylation. In some embodiments, methylation is maintained for at least 1 day, at least 2 days, at least 5 days, at least 7 days, at least 10 days, at least 15 days, or at least 20 days following treatment with an expression inhibitor or system disclosed herein.

The expression suppressors or systems of the invention can be used to reduce the survival of cells comprising a targeted locus (eg, the MYC locus). In some embodiments, an expression suppressor or system of the invention can be used to reduce the survival of a plurality of cells comprising a targeted locus (eg, the MYC locus). In some embodiments, the number of viable cells exposed to the expressed inhibitor or system or comprising the expressed inhibitor or system is compared to the number of viable cells in a control cell population not contacted with the expressed inhibitor or system or not comprising the expressed inhibitor or system The number of significantly reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100%.

In some embodiments, the expression inhibitors or systems of the invention can be used to reduce the survival of a plurality of cells, including cancer cells and non-cancer cells. In some embodiments, an expression inhibitor or system of the invention can be used to reduce the survival rate of a plurality of cancer cells more than it reduces the survival rate of a plurality of non-cancerous cells. In some embodiments, the expression inhibitors or systems of the invention can be used to reduce the survival of a plurality of cancer cells by 1.05x (i.e., 1.05 times), the reduction in the survival of a plurality of non-cancer cells, 1.1x, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x , 8x, 9x, 10x, 20x, 50x or 100x.

In some embodiments, the expression inhibitors or systems of the invention can be used to reduce the viability of a plurality of cells, including both infected and uninfected cells. In some embodiments, an expression inhibitor or system of the invention can be used to reduce the survival of infected cells more than it reduces the survival of uninfected cells. In some embodiments, an expression inhibitor or system of the invention can be used to reduce the survival of infected cells by 1.05x (i.e., 1.05 times), the reduction in the survival of uninfected cells by a factor of 1.05, 1.1x, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x , 8x, 9x, 10x, 20x, 50x or 100x.

An expression inhibitory system may comprise a plurality of expression inhibitors, wherein each expression inhibitor comprises an effector moiety that is functionally different from the effector moiety of another expression inhibitor. For example, an expression repression system may comprise two expression repressors, wherein a first expression repressor comprises a first effector moiety comprising an epigenetic modification moiety (e.g., a DNA methyltransferase, e.g., MQ1) and a second expression repressor A second effector moiety comprising a transcriptional repressor (eg KRAB) is included. In some embodiments, the second expression suppressor does not comprise a second effector moiety. In some embodiments, the expression suppression system comprises an expression suppressor comprising a combination of effector moieties whose functions are complementary to each other in suppressing expression of a target gene (e.g., MYC), wherein the functions together suppress expression and Performance is not suppressed or negligibly suppressed when present individually, as appropriate. In some embodiments, the expression suppression system comprises a plurality of expression suppressors, wherein each expression suppressor comprises an effector moiety complementary to the effector moiety of each other expression suppressor, eg, each effector moiety reduces expression of a target gene (eg, MYC).

In some embodiments, the expression suppression system comprises an expression suppressor comprising a combination of effector moieties that function synergistically with each other in inhibiting expression of a target gene (eg, MYC). Without wishing to be bound by theory, epigenetic modifications to gene body loci can accumulate as multiple individual repressive epigenetic markers (e.g. multiple different types of epigenetic markers and/or larger range markers) together are more effective in suppressing expression than the individual modifications alone (eg, a greater reduction in expression and/or a longer-lasting reduction in expression). In some embodiments, the expression suppression system comprises a plurality of expression suppressors, wherein each expression suppressor comprises an effector moiety that acts synergistically with the effector moieties of each other expression suppressor, eg, each effector moiety reduces the expression of a target gene (eg, MYC).

In some embodiments, the expression suppressor or system modulates (e.g., reduces) the expression of a target gene (e.g., MYC) by altering one or more of the expression control sequences associated with the target gene (e.g., MYC) or operably linked thereto. multiple epigenetic markers. In some embodiments, altering comprises reducing the level of an epigenetic marker associated with a target gene (eg, MYC) or an expression control sequence operably linked thereto. Epigenetic marks include, but are not limited to, DNA methylation, histone methylation, and histone deacetylation.

In some embodiments, altering the level of an epigenetic marker reduces the level of an epigenetic marker associated with a target gene (e.g., MYC) or an expression control sequence operably linked thereto, compared to uncontacted expression suppressors or The level of an epigenetic marker associated with a target gene (eg, MYC) or an expression control sequence operably linked thereto is at least 1.05x (i.e., 1.05-fold) lower in the system or in cells that do not comprise the expression suppressor or system , 1.1x, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.55x, 1.6x, 1.65x, 1.7x, 1.75x, 1.8x, 1.85x, 1.9 x, 1.95x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, or 100x. Epigenetic marker levels can be analyzed by methods known to those skilled in the art, including whole genome bisulfite sequencing, simplified representation bisulfite sequencing, bisulfite amplicon sequencing, Methylation array, pyrosequencing, ChIP-seq or ChIP-qPCR. In some embodiments, bisulfite genome sequencing can be used to analyze epigenetic markers (e.g., DNA methylation) at precise gene body coordinates according to the hg19 reference gene body (e.g., chr8 according to the hg19 reference gene body). : between 129188693-129189048) (eg increase or decrease). In some embodiments, bisulfite gene body sequencing can be used to analyze changes (e.g., increases or decreases) in epigenetic markers (e.g., DNA methylation) at gene body positions according to SEQ ID NO: 123 .

The expression suppressors or systems of the invention can be used to alter the level in a cell of an epigenetic marker associated with a target gene (eg, MYC) or an expression control sequence operably linked thereto over a period of time. In some embodiments, contacting the expression suppressor or system or a cell comprising the expression suppressor or system significantly reduces the level of an epigenetic marker associated with the target gene or an expression control sequence operably linked thereto by at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or at least 1, 2, 3, 4, 5, 6, 7, 10, or 14 days, or at least 1, 2, 3, 4, or 5 weeks, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, or at least 1, 2, 3, 4 or 5 years (eg indefinitely). Optionally, contacting the expression suppressor or system or a cell comprising the expression suppressor or system significantly reduces the level of an epigenetic marker associated with a target gene (e.g., MYC) or an expression control sequence operably linked thereto by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 year.

suppressor combination

In some embodiments, the expression suppression system comprises a first expression inhibitor comprising a first effector moiety and a second expression inhibitor comprising a second effector moiety, wherein the first effector moiety and the second effector moiety are different from each other. In some embodiments, the first effector moiety is or comprises a first epigenetic modification moiety (eg, increases or decreases a first epigenetic marker) or a functional fragment thereof and the second effector moiety is or comprises a second epigenetic modification moiety A modifying moiety (eg, increasing or decreasing a second epigenetic marker) or a functional fragment thereof. In some embodiments, the first effector moiety is or comprises a DNA methyltransferase or a functional fragment thereof and the second effector moiety is or comprises a KRAB or a functional fragment thereof. In some embodiments, the first effector moiety is or comprises a histone deacetylase or a functional fragment thereof and the second effector moiety is or comprises KRAB or a functional fragment thereof. In some embodiments, the first effector moiety is or comprises a histone methyltransferase or a functional fragment thereof and the second effector moiety n is or comprises KRAB or a functional fragment thereof. In some embodiments, the first effector moiety is or comprises a histone demethylase or a functional fragment thereof and the second effector moiety is or comprises KRAB or a functional fragment thereof.

In some embodiments, the first effector moiety is or comprises MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8 , HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (aka LSD1), KDM1B (aka LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C , KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (ie, G9A), EHMT1 (ie, GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, or a functional fragment of any of them, and The second effector moiety is or comprises KRAB (eg, KRAB domain), MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or a functional fragment of any of them.

In some embodiments, the first effector moiety is or comprises a functional fragment of KRAB (e.g., a KRAB domain), MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, or any one thereof, and the second effector moiety is or comprises MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, KDM1A (aka LSD1), KDM1B (aka LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, SETDB1, SETDB2, EHMT2 (aka , G9A), EHMT1 (ie, GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, or a functional fragment of any of them.

In some embodiments, the first effector moiety is or comprises MQ1 or a functional variant or fragment thereof and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.

In some embodiments, the first effector moiety is or comprises DNMT3A or a functional variant or fragment thereof and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.

In some embodiments, the first effector moiety is or comprises DNMT3B or a functional variant or fragment thereof and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.

In some embodiments, the first effector moiety is or comprises DNMT3L or a functional variant or fragment thereof and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.

In some embodiments, the first effector moiety is or comprises a DNMT3a/3L complex or a functional variant or fragment thereof and the second effector moiety is or comprises KRAB or a functional variant or fragment thereof.

Targets The expression suppressors or expression suppression systems disclosed herein can be used to modulate (eg, reduce) the expression of a target gene (eg, MYC) in cells (eg, cells of an individual or patient). The target gene (eg MYC) can be any gene known to those skilled in the art. In some embodiments, the target gene (eg, MYC) is associated with a disease or condition in an individual (eg, a mammal, eg, a human, cow, horse, sheep, chicken, rat, mouse, cat, or dog). A target gene may include coding sequences, such as exons, and/or non-coding sequences, such as introns, 3'UTRs or 5'UTRs. In some embodiments, the target gene is operably linked to a transcriptional control element.

Targeting moieties suitable for use in the expression suppressors or expression suppression systems described herein can bind (e.g., specifically bind) to: any site within a target gene (e.g., MYC), be operably linked to a target gene (e.g., MYC) Transcriptional control elements, anchor sequences (e.g., anchor sequences in close proximity to the target gene, or anchor sequences operatively linked to the target gene (e.g., MYC) mediate adapters (e.g., if fragmentation of the adapter changes the target expression of a gene (such as MYC), the anchor sequence-mediated adapter is operably linked to the target gene) associated anchor sequence), or a regulatory element located in a super-enhancer region (such as a super-enhancer located in MYC Regulatory elements in the region).

In some embodiments, an expression inhibitor described herein binds at or adjacent to a site. For example, a targeting moiety can bind to a first site adjacent to a repressor (second site), and an effector moiety linked to the targeting moiety can epigenetically modify the first site so as to modulate potentiation The effect of the promoter on the expression of the target gene is substantially the same as the second site (enhancer sequence) that has been bound and/or modified. In some embodiments, the target gene is located in close proximity to a target gene (such as an exon, an intron, or a splice site within a target gene), close to a transcriptional control element operably linked to a target gene (such as MYC), or close to a The site of the anchor sequence is less than 5000, 4000 from the target gene (eg MYC) (eg exon, intron, or splice site within the target gene (eg MYC), transcriptional control element or anchor sequence , 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, or 25 base pairs (and optionally, from a target gene (e.g., MYC) (e.g., an exon, Introns, or splice sites within the target gene), transcriptional control elements, or at least 20, 25, 50, 100, 200, or 300 base pairs of an anchor sequence).

In some embodiments, the targeting moiety binds to a target gene, such as MYC. In some embodiments, the DNA targeting moiety binds to a site within the exon of a target gene (eg, MYC). In some embodiments, the targeting moiety binds to a site within an intron of a target gene (eg, MYC). In some embodiments, the targeting moiety binds to a site, such as a splice site, at an exon-intron boundary of a target gene (eg, MYC). In some embodiments, the targeting moiety binds to a site within the 5'UTR of a target gene (eg, MYC). In some embodiments, the targeting moiety binds to a site within the 3'UTR of a target gene (eg, MYC). Target genes include, but are not limited to, the gene encoding MYC.

In some embodiments, the targeting moiety binds to a transcriptional control element operably linked to a target gene (eg, MYC). In some embodiments, the targeting moiety binds to a portion of, or a site within, a promoter operably linked to a target gene (eg, MYC). In some embodiments, targeting moieties bind to the start of transcription of a target gene (eg, MYC). In some embodiments, the targeting moiety binds to a portion of, or a site within, an enhancer operably linked to a target gene (eg, MYC). In some embodiments, a gene body complex (eg, ASMC) colocalizes two or more gene body sequence elements, wherein the two or more gene body sequence elements include a promoter. A promoter is typically a sequence element that initiates transcription of an associated gene. A promoter is typically near the 5' end of a gene, not far from its start of transcription. As is understood by those of ordinary skill, transcription of protein-coding genes in eukaryotic cells typically begins with binding of common transcription factors (eg, TFIID, TFIIE, TFIIH, FUSE, CT elements, etc.) and mediators to the core promoter sequence to initiate The pre-initiation complex, the pre-initiation complex, directs RNA polymerase II towards the start of transcription and in many cases remains bound to the core promoter sequence even after RNA polymerase escapes and initiates primary transcript elongation. In some embodiments, a promoter includes sequence elements such as TATA, Inr, DPE, or BRE, but those skilled in the art are well aware that such sequences are not necessarily necessary to define a promoter. Those skilled in the art are familiar with a variety of positive transcriptional control elements (such as enhancers) or negative transcriptional control elements (such as repressors or silencers) associated with genes. In some embodiments, the transcriptional control element is a transcription factor binding site. Typically, when a cognate regulatory protein binds to such a transcriptional control element, transcription from the linked gene is altered (eg, increased or decreased). In some embodiments, the targeting moiety binds to a gene body sequence located within gene body coordinates GRCh37:chr8:129162465-129212140.

In some embodiments, a targeting moiety binds to a target sequence comprised or partially comprised by a gene body sequence element. In some embodiments, the genome sequence element is or comprises an expression control sequence. In some embodiments, the gene body sequence element is or comprises a target gene, eg, MYC, or a portion of a target gene, eg, MYC. In some embodiments, the targeting moiety binds to a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 bases (and up to 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 or 20 bases) of the target sequence. In some embodiments, the targeting moiety binds to a target sequence that is 10-30, 15-30, 15-25, 18-24, 19-23, 20-23, 21-23, or 22-23 bases in length . In some embodiments, the target sequence has 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 , 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 bases in length. In some embodiments, the genome sequence element is or comprises an anchor sequence.

Each ASMC comprises one or more anchor sequences, eg, a plurality. In some embodiments, the anchor sequence can be manipulated or altered to modulate (e.g., disrupt) a naturally occurring gene body complex (e.g., ASMC) or to form a new gene body complex (e.g., ASMC) (e.g., with an exogenous or altered anchor Sequences together form non-naturally occurring gene body complexes (eg, ASMC)). In some embodiments, anchor sequence-mediated adapters are cleavable to alter (eg, inhibit, eg, reduce) target gene expression. Such breaks can modulate gene expression, eg, by altering the topology of the DNA, eg, by modulating the ability of the target gene to interact with transcriptional control elements (eg, enhancing and silencing/repressing sequences).

In some embodiments, the targeting moiety binds to the anchor sequence, e.g., in proximity to the target gene (e.g., MYC) or associated with an anchor sequence-mediated adapter (ASMC) operably linked to the target gene (e.g., MYC) (eg, if disruption of the adapter alters expression of the target gene (eg, MYC), the anchor sequence mediates the operative linkage of the adapter to the target gene, such as MYC). In general, an anchor sequence is a gene body sequence element to which a gene body complex component (eg, a nucleating polypeptide) specifically binds. In some embodiments, binding of a gene body complex component to an anchor sequence results in nucleation complex formation, eg, ASMC formation. In some embodiments, the targeting moiety binds to a target gene, such as the MYC locus. A locus is generally defined as comprising a transcribed region, a promoter, and an anchor site for ASMC comprising a target gene (eg, MYC). In some embodiments, the targeting moiety binds to a sequence comprising any of SEQ ID NOs: 75-86 or 199-206. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 75-86 and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 75-86. sequence, wherein the first and second targeting moieties bind to the same sequence. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 75-86 and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 75-86. sequence, wherein the first and second targeting moieties bind to different sequences. In some embodiments, the first targeting moiety binds to a sequence comprising any one of SEQ ID NO: 83, 203, or 206 and the second targeting moiety binds to a sequence comprising SEQ ID NO: 77. In some embodiments, the first targeting moiety binds to a sequence comprising SEQ ID NO: 77 and the second targeting moiety binds to a sequence comprising any of SEQ ID NO: 83, 203, or 206. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 83, 203, or 206, and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 199, 204, or 205. sequence of either. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 199, 204, or 205, and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 83, 203, or 206. sequence of either. In some embodiments, the first targeting moiety binds to a sequence comprising any one of SEQ ID NO: 83, 203, or 206 and the second targeting moiety binds to a sequence comprising SEQ ID NO: 201. In some embodiments, the nucleic acid encoding the first and second expression inhibitors comprises a first region encoding the first expression inhibitor, wherein the first region is upstream of the second region encoding the second expression inhibitor. In some embodiments, the nucleic acid encoding the first and second expression inhibitors comprises a first region encoding the first expression inhibitor, wherein the first region is downstream of the second region encoding the second expression inhibitor. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 75-86 or 199-206, and the second targeting moiety (e.g., a CRISPR/Cas domain comprising a gRNA) binds to a sequence comprising any one of SEQ ID NO: 1-4. In some embodiments, the targeting moiety binds to a sequence comprising any one of SEQ ID NOs: 96-110. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 96-110 and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 96-110 sequence, wherein the first and second targeting moieties bind to the same sequence. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 96-110 and the second targeting moiety binds to a sequence comprising any of SEQ ID NOs: 96-110 sequence, wherein the first and second targeting moieties bind to different sequences. In some embodiments, the first targeting moiety binds to a sequence comprising any of SEQ ID NOs: 96-110, and the second targeting moiety (e.g., a CRISPR/Cas domain comprising a gRNA) binds to a sequence comprising any of SEQ ID NO: 96-110. NO: the sequence of any one of 1-4. In some embodiments, the first targeting moiety binds to a sequence comprising any one of the SEQ ID Nos disclosed in Table 2, 12 or 13, and the second targeting moiety (e.g., a CRISPR/Cas domain comprising a gRNA) binds to a sequence comprising any one of the SEQ ID No. disclosed in Table 2, 12 or 13.

GRCh37: chr8:128746267-128746287 ZF2- KRAB 76

GRCh37: chr8:128746349-128746369 ZF3- KRAB 77

GRCh37: chr8:128746405-128746425 ZF4- KRAB 78

GRCh37: chr8:128746455-128746475 ZF5- KRAB 79

GRCh37: chr8:128746339-128746359 ZF6- KRAB 80

GRCh37: chr8:128746287-128746307 ZF7-MQ1 81

GRCh37: chr8:128747885-128747905 ZF8-MQ1 82

GRCh37: chr8:128747990-128748010 ZF9-MQ1 83

GRCh37: chr8:128748069-128748089 ZF10- MQ1 84

GRCh37: chr8:128748143-128748163 ZF11- MQ1 85

GRCh37: chr8:128747897-128747917 ZF12- MQ1 86

GRCh37: chr8:128747829-128747849 ZF54- KRAB 199

GRCh37: chr8:129188825- 129188845 ZF61- KRAB 200

GRCh37: chr8:129209866-129209888 ZF67- KRAB 201

GRCh37: chr8:129188822-129188842 ZF68- KRAB 202

GRCh37: chr8:129189024-129189044 ZF09- MQ1- tPT2A- ZF54- KRAB 靶序列1 203

GRCh37: chr8:128748069-128748089 ZF09- MQ1- tPT2A- ZF54- KRAB 靶序列2 204

GRCh37: chr8:129188825-129188845 ZF54- KRAB- tPT2A- ZF09- MQ1 靶序列1 205

GRCh37: chr8:129188825-129188845 ZF54- KRAB- tPT2A- ZF09- MQ1 靶序列2 206

GRCh37: chr8:128748069-128748089 Exemplary target sequences are disclosed in Table 12. Table 12: Exemplary target sequences name SEQ ID NO: sequence genome coordinates ZF1-KRAB 75

GRCh37: chr8:128746267-128746287 ZF2-KRAB 76

GRCh37: chr8:128746349-128746369 ZF3-KRAB 77

GRCh37: chr8:128746405-128746425 ZF4-KRAB 78

GRCh37: chr8:128746455-128746475 ZF5-KRAB 79

GRCh37: chr8:128746339-128746359 ZF6-KRAB 80

GRCh37: chr8:128746287-128746307 ZF7-MQ1 81

GRCh37: chr8:128747885-128747905 ZF8-MQ1 82

GRCh37: chr8:128747990-128748010 ZF9-MQ1 83

GRCh37: chr8:128748069-128748089 ZF10-MQ1 84

GRCh37: chr8:128748143-128748163 ZF11-MQ1 85

GRCh37: chr8:128747897-128747917 ZF12-MQ1 86

GRCh37: chr8:128747829-128747849 ZF54-KRAB 199

GRCh37: chr8:129188825-129188845 ZF61-KRAB 200

GRCh37: chr8:129209866-129209888 ZF67-KRAB 201

GRCh37: chr8:129188822-129188842 ZF68-KRAB 202

GRCh37: chr8:129189024-129189044 ZF09-MQ1-tPT2A-ZF54-KRAB target sequence 1 203

GRCh37: chr8:128748069-128748089 ZF09-MQ1-tPT2A-ZF54-KRAB target sequence 2 204

GRCh37: chr8:129188825-129188845 ZF54-KRAB-tPT2A-ZF09-MQ1 target sequence 1 205

GRCh37: chr8:129188825-129188845 ZF54-KRAB-tPT2A-ZF09-MQ1 target sequence 2 206

GRCh37: chr8:128748069-128748089

In some embodiments, the expression suppressor binds to a gene body locus having a sequence set forth herein (eg, any of SEQ ID NOs: 1-4, 75-86, 96-110, or 199-206). It will be appreciated that in many cases the associated gene body locus comprises double-stranded DNA, and that this locus can be described by showing the sequence of its sense or antisense strand. Thus, a gRNA with a specified spacer sequence can induce expression suppressor binding to a specific gene body locus, wherein one strand in the gene body locus has a sequence similar to or identical to the spacer sequence, and the gene body locus The other strand in has a complementary sequence. Typically, binding of a gRNA to a gene body locus will involve some unwinding of the gene body locus and pairing of the gRNA spacer with the spacer complementary strand.

GRCm38: chr15:61985053- 61985073 ZF16- MQ1 191

GRCm38: chr15:61985079- 61985099 ZF17- MQ1 192

GRCm38: chr15:61985151- 61985171 In some embodiments, the targeting moiety binds to the anchor sequence, e.g., in proximity to the target gene (e.g., MYC) or associated with an anchor sequence-mediated adapter (ASMC) operably linked to the target gene (e.g., MYC) (eg, if disruption of the adapter alters the expression of the target gene (eg, MYC) in the mouse gene body, the anchor sequence mediates the operative linkage of the adapter to a target gene, such as MYC). In general, an anchor sequence is a gene body sequence element to which a gene body complex component (eg, a nucleating polypeptide) specifically binds. In some embodiments, binding of a gene body complex component to an anchor sequence results in nucleation complex formation, eg, ASMC formation. In some embodiments, the targeting moiety binds to a target gene, such as the MYC locus. A locus is generally defined as comprising a transcribed region, a promoter, and an anchor site for ASMC comprising a target gene (eg, MYC). In some embodiments, the targeting moiety binds to a sequence comprising any one of SEQ ID NOs: 190-192. In some embodiments, the targeting moiety binds to a sequence comprising any one of the SEQ ID Nos. disclosed in Table 18. Exemplary target sequences in the mouse gene body are disclosed in Table 18. Table 18: Exemplary target sequences in the mouse gene body name SEQ ID NO: sequence genome coordinates ZF15-MQ1 190

GRCm38: chr15:61985053-61985073 ZF16-MQ1 191

GRCm38: chr15:61985079-61985099 ZF17-MQ1 192

GRCm38: chr15:61985151-61985171

In some embodiments, the expression suppressor binds to a gene body locus having a sequence set forth herein (eg, any of SEQ ID NOs: 190-192). It will be appreciated that in many cases the associated gene body locus comprises double-stranded DNA, and that this locus can be described by showing the sequence of its sense or antisense strand.

In one embodiment, the anchor sequence-mediated adapter comprises a loop, such as an intrachromosomal loop. In certain embodiments, the anchor sequence-mediated adapter has a plurality of loops. One or more loops may include a first anchor sequence, a nucleic acid sequence, a transcription control sequence, and a second anchor sequence. In another embodiment, at least one loop comprises a first anchor sequence, a transcriptional control sequence and a second anchor sequence, or a first anchor sequence, a nucleic acid sequence and a second anchor sequence, in sequence. In yet another embodiment, one or both of the nucleic acid sequence and the transcriptional control sequence are located within or outside the loop. In another embodiment, one or more loops comprise transcriptional control sequences.

In some embodiments, the anchor sequence-mediated adapter comprises a TATA box, a CAAT box, a GC box, or a CAP site. In some embodiments, the anchor sequence-mediated adapter comprises a plurality of loops, and wherein the anchor sequence-mediated adapter comprises at least one of an anchor sequence, a nucleic acid sequence, and a transcription control sequence in one or more loops one.

In some embodiments, the chromatin structure is modified by substituting, adding, or deleting one or more nucleotides within the anchor sequence. In some embodiments, the chromatin structure is modified by substituting, adding, or deleting one or more nucleotides within the anchor sequence of the anchor sequence-mediated adapter. In some embodiments, transcription is inhibited by including an activation loop or excluding a repression loop. In one such embodiment, the anchor sequence-mediated adapter does not include a transcription control sequence that reduces transcription of the nucleic acid sequence. In some embodiments, transcription is inhibited by including an inhibitory loop or excluding an activation loop. In one such embodiment, the anchor sequence-mediated adapter includes a transcription control sequence that reduces transcription of the nucleic acid sequence.

The anchor sequences may not be contiguous to each other. In embodiments using non-contiguous anchor sequences, the first and second anchor sequences can be separated by about 500 bp to about 500 Mb, about 750 bp to about 200 Mb, about 1 kb to about 100 Mb, about 1 kb to about 100 Mb, about 25 kb to about 50 Mb, about 50 kb to about 1 Mb, about 100 kb to about 750 kb, about 150 kb to about 15,500 kb, or about 175 kb to about 500 kb. In some embodiments, the first anchor sequence is separated from the second anchor sequence by about 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1 kb, 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, kb, 30 kb, 35 kb, 40 kb, 45 kb, 50 kb, 55 kb, 60 kb, 65 kb, 70 kb, 75 kb, 80 kb, 85 kb, 90 kb, 95 kb, 100 kb, 125 kb, 150 kb, 175 kb, 200 kb, 225 kb, 250 kb, 275 kb, 300 kb, 350 kb, 400 kb, 500 kb, 600 kb, 700 kb, 800 kb, 900 kb, 1 Mb, 2 Mb, 3 Mb , 4 Mb, 5 Mb, 6 Mb, 7 Mb, 8 Mb, 9 Mb, 10 Mb, 15 Mb, 20 Mb, 25 Mb, 50 Mb, 75 Mb, 20 100 Mb, 200 Mb, 300 Mb, 400 Mb, 500 Mb or any size in between.

In some further embodiments, the targeting moiety introduces at least one of: at least one exogenous anchor sequence; at least one alteration of the binding site of the engaging nuclear molecule, such as by altering the binding affinity of the engaging nuclear molecule ; a change in the orientation of at least one common nucleotide sequence, such as a CTCF binding motif, a YY1 binding motif, a ZNF143 binding motif or other binding motifs mentioned herein; and a substitution, addition or deletion of at least one anchor sequence , such as CTCF binding motifs, YY1 binding motifs, ZNF143 binding motifs or other binding motifs mentioned herein.

In some embodiments, the anchor sequence comprises a nucleating polypeptide binding motif, such as a CTCF binding motif: N(T/C/G)N(G/A/T)CC(A/T/G)(C/ G)(C/T/A)AG(G/A)(G/T)GG(C/A/T)(G/A)(C/G)(C/T/A)(G/A/ C) (SEQ ID NO: 71), wherein N is any nucleotide.

The CTCF binding motif can also be in the opposite orientation, for example (G/A/C)(C/T/A)(C/G)(G/A)(C/A/T)GG(G/T)(G /A)GA(C/T/A)(C/G)(A/T/G)CC(G/A/T)N(T/C/G)N (SEQ ID NO: 72). wherein N is any nucleotide.

In some embodiments, the anchor sequence comprises SEQ ID NO: 71 or SEQ ID NO: 72 or at least 75%, at least 80%, at least 90%, at least 95%, At least 96%, at least 97%, at least 98%, at least 99% identical sequences.

In some embodiments, the anchor sequence comprises a nucleating polypeptide binding motif, such as the YY1 binding motif: CCGCCANTTT (SEQ ID NO: 73), wherein N is any nucleotide.

The YY1 binding motif can also be in the opposite orientation, such as AANATGGCGG (SEQ ID NO: 74), wherein N is any nucleotide.

In some embodiments, the anchor sequence-mediated adapter comprises at least a first anchor sequence and a second anchor sequence. For example, in some embodiments, the first anchor sequence and the second anchor sequence can each comprise a nucleating polypeptide binding motif, eg, each comprise a CTCF binding motif.

In some embodiments, the first anchor sequence and the second anchor sequence comprise different sequences, for example the first anchor sequence comprises a CTCF binding motif and the second anchor sequence comprises an anchor other than the CTCF binding motif sequence. In some embodiments, each anchor sequence comprises a nucleating polypeptide binding motif and one or more flanking nucleotides flanking one or both sides of the nucleating polypeptide binding motif.

Two CTCF binding motifs that can form ASMCs (e.g. contiguous or non-contiguous CTCF binding motifs) can be present in the gene body in any orientation, e.g. same orientation (tandem) 5'-3' (left tandem, e.g. two containing CTCF binding motif of SEQ ID NO: 71) or 3'-5' (right tandem, e.g. two CTCF binding motifs comprising SEQ ID NO: 72), or convergent orientation, wherein one CTCF binding motif comprises SEQ ID NO: 71 and another remaining motif comprising SEQ ID NO: 72.

In some embodiments, the anchor sequence comprises a CTCF binding motif associated with a target gene (e.g., MYC), wherein the target gene is associated with a disease, disorder, and/or condition, e.g., a MYC dysregulated disorder, e.g., liver disease (e.g., liver cancer ) or lung cancer.

In some embodiments, the methods of the invention comprise modulating (e.g., disrupting) a gene body complex (e.g., ASMC), e.g., by modifying chromatin structure, by substituting, adding, or deleting anchor sequences (e.g., nucleating polypeptide binding one or more nucleotides in the body). One or more nucleotides can be specifically targeted, eg, targeted for changes, to effect a substitution, addition or deletion within an anchor sequence (eg, a nucleating polypeptide binding motif).

In some embodiments, a gene body complex (eg, ASMC) can be altered by altering the orientation of at least one nucleating polypeptide binding motif. In some embodiments, the anchor sequence comprises a nucleating polypeptide binding motif, such as a CTCF binding motif, and the targeting moiety introduces a change in at least one nucleating polypeptide binding motif, such as altering the binding affinity for the nucleating polypeptide.

In some embodiments, the target gene (eg, MYC) has a defined expression state, such as a disease state, prior to administration of an expression suppressor or system described herein. For example, a target gene (eg, MYC) may be highly expressed in diseased cells. By disrupting the anchor sequence-mediated adapter, the expression of target genes such as MYC can be reduced.

Targeting moieties for expression inhibitors suitable for use in the expression inhibition systems described herein can bind (e.g., specifically bind) to a group comprising at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 , 46, 47, 48, 49, or 50 nucleotides or base pairs (and, as the case may be, no more than 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38 , 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13 , 12, 11 or 10 nucleotides or base pairs). In some embodiments, the DNA targeting moiety binds to a , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides or bases Base pair positions.

The expression inhibition system of the present invention may comprise two or more expression inhibitors. In some embodiments, the expression inhibitors in the expression inhibition system each comprise a different targeting moiety.

In some embodiments, the expression suppression system comprises: a first expression suppressor comprising a target that binds to a target gene (e.g., an exon, an intron, or an exon-intron boundary (e.g., a splice site)). and a second expression suppressor comprising a targeting moiety that binds to a target gene (eg, an exon, an intron, or an exon-intron boundary (eg, a splice site)). In some embodiments, the expression suppression system comprises: a first expression suppressor comprising a target that binds to a target gene (e.g., an exon, an intron, or an exon-intron boundary (e.g., a splice site)). and a second expression suppressor comprising a targeting moiety that binds to a transcriptional control element (eg, a promoter or enhancer) operably linked to a target gene (eg, MYC). In some embodiments, the expression suppression system comprises: a first expression suppressor comprising a targeting moiety that binds to a transcriptional control element (such as a promoter or enhancer) operably linked to a target gene; and a second expression suppressor A promoter comprising a targeting moiety that binds to a transcriptional control element (eg, a promoter or enhancer) operably linked to a target gene. In some embodiments, the expression suppression system comprises: a first expression suppressor comprising an anchor sequence mediated engagement that binds to a target gene (e.g., MYC) in proximity to or operably linked to a target gene (e.g., MYC) and a second expression suppressor comprising a targeting moiety that binds to a transcriptional control element (such as a promoter or enhancer) operably linked to a target gene (such as MYC). In some embodiments, the expression suppression system comprises: a first expression suppressor comprising an anchor sequence mediated engagement that binds to a target gene (e.g., MYC) in proximity to or operably linked to a target gene (e.g., MYC) targeting moieties of body-associated anchor sequences; and a second expression suppressor comprising binding to target genes (e.g. MYC) (e.g. exons, introns, or exon-intron boundaries (e.g. splicing) The targeting moiety of the site)). In some embodiments, the expression suppression system comprises: a first expression suppressor comprising an anchor sequence mediated engagement that binds to a target gene (e.g., MYC) in proximity to or operably linked to a target gene (e.g., MYC) a targeting portion of an anchor sequence associated with a body; and a second expression suppressor comprising a mediator that binds to an anchor sequence that is in close proximity to or operably linked to a target gene (such as MYC) The targeting moiety of the adapter-associated anchor sequence.

In some embodiments, the expression suppression system comprises: a first expression suppressor comprising a target bound to a first site, such as a first site in a promoter operably linked to a target gene (eg, MYC) and a second expression suppressor comprising a targeting moiety that binds to a second site, eg, a second site in a promoter operably linked to a target gene (eg, MYC). The first and second positions may be distinct and non-overlapping positions, eg, the first and second positions do not share any sequence in common. The first site and the second site can be different but overlapping sites, eg, the first site and the second site comprise different sequences but share some sequences in common.

In some embodiments, the target gene is MYC. In some embodiments, MYC is located on human chromosome 8. In some embodiments, a presentation repressor or presentation repression system as described herein binds to the transcriptional start (TSS) of MYC.

Other compositions Nucleic acid and carrier The invention further relates, in part, to nucleic acids encoding the expression suppressors or expression suppression systems described herein. In some embodiments, the expression suppressor may be provided via a composition comprising a nucleic acid encoding the expression suppressor, wherein the nucleic acid is associated with sufficient expression of the expression suppressor in a system of interest (e.g., a particular cell, tissue, organism, etc.) other serial correlations. In some embodiments, the expression suppression system may be provided via a composition comprising a nucleic acid encoding the expression suppression system (e.g., an expression suppressor in the expression suppression system), wherein the nucleic acid is sufficiently compatible to achieve the expression suppression system (e.g., Expression inhibitors) other sequence associations expressed in a system of interest (eg, a particular cell, tissue, organism, etc.).

In some specific embodiments, the invention provides compositions of nucleic acids encoding expression inhibitors or polypeptide portions thereof. In some such embodiments, provided nucleic acids can be or include DNA, RNA, or any other nucleic acid portion or entity as described herein, and can be prepared by any technique described herein or available in the art (eg, synthesis, cloning, amplification, in vitro or in vivo transcription, etc.). In some embodiments, provided nucleic acids encoding expression inhibitors, or polypeptide portions thereof, may be operatively associated with one or more replication, integration and/or expression signals that are appropriate and/or sufficient to achieve the provided The integration, replication and/or expression of the nucleic acid in the concerned system (such as a specific cell, tissue, organism, etc.).

In some embodiments, a composition for delivery of an expression inhibitor as described herein is or comprises a vector, such as a viral vector, comprising an expression inhibitor as described herein or one or more components encoding an expression inhibitor as described herein of one or more nucleic acids.

In some specific embodiments, the invention provides compositions of nucleic acids encoding an expression suppression system, one or more expression suppressors, or polypeptide portions thereof. In some such embodiments, provided nucleic acids can be or include DNA, RNA, or any other nucleic acid portion or entity as described herein, and can be prepared by any technique described herein or available in the art (eg, synthesis, cloning, amplification, in vitro or in vivo transcription, etc.). In some embodiments, provided nucleic acids encoding an expression suppression system, one or more expression suppressors, or polypeptide portions thereof, may be operatively associated with one or more replication, integration, and/or expression signals, suitably and /or sufficient to achieve integration, replication and/or expression of the provided nucleic acid in the system of interest (eg, specific cells, tissues, organisms, etc.).

In some embodiments, a composition for delivery of an expression suppression system described herein is or comprises a vector, such as a viral vector, comprising a vector encoding one or more components of an expression suppression system (e.g., an expression suppression system as described herein). One or more nucleic acids expressing a suppressor in the system.

In some embodiments, a composition for delivering an expression suppressor as described herein is or comprises RNA, such as mRNA, comprising a protein encoding an expression suppressor or one or more components of an expression suppressor as described herein. one or more nucleic acids.

In some embodiments, a composition for delivery of an expression suppression system described herein is or comprises RNA, such as mRNA, comprising a protein encoding one or more components of an expression suppression system (e.g., as in an expression suppression system described herein). One or more nucleic acids of expression inhibitors of .

A nucleic acid as described herein or a nucleic acid encoding a protein described herein can be incorporated into a vector. Vectors, including those derived from retroviruses such as lentiviruses, are suitable tools for long-term gene transfer because they allow long-term stable integration of the transgene and propagation in daughter cells. Examples of vectors include expression vectors, replication vectors, probe generation vectors, and sequencing vectors. Expression vectors can be provided to cells as viral vectors. Viral vector technology is well known in the art and described in various virology and molecular biology manuals. Viruses suitable for use as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, suitable vectors contain an origin of replication functional in at least one organism, a promoter sequence, suitable restriction endonuclease sites, and one or more selectable markers.

Expression of natural or synthetic nucleic acids is typically achieved by operably linking the nucleic acid encoding the gene of interest to a promoter and incorporating the construct into an expression vector. Vectors may be suitable for replication and integration in eukaryotes. A typical cloning vector contains transcriptional and translational terminators, initiation sequences and a promoter suitable for expression of the desired nucleic acid sequence.

Other promoter elements, such as enhancer sequences, can regulate the frequency of transcription initiation. Typically, these sequences are located in a region 30-110 bp upstream of the start of transcription, but various promoters have recently been shown to also contain functional elements downstream of the transcription start site.

In some embodiments, the expression inhibitors or systems described herein act on enhancer sequences. In some embodiments, the enhancer sequence is an enhancer, stretch enhancer, shadow enhancer, locus control region (LCR), or super enhancer. In some embodiments, a super-enhancer comprises a cluster of enhancers and other regulatory elements. In some embodiments, such sequences are located in a region .2-2 Mb upstream or downstream of the start of transcription. In some embodiments, this region is a non-coding region. In some embodiments, the region contains at least one SNP associated with a higher risk of developing cancer. In some embodiments, the region is associated with long-range regulation of a target gene (eg, MYC). In some embodiments, the region is cell type specific. In some embodiments, a super-enhancer modulates (eg, increases or decreases) target gene expression, eg, MYC expression, by recruiting a target gene promoter (eg, MYC promoter). In some embodiments, a super-enhancer interacts with a target gene promoter (eg, MYC promoter) via an enhancer docking site. In some embodiments, the enhancer docking site is an anchor sequence. In some embodiments, the enhancer docking site is located at least 100 bp, 200 bp, 500 bp, 1000 bp, 1500 bp, 2000 bp, or 3000 bp from the target gene promoter (eg, the MYC promoter). In some embodiments, the super-enhancer region has at least 100 bp, at least 200 bp, at least 300 bp, at least 500 bp, at least 1 kb, at least 2 kb, at least 3 kb, at least 5 kb, at least 10 kb, at least 15 kb , at least 20 kb or at least 25 kb in length.

The spacing between promoter elements is usually flexible so that when elements are inverted or moved relative to each other, promoter function is maintained. In the thymidine kinase (tk) promoter, the spacing between promoter elements can increase to 50 bp apart before activity begins to decline. Depending on the promoter, individual elements appear to act cooperatively or independently to activate transcription.

One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high expression of any polynucleotide sequence operably linked to it. In some embodiments, the suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences can also be used, including but not limited to Simian Virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) ) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr virus (Epstein-Barr virus) immediate early promoter, Rous sarcoma virus (Rous sarcoma virus) promoter, and human gene promoters such as But not limited to, actin promoter, myosin promoter, heme promoter, and creatine kinase promoter.

The present invention should not be construed as being limited to use with any particular promoter or class of promoters (eg, constitutive promoters). For example, inducible promoters are contemplated as part of the invention in some embodiments. In some embodiments, an inducible promoter is used to provide a molecular switch capable of turning on the expression of a polynucleotide sequence operably linked thereto when such expression is desired. In some embodiments, an inducible promoter is used to provide a molecular switch capable of turning off expression when it is not desired. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

In some embodiments, the expression vector to be introduced may also contain a selectable marker gene or a reporter gene or both to facilitate the identification and selection of expressing cells from a population of cells seeking to be transfected or infected by the viral vector. In some aspects, selectable markers can be carried on separate DNA segments and used in co-transfection procedures. Both the selectable marker and the reporter gene may be flanked by appropriate transcriptional control sequences to enable expression in the host cell. Suitable selectable markers may include, for example, antibiotic resistance genes such as neo and the like.

In some embodiments, reporter genes can be used to identify potentially transfected cells and/or to assess the function of transcriptional control sequences. In general, a reporter gene is a gene that is absent from or expressed by the source of the recipient (of the reporter gene), and the expression of the polypeptide encoded by the gene shows some easily detectable characteristics , such as enzymatic activity or visualizing fluorescence. Expression of the reporter gene is analyzed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g. Ui-Tei et al. , 2000 FEBS Letters 479: 79-82). Suitable presentation systems are well known and can be prepared using known techniques or purchased commercially. In general, the construct showing the highest expression of the reporter gene with the smallest 5' flanking region was identified as the promoter. Such promoter regions can be linked to reporter genes and used to assess the ability of agents to modulate promoter-driven transcription.

Cells The present invention additionally relates in part to cells comprising the expression suppressors or expression suppression systems described herein. Any cell, such as a cell line known to those skilled in the art, eg, a cell line suitable for expressing a recombinant polypeptide, is suitable for comprising an expression suppressor or expression suppression system as described herein. In some embodiments, cells (eg, cell lines) can be used to express an expression suppressor or expression suppression system, such as the expression suppressors described herein. In some embodiments, cells (eg, cell lines) can be used to express or amplify nucleic acids, eg, vectors, encoding expression suppressors or expression suppressor systems (eg, expression suppressors described herein). In some embodiments, a cell comprises a nucleic acid encoding an expression suppressor or expression suppressor system (eg, an expression suppressor described herein).

In some embodiments, the cell comprises a first nucleic acid encoding a first component of the expression suppression system (e.g., a first expression suppressor), and a first nucleic acid encoding a second component of the expression suppression system (e.g., a second expression suppressor). Two nucleic acids. In some embodiments wherein the cell comprises a nucleic acid encoding an expression inhibition system comprising two or more expression inhibitors, the sequences encoding each expression inhibitor are placed on separate nucleic acid molecules, for example on different vectors, For example, a first vector encoding a first expression suppressor and a second vector encoding a second expression suppressor. In some embodiments, the sequences encoding the respective expression inhibitors are placed on the same nucleic acid molecule, eg, on the same vector. In some embodiments, some or all of the nucleic acid encoding the expression suppression system is integrated in the gene body DNA of the cell. In some embodiments, the nucleic acid encoding the first expression suppressor in the expression suppression system is integrated in the gene body DNA of the cell, and the nucleic acid encoding the second expression suppressor in the expression suppression system is not integrated in the gene body DNA of the cell in (e.g. on a carrier). In some embodiments, the nucleic acids encoding the first and second expression suppressors in the expression suppression system are integrated in the genomic DNA of the cell, e.g., at the same (e.g., adjacent or colocalized) site in the genomic DNA or different locations.

Examples of cells that may contain and/or express an expression suppression system or expression suppressor described herein include, but are not limited to, hepatocytes, neuronal cells, endothelial cells, myocytes, and lymphocytes.

The invention additionally pertains to cells produced by the methods or processes described herein. In some embodiments, the invention provides a cell produced by providing an expression suppressor or expression suppression system described herein, providing the cell, and contacting the cell with the expression suppressor (or nucleic acid encoding the expression suppressor, or comprising The expression inhibitor or nucleic acid composition) or the expression inhibition system (or the nucleic acid encoding the expression inhibition system, or the composition comprising the expression inhibition system or nucleic acid) is contacted. In some embodiments, contacting the cell with the expression inhibitor comprises contacting the cell with a nucleic acid encoding the expression inhibitor under conditions that allow the cell to produce the expression inhibitor. In some embodiments, contacting the cell with the expression inhibitor comprises contacting an organism comprising the cell with the expression inhibitor or a nucleic acid encoding the expression inhibitor under conditions that allow the cell to produce the expression inhibitor.

Without wishing to be bound by theory, cells contacted with an expression suppressor or expression suppression system described herein may exhibit a reduction in the expression of a target gene (e.g., MYC) compared to similar cells that have not been contacted with the expression suppressor or expression suppression system and/or changes in epigenetic markers associated with the target gene (eg MYC), transcriptional control elements operably linked to the target gene (eg MYC), or in proximity to the target gene or operably linked to the target gene The anchor sequence of the target gene (eg MYC) mediates the anchor sequence associated with the adapter. In some embodiments, cells exhibiting such reduction in expression of a target gene (eg, MYC) and/or changes in epigenetic markers do not comprise expression suppressors or expression suppression systems. The reduction in appearance and/or alteration of expression of a genetic marker may be persistent, for example, following contact with an expression suppressor or expression suppression system, in the presence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or at least 1, 2, 3, 4, 5, 6, 7, 10, or 14 hours days, or at least 1, 2, 3, 4, or 5 weeks, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, or at least 1, 2, 3 , 4 or 5 years (eg indefinitely).

In some embodiments, the reduction in expression and/or changes in epigenetic markers in cells previously contacted with the expression inhibitor or expression inhibition system are maintained after the expression inhibitor or expression inhibition system is no longer present in the cell , for example, after the expression suppressor or expression suppression system is no longer present in the cell, for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or at least 1, 2, 3, 4, 5, 6, 7, 10, or 14 days, or at least 1, 2, 3, 4, or 5 weeks, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, or at least 1, 2, 3, 4, or 5 years (eg, indefinitely).

Methods of Making Expression Suppressor Systems and/or Expression Suppressors In some embodiments, expression suppressors comprise or are proteins and thus can be produced by protein production methods. In some embodiments, the expression suppression system (eg, the expression suppressor in the expression suppression system) comprises one or more proteins and thus can be produced by protein production methods. As will be appreciated by those skilled in the art, methods of making proteins or polypeptides (which may be included in modulators as described herein) are routine in the art. See generally Smales and James (eds), Therapeutic Proteins: Methods and Protocols (Methods in Molecular Biology), Humana Press (2005); and Crommelin, Sindelar and Meibohm (eds), Pharmaceutical Biotechnology: Fundamentals and Applications, Springer (2013).

The proteins or polypeptides in the compositions of the invention can be biochemically synthesized using standard solid phase techniques. Such methods include exclusive solid phase synthesis, partial solid phase synthesis methods, fragment condensation, classical solution synthesis. These methods can be used when the peptide is relatively short (eg, 10 kDa) and/or when it cannot be produced by recombinant techniques (ie, not encoded by a nucleic acid sequence) and thus involves different chemical reagents.

Solid phase synthesis procedures are well known in the art and are further described in John Morrow Stewart and Janis Dillaha Young, Solid Phase Peptide Syntheses, 2nd Edition, Pierce Chemical Company, 1984; and Coin, I. et al., Nature Protocols, 2 :3247-3256, 2007.

For longer peptides, recombinant methods can be used. Methods of manufacturing recombinant therapeutic polypeptides are routine in the art. See generally Smales and James (eds), Therapeutic Proteins: Methods and Protocols (Methods in Molecular Biology), Humana Press (2005); and Crommelin, Sindelar & Meibohm (eds), Pharmaceutical Biotechnology: Fundamentals and Applications, Springer (2013).

Exemplary methods for producing therapeutic pharmaceutical proteins or polypeptides involve expression in mammalian cells, but insect cells, yeast, bacteria or other cells can also be used to produce recombinant proteins under the control of appropriate promoters. Mammalian expression vectors may contain non-transcribed elements, such as an origin of replication, a suitable promoter, and other 5' or 3' flanking non-transcribed sequences, and 5' or 3' non-translated sequences, such as essential ribosome binding sites, polyadenylation nucleotide acidification sites, splice donor and acceptor sites, and termination sequences. DNA sequences derived from the SV40 viral genome, such as the SV40 origin, early promoter, splice sites, and polyadenylation sites, can be used to provide other genetic elements necessary for expression of heterologous DNA sequences. Selection and expression vectors suitable for bacterial, fungal, yeast, and mammalian cell hosts are described in Green and Sambrook, Molecular Cloning: A Laboratory Manual (Fourth Edition), Cold Spring Harbor Laboratory Press (2012).

Where large quantities of proteins or polypeptides are desired, they can be produced using techniques such as those described in: Brian Bray, Nature Reviews Drug Discovery, 2:587-593, 2003; and Weissbach and Weissbach, 1988, Methods for Plant Molecular Biology , Academic Press, NY, Chapter VIII, pp. 421-463.

Recombinant proteins can be expressed and produced using a variety of mammalian cell culture systems. Examples of mammalian expression systems include CHO cells, COS cells, HeLA and BHK cell lines. Host cell culture methods for the production of protein therapeutics are described in Zhou and Kantardjieff (eds), Mammalian Cell Cultures for Biologics Manufacturing (Advances in Biochemical Engineering/Biotechnology), Springer (2014). The compositions described herein may include vectors encoding recombinant proteins, such as viral vectors, eg lentiviral vectors. In some embodiments, a vector (eg, a viral vector) may comprise nucleic acid encoding a recombinant protein. The compositions described herein may include lipid nanoparticles that encapsulate recombinant protein-encoding vectors, such as viral vectors, eg lentiviral vectors. In some embodiments, a lipid nanoparticle encapsulating a vector (eg, a viral vector) can comprise a nucleic acid encoding a recombinant protein.

Purification of protein therapeutics is described in Franks, Protein Biotechnology: Isolation, Characterization, and Stabilization, Humana Press (2013); and Cutler, Protein Purification Protocols (Methods in Molecular Biology), Humana Press (2010). The formulation of protein therapeutics is described in Meyer (ed.), Therapeutic Protein Drug Products: Practical Approaches to formulation in the Laboratory, Manufacturing, and the Clinic, Woodhead Publishing Series (2012).

Proteins contain one or more amino acids. Amino acids include any compound and/or substance that can be incorporated into a polypeptide chain, eg, via the formation of one or more peptide bonds. In some embodiments, the amino acid has the general structure _H2NC (H)I-COOH. In some embodiments, the amino acid is a naturally occurring amino acid. In some embodiments, the amino acid is an unnatural amino acid; in some embodiments, the amino acid is a D-amino acid; in some embodiments, the amino acid is an L-amino acid. "Standard amino acid" refers to any of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Non-standard amino acid" means any amino acid other than a standard amino acid, whether prepared synthetically or obtained from a natural source. In some embodiments, amino acids (including carboxyl and/or amino terminal amino acids in polypeptides) may contain structural modifications compared to the above general structure. For example, in some embodiments, compared with the general structure, methylation, amidation, acetylation (such as amine group, carboxylic acid group, one or more protons and/or hydroxyl group) can be used , PEGylation, glycosylation, phosphorylation and/or substitution to modify amino acids. In some embodiments, such modifications can, for example, alter the circulating half-life of a polypeptide containing a modified amino acid compared to a polypeptide containing the otherwise identical unmodified amino acid. In some embodiments, such modifications do not significantly alter the associated activity of a polypeptide containing the modified amino acid as compared to a polypeptide containing the otherwise identical unmodified amino acid. As apparent from the context, in some embodiments, the term "amino acid" may be used to refer to a free amino acid; in some embodiments, it may be used to refer to an amino acid residue of a polypeptide.

Pharmaceutical Compositions, Formulations, Delivery and Administration The present invention additionally relates in part to pharmaceutical compositions comprising expression inhibitors or expression inhibition systems such as those described herein; comprising encoding expression inhibitors or expression inhibition systems (e.g. Pharmaceutical compositions of nucleic acids expressing inhibitors described herein); and/or compositions for delivery of expressing inhibitors or expression inhibiting systems (such as expressing inhibitors described herein) to cells, tissues, organs and/or individuals .

As used herein, the term "pharmaceutical composition" refers to an active agent (such as A nucleic acid that expresses a suppressor or expresses a receptor, such as an expression suppressor system, such as an express suppressor in an expression suppressor system, or a nucleic acid encoding the same). In some embodiments, the active agent is present in the therapeutic regimen in an amount suitable for administration in a unit dosage that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, a pharmaceutical composition comprising an expressed inhibitor of the invention comprises an expressed inhibitor or a nucleic acid encoding the same. In some embodiments, pharmaceutical compositions comprising the expression inhibition system of the present invention comprise various expression inhibitors in the expression inhibition system or nucleic acids encoding them (for example, if the expression inhibition system comprises a first expression inhibitor and a second expression inhibitor , the pharmaceutical composition comprises the first and the second expression inhibitor). In some embodiments, the pharmaceutical composition comprises less than all of the expression inhibitors in an expression inhibition system comprising a plurality of expression inhibitors. For example, an expression inhibitory system can comprise a first expression inhibitor and a second expression inhibitor, and a first pharmaceutical composition can comprise the first expression inhibitor or a nucleic acid encoding the same and a second pharmaceutical composition can comprise the second expression inhibitor. A suppressor or a nucleic acid encoding the same. In some embodiments, a pharmaceutical composition may comprise a co-formulation of one or more expression inhibitors or nucleic acids encoding the same.

In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those forms adapted for oral administration, such as drenches (aqueous or non-aqueous solutions or suspensions), lozenges ( e.g. lozenges for buccal, sublingual and systemic absorption), boluses, powders, granules, pastes for tongue application; parenteral administration, e.g. subcutaneous, intramuscular, intravenous or epidural injection, For example, as a sterile solution or suspension, or a sustained-release formulation; topical application, for example, to the skin, lungs or mouth in the form of a cream, ointment, or controlled-release patch or spray; intravaginal or rectal administration, for example, to the uterus In the form of pads, creams, or foams; sublingually; ocularly; transdermally; or on nasal, pulmonary, and/or other mucosal surfaces.

As used herein, the term "pharmaceutically acceptable" means, within the scope of sound medical judgment, suitable for contact with human and animal tissues without undue toxicity, irritation, allergic reaction or other problems or complications, and reasonable benefit/risk ratio. commensurate with those compounds, materials, compositions and/or dosage forms.

As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, combination or material involved in carrying or transporting a compound of the present invention from one organ or part of the body to another organ or part of the body. Substance or vehicle, such as liquid or solid filler, diluent, excipient or solvent encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. In some embodiments, materials that may serve as pharmaceutically acceptable carriers include, for example: sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as Sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered gum tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower Oils, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and lauric acid Ethyl esters; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; pH buffer solution; polyester, poly Carbonates and/or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.

As used herein, the term "pharmaceutically acceptable salts" refers to salts of such compounds which are suitable for use in a medical context, that is, which, within the scope of sound medical judgment, are suitable for use with tissues of humans and lower animals. Salts that are used by contact without unusual toxicity, irritation, allergic reaction and the like and commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts, which are salts of an amino group with an inorganic acid or with an organic acid or obtained by using other compounds used in the art. Salts formed by methods such as ion exchange, inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid . In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, besylate, benzoate, bisulfate , Borate, Butyrate, Camphorate, Camphorsulfonate, Citrate, Cyclopentanepropionate, Digluconate, Lauryl Sulfate, Ethanesulfonate, Formate , fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, Lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitric acid Salt, oleate, oxalate, palmitate, pamoate, pectate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate salts, stearates, succinates, sulfates, tartrates, thiocyanates, p-toluenesulfonates, undecanoates, valerates and similar salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, where appropriate, pharmaceutically acceptable salts include nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, formates, Sulfate, phosphate, nitrate, alkyl having 1 to 6 carbon atoms, sulfonate and arylsulfonate.

In various embodiments, the present invention provides a pharmaceutical composition described herein having a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients include excipients suitable for the manufacture of generally safe, nontoxic and desirable pharmaceutical compositions, and include excipients acceptable for veterinary use as well as human pharmaceutical use. Such excipients may be solid, liquid, semi-solid, or, in the case of aerosol compositions, a gas.

The pharmaceutical preparations can be prepared following conventional pharmaceutical techniques involving milling, mixing, granulating and, if necessary, compression for tablet form or milling, mixing and filling for hard gelatin capsule form. When a liquid carrier is used, the formulation will be in the form of a syrup, elixir, emulsion or aqueous or non-aqueous solution or suspension. Such liquid formulations can be administered directly orally.

In some embodiments, pharmaceutical compositions can be formulated for delivery to cells and/or individuals via any route of administration. The mode of administration to a subject may include injection, infusion, inhalation, intranasal, intraocular, topical delivery, intracatheter delivery, or ingestion. Injections include (but are not limited to) intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intraarticular, subcapsular , subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In some embodiments, administration comprises aerosol inhalation, eg, by nebulization. In some embodiments, administration is systemic (e.g., oral, rectal, nasal, sublingual, buccal, or parenteral), enteral (e.g., systemic effects, but delivered via the gastrointestinal tract), or topical (e.g., Topical application to the skin, intravitreal injection). In some embodiments, one or more compositions are administered systemically. In some embodiments, the administration is non-parenteral and the therapeutic agent is a parenteral therapeutic agent. In some specific embodiments, administration may be via one or more of bronchi (e.g., by bronchial instillation), buccal, dermis (which may be or include, e.g., body surface to dermis, intradermal, interdermal, transdermal, etc. ), enteral, intraarterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, intraspecific (e.g. intrahepatic), mucosal, nasal, oral , rectal, subcutaneous, sublingual, superficial, tracheal (eg by intratracheal instillation), vaginal, transvitreous, etc. In some embodiments, administration can be a single dose. In some embodiments, administration can involve intermittent administration (eg, multiple doses spaced apart in time) and/or periodic administration (eg, individual doses separated by a constant period of time). In some embodiments, administration can involve continuous administration (eg, infusion) for at least a selected period of time. In some embodiments, six, eight, ten, 12, 15, or 20 or more administrations may be administered to an individual during a single treatment or over a period of time as a course of treatment.

In some embodiments, administration is optional, eg, as long as symptoms associated with the disease, disorder or condition persist. In some embodiments, repeated dosing may be prescribed for the remainder of the subject's life. The treatment period can vary and can be, for example, one day, two days, three days, one week, two weeks, one month, two months, three months, six months, one year or longer.

dose The dose of the agent or composition administered may vary based on, for example, the condition being treated, the severity of the disease, individual parameters of the individual including age, physiological condition, size and weight, duration of treatment, the The type of treatment (if any), the particular route of administration, and similar factors. Accordingly, the administered doses of the agents described herein can be determined according to such various parameters. The dosage of the composition administered may also vary depending on other factors, such as the sex of the subject, the general medical condition and the severity of the condition being treated. It may be desirable to provide an individual with a modulator or combination of modulators disclosed herein at a dose in the range of about 1 mg/kg to 6 mg/kg as a single intravenous infusion, but as circumstances dictate, can also be administered with lower or higher doses. Dosing can be repeated if necessary, for example once a day (for example 1-30 days), once every 3 days (for example 1-30 days), once every 5 days (for example 1-30 days), once a week (for example 1-6 week or 2-5 weeks). In some embodiments, doses may include, but are not limited to, 1.0 mg/kg-6 mg/kg, 1.0 mg/kg-5 mg/kg, 1.0 mg/kg-4 mg/kg, 1.0-3.0 mg/kg, 1.5 mg/kg-3.0 mg/kg, 1.0 mg/kg-1.5 mg/kg, 1.5 mg/kg-3 mg/kg, 3 mg/kg-4 mg/kg, 4 mg/kg-5 mg/kg or 5 mg/kg-6 mg/kg. Doses may be administered multiple times, such as once or twice a week, or every 1 or 2 weeks. In some embodiments, an individual is provided with a modulator or combination of modulators disclosed herein at a dose in the range of about 1 mg/kg to 6 mg/kg as multiple intravenous infusions, but as circumstances dictate, Lower or higher doses may also be administered.

A modulator or combination of modulators as disclosed herein may be administered in one dose every 3-5 days, repeated for a total of at least 3 doses. Alternatively, a modulator or combination of modulators as disclosed herein can be administered at 3 mg/kg every 5 days for 25 days. Alternatively, a modulator or combination of modulators as disclosed herein may be administered in 1-10 doses of 1.0-5.0 mg/kg once every 3-5 days. Alternatively, a modulator or combination of modulators as disclosed herein may be administered in 3 doses of 1.0-3.0 mg/kg every 5 days, followed by 3 doses every 3 days. Alternatively, a modulator or combination of modulators as disclosed herein may be administered in 4 doses of 1.0-3.0 mg/kg every 5 days, followed by 3 doses every 3 days. Alternatively, a modulator or combination of modulators as disclosed herein may be administered in 1-10 doses of 6 mg/kg every 5 days. Alternatively, a modulator or combination of modulators as disclosed herein may be administered in 1-10 doses at 3 mg/kg every 5 days. Alternatively, a modulator or combination of modulators as disclosed herein may be administered in 2 doses at 1.5 mg/kg every 5 days; 3 doses at 3 mg/kg every 5 days; at 3 mg/kg 1. Administer 1 dose once every 3 days. Alternatively, a modulator or combination of modulators as disclosed herein may be administered at 6 mg/kg every 5 days, or at 1.5 mg/kg once a day for 5 days with 2 days off. The dosing schedule can be repeated at other intervals as appropriate and doses can be administered via various parenteral routes with appropriate adjustments in dose and schedule. In some embodiments, the administration of a modulator or combination of modulators may comprise a dose of between 1.0 mg/kg and 6.0 mg/kg given once a week, twice a week, or every other week as appropriate with once. Those of ordinary skill will recognize that various factors may be considered in selecting dosages of modulators or combinations of modulators as disclosed herein, and that dosages and/or frequency of administration may be increased or decreased during the course of treatment. Dosing can be repeated as necessary, with evidence that a reduction in tumor volume is observed after at least 2 to 8 doses. The doses and schedules of administration disclosed herein showed minimal effect on the subject's total body weight compared to cisplatin, sorafenib, or the small molecule comparator. The methods of the invention may include measuring tumor response using CT and/or PET/CT or MRI at regular intervals. Blood levels of tumor markers may also be monitored. Dosage and/or dosing schedule can be adjusted as needed based on imaging results and/or marker blood levels.

In some embodiments, the compositions disclosed herein may be administered in combination with one or more therapeutic agents or methods selected from the group consisting of surgical resection; tyrosine kinase inhibitors (TKIs), such as Sola Fenib; bromodomain inhibitors, e.g. BET inhibitors, e.g. JQ1, e.g. BET672, e.g. birabresib; MEK inhibitors (e.g. Trametinib), orthotopic liver transplantation, radiofrequency ablation, Immunotherapy, immune checkpoint plus anti-vascular endothelial growth factor combination therapy, photodynamic therapy (PDT), laser therapy, brachytherapy, radiotherapy, transcatheter arterial chemo or radioembolization, stereotactic radiotherapy, chemotherapy and/or or systemic chemotherapy. Table 21 below discloses exemplary therapeutic agents.

JQ1

BET762

必納昔布

曲美替尼

Table 21: Small molecule compounds, e.g., for combination therapy with the expression inhibitors described herein Sorafenib

JQ1

BET762

Benacoxib

trametinib

The pharmaceutical compositions of the invention can be delivered in therapeutically effective amounts. A precise therapeutically effective amount is that amount of the composition which will produce the most effective results in a given individual with respect to therapeutic efficacy. This amount will vary depending on many factors including, but not limited to, the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the individual (including age, sex, type and stage of disease) , general physical condition, response to the prescribed dose and type of drug), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration.

In some aspects, the invention provides methods of delivering a therapeutic agent comprising administering to an individual a composition as described herein, wherein the modulator is a therapeutic agent and/or wherein the therapeutic agent is expressed relative to gene expression in the absence of the therapeutic agent. The delivery of an agent causes changes in gene expression.

Methods as provided in the various embodiments herein can be used in any of the aspects described herein. In some embodiments, one or more compositions target specific cells or one or more specific tissues.

For example, in some embodiments, one or more compositions target liver, epithelial, connective tissue, muscle, reproductive and/or neural tissues or cells. In some embodiments, the composition targets cells or tissues of specific organ systems, such as the cardiovascular system (heart, blood vessels); digestive system (esophagus, stomach, liver, gallbladder, pancreas, intestine, colon, rectum, and anus) ; endocrine system (hypothalamus, pituitary gland, pineal or pineal gland, thyroid, parathyroid, adrenal gland); excretory system (kidneys, ureters, bladder); lymphatic system (lymph, lymph nodes, lymphatic vessels, tonsils, adenoids, thymus, spleen); epidermal system (skin, hair, nails); muscular system (e.g. skeletal muscle); nervous system (brain, spinal cord, nerves); reproductive system (ovaries, uterus, breast, testes, Vas deferens, seminal vesicles, prostate); respiratory system (pharynx, larynx, trachea, bronchi, lungs, diaphragm); skeletal system (bones, cartilage); and/or combinations thereof.

In some embodiments, compositions of the invention cross the blood-brain barrier, placental membrane, or blood-testicular barrier.

In some embodiments, pharmaceutical compositions as provided herein are administered systemically.

In some embodiments, the administration is non-parenteral and the therapeutic agent is a parenteral therapeutic agent.

The methods and compositions provided herein may include pharmaceutical compositions administered by therapy sufficient to alleviate the symptoms of a disease, disorder, and/or condition. In some aspects, the invention provides methods of delivering a therapeutic agent by administering a composition as described herein.

Medical uses of the invention may include compositions as described herein (eg, modulators, eg, interfering agents).

In some embodiments, the pharmaceutical compositions of the invention have improved PK/PD, e.g., enhanced pharmacokinetics or pharmacodynamics, such as improved targeting, absorption or delivery (e.g., improved At least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 75%, 80%, 90% or more). In some embodiments, the pharmaceutical composition has reduced adverse effects, such as reduced diffusion to off-target sites, off-target activity, or toxic metabolism, as compared to the therapeutic agent alone (e.g., a reduction of at least 5 compared to the active agent alone). %, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 75%, 80%, 90% or more). In some embodiments, the composition increases the efficacy of the therapeutic agent and/or reduces the toxicity of the therapeutic agent (e.g., at least 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 75%, 80%, 90% or more).

The formulated pharmaceutical compositions described herein may, for example, include a carrier, such as a pharmaceutical carrier and/or a polymeric carrier, such as nanoparticles, liposomes or vesicles, and be delivered to an individual in need thereof by known methods ( For example human or non-human farm or domestic animals such as cattle, dogs, cats, horses, poultry). Such methods include transfection (e.g., lipid-mediated, cationic polymers, calcium phosphate); electroporation or membrane disruption (e.g., nucleofection) and viral delivery (e.g., lentivirus, retrovirus, adenovirus, AAV) among others. method. Delivery methods are also described, e.g., in Gori et al., Delivery and Specificity of CRISPR/Cas9 Genome Editing Technologies for Human Gene Therapy. Human Gene Therapy. 2015 Jul, 26(7): 443-451. DOI: 10.1089/ hum.2015.074; and Zuris et al., Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2014 Oct 30;33(1):73-80.

lipid nanoparticles Expression inhibitors or expression inhibitory systems as described herein can be delivered using any biological delivery system/formulation including particles (eg, nanoparticle delivery systems). Nanoparticles include dimensions (e.g., diameters) between about 1 nm and about 1000 nm, between about 1 nm and about 500 nm in size, between about 1 and about 100 nm, between about 30 nm and about 200 nm Particles between about 50 nm and about 300 nm, between about 75 nm and about 200 nm, between about 100 nm and about 200 nm, and any range therebetween. Nanoparticles have a composite structure with nanoscale dimensions. In some embodiments, nanoparticles are typically spherical in shape, but may have different morphologies depending on the composition of the nanoparticles. The portion of the nanoparticle that is in contact with the external environment of the nanoparticle is generally identified as the surface of the nanoparticle. In some embodiments, nanoparticles have a maximum dimensional range between 25 nm and 200 nm. Nanoparticles as described herein comprise delivery systems that may be provided in any form, including but not limited to solid, semi-solid, emulsion or colloidal nanoparticles. Nanoparticle delivery systems may include, but are not limited to, lipid-based systems, liposomes, micelles, microvesicles, exosomes, or gene guns. In one embodiment, the nanoparticles are lipid nanoparticles (LNPs). In some embodiments, the LNP is a particle comprising a plurality of lipid molecules physically associated with each other by intermolecular forces.

In some embodiments, the LNP may comprise multiple components, eg, 3 to 4 components. In one embodiment, the expression inhibitor or a pharmaceutical composition comprising the expression inhibitor (or nucleic acid encoding the same, or a pharmaceutical composition comprising the expression inhibitor nucleic acid) is encapsulated in LNP. In one embodiment, the expression inhibition system or the pharmaceutical composition comprising the expression inhibition system (or the nucleic acid encoding it, or the pharmaceutical composition comprising the expression inhibition system nucleic acid) is encapsulated in LNP. In some embodiments, the nucleic acid encoding the first inhibitor of expression is present in the same LNP as the nucleic acid encoding the second inhibitor of expression. In some embodiments, the nucleic acid encoding the first inhibitor of expression is present in a different LNP than the nucleic acid encoding the second inhibitor of expression. LNP preparation and modulator encapsulation can be used and/or adapted according to Rosin et al., Molecular Therapy, Vol. 19, No. 12, pp. 1286-2200, Dec. 2011). In some embodiments, the lipid nanoparticle compositions disclosed herein are suitable for the expression of proteins encoded by mRNA. In some embodiments, the nucleic acid, when present in the lipid nanoparticles, is resistant to degradation by nucleases in aqueous solution.

In some embodiments, LNP formulations can include CCD lipids, neutral lipids, and/or helper lipids. In some embodiments, the LNP formulation comprises ionizable lipids. In some embodiments, the ionizable lipid can be a cationic lipid, an ionizable cationic lipid, or an amine-containing lipid that is readily protonatable. In some embodiments, the lipids are cationic lipids, which can exist in positively charged or neutral form, depending on pH. In some embodiments, cationic lipids are lipids capable of being positively charged, eg, under physiological conditions. In some embodiments, the lipid particle comprises a cationic lipid in a formulation with one or more of: neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, including polyunsaturated lipids Phospholipids, structured lipids (such as sterols), PEG, cholesterol, and polymer-conjugated lipids.

In some embodiments, LNP formulations (eg, MC3 and/or SSOP) include cholesterol, PEG, and/or helper lipids. LNPs can be, for example, substantially spherical microspheres (including unilamellar and multilamellar vesicles, lamellar phase lipid bilayers) in some embodiments.

In some embodiments, a LNP may comprise an aqueous core, eg, comprising a nucleic acid encoding an expression inhibitor or system as disclosed herein. In some embodiments of the invention, the payload of the LNP formulation includes at least one guide RNA. In some embodiments, a payload (eg, a nucleic acid encoding an expression inhibitor or system as disclosed herein) can be adsorbed to the surface of a LNP (eg, a LNP comprising a cationic lipid). In some embodiments, a payload (eg, a nucleic acid encoding an expression inhibitor or system as disclosed herein) can be associated with a LNP. In some embodiments, payloads (eg, nucleic acids encoding expression inhibitors or systems as disclosed herein) can be encapsulated (eg, fully and/or partially encapsulated) in LNPs.

In some embodiments, LNPs comprising a payload can be administered for systemic delivery, eg, delivery of a therapeutically effective dose of the payload, such that broad exposure of the active agent in the organism can be achieved. Systemic delivery of lipid nanoparticles can be achieved by any means known in the art, including, for example, intravenous, intraarterial, subcutaneous and intraperitoneal delivery. In some embodiments, systemic delivery of lipid nanoparticles is achieved by intravenous delivery. In some embodiments, LNPs comprising a cargo can be administered for local delivery, eg, delivery of an active agent directly to a target in an organism. In some embodiments, LNP can be delivered locally to a site of disease (e.g., a tumor), other target (e.g., a site of inflammation), or to a target organ, such as liver, lung, stomach, large intestine, pancreas, uterus, Breast, lymph nodes and the like. In some embodiments, LNPs as disclosed herein can be delivered locally to specific cells, such as hepatocytes, astrocytes, Kupffer cells, endothelial cells, alveoli, and/or epithelial cells. In some embodiments, LNPs as disclosed herein can be delivered locally to a specific tumor site, eg, subcutaneously, orthotopically.

LNP can be formulated as a dispersed phase in emulsions, micelles, or as an internal phase in suspensions. In some embodiments, LNPs are biodegradable. In some embodiments, the LNP does not accumulate to cytotoxic levels or become toxic in vivo at therapeutically effective doses. In some embodiments, the LNP does not accumulate to cytotoxic levels or become toxic in vivo following repeated administration at a therapeutically effective dose. In some embodiments, the LNP does not produce an innate immune response that results in substantial side effects at therapeutically effective doses.

In some embodiments, the LNP used comprises the formula 4-(dimethylamino)butyric acid (6Z,9Z,28Z,31Z)-heptakadec-6,9,28,31-tetraen-19-yl ester or ssPalmO-Phenyl-P4C2 (ssPalmO-Phe, SS-OP). In some embodiments, the LNP formulation comprises 4-(dimethylamino)butanoic acid (6Z,9Z,28Z,31Z)-heptakadec-6,9,28,31-tetraen-19-yl Esters (MC3), 1,2-dioleyl-sn-glycero-3-phosphocholine (DOPC), cholesterol, 1,2-dimyristyl-rac-glycero-3-methoxypolyethylene Diol-2000 (PEG2k-DMG), such as MC3 LNP or ssPalmO-phenyl-P4C2 (ssPalmO-Phe, SS-OP), 1,2-dioleyl-sn-glycero-3-phosphocholine (DOPC ), cholesterol, 1,2-dimyristyl-rac-glycerol-3-methoxypolyethylene glycol-2000 (PEG2k-DMG), eg SSOP-LNP.

Liposomes are spherical vesicular structures composed of a single or multilamellar lipid bilayer surrounding an inner aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral or cationic. Liposomes are biocompatible, non-toxic, deliver hydrophilic and lipophilic drug molecules, protect their load from degradation by plasma enzymes, and transport their load across biomembranes and the blood-brain barrier (BBB) (for review, see e.g. Spuch and Navarro, Journal of Drug Delivery, Volume 2011, Article ID 469679, p. 12, 2011. Digital Object ID: 10.1155/2011/469679).

Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Vesicles may include, but are not limited to, DOTMA, DOTAP, DOTIM, DDAB, which alone or together with cholesterol yield DOTMA and cholesterol, DOTAP and cholesterol, DOTIM and cholesterol, and DDAB and cholesterol. Methods for preparing multilamellar vesicle lipids are known in the art (see, eg, US Patent No. 6,693,086, which is incorporated herein by reference for its teachings regarding the preparation of multilamellar vesicle lipids). Although vesicle formation can occur spontaneously when a lipid film is mixed with an aqueous solution, it can also be accelerated by applying an oscillating form of force using a homogenizer, sonicator, or extrusion device (for a review, see, e.g., Spuch and Navarro, Journal of Drug Delivery, Volume 2011, Paper ID 469679, Page 12, 2011. Digital Object ID: 10.1155/2011/469679). Extruded lipids can be prepared by extrusion through reduced size filters as described in Templeton et al., Nature Biotech, 15:647-652, 1997, incorporated by reference for the teachings of extrusion lipid preparation In this article.

The methods and compositions provided herein may include pharmaceutical compositions administered by therapy sufficient to alleviate the symptoms of a disease, disorder, and/or condition. In some aspects, the invention provides methods of delivering a therapeutic agent by administering a composition as described herein.

Uses The present invention additionally relates to the use of the expression inhibitors or expression inhibition systems disclosed herein. Furthermore, in some embodiments, such technology provided can be used to achieve, for example, modulation, e.g., suppression, of the expression of a target gene (e.g., MYC) in a cell, e.g., enabling control of a target gene, e.g., control of MYC activity, delivery, and frequency of gene expression . In some embodiments, the cells are mammalian (eg, human) cells. In some embodiments, the cells are somatic cells. In some embodiments, the cells are primary cells. For example, in some embodiments, the cells are mammalian somatic cells. In some embodiments, the mammalian somatic cells are primary cells. In some embodiments, the mammalian somatic cells are non-embryonic cells.

regulate gene expression

The present invention also relates in part to a method of modulating (e.g., reducing) the expression of a target gene (e.g., MYC), the method comprising: providing an expression suppressor (or a nucleic acid encoding it, or a medicament comprising the expression suppressor nucleic acid) described herein composition) or expression inhibition system (or nucleic acid encoding it, or a pharmaceutical composition comprising the expression inhibition system or nucleic acid), and the target gene (such as MYC) and/or operably linked transcriptional control elements and expression inhibition Sub or performance inhibition system contacts. In some embodiments, modulating (eg, reducing) expression of a target gene (eg, MYC) comprises: modulating target gene (eg, MYC) transcription compared to a reference value (eg, transcription of a target gene (eg, MYC) in the absence of an expression repressor or expression repression system). Transcription of genes such as MYC. In some embodiments, methods of modulating (eg, reducing) the expression of a target gene (eg, MYC) are used ex vivo, eg, on cells from an individual (eg, a mammalian individual, eg, a human individual). In some embodiments, methods of modulating (eg, reducing) the expression of a target gene (eg, MYC) are used in vivo, eg, in a mammalian subject (eg, a human subject). In some embodiments, methods of modulating (eg, reducing) the expression of a target gene, eg, MYC, are used in vitro, eg, on a cell or cell line as described herein.

The invention also relates in part to a method of treating a condition in an individual associated with aberrant regulation (e.g., overexpression) of a target gene (e.g., MYC), comprising administering to the individual an expression suppressor as described herein (or a gene encoding the same) nucleic acid, or a pharmaceutical composition comprising the expression inhibitor nucleic acid) or an expression inhibition system (or a nucleic acid encoding it, or a pharmaceutical composition comprising the expression inhibition system or nucleic acid). Pathologies associated with overexpression of particular genes are known to those skilled in the art. Such conditions include, but are not limited to, metabolic disorders, cancer (eg, solid tumors), and hepatitis.

The methods and compositions as provided herein can treat conditions associated with overexpression or dysregulation of a target gene (eg, MYC) by stably or temporarily altering (eg, reducing) transcription of the target gene (eg, MYC). In some embodiments, such modulation is maintained for at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days. days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days or more or any time in between. In some embodiments, such adjustments maintain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, or 24 hours, or at least 1, 2, 3, 4, 5, 6, or 7 days, or at least 1, 2, 3, 4, or 5 weeks, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, or at least 1, 2, 3, 4 or 5 years (e.g. permanently or indefinitely). Such adjustments are maintained for no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 year, as appropriate.

In some embodiments, the methods or compositions provided herein reduce the expression of a target gene (e.g., MYC) in cells by at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% (and up to 100% as appropriate).

In some embodiments, the methods provided herein modulate (eg, reduce) expression of a target gene (eg, MYC) by disrupting a gene body complex (eg, anchor sequence-mediated adapter) associated with the target gene. The gene associated with the anchor sequence-mediated adapter may be at least partially within the adapter (i.e., positioned sequentially between the first and second anchor sequences), or it may be outside the adapter such that it is not sequentially located within the adapter. The sequence is located between the first and second anchor sequences, but is located on the same chromosome and at least sufficiently close to the first or second anchor sequences so that the topology of the adapter can be mediated by controlling the anchor sequences to adjust its performance. Those of ordinary skill in the art will appreciate that in some embodiments, the three-dimensional distance between two elements (e.g., between a gene and an anchor sequence-mediated adapter) can be more correlated than in base pairs distance. In some embodiments, the external but related gene is located within 2 Mb, within 1.9 Mb, within 1.8 Mb, within 1.7 Mb, within 1.6 Mb, within 1.5 Mb, within 1.4 Mb, of the first or second anchor sequence 1.3 Mb, 1.3 Mb, 1.2 Mb, 1.1 Mb, 1 Mb, 900 kb, 800 kb, 700 kb, 500 kb, 400 kb, 300 kb, 200 kb, 100 kb , within 50 kb, within 20 kb, within 10 kb, or within 5 kb.

In some embodiments, modulating expression of a gene (eg, MYC) comprises altering the accessibility of a transcriptional control sequence to the gene (eg, MYC). Transcriptional control sequences (whether internal or external to an anchor sequence-mediated adapter) can be enhancing sequences or silencing (or repressing) sequences.

In some embodiments, such provided techniques can be used to treat a gene dysregulation disorder, such as a MYC gene dysregulation disorder, such as a symptom associated with a MYC gene dysregulation, in an individual (eg, a patient) in need thereof. In some embodiments, the provided technology can be used to treat a disorder of MYC gene dysregulation or a symptom associated with a disorder of MYC gene dysregulation in an individual (eg, a patient) in need thereof. In some embodiments, the disorder is associated with dysregulation of MYC (eg, MYC overexpression). In some embodiments, the disorder is associated with dysregulation of AFP (eg, AFP overexpression). In some embodiments, the provided technology can be used to methylate the promoter of a target gene (such as MYC) to treat a disorder of gene dysregulation in an individual (such as a patient) in need, such as aberrant regulation of the MYC gene Conditions, such as symptoms associated with abnormal regulation of the MYC gene. In some embodiments, such techniques are provided to selectively affect the survival of cells that aberrantly express a polypeptide encoded by a target gene (eg, MYC).

In some embodiments, such technology provided can be used to treat liver disease or a condition, eg, a symptom, associated with liver disease in an individual (eg, a patient) in need thereof. In some embodiments, provided such techniques are useful for treating conditions, eg, symptoms, of lung or liver disease in individuals (eg, patients) in need thereof. In some embodiments, such provided techniques are useful for treating a neoplastic disorder, such as a condition or symptom associated with a neoplastic disorder, in an individual (eg, a patient) in need thereof. In some embodiments, such provided techniques can be used to treat a viral infection-associated condition, eg, a condition or symptom associated with a viral infection-associated condition, in a subject (eg, a patient) in need thereof. In some embodiments, such provided techniques can be used to treat an alcohol misuse-related disorder, such as a disorder or symptom associated with an alcohol misuse-related disorder, in a subject (eg, a patient) in need thereof. In some embodiments, such technology provided can be used to treat a neoplastic disorder associated with a viral infection or alcohol misuse, such as a neoplastic disorder associated with a viral infection or alcohol misuse, in an individual (e.g., a patient) in need thereof. Condition or symptom.

In some embodiments, the condition treated is a neoplasia. In some embodiments, the condition treated is tumorigenesis. In some embodiments, the condition treated is cancer. In some embodiments, cancer is associated with poor prognosis. In some embodiments, the cancer is associated with MYC dysregulation (eg, MYC overexpression). In some embodiments, the cancer is associated with dysregulation of AFP (eg, AFP overexpression). In some embodiments, the cancer is breast cancer, liver cancer, colorectal cancer, lung cancer, pancreatic cancer, gastric cancer and/or uterine cancer. In some embodiments, the cancer is associated with an infection (eg, a virus, such as a bacterium). In some embodiments, the cancer is associated with alcohol abuse. In some embodiments, the cancer is liver cancer.

In some embodiments, the cancer cells are lung cancer cells, gastric cancer cells, gastrointestinal cancer cells, colorectal cancer cells, pancreatic cancer cells, or liver cancer cells. In some embodiments, the cancer is hepatocellular carcinoma (HCC), fibrolamellar hepatocellular carcinoma (FHCC), cholangiocarcinoma, angiosarcoma, secondary liver cancer, non-small cell lung cancer (NSCLC), adenocarcinoma, small cell lung cancer ( SCLC), large cell (undifferentiated) carcinoma, triple-negative breast cancer, gastric adenocarcinoma, endometrial cancer, or pancreatic cancer.

In some embodiments, the condition treated is liver disease. In some embodiments, the condition being treated is associated with dysregulation of MYC (eg, MYC overexpression). In some embodiments, the condition being treated is a chronic disease. In some embodiments, the condition treated is chronic liver disease. In some embodiments, the condition treated is a viral infection. In some embodiments, the condition treated is an alcohol misuse related disorder.

In some embodiments, the condition treated is pulmonary disease. In some embodiments, the condition being treated is associated with dysregulation of MYC (eg, MYC overexpression). In some embodiments, the condition being treated is a chronic disease. In some embodiments, the condition being treated is chronic lung disease. In some embodiments, such techniques provided are useful for treating or reducing lung cancer growth, metastasis, drug resistance, and/or cancer stem cell (CSC) maintenance. In some embodiments, the condition treated is cancer, such as non-small cell lung cancer (NSCLC). In some embodiments, chronic lung disease is associated with tobacco misuse.

In some embodiments, the cancer is hepatocellular carcinoma subtype S1 (HCC S1), hepatic carcinoma subtype S2 (HCC S2), or hepatic carcinoma subtype S3 (HCC S2). In some embodiments, the HCC subtype is associated with MYC overexpression. In some embodiments, the cancer is HCC S1 or HCC S2. In some embodiments, cancer subtypes are associated with aggressive tumors and poor clinical outcome.

In some embodiments, the present invention provides a treatment regimen that can be designed for an individual based on the subtype of HCC in the individual, for example, a personalized regimen that tailors the aggressiveness of the treatment based on the subtype of HCC in the individual. In some embodiments, the present invention provides a method of treatment using an expression suppressor or expression suppressor system disclosed herein, the method comprising identifying HCC subtypes in a patient and determining the expression suppressors based on the HCC subtype identification and / or the dosage and administration schedule of the expression inhibitory system.

Described herein are methods of delivering an agent, or a composition as disclosed herein, to an individual to treat a disorder such that the individual suffers minimal side effects or systemic toxicity compared to chemotherapy treatment. In some embodiments, the individual does not experience any significant side effects typically associated with chemotherapy when treated with the agents and/or compositions described herein. In some embodiments, the subject does not experience significant side effects when treated with the agents and/or compositions described herein, including, but not limited to, alopecia, nausea, vomiting, loss of appetite, soreness, neutropenia anemia, thrombocytopenia, dizziness, fatigue, constipation, mouth sores, itchy skin, peeling, nerve and muscle damage, hearing changes, weight loss, diarrhea, immunosuppression, congestion, heart damage, bleeding, liver damage, kidney Injuries, edema, mouth and throat sores, infertility, fibrosis, hair loss, wet peeling, dry mucous membranes, dizziness, and brain lesions. In some embodiments, the individual does not exhibit significant weight loss when treated with the agents and/or compositions described herein.

The agents and compositions described herein can be administered to an individual, such as a mammal, eg, in vivo, to treat or prevent a variety of disorders as described herein. The disorder includes a disorder involving cells characterized by an altered expression pattern of MYC.

Epigenetic modification The present invention is additionally directed in part to a target gene, a transcriptional control element or an anchor sequence operably linked to a target gene (e.g., in close proximity to or with an anchor sequence operably linked to a target gene) An anchor sequence associated with a conductive adapter) for epigenetic modification, the method comprising: providing an expression repressor (or a nucleic acid encoding it) or an expression repression system (such as an expression repressor), or a nucleic acid encoding it, or a pharmaceutical composition comprising the expression inhibitor (or nucleic acid encoding it) or expression inhibition system or nucleic acid; and contacting the target gene or a transcriptional control element operably linked to the target gene with the expression inhibitor or expression inhibition system, Epigenetic modifications are thereby made to a target gene (eg MYC) or a transcriptional control element operably linked to a target gene (eg MYC).

In some embodiments, the method of epigenetically modifying a target gene (eg, MYC) or a transcriptional control element operably linked to a target gene (eg, MYC) comprises increasing or decreasing a target gene (eg, MYC) or operably linked to a target gene (eg, MYC) DNA methylation of transcriptional control elements linked to target genes such as MYC. In some embodiments, the method of epigenetically modifying a target gene (eg, MYC) or a transcriptional control element operably linked to a target gene (eg, MYC) comprises increasing or decreasing a transcriptional control element operably linked to a target gene (eg, MYC) or Histone methylation of histones associated with transcriptional control elements that are positively linked to target genes such as MYC. In some embodiments, the method of epigenetically modifying a target gene (eg, MYC) or a transcriptional control element operably linked to a target gene (eg, MYC) comprises reducing Histone acetylation to histones associated with transcriptional control elements of target genes (eg MYC). In some embodiments, the method of epigenetically modifying a target gene (eg, MYC) or a transcriptional control element operably linked to a target gene (eg, MYC) comprises increasing or decreasing a transcriptional control element operably linked to a target gene (eg, MYC) or Histone-like microubiquitination of histones associated with transcriptional control elements that are positively linked to target genes such as MYC. In some embodiments, the method of epigenetically modifying a target gene (eg, MYC) or a transcriptional control element operably linked to a target gene (eg, MYC) comprises increasing or decreasing a transcriptional control element operably linked to a target gene (eg, MYC) or Histone phosphorylation of histones associated with transcriptional control elements that are positively linked to target genes such as MYC.

In some embodiments, the target gene (e.g., MYC) or operably linked to the target gene (e.g., MYC A method of epigenetic modification of a transcriptional control element of ) that reduces the level of epigenetic modification by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% (and optionally, up to 100%) . In some embodiments, the target gene (e.g., MYC) or operably linked to the target gene (e.g., MYC ) method for epigenetic modification of a transcriptional control element that increases the level of epigenetic modification by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200 . In some embodiments, epigenetic modification of a target gene (e.g., MYC) or a transcriptional control element operably linked to a target gene (e.g., MYC) modifies the expression of the target gene (e.g., MYC), e.g., as described herein stated.

In some embodiments, epigenetic modifications produced by the methods described herein are maintained for at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days , 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days or longer, or any period in between. In some embodiments, such adjustments maintain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 21, 22, 23, or 24 hours, or at least 1, 2, 3, 4, 5, 6, or 7 days, or at least 1, 2, 3, 4, or 5 weeks, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, or at least 1, 2, 3, 4 or 5 years (eg indefinitely). Such adjustments are maintained for no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 year, as appropriate.

In some embodiments, the expression suppressor or expression suppression system used in the method of epigenetic modification of a target gene (eg, MYC) or a transcriptional control element operably linked to a target gene (eg, MYC) comprises an effector moiety comprising The expression suppressor of, the effector portion is or comprises an epigenetic modification portion.

For example, an effector moiety can be or comprise an epigenetic modification moiety having DNA methyltransferase activity, and an endogenous or naturally occurring target sequence (e.g., a target gene, such as MYC, or a transcriptional control element) can be altered to Increase its methylation (e.g., reduce the interaction of a transcription factor with a target gene (e.g., MYC) or part of a transcriptional control element, reduce binding of nucleating proteins to anchor sequences, and/or disrupt or prevent anchor sequence-mediated adapters), or can be altered to reduce their methylation (e.g., to increase the interaction of a transcription factor with a target gene (e.g., MYC) or part of a transcriptional control element, to increase the binding of a nucleating protein to an anchor sequence, and/or promote or increase the strength of anchor sequence-mediated adapters).

Kits The present invention additionally relates in part to a kit comprising an expression suppressor or expression suppressor system, such as the expression suppressors described herein. In some embodiments, a kit comprises an expression inhibitor or expression inhibition system (eg, an expression inhibitor in an expression inhibition system) and instructions for use of the expression inhibitor or expression inhibition system. In some embodiments, the kit comprises a nucleic acid encoding an expression inhibitor or a nucleic acid encoding an expression inhibition system or a component thereof (e.g., an expression inhibitor in an expression inhibition system) and the expression inhibitor (and/or the nucleic acid) and and/or instructions for use of the expression suppression system (and/or the nucleic acid). In some embodiments, the kit comprises a cell comprising a nucleic acid encoding an expression inhibitor or a nucleic acid encoding an expression inhibition system or a component thereof (e.g., an expression inhibitor in an expression inhibition system); and the cell, the nucleic acid, and/or Or instructions for use of the expression suppressor or expression suppression system.

In some aspects, the kit comprises a) a container comprising a composition comprising a system comprising two expression inhibitors comprising a first targeting moiety and optionally a first effector moiety. An expression repressor, wherein the first expression repressor binds to a translational regulatory element (e.g., a promoter or a transcriptional start (TSS)) operably linked to a target gene (e.g., MYC) or to a sequence in close proximity to a translational regulatory element and an expression suppressor comprising a second targeting moiety and optionally a second effector moiety, wherein the second expression suppressor binds to an anchor sequence-mediated adapter (ASMC) comprising a target gene (eg, MYC) anchor sequence or binds to a sequence in close proximity to the anchor sequence.

In some aspects, the kit comprises a) a container comprising a composition comprising a system comprising two expression inhibitors comprising a first targeting moiety and optionally a first effector moiety. An expression repressor, wherein the first expression repressor binds to a translational regulatory element (e.g., a promoter or a transcriptional start (TSS)) operably linked to a target gene (e.g., MYC) or to a sequence in close proximity to a translational regulatory element and an expression suppressor comprising a second targeting moiety and optionally a second effector moiety, wherein the second expression suppressor binds to a gene body locus located in a super-enhancer region of a target gene (eg, MYC).

In some embodiments, the kit further comprises b) a set of instructions comprising at least one method of using the composition to treat a disease or modulate (eg, reduce) the expression of a target gene (eg, MYC) in a cell. In some embodiments, the kit optionally includes a delivery vehicle (eg, lipid nanoparticles) for the composition. The agent may be provided suspended in the excipient and/or delivery vehicle, or the agent may be provided as a separate component which may then be combined with the excipient and/or delivery vehicle. In some embodiments, the kit optionally contains other therapeutic agents co-administered with the composition to affect desired target gene expression, eg, modulate MYC gene expression. While instructional material is typically written or printed material, it is not limited to such. Any medium capable of storing such instructions and communicating them to end users is contemplated. Such media include, but are not limited to, electronic storage media (eg, magnetic disks, tapes, cartridges, wafers), optical media (eg, CD ROM), and the like. Such media may include addresses to Internet sites that provide such instructional materials.

In some embodiments, the kit comprises a unit dosage form of an expression inhibitor, an expression inhibitor system, such as an expression inhibitor described herein, or a nucleic acid (e.g., a vector) encoding an expression inhibitor system, such as an expression inhibitor described herein. ) in unit dosage form.

The following examples are provided to further illustrate some embodiments of the present invention, but are not intended to limit the scope of the present invention; technology.

example example 1 : CTCF Targeted modification of the motif causes MYC lower down

This example describes nuclease editing of the CTCF motif or regions adjacent to the CTCF motif using Cas9 to downregulate MYC expression.

In this example, four sgRNAs complementary to the CpG islands of the promoter region contained in exon 1 were designed in order to identify the optimal target regions for directing epigenetic effector-mediated downregulation of the MYC gene. The c-MYC gene contains a long non-translated exon 1 (Spencer CA, Groudine M 1991), and exons 2 and 3 contain the main coding region. To identify suitable down-regulated regions, the CRISPR-dCas9-KRAB and CRISPR-dCas9-MQ1 (DNMT from the bacterium Mollicula spiroplasma) effectors targeted by four sgRNAs complementary to the CpG island region of the MYC promoter were used Perform genome editing. Changes in MYC expression were assessed using (1) dCas9 (no effector) in combination with sgRNA and (2) untreated cells as controls. These initial screens were performed on easily grown and transfectable cells K562 and HEK293 to select sgRNAs and determined that sgRNA GD-28617 mediated the strongest effect on MYC mRNA downregulation (data not shown).

chr8:128746342-128746364 GD-28859 CTCF

chr8:128746321-128746343 GD-28862 CTCF

chr8:128746525-128746547 GD-28617 啟動子

chr8:128748014-128748036 實例 2 ： 與 dCas9sgRNA 融合之 KRAB 效應子對 MYC1 表現的下調作用 Three human HCC models (HepG2 , Hep3B and SKHEP1) (Table 11 and Figures 1A-B). Disruption of the CTCF motif by Cas9 (in combination with GD-28616) caused a 32-39% downregulation of MYC expression in all three HCC cell lines (HepG2, Hep3B, and SKHEP1). Disruption of the region adjacent to the CTCF motif (GD-28859) downregulated MYC expression by 35-45% in two of the three lines (HepG2 and Hep3B) (Figure 2A). Editing efficiency as assessed by AmpSeq confirmed 77-100% editing of cell lines (Fig. 2B). Table 11: Wizard wizard name target target sequence genome coordinates GD-28616 CTCF

chr8:128746342-128746364 GD-28859 CTCF

chr8:128746321-128746343 GD-28862 CTCF

chr8:128746525-128746547 GD-28617 Promoter

chr8:128748014-128748036 Example 2 : Down-regulation of MYC1 expression by KRAB effectors fused to dCas9sgRNA

This example describes the downregulation of MYC1 expression by targeting a KRAB effector fused to dCas9sgRNA to the CTCF motif (GD-28616) or immediately upstream of the CTCF motif (GD-28859) or the MYC promoter (GD-28617) . To target MYC expression in HCC, the CRISPR-dCas9 system was modified by tethering the system to KRAB.

In this example, dCas9-KRAB mRNA was delivered to human HCC cell lines (HepG2, Hep3B, and SKHEP1) along with individual sgRNAs (Table 1 and Figure 1A-B) to target the CTCF motif (GD-28616) , CTCF "anchor" site (GD-28859) or MYC promoter (GD-28617). Effector mRNA was co-delivered with sgRNA using LNP delivery in the form of SSOP. As controls, changes were assessed using (1) dCas9 (no effector) in combination with sgRNA and (2) untreated cells. HCC cells were seeded in 96-well plates (5000 cells/well) in growth medium. LNP formulations (2-2.5 μg/ml) were then added to cells to transfect mRNA and sgRNA. All treatments were biologically replicated three times. MYC expression and cell viability were assessed at time points ranging from 24 to 168 hours. RNA from four independent experiments was isolated using the ^RNeasy® plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method. Untreated samples and dCas9 (no effector) samples were used as calibrators.

Experimental data showed that LNP-mediated dCas9-KRAB/GD-28616 transfection downregulated MYC expression in Hep3B and SKHEP1 by 11-34% at the time point of 48/72 hours. At the 48/72 hour time point, LNP-mediated dCas9-KRAB/GD-28859 transfection downregulated MYC expression by 18-44% in all 3 HCC models (Figure 3). By 168 hours, this effect was reduced in both lines (Hep3B and SKHEP1), but MYC expression in the HepG2 line was reduced by 28% at 168 hours (Figure 3). Directing dCas9-KRAB to the MYC promoter via dCas9-KRAB/GD-28617 downregulated MYC expression by 24-58% in all 3 HCC models at the 48/72 hour time point. By 168 hours, this effect was reduced in both lines (Hep3B and SKHEP1), but MYC in HepG2 was reduced by 43% at 168 hours (Figure 3). Example 3: Down-regulation of MYC1 expression by KRAB effectors fused to zinc finger domains

This example describes the downregulation of MYC1 expression by targeting a KRAB effector fused to a zinc finger domain immediately upstream of a CTCF motif (GD-28859). In this example, zinc finger-directed KRAB effectors (ZF-KRAB effectors) were designed to bind anchor sites located at the DNA region targeted by GD-28859 (Figure 4A). Seven constructs (dCas-KRAB/GD-59, ZF1-KRAB, ZF2-KRAB, ZF3-KRAB, ZF4-KRAB, ZF5-KRAB, and ZF6-KRAB) were designed and tested in human HCC models (HepG2, Hep3B, SKHEP1) filter in. Negative controls for these experiments included untreated cells and dCas9-KRAB/GD-28859 was used as a positive control. RNA from two independent experiments (each biologically replicated in triplicate) was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific Taqman Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific) (Technical experiment repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples and dCas9 (no effector) samples as calibrators. Cell viability was assessed by ATP quantification using the CellTiter-GLO ^® Luminescent Cell Viability Assay (Promega #G9241). HCC cells were seeded in 96-well plates (5000 cells/well) in growth medium. LNP formulations (0.6-2.5 μg/ml) were then added to cells to transfect mRNA and sgRNA. All treatments were biologically replicated three times.

These data indicate that ZF2-KRAB, ZF3-KRAB and ZF4-KRAB downregulate MYC in Hep3B cells to a degree equivalent to or greater than that of dCas9-KRAB/GD-28859, among which ZF3-KRAB has the strongest downregulation effect (Fig. 4B ). In two other HCC models, HepG2 and SKHEP1, ZF3-KRAB was also shown to downregulate MYC to an equivalent or greater extent than dCas9-KRAB/GD-28859 (Fig. 4C). It was also determined that ZF3-neutral effector (NE) has a down-regulation effect on MYC expression, which may be due to steric hindrance at the regulatory site. Both ZF3-KRAB and ZF3-NE exhibited downregulation of MYC expression and survival in Hep3B over a time course of 24, 72 and 120 hours (Fig. 4D). Example 4: Down-regulation of MYC1 expression by MQ1 effectors fused to dCas9sgRNA

This example describes targeting the CTCF motif (GD-28616) or immediately upstream of the CTCF motif (GD-28859), GD-28862, or the MYC promoter (GD-28617) by targeting an MQ1 effector fused to a dCas9 sgRNA while down-regulating MYC1 expression.

In this example, dCas9-MQ1 mRNA was delivered to human HCC cell lines (HepG2, Hep3B, and SKHEP1) along with individual sgRNAs (Table 11 and Figure 1A-B), allowing them to target the CTCF "anchor" site or MYC promoter. Effector mRNA was co-delivered with sgRNA using LNP delivery in the form of SSOP. As controls, changes were assessed using (1) dCas9 (no effector) in combination with sgRNA and (2) untreated cells. Experiments were performed following a protocol essentially as described in Example 2.

The results showed that dCas9-MQ1 targets CTCF via GD-16, GD-59, and GD-62, causing variable down-regulation and up-regulation in a cell line-specific manner. Targeting the promoter by GD-17, dCas9-MQ1 caused a 50-90% downregulation of MYC at 72 hours and was maintained until 168 hours in all three HCC models (Fig. 5). Although MYC downregulation had minimal effect on SK-HEP-1 survival, MYC downregulation significantly decreased HepG2 and Hep3B survival at 72 hours and 168 hours. The dCas9-sgRNA control had no effect on performance or survival compared to untreated controls. Example 5: Down-regulation of MYC1 expression by MQ1 effectors fused to zinc finger domains

This example describes the downregulation of MYC1 expression by targeting an MQ1 effector fused to a zinc finger domain to the MYC promoter (GD-28617).

In this example, a zinc finger-directed MQ1 effector (ZF-MQ1 effector) was designed to bind the DNA region targeted by GD-28617 (Figure 4A and Figure 6A). Six constructs (ZF7-MQ1 , ZF8-MQ1 , ZF9-MQ1 , ZF10-MQ1 , ZF11-MQ1 , and ZF12-MQ1 ) were designed around GD-28617 to bind the regions identified in the Example 4 screen and in human HCC models ( Screening in HepG2, Hep3B, SKHEP1). Untreated cells and cells transfected with ZF protein alone (ZF-null effector or ZF-NE) were used as negative controls for the experiment and dCas9-KRAB/GD-28859 was used as positive control. The protocol as described in Example 3 was followed.

The results showed that ZF8-MQ1, ZF9-MQ1 and ZF11-MQ1 down-regulated MYC in Hep3B cells to the greatest extent, and ZF9-MQ1 had the strongest down-regulation effect ( FIG. 6B ). The data further indicate that the gene body binding sites of ZF-MQ1 molecules that successfully reduce MYC expression (ZF8-MQ1, ZF9-MQ1, and ZF11-MQ1) are more The gene body binding sites of MQ1 and ZF12-MQ1) are in close proximity. This could be an effect of binding efficiency, 3-D binding orientation, region methylation stretching, or a consequence of the positioning of specific effectors relative to regulatory elements in the MYC promoter. A slight shift in the ZF-effector binding site appears to have dramatic consequences for MYC gene regulation. ZF9-MQ1 was found to strongly downregulate MYC mRNA and reduce survival in all three HCC models, and the effect found in the presence of the ZF9-MQ1 construct was much larger than could be pointed to by the dCas9-MQ1/GD-28617 system. Example 6: ZF9-MQ1 exhibits the strongest downregulation of MYC1 expression compared to other ZF-MQ1 effectors

This example describes that ZF9-MQ1 exerts the strongest effect in downregulating MYC1 expression by targeting the MQ1 effector fused to the zinc finger domain to the MYC promoter compared to other ZF-MQ1 effectors tested (GD-28617 ).

In this example, the effect of ZF9-MQ1 on downregulating MYC expression in all HCC models (HepG2, Hep3B, and SKHEP1) was compared to that of ZF12-MQ1, ZF8-MQ1, and dCas9-MQ1/GD-28617, respectively. Untreated cells and cells transfected with ZF protein alone (ZF-null effector or ZF-NE) were used as negative controls for the experiment and dCas9-KRAB/GD-28859 was used as positive control. The protocol as described in Example 3 was followed.

Compared to ZF12-MQ1, ZF9-MQ1 was shown to strongly downregulate MYC and reduce survival in all three HCC models examined (Hep3B, HepG2 and SKHEP1) (Fig. 7A-C). The downregulation of MYC1 regulated by ZF9-MQ1 was relatively greater than that seen in the presence of ZF8-MQ1 (Fig. 7D-F) and the effect seen in the presence of the ZF9-MQ1 construct was larger than that which the dCas9-MQ1/GD-28617 system could point to Much larger (Fig. 7G-I). The data further showed that while ZF9-MQ1 downregulated MYC expression as fast as 24 hours, the effect on survival was not observed until 72 hours or later. In contrast, ZF8-MQ1 achieved a significantly lower change in MYC mRNA and a much greater immediate decrease in cell viability. Example 7: dCas9-MQ1 has a significantly greater effect on MYC expression than human dCas9-DNMT1 or dCas9-DNMT-3A-3L

This example demonstrates that dCas9-MQ1 has a significantly greater effect on MYC expression than human dCas9-DNMT1 or dCas9-DNMT-3A-3L.

In this example, the CRISPR-dCas9 system was modified by tethering the system to a series of epigenetic suppressors including KRAB, human DNMT1, human DNMT3A-3L fusion, human DNMT3Bm prokaryotic DNMT, and MQ1. These molecules regulate transcriptional repression by recruiting the repressive complex (KRAB) or methylating CpG nucleotides of DNA (DNMT1, DNMT3A-3L, DNMT3B and MQ1). Using a panel of human HCC cell lines including HepG2, Hep3B, and SKHEP1, effector screening was performed in a hepatoma model. GD-28617 sgRNA was combined with dCas9-DNMT mRNA and co-delivered into these cell lines by LNP transfection. CRISPR-Cas9 studies evaluated LNP delivery efficacy by measuring the editing efficiency of sgRNA/Cas9, demonstrating that 90-99% editing efficiency was achieved using this system (data not shown). After transfection, the expression of MYC mRNA in the cells was analyzed by qPCR at various time points, and the viability of the cells was analyzed by CellTiter-GLO ^® . For targeted and global methylation analysis by bisulfite sequencing, genomic DNA was isolated using the Lucigen DNA Extraction Kit.

These studies demonstrated that dCas9-MQ1 had a significantly greater effect on MYC expression than either human dCas9-DNMT or dCas9-KRAB examined (data not shown). At 72 hours, dCas9-MQ1 achieved a 50-90% reduction in mRNA in all three lines (Fig. 8A). Although MYC downregulation had minimal effect on SK-HEP-1 survival, MYC downregulation significantly decreased HepG2 and Hep3B survival at 72 hours and 168 hours (Fig. 8B). The dCas9-sgRNA control had no effect on performance or survival compared to untreated controls.

Since the SK-HEP-1 model exhibited minimal changes in survival following MYC downregulation, this line was used to assess durability against downregulation of MYC expression. On day 5, MYC mRNA was reduced by 80% compared to dCas9 DBD alone and untreated controls. MYC mRNA was reduced by about 70% and about 55% on day 7 and day 11, respectively. Transcripts maintained about 40% downregulation as far as day 15 (Fig. 8C). Using bisulfite genome sequencing (qualitative and quantitative means of measuring 5-methylcytosine at single base pair resolution), it was determined that dCas9-MQ1/GD-28617 treatment directs de novo methylation to target region, and determined that these transcriptional changes were closely correlated with the percent CpG methylation in the targeted region and confirmed that methylation was maintained up to day 15 (Fig. 8D). Example 8: dCas9-MQ1/GD-17 treatment inhibits tumor growth in vivo

This example describes in vivo analysis of dCas9-MQ1/GD-17 treatment of subcutaneous Hep3B xenografts, which resulted in inhibition of tumor growth compared to control treatment (PBS and/or dCas9/GD-safe harbor).

In this example, 0.6 mg/ml LNP (MC3) formulated effector (dCas9-MQ1/GD-17) was delivered to the assay by intratumoral injection (20 µl/mouse) on days 1 and 7 Tumor sites in group animals. PBS or 0.6 mg/ml LNP (MC3) control effector dCas9/GD-Safe Harbor (20 µl/mouse) was injected into tumor sites in control mice. Each control and test group consisted of 6 animals with SubQ Hep3B xenografts (250 mm ³ ). Tumor volume changes in each group were measured every 3 days during the 15-day period. At the end of 15 days, the change in mean tumor volume was measured using a paired T-test and plotted. Mice treated with dCas9-MQ1/GD-17 showed reduced tumor volume compared to the two control groups (Fig. 9). Example 9: In the context of hepatitis B infection, dCas9-MQ1/GD-17 downregulates MYC in human hepatocytes

This example demonstrates that dCas9-MQ1/GD-17 downregulates MYC in human hepatocytes in the context of hepatitis B infection.

In this example, human hepatocytes were infected with HBV and uninfected hepatocytes were inoculated with infected hepatocytes and grown for a period of 8 days. At the end of 9 days, HBV-infected human hepatocytes showed higher MYC expression compared to uninfected cells. Uninfected and HBV-infected hepatocytes were transfected with LNPs with control effector (dCas9 + safe harbor sgRNA (GD-SH)) or effector dCas9-MQ1/GD-17 and allowed to grow for an additional 48 hours. Then after 48 hours, MYC expression was assessed by qPCR ( FIG. 8 ). The study was biologically replicated three times. RNA was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method and dCas9 + GD-SH samples were used as calibrator.

After 48 hours dCas9-MQ1/GD-17 (promoter) increased MYC expression in uninfected and infected cells as assessed by qPCR and normalized to the uninfected human hepatocyte control group. down-regulation (Figure 10).

Example 10: Combination of Zinc Finger Domains and Transcriptional Effectors Targeting MYC ASMCs Downregulates MYC Expression

This example demonstrates that KRAB effectors (or no effectors or NEs) fused to zinc finger domains target the immediately upstream region of the CTCF motif (ZF3-NE or ZF3-KRAB) and MQ1 effectors fused to zinc finger domains Targeting the MYC promoter (ZF9-MQ1) downregulates MYC mRNA expression. The combination of ZF9-MQ1 and ZF3-KRAB downregulated MYC expression more effectively than the other effectors tested in this example (individually or in combination).

ZF3-NE or ZF3-KRAB effectors targeting anchored CTCF were combined with ZF9-MQ1, which was designed to bind and target the MYC promoter in the HCC cell line Hep3B. Use dCas-KRAB/GD-28859 and dCas9-MQ1/GD-28617 as positive controls for both regions. Negative controls for these experiments included untreated cells and cells transfected with ZF5-NE and green fluorescent protein (GFP). Effector mRNAs were co-delivered using LNP delivery in the form of SSOP. HCC cells were seeded in 96-well plates (approximately 5000 cells/well) in growth medium. LNP formulations (0.6 μg/ml) were then added to cells to transfect mRNA, followed by incubation for different time points. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples and dCas9 (no effector) samples as calibrators.

These data show that ZF3-KRAB plus ZF9-MQ1 downregulates MYC to a greater extent than dCas9-KRAB/GD-28859, ZF3-KRAB, ZF3-NE, dCas9-MQ1/GD-28617, ZF9-MQ1 alone, or ZF3- NE, or ZF5-NE plus ZF9-MQ1 combination (Figure 11). GFP and ZF5-NE alone had negligible effects on MYC expression. The data were similar over the time courses tested (24, 48 and 72 hours), with maximal inhibition occurring after 24 hours and lasting for at least 72 hours. Example 11: Combination of ZF9-MQ1 and ZF3-KRAB downregulates MYC expression in three HCC models.

This example demonstrates that the combination of ZF9-MQ1 and ZF3-KRAB caused a greater downregulation of MYC mRNA in other HCC cell lines (Hep3B, HepG2 and SKHEP1 ) than the other effectors tested alone or in combination.

ZF3-NE or ZF3-KRAB effectors targeting anchored CTCF were combined with ZF9-MQ1, which was designed to bind and target the MYC promoter in three HCC cell lines Hep3B, HepG2 and SKHEP1. Negative controls for these experiments included ZF5-NE transfected cells. Effector mRNAs were co-delivered using LNP delivery in the form of SSOP. HCC cells were seeded in 96-well plates (approximately 5000 cells/well) in growth medium. LNP formulations (0.6 μg/ml) were then added to cells to transfect mRNA, followed by incubation for different time points. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples and dCas9 (no effector) samples as calibrators.

These data show that ZF3-KRAB plus ZF9-MQ1 downregulates MYC to a greater extent than ZF9-MQ1 alone or the combination of ZF3-NE plus ZF9-MQ1 ( FIG. 12 ). Data were similar for the duration of the test (24, 48, and 72 hours). Example 12: Dose-response curves of ZF9-MQ1 achieved survival and MYC expression in other HCC models.

This example describes the downregulation of Myc expression and cell viability by ZF9-MQ1 in five HCC cell lines using dose response curves.

In this example, ZF9-MQ1 designed to bind and target the MYC promoter was administered at various concentrations to five HCC cell lines: Hep3B, HepG2, SKHEP1, SNU-182 and SNU-449 ( FIG. 13A ). Untreated cells were used as negative controls. LNP delivery in the form of SSOP was used to deliver effector mRNA. HCC cells were seeded in 96-well plates (approximately 5000 cells/well) in growth medium. LNP formulations (starting at 5 or 0.6 μg/ml) were then added to 3 wells, followed by 6 to 10 doses each approximately 1:2 diluted in subsequent wells to transfect mRNA, followed by incubation for 72 hours. Different replica discs were collected for survival and RNA. Viability was measured using Promega's Celltiter GLO assay kit according to the manufacturer's protocol. RNA from three biological replicates was isolated using the ^Rneasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples and dCas9 (no effector) samples as calibrators. EC50 values were calculated based on dose-response curves.

These data show that ZF9-MQ1 downregulates MYC expression and reduces survival in all five HCC cell lines tested. At 72 hours, ZF9-MQ1 downregulated MYC expression in these five HCC cell lines with EC50 ranging from 0.0057-0.065 μg/ml LNP/mRNA, and its EC50 effect on in vitro survival rate was 0.049-0.29 μg /ml range (Fig. 13B-F). Example 13: In vivo efficacy of ZF9-MQ1 in the Hep 3B model grown subcutaneously in nude mice

This example demonstrates that treatment with ZF9-MQ1 inhibits the growth of established Hep 3B tumors in female nude mice.

Hep 3B tumor cells were implanted into the left flank of thirty female nude mice to induce tumors.

Changes in tumor volume were measured and treatment was initiated when the average tumor volume reached approximately 100-150 ^mm3 . Mice were divided into treatment and control groups such that the mean tumor volumes in each group were approximately equal. Control groups were injected with PBS or MYCi975 (a small molecule comparator). Mice in each group were injected intratumorally with PBS (3 doses, injected every 5 days, followed by switching to 2 doses, injected intravenously), injected intravenously with ZF9-MQ1 (injected every 5 days, 3 mg/kg) or MYCi975 was injected intraperitoneally (once a day, 5 days a week). All animals were weighed daily and assessed visually. The tumor volume changes in each group were measured 3 times a week. Over the course of 22 days, changes in body weight from baseline and mean tumor volume were measured and plotted using paired T-tests (Fig. 14A-B).

The results showed that ZF9-MQ1 was able to significantly reduce tumor growth (from day 6 onwards) compared to PBS control treated mice. ZF9-MQ1 reduced tumor growth to a greater extent than the small molecule comparator (MYCi975) (Figure 14A). In addition, IHC staining at 48 hours after the last dose showed ZF9-MQ1 polypeptide expression, reduced MYC expression, and reduced proliferation as measured by Ki67 (data not shown). ZF9-MQ1 had minimal effect on whole animal body weight (Fig. 14B). Example 14: In vivo efficacy of ZF9-MQ1 + ZF3-KRAB in the Hep 3B model of orthotopic growth in Fox Chase CB17 SCID mice

This example demonstrates the long-term antitumor efficacy and durability of bicistronic ZF9-MQ1 + ZF3-KRAB in the orthotopic Hep3B-luc model after administration to female Fox Chase CB17 SCID mice.

Hep-3B-luc cells were injected in the left upper lobe of the liver of SCID mice. Mean ventral whole-body tumor-associated bioluminescence (TABL) was approximately ^2.8x109 p/s for each randomized group. On day 7 after cell implantation, mice were randomly assigned to two groups of 12 mice each treated with PBS and ZF9-MQ1+ZF3-KRAB and a group of 6 mice treated with sorafenib. Treatment started on day 8 after tumor cell implantation (marked on the graph as day 1 of administration). Mice were treated intravenously with PBS (4 doses, every 5 days, followed by 2 doses, every 3 days), intravenously with LNP (MC3) ZF9-MQ1 + ZF3-KRAB (2 doses, every 1.5 mg/kg for 5 days; 3 doses, 3 mg/kg every 5 days; 1 dose, 3 mg/kg every 3 days), orally treated with sorafenib (50 mg/kg daily). All animals were weighed daily and assessed visually. Tumor size was measured by bioluminescence twice a week.

Results showed that treatment with ZF9-MQ1 + ZF3-KRAB significantly reduced tumor growth (from day 21) compared to PBS control treated mice. ZF9-MQ1 + ZF3-KRAB reduced tumor growth similar to Sorafenib (Fig. 15A). ZF9-MQ1 + ZF3-KRAB treatment had minimal effect on whole animal body weight (Fig. 15B). Example 15: In vivo efficacy of ZF9-MQ1 and co-formulated ZF9-MQ1 + ZF3-KRAB in a Hep 3B model grown subcutaneously in nude mice

This example demonstrates that ZF9-MQ1 and co-formulated ZF9-MQ1 + ZF3-KRAB are able to inhibit Hep 3B tumor growth in female nude mice in a dose-dependent manner.

Hep 3B tumor cells were implanted into the left flank of seventy-two female nude mice to induce tumors. Changes in tumor volume were measured and treatment was initiated when the average tumor volume reached approximately 200 ^mm3 . Mice were divided into nine treatment groups (8 mice per group) such that the mean tumor volumes in each group were approximately equal. Mice in each group were injected intravenously with PBS (3 doses, every 5 days; followed by 3 doses, every 3 days), 1 mg/kg and 3 mg/kg of ZF9-MQ1 (3 doses, every 3 days). 5-day injection; followed by 3 doses, injected every 3 days), 1 mg/kg and 3 mg/kg co-formulated ZF9-MQ1 + ZF3-KRAB (3 doses, injected every 5 days; followed by 3 doses, every 3 days injection), 1 mg/kg and 3 mg/kg negative control mRNA (3 doses, injected every 5 days; followed by 3 doses, injected every 3 days), intraperitoneal injection of 100 mg/kg MYCi975 (every 5 days a week, once a day) or intraperitoneal injection of 1 mg/kg cisplatin (once every 15 days). All animals were weighed daily and assessed visually. Tumor volume changes were measured 3 times a week.

The results showed that 1 mg/kg of ZF9-MQ1 alone and the combination of ZF9-MQ1 and ZF3-KRAB was able to reduce tumor growth compared to negative control treated mice ( FIG. 16A ). In addition, ZF9-MQ1 at 3 mg/kg individually (from day 13) and the co-formulated ZF9-MQ1 + ZF3-KRAB combination (from day 6) were able to Tumor growth was significantly reduced (Fig. 16B). Co-formulated ZF9-MQ1 +/ ZF3-KRAB was able to reduce tumor growth to a similar or greater extent than cisplatin or the small molecule comparator (MYCi975) at both 1 mg/kg and 3 mg/kg doses. Co-formulated ZF9-MQ1 +/- ZF3-KRAB had minimal effect on whole animal body weight compared to 1 mg/kg and 3 mg/kg doses of cisplatin and MYCi975 (Fig. 16C-D). Example 16: Combination of Zinc Finger Domain + DNA Methyltransferase Targeting the MYC Sequestered Gene Body Domain (IGD) Downregulates MYC Expression and Decreases Cell Survival in Various Lung Cancer Cell Lines

This example demonstrates that downregulation of Myc1 mRNA expression by targeting MQ1 effectors fused to zinc finger domains to the MYC promoter (ZF9-MQ1) in NSCLC lines (A549, NCI-H2009, NCI-H358HCC95) leads to multiple lung cancers The cell viability of the cell line is reduced.

ZF9-MQ1, designed to bind and target the MYC promoter in lung cancer cell lines, was delivered with negative controls including untreated cells and cells transfected with green fluorescent protein (GFP). mRNA encoding ZF9-MQ1 or GFP was delivered using SSOP LNP delivery as described in Examples 12 and 14 above. Lung cancer cells were seeded in 96-well dishes (approximately 10000 cells/well) in growth medium. LNP formulations (1 μg/ml) were then added to cells to transfect mRNA, followed by incubation for 72 hours and 120 hours, respectively. Different replica plates were pooled to determine survival and changes in mRNA expression. Viability was measured using Promega's Celltiter-GLO ^® assay kit according to the manufacturer's protocol. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples as calibrators.

These data indicated that ZF9-MQ1 was able to reduce MYC mRNA levels in four lung cancer cell lines by >80% and this was consistent with a significant reduction in lung cancer cell survival in all four cell lines (Fig. 17A-H). Example 17: ZF9-MQ1 induces apoptosis in NSCLC cell line NCI-H2009

This example demonstrates the effect of ZF9-MQ1 on apoptosis of lung cancer cells.

Viability assays, such as Cell Titer GLO (used in Example 16), measure viability by determining the relative number of cells remaining in the well based on ATP levels. These analyzes fail to distinguish between loss of cell proliferation and different types of cell death (eg necroptosis versus apoptosis).

Following transfection with ZF9-MQ1, apoptotic cells were quantified using a fluorescently labeled antibody against the phospholipid binding protein V protein and propidium iodide (PI) nuclear stain. In addition to untreated cells, mRNA encoding the ZF9 zinc finger domain without effector protein (ZF9-NE) was used as a negative control. Lung cell line NCI-H2009 was seeded in 12-well dishes (50,000 cells per well) in growth medium. LNP formulations (1 μg/ml) with mRNA were then added to cells to transfect ZF9-MQ1 or ZF9-NE mRNA, followed by 96 hours of incubation. Cells were harvested and stained using the BD Phospholipid Binding Protein V: FITC Apoptosis Detection Kit (BDB556570) and analyzed by flow cytometry. Cells positive for phospholipid-binding protein V-FITC and PI were classified as apoptotic.

These data indicate that after 96 hours, only 18% of the cells in the negative controls (ZF9-NE treated cells and untreated cells) were apoptotic (Fig. 18A-B, 18D). In contrast, in ZF9-MQ1 -treated NCI-H2009 cultures, 40% of cells were apoptotic (Fig. 18C-D). This indicates that ZF9-MQ1 can induce apoptosis in lung cancer cells.

Example 18: Dose-response curves of survival rate and MYC expression of other NSCLC cell lines using ZF9-MQ1.

This example demonstrates that ZF9-MQ1 downregulates MYC1 expression and cell viability in NSCLC cell lines in a dose-responsive manner.

ZF9-MQ1 designed to bind and target the MYC promoter was administered at various concentrations to two NSCLC cell lines: A549 and HCC95. Untreated cells were used as negative controls. LNP delivery in the form of SSOP was utilized to deliver effector mRNA. Lung cancer cells were seeded in 96-well dishes (approximately 10000 cells/well) in growth medium. The LNP formulation (starting at 5 μg/ml) was then added to 3 wells, then diluted approximately 1 :2 into 10 doses each in subsequent wells for mRNA transfection, and incubated for 72 hours. Different replica plates were pooled to determine survival and changes in mRNA expression.

Viability was measured using Promega's Celltiter-GLO ^® assay kit according to the manufacturer's protocol. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples and dCas9 (no effector) samples as calibrators.

The data showed that at 72 hours, ZF9-MQ1 down-regulated both A549 and HCC95 MYC, and its EC50 was 0.08 μg/ml LNP/mRNA, which had about 25 times higher in vitro EC50 effect on survival rate (2 μg/ml) (FIGS. 19A-B).

Example 19: ZF9-MQ1 reduces MYC protein levels in NSCLC cell line NCI-H2009 by more than 80%

This example demonstrates changes in MYC protein levels as a response to ZF9-MQ1 treatment via immunoblotting techniques.

In addition to the negative control ZF9-NE and untreated cells, ZF9-MQ1 designed to bind to and target the MYC promoter in lung cancer cell lines was delivered. Lung cell line NCI-H2009 was seeded in 12-well dishes (50,000 cells per well) in growth medium. LNP formulations (1 μg/ml) were then added to cells to transfect ZF9-MQ1 or ZF9-NE mRNA, followed by 96 hours of incubation. Cells were then lysed in RIPA buffer and protein levels quantified using the Pierce BCA protein assay (23225). Each sample was loaded with an equal amount of protein and separated by size using the NuPAGE ^™ Mini Gel System (Thermo Fisher). Proteins were then transferred to PVDF membranes using the iBlot™ 2 Gel Transfer Apparatus (Thermo Fisher). Membranes were probed overnight with an ABCAM anti-MYC antibody (ab32072). Cell Signaling anti-actin antibody (8H10D10) was used as an internal reference. The signal was then visualized and quantified using a fluorescent secondary antibody against MYC and the actin antibody species using a LI-COR imaging system.

The data showed that at 96 hours after the lung cancer cell lines were treated, ZF9-MQ1 treatment reduced the MYC protein level by more than 80% (FIG. 20A-B), similar to the reduction of mRNA expression (Example 17). Example 20: In vivo efficacy of ZF9-MQ1 in the NCI-H2009 model grown subcutaneously in nude mice

This example demonstrates that ZF9-MQ1 inhibits the growth of established NCI-H2009 tumors in female nude mice.

Disease was induced in female nude mice by implanting NCI-H2009 tumor cells into the left flank. Treatment was initiated ^when the average tumor volume reached approximately 100-150 mm. Mice were divided into treatment groups such that the mean tumor volumes in each group were approximately equal. mRNA was delivered in MC3 LNP. Mice were injected intravenously with 3 mg/kg of ZF9-MQ1 or MC3 LNP containing non-coding mRNA, or with PBS (4 doses every 5 days, followed by 3 doses every 3 days; mice were given a total of 7 doses). All animals were weighed daily and assessed visually. Tumor size was measured 3 times a week.

The results showed that ZF9-MQ1 was able to significantly reduce tumor growth (from day 8) compared to PBS control treated mice (Figure 21). ZF9-MQ1 had minimal effects on whole animal body weight. Example 21: Combination of guide RNA and transcriptional repressor targeting MYC IGD super-enhancer (via dCas9) Downregulation of MYC expression using SSOP LNP

This example demonstrates that MYC mRNA expression is downregulated when the lung-specific super-enhancer that regulates MYC expression in the A549 cell line is targeted by KRAB effector proteins.

GRCh37: chr8:129188878-129188900 GD-29834

GRCh37: chr8:129188958-129188980 GD-29835

GRCh37: chr8:129188960-129188982 GD-29836

GRCh37: chr8:129189067-129189089 GD-29837

GRCh37: chr8:129189457-129189479 GD-29838

GRCh37: chr8:129189554-129189576 GD-29839

GRCh37: chr8:129189679-129189701 GD-29840

GRCh37: chr8:129209511-129209533 GD-29841

GRCh37: chr8:129209643-129209665 GD-29842

GRCh37: chr8:129209658-129209680 GD-29843

GRCh37: chr8:129209856-129209878 GD-29844

GRCh37: chr8:129189452-129189474 GD-29914

GRCh37: chr8:129189190-129189212 GD-29915

GRCh37: chr8:129189274-129189296 GD-29916

GRCh37: chr8:129189421-129189443 GD-28662

GRCh37: chr19:55627120-55627139 Guide RNAs (Table 13) were designed based on the entire lung super-enhancer region and tested in combination with the KRAB repressor protein coupled to the enzyme-deactivating CAS9. Effector mRNA was co-delivered with guide RNA using LNP delivery in the form of SSOP, with mRNA delivery of GFP serving as a negative control. NCSLC cell line A549 was seeded in 96-well plates (approximately 10,000 cells/well) in growth medium. LNP formulation (2.5 μg/ml) was then added to cells to transfect effector mRNA/guide RNA followed by 72 hours of incubation. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples as calibrators. Table 13: Wizard wizard name target sequence genome coordinates GD-29833

GRCh37: chr8:129188878-129188900 GD-29834

GRCh37: chr8:129188958-129188980 GD-29835

GRCh37: chr8:129188960-129188982 GD-29836

GRCh37: chr8:129189067-129189089 GD-29837

GRCh37: chr8:129189457-129189479 GD-29838

GRCh37: chr8:129189554-129189576 GD-29839

GRCh37: chr8:129189679-129189701 GD-29840

GRCh37: chr8:129209511-129209533 GD-29841

GRCh37: chr8:129209643-129209665 GD-29842

GRCh37: chr8:129209658-129209680 GD-29843

GRCh37: chr8:129209856-129209878 GD-29844

GRCh37: chr8:129189452-129189474 GD-29914

GRCh37: chr8:129189190-129189212 GD-29915

GRCh37: chr8:129189274-129189296 GD-29916

GRCh37: chr8:129189421-129189443 GD-28662

GRCh37: chr19:55627120-55627139

These data show that guide RNAs GD-29833 and 29914 downregulate MYC mRNA levels when delivered together with dCAS9-KRAB effector mRNA, highlighting the ability to use this remote regulatory element to reduce oncogenic MYC (Figure 22). Example 22: Combination of guide RNA and transcriptional repressor (dCas9) targeting the MYC IGD super-enhancer uses MC3 LNP to downregulate MYC expression

This example describes the use of the surrogate lipid MC3 (relative to SSOP in Example 21) to downregulate MYC mRNA expression by targeting KRAB effector proteins to lung-specific super-enhancers that regulate MYC expression.

Guide RNAs (Table 13) were designed based on the entire lung super-enhancer region and tested in combination with the KRAB repressor protein coupled to the enzyme-deactivating CAS9. Effector mRNA was co-delivered with guide RNA using LNP delivery in the form of MC3, using mRNA delivery of GFP as a negative control. NCSLC cell line A549 was seeded in 96-well plates (approximately 10,000 cells/well) in growth medium. LNP formulation (2.5 μg/ml) was then added to cells to transfect effector mRNA/guide RNA followed by 72 hours of incubation. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples as calibrators.

These data show that guide RNAs GD-29833 and 29914 downregulate MYC mRNA levels when delivered together with dCAS9-KRAB effector mRNA, highlighting the ability to use this remote regulatory element to reduce oncogenic MYC (Figure 23). This effect was found with both SSOP (Example 21) and MC3 lipofection (Example 22). Example 23: Combination of guide RNA and transcriptional repressor (dCas9) targeting the MYC IGD super-enhancer downregulates MYC expression in NSCLC

This example describes the downregulation of MYC mRNA expression by targeting various transcriptional effector proteins (EZH2, EZH2-KRAB or MQ1 ) to lung-specific super-enhancers that regulate MYC expression.

Guide RNAs targeting the MYC super-enhancer (GD-29833 and GD-29914) and repressor proteins including the histone methyltransferase EZH2 (alone or in combination with KRAB) and DNA methyltransferase coupled to enzyme-deactivating CAS9 MQ1) Combination test. Effector mRNA was co-delivered with guide RNA using LNP delivery in the form of SSOP, with mRNA delivery of GFP serving as a negative control. NCSLC cell lines A549 or NCI-H2009 were seeded in 96-well plates (approximately 10,000 cells/well) in growth medium. LNP formulation (2.5 μg/ml) was then added to cells to transfect effector mRNA/guide RNA followed by 72 hours of incubation. RNA from three biological replicates was isolated using the ^Rneasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples as calibrator.

These data demonstrate that guide RNAs GD-29833 and 29914 are effective when delivered with all 3 effector proteins (EZH2, EZH2-KRAB and MQ1) and tested against 2 different NSCLC cell lines (A549 and NCI-H2009) Downregulation of MYC mRNA levels (Fig. 24A-B). Example 24: Combination of guide RNA and transcriptional repressor (dCas9) targeting the MYC IGD super-enhancer further downregulates MYC expression in NSCLC at 120 hours

This example shows that at 120 hours after transfection of lung cancer cell lines (A549 and NCI-H2009) with super-enhancer-targeting guides together with KRAB or MQ1 effector proteins, an increased decrease in MYC mRNA expression was observed.

Guide RNAs targeting the MYC super-enhancer were tested in combination with KRAB repressor protein or MQ1 DNA methyltransferase. Effector mRNA was co-delivered with guide RNA using LNP delivery in the form of SSOP, with mRNA delivery of GFP serving as a negative control. NCSLC cell lines A549 or NCI-H2009 were seeded in 12-well plates (approximately 50,000 cells/well) in growth medium. LNP formulation (2.5 μg/ml) was then added to cells to transfect effector mRNA/guide RNA followed by 120 hours of incubation. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method, using untreated samples as calibrators.

These data indicated that guide RNAs GD-29833 and 29914 delivered together with KRAB or MQ1 could significantly downregulate MYC mRNA levels in 2 NSCLC cell lines (A549 and NCI-H2009) at 120 hours (Fig. 25A-B). In addition, the downregulation observed was similar to that observed for ZF9-MQ1 treatment of NCI-H2009 (Figure 25B). Example 25: Directing dCAS9-MQ1 to the MYC super-enhancer resulted in increased DNA methylation at the super-enhancer target as well as at the MYC promoter region.

This example demonstrates that dCas9-MQ1 can be directed to the MYC super-enhancer, resulting in methylation of the target site as well as the MYC promoter region.

The CRISPR-dCas9 system was modified by tethering the system to the epigenetic suppressor MQ1. These molecules regulate transcriptional repression, resulting in the methylation of CpG nucleotides of DNA. Effector mRNA was co-delivered with super-enhancer guide RNAs (29833 and 29914) using LNP delivery in the SSOP format, using mRNA delivery of GFP or dCAS9-null effector construct (dCas9-NE) as a negative control. The NCSLC cell line NCI-H2009 was seeded in 6-well plates (approximately 100,000 cells/well) in growth medium. LNP formulation (2.5 μg/ml) was then added to cells to transfect effector mRNA/guide RNA followed by 72 hours of incubation. DNA was isolated using the Lucigen QuickExtract™ DNA Extraction Kit and methylated regions were determined by using targeted bisulfite sequencing on promoter and super-enhancer regions.

These studies showed that dCas9-MQ1 increased target methylation in NSCLC by 60% and also directed methylation to distal promoter regions (increased to approximately 50%) (Fig. 26A-B). Example 26 : Combination of guide RNA and transcriptional repressor targeting MYC IGD super-enhancer ( via "disabled" CAS9 ) reduces MYC protein levels in NSCLC cell line NCI - H2009

This example demonstrates changes in MYC protein levels by targeting guide RNAs to the MYC super-enhancer in NSCLC cells by immunoblotting techniques.

GD-29833, designed to bind to and target the MYC super-enhancer in lung cancer cell lines, was co-delivered with dCAS9-KRAB or dCAS9-MQ1 effector mRNA. Lung cell line NCI-H2009 was seeded in 12-well dishes (50,000 cells per well) in growth medium. LNP formulations (1 μg/ml) were then added to cells to transfect guide and effector mRNAs, followed by incubation for 96 hours. The dCAS9-null effector (dCAS9-NE) construct was used as a negative control. Cells were then lysed in RIPA buffer and protein levels quantified using the Pierce BCA protein assay (23225). Each sample was loaded with an equal amount of protein and separated by size using the NuPAGE ^™ Mini Gel System (Thermo Fisher). Proteins were then transferred to PVDF membranes using the Invitrogen iBlot™ 2 Gel Transfer Apparatus (Thermo Fisher). Membranes were probed overnight with an ABCAM anti-MYC antibody (ab32072). Cell Signaling anti-actin antibody (8H10D10) was used as an internal reference. The signal was then visualized and quantified using a fluorescent secondary antibody against MYC and the actin antibody species using a LI-COR imaging system.

These data demonstrate that directing the guide along with the transcriptional repressor to the MYC lung super-enhancer reduces MYC protein levels by up to 50% in the NCI-H2009 lung cancer cell line at 96 hours (Fig. 27A-B), similar to mRNA expression Quantitative reduction (Example 16). Example 27: The presence of ZF9-MQ1 protein in whole cell lysates is associated with downregulation of MYC protein in Hep3B cell line

The examples describe changes in the expression of ZF9-MQ1 and MYC proteins in Hep 3B cells over a time course following ZF9-MQ1 treatment.

At 6, 16 and 48 hours after ZF9-MQ1 treatment, ZF9-MQ1 and MYC protein expression levels (Western blotting) were assessed, and LNPs were removed and medium replaced at 24 hours after the start of treatment. Protein was extracted using RIPA buffer and total protein was quantified using BCA assay (Thermo Fisher). Total proteins were run on NuPAGE ^™ Bis-Tris gels (Thermo Fisher) through MOPS running buffer and transferred using the iBlot™ 2 Gel Transfer Device (Thermo Fisher).

MYC western blotting: β-actin antibody was stained with a secondary antibody labeled with a fluorophore emitting at 594 nm, and the MYC antibody (Abcam) was stained with a secondary antibody labeled with a fluorophore emitting at 488 nm. grade antibody staining. An Odyssey ^® CLx imaging system using near-infrared (NIR) fluorescence (LI-COR) was used to capture protein images, which were used for quantification via LI-COR software. Background areas were subtracted from the area under the curve (AUC) for each MYC and actin band, then both were normalized to the negative control at each time point.

ZF9-MQ1 (control labeled with hemagglutinin [HA] epitope) Western blot: β-actin antibody stained with a secondary antibody labeled with a fluorophore emitting at 594 nm, and HA Antibodies were stained with secondary antibodies labeled with a fluorophore emitting at a wavelength of 488 nm. The Odyssey ^® CLx Imaging System with NIR Fluorescence (LI-COR) was used to capture protein images, which were used for quantification via LI-COR software. The background area was subtracted from the AUC of each HA and actin band, then both were normalized to the negative control at each time point.

The data showed that after the cells were treated with ZF9-MQ1, the expression levels of ZF9-MQ1 protein and MYC protein present in the whole cell lysates were both reduced (Figure 28A-B), and the ZF9-MQ1 protein and MYC protein present in the whole cell Downregulation of the protein was associated (Fig. 28C). Example 28: Duration and Methylation Status of MYC Expression Reduction

The experiments assessed the durability of MYC exhibiting reductions following ZF9-MQ1 treatment. Additionally, this experiment demonstrates and evaluates the correlation of MYC expression with increased DNA methylation at targeted loci.

The SKHEP-1 cell line (Example 4) exhibiting minimal change in viability, but 40-50% downregulation of MYC, was used to assess durability of response. SK-HEP-1 was transfected with LNP/ZF9-MQ1 or ZF-null effector (negative control), followed by replacement with new medium after 24 hours of treatment. Cells were harvested at indicated time points for extraction of mRNA and genomic DNA (Qiagen RNA/DNA kit). To assess MYC mRNA, whole-cell RNA was processed to generate complementary DNA (cDNA) (using polyA primers), followed by reverse transcription-polymerase chain reaction (RT-PCR) analysis using the human MYC mRNA transcript Specific TaqMan ^™ probes (Thermo Fisher). To assess methylation status at targeted loci, 5-methylcytosine was measured at single DNA base pair resolution using targeted bisulfite genome sequencing.

On day 3, MYC mRNA was reduced by 89% compared to negative control (ZF-null effector) and untreated cells (not shown). The downregulation of mRNA expression increased slowly, with MYC transcripts maintaining a 45% downregulation at day 15 (FIG. 29A). Additionally, expression of ZF9-MQ1 directs de novo CpG methylation to the MYC promoter region. MYC transcriptional changes correlated with percent methylation up to day 15 (Fig. 29B). Example 29: C-MYC Expression and Cell Viability of Primary Hepatocytes Using Bicistronic ZF9-MQ1_ZF3-KRAB

This example evaluates the effect of bicistronic ZF9-MQ1_ZF3-KRAB on MYC mRNA and viability of primary hepatocytes. Cryopreserved primary human hepatocytes (Lonza) were thawed and added to pre-warmed thawed medium and seeded at 24 hours. Cells were resuspended in seeding medium and counted to prepare the indicated concentrations ( ¹⁰⁶ cells/ml). Fifty (50) μL of the cell solution was then added to the 96-well plate (containing an additional 50 μL of seeding medium) to a total volume of 100 μL and incubated overnight. LNP-modulated mRNA (GFP, ZF-NE, ZF9-MQ1, ZF3-KRAB, ZF9-MQ1 + ZF3-KRAB, or bicistronic ZF9-MQ1_ZF3-KRAB) at 0.6 µg/ml, 1.25 µg/ml and A concentration of 2.5 µg/ml was added to 100 µL of additional medium containing the cells. Cells were incubated for 72 hours with replacement of maintenance medium beginning at 6 hours and then daily thereafter. At 72 hours after treatment, MYC mRNA expression (RT-PCR) and cell viability (CellTiter-GLO ^® ) were assessed.

Primary hepatocytes treated with ZF9-MQ1, ZF9-MQ1 + ZF3-KRAB, or bicistronic ZF9-MQ1_ZF3-KRAB showed reduced MYC mRNA expression compared to GFP, ZF-NE, or ZF3-KRAB (Fig. 30A) . Overall, this treatment showed minimal effect on survival, indicating that normal cells had a lower consequent reduction in MYC expression than HCC cell lines (Fig. 30B).

In another experiment, cryopreserved PHH was thawed in pre-warmed hepatocyte thawing medium and centrifuged at 100 g for 8 min at room temperature. The cell pellet was resuspended in hepatocyte seeding medium. Cells were then counted and their baseline viability was measured. Cell dilutions were prepared and 50,000 cells were seeded in duplicate 96-well plates. Cells were incubated overnight. The seeding medium was completely removed the next day and pre-warmed hepatocyte medium was added. Cells were treated with 2.0, 1.0 or 0.5 μg/mL of bicistronic ZF9-MQ1_ZF3-KRAB, ZF9-MQ1, ZF3-KRAB, ZF9-NE or control GFP mRNA three times and incubated for 6 hours. Treatment medium was then removed and replaced with 200 μL of fresh hepatocyte medium. Cells were incubated for 66 hours after transfection (total 72 hours). After treatment, one plate is lysed with CellTiter-GLO® Reagent, and luminescence is quantified using a Glo Max Discovery plate reader. Media was removed from the second cell culture plate by aspiration and cells were lysed with RLT Plus Lysis Buffer. mRNA extraction was performed using the RNeasy® Plus 96 kit according to the manufacturer's instructions. After extraction, the mRNA was converted to cDNA using the LunaScript® RT SuperMix Kit (NEB). cDNA was analyzed by ΔΔCT qPCR using MYC (target) and GAPDH (reference) probes.

PHH treated with the bicistronic ZF9-MQ1_ZF3-KRAB showed a decrease in MYC mRNA compared to controls (Fig. 30C). ZF9-MQ1 (all doses) and ZF3-KRAB (2 µg/mL) downregulated MYC mRNA with minimal effect on cell viability (Fig. 30D). ZF9-NE did not affect MYC mRNA or survival (Fig. 30C-D). Overall, bicistronic ZF9-MQ1_ZF3-KRAB treatment showed minimal effect on survival, suggesting that reduction of MYC expression in normal cells did not affect cell survival (Fig. 30A-D). Example 30: In vivo efficacy of ZF9-MQ1+ZF3-KRAB in the NCI-H2009 model grown subcutaneously in nude mice

This example demonstrates that ZF9-MQ1+ZF3-KRAB inhibits the growth of established NCI-H2009 tumors in female nude mice.

Disease was induced in female nude mice by implanting NCI-H2009 tumor cells into the left flank. Treatment was initiated ^when the average tumor volume reached approximately 100-150 mm. Mice were divided into treatment groups such that the mean tumor volumes in each group were approximately equal. mRNA was delivered in MC3 LNP. Mice were injected intravenously with 3 mg/kg of ZF9-MQ1+ZF3-KRAB every 5 days, or with MC3 LNP containing non-coding mRNA at 3 mg/kg intravenously every 5 days, or with 1 mg intraperitoneally every 15 days /kg of cisplatin, or inject PBS every 5 days.

The results showed that ZF9-MQ1+ZF3-KRAB therapy showed a statistically significant reduction in tumor size after three administrations, and the tumor volume was reduced by 63% on day 25 compared with the control ( FIG. 31A ). The body weight of the mice was not significantly affected (FIG. 31B). In this study, ZF9-MQ1 + ZF3-KRAB therapy had equal effects on tumor volume as cisplatin therapy (Fig. 31A). Example 31: In Vivo Efficacy of ZF9-MQ1 + ZF3-KRAB Co-Formulation in Hep 3B Model Orthotopically Growing in Fox Chase CB17 SCID Mice

This example demonstrates the long-term antitumor efficacy and durability of ZF9-MQ1 + ZF3-KRAB co-formulations in the orthotopic Hep3B-luc model after administration to female Fox Chase CB17 SCID mice.

Hep-3B-luc cells were injected in the left upper lobe of the liver of SCID mice. Mean ventral whole-body tumor-associated bioluminescence (TABL) was approximately ^2.8x109 p/s for each randomized group. Mice were randomly assigned to four groups of 12 mice each treated with PBS, ZF9-MQ1+ZF3-KRAB (higher dose, i.e., 6 mg/kg), ZF9-MQ1+ZF3-KRAB (medium dose, that is, 3 mg/kg), ZF9-MQ1+ZF3-KRAB (low dose, that is, 3 mg/kg) treatment, and assigned to a group of 6 mice, these mice were implanted with cells After the 7th day of treatment with sorafenib. Treatment started on day 8 after tumor cell implantation (marked on the graph as day 1 of administration). Mice were treated intravenously with PBS (4 doses every 5 days, followed by 2 doses every 3 days), LNP (MC3) ZF9-MQ1 + ZF3-KRAB (1.5 mg/kg, every 5 days) Treatment, intravenous LNP (MC3) ZF9-MQ1 + ZF3-KRAB (3 mg/kg, every 5 days) treatment, intravenous LNP (MC3) ZF9-MQ1 + ZF3-KRAB (6 mg/kg, every 5 days) Every 5 days) and sorafenib (50 mg/kg, once a day) orally. All animals were weighed daily and assessed visually. Tumor size was measured by bioluminescence twice a week.

Results showed that ZF9-MQ1 + ZF3-KRAB therapy was associated with significant suppression of tumor size after two administrations. Compared with the negative control, treatment at 1.5 mg/kg dose resulted in approximately 63% inhibition of tumor growth by day 23; compared with negative control, treatment at 3 mg/kg resulted in approximately 54% inhibition of tumor growth by day 23 (Fig. 32A). Similarly, ZF9-MQ1 + ZF3-KRAB therapy at a dose of 6 mg/kg was associated with a statistically significant reduction in tumor size after two administrations, resulting in a 63% lower tumor volume at day 23 than the negative control (Fig. 32A). 3 mg/kg ZF9-MQ1 + ZF3-KRAB therapy was equivalent to Sorafenib therapy (Fig. 32A). ZF9-MQ1 + ZF3-KRAB treated mice did not experience a significant decrease in body weight (Fig. 32B). Sorafenib-treated mice experienced an initial decrease in body weight, followed by a potential increase in overall body weight due to increased tumor mass (Fig. 32B). These data indicate that ZF9-MQ1 + ZF3-KRAB therapy was well tolerated in this study. Example 32: Bicistronic mRNA encoding ZF9-MQ1 and ZF3-KRAB reduces MYC expression and cell viability

This example compares the efficacy of co-formulations of the bicistronic construct ZF9-MQ1_ZF3-KRAB with the single constructs ZF3-KRAB and ZF9-MQ1 and ZF3-KRAB with ZF9-MQ1. These constructs were delivered to hepatocellular carcinoma cells via mRNA encapsulated in lipid nanoparticles (LNP).

ZF9-MQ1 , ZF3-KRAB, bicistronic ZF9-MQ1_ZF3-KRAB and co-formulated ZF9-MQ1 and ZF3-KRAB constructs were prepared by encapsulating the respective mRNAs in LNPs. Hep 3B cells were transfected by seeding 10,000 cells per well in 96-well plates and further treated with 0.6 μg/mL and 2 μg/mL mRNA/LNP.

At 48 hours after transfection, MYC mRNA and cell viability were analyzed. Viability was measured using Promega's Celltiter-GLO ^® assay kit according to the manufacturer's protocol. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression (using TaqMan ^™ primers/probes) was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method. MYC expression was normalized to untreated cells.

These data demonstrate that the bicistronic construct ZF9-MQ1_ZF3-KRAB downregulates MYC mRNA and cell viability in Hep 3B cells to a greater extent than either single construct (ZF3-KRAB or ZF9-MQ1 ) alone (FIGS. 33A-33B ). At 48 hours, the bicistronic ZF9-MQ1_ZF3-KRAB reduced total MYC mRNA levels by 99% at both 0.6 µg/ml and 2 µg/ml concentrations (Fig. 33A). Bicistronic ZF9-MQ1_ZF3-KRAB decreased the viability of Hep3B cells by approximately 80% and 27% at concentrations of 2 µg/ml and 0.6 µg/ml, respectively (Fig. 33B). In addition, bicistronic construct therapy was as effective as co-formulations of ZF3-KRAB and ZF9-MQ1 constructs. Example 33: Bicistronic ZF9-MQ1_ZF3-KRAB reduces MYC mRNA and HCC cell survival in all HCC subtypes in a dose-dependent manner

This example evaluates the potency of the bicistronic ZF9-MQ1_ZF3-KRAB against all HCC subtypes S1 and S2. The HCC S1 subtype cell lines SKHEP-1, SNU-449 and SNU-182 and the S2 subtype cell lines Hep 3B and Hep G2 were treated with bicistronic ZF9-MQ1_ZF3-KRAB. After 72 hours of treatment, we evaluated MYC mRNA and cell viability at serially diluted concentrations of the bicistronic construct ZF9-MQ1_ZF3-KRAB.

HCC cells were seeded in 96-well plates (approximately 10,000 cells/well) in growth medium. LNP formulations (starting at 2.5 μg/ml) were then added to 3 wells, then diluted approximately 1 :2 into 10 dose points each in subsequent wells for transfection of mRNA, followed by 72 hours of incubation. Different replica discs were collected for survival and RNA. Viability was measured using Promega's Celltiter-GLO ^® assay kit according to the manufacturer's protocol. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific) (Technical experiment repeated three times). MYC expression (using TaqMan ^™ primers/probes) was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method. MYC expression was normalized to untreated cells.

The results showed that bicistronic ZF9-MQ1_ZF3-KRAB treatment showed an effect on cell viability in all HCC subtypes (Fig. 34A-C). EC50 values for inhibition of MYC mRNA ranged from <1-20 ng/mL with no trend between S1 and S2 subtypes (Fig. 34D). Similarly, the 50% reduction in cell viability translated into a higher range of values (120-200 ng/mL) compared to the MYC mRNA EC50. There were no significant differences in MYC mRNA expression or cell viability between the S1 and S2 subtypes. The EC50 values of the three S1 and two S2 subtype HCC tumor cell lines demonstrated that the bicistronic ZF9-MQ1_ZF3-KRAB was effective against the two HCC subtypes (Fig. 34D). Example 34: Apoptosis induced by bicistronic ZF9-MQ1_ZF3-KRAB on HCC cells

This example describes the apoptotic effect of bicistronic ZF9-MQ1_ZF3-KRAB on HCC cells. Viability assays (such as CellTiter-GLO ^® ) only assess the relative number of cells remaining in the well, based on ATP levels that are indistinguishable between loss of cell proliferation and cell death.

In this example, following transfection with the bicistronic ZF9-MQ1_ZF3-KRAB, the following three Apoptotic cells in HCC cell lines: Hep 3B, Hep G2 and SK-HEP-1. In addition to untreated cells, non-coding mRNA was used as a negative control. HCC cells were seeded in 12-well dishes (50,000 cells per well) in growth medium. LNP formulation (1 μg/ml) was then added to cells to transfect mRNA and incubated for 48 hours. Cells were harvested and stained using the BD Phospholipid Binding Protein V: FITC Apoptosis Detection Kit (BDB556570) and analyzed by flow cytometry. Cells positive for phospholipid binding protein V FITC and PI were classified as apoptotic.

These data show that at 48 hours after bicistronic ZF9-MQ1_ZF3-KRAB treatment, >75% of apoptotic cells were detected in Hep 3B and Hep G2 cell lines and apoptosis in SK-HEP-1 cell line was detected Cells were 15% (Figure 35). Non-coding mRNA controls had no effect on cells compared to untreated cells (5-20% background apoptosis) (Figure 35). It shows that bicistronic ZF9-MQ1_ZF3-KRAB can induce cell apoptosis in cultured HCC cell lines.

Example 35: The bicistronic ZF9-MQ1_ZF3-KRAB reduces MYC mRNA levels in a durable manner

In this example, the durability of MYC mRNA downregulation achieved by the bicistronic ZF9-MQ1_ZF3-KRAB was evaluated following one treatment with the bicistronic ZF9-MQ1_ZF3-KRAB SSOP LNP. The bicistronic ZF9-MQ1_ZF3-KRAB inhibits MYC by directing methylation and repressive histone marks to MYC IGD. To determine the duration for which these modifications are effective, SK-HEP-1 cells were used, since these modifications exhibited minimal effects on cell viability after bicistronic ZF9-MQ1_ZF3-KRAB treatment. The goal of this study was to determine whether a single treatment with the bicistronic ZF9-MQ1_ZF3-KRAB could maintain MYC mRNA repression for approximately 2 weeks.

SK-HEP-1 cells were seeded in 6-well plates at 200,000 cells per well in 2 mL of growth medium. Cells were then treated with 0.6 μg/mL bicistronic ZF9-MQ1_ZF3-KRAB or control non-coding mRNA LNP. On day 1, after treatment with bicistronic ZF9-MQ1_ZF3-KRAB, cells were trypsinized and split into three samples; 1 sample for RNA extraction, 1 sample for genomic DNA (gDNA) extraction, 1 Samples are saved for future time points. This process was repeated on days 3, 6, 9 and 12 after treatment. On day 15, the remaining cells were aliquoted for RNA and gDNA extraction. RNA from three biological replicates was isolated using the ^RNeasy® Plus 96-well kit (Qiagen) following the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using the ^LunaScript® RT SuperMix Kit (NEB) and analyzed by quantitative PCR (qPCR) using MYC-specific TaqMan ^™ Primer/Probe Set Analysis and TaqMan ^™ Fast Advanced Master Mix (Thermo Scientific). Analysis (technical experiments repeated three times). MYC expression (using TaqMan ^™ primers/probes) was quantified relative to the expression of the GAPDH reference gene using the ΔΔCt method. MYC expression was normalized to untreated cells.

This data demonstrates the durability of bicistronic ZF9-MQ1_ZF3-KRAB-mediated regulation of MYC gene expression. After one treatment of SKHEP1 cells with bicistronic ZF9-MQ1_ZF3-KRAB, MYC mRNA levels decreased at day 1 and remained suppressed up to 15 days after treatment (Figure 36). Example 36: Bicistronic ZF9-MQ1_ZF3-KRAB reduces MYC mRNA and protein expression and cell viability in HCC cell lines

To understand the pharmacodynamics of bicistronic ZF9-MQ1_ZF3-KRAB on various HCC cells, MYC mRNA expression and protein levels were assessed in HCC cells at 6-96 hours after bicistronic ZF9-MQ1_ZF3-KRAB treatment , cell viability, and bicistronic ZF9-MQ1_ZF3-KRAB expression.

At each time point, Hep 3B or SK-HEP-1 cells were seeded in culture medium at 10,000 cells per well in a set of two 96-well plates and at 400,000 cells per well in 6-well plates. The 96-well plate was treated with 1 μg/mL bicistronic ZF9-MQ1_ZF3-KRAB or non-coding mRNA, and repeated three times for cell viability and mRNA analysis. Treat 6-well plates with 1 μg/mL of bicistronic ZF9-MQ1_ZF3-KRAB or non-coding mRNA in duplicate for protein analysis. Cells were incubated at 6, 24, 48, 72 or 96 hours after treatment, with a small subset of cells retained at each time point as an untreated negative control. At each time point, one 96-well plate was lysed with CellTiter- ^GLO® and luminescence was quantified using ^GLOMAX® . Dissolve a second 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA is then converted to cDNA using RT ^LunaScript® . The cDNA was then analyzed by ΔΔCT qPCR using MYC (target) and GAPDH (reference) probes. Cells in 6-well plates were lysed with RIPA buffer at various time points for protein isolation. Total protein was quantified using the Pierce BCA protein assay (23225). Each sample was loaded with an equal amount of protein and separated by size using the NuPAGE ^™ Mini Gel System (Thermo Fisher). Proteins were then transferred to PVDF membranes using the iBlot™ 2 Gel Transfer Apparatus (Thermo Fisher). Membranes were probed overnight with anti-MYC antibody (Abcam ab32072). Anti-β-actin antibody (Cell Signaling 8H10D10) was used as internal reference. The signal was then visualized and quantified using a fluorescent secondary antibody against MYC and a β-actin primary antibody using a LI-COR imaging system.

Bicistronic ZF9-MQ1_ZF3-KRAB reduced MYC mRNA and protein expression in both cell lines at 6 hours compared to non-coding short mRNA or untreated cells, and remained down-regulated for 96 hours thereafter (Figure 37) . At 48 hours after treatment with the bicistronic ZF9-MQ1_ZF3-KRAB, a decrease in cell viability was observed for both cell lines (Figure 37). The shorter non-coding negative control had no effect on cell viability. Example 37: Bicistronic ZF9-MQ1_ZF3-KRAB mRNA expresses ZF9-MQ1 and ZF3-KRAB as visualized by HA-tagged protein

In this example, the expression of the protein encoded by the bicistronic ZF9-MQ1_ZF3-KRAB mRNA/LNP was confirmed by Western blot analysis. Inside the cell, the bicistronic ZF9-MQ1_ZF3-KRAB produces two ZF proteins (ZF3-KRAB and ZF9-MQ1), which in this experiment were tagged with HA, allowing for the identification of HCC cells after transfection. Protein expression was quantified.

At each time point, Hep 3B or SK-HEP-1 cells were seeded in 6-well plates at 400,000 cells per well in culture medium. Treat the 6-well plate with 1 µg/mL of bicistronic ZF9-MQ1_ZF3-KRAB in duplicate for protein analysis. Cells were incubated for 6 or 24 hours. Cells were then lysed in RIPA buffer and total protein levels quantified using the Pierce BCA protein assay (23225). Each sample was loaded with an equal amount of protein and separated by size using the NuPAGE ^™ Mini Gel System (Thermo Fisher). Proteins were then transferred to PVDF membranes using the iBlot™ 2 Gel Transfer Apparatus (Thermo Fisher). Membranes were probed overnight with Abcam HA antibody. Anti-β-actin antibody (Cell Signaling 8H10D10) was used as internal reference. Signals were visualized and quantified using fluorescent secondary antibodies against MYC and β-actin antibodies using a LI-COR imaging system.

ZF3-KRAB and ZF9-MQ1 proteins encoded by bicistronic ZF9-MQ1_ZF3-KRAB mRNA were visualized by HA-tag on western blots at 6 and 24 hours after transfection ( FIG. 38 ). Aggregation of the ZF3-KRAB and ZF9-MQ1 constructs was observed at two time points. Example 38: Bicistronic ZF9-MQ1_ZF3-KRAB enhances the response of HCC cells to Sorafenib

In this example, the effect of the bicistronic ZF9-MQ1_ZF3-KRAB on the efficacy of the small molecule sorafenib, a multikinase inhibitor, in HCC cell lines was evaluated. Sorafenib is used as standard-of-care therapy in HCC and high MYC levels predict sorafenib resistance. We hypothesized that the bicistronic ZF9-MQ1_ZF3-KRAB could resensitize HCC to sorafenib via its downregulation of MYC. Dose-response analysis was used to evaluate whether bicistronic ZF9-MQ1_ZF3-KRAB therapy can reduce the IC ₅₀ of sorafenib.

To evaluate the potential synergy between the bicistronic ZF9-MQ1_ZF3-KRAB and Sorafenib, Hep 3B or SK-HEP-1 cells were seeded in 96-well plates at 10,000 cells per well. Cells were then treated with sorafenib (1 :2 serial dilution) at doses ranging between 0.1 and 25 μΜ. The lipid mixture carrying the bicistronic ZF9-MQ1_ZF3-KRAB was then added to a small set of wells at a dose of 0.1 or 0.6 μg/mL. A group of cells treated with Sorafenib alone was used as a control. After 72 hours of treatment, cells were lysed with CellTiter- ^GLO® reagent and luminescence was quantified using Glo Max. Relative cell viability was calculated by averaging the untreated values and dividing the luciferase value for each experiment by this average. Table 19: Effect of bicistronic ZF9-MQ1_ZF3-KRAB on Sorafenib IC ₅₀ Hep3B SKHEP-1 Bicistronic ZF9-MQ1_ZF3-KRAB concentration Sorafenib IC ₅₀ Bicistronic ZF9-MQ1_ZF3-KRAB concentration Sorafenib IC ₅₀ 0 µg/ml 4.4 µM 0 µg/ml 12.3 µM 0.1 µg/ml 4.25 µM 0.1 µg/ml 12.3 µM 0.6 µg/ml 2.9 µM 0.6 µg/ml 10.7 µM

The data showed that when Sorafenib was administered in combination with 0.6 µg/ml bicistronic ZF9-MQ1_ZF3-KRAB, the IC ₅₀ of Sorafenib against SKHEP1 decreased from 12.3 to 10.7 µM (Figure 39A and Table 19) And the IC ₅₀ against Hep 3B decreased from 4.4 to 2.9 µM (Fig. 39B and Table 19). When Sorafenib was administered in combination with 0.1 µg/ml bicistronic ZF9-MQ1_ZF3-KRAB, there was no significant change in the _IC50 of Sorafenib against Hep 3B or SK-HEP-1 cells (Fig. 39A-39B ). The combination of Sorafenib with the bicistronic ZF9-MQ1_ZF3-KRAB was more effective than Sorafenib alone (Figure 39A-39B). This data suggests a synergistic activity between the bicistronic ZF9-MQ1_ZF3-KRAB and Sorafenib. Example 39: Bicistronic ZF9-MQ1_ZF3-KRAB enhances the response of HCC cells to JQ1

This example evaluates the efficacy of the combination of bicistronic ZF9-MQ1_ZF3-KRAB and JQ1 (BET inhibitor) against various HCC cell lines. BET proteins have been shown to have an important role in MYC transcription. A new generation of BET inhibitors is currently being evaluated in the clinic for hematological indications; however, their toxicity profile has limited their use. Combination therapies that enhance the efficacy of BET inhibitors at reduced dose levels may improve BET inhibitor tolerability.

To evaluate the potential synergy between the bicistronic ZF9-MQ1_ZF3-KRAB and JQ1, Hep 3B or SK-HEP-1 cells were seeded in 96-well plates at 10,000 cells per well. Cells were then treated with JQ1 (1:2 serial dilution) at doses ranging between 0.1 and 25 μM. The lipid mixture carrying the bicistronic ZF9-MQ1_ZF3-KRAB was then added to one set of wells at a dose of 0.1 or 0.6 μg/mL. A panel of cells treated with JQ1 alone was used as a control. After 72 hours of treatment, cells were lysed with CellTiter- ^GLO® reagent and luminescence was quantified using Glo Max. Relative cell viability was calculated by averaging the untreated values and dividing the luciferase value for each experiment by this average. Table 20 : Effect of bicistronic ZF9 - MQ1_ZF3 - KRAB on JQ1 IC50 _ _ Hep3B SKHEP-1 Concentration of bicistronic ZF9-MQ1_ZF3-KRAB JQ1 IC ₅₀ Concentration of bicistronic ZF9-MQ1_ZF3-KRAB JQ1 IC ₅₀ 0 µg/ml 6.6 µM 0 µg/ml >25 µM 0.1 µg/ml 0.6 µM 0.1 µg/ml 1.9 µM 0.6 µg/ml 0.2 µM 0.6 µg/ml 1.1 µM

Combination of bicistronic ZF9-MQ1_ZF3-KRAB at 0.6 μg/mL with JQ1 decreased the IC ₅₀ of JQ1 against SK-HEP1 from >25 to 1.1 μM (Figure 40A and Table 20) and increased the IC ₅₀ of JQ1 against Hep 3B Decreased from 6.6 to 0.2 μM (FIG. 40B and Table 20). Combination of bicistronic ZF9-MQ1_ZF3-KRAB at 0.1 μg/mL with JQ1 reduced the IC ₅₀ of JQ1 against SK-HEP1 from >25 to 1.9 µM (Figure 40A and Table 20) and increased the IC ₅₀ of JQ1 against Hep 3B Decreased from 6.6 to 0.6 μM (FIG. 40B and Table 20). This data suggests a synergistic activity between the bicistronic construct ZF9-MQ1_ZF3-KRAB and JQ1. Example 40: Screening of Mouse Alternative Constructs Designed to Target the MYC Genome Locus

This example (mouse hepatocellular carcinoma model Hepal-6) was used to evaluate constructs targeting MYC IGD in mice. These constructs (ZF15-MQ1 , ZF16-MQ1 and ZF17-MQ1 ) were developed as alternatives to the bicistronic ZF9-MQ1_ZF3-KRAB targeting the mouse gene body. We evaluated the ability of these constructs to downregulate MYC mRNA expression and reduce mouse HCC cell survival.

A panel of mouse replacement constructs (ZF15-MQ1, ZF16-MQ1, and ZF17-MQ1) was generated and screened in Hepa1-6 cells by seeding 10,000 cells per well in duplicate dishes for mRNA extraction or Cell Viability Analysis. Treat 96-well plates with 0.6 or 1.2 μg/mL of candidate ZFs in triplicate. Cells were incubated for 72 hours. Following the incubation period, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence quantified using a GloMax ^® Discovery plate reader. Dissolve a second 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA is then converted to cDNA using RT ^LunaScript® . The cDNA was then analyzed by ΔΔCT qPCR using MYC (target) and GAPDH (reference) probes.

This screen showed that ZF17-MQ1 exhibited downregulation of mouse MYC mRNA (FIG. 41A), which corresponded to reduced survival (FIG. 41B). Example 41: Effect of Mouse Alternative Construct ZF17-MQ1 on HCC Cell Survival Rate and MYC mRNA and Protein Expression

In this example, the effect of the ZF17-MQ1 construct on downregulation of MYC mRNA and protein expression and mouse HCC cell survival was evaluated using the mouse hepatocellular carcinoma model Hepa1-6.

After treatment with ZF17-MQ1 or GFP mRNA for 96 hours, MYC mRNA and cell viability were analyzed. Hepa1-6 cells were plated in duplicate at 10,000 cells per well for mRNA extraction or cell viability analysis. Treat 96-well plates with 0.6 or 1.2 μg/mL of ZF17-MQ1 in triplicate. After incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence was quantified using a GloMax ^® Discovery plate reader. Dissolve a second 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using RT Lunascript. The cDNA was then analyzed by ΔΔCT qPCR using MYC (target) and GAPDH (reference) probes.

MYC protein levels were analyzed after 24 and 48 hours of treatment by transfecting 100,000 cells with ZF17-MQ1 or control GFP mRNA in 12-well plates. Cells were lysed in RIPA buffer and total protein levels were quantified using the Pierce BCA protein assay (23225). Each sample was loaded with an equal amount of protein and separated by size using the NuPAGE ^™ Mini Gel System (Thermo Fisher). Proteins were then transferred to PVDF membranes using the iBlot™ Gel Transfer Apparatus (Thermo Fisher). Membranes were probed overnight with anti-MYC antibody (Abcam ab32072). Anti-β-actin antibody (Cell Signaling 8H10D10) was used as internal reference. The signal was then visualized and quantified using a fluorescent secondary antibody against MYC and a β-actin antibody using a LI-COR imaging system.

The data suggest that ZF17-MQ1 can act as a mouse surrogate for the bicistronic ZF9-MQ1_ZF3-KRAB by targeting MYC IGD. Treatment of mouse HCC cells Hepa1-6 with ZF17-MQ1 significantly down-regulated MYC protein at 24 and 48 hours ( FIG. 42A ). ZF17-MQ1 treatment of mouse HCC cells Hepa1-6 showed a significant downregulation of MYC mRNA at 96 hours ( FIG. 42C ) and decreased cell viability at 96 hours ( FIG. 42D ). Example 42: Hepa1-6 subcutaneous isogenic model shows efficacy of ZF17-MQ1

This example demonstrates the efficacy of ZF17-MQ1 in immunocompetent animals. Specifically, Hepal-6 was implanted into isogenic recipient C57BL/6 normal mice.

Disease was induced in female C57BL/6 mice by implanting Hepal-6 tumor cells into the left flank. Treatment was ^initiated when the average tumor volume reached approximately 150 mm. Mice were divided into treatment groups (nine mice each for PBS or ZF17-MQ1 and six mice for sorafenib) such that the mean tumor volumes in each group were approximately equal. Mice were injected intravenously with 3 mg/kg of PBS or ZF17-MQ1. The positive control standard of care drug Sorafenib at 50 mg/kg was given daily via oral gavage. ZF17-MQ1 was given once every 5 days for a total of 4 doses, followed by a 2-week break before starting treatment two more times. All animals were weighed daily and assessed visually. Tumor size was measured 3 times per week via calipers.

The results showed that after 4 doses, ZF17-MQ1 significantly reduced the tumor burden of animals ( FIG. 43 ). Following the drug holiday, re-treatment of the mice resulted in complete tumor depletion after approximately 4 weeks (Fig. 43). These data demonstrate that ZF17-MQ1 can effectively reduce the tumor burden of HCC xenografts in immunocompetent animals.

Example 43: Epigenetic modulation of the MYC oncogene as a potential novel HCC therapy

This example describes the characterization of bicistronic ZF9-MQ1-ZF3 in HCC cell lines (Hep 3B, Hep G2, SK-HEP-1, SNU-182 and SNU-449) by measuring MYC mRNA and cell viability -KRAB.

The bicistronic ZF9-MQ1_ZF3KRAB construct in HCC cell lines (Hep 3B, Hep G2, SK-HEP-1, SNU-182 and SNU-449) was characterized by measuring MYC mRNA and cell viability. The bicistronic ZF9-MQ1_ZF3KRAB was tested for persistent epigenetic (eg DNA/chromatin methylation) and total transcript (eg RNA-seq) changes. Changes in MYC protein levels and pathway signaling were measured using various proteosome methods. Finally, the in vivo activity of the bicistronic ZF9-MQ1_ZF3KRAB in subcutaneous (subQ) and orthotopic HCC models was analyzed by assessing tumor volume, tumor-associated bioluminescence (BLI) and immunohistochemistry (IHC).

We identified constructs including the bicistronic ZF9-MQ1_ZF3-KRAB that target multiple loci on MYC IGD and potently reduce MYC mRNA, protein, and cell survival in HCC cells while avoiding normal cells. In HCC cells, the bicistronic ZF9-MQ1_ZF3KRAB had a median EC50 of <0.001 ng/mL for inhibition of MYC mRNA and 120 ng/mL for inhibition of cell viability. Importantly, the effect of the bicistronic ZF9-MQ1_ZF3KRAB was maintained for more than 2 weeks, providing durable MYC mRNA suppression. By day 23, the bicistronic ZF9-MQ1_ZF3KRAB present in LNP delivered intravenously at 3 and 6 mg/kg Q5D respectively exhibited 54% in the Hep 3B subQ model of athymic nude mice compared to the negative control and a statistically significant tumor growth inhibition (TGI) of 63%. Body weight (BW) of bicistronic ZF9-MQ1_ZF3KRAB-treated mice did not show a significant decrease compared to negative control or sorafenib-treated mice. IHC of tumors treated with bicistronic ZF9-MQ1_ZF3KRAB and controls showed significant downregulation of MYC and Ki67 (markers of proliferation) and upregulation of caspase 3 (marker of apoptosis). In the Hep 3B orthotopic model, 3 mg/kg bicistronic ZF9-MQ1_ZF3KRAB Q5D showed a similar reduction in BLI as 50 mg/kg QD of sorafenib without a reduction in BW. Example 44: Effect of Mouse Alternative Constructs on MYC Expression and Cell Viability of LL2 Cells

This example is about evaluating the effect of mouse alternative constructs (ZF15-MQ1 , ZF16-MQ1 and ZF17-MQ1 ) on MYC expression and cell viability of LL2 cells.

LL2 cells were plated in duplicate 96-well plates at 5,000 cells per well for mRNA extraction or cell viability analysis. 96-well plates were treated with 0.625 µg/mL (mRNA and viability readout) and 1.25 µg/ml (mRNA and viability readout) of LNP loaded with ZF15-MQ1, ZF16-MQ1 or ZF17-MQ1 in triplicate and incubated. 6-well plates were seeded with 200,000 cells per well and transfected with 1.25 µg/ml of the above constructs (western blot read). GFP-treated cells were used as negative controls. After incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence was quantified using a GloMax ^® Discovery plate reader. Dissolve a second 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using a polyA primer and RT Lunascript. The cDNA was then used for reverse transcription polymerase chain reaction (RT-PCR) analysis using TaqMan ^™ probes (Thermo Fisher) specific for mouse MYC mRNA transcripts. All groups were normalized using GAPDH mRNA transcript levels. For western blotting, the β-actin antibody was stained with a secondary antibody labeled with a fluorophore emitting at 594 nm, and the MYC antibody (Abcam) was labeled with a fluorophore emitting at 488 nm. Secondary antibody detection. The Odyssey ^® CLx Imaging System (LI-COR) using near-infrared (NIR) fluorescence was used to capture protein images.

The data indicated that in LL2 cells, ZF17-MQ1 -treated cells showed reduced MYC protein levels compared to untreated or GFP-treated regulatory cells (Figure 44A). ZF17-MQ1 and ZF16-MQ1 reduced MYC mRNA levels in LL2 cells by >99.9% or 74%, respectively, compared to levels observed in untreated cells (Figure 44B). In addition, all three constructs were able to reduce cell viability of LL2 cells to a greater extent than untreated and GFP-treated cells (Fig. 44C). Constructs ZF17-MQ1 , ZF16-MQ1 and ZF15-MQ1 reduced the viability of LL2 cells by up to 74%, 65% and 30%, respectively, compared to untreated cells. Example 45 : Down-regulation of MYC transcripts in LL2 and CT26 cells treated with ZF17 - MQ1

This example is about evaluating the efficacy of the ZF17-MQ1 construct to downregulate MYC mRNA expression and reduce cell viability in CT26 and LL2 cells.

CT26 and LL2 cells were plated in duplicate at 2,500 cells per well for mRNA extraction or cell viability analysis. 96-well plates were treated with 1.25 µg/mL and 2.5 µg/ml of ZF17-MQ1-loaded LNPs in triplicate and incubated. Untreated cells and GFP-treated cells were used as controls. After incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence was quantified using a GloMax ^® Discovery plate reader. Dissolve a second 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using a polyA primer and RT Lunascript. The cDNA was then used for reverse transcription polymerase chain reaction (RT-PCR) analysis using TaqMan ^™ probes (Thermo Fisher) specific for mouse MYC mRNA transcripts. All groups were normalized using GAPDH mRNA transcript levels.

The data showed that ZF17-MQ1 down-regulated MYC mRNA and decreased the cell viability of LL2 and CT26 cells to a greater extent than untreated cells and GFP-treated cells (negative control group). At 2.5 µg/mL, ZF17-MQ1 reduced MYC mRNA levels in LL2 and CT26 cells by 93% and 85%, respectively, compared to the levels observed in untreated cells (Fig. 45A). In addition, under these conditions, ZF17-MQ1 reduced the cell viability of LL2 and CT26 cells by 87% and 93%, respectively, compared to untreated cells ( FIG. 45B ). Example 46 : Down-regulation of MYC transcripts in LL2 and CMT167 cells treated with ZF17 - MQ1

This example is about evaluating the efficacy of the ZF17-MQ1 construct to downregulate MYC mRNA expression and reduce cell viability in CMT167 and LL2 cells.

CMT167 and LL2 cells were plated in duplicate at 5,000 cells per well for mRNA extraction or cell viability analysis. The 96-well plate was treated with 1.0 μg/mL of LNP loaded with GFP, non-coding RNA or ZF17-MQ1, repeated three times, and incubated. Untreated cells and GFP-treated cells were used as controls. After incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence was quantified using a GloMax ^® Discovery plate reader. Dissolve a second 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using a polyA primer and RT Lunascript. The cDNA was then used for reverse transcription polymerase chain reaction (RT-PCR) analysis using TaqMan ^™ probes (Thermo Fisher) specific for mouse MYC mRNA transcripts. All groups were normalized using GAPDH mRNA transcript levels.

The data showed that ZF17-MQ1 down-regulated the MYC mRNA of CMT167 and LL2 cells and reduced the cell viability to a greater extent than untreated cells and GFP-treated cells (negative control group). ZF17-MQ1 reduced MYC mRNA levels in CMT167 and LL2 cells by 62% and 73%, respectively, compared to the levels observed in untreated cells (Figure 46). In addition, under these conditions, ZF17-MQ1 reduced the cell viability of CMT167 and LL2 cells by 54% and 57%, respectively, compared to untreated cells ( FIG. 46 ). Example 47: ZF9-MQ1 shows minimal effect on primary cell viability

This example evaluates the effect of the ZF9-MQ1 construct on primary cell viability.

Primary small airway epithelial cells, primary pulmonary lobe epithelial cells, and primary lung fibroblasts were cultured at 7,500 cells (primary airway epithelial cells) or 5,000 cells (primary pulmonary lobe epithelial cells and primary pulmonary fibroblasts) per well. Blast cells were plated in duplicate for cell viability analysis. The 96-well plate was treated with 1.0 μg/mL of GFP- or ZF9-MQ1-loaded LNP, repeated three times, and incubated. Untreated cells and GFP-treated cells were used as controls. After incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence was quantified using a GloMax ^® Discovery plate reader. Dissolve a second 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using a polyA primer and RT Lunascript. The cDNA was then used for reverse transcription polymerase chain reaction (RT-PCR) analysis using TaqMan ^™ probes (Thermo Fisher) specific for human MYC mRNA transcripts. All groups were normalized using GAPDH mRNA transcript levels.

The data showed that compared with untreated cells, ZF9-MQ1 reduced the levels of MYC mRNA in small airway primary epithelial cells, lung lobe primary epithelial cells, and lung primary fibroblasts by 94%, 96%, and 96% respectively ( Figure 47). However, the survival rate was only reduced by 16%, 9% and 22% compared with the control cells, indicating that ZF9-MQ1 has only moderate effect on the cell survival rate of normal lung epithelial cells or fibroblasts compared with the results of previous studies on H2009 cancer cells. Impact. Example 48: Co-treatment of ZF9-MQ1 and JQ1 shows greater than additive effect on A549 survival

This example evaluates the effect of ZF9-MQ1 constructs on A549 cell viability when used in combination with different concentrations of JQ1 inhibitors.

A549 cells were seeded in duplicate dishes at 4,000 cells per well for cell viability analysis. 96-well plates were treated with 0.5 µg/mL or 1.0 µg/mL of GFP- or ZF9-MQ1-loaded LNP in combination with increasing concentrations of the BET inhibitor JQ1 (concentration up to 6.25 µM) in triplicate and incubated. Untreated cells and GFP-treated cells were used as controls. After 72 hours of incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence quantified using a GloMax ^® Discovery plate reader.

The data showed that each of ZF9-MQ1 and JQ1 inhibited the cell viability of A549 cells ( FIG. 48A ). ZF9-MQ1 (0.5 or 1 µg/ml) in combination with JQ1 (concentrations up to 6.25 μM) showed a greater than additive effect on inhibiting A549 survival compared to the effect predicted from their individual activities, suggesting that ZF9- The combination of MQ1 and JQ1 synergistically inhibited the survival of A549 cells (FIGS. 48B-48C). Example 49: Co-treatment of ZF9-MQ1 and BET762 shows greater than additive effect on A549 survival

This example evaluates the effect of ZF9-MQ1 constructs on A549 cell viability when used in combination with different concentrations of BET762 inhibitors.

A549 cells were seeded in duplicate dishes at 4,000 cells per well for cell viability analysis. 96-well plates were treated with 0.5 µg/mL or 1.0 µg/mL of GFP- or ZF9-MQ1-loaded LNP in combination with increasing concentrations (up to 1.25 μM) of the BET inhibitor BET762, three times, and incubated. Untreated cells and GFP-treated cells were used as controls. After 72 hours of incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence quantified using a GloMax ^® Discovery plate reader.

The data showed that ZF9-MQ1 and BET762 each inhibited the cell viability of A549 cells ( FIG. 49A ). ZF9-MQ1 (0.5 µg/ml) with BET762 (up to 1.25uM for cells treated with 0.5 µg/ml ZF9-MQ1 and up to 1.0 µg/ml for cells treated with ZF9-MQ1 0.625 μΜ) when combined showed a greater than additive effect on inhibiting A549 survival compared to the effect predicted from their individual activities (Figure 49B). ZF9-MQ1 (1.0 µg/ml) in combination with BET762 (concentrations up to 0.625 µM) showed a greater than additive effect on inhibiting A549 survival compared to the effect predicted from their individual activities (Fig. 49C). The data indicated that the combination of ZF9-MQ1 and BET762 synergistically inhibited the survival of A549 cells (Figure 49B-C).

Example 50: Co-treatment of ZF9-MQ1 with Birabresib shows a greater than additive effect on A549 survival

This example evaluates the effect of the ZF9-MQ1 construct on A549 cell viability when used in combination with different concentrations of BET inhibitors.

A549 cells were seeded in duplicate dishes at 4,000 cells per well for cell viability analysis. With 0.5 µg/mL or 1.0 µg/mL of GFP- or ZF9-MQ1-loaded LNP with increasing concentrations (up to 0.625 µM for cells treated with 0.5 µg/ml ZF9-MQ1; and for cells treated with 1.0 µg/ml For ZF9-MQ1-treated cells, 96-well plates were treated with combinations of the BET inhibitor binacoxib at concentrations up to 0.313 μM) in triplicate and incubated. Untreated cells and GFP-treated cells were used as controls. After 72 hours of incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence quantified using a GloMax ^® Discovery plate reader.

The data showed that ZF9-MQ1 and binacoxib each inhibited the cell viability of A549 cells ( FIG. 50A ). ZF9-MQ1 (0.5 µg/ml) when combined with binacoxib (concentrations up to 0.625 µM) showed a greater than additive effect on the inhibition of A549 survival compared to the effect predicted from their individual activities (Figure 50B ). ZF9-MQ1 (1.0 µg/ml) in combination with binacoxib (concentrations up to 0.313 µM) showed a greater than additive effect on the inhibition of A549 survival compared to the effect predicted from their individual activities (Fig. 50C ). The data indicated that the combination of ZF9-MQ1 and binacoxib synergistically inhibited the viability of A549 cells (Figures 50B-50C). Example 51: Co-treatment of ZF9-MQ1 with trametinib shows greater than additive effect on A549 survival

This example evaluates the effect of the ZF9-MQ1 construct on A549 cell viability when used in combination with different concentrations of the MEK inhibitor Trametinib.

A549 cells were seeded in duplicate dishes at 4,000 cells per well for cell viability analysis. 96-well plates were treated with 0.5 µg/mL or 1.0 µg/mL of GFP- or ZF9-MQ1-loaded LNP in combination with increasing concentrations (up to 0.05 μM) of the MEK inhibitor trametinib in triplicate and incubated. Untreated cells and GFP-treated cells were used as controls. After 72 hours of incubation, a 96-well plate was lysed with CellTiter-GLO ^® and luminescence quantified using a GloMax ^® Discovery plate reader.

The data showed that ZF9-MQ1 and trametinib each inhibited the cell viability of A549 cells ( FIG. 51A ). ZF9-MQ1 (0.5 µg/ml) when combined with trametinib (concentrations up to 0.05 µM) showed a greater than additive effect on inhibiting A549 survival compared to the effect predicted from their individual activities (Figure 51B ). ZF9-MQ1 (1.0 µg/ml) in combination with trametinib (concentrations up to 0.05 µM) showed a greater than additive effect on inhibiting A549 survival compared to the effect predicted from their individual activities (Fig. 51C ). The data indicated that the combination of ZF9-MQ1 and Trametinib synergistically inhibited the survival of A549 cells (FIGS. 51B-51C). Example 52: Down-regulation of MYC in various cell lines using a panel of ZF-KRAB constructs targeting one of the super-enhancer regions

This example evaluates the ability of ZF9-MQ1 and a set of zinc finger constructs ZF9-MQ1 , ZF54-KRAB, ZF61-KRAB, ZF67-KRAB and ZF68-KRAB targeting super-enhancer regions to downregulate MYC in H2009, H460 and H226 cells effect.

H2009 and H226 cells were seeded in duplicate dishes at 5,000 cells per well for mRNA analysis. The 96-well plate was treated with 1.0 μg/mL of LNP loaded with GFP, ZF9-MQ1, ZF54-KRAB, ZF67-KRAB or ZF68 KRAB, repeated three times, and incubated. H226 cells were also treated with 1.0 µg/mL of non-coding RNA-loaded LNP three times and incubated. H460 cells were seeded in duplicate dishes at 5,000 cells per well for mRNA analysis. The 96-well plate was treated with 1.0 µg/mL of LNP loaded with GFP, ZF9-MQ1, ZF61-KRAB, ZF67-KRAB or ZF68-KRAB in triplicate and incubated. Untreated cells and GFP-treated cells were used as controls. After 72 hours of incubation, cells were lysed with RLT Plus Lysis Buffer for mRNA extraction using the RNeasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using a polyA primer and RT Lunascript. The cDNA was then used for reverse transcription polymerase chain reaction (RT-PCR) analysis using TaqMan ^™ probes (Thermo Fisher) specific for human MYC mRNA transcripts. All groups were normalized using GAPDH mRNA transcript levels.

The data showed that ZF9-MQ1 , ZF54-KRAB, ZF67-KRAB, and ZF68-KRAB downregulated MYC mRNA levels in H2009 by at least 42% compared to untreated cells ( FIG. 52A ) and upregulated MYC mRNA levels in H226 cells. Downregulated by at least 27% (FIGS. 52B-52C). In addition, ZF9-MQ1 , ZF61-KRAB, ZF67-KRAB and ZF68-KRAB downregulated MYC mRNA levels by at least 26% in H460 cells compared to untreated cells ( FIG. 52D ). Example 53: Co-treatment of ZF54-KRAB with ZF9-MQ1 further reduces MYC mRNA levels compared to ZF9-MQ1 alone

This example evaluates the effect of ZF9-MQ1 and ZF54-KRAB combination therapy to downregulate MYC in H2009 cells.

H2009 cells were seeded in 96-well plates at 5,000 cells per well for mRNA analysis. Disc walls were treated with 1.0 µg/mL or 2.0 µg/mL of GFP, ZF9-MQ1, loaded LNP, and increasing concentrations of ZF9-MQ1-loaded LNP, repeated three times, and incubated for 72 hours. Untreated cells and GFP-treated cells were used as controls. After incubation, cells were lysed with RLT Plus Lysis Buffer for mRNA extraction using the RNeasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using a polyA primer and RT Lunascript. The cDNA was then used for reverse transcription polymerase chain reaction (RT-PCR) analysis using TaqMan ^™ probes (Thermo Fisher) specific for human MYC mRNA transcripts. All groups were normalized using GAPDH mRNA transcript levels.

The data showed that ZF9-MQ1 and ZF54-KRAB each down-regulated MYC mRNA in H2009 cells by 99% or 62%, respectively, at the highest concentrations tested, relative to untreated control cells. When less than 0.313 µg/mL of ZF9-MQ1 was combined with 1 or 2 µg/mL of ZF54-KRAB, the degree of MYC mRNA downregulation was greater than that observed with individual treatments, indicating that ZF9-MQ1 and ZF54-KRAB each had External down-regulation of MYC mRNA levels in H2009 cell lines contributed ( FIG. 53 ). Example 54: 1:1 combination of ZF9-MQ1 and ZF54-KRAB inhibits MYC expression at all time points up to at least 6 days

This example evaluates the durability of ZF9-MQ1 and ZF54-KRAB combination therapy to downregulate MYC in H1299 cells.

H1299 cells were seeded in 96-well plates at 10,000 cells per well for mRNA analysis. The walls of 96-well plates were treated with 1.0 μg/mL of LNP loaded with GFP, ZF54-KRAB or ZF9-MQ1 + ZF54-KRAB, repeated three times, and incubated. Untreated cells and GFP-treated cells were used as controls. Measurements were taken at 6 hours, 1 day, 2 days, 3 days or 6 days after transfection. After incubation, lyse a 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using a polyA primer and RT Lunascript. The cDNA was then used for reverse transcription polymerase chain reaction (RT-PCR) analysis using TaqMan ^™ probes (Thermo Fisher) specific for human MYC mRNA transcripts. All groups were normalized using GAPDH mRNA transcript levels.

The data show that ZF9-MQ1 downregulates MYC mRNA in H1299 cells by 95% at 48 hours relative to untreated control cells and maintains the downregulation at 90% of control levels at 144 hours. The ZF9-MQ1 + ZF54-KRAB combination reduced MYC mRNA levels to 98% at 48 hours and maintained the downregulation at 93% of control levels at 144 hours (Figure 54). In addition, the data showed that ZF9-MQ1 and the combination of ZF9-MQ1 and ZF54-KRAB downregulated MYC mRNA levels in H1299 cells for at least 6 days (Figure 54). Example 55 : Bicistronic ZF9 - MQ1_ZF54 - KRAB Suppresses MYC Levels Earlier Than ZF9 - MQ1 _ _

This example evaluates the efficacy of the bicistronic constructs ZF9-MQ1_ZF54-KRAB and ZF54-KRAB_ZF9-MQ1 compared to the ZF9-MQ1 and ZF54-KRAB constructs alone.

H2009 cells were seeded in 96-well plates at 5,000 cells per well for mRNA analysis. The wall of the 96-well plate was treated with 0.5 μg/mL or 1.0 μg/mL of LNP loaded with GFP, ZF9-MQ1, ZF54-KRAB, ZF9-MQ1_ZF54-KRAB or ZF54-KRAB_ZF9-MQ1, repeated three times, and incubated. Untreated cells and GFP-treated cells were used as controls. Measurements were taken at 24 hours and 48 hours after transfection. After incubation, lyse a 96-well plate with RLT Plus Lysis Buffer for mRNA extraction using the Rneasy ^® Plus 96 Kit. The solubilized sample was bound to an RNA column, washed with buffer and eluted. The mRNA was then converted to cDNA using a polyA primer and RT Lunascript. The cDNA was then used for reverse transcription polymerase chain reaction (RT-PCR) analysis using TaqMan ^™ probes (Thermo Fisher) specific for human MYC mRNA transcripts. All groups were normalized using GAPDH mRNA transcript levels.

The data showed that compared with untreated cells, ZF9-MQ1 and ZF54-KRAB down-regulated MYC mRNA levels by up to 83% and 55%, respectively, at 24 hours after introduction into H2009 cells. At 48 hours after treatment, MYC mRNA levels in ZF9-MQ1-treated cells were further reduced by another 13%, 96% of untreated controls, while ZF54-KRAB did not further down-regulate MYC levels. At 24 hours after treatment, MYC mRNA levels in ZF9-MQ1_ZF54-KRAB and ZF54-KRAB_ZF9-MQ1-treated cells were reduced to 95% and 96% of control cells, respectively. The data indicated that these control agents were able to reduce MYC mRNA levels in H2009 cells earlier than ZF9-MQ1 , downregulating MYC in treated cells to a greater extent than ZF9-MQ1 -treated cells at 24 hours. (Figure 55). Example 56: Effect of ZF9-MQ1 Therapy Inhibits Tumor Growth in Mice Bearing H460 SQ Tumors

This example demonstrates that ZF9-MQ1 inhibits the growth of established subcutaneous H460 tumors in nude mice.

Disease was induced in nude mice by subcutaneous implantation of H460 tumor cells into the left flank. Treatment was initiated ^when the average tumor volume reached approximately 100-150 mm. Mice were divided into treatment groups such that the mean tumor volumes in each group were approximately equal. Tumors were treated with PBS (vehicle), sorafenib (standard of care therapy), noncoding RNA formulated in MC3 LNP, or ZF9-MQ1 mRNA formulated in MC3 LNP. PBS, non-coding RNA (SEQ ID NO: 198) LNP and ZF9-MQ1 LNP were administered at 3 mg/kg every five days. Give 50 mg/kg sorafenib daily. Tumor length and width were measured twice a week. Tumor volume was calculated as (width2×length)/2.

The results showed that ZF9-MQ1 therapy inhibited tumor growth in the H460 subcutaneous tumor model. The mean tumor volumes at the end of the study were 1921 mm ³ , 1829 mm ³ and 702 mm ³ in the PBS-treated group, the mRNA negative control group and the ZF09-MQ1-treated group, respectively. The mean tumor volume (752 mm ³ ) of Sorafenib-treated mice was indistinguishable from that of ZF9-MQ1-LNP-treated mice, suggesting that ZF9-MQ1 exhibits similar or greater good activity. These results indicated that ZF9-MQ1 loaded LNPs effectively inhibited tumor growth in the in vivo H460 subcutaneous tumor model compared to the negative control group ( FIG. 56 ).

EQUIVALENTS It should be understood that while the invention has been described in conjunction with embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Some aspects, advantages and modifications belong to the scope of the following claims.

The following detailed description of the embodiments of the present invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, current exemplary embodiments are shown in the drawings. It should be understood, however, that the invention is not limited to the precise arrangements and execution of the embodiments shown in the drawings. Figure 1A depicts a schematic diagram of a dual-target approach based on a persistent block of the MYC promoter and a transient (48/72 hours) block of the CTCF/TF site using a DBD fused to a DNA methyltransferase, which Short-lived blocks use DBDs or DBDs fused to short-lived effectors. Figure 1B depicts guide RNA localization and chromatin environment at the target sites (CTCF and promoter) of the MYC gene. From top to bottom, the graphs represent the extent of H3K4me3 (histone H3 Ky trimethylation) in the MYC locus of HepG2 cells; the extent of H3K9me3 (histone H3 K9 trimethylation) (replica 1); the H3K9me3 (histone H3 K9 trimethylation) degree (replica 2); H3K27me3 (histone H3 K27 trimethylation) degree; H3K27ac (histone H3 K27 acetylation) degree; GROseq_forward strand degree (transcriptionally active RNA pol II pair Forward strand binding); GROseq_reverse strand level (binding of transcriptionally active RNA pol II to reverse strand); RNAseq_rep2 content (MYC transcript content measured using RNAseq, replica 2); as measured by WGBS (whole The degree of DNA methylation measured by Genome Bisulfite Sequencing), and the degree of CTCF binding. The positions of the four gRNAs are indicated by arrows. gRNA GD-28859, GD-28616, GD-28862 targeted the anchor site upstream of MYC or its vicinity, and gRNA GD-28617 targeted the MYC promoter. In the present invention, GD-28859 is also called GD-59; GD-28616 is also called GD-16; GD-28862 is also called GD-62; and GD-28617 is also called GD-17. Figure 1C shows a schematic of exemplary bicistronic constructs. The 5' end of the construct has a cap structure defined by an N7-methylated guanosine linked to the first nucleotide of the mRNA via an inverted 5' to 5' triphosphate linkage. In some embodiments, the cap structure promotes protein translation and stability. Downstream of the cap structure is an untranslated region (5'UTR) designed to promote high levels of protein translation, followed by a typical "Kozak" sequence that is recognized by ribosomes to initiate protein translation. The "Kozak" sequence is followed by the CDS, which is a single contiguous sequence comprising a first expression suppressor containing a first targeting moiety and a first effector moiety and containing a tPT2A "ribosomal skipping" sequence (linker) separated The second expression inhibitor of the second targeting moiety and the second effector moiety. Without wishing to be bound by theory, when the ribosome reaches the tPT2A linker, it begins to translate the linker into an amino acid. The first 18 amino acids from the P2A linker remain C-terminal to the first expressed inhibitor (eg comprising ZF DBD and MQ1 ), which is then released by the ribosome. The ribosome then proceeds until it reaches the T2A linker, and the first 17 residues of the T2A linker are translated and released. A second polypeptide comprising a single amino acid is then translated, and then translation of a second expression suppressor (eg, comprising a second ZF DBD and KRAB) is initiated. The CDS is followed by a 3' UTR designed to facilitate high levels of translation and stabilize the mRNA. Finally, the very terminal 3' end of the mRNA is a polyA tail. In some embodiments, the polyA tail promotes protein translation and mRNA stability. Figure 2A shows that Cas9-nuclease editing of the CTCF motif results in downregulation of MYC expression. Disruption of the CTCF motif by Cas9 (in combination with GD-28616) caused a 32-39% downregulation of MYC expression in all three HCC cell lines (HepG2, Hep3B, and SKHEP1). Disruption of the region adjacent to the CTCF motif (GD-28859) modulated MYC expression by 35-45% in two of the three cell lines (HepG2 and Hep3B). Figure 2B shows editing efficiency as assessed by AmpSeq, demonstrating that all cell lines were 77-100% edited. Figure 3 shows that dCas9-KRAB downregulates MYC expression when directed against the promoter or linked CTCF motif. LNP-mediated dCas9-KRAB/GD-28616 transfection downregulated MYC expression in Hep3B and SKHEP1 by 11-34% at the 48/72 hour time point. LNP-mediated dCas9-KRAB/GD-28859 transfection downregulated MYC expression by 18-44% in all 3 HCC models at the 48/72 hour time point. Directing dCas9-KRAB to the MYC promoter via dCas9-KRAB/GD-28617 downregulated MYC expression by 24-58% in all 3 HCC models at the 48/72 hour time point. Figure 4A depicts sgRNA positioning and zinc finger design at the CTCF motif linked to the promoter. The scheme reveals SEQ ID NO: 208. Figure 4B shows that the ZF-KRAB construct against CTCF linked to the promoter achieves downregulation of MYC in Hep3B. ZF2-KRAB, ZF3-KRAB and ZF4-KRAB can down-regulate MYC in Hep3B cells to the same or greater extent than dCas9-KRAB/GD-28859, and ZF3-KRAB has the strongest down-regulation effect. Figure 4C shows that ZF3-non-effector and ZF3-KRAB downregulate MYC expression in various human HCC models (HepG2, Hep3B and SKHEP1). In two other HCC models, HepG2 and SKHEP1, ZF3-KRAB was also shown to downregulate MYC to an extent equal to or greater than ZF3-non-effector and ZF5-non-effector. Figure 4D shows that ZF3-non-effector and ZF3-KRAB exhibit equivalent effects on MYC expression and viability of Hep3B cells at different time points (24 hours, 72 hours and 120 hours). Figure 5 shows that dCas9-MQ1 downregulates MYC expression when targeting the MYC promoter in various HCC models (HepG2, Hep3B, and SKHEP1). Figure 6A depicts sgRNA positioning and zinc finger design at the MYC promoter. The scheme reveals SEQ ID NO: 209. Figure 6B depicts six ZF-MQ1 constructs directed against the MYC promoter, screened for MYC downregulation in Hep3B. ZF8-MQ1, ZF9-MQ1 and ZF11-MQ1 down-regulated MYC in Hep3B cells to the greatest extent, and ZF9-KRAB MQ1 had the strongest down-regulation effect. Figure 7A shows that ZF9-MQ1 significantly downregulates MYC expression and reduces Hep3B survival compared to ZF12-MQ1. Figure 7B shows that ZF9-MQ1 significantly downregulates MYC expression and reduces survival of HepG2 compared to ZF12-MQ1. Figure 7C shows that ZF9-MQ1 significantly downregulates MYC expression and reduces survival of SKHEP1 compared to ZF12-MQ1. Figure 7D shows that ZF9-MQ1 downregulates MYC expression more effectively and reduces Hep3B survival compared to ZF8-MQ1. Figure 7E shows that ZF9-MQ1 downregulates MYC expression more effectively and reduces survival of HepG2 compared to ZF8-MQ1. Figure 7F shows that ZF9-MQ1 downregulates MYC expression more effectively and reduces the survival rate of SKHEP1 compared to ZF8-MQ1. Figure 7G shows that ZF9-MQ1 significantly downregulates MYC expression and reduces Hep3B survival compared to dCas9-MQ1/GD17. Figure 7H shows that ZF9-MQ1 significantly downregulates MYC expression and reduces survival of HepG2 compared to dCas9-MQ1/GD17. Figure 7I shows that ZF9-MQ1 significantly downregulates MYC expression and reduces the survival rate of SKHEP1 compared to dCas9-MQ1/GD17. Figure 8A shows that dCas9-MQ1 achieved a 50-90% reduction in mRNA in all three cell lines (Hep3B, HepG2 and SKHEP1) at 72 hours. Figure 8B shows that although MYC downregulation had minimal effect on SK-HEP-1 survival, at 72 hours and 168 hours, MYC downregulation significantly decreased the survival rates of HepG2 and Hep3B. Figure 8C shows that MYC mRNA was reduced by about 70% and about 55% on day 7 and day 11, respectively. Transcripts maintained about 40% downregulation as far as day 15. Figure 8D shows that treatment with dCas9-MQ1/GD-28617 directs de novo methylation to the target region and that these transcriptional changes are closely correlated with the percentage of CpG methylation in the target region and demonstrates that methylation is maintained up to day 15 . Figure 9 shows that treatment with dCas9-MQ1/GD-17 inhibits tumor growth in vivo. Figure 10 shows that dCas9-MQ1/GD-17 downregulates MYC in human hepatocytes in the context of hepatitis B infection. Figure 11 shows KRAB effectors (or non-effectors or NEs) fused to zinc finger domains (ZF3-NE or ZF3-KRAB) targeting the upstream region directly adjacent to the CTCF motif and targeting the MYC promoter with zinc The MQ1 effector of finger domain fusion (ZF9-MQ1) downregulates MYC1 mRNA expression. Figure 12 shows that ZF3-KRAB + ZF9-MQ1 downregulates MYC to a greater extent than ZF9-MQ1 alone, or the ZF3-NE + ZF9-MQ1 combination. Figure 13A shows that ZF9-MQ1 designed to bind and target the MYC promoter was administered at various concentrations to five HCC cell lines: Hep3B, HepG2, SKHEP1, SNU-182 and SNU-449. Figure 13B-F shows that ZF9-MQ1 downregulates MYC expression and reduces survival of all five HCC cell lines tested and ZF9-MQ1 downregulates MYC expression with a median EC50 of 0.028 μg/ml LNP/mRNA, and in vitro , had an approximately 10-fold higher median EC50 effect (0.13 μg/ml) on the viability of the HepG2 cell line at 72 hours. Figure 14 shows that ZF9-MQ1 was able to significantly reduce tumor growth (from day 6) compared to PBS control treated mice and that ZF9-MQ1 reduced tumor growth over a small molecule comparator (MYCi975) (A). Compared to PBS or MYCi975 (B), ZF9-MQ1 had minimal effects on whole animal body weight. Figure 15A shows ZF9- Combining MQ1 with ZF3-KRAB reduced tumor growth to a similar extent as sorafenib. Figure 15B shows that treatment with the combination of ZF9-MQ1 and ZF3-KRAB had minimal effect on whole animal body weight compared to the effect of Sorafenib treatment on whole animal body weight. Figure 16A shows that ZF9-MQ1 (from day 13 onwards) and co-formulations of ZF9-MQ1 and ZF3-KRAB (from day 6 onwards) were able to Significantly reduces tumor growth. Figure 16B shows that ZF9-MQ1 alone and co-formulations of ZF9-MQ1 and ZF3-KRAB were able to reduce tumor growth at 3 mg/kg compared to negative control treated mice. Figure 16C shows that co-formulations of ZF9-MQ1 and ZF3-KRAB were able to reduce tumors at doses of 1 mg/kg and 3 mg/kg to a degree similar to or greater than that of cisplatin or a small molecule comparator (MYCi975) grow. Figure 16D shows that co-formulations of ZF9-MQ1 and ZF3-KRAB had minimal effects on whole animal body weight at doses of 1 mg/kg and 3 mg/kg compared to the effects of cisplatin or MYCi975 treatment on whole animal body weight. Figure 17A shows that ZF9-MQ1 reduced MYC mRNA levels in A549 cell line by more than 80% at 120 hours after treatment. Figure 17B shows that ZF9-MQ1 reduced MYC mRNA levels in NCI-H2009 cell line by more than 80% at 120 hours after treatment. Figure 17C shows that ZF9-MQ1 reduced MYC mRNA levels in NCI-H358 cell line by more than 80% at 120 hours after treatment. Figure 17D shows that ZF9-MQ1 reduced MYC mRNA levels in HCC95 cell lines by more than 80% at 72 hours after treatment. Figure 17E shows that ZF9-MQ1 reduced the cell viability of the A549 cell line at 120 hours after treatment. Figure 17F shows that ZF9-MQ1 reduced the cell viability of NCI-H2009 cell line at 120 hours after treatment. Figure 17G shows that ZF9-MQ1 reduced the cell viability of NCI-H358 cell line at 120 hours after treatment. Figure 17H shows that ZF9-MQ1 reduced the cell viability of the HCC95 cell line at 72 hours after treatment. Figure 18A shows that at 96 hours after treatment, about 17.5% of the cells in the untreated cell population underwent apoptosis. Figure 18B shows that at 96 hours after treatment, about 18% of the cells in the ZF9-NE-treated cell population underwent apoptosis. Figure 18C shows that at 96 hours after treatment, about 38.9% of the cells in the ZF9-MQ1-treated cell population underwent apoptosis. Figure 18D shows that at 96 hours after treatment, about 38.9% of the cells in the ZF9-MQ1-treated cell population underwent apoptosis, compared to about 18% of the untreated cells and the ZF9-NE-treated cell population. Cell apoptosis, indicating that ZF9-MQ1 can induce apoptosis in lung cancer cells. Figure 19 A and B shows that ZF9-MQ1 downregulates MYC with an EC50 of 0.08 μg/ml LNP/mRNA, and the survival rate of these A549 (Figure 19A) and HCC95 (Figure 19B) cell lines at 72 hours in vitro Has about 25-fold higher EC50 effect (2 μg/ml). Figures 20A and B show that at 96 hours after treatment of lung cancer cell lines, treatment with ZF9-MQ1 reduced MYC protein content by more than 80%. Figure 21 shows that ZF9-MQ1 was able to significantly reduce tumor growth (from day 8) compared to PBS control treated mice. It was also observed that ZF9-MQ1 had minimal effect on whole animal body weight. Figure 22 shows that guide RNAs GD-29833 and 29914, when delivered with dCAS9-KRAB effector mRNA as SSOP using LNP, can effectively downregulate MYC mRNA levels, highlighting the ability to reduce oncogenic MYC using this distal regulatory element. Figure 23 shows that guide RNAs GD-29833 and 29914, when delivered in MC3 form using LNP together with dCAS9-KRAB effector mRNA, can effectively downregulate MYC mRNA levels, highlighting the ability to reduce oncogenic MYC using this distal regulatory element. Figure 24A shows that guide RNAs GD-29833 and 29914, when delivered together with all 3 effector proteins (EZH2, EZH2-KRAB and MQ1), can effectively downregulate MYC mRNA levels in A549 cell line. Figure 24B shows that guide RNAs GD-29833 and 29914, when delivered together with all 3 effector proteins (EZH2, EZH2-KRAB and MQ1), can effectively downregulate MYC mRNA levels in NCI-H2009 cell line. Figure 25A shows that guide RNAs GD-29833 and 29914 delivered together with KRAB or MQ1 can significantly downregulate MYC mRNA levels in A549 cell line at 120 hours after treatment. Figure 25B shows that guide RNAs GD-29833 and 29914 delivered together with KRAB or MQ1 can significantly down-regulate MYC mRNA levels in NCI-H2009 cell line at 120 hours after treatment and this down-regulation is similar to that observed after ZF9-MQ1 treatment down. Figure 26A shows that dCas9-MQ1 increases target site methylation in NSCLC to about 60%. Figure 26B shows that dCas9-MQ1 directs methylation to the distal promoter region (increased to about 50%). Figures 27A-B show that targeting of the MYC lung super-enhancer via a transcriptional repressor reduces MYC protein levels in the NCI-H2009 lung cancer cell line at 96 hours. Figure 28A shows that following ZF9-MQ1 treatment of Hep3B cells, the presence of ZF9-MQ1 protein in whole cell lysates gradually decreased. Figure 28B shows that after ZF9-MQ1 treatment of Hep3B cells, MYC protein in whole cell lysates was gradually down-regulated. Figure 28C shows that the presence of ZF9-MQ1 protein in whole cell lysates correlates with the downregulation of MYC protein following ZF9-MQ1 treatment of Hep3B cells. Figure 29A shows that mRNA in the MYC transcript of the SK-HEP cell line was down-regulated by 45% at several time points after ZF9-MQ1 treatment up to day 15. Figure 29B shows that MYC transcriptional changes correlate with percent methylation up to day 15. Figure 30A shows that compared with GFP, ZF-NE or ZF3-KRAB alone, ZF9-MQ1, ZF9-MQ1 + ZF3-KRAB or bicis-trans Primary hepatocytes treated with subZF9-MQ1_ZF3-KRAB showed reduced expression of MYC mRNA. Figure 30B shows the survival rate of primary hepatocytes treated with ZF9-MQ1, ZF9-MQ1 + ZF3-KRAB or bicistronic ZF9-MQ1_ZF3-KRAB at concentrations of 0.6 µg/ml, 1.25 µg/ml and 2.5 µg/ml The effect was minimal, demonstrating a lower MYC expression reduction in normal cells than in HCC cell lines. Figure 30C shows that compared with GFP, ZF-NE or ZF3-KRAB alone, ZF9-MQ1, ZF9-MQ1 + ZF3-KRAB or bicis-trans Primary hepatocytes treated with subZF9-MQ1_ZF3-KRAB showed reduced expression of MYC mRNA. Figure 30D shows the survival rate of primary hepatocytes treated with ZF9-MQ1, ZF9-MQ1 + ZF3-KRAB or bicistronic ZF9-MQ1_ZF3-KRAB at concentrations of 0.5 µg/ml, 1.0 µg/ml and 2.0 µg/ml The effect was minimal, demonstrating a lower MYC expression reduction in normal cells than in HCC cell lines. Figure 31A shows that ZF9-MQ1 + ZF3-KRAB therapy showed a statistically significant reduction in tumor size after three administrations, with tumor volumes 63% lower at day 25 than in the control group, and ZF9-MQ1 + ZF3-KRAB therapy had no effect on tumor size. The effect of tumor volume was equivalent to that of cisplatin therapy. Figure 3 IB shows that mice treated with ZF9-MQ1 + ZF3-KRAB did not experience a significant decrease in body weight. Figure 32A shows that 1.5 mg/kg ZF9-MQ1 + ZF3-KRAB therapy resulted in a statistically significant reduction in tumor size after two administrations, inhibiting tumor growth by 63% at day 23 (compared to negative control group) . 3 mg/kg ZF9-MQ1 + ZF3-KRAB resulted in a statistically significant reduction in tumor size after two doses, inhibiting tumor growth by 54% at day 23 (compared to the negative control group), and 6 ZF9-MQ1 + ZF3-KRAB therapy at a mg/kg dose resulted in a statistically significant reduction in tumor size after two doses, reducing tumor volume by 63% at day 23 (compared to the negative control group). Figure 32B shows that mice treated with ZF9-MQ1 + ZF3-KRAB did not experience a significant decrease in body weight. Sorafenib-treated mice initially experienced a decrease in body weight, followed by a potential increase in overall body weight due to increased tumor mass. Figure 33A shows that the bicistronic construct ZF9-MQ1_ZF3-KRAB at 0.6 µg/ml and 2.0 µg/ml concentrations down-regulates MYC mRNA expression in Hep 3B cells more than a single single construct (ZF3-KRAB or ZF9 -MQ1). At 48 hours, the bicistronic ZF9-MQ1_ZF3-KRAB reduced total MYC mRNA levels by 99% at both 0.6 µg/ml and 2 µg/ml concentrations. Figure 33B shows that the bicistronic construct ZF9-MQ1_ZF3-KRAB downregulates cell viability of Hep 3B cells to a greater extent than either single construct (ZF3-KRAB or ZF9-MQ1 ). Bicistronic ZF9-MQ1_ZF3-KRAB reduced the viability of Hep3B cells by about 80% and 27% at concentrations of 0.6 µg/ml and 2 µg/ml, respectively. Figure 34A shows that the bicistronic construct ZF9-MQ1_ZF3-KRAB down-regulates MYC mRNA and cell viability in Hep3B cells in a dose-dependent manner. Figure 34B shows that the bicistronic construct ZF9-MQ1_ZF3-KRAB down-regulates MYC mRNA and cell viability in HepG2 cells in a dose-dependent manner. Figure 34C shows that the bicistronic construct ZF9-MQ1_ZF3-KRAB down-regulates MYC mRNA and cell viability in SKHEP1 cells in a dose-dependent manner. Figure 34D shows that the bicistronic ZF9-MQ1_ZF3-KRAB is effective against HCC S1 and S2 subtypes. Figure 35 shows that at the 48th hour of bicistronic ZF9-MQ1_ZF3-KRAB treatment, >75% of apoptotic cells in Hep 3B and Hep G2 cell lines were detected and apoptotic cells in SK-HEP-1 cell line were detected is about 15%. Noncoding mRNA controls had no effect on cells compared to untreated cells (5-20% background apoptosis). Figure 36 shows that after 1 treatment with the bicistronic ZF9-MQ1_ZF3-KRAB construct, MYC mRNA levels in SKHEP1 cells decreased on the first day and remained repressed for up to fifteen days after treatment. Figure 37 shows that compared with non-coding short mRNA or untreated cells, bicistronic ZF9-MQ1_ZF3-KRAB treatment reduced MYC mRNA and protein expression in Hep3B and SKHEP1 cell lines at 6 hours, and maintained for 96 hours down. Figure 38 shows OEC ZF3-KRAB and ZF9-MQ1 proteins encoded by bicistronic ZF9-MQ1_ZF3-KRAB mRNA visualized by HA-tag on western blots at 6 and 24 hour time points after transfection . Figure 39A shows that the _IC50 of Sorafenib against SKHEP1 was reduced from 12.3 µM to 10.7 µM when Sorafenib was administered in combination with 0.6 µg/ml bicistronic ZF9-MQ1_ZF3-KRAB. When Sorafenib was administered in combination with 0.1 µg/ml bicistronic ZF9-MQ1_ZF3-KRAB, there was no significant change in the _IC50 of Sorafenib against SKHEP1 cells. Figure 39B shows that the IC50 of Sorafenib against Hep 3B was reduced from 4.4 µM to 2.9 µM when Sorafenib was administered in combination with 0.6 µg/ml bicistronic ZF9-MQ1_ZF3-KRAB. When Sorafenib was administered in combination with 0.1 µg/ml bicistronic ZF9-MQ1_ZF3-KRAB, there was no significant change in the _IC50 of Sorafenib against Hep 3B cells. Figure 40A shows that the _IC50 of JQ1 against SKHEP1 cells was reduced when treated with bicistronic ZF9-MQ1_ZF3-KRAB at concentrations of 0.6 µg/ml and 0.1 µg/ml, respectively. Figure 40B shows that the _IC50 of JQ1 against Hep 3B cells was reduced when treated with bicistronic ZF9-MQ1_ZF3-KRAB at concentrations of 0.6 µg/ml and 0.1 µg/ml, respectively. Figure 41A shows that ZF17-MQ1 can down-regulate MYC mRNA expression in mouse Hepa1-6 cells at both 0.6 µg/ml and 1.2 µg/ml concentrations compared with untreated cells. Figure 41B shows that ZF17-MQ1 at both 0.6 µg/ml and 1.2 µg/ml concentrations can reduce the cell viability of mouse Hepa1-6 cells compared with untreated cells. Figure 42A shows that ZF17-MQ1 treatment of mouse HCC cells Hepal-6 significantly down-regulates MYC protein at 24 and 48 hours. Figure 42B shows that ZF17-MQ1 treatment of mouse HCC cells Hepal-6 significantly down-regulates MYC protein at 24 and 48 hours. Figure 42C shows that ZF17-MQ1 treatment of mouse HCC cells Hepa1-6 significantly down-regulates MYC mRNA at 96 hours. Figure 42D shows that ZF17-MQ1 treatment of mouse HCC cells Hepa1-6 significantly reduced cell viability at 96 hours. Figure 43 shows that ZF17-MQ1 significantly reduced the tumor burden of animals after 4 doses and after a two week drug holiday, re-treatment of mice with ZF17-MQ1 resulted in complete tumor depletion after about 4 weeks. Figure 44A shows that MYC protein levels are reduced in ZF17-MQ1 -treated cells (LL2 cells) compared to untreated or GFP-treated cells. Figure 44B shows that ZF17-MQ1 and ZF16-MQ1 reduced MYC mRNA levels in LL2 cells by >99.9% or 74%, respectively, compared to the levels observed in untreated cells. Figure 44C shows that all three constructs ZF15-MQ1 , ZF16-MQ1 and ZF17-MQ1 were able to reduce cell viability of LL2 cells to a greater extent compared to untreated cells and GFP-treated cells. Figure 45A shows that ZF17-MQ1 reduced MYC mRNA levels at both 1.25 µg/mL and 2.5 µg/mL concentrations. At 2.5 µg/mL, ZF17-MQ1 reduced MYC mRNA levels in LL2 and CT26 cells by 93% and 85%, respectively, compared to levels observed in untreated cells. Figure 45B shows that ZF17-MQ1 reduced cell viability at both concentrations. Under these conditions, ZF17-MQ1 reduced the cell viability of LL2 and CT26 cells by 87% and 93%, respectively, compared to untreated cells. Figure 46 shows that ZF17-MQ1 down-regulates MYC mRNA in CMT167 and LL2 cells and reduces cell viability to a greater extent than untreated cells and GFP-treated cells (negative control group). ZF17-MQ1 reduced MYC mRNA levels in CMT167 and LL2 cells by 62% and 73%, respectively, compared to the levels observed in untreated cells. In addition, ZF17-MQ1 reduced the cell viability of CMT167 and LL2 cells by 54% and 57%, respectively, under these conditions compared to untreated cells. Figure 47 shows that compared with untreated cells, ZF9-MQ1 down-regulates MYC mRNA levels in small airway primary epithelial cells, lung lobe primary epithelial cells, and lung primary fibroblasts by 94%, 96%, and 96% respectively . However, viability was only reduced by 16%, 9% and 22% compared to control cells. Figure 48A shows that each of ZF9-MQ1 and JQ1 inhibited the cell viability of A549 cells, respectively. Figure 48B shows that ZF9-MQ1 (0.5 µg/ml) and JQ1 (concentrations up to 6.25 µM) exhibited a greater than additive effect in inhibiting A549 survival compared to the effect predicted from their individual activities. Figure 48C shows that ZF9-MQ1 (1.0 µg/ml) and JQ1 (concentrations up to 6.25 µM) exhibited a greater than additive effect in inhibiting A549 survival compared to the effect predicted from their individual activities. Figure 49A shows that ZF9-MQ1 and BET762 each inhibited the cell viability of A549 cells, respectively. Figure 49B shows that ZF9-MQ1 (0.5 µg/ml) and BET762 (concentrations up to 1.25 µM) exhibited a greater than additive effect in inhibiting A549 survival compared to the effect predicted from their individual activities. Figure 49C shows that ZF9-MQ1 (1.0 µg/ml) and BET762 (concentrations up to 0.625 µM) exhibited a greater than additive effect in inhibiting A549 survival compared to the effect predicted from their individual activities. Figure 50A shows that ZF9-MQ1 and Birabresib each inhibited the cell viability of A549 cells, respectively. Figure 50B shows that ZF9-MQ1 (0.5 µg/ml) and binacoxib (concentrations up to 0.625 µM) exhibited a greater than additive effect in inhibiting A549 survival compared to the effect predicted from their individual activities. Figure 50C shows that ZF9-MQ1 (1.0 µg/ml) and binacoxib (concentrations up to 0.313 µM) exhibited a greater than additive effect in inhibiting A549 survival compared to the effect predicted from their individual activities. Figure 51A shows that ZF9-MQ1 and Trametinib each inhibit the cell viability of A549 cells, respectively. Figure 51B shows that ZF9-MQ1 (0.5 µg/ml) and trametinib (concentrations up to 0.05 µM) exhibited a greater than additive effect in inhibiting A549 survival compared to the effect predicted from their individual activities. Figure 51C shows that ZF9-MQ1 (1.0 µg/ml) and trametinib (concentrations up to 0.05 µM) exhibited a greater than additive effect in inhibiting A549 survival compared to the effect predicted from their individual activities. Figure 52A shows that all constructs ZF9-MQ1, ZF54-KRAB, ZF67-KRAB and ZF68-KRAB were able to down-regulate MYC mRNA levels in H2009 cells by at least 42% at 72 hours after treatment compared to untreated cells . Figure 52B shows that constructs ZF9-MQ1 , ZF67-KRAB and ZF68-KRAB were able to downregulate MYC mRNA levels in H226 cells by at least 27% at 72 hours after treatment compared to untreated cells. Figure 52C shows that both constructs ZF9-MQ1 and ZF54-KRAB were able to down-regulate MYC mRNA levels in H226 cells by at least 27% at 72 hours after treatment compared to untreated cells. Figure 52D shows that constructs ZF9-MQ1, ZF61-KRAB, ZF67-KRAB and ZF68-KRAB were able to downregulate MYC mRNA levels in H460 cells by at least 26% at 72 hours post-treatment compared to untreated cells. Figure 53 shows that ZF9-MQ1 and ZF54-KRAB each down-regulate MYC mRNA in H2009 cells by 99% or 62%, respectively, at the highest concentrations tested, relative to untreated control cells. When less than 0.313 µg/mL of ZF9-MQ1 was combined with 1 or 2 µg/mL ZF54-KRAB, the degree of MYC mRNA downregulation was greater than that observed for monotherapy. Figure 54 shows that ZF9-MQ1 downregulates MYC mRNA in H1299 cells by 95% at 48 hours relative to untreated control cells and maintains the downregulation at 90% of control levels at 144 hours. The ZF9-MQ1 + ZF54-KRAB combination reduced MYC mRNA levels to 98% at 48 hours and maintained the downregulation at 93% of control levels at 144 hours (Figure 54). In addition, data show that ZF9-MQ1 and the combination of ZF9-MQ1 and ZF54-KRAB downregulate MYC mRNA levels in H1299 cells for at least 6 days. Figure 55 shows that ZF9-MQ1 and ZF54-KRAB down-regulated MYC mRNA levels by up to 83% and 55%, respectively, at 24 hours after introduction into H2009 cells compared to untreated cells. At 48 hours after treatment, MYC mRNA levels in ZF9-MQ1-treated cells were further reduced by another 13%, to 96% of untreated controls, whereas ZF54-KRAB did not further down-regulate MYC levels. At 24 hours after treatment, MYC mRNA levels in ZF9-MQ1_ZF54-KRAB and ZF54-KRAB_ZF9-MQ1-treated cells were reduced to 95% and 96% of control cells, respectively. The data indicated that these control agents were able to reduce MYC mRNA levels in H2009 cells earlier than ZF9-MQ1 , downregulating MYC in treated cells to a greater extent than ZF9-MQ1 -treated cells at 24 hours. Figure 56 shows that ZF9-MQ1 therapy inhibits tumor growth in the H460 subcutaneous tumor model to a degree similar to or greater than that induced by sorafenib.

         
           <![CDATA[ <110> FLAGSHIP PIONEERING INNOVATIONS V, INC.]]>
           <![CDATA[ <120> Compositions and methods for modulating MYC expression]]>
           <![CDATA[ <130> O2057-7029WO]]>
           <![CDATA[ <140> TW 111112954]]>
           <![CDATA[ <141> 2022-04-01]]>
           <![CDATA[ <150> 63/281,022]]>
           <![CDATA[ <151> 2021-11-18]]>
           <![CDATA[ <150> 63/212,991]]>
           <![CDATA[ <151> 2021-06-21]]>
           <![CDATA[ <150>PCT/US21/10059]]>
           <![CDATA[ <151> 2021-12-15]]>
           <![CDATA[ <160> 210 ]]>
           <![CDATA[ <170> PatentIn Version 3.5]]>
           <![CDATA[ <210> 1]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 1]]>
          atgatctctg ctgccagtag 20
           <![CDATA[ <210> 2]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 2]]>
          atcgcgcctg gatgtcaacg 20
           <![CDATA[ <210> 3]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 3]]>
          attgtgcagt gcatcggatt 20
           <![CDATA[ <210> 4]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 4]]>
          gtcaaacagt actgctacgg 20
           <![CDATA[ <210> 5]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 5]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Arg Ser Asp Lys Leu Thr Glu His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Lys
                  35 40 45
          Asn Ser Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Thr Thr Gly Ala Leu Thr Glu His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Asp Ser Gly Asn Leu Arg Val His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg
          145 150 155 160
          Ala His Leu Glu Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu Leu Val
                      180 185 190
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 6]]>
           <![CDATA[ <21]]>1> 209]]&gt;
           <br/> &lt;![CDATA[ &lt;212&gt;PRT]]&gt;
           <br/> &lt;![CDATA[ &lt;213&gt; Artificial Sequence]]&gt;
           <br/>
           <br/> &lt;![CDATA[ &lt;220&gt;]]&gt;
           <br/> &lt;![CDATA[ &lt;223&gt; Description of artificial sequence: synthetic polypeptide]]&gt;
           <br/>
           <br/> &lt;![CDATA[ &lt;400&gt;6]]&gt;
           <br/> <![CDATA[Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Ser Pro Ala Asp Leu Thr Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro
                  35 40 45
          Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asn Leu Val
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Leu Val Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Thr Ser His Ser Leu Thr Glu His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn
          145 150 155 160
          Asp Ala Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Ala Leu Thr
                      180 185 190
          Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 7]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 7]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg
                  35 40 45
          Ala His Leu Glu Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro Gly His Leu Val
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Gln Leu Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala
          145 150 155 160
          Asp Asn Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala
                      180 185 190
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 8]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> ]]>8
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser His Thr Gly His Leu Leu Glu His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Thr
                  35 40 45
          Gly Asn Leu Thr Val His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Lys Lys Asp Leu Thr
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Gln Arg Ala His Leu Glu Arg His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser
          145 150 155 160
          Asp Lys Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Thr Asp Thr Leu Arg
                      180 185 190
          Asp His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 9]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 9]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser His Thr Gly His Leu Leu Glu His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser
                  35 40 45
          Gly Asn Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Asn Leu Val
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro
          145 150 155 160
          Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr His Leu Asp Leu Ile
                      180 185 190
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 10]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 10]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Asp Pro Gly Ala Leu Val Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg
                  35 40 45
          Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr
          65 70 75 80
          Asn His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Arg Ser Asp His Leu Thr Asn His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro
          145 150 155 160
          Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val
                      180 185 190
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 11]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 11]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Arg Asn Asp Ala Leu Thr Glu His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Cys
                  35 40 45
          Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro Gly His Leu Val
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Gln Ser Gly His Leu Thr Glu His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Lys
          145 150 155 160
          Asn Ser Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr
                      180 185 190
          Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 12]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 12]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Arg Ser Asp Lys Leu Thr Glu His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Arg
                  35 40 45
          Asp Glu Leu Asn Val His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr
          65 70 75 80
          Asn His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Ser Pro Ala Asp Leu Thr Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Arg Ser Asp His Leu Thr Asn His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Ser Ser Lys
          145 150 155 160
          Lys Ala Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr His Leu Asp Leu Ile
                      180 185 190
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 13]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 13]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Arg Ser Asp Asp Leu Val Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Glu
                  35 40 45
          Asp Asn Leu His Thr His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr
          65 70 75 80
          Thr His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Gln Leu Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg
          145 150 155 160
          Ala Asn Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg
                      180 185 190
          Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 14]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 14]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Gln Ser Gly Asp Leu Arg Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser
                  35 40 45
          Gly His Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg
          65 70 75 80
          Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Arg Asn Asp Thr Leu Thr Glu His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala
          145 150 155 160
          Asp Asn Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr His Leu Asp Leu Ile
                      180 185 190
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 15]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 15]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser His Thr Gly His Leu Leu Glu His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Ser Ser Lys
                  35 40 45
          Lys Ala Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser His Thr Gly His Leu Leu Glu His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Arg Asn Asp Ala Leu Thr Glu His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser
          145 150 155 160
          Gly Asp Leu Arg Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Ser Gly Asn Leu Arg
                      180 185 190
          Val His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 16]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 16]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Gln Ser Ser Ser Leu Val Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser
                  35 40 45
          Asp His Leu Thr Asn His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg
          65 70 75 80
          Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Gln Ser Ser Asn Leu Val Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Arg Ser Asp Asn Leu Val Arg His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser
          145 150 155 160
          Asp Glu Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg
                      180 185 190
          Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 17]]>
           <![CDATA[ <211> 1367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 17]]>
          Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val Gly
          1 5 10 15
          Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys
                      20 25 30
          Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly
                  35 40 45
          Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys
              50 55 60
          Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr
          65 70 75 80
          Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe
                          85 90 95
          Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His
                      100 105 110
          Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His
                  115 120 125
          Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser
              130 135 140
          Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met
          145 150 155 160
          Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp
                          165 170 175
          Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn
                      180 185 190
          Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys
                  195 200 205
          Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu
              210 215 220
          Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu
          225 230 235 240
          Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp
                          245 250 255
          Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp
                      260 265 270
          Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu
                  275 280 285
          Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile
              290 295 300
          Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met
          305 310 315 320
          Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala
                          325 330 335
          Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp
                      340 345 350
          Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln
                  355 360 365
          Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly
              370 375 380
          Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys
          385 390 395 400
          Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly
                          405 410 415
          Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu
                      420 425 430
          Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro
                  435 440 445
          Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met
              450 455 460
          Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val
          465 470 475 480
          Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn
                          485 490 495
          Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu
                      500 505 510
          Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr
                  515 520 525
          Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys
              530 535 540
          Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val
          545 550 555 560
          Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser
                          565 570 575
          Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr
                      580 585 590
          Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn
                  595 600 605
          Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu
              610 615 620
          Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His
          625 630 635 640
          Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Arg Tyr Thr
                          645 650 655
          Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys
                      660 665 670
          Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala
                  675 680 685
          Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys
              690 695 700
          Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His
          705 710 715 720
          Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile
                          725 730 735
          Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg
                      740 745 750
          His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr
                  755 760 765
          Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu
              770 775 780
          Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val
          785 790 795 800
          Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln
                          805 810 815
          Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu
                      820 825 830
          Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys Asp
                  835 840 845
          Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Ala Arg Gly
              850 855 860
          Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn
          865 870 875 880
          Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe
                          885 890 895
          Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys
                      900 905 910
          Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys
                  915 920 925
          His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu
              930 935 940
          Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys
          945 950 955 960
          Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu
                          965 970 975
          Ile Asn Asn Tyr His His His Ala His Asp Ala Tyr Leu Asn Ala Val Val
                      980 985 990
          Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val
                  995 1000 1005
          Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys
              1010 1015 1020
          Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr
              1025 1030 1035
          Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn
              1040 1045 1050
          Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr
              1055 1060 1065
          Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg
              1070 1075 1080
          Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu
              1085 1090 1095
          Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg
              1100 1105 1110
          Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys
              1115 1120 1125
          Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu
              1130 1135 1140
          Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser
              1145 1150 1155
          Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe
              1160 1165 1170
          Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu
              1175 1180 1185
          Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe
              1190 1195 1200
          Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu
              1205 1210 1215
          Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn
              1220 1225 1230
          Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro
              1235 1240 1245
          Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His
              1250 1255 1260
          Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg
              1265 1270 1275
          Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr
              1280 1285 1290
          Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile
              1295 1300 1305
          Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe
              1310 1315 1320
          Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr
              1325 1330 1335
          Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly
              1340 1345 1350
          Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp
              1355 1360 1365
           <![CDATA[ <210> 18]]>
           <![CDATA[ <211> 96]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 18]]>
          Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys
          1 5 10 15
          Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr
                      20 25 30
          Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn
                  35 40 45
          Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg
              50 55 60
          Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln
          65 70 75 80
          Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val
                          85 90 95
           <![CDATA[ <210> 19]]>
           <![CDATA[ <211> 385]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 19]]>
          Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val Phe Glu Ala Phe
          1 5 10 15
          Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys Val Arg Lys Asp
                      20 25 30
          Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val Pro Ala Ile Val
                  35 40 45
          Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys Leu Glu Tyr Lys
              50 55 60
          Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu Asn Lys Thr Leu
          65 70 75 80
          Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr Trp Lys Arg Lys
                          85 90 95
          Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile Lys Leu Ser Glu
                      100 105 110
          Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr Lys Arg Thr Leu
                  115 120 125
          Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys Gln Asp Leu Ser
              130 135 140
          Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser Gly Thr Arg Ser
          145 150 155 160
          Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser Thr Glu Lys Asn
                          165 170 175
          Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly Ala Leu Leu His
                      180 185 190
          Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln Lys Leu Glu Ser
                  195 200 205
          Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala Ala Asp Phe Gly
              210 215 220
          Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser Thr Leu Asn Glu
          225 230 235 240
          Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys Ser Ile Lys Lys
                          245 250 255
          Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu Asn Asn Leu Leu
                      260 265 270
          Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser Asn Ile Asn Lys
                  275 280 285
          Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu Gly Tyr Val Tyr
              290 295 300
          Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser Gly Ala Asn Ser
          305 310 315 320
          Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys Met Asn Ser Asp
                          325 330 335
          Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp Gly Lys Arg Val
                      340 345 350
          Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile Phe Val Cys Gly
                  355 360 365
          Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile Asp Lys Ile Gly
              370 375 380
          Gly
          385
           <![CDATA[ <210> 20]]>
           <![CDATA[ <211> 480]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 20]]>
          Val Asp Leu Arg Thr Leu Asp Val Phe Ser Gly Cys Gly Gly Leu Ser
          1 5 10 15
          Glu Gly Phe His Gln Ala Gly Ile Ser Asp Thr Leu Trp Ala Ile Glu
                      20 25 30
          Met Trp Asp Pro Ala Ala Gln Ala Phe Arg Leu Asn Asn Pro Gly Ser
                  35 40 45
          Thr Val Phe Thr Glu Asp Cys Asn Ile Leu Leu Lys Leu Val Met Ala
              50 55 60
          Gly Glu Thr Thr Asn Ser Arg Gly Gln Arg Leu Pro Gln Lys Gly Asp
          65 70 75 80
          Val Glu Met Leu Cys Gly Gly Pro Pro Cys Gln Gly Phe Ser Gly Met
                          85 90 95
          Asn Arg Phe Asn Ser Arg Thr Tyr Ser Lys Phe Lys Asn Ser Leu Val
                      100 105 110
          Val Ser Phe Leu Ser Tyr Cys Asp Tyr Tyr Arg Pro Arg Phe Phe Leu
                  115 120 125
          Leu Glu Asn Val Arg Asn Phe Val Ser Phe Lys Arg Ser Met Val Leu
              130 135 140
          Lys Leu Thr Leu Arg Cys Leu Val Arg Met Gly Tyr Gln Cys Thr Phe
          145 150 155 160
          Gly Val Leu Gln Ala Gly Gln Tyr Gly Val Ala Gln Thr Arg Arg Arg
                          165 170 175
          Ala Ile Ile Leu Ala Ala Ala Pro Gly Glu Lys Leu Pro Leu Phe Pro
                      180 185 190
          Glu Pro Leu His Val Phe Ala Pro Arg Ala Cys Gln Leu Ser Val Val
                  195 200 205
          Val Asp Asp Lys Lys Phe Val Ser Asn Ile Thr Arg Leu Ser Ser Gly
              210 215 220
          Pro Phe Arg Thr Ile Thr Val Arg Asp Thr Met Ser Asp Leu Pro Glu
          225 230 235 240
          Val Arg Asn Gly Ala Ser Ala Leu Glu Ile Ser Tyr Asn Gly Glu Pro
                          245 250 255
          Gln Ser Trp Phe Gln Arg Gln Leu Arg Gly Ala Gln Tyr Gln Pro Ile
                      260 265 270
          Leu Arg Asp His Ile Cys Lys Asp Met Ser Ala Leu Val Ala Ala Arg
                  275 280 285
          Met Arg His Ile Pro Leu Ala Pro Gly Ser Asp Trp Arg Asp Leu Pro
              290 295 300
          Asn Ile Glu Val Arg Leu Ser Asp Gly Thr Met Ala Arg Lys Leu Arg
          305 310 315 320
          Tyr Thr His His Asp Arg Lys Asn Gly Arg Ser Ser Ser Ser Gly Ala Leu
                          325 330 335
          Arg Gly Val Cys Ser Cys Val Glu Ala Gly Lys Ala Cys Asp Pro Ala
                      340 345 350
          Ala Arg Gln Phe Asn Thr Leu Ile Pro Trp Cys Leu Pro His Thr Gly
                  355 360 365
          Asn Arg His Asn His Trp Ala Gly Leu Tyr Gly Arg Leu Glu Trp Asp
              370 375 380
          Gly Phe Phe Ser Thr Thr Val Thr Asn Pro Glu Pro Met Gly Lys Gln
          385 390 395 400
          Gly Arg Val Leu His Pro Glu Gln His Arg Val Val Ser Val Arg Glu
                          405 410 415
          Cys Ala Arg Ser Gln Gly Phe Pro Asp Thr Tyr Arg Leu Phe Gly Asn
                      420 425 430
          Ile Leu Asp Lys His Arg Gln Val Gly Asn Ala Val Pro Pro Pro Pro Leu
                  435 440 445
          Ala Lys Ala Ile Gly Leu Glu Ile Lys Leu Cys Met Leu Ala Lys Ala
              450 455 460
          Arg Glu Ser Ala Ser Ala Lys Ile Lys Glu Glu Glu Ala Ala Lys Asp
          465 470 475 480
           <![CDATA[ <210> 21]]>
           <![CDATA[ <211> 457]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 21]]>
          Glu Trp Gly Pro Phe Asp Leu Val Ile Gly Gly Ser Pro Cys Asn Asp
          1 5 10 15
          Leu Ser Ile Val Asn Pro Ala Arg Lys Gly Leu Tyr Glu Gly Thr Gly
                      20 25 30
          Arg Leu Phe Phe Glu Phe Tyr Arg Leu Leu His Asp Ala Arg Pro Lys
                  35 40 45
          Glu Gly Asp Asp Arg Pro Phe Phe Trp Leu Phe Glu Asn Val Val Ala
              50 55 60
          Met Gly Val Ser Asp Lys Arg Asp Ile Ser Arg Phe Leu Glu Ser Asn
          65 70 75 80
          Pro Val Met Ile Asp Ala Lys Glu Val Ser Ala Ala His Arg Ala Arg
                          85 90 95
          Tyr Phe Trp Gly Asn Leu Pro Gly Met Asn Arg Pro Leu Ala Ser Thr
                      100 105 110
          Val Asn Asp Lys Leu Glu Leu Gln Glu Cys Leu Glu His Gly Arg Ile
                  115 120 125
          Ala Lys Phe Ser Lys Val Arg Thr Ile Thr Thr Arg Ser Asn Ser Ile
              130 135 140
          Lys Gln Gly Lys Asp Gln His Phe Pro Val Phe Met Asn Glu Lys Glu
          145 150 155 160
          Asp Ile Leu Trp Cys Thr Glu Met Glu Arg Val Phe Gly Phe Pro Val
                          165 170 175
          His Tyr Thr Asp Val Ser Asn Met Ser Arg Leu Ala Arg Gln Arg Leu
                      180 185 190
          Leu Gly Arg Ser Trp Ser Val Pro Val Ile Arg His Leu Phe Ala Pro
                  195 200 205
          Leu Lys Glu Tyr Phe Ala Cys Val Ser Ser Gly Asn Ser Asn Ala Asn
              210 215 220
          Ser Arg Gly Pro Ser Phe Ser Ser Ser Gly Leu Val Pro Leu Ser Leu Arg
          225 230 235 240
          Gly Ser His Met Asn Pro Leu Glu Met Phe Glu Thr Val Pro Val Trp
                          245 250 255
          Arg Arg Gln Pro Val Arg Val Leu Ser Leu Phe Glu Asp Ile Lys Lys
                      260 265 270
          Glu Leu Thr Ser Leu Gly Phe Leu Glu Ser Gly Ser Asp Pro Gly Gln
                  275 280 285
          Leu Lys His Val Val Asp Val Thr Asp Thr Val Arg Lys Asp Val Glu
              290 295 300
          Glu Trp Gly Pro Phe Asp Leu Val Tyr Gly Ala Thr Pro Pro Leu Gly
          305 310 315 320
          His Thr Cys Asp Arg Pro Pro Ser Trp Tyr Leu Phe Gln Phe His Arg
                          325 330 335
          Leu Leu Gln Tyr Ala Arg Pro Lys Pro Gly Ser Pro Arg Pro Phe Phe
                      340 345 350
          Trp Met Phe Val Asp Asn Leu Val Leu Asn Lys Glu Asp Leu Asp Val
                  355 360 365
          Ala Ser Arg Phe Leu Glu Met Glu Pro Val Thr Ile Pro Asp Val His
              370 375 380
          Gly Gly Ser Leu Gln Asn Ala Val Arg Val Trp Ser Asn Ile Pro Ala
          385 390 395 400
          Ile Arg Ser Arg His Trp Ala Leu Val Ser Glu Glu Glu Leu Ser Leu
                          405 410 415
          Leu Ala Gln Asn Lys Gln Ser Ser Lys Leu Ala Ala Lys Trp Pro Thr
                      420 425 430
          Lys Leu Val Lys Asn Cys Phe Leu Pro Leu Arg Glu Tyr Phe Lys Tyr
                  435 440 445
          Phe Ser Thr Glu Leu Thr Ser Ser Leu
              450 455
           <![CDATA[ <210> 22]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 22]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Thr Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Thr Lys Asn Ser Leu Thr Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Gln Ser Gly Asp Leu Arg Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Ala
                  115 120 125
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Ser Gly Asn Leu Arg Val His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Thr Ser Gly Glu Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 23]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 23]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Ser Pro Ala Asp Leu Thr Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Ser
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser His Ser Leu Thr Glu His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Asn Asp Ala Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Asn Asp Ala Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 24]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 24]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Pro Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 25]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 25]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser His Thr Gly His Leu Leu Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Lys Lys Asp Leu Thr Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp
                  115 120 125
          Leu Arg Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ser Asp Lys Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Thr Asp Thr Leu Arg Asp His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 26]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 26]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser His Thr Gly His Leu Leu Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Thr Ser Gly Asn Leu Thr Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Thr Ser Gly Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Thr His Leu Asp Leu Ile Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 27]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 27]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro Gly Ala Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Asn His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His
                  115 120 125
          Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr Asn His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 28]]>
           <![CDATA[ <211> 661]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 28]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Ala Leu Thr Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Pro Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly His
                  115 120 125
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Thr Lys Asn Ser Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala
                      660
           <![CDATA[ <210> 29]]>
           <![CDATA[ <211> 661]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 29]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Thr Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Arg Asp Glu Leu Asn Val His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Asn His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Ser Pro Ala Asp
                  115 120 125
          Leu Thr Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr Asn His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Ser Lys Lys Ala Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Thr His Leu Asp Leu Ile Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala
                      660
           <![CDATA[ <210> 30]]>
           <![CDATA[ <211> 661]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 30]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala
                      660
           <![CDATA[ <210> 31]]>
           <![CDATA[ <211> 661]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 31]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Ser Gly His Leu Thr Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro Gly His
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Thr Leu Thr Glu His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Thr His Leu Asp Leu Ile Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala
                      660
           <![CDATA[ <210> 32]]>
           <![CDATA[ <211> 661]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 32]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser His Thr Gly His Leu Leu Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Ser Lys Lys Ala Leu Thr Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser His Thr Gly His
                  115 120 125
          Leu Leu Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Ala Leu Thr Glu His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Ser Gly Asn Leu Arg Val His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala
                      660
           <![CDATA[ <210> 33]]>
           <![CDATA[ <211> 661]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 33]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Ser Asp His Leu Thr Asn His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Gln Leu Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Asn
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asn Leu Val Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ser Asp Glu Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Gln Leu Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala
                      660
           <![CDATA[ <210> 34]]>
           <![CDATA[ <211> 1528]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 34]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val
                      20 25 30
          Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe
                  35 40 45
          Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile
              50 55 60
          Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu
          65 70 75 80
          Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys
                          85 90 95
          Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser
                      100 105 110
          Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys
                  115 120 125
          His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr
              130 135 140
          His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp
          145 150 155 160
          Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His
                          165 170 175
          Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro
                      180 185 190
          Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr
                  195 200 205
          Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala
              210 215 220
          Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn
          225 230 235 240
          Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn
                          245 250 255
          Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe
                      260 265 270
          Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp
                  275 280 285
          Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp
              290 295 300
          Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp
          305 310 315 320
          Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser
                          325 330 335
          Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys
                      340 345 350
          Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe
                  355 360 365
          Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser
              370 375 380
          Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp
          385 390 395 400
          Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg
                          405 410 415
          Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu
                      420 425 430
          Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe
                  435 440 445
          Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile
              450 455 460
          Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp
          465 470 475 480
          Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu
                          485 490 495
          Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr
                      500 505 510
          Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser
                  515 520 525
          Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys
              530 535 540
          Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln
          545 550 555 560
          Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr
                          565 570 575
          Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp
                      580 585 590
          Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly
                  595 600 605
          Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp
              610 615 620
          Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr
          625 630 635 640
          Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala
                          645 650 655
          His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr
                      660 665 670
          Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp
                  675 680 685
          Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe
              690 695 700
          Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe
          705 710 715 720
          Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu
                          725 730 735
          His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly
                      740 745 750
          Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly
                  755 760 765
          Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln
              770 775 780
          Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile
          785 790 795 800
          Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro
                          805 810 815
          Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu
                      820 825 830
          Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg
                  835 840 845
          Leu Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys
              850 855 860
          Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Ala Arg
          865 870 875 880
          Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys
                          885 890 895
          Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys
                      900 905 910
          Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp
                  915 920 925
          Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr
              930 935 940
          Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp
          945 950 955 960
          Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser
                          965 970 975
          Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg
                      980 985 990
          Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val
                  995 1000 1005
          Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu
              1010 1015 1020
          Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile
              1025 1030 1035
          Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe
              1040 1045 1050
          Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu
              1055 1060 1065
          Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly
              1070 1075 1080
          Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr
              1085 1090 1095
          Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys
              1100 1105 1110
          Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro
              1115 1120 1125
          Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp
              1130 1135 1140
          Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser
              1145 1150 1155
          Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu
              1160 1165 1170
          Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser
              1175 1180 1185
          Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr
              1190 1195 1200
          Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser
              1205 1210 1215
          Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala
              1220 1225 1230
          Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr
              1235 1240 1245
          Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly
              1250 1255 1260
          Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His
              1265 1270 1275
          Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser
              1280 1285 1290
          Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser
              1295 1300 1305
          Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu
              1310 1315 1320
          Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala
              1325 1330 1335
          Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr
              1340 1345 1350
          Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile
              1355 1360 1365
          Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly
              1370 1375 1380
          Asp Lys Arg Pro Ala Ala Thr Lys Lys Lys Ala Gly Gln Ala Lys Lys
              1385 1390 1395
          Lys Lys Ala Ser Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr
              1400 1405 1410
          Leu Val Thr Phe Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Glu
              1415 1420 1425
          Trp Lys Leu Leu Asp Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val
              1430 1435 1440
          Met Leu Glu Asn Tyr Lys Asn Leu Val Ser Leu Gly Tyr Gln Leu
              1445 1450 1455
          Thr Lys Pro Asp Val Ile Leu Arg Leu Glu Lys Gly Glu Glu Pro
              1460 1465 1470
          Trp Leu Val Glu Arg Glu Ile His Gln Glu Thr His Pro Asp Ser
              1475 1480 1485
          Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Ser Gly Gly Lys Arg
              1490 1495 1500
          Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly
              1505 1510 1515
          Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
              1520 1525
           <![CDATA[ <210> 35]]>
           <![CDATA[ <211> 1820]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 35]]> Met Ala Pro Lys Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 20 25 30 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 35 40 45 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 50 55 60 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 65 70 75 80 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 85 90 95 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 100 105 110 Phe Phe His Arg Leu Glu Glu Ser PHE Leu Val Glu Glu Glu ASP LYS LYS LYS LYS LYS LYS LYS LYS 115 120 HIS GLU ARG HIS Pro Ile PHE GLE Val ASP GLU Val Ala Tyr 130 135 His Glu Lys Tyr His Leu ARG LYS LYS LYS LYS LYS LYS Leu Val ASP 145 150 155 160 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 165 170 175 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 180 185 190 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 195 200 205 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 210 215 220 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 225 230 235 240 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 245 250 255 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 260 265 270 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 275 280 285 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 290 295 300 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 305 310 315 320 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 325 330 335 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 340 345 350 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 355 360 365 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 370 375 380 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 385 390 395 400 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu ASP Leu Leu ARG 410 415 LYS GLN ARG THR PHR PHE Asn Gly Serle Pro His Gln Ile His Leu 420 425 430 GLU HIS ALA ILE Leu ARG Gln Gln Glu Asr Pro PHE 4 35 440 445 leu lys asp asn arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 450 455 460 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 465 470 475 480 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 485 490 495 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 500 505 510 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 515 520 525 Leu Leu Tyr Glu Tyr Phe Thr Val Ty r Asn Glu Leu Thr Lys Val Lys 530 535 540 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 545 550 555 560 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 565 570 575 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 580 585 590 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 595 600 605 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 610 615 620 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 625 630 635 640 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 645 650 655 His Leu Phe Asp A sp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 660 665 670 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 675 680 685 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 690 695 700 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 705 710 715 720 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 725 730 735 His Glu His Ile Ala Asn Leu A la Gly Ser Pro Ala Ile Lys Lys Gly 740 745 750 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 755 760 765 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 770 775 780 Thr Thr GLN LYS GLY GLN LSN Serg Glu ARG MET LYS ARG ILE 785 795 800 GLU GLY ILE LYS GLU Leu GLN ILE Leu Ly Glu His Pro 805 Val Gl Gln Leu GLN Asn Glu LYS Leu Tyr Leu Tyr Tyr Leu 820 825 830 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 835 840 845 Leu Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys 850 855 860 Asp Asp Ser Ile Asp Asn LYS VAL Leu Thr ASP LYS ALA ALA ALA ARG 865 870 880 Gly LYS Sern Val Pro Serg Val Val Val Lys Met Lys 885 895 ARG Gln Leu Leu asn Ala LYS Leu Ile Thr Gln ARG LYS 900 905 910 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 915 920 925 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 930 935 940 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 945 950 955 960 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 965 970 975 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 980 985 990 G lu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 995 1000 1005 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu 1010 1015 1020 Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys M et Ile 1025 1030 1035 Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1040 1045 1050 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu 1055 1060 1065 Ala Asn Gly Glu Ile Ar g Lys Arg Pro Leu Ile Glu Thr Asn Gly 1070 1075 1080 Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr 1085 1090 1095 Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys 1100 1105 1110 Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro 1115 1120 1125 Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp 1130 1135 1140 Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser 1145 1150 1155 Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu 1160 1165 1170 Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser 1175 1180 1185 Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr 1190 1 195 1200 Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser 1205 1210 1215 Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro S er Lys Tyr 1235 1240 1245 Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly 1250 1255 1260 Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His 1265 1270 1275 Lys His Ty r Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1280 1285 1290 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser 1295 1300 1305 Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu 1310 1315 1320 Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala 1325 1330 1335 Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr 1340 1345 1350 Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile 1355 136 0 1365 Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly 1370 1375 1380 Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys 1385 1390 1395 Lys Lys Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Lys Leu 1400 1405 1410 Arg Val Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala 1415 1420 1425 Leu Glu Lys Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala 1430 1435 1440 Glu Trp Tyr Val Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn 1445 1450 1455 Asn Phe His Thr Lys Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu 1460 1465 1470 Met Ile Asp Tyr Leu Glu Asn Lys Thr Leu Ser Trp Asn Ser Lys 1475 1480 1485 As n Pro Val Ser Asn Gly Tyr Trp Lys Arg Lys Lys Asp Asp Glu 1490 1495 1500 Leu Lys Ile Ile Tyr Asn Ala Ile Lys Leu Ser Glu Lys Glu Gly 1505 1510 1515 Asn Ile Phe Asp Ile Arg Asp Leu Tyr Lys Arg Thr Leu Lys Asn 1520 1525 1530 Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys Gln Asp Leu Ser Gln 1535 1540 1545 Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser Gly Thr Arg Ser 1550 1555 1560 Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser Thr Glu Lys 15 65 1570 1575 Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly Ala Leu 1580 1585 1590 Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln Lys 1595 1600 1605 Leu Glu Ser Leu Gly Tyr Gln Asn S er Ile Glu Val Leu Asn Ala 1610 1615 1620 Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile 1625 1630 1635 Ser Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys 1640 1645 1650 Pro Lys Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys 1655 1660 1665 Asp Ile Leu Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys 1670 1675 1680 Lys Thr Lys Ser Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser 1685 1690 16 95 Lys Phe Asn Ser Glu Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly 1700 1705 1710 Pro Thr Leu Thr Ala Ser Gly Ala Asn Ser Arg Ile Lys Ile Lys 1715 1720 1725 Asp Gly Ser Asn Ile Arg Lys Met Asn Ser Asp Glu Thr Phe Leu 1730 173 5 1740 Tyr Ile Gly Phe Asp Ser Gln Asp Gly Lys Arg Val Asn Glu Ile 1745 1750 1755 Glu Phe Leu Thr Glu Asn Gln Lys Ile Phe Val Cys Gly Asn Ser 1760 1765 1770 Ile Ser Val Glu Val Leu Glu Ala Ile Ile Asp Lys Ile Gly G ly 1775 1780 1785 Pro Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly 1790 1795 1800 Gln Ala Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp 1805 1810 1815 Tyr Ala 1820 <![CDATA[ <210> 36]]>
           <![CDATA[ <211> 1922]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 36]]> Met Ala Pro Lys Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 20 25 30 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 35 40 45 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 50 55 60 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 65 70 75 80 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 85 90 95 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 100 105 110 Phe Phe His Arg Leu Glu Glu Ser PHE Leu Val Glu Glu Glu ASP LYS LYS LYS LYS LYS LYS LYS LYS 115 120 HIS GLU ARG HIS Pro Ile PHE GLE Val ASP GLU Val Ala Tyr 130 135 His Glu Lys Tyr His Leu ARG LYS LYS LYS LYS LYS LYS Leu Val ASP 145 150 155 160 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 165 170 175 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 180 185 190 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 195 200 205 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 210 215 220 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 225 230 235 240 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 245 250 255 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 260 265 270 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 275 280 285 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 290 295 300 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 305 310 315 320 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 325 330 335 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 340 345 350 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 355 360 365 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 370 375 380 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 385 390 395 400 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu ASP Leu Leu ARG 410 415 LYS GLN ARG THR PHR PHE Asn Gly Serle Pro His Gln Ile His Leu 420 425 430 GLU HIS ALA ILE Leu ARG Gln Gln Glu Asr Pro PHE 4 35 440 445 leu lys asp asn arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 450 455 460 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 465 470 475 480 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 485 490 495 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 500 505 510 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 515 520 525 Leu Leu Tyr Glu Tyr Phe Thr Val Ty r Asn Glu Leu Thr Lys Val Lys 530 535 540 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 545 550 555 560 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 565 570 575 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 580 585 590 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 595 600 605 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 610 615 620 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 625 630 635 640 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 645 650 655 His Leu Phe Asp A sp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 660 665 670 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 675 680 685 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 690 695 700 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 705 710 715 720 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 725 730 735 His Glu His Ile Ala Asn Leu A la Gly Ser Pro Ala Ile Lys Lys Gly 740 745 750 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 755 760 765 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 770 775 780 Thr Thr GLN LYS GLY GLN LSN Serg Glu ARG MET LYS ARG ILE 785 795 800 GLU GLY ILE LYS GLU Leu GLN ILE Leu Ly Glu His Pro 805 Val Gl Gln Leu GLN Asn Glu LYS Leu Tyr Leu Tyr Tyr Leu 820 825 830 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 835 840 845 Leu Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys 850 855 860 Asp Asp Ser Ile Asp Asn LYS VAL Leu Thr ASP LYS ALA ALA ALA ARG 865 870 880 Gly LYS Sern Val Pro Serg Val Val Val Lys Met Lys 885 895 ARG Gln Leu Leu asn Ala LYS Leu Ile Thr Gln ARG LYS 900 905 910 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 915 920 925 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 930 935 940 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 945 950 955 960 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 965 970 975 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 980 985 990 G lu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 995 1000 1005 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu 1010 1015 1020 Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys M et Ile 1025 1030 1035 Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1040 1045 1050 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu 1055 1060 1065 Ala Asn Gly Glu Ile Ar g Lys Arg Pro Leu Ile Glu Thr Asn Gly 1070 1075 1080 Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr 1085 1090 1095 Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys 1100 1105 1110 Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro 1115 1120 1125 Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp 1130 1135 1140 Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser 1145 1150 1155 Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu 1160 1165 1170 Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser 1175 1180 1185 Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr 1190 1 195 1200 Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser 1205 1210 1215 Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro S er Lys Tyr 1235 1240 1245 Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly 1250 1255 1260 Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His 1265 1270 1275 Lys His Ty r Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1280 1285 1290 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser 1295 1300 1305 Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu 1310 1315 1320 Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala 1325 1330 1335 Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr 1340 1345 1350 Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile 1355 136 0 1365 Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly 1370 1375 1380 Asp Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln 1385 1390 1395 Ala Lys Lys Lys Lys Ser Gly Gly Gly Gly Ser Val Asp Leu Arg 1400 1405 1410 Thr Leu Asp Val Phe Ser Gly Cys Gly Gly Leu Ser Glu Gly Phe 1415 1420 1425 His Gln Ala Gly Ile Ser Asp Thr Leu Trp Ala Ile Glu Met Trp 1430 1435 1440 Asp Pro Ala Ala Gln Ala Phe Arg Leu Asn Asn Pro Gly Ser Thr 1445 1450 1455 Val Phe Thr Glu Asp Cys Asn Ile Leu Leu Lys Leu Val Met Ala 1460 1465 1470 Gly Glu Thr Asn Ser Arg Gly Gln Arg Leu Pro Gln Lys Gly 1475 1480 1485 Asp Val Glu M et Leu Cys Gly Gly Pro Pro Cys Gln Gly Phe Ser 1490 1495 1500 Gly Met Asn Arg Phe Asn Ser Arg Thr Tyr Ser Lys Phe Lys Asn 1505 1510 1515 Ser Leu Val Val Ser Phe Leu Ser Tyr Cys Asp Tyr Tyr Arg Pro 1520 1525 1530 Arg Phe Phe Leu Leu Glu Asn Val Arg Asn Phe Val Ser Phe Lys 1535 1540 1545 Arg Ser Met Val Leu Lys Leu Thr Leu Arg Cys Leu Val Arg Met 1550 1555 1560 Gly Tyr Gln Cys Thr Phe Gly Val Leu Gln Ala Gly Gln Tyr Gly 1565 1570 1575 Val Ala Gln Thr Arg Arg Arg Ala Ile Ile Ile Leu Ala Ala Ala Pro 1580 1585 1590 Gly Glu Lys Leu Pro Leu Phe Pro Glu Pro Leu His Val Phe Ala 1595 1600 1605 Pro Arg Ala Cys Gln Leu Ser Val Val Val Asp Asp Lys Lys Phe 1610 1615 1620 Val Ser Asn Ile Thr Arg Leu Ser Ser Gly Pro Phe Arg Thr Ile 1625 1630 1635 Thr Val Arg Asp Thr Met Ser Asp Leu Pro Glu Val Arg Asn Gly 1640 1645 1650 Ala Ser Ala Leu Glu Ile S er Tyr Asn Gly Glu Pro Gln Ser Trp 1655 1660 1665 Phe Gln Arg Gln Leu Arg Gly Ala Gln Tyr Gln Pro Ile Leu Arg 1670 1675 1680 Asp His Ile Cys Lys Asp Met Ser Ala Leu Val Ala Ala Arg Met 1685 1690 1695 Arg His Ile Pro Leu Ala Pro Gly Ser Asp Trp Arg Asp Leu Pro 1700 1705 1710 Asn Ile Glu Val Arg Leu Ser Asp Gly Thr Met Ala Arg Lys Leu 1715 1720 1725 Arg Tyr Thr His His Asp Arg Lys Asn Gly Arg Ser Ser Ser Ser Gly 1730 1735 1740 Ala. Leu ARG GLY VAL CYS VAL GLU Ala Gly Lys Ala Cys 1745 1755 ASP Pro Ala Ala ARG Gln PHR Leu Ile Pro TRP CYS Leu 1760 1770 PRO His Thr Gly ass n aRG HIS Asn His Tyr Gly Leu Tyr Gly 1775 1780 1785 Arg Leu Glu Trp Asp Gly Phe Phe Ser Thr Thr Val Thr Asn Pro 1790 1795 1800 Glu Pro Met Gly Lys Gln Gly Arg Val Leu His Pro Glu Gln His 1805 1810 1815 Arg Val Val Ser Val Arg Glu Cys Ala Arg Ser Gln Gly Phe Pro 1820 1825 1830 Asp Thr Tyr Arg Leu Phe Gly Asn Ile Leu Asp Lys His Arg Gln 1835 1840 1845 Val Gly Asn Ala Val Pro Pro Pro Leu Ala Lys Ala Ile Gly Leu 1850 1855 1860 Glu Ile Lys Leu Cys Met Leu Ala Lys Ala Arg Glu Ser Ala Ser 1865 1870 1875 Ala Lys Ile Lys Glu Glu Glu Ala Ala Lys Asp Gly Gly Gly Gly 1880 1885 1890 Ser Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys 1895 1900 1905 L ys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala 1910 1915 1920 <![CDATA[ <210> 37]]>
           <![CDATA[ <211> 1986]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 37]]> Met Ala Pro Lys Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 20 25 30 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 35 40 45 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 50 55 60 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 65 70 75 80 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 85 90 95 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 100 105 110 Phe Phe His Arg Leu Glu Glu Ser PHE Leu Val Glu Glu Glu ASP LYS LYS LYS LYS LYS LYS LYS LYS 115 120 HIS GLU ARG HIS Pro Ile PHE GLE Val ASP GLU Val Ala Tyr 130 135 His Glu Lys Tyr His Leu ARG LYS LYS LYS LYS LYS LYS Leu Val ASP 145 150 155 160 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 165 170 175 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 180 185 190 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 195 200 205 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 210 215 220 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 225 230 235 240 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 245 250 255 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 260 265 270 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 275 280 285 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 290 295 300 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 305 310 315 320 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 325 330 335 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 340 345 350 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 355 360 365 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 370 375 380 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 385 390 395 400 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu ASP Leu Leu ARG 410 415 LYS GLN ARG THR PHR PHE Asn Gly Serle Pro His Gln Ile His Leu 420 425 430 GLU HIS ALA ILE Leu ARG Gln Gln Glu Asr Pro PHE 4 35 440 445 leu lys asp asn arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 450 455 460 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 465 470 475 480 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 485 490 495 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 500 505 510 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 515 520 525 Leu Leu Tyr Glu Tyr Phe Thr Val Ty r Asn Glu Leu Thr Lys Val Lys 530 535 540 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 545 550 555 560 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 565 570 575 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 580 585 590 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 595 600 605 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 610 615 620 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 625 630 635 640 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 645 650 655 His Leu Phe Asp A sp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 660 665 670 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 675 680 685 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 690 695 700 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 705 710 715 720 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 725 730 735 His Glu His Ile Ala Asn Leu A la Gly Ser Pro Ala Ile Lys Lys Gly 740 745 750 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 755 760 765 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 770 775 780 Thr Thr GLN LYS GLY GLN LSN Serg Glu ARG MET LYS ARG ILE 785 795 800 GLU GLY ILE LYS GLU Leu GLN ILE Leu Ly Glu His Pro 805 Val Gl Gln Leu GLN Asn Glu LYS Leu Tyr Leu Tyr Tyr Leu 820 825 830 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 835 840 845 Leu Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys 850 855 860 Asp Asp Ser Ile Asp Asn LYS VAL Leu Thr ASP LYS ALA ALA ALA ARG 865 870 880 Gly LYS Sern Val Pro Serg Val Val Val Lys Met Lys 885 895 ARG Gln Leu Leu asn Ala LYS Leu Ile Thr Gln ARG LYS 900 905 910 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 915 920 925 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 930 935 940 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 945 950 955 960 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 965 970 975 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 980 985 990 G lu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 995 1000 1005 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu 1010 1015 1020 Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys M et Ile 1025 1030 1035 Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1040 1045 1050 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu 1055 1060 1065 Ala Asn Gly Glu Ile Ar g Lys Arg Pro Leu Ile Glu Thr Asn Gly 1070 1075 1080 Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr 1085 1090 1095 Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys 1100 1105 1110 Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro 1115 1120 1125 Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp 1130 1135 1140 Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser 1145 1150 1155 Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu 1160 1165 1170 Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser 1175 1180 1185 Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr 1190 1 195 1200 Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser 1205 1210 1215 Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro S er Lys Tyr 1235 1240 1245 Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly 1250 1255 1260 Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His 1265 1270 1275 Lys His Ty r Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1280 1285 1290 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser 1295 1300 1305 Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu 1310 1315 1320 Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala 1325 1330 1335 Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr 1340 1345 1350 Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile 1355 136 0 1365 Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly 1370 1375 1380 Asp Ser Ala Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 1385 1390 1395 Gly Gly Ser Gly Pro Lys Lys Lys Lys Arg Lys Val Ala Ala Ala Gly 1400 1405 1410 Ser Asn His Asp Gln Glu Phe Asp Pro Pro Lys Val Tyr Pro Pro 1415 1420 1425 Val Pro Ala Glu Lys Arg Lys Pro Ile Arg Val Leu Ser Leu Phe 1430 1435 1440 Asp Gly Ile Ala Thr Gly Leu Leu Val Leu Lys Asp Leu Gly Ile 1445 1450 1455 Gln Val Asp Arg Tyr Ile Ala Ser Glu Val Cys Glu Asp Ser Ile 1460 1465 1470 Thr Val Gly Met Val Arg His Gln Gly Lys Ile Met Tyr Val Gly 1475 1480 1485 Asp Val Ar g Ser Val Thr Gln Lys His Ile Gln Glu Trp Gly Pro 1490 1495 1500 Phe Asp Leu Val Ile Gly Gly Ser Pro Cys Asn Asp Leu Ser Ile 1505 1510 1515 Val Asn Pro Ala Arg Lys Gly Leu Tyr Glu Gly Thr Gly Arg Leu 1520 1525 153 0 Phe Phe Glu Phe Tyr Arg Leu Leu His Asp Ala Arg Pro Lys Glu 1535 1540 1545 Gly Asp Asp Arg Pro Phe Phe Trp Leu Phe Glu Asn Val Val Ala 1550 1555 1560 Met Gly Val Ser Asp Lys Arg Asp Ile Ser Arg Phe Leu Glu Ser 1565 1 570 1575 Asn Pro Val Met Ile Asp Ala Lys Glu Val Ser Ala Ala His Arg 1580 1585 1590 Ala Arg Tyr Phe Trp Gly Asn Leu Pro Gly Met Asn Arg Pro Leu 1595 1600 1605 Ala Ser Thr Val Asn Asp Lys Leu Glu Leu Gln G lu Cys Leu Glu 1610 1615 1620 His Gly Arg Ile Ala Lys Phe Ser Lys Val Arg Thr Ile Thr Thr 1625 1630 1635 Arg Ser Asn Ser Ile Lys Gln Gly Lys Asp Gln His Phe Pro Val 1640 1645 1650 Phe Met Asn Glu Lys Glu Asp Ile Leu Trp Cys Thr Glu Met Glu 1655 1660 1665 Arg Val Phe Gly Phe Pro Val His Tyr Thr Asp Val Ser Asn Met 1670 1675 1680 Ser Arg Leu Ala Arg Gln Arg Leu Leu Gly Arg Ser Trp Ser Val 1685 1690 1695 Pro Val Ile Arg His Leu Phe Ala Pro Leu Lys Glu Tyr Phe Ala 1700 1705 1710 Cys Val Ser Ser Gly Asn Ser Asn Ala Asn Ser Arg Gly Pro Ser 1715 1720 1725 Phe Ser Ser Gly Leu Val Pro Leu Ser Leu Arg Gly Ser His Met 1730 1735 1740 Asn Pro Leu Glu Met Phe Glu Thr Val Pro Val Trp Arg Arg Gln 1745 1750 1755 Pro Val Arg Val Leu Ser Leu Phe Glu Asp Ile Lys Lys Glu Leu 1760 1765 1770 Thr Ser Leu Gly Phe Leu Glu Ser Gly Ser Asp Pro Gly Gln Leu 1775 1780 1785 Lys His Val Asp Val Thr Asp Thr Val Arg Lys Asp Val Glu 1790 1795 1800 Glu Trp Gly Pro Phe Asp Leu Val Tyr Gly Ala Thr Pro Pro Leu 1805 1810 1815 Gly His Thr Cys Asp Arg Pro Pro Ser Tr p Tyr Leu Phe Gln Phe 1820 1825 1830 His Arg Leu Leu Gln Tyr Ala Arg Pro Lys Pro Gly Ser Pro Arg 1835 1840 1845 Pro Phe Phe Trp Met Phe Val Asp Asn Leu Val Leu Asn Lys Glu 1850 1855 1860 Asp Leu Asp Val Ala Ser Arg Phe Leu Glu Met Glu Pro Val Thr 1865 1870 1875 Ile Pro Asp Val His Gly Gly Ser Leu Gln Asn Ala Val Arg Val 1880 1885 1890 Trp Ser Asn Ile Pro Ala Ile Arg Ser Arg His Trp Ala Leu Val 1895 1900 190 5 Ser Glu Glu Glu Leu Ser Leu Leu Ala Gln Asn Lys Gln Ser Ser 1910 1915 1920 Lys Leu Ala Ala Lys Trp Pro Thr Lys Leu Val Lys Asn Cys Phe 1925 1930 1935 Leu Pro Leu Arg Glu Tyr Phe Lys Tyr Phe Ser Thr Glu Leu Thr 19 40 1945 1950 Ser Ser Leu Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala 1955 1960 1965 Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro 1970 1975 1980 Asp Tyr Ala 1985 <![CDATA[ <210> 38]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 38]]>
          ctggagcccg gcgagaaacc ctacaagtgc cccgagtgcg gcaaatcctt ctctagaagc 60
          gacaaactga ccgaacatca gaggacccac accggcgaga agccttataa gtgtcccgaa 120
          tgcggcaaat ccttcagcac caagaactct ctgacagaac accagagaac acataccgga 180
          gagaaacctt ataaatgccc cgagtgcggc aagtccttct cccagtccgg cgatctgagg 240
          agacaccaaa gaacacatac cggcgaaaag ccttacaagt gccccgagtg tggaaagagc 300
          ttctccacca ccggcgctct gaccgagcac cagagaacac acaccggcga gaaaccctat 360
          aaatgtcccg agtgtggcaa atccttcagc gacagcggca atctgagagt gcaccaaaga 420
          acccataccg gcgaaaaacc ctacaaatgc cccgagtgcg gcaaatcctt cagccagagg 480
          gcccatctgg agaggcacca aaggacacac accggagaaa agccctacaa gtgtcccgag 540
          tgtggaaaaa gctttagcac aagcggcgag ctggtgaggc atcaaaggac ccacaccggc 600
          gaaaagccca ccggcaaaaa gaccagc 627
           <![CDATA[ <210> 39]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial]]> sequence
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 39]]>
          ctggagcccg gcgagaagcc ctacaagtgc cccgagtgcg gaaagtcctt cagctccccc 60
          gccgatctga caagacatca gagaacccat accggcgaga aaccttacaa atgccccgaa 120
          tgtggcaagt cctttagcga tcccggacat ctggtgaggc accagaggac acaccaccggc 180
          gaaaagccct ataaatgtcc cgagtgtgga aagagctttt ctagaagcga caatctcgtg 240
          agacaccaga gaacccacac cggagagaag ccttacaagt gccccgagtg cggcaaatcc 300
          ttcagccaga gctcctctct ggtgaggcac caaaggaccc acaccggcga gaaaccttat 360
          aagtgtcccg agtgtggcaa aagcttcagc acctcccact ctctgaccga gcatcaaaga 420
          accccacaccg gcgaaaaacc ttataaatgc cccgagtgtg gcaaatcctt cagcagaaat 480
          gacgctctga cagagcacca aagaacacat accggagaaa agccctaca atgccccgag 540
          tgtggaaaat ccttttctag aaacgatgct ctgaccgaac accaaagaac acacaccggc 600
          gaaaagccta ccggaaaaaa gaccagc 627
           <![CDATA[ <210> 40]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 40]]>
          ctggagcccg gcgaaaaacc ttacaagtgc cccgagtgcg gaaagagctt cagcagaagc 60
          gacaaactgg tgaggcatca aaggacacat accggagaga agccctataa gtgccccgaa 120
          tgtggcaaat ccttttccca gagggctcat ctggaaagac accagaggac ccataccggc 180
          gaaaaaccct acaaatgtcc cgagtgtgga aagagctttt ccgatcccgg ccatctggtc 240
          agacatcaga ggacacatac cggcgaaaag ccttacaagt gtcccgaatg cggaaaatcc 300
          ttctccagaa gcgacaagct ggtgaggcac caaagaaccc acaccggcga aaaaccctat 360
          aaatgccccg agtgcggcaa gtcctttagc cagctggccc atctgagagc ccaccagaga 420
          acacacaccg gagagaagcc ttataagtgt cccgagtgcg gaaagtcctt ctctagagcc 480
          gacaatctga ccgaacatca aaggacacac accggcgaga aaccttataa atgccccgag 540
          tgcggaaaaa gcttttccga ctgcagagat ctggctagac accagagaac ccacaccggc 600
          gagaaaccca ccggcaaaaa gaccagc 627
           <![CDATA[ <210> 41]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 41]]>
          ctggagcccg gcgaaaagcc ttataaatgt cccgaatgcg gcaagagctt tagccacacc 60
          ggccatctgc tggaacacca aaggacccat accggcgaaa agccctataa gtgccccgag 120
          tgtggcaaga gcttcagcac caccggcaat ctgacagtcc atcagaggac ccacaccgga 180
          gagaaaccct ataaatgccc cgagtgtgga aagtccttct ccgacaagaa ggatctgaca 240
          agacaccaga ggacccatac cggcgagaaa ccctacaaat gccccgagtg cggcaaatcc 300
          ttctccccaga gcggcgatct gaggagacat caaagaacac ataccggcga aaaaccctat 360
          aagtgccccg aatgcggcaa gtccttcagc cagagggccc atctggaaag gcatcagagg 420
          acacacaccg gcgagaagcc ttacaaatgt cccgagtgcg gaaagagctt ctctagaagc 480
          gacaagctga ccgagcatca gaggacccac accggagaaa aaccttacaa gtgccccgag 540
          tgcggcaaaa gcttcagcag aaccgacaca ctgagagatc accaaaggac acacaccggc 600
          gagaaaccca ccggcaaaaa gaccagc 627
           <![CDATA[ <210> 42]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 42]]>
          ctggagcccg gcgagaagcc ttataagtgc cccgagtgtg gcaagagctt tagccacacc 60
          ggccatctgc tggagcatca aaggacacac accggagaaa agccctataa gtgccccgag 120
          tgtggcaaat ccttcagcac ctccggcaat ctcaccgaac accagagaac acacaccgga 180
          gaaaaacctt acaaatgtcc cgagtgtgga aagagctttt ccaccagcgg caatctggtg 240
          agacatcaaa gaacacatac cggcgaaaaa ccctataaat gccccgagtg tggaaaatcc 300
          ttctcccaac tggcccatct gagggcccac cagaggacac ataccggaga aaaaccctac 360
          aaatgccccg aatgcggaaa aagcttctcc gagagaagcc atctgagaga gcaccaaagg 420
          acccataccg gagaaaagcc ttacaagtgt cccgagtgcg gaaaaagctt tagcgatccc 480
          ggacatctgg tgagacatca gagaacccac accggcgaaa agccttataa atgtcccgaa 540
          tgtggcaagt cctttagcac ccatctggat ctgattagac accaaagaac ccacaccggc 600
          gagaaaccca ccggaaaaaa gaccagc 627
           <![CDATA[ <210> 43]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 43]]>
          ctggagcccg gcgaaaagcc ttacaaatgt cccgagtgcg gaaagtcctt cagcgacccc 60
          ggcgctctgg tgagacatca aagaacacat accggcgaga aaccttataa atgccccgaa 120
          tgtggaaaat ccttcagcga aagaagccat ctgagggaac accagaggac ccacaccggc 180
          gaaaaacctt ataagtgccc cgaatgcgga aaaagctttt ctagaagcga tcatctgacc 240
          aaccatcaga gaacacacac cggcgaaaag ccctataaat gtcccgagtg tggcaaatcc 300
          tttagcgaga ggtcccatct gagagagcac cagaggacac ataccggaga gaagccctac 360
          aagtgccccg agtgtggcaa gagctttagc agaagcgacc atctgaccaa tcatcaaagg 420
          accccacaccg gagagaagcc ttacaagtgt cccgagtgcg gaaagtcctt ttccgatccc 480
          ggccacctcg tgaggcacca aagaacccat accggcgaga aaccctacaa atgccccgag 540
          tgtggaaaga gcttctccag aagcgacaag ctggtgaggc atcagaggac acacaccggc 600
          gaaaaaccca ccggcaagaa aaccagc 627
           <![CDATA[ <210> 44]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 44]]>
          ctggagcccg gagagaagcc ctacaaatgc cccgagtgtg gaaagagctt ctctagaaat 60
          gacgctctga cagaaccacca gaggaccccat accggcgaga aaccttacaa atgccccgag 120
          tgcggaaaaa gctttagcga ttgcagagat ctggctagac atcagagaac acacaccggc 180
          gagaagccct ataagtgccc cgaatgcggc aagagcttta gcgaccccgg ccatctggtg 240
          agacatcaaa ggacacatac cggagaaaaa ccttacaagt gccccgagtg cggaaagtcc 300
          ttctccccaga gcggccatct caccgagcat caaaggaccc acaccggcga aaagccttat 360
          aaatgtcccg aatgtggcaa gtccttctct agagaggata atctgcacac ccatcagagg 420
          accccacaccg gcgaaaagcc ttataaatgc cccgaatgtg gaaagtcctt ttccaccaag 480
          aactctctga ccgagcatca gaggacacac accggagaga aaccctataa atgtcccgag 540
          tgtggcaaga gcttcagcag agccgacaat ctgacagagc accaaagaac acataccggc 600
          gaaaagccca ccggcaaaaa gaccagc 627
           <![CDATA[ <210> 45]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 45]]>
          ctggagcccg gcgagaaacc ctacaagtgc cccgagtgtg gcaaatcctt ctctagatcc 60
          gacaaactga ccgaacatca gaggacccat accggcgaaa aaccttataa atgtcccgag 120
          tgcggaaagt ccttctctag aagggacgag ctgaacgtgc atcagagaac acataccggc 180
          gagaagccct ataaatgccc cgaatgcggc aaaagcttct ctagaagcga tcatctgacc 240
          aaccaccaga gaacccatac cggagaaaag ccttacaagt gtcccgaatg tggaaaatcc 300
          ttcagctccc ccgccgatct gaccagacac caaaggaccc acaccggcga gaagccctat 360
          aaatgccccg agtgcggcaa gagcttttcc agatccgacc atctgaccaa tcatcaaaga 420
          accccacaccg gcgaaaagcc ttataaatgt cccgagtgcg gcaaatcctt ttccagcaag 480
          aaggctctga ccgagcatca aaggacccat accggcgaga agccttacaa atgccccgag 540
          tgtggaaagt cctttagcac ccatctggat ctgattagac accagaggac acacaccgga 600
          gagaaaccca ccggcaaaaa gaccagc 627
           <![CDATA[ <210> 46]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 46]]>
          ctggagcccg gcgagaaacc ttacaaatgc cccgagtgcg gcaagagctt cagcagaagc 60
          gacgatctgg tgaggcacca aagaacccac accggcgaaa aaccttacaa gtgtcccgaa 120
          tgcggaaagt ccttcagcag agaggacaat ctgcacaccc accagagaacacacaccgga 180
          gaaaagcctt acaagtgccc cgaatgcggc aaatcctttt ctagaagcga tcatctgacc 240
          accccaccaaa gaacacatac cggcgagaag ccttacaaat gtcccgagtg cggaaagtcc 300
          ttctccccaga gagccaatct gagggctcat caaaggaccc ataccggcga aaagccctac 360
          aaatgccccg agtgcggaaa atccttcagc cagctggccc atctgagagc ccaccaaagg 420
          acacacaccg gagagaaacc ctataagtgc cccgagtgtg gaaaaagctt ttcccagagg 480
          gccaatctga gggcccatca gaggaccccat accggagaga agccttataa atgtcccgag 540
          tgcggaaaaa gcttcagcga gaggagccat ctgagggaac atcaaagaac ccacaccggc 600
          gaaaaaccca ccggaaaaaa gaccagc 627
           <![CDATA[ <210> 47]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223]]>> Description of artificial sequences: synthetic polynucleotides]]&gt;
           <br/>
           <br/> &lt;![CDATA[ &lt;400&gt;47]]&gt;
           <br/> <![CDATA[ctggagcccg gcgagaaacc ctacaagtgc cccgagtgtg gaaaaagctt tagccaaagc 60
          ggcgatctga ggagacacca aagaacacac accggcgaga agccctacaa atgtcccgag 120
          tgcggaaaga gcttcagcca gagcggccat ctgaccgagc atcagagaac ccataccggc 180
          gaaaaacctt ataagtgccc cgagtgtgga aagtccttct ccgagagatc ccatctgaga 240
          gaacaccaga ggacacacac cggcgaaaaa ccttataagt gtcccgagtg cggaaagtcc 300
          ttcagcgatc ccggccatct ggtgagacat caaaggacac ataccggcga aaaaccttat 360
          aagtgtcccg aatgcggcaa gagctttagc agaaacgaca cactcaccga acaccagagg 420
          accccacaccg gcgagaaacc ctacaaatgc cccgagtgcg gcaaatcctt ttctagagcc 480
          gacaatctga ccgaaccacca gaggacccat accggagaaa agccttacaa atgtcccgag 540
          tgtggcaaat ccttctccac ccatctggat ctgattagac accaaagaac acataccgga 600
          gaaaagccca ccggaaaaaa gaccagc 627
           <![CDATA[ <210> 48]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 48]]>
          ctggagcccg gcgaaaaacc ctataagtgc cccgaatgtg gaaagagctt cagccatacc 60
          ggccatctgc tggaacacca aaggacacac accggcgaga aaccttacaa gtgtcccgag 120
          tgcggaaaaa gcttctcctc caaaaaggct ctcaccgagc accagagaac acataccggc 180
          gaaaagcctt ataagtgccc cgagtgtggc aaatcctttt ccgactgtag agatctggcc 240
          agacatcaaa gaacccacac cggagagaaa ccttataaat gccccgagtg cggcaagtcc 300
          tttagccata ccggccatct gctggagcac cagaggaccc ataccggcga gaagccttac 360
          aaatgccccg agtgcggcaa aagcttcagc agaaatgacg ctctgaccga gcatcaaagg 420
          acccataccg gcgaaaagcc ctacaagtgt cccgagtgtg gaaagtcctt ctcccagagc 480
          ggcgatctga ggagacacca gagaacacac accggcgaga aaccctataa atgtcccgag 540
          tgcggaaaga gctttagcga cagcggcaat ctgagggtgc atcaaagaac acacaccggc 600
          gaaaaaccca ccggaaaaaa gacaagc 627
           <![CDATA[ <210> 49]]>
           <![CDATA[ <211> 538]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 49]]>
          caccggcgaa aagccttata agtgccccga gtgcggcaag tccttctcta gaagcgatca 60
          cctcaccaat catcagagga cacataccgg agagaagccc tataagtgcc ccgagtgcgg 120
          caagagcttt agccagctgg ctcatctgag agctcaccaa agaacccata ccggcgagaa 180
          gccttacaaa tgccccgagt gtggaaaatc cttttccccag tccagcaacc tcgtcagaca 240
          tcaaaggacc cataccggcg aaaagcctta caagtgtccc gagtgcggaa agtccttctc 300
          tagatccgac aacctcgtga ggcaccagag aacccacacc ggcgagaaac cttacaaatg 360
          tcccgagtgt ggcaaaagct tttctagaag cgacgagctg gtgagacatc aaagaaccca 420
          taccggcgaa aaaccttata agtgtcccga gtgcggcaaa tcctttagcc agctggccca 480
          tctgagggcc caccagagaa cacataccgg cgaaaaaccc accggcaaaa agacaagc 538
           <![CDATA[ <210> 50]]>
           <![CDATA[ <211> 4101]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 50]]>
          gacaagaagt acagcatcgg cctggccatc ggcaccaaca gcgtgggctg ggccgtgatc 60
          accgacgagt acaaggtgcc cagcaagaag ttcaaggtgc tgggcaacac cgaccggcac 120
          agcatcaaga agaacctgat cggcgccctg ctgttcgaca gcggcgagac cgccgaggcc 180
          acccggctga agcggaccgc ccggcggcgg taacacccggc ggaagaaccg gatctgctac 240
          ctgcaggaga tcttcagcaa cgagatggcc aaggtggacg acagcttctt ccaccggctg 300
          gaggagagct tcctggtgga ggaggacaag aagcacgagc ggcaccccat cttcggcaac 360
          atcgtggacg aggtggccta ccacgagaag taccccacca tctaccacct gcggaagaag 420
          ctggtggaca gcaccgacaa ggccgacctg cggctgatct acctggccct ggcccacatg 480
          atcaagttcc ggggccactt cctgatcgag ggcgacctga accccgacaa cagcgacgtg 540
          gacaagctgt tcatccagct ggtgcagacc tacaaccagc tgttcgagga gaaccccatc 600
          aacgccagcg gcgtggacgc caaggccatc ctgagcgccc ggctgagcaa gagccggcgg 660
          ctggagaacc tgatcgccca gctgcccggc gagaagaaga acggcctgtt cggcaacctg 720
          atcgccctga gcctggggcct gacccccaac ttcaagagca acttcgacct ggccgaggac 780
          gccaagctgc agctgagcaa ggacacctac gacgacgacc tggacaacct gctggcccag 840
          atcggcgacc agtacgccga cctgttcctg gccgccaaga acctgagcga cgccatcctg 900
          ctgagcgaca tcctgcgggt gaacaccgag atcaccaagg cccccctgag cgccagcatg 960
          atcaagcggt acgacgagca ccaccaggac ctgaccctgc tgaaggccct ggtgcggcag 1020
          cagctgcccg agaagtacaa ggagatcttc ttcgaccaga gcaagaacgg ctacgccggc 1080
          tacatcgacg gcggcgccag ccaggagggag ttctacaagt tcatcaagcc catcctggag 1140
          aagatggacg gcaccgagga gctgctggtg aagctgaacc gggaggacct gctgcggaag 1200
          cagcggacct tcgacaacgg cagcatcccc caccagatcc acctgggcga gctgcacgcc 1260
          atcctgcggc ggcaggagga cttctacccc ttcctgaagg acaaccggga gaagatcgag 1320
          aagatcctga ccttccggat cccctactac gtgggccccc tggcccgggg caacagccgg 1380
          ttcgcctgga tgacccggaa atccgaggag accatcaccc cctggaactt cgaggaggtg 1440
          gtggacaagg gcgccagcgc ccagagcttc atcgagcgga tgaccaactt cgacaagaac 1500
          ctgcccaacg agaaggtgct gcccaagcac agcctgctgt acgagtactt caccgtgtac 1560
          aacgagctga ccaaggtgaa gtacgtgacc gagggcatgc ggaagcccgc cttcctgagc 1620
          ggcgagcaga agaaggccat cgtggacctg ctgttcaaga ccaaccggaa ggtgaccgtg 1680
          aagcagctga aggaggacta cttcaagaag atcgagtgct tcgacagcgt ggagatcagc 1740
          ggcgtggagg accggttcaa cgccagcctg ggcacctacc acgacctgct gaagatcatc 1800
          aaggacaagg acttcctgga caacgaggag aacgaggaca tcctggagga catcgtgctg 1860
          accctgaccc tgttcgagga ccgggagatg atcgaggagc ggctgaaaac ctacgcccac 1920
          ctgttcgacg acaaggtgat gaagcagctg aagcggcggc ggtacaccgg ctggggccgg 1980
          ctgagccgga agctgatcaa cggcatccgg gacaagcaga gcggcaagac catcctggac 2040
          ttcctgaaat ccgacggctt cgccaaccgg aacttcatgc agctgatcca cgacgacagc 2100
          ctgaccttca aggaggacat ccagaaggcc caggtgagcg gccagggcga cagcctgcac 2160
          gagcacatcg ccaacctggc cggcagcccc gccatcaaga agggcatcct gcagaccgtg 2220
          aaggtggtgg acgagctggt gaaggtgatg ggccggcaca agcccgagaa catcgtgatc 2280
          gagatggccc gggagaacca gaccacccag aagggccaga agaacagccg ggagcggatg 2340
          aagcggatcg aggagggcat caaggagctg ggcagccaga tcctgaagga gcaccccgtg 2400
          gagaacaccc agctgcagaa cgagaagctg tacctgtact acctgcagaa cggccgggac 2460
          atgtacgtgg accagagct ggacatcaac cggctgagcg actacgacgt ggccgccatc 2520
          gtgccccaga gcttcctgaa ggacgacagc atcgacaaca aggtgctgac ccggagcgac 2580
          aaggcccggg gcaagagcga caacgtgccc agcgaggagg tggtgaagaa gatgaagaac 2640
          tactggcggc agctgctgaa cgccaagctg atcacccagc ggaagttcga caacctgacc 2700
          aaggccgagc ggggcggcct gagcgagctg gacaaggccg gcttcatcaa gcggcagctg 2760
          gtggagaccc ggcagatcac caagcacgtg gccccagatcc tggacagccg gatgaacacc 2820
          aagtacgacg agaacgacaa gctgatccgg gaggtgaagg tgatcaccct gaaatccaag 2880
          ctggtgagcg acttccggaa ggacttccag ttctacaagg tgcggggagat caacaactac 2940
          caccacgccc acgacgccta cctgaacgcc gtggtgggca ccgccctgat caagaagtac 3000
          cccaagctgg agagcgagtt cgtgtacggc gactacaagg tgtacgacgt gcggaagatg 3060
          atcgccaaga gcgagcagga gatcggcaag gccaccgcca agtacttctt ctacagcaac 3120
          atcatgaact tcttcaagac cgagatcacc ctggccaacg gcgagatccg gaagcggccc 3180
          ctgatcgaga ccaacggcga gaccggcgag atcgtgtggg acaagggccg ggacttcgcc 3240
          accgtgcgga aggtgctgag catgccccag gtgaacatcg tgaagaaaac cgaggtgcag 3300
          accggcggct tcagcaagga gagcatcctg cccaagcgga acagcgacaa gctgatcgcc 3360
          cggaagaagg actgggaccc caagaagtac ggcggcttcg acagccccac cgtggcctac 3420
          agcgtgctgg tggtggccaa ggtggagaag ggcaagagca agaagctgaa atccgtgaag 3480
          gagctgctgg gcatcaccat catggagcgg agcagcttcg agaagaaccc catcgacttc 3540
          ctggaggcca agggctacaa ggaggtgaag aaggacctga tcatcaagct gcccaagtac 3600
          agcctgttcg agctggagaa cggccggaag cggatgctgg ccagcgccgg cgagctgcag 3660
          aagggcaacg agctggccct gcccagcaag tacgtgaact tcctgtacct ggccagccac 3720
          tacgagaagc tgaagggcag ccccgaggac aacgagcaga agcagctgtt cgtggagcag 3780
          cacaagcact acctggacga gatcatcgag cagatcagcg agttcagcaa gcgggtgatc 3840
          ctggccgacg ccaacctgga caaggtgctg agcgcctaca acaagcaccg ggacaagccc 3900
          atccgggagc aggccgagaa catcatccac ctgttcaccc tgaccaacct gggcgccccc 3960
          gccgccttca agtacttcga caccaccatc gaccggaagc ggtacaccag caccaaggag 4020
          gtgctggacg ccaccctgat ccaccagagc atcaccggcc tgtacgagac ccggatcgac 4080
          ctgagccagc tgggcggcga c 4101
           <![CDATA[ <210> 51]]>
           <![CDATA[ <211> 288]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 51]]>
          gacgccaaga gcctgaccgc ctggagccgg accctggtga ccttcaagga cgtgttcgtg 60
          gacttcaccc gggaggagtg gaagctgctg gacaccgccc agcagatcct gtaccggaac 120
          gtgatgctgg agaactacaa gaacctggtg agcctgggct accagctgac caagcccgac 180
          gtgatcctgc ggctggagaa gggcgaggag ccctggctgg tggagcggga gatccaccag 240
          gagacccacc ccgacagcga gaccgccttc gagatcaaga gcagcgtg 288
           <![CDATA[ <210> 52]]>
           <![CDATA[ <211> 1155]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 52]]>
          agcaaggtgg agaacaagac caagaagctg cgggtgttcg aggccttcgc cggcatcggc 60
          gcccagcgga aggccctgga gaaggtgcgg aaggacgagt acgagatcgt gggcctggcc 120
          gagtggtacg tgcccgccat cgtgatgtac caggccatcc acaacaactt ccacaccaag 180
          ctggagtaca agagcgtgag ccgggaggag atgatcgact acctggagaa caagaccctg 240
          agctggaaca gcaagaaccc cgtgagcaac ggctactgga agcggaagaa ggacgacgag 300
          ctgaagatca tctacaacgc catcaagctg agcgagaagg agggcaacat cttcgacatc 360
          cgggacctgt acaagcggac cctgaagaac atcgacctgc tgacctacag cttcccctgc 420
          caggacctga gccagcaggg catccagaag ggcatgaagc ggggcagcgg cacccggagc 480
          ggcctgctgt gggagatcga gcgggccctg gacagcaccg agaagaacga cctgcccaag 540
          tacctgctga tggagaacgt gggcgccctg ctgcacaaga agaacgagga ggagctgaac 600
          cagtggaagc agaagctgga gagcctgggc taccagaaca gcatcgaggt gctgaacgcc 660
          gccgacttcg gcagcagcca ggcccggcgg cgggtgttca tgatcagcac cctgaacgag 720
          ttcgtggagc tgcccaaggg cgacaagaag cccaagagca tcaagaaggt gctgaacaag 780
          atcgtgagcg agaaggacat cctgaacaac ctgctgaagt acaacctgac cgagttcaag 840
          aaaaccaaga gcaacatcaa caaggccagc ctgatcggct acaagcaagtt caacagcgag 900
          ggctacgtgt acgaccccga gttcaccggc cccaccctga ccgccagcgg cgccaacagc 960
          cggatcaaga tcaaggacgg cagcaacatc cggaagatga acagcgacga gaccttcctg 1020
          tacatcggct tcgacagcca ggacggcaag cgggtgaacg agatcgagtt cctgaccgag 1080
          aaccagaaga tcttcgtgtg cggcaacagc atcagcgtgg aggtgctgga ggccatcatc 1140
          gacaagatcg gcggc 1155
           <![CDATA[ <210> 53]]>
           <![CDATA[ <211> 1440]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 53]]>
          gtggatctga ggacactcga cgtgtttagc ggatgcggcg gactctccga aggcttccac 60
          caagccggaa tttccgacac actctgggcc attgagatgt gggaccccgc cgctcaagcc 120
          ttcagactga ataatcccgg ctccaccgtg ttcaccgagg actgcaacat tctgctgaag 180
          ctggtgatgg ctggcgaaac caccaactct agaggccaga ggctgcccca gaagggagat 240
          gtggaaatgc tctgtggagg ccctccttgc caaggcttct ccggcatgaa caggttcaac 300
          tctagaacat acaagcaagtt caagaactct ctggtcgtga gctttctgag ctactgcgac 360
          tactatagac ctaggttctt tctgctggag aacgtgagaa atttcgtgtc cttcaagagg 420
          agcatggtgc tgaagctgac actgaggtgt ctggtgagga tgggctacca gtgcacattc 480
          ggagtgctgc aagctggcca gtacggcgtg gcccagacca gaaggagggc catcattctg 540
          gctgctgccc ccggcgagaa actccctctg ttccccgagc ccctccacgt gttcgcccct 600
          agagcttgcc agctgagcgt ggtggtcgac gataagaagt tcgtgagcaa catcacaagg 660
          ctgtccagcg gacccttcag aaccattacc gtgagggata ccatgtccga cctccccgag 720
          gtgaggaatg gcgccagcgc tctggagatt tcctacaacg gcgaacctca gagctggttc 780
          caaaggcagc tgagaggcgc tcagtatcag cccattctga gggaccacat ctgcaaagat 840
          atgagcgctc tggtggccgc tagaatgaga catattcctc tggcccccgg cagcgactgg 900
          agagatctgc ccaatattga ggtgagactc agcgacggaa caatggctag aaaactgagg 960
          tacacccatc atgatagaaa gaacggaagg agcagcagcg gcgctctgag aggagtgtgt 1020
          agctgcgtgg aagctggcaa ggcttgcgat cccgccgcta ggcagttcaa taccctcatc 1080
          ccttggtgtc tgcctcacac cggcaacaga cacaatcatt gggctggact gtatggaagg 1140
          ctcgaatggg acggcttttt cagcaccacc gtgaccaatc ccgaacctat gggcaagcaa 1200
          ggaagggtgc tccaccccga gcagcataga gtcgtgtccg tgagagaatg cgctagaagc 1260
          caaggcttcc ccgacaccta tagactgttc ggcaacattc tggataagca cagacaagtg 1320
          ggaaatgctg tccctcctcc tctggccaag gctatcggac tggagatcaa gctgtgtatg 1380
          ctcgccaaag ctagggagag cgcttccgcc aagattaagg aggaggaggc cgccaaggac 1440
           <![CDATA[ <210> 54]]>
           <![CDATA[ <211> 1626]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 54]]>
          aaccacgacc aggagttcga cccccccaag gtgtaccccc ccgtgcccgc cgagaagcgg 60
          aagcccatcc gggtgctgag cctgttcgac ggcatcgcca ccggcctgct ggtgctgaag 120
          gacctgggca tccaggtgga ccggtacatc gccagcgagg tgtgcgagga cagcatcacc 180
          gtgggcatgg tgcggcacca gggcaagatc atgtacgtgg gcgacgtgcg gagcgtgacc 240
          cagaagcaca tccaggagtg gggccccttc gacctggtga tcggcggcag cccctgcaac 300
          gacctgagca tcgtgaaccc cgcccggaag ggcctgtacg agggcaccgg ccggctgttc 360
          ttcgagttct accggctgct gcacgacgcc cggcccaagg agggcgacga ccggcccttc 420
          ttctggctgt tcgagaacgt ggtggccatg ggcgtgagcg acaagcggga catcagccgg 480
          ttcctggaga gcaaccccgt gatgatcgac gccaaggagg tgagcgccgc ccaccgggcc 540
          cggtacttct ggggcaacct gcccggcatg aaccggcccc tggccagcac cgtgaacgac 600
          aagctggagc tgcaggagtg cctggagcac ggccggatcg ccaagttcag caaggtgcgg 660
          accatcacca cccggagcaa cagcatcaag cagggcaagg accagcactt ccccgtgttc 720
          atgaacgaga aggaggacat cctgtggtgc accgagatgg agcgggtgtt cggcttcccc 780
          gtgcactaca ccgacgtgag caacatgagc cggctggccc ggcagcggct gctgggccgg 840
          agctggagcg tgcccgtgat ccggcacctg ttcgcccccc tgaaggagta cttcgcctgc 900
          gtgagcagcg gcaacagcaa cgccaacagc cggggcccca gcttcagcag cggcctggtg 960
          cccctgagcc tgcggggcag ccacatgaat cctctggaga tgttcgagac agtgcccgtg 1020
          tggagaaggc aacccgtgag ggtgctgagc ctcttcgagg acattaagaa ggagctgacc 1080
          tctctgggct ttctggaatc cggcagcgac cccggccagc tgaaacacgt ggtggacgtg 1140
          accgacacag tgaggaagga cgtggaagag tggggcccct ttgacctcgt gtatggagcc 1200
          acacctcctc tcggccacac atgcgatagg cctcccagct ggtatctctt ccagttccac 1260
          agactgctcc agtacgccag acctaagccc ggcagcccca gacccttctt ctggatgttc 1320
          gtggacaatc tggtgctgaa caaggaggat ctggatgtgg ccagcagatt tctggagatg 1380
          gaacccgtga caatccccga cgtgcatggc ggctctctgc agaacgccgt gagagtgtgg 1440
          tccaacatcc ccgccattag aagcagacac tgggctctgg tgagcgagga ggaactgtct 1500
          ctgctggccc agaataagca gtcctccaag ctggccgcca agtggcccac caagctggtg 1560
          aagaactgct ttctgcctct gagggagtat ttcaagtatt tcagcaccga actgaccagc 1620
          agcctg 1626
           <![CDATA[ <210> 55]]>
           <![CDATA[ <211> 1345]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 55]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa accctacaag tgccccgagt gcggcaaatc cttctctaga agcgacaaac 180
          tgaccgaaca tcagaggacc cacaccggcg agaagcctta taagtgtccc gaatgcggca 240
          aatccttcag caccaagaac tctctgacag aacaccagag aacacatacc ggagagaaac 300
          ccttataaatg ccccgagtgc ggcaagtcct tctcccagtc cggcgatctg aggagacacc 360
          aaagaacaca taccggcgaa aagccttaca agtgccccga gtgtggaaag agcttctcca 420
          ccaccggcgc tctgaccgag caccagagaa cacacaccgg cgagaaaccc tataaatgtc 480
          ccgagtgtgg caaatccttc agcgacagcg gcaatctgag agtgcaccaa agaacccata 540
          ccggcgaaaa accctacaaa tgccccgagt gcggcaaatc cttcagccag agggcccatc 600
          tggagaggca ccaaaggaca cacaccggag aaaagcccta caagtgtccc gagtgtggaa 660
          aaagctttag cacaagcggc gagctggtga ggcatcaaag gacccacacc ggcgaaaagc 720
          ccaccggcaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gacgccaaga 780
          gcctgaccgc ctggagccgg accctggtga ccttcaagga cgtgttcgtg gacttcaccc 840
          gggaggagtg gaagctgctg gacaccgccc agcagatcct gtaccggaac gtgatgctgg 900
          agaactacaa gaacctggtg agcctgggct accagctgac caagcccgac gtgatcctgc 960
          ggctggagaa gggcgaggag ccctggctgg tggagcggga gatccaccag gagacccacc 1020
          ccgacagcga gaccgccttc gagatcaaga gcagcgtgag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1345
           <![CDATA[ <210> 56]]>
           <![CDATA[ <211> 1345]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 56]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa gccctacaag tgccccgagt gcggaaagtc cttcagctcc cccgccgatc 180
          tgacaagaca tcagagaacc cataccggcg agaaacctta caaatgcccc gaatgtggca 240
          agtcctttag cgatcccgga catctggtga ggcaccagag gacacaccc ggcgaaaagc 300
          cctataaatg tcccgagtgt ggaaagagct tttctagaag cgacaatctc gtgagacacc 360
          agagaaccca caccggagag aagccttaca agtgccccga gtgcggcaaa tccttcagcc 420
          agagctcctc tctggtgagg caccaaagga cccacaccgg cgagaaacct tataagtgtc 480
          ccgagtgtgg caaaagcttc agcacctccc actctctgac cgagcatcaa agaacccaca 540
          ccggcgaaaa accttataaa tgccccgagt gtggcaaatc cttcagcaga aatgacgctc 600
          tgacagagca ccaaagaaca cataccggag aaaagcccta caaatgcccc gagtgtggaa 660
          aatccttttc tagaaacgat gctctgaccg aacaccaaag aacacacacc ggcgaaaagc 720
          ctaccggaaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gacgccaaga 780
          gcctgaccgc ctggagccgg accctggtga ccttcaagga cgtgttcgtg gacttcaccc 840
          gggaggagtg gaagctgctg gacaccgccc agcagatcct gtaccggaac gtgatgctgg 900
          agaactacaa gaacctggtg agcctgggct accagctgac caagcccgac gtgatcctgc 960
          ggctggagaa gggcgaggag ccctggctgg tggagcggga gatccaccag gagacccacc 1020
          ccgacagcga gaccgccttc gagatcaaga gcagcgtgag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1345
           <![CDATA[ <210> 57]]>
           <![CDATA[ <211> 1345]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 57]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgaaaa accttacaag tgccccgagt gcggaaagag cttcagcaga agcgacaaac 180
          tggtgaggca tcaaaggaca cataccggag agaagcccta taagtgcccc gaatgtggca 240
          aatccttttc ccagagggct catctggaaa gacaccagag gacccatacc ggcgaaaaac 300
          cctacaaatg tcccgagtgt ggaaagagct tttccgatcc cggccatctg gtcagacatc 360
          agaggacaca taccggcgaa aagccttaca agtgtcccga atgcggaaaa tccttctcca 420
          gaagcgacaa gctggtgagg caccaaagaa cccacaccgg cgaaaaaccc tataaatgcc 480
          ccgagtgcgg caagtccttt agccagctgg cccatctgag agcccaccag agaacacaca 540
          ccggagagaa gccttataag tgtcccgagt gcggaaagtc cttctctaga gccgacaatc 600
          tgaccgaaca tcaaaggaca cacaccggcg agaaacctta taaatgcccc gagtgcggaa 660
          aaagcttttc cgactgcaga gatctggcta gacaccagag aacccacacc ggcgagaaac 720
          ccaccggcaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gacgccaaga 780
          gcctgaccgc ctggagccgg accctggtga ccttcaagga cgtgttcgtg gacttcaccc 840
          gggaggagtg gaagctgctg gacaccgccc agcagatcct gtaccggaac gtgatgctgg 900
          agaactacaa gaacctggtg agcctgggct accagctgac caagcccgac gtgatcctgc 960
          ggctggagaa gggcgaggag ccctggctgg tggagcggga gatccaccag gagacccacc 1020
          ccgacagcga gaccgccttc gagatcaaga gcagcgtgag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1345
           <![CDATA[ <210> 58]]>
           <![CDATA[ <211> 1345]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223]]>> Description of artificial sequences: synthetic polynucleotides]]&gt;
           <br/>
           <br/> &lt;![CDATA[ &lt;400&gt;58]]&gt;
           <br/> <![CDATA[aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgaaaa gccttataaa tgtcccgaat gcggcaagag ctttagccac accggccatc 180
          tgctggaaca ccaaaggacc cataccggcg aaaagcccta taagtgcccc gagtgtggca 240
          agagcttcag caccaccggc aatctgacag tccatcagag gacccacacc ggagagaaac 300
          cctataaatg ccccgagtgt ggaaagtcct tctccgacaa gaaggatctg acaagacacc 360
          agaggaccca taccggcgag aaaccctaca aatgccccga gtgcggcaaa tccttctccc 420
          agagcggcga tctgaggaga catcaaagaa cacataccgg cgaaaaaccc tataagtgcc 480
          ccgaatgcgg caagtccttc agccagaggg cccatctgga aaggcatcag aggacacaca 540
          ccggcgagaa gccttacaaa tgtcccgagt gcggaaagag cttctctaga agcgacaagc 600
          tgaccgagca tcagaggacc cacaccggag aaaaacctta caagtgcccc gagtgcggca 660
          aaagcttcag cagaaccgac acactgagag atcaccaaag gacacacacc ggcgagaaac 720
          ccaccggcaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gacgccaaga 780
          gcctgaccgc ctggagccgg accctggtga ccttcaagga cgtgttcgtg gacttcaccc 840
          gggaggagtg gaagctgctg gacaccgccc agcagatcct gtaccggaac gtgatgctgg 900
          agaactacaa gaacctggtg agcctgggct accagctgac caagcccgac gtgatcctgc 960
          ggctggagaa gggcgaggag ccctggctgg tggagcggga gatccaccag gagacccacc 1020
          ccgacagcga gaccgccttc gagatcaaga gcagcgtgag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1345
           <![CDATA[ <210> 59]]>
           <![CDATA[ <211> 1345]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 59]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa gccttataag tgccccgagt gtggcaagag ctttagccac accggccatc 180
          tgctggagca tcaaaggaca cacaccggag aaaagcccta taagtgcccc gagtgtggca 240
          aatccttcag cacctccggc aatctcaccg aacaccagag aacacacacc ggagaaaaac 300
          cttacaaatg tcccgagtgt ggaaagagct tttccaccag cggcaatctg gtgagacatc 360
          aaagaacaca taccggcgaa aaaccctata aatgccccga gtgtggaaaa tccttctccc 420
          aactggccca tctgagggcc caccagagga cacataccgg agaaaaaccc tacaaatgcc 480
          ccgaatgcgg aaaaagcttc tccgagagaa gccatctgag agagcaccaa aggacccata 540
          ccggagaaaa gccttacaag tgtcccgagt gcggaaaaag ctttagcgat cccggacatc 600
          tggtgagaca tcagagaacc cacaccggcg aaaagcctta taaatgtccc gaatgtggca 660
          agtcctttag cacccatctg gatctgatta gacaccaaag aacccacacc ggcgagaaac 720
          ccaccggaaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gacgccaaga 780
          gcctgaccgc ctggagccgg accctggtga ccttcaagga cgtgttcgtg gacttcaccc 840
          gggaggagtg gaagctgctg gacaccgccc agcagatcct gtaccggaac gtgatgctgg 900
          agaactacaa gaacctggtg agcctgggct accagctgac caagcccgac gtgatcctgc 960
          ggctggagaa gggcgaggag ccctggctgg tggagcggga gatccaccag gagacccacc 1020
          ccgacagcga gaccgccttc gagatcaaga gcagcgtgag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1345
           <![CDATA[ <210> 60]]>
           <![CDATA[ <211> 1345]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 60]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgaaaa gccttacaaa tgtcccgagt gcggaaagtc cttcagcgac cccggcgctc 180
          tggtgagaca tcaaagaaca cataccggcg agaaacctta taaatgcccc gaatgtggaa 240
          aatccttcag cgaaagaagc catctgaggg aacaccagag gacccacacc ggcgaaaaac 300
          cttataagtg ccccgaatgc ggaaaaagct tttctagaag cgatcatctg accaaccatc 360
          agagaacaca caccggcgaa aagccctata aatgtcccga gtgtggcaaa tcctttagcg 420
          agaggtccca tctgagagag caccagagga cacataccgg agagaagccc tacaagtgcc 480
          ccgagtgtgg caagagcttt agcagaagcg accatctgac caatcatcaa aggacccaca 540
          ccggagagaa gccttacaag tgtcccgagt gcggaaagtc cttttccgat cccggccacc 600
          tcgtgaggca ccaaagaacc cataccggcg agaaacccta caaatgcccc gagtgtggaa 660
          agagcttctc cagaagcgac aagctggtga ggcatcagag gacacaccc ggcgaaaaac 720
          ccaccggcaa gaaaaccagc gctagcggca gcggcggcgg cagcggcggc gacgccaaga 780
          gcctgaccgc ctggagccgg accctggtga ccttcaagga cgtgttcgtg gacttcaccc 840
          gggaggagtg gaagctgctg gacaccgccc agcagatcct gtaccggaac gtgatgctgg 900
          agaactacaa gaacctggtg agcctgggct accagctgac caagcccgac gtgatcctgc 960
          ggctggagaa gggcgaggag ccctggctgg tggagcggga gatccaccag gagacccacc 1020
          ccgacagcga gaccgccttc gagatcaaga gcagcgtgag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1345
           <![CDATA[ <210> 61]]>
           <![CDATA[ <211> 2227]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 61]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggagagaa gccctacaaa tgccccgagt gtggaaagag cttctctaga aatgacgctc 180
          tgacagaaca ccagaggacc cataccggcg agaaacctta caaatgcccc gagtgcggaa 240
          aaagctttag cgattgcaga gatctggcta gacatcagag aacacacacc ggcgagaagc 300
          cctataagtg ccccgaatgc ggcaagagct ttagcgaccc cggccatctg gtgagacatc 360
          aaaggacaca taccggagaa aaaccttaca agtgccccga gtgcggaaag tccttctccc 420
          agagcggcca tctcaccgag catcaaagga cccacaccgg cgaaaagcct tataaatgtc 480
          ccgaatgtgg caagtccttc tctagagagg ataatctgca cacccatcag aggacccaca 540
          ccggcgaaaa gccttataaa tgccccgaat gtggaaagtc cttttccacc aagaactctc 600
          tgaccgagca tcagaggaca cacaccggag agaaacccta taaatgtccc gagtgtggca 660
          agagcttcag cagagccgac aatctgacag agcaccaaag aacacatacc ggcgaaaagc 720
          ccaccggcaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc agcggcggca agcggcccgc cgccaccaag aaggccggcc 1980
          aggccaagaa gaagaagggc agctacccct acgacgtgcc cgactacgcc tgagcggccg 2040
          cttaattaag ctgccttctg cggggcttgc cttctggcca tgcccttctt ctctcccttg 2100
          cacctgtacc tcttggtctt tgaataaagc ctgagtagga agtctagaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaa 2227
           <![CDATA[ <210> 62]]>
           <![CDATA[ <211> 2227]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 62]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa accctacaag tgccccgagt gtggcaaatc cttctctaga tccgacaaac 180
          tgaccgaaca tcagaggacc cataccggcg aaaaacctta taaatgtccc gagtgcggaa 240
          agtccttctc tagaagggac gagctgaacg tgcatcagag aacacatacc ggcgagaagc 300
          cctataaatg ccccgaatgc ggcaaaagct tctctagaag cgatcatctg accaaccacc 360
          agagaaccca taccggagaa aagccttaca agtgtcccga atgtggaaaa tccttcagct 420
          cccccgccga tctgaccaga caccaaagga cccacaccgg cgagaagccc tataaatgcc 480
          ccgagtgcgg caagagcttt tccagatccg accatctgac caatcatcaa agaacccaca 540
          ccggcgaaaa gccttataaa tgtcccgagt gcggcaaatc cttttccagc aagaaggctc 600
          tgaccgagca tcaaaggacc cataccggcg agaagcctta caaatgcccc gagtgtggaa 660
          agtcctttag cacccatctg gatctgatta gacaccagag gacacacacc ggagagaaac 720
          ccaccggcaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc agcggcggca agcggcccgc cgccaccaag aaggccggcc 1980
          aggccaagaa gaagaagggc agctacccct acgacgtgcc cgactacgcc tgagcggccg 2040
          cttaattaag ctgccttctg cggggcttgc cttctggcca tgcccttctt ctctcccttg 2100
          cacctgtacc tcttggtctt tgaataaagc ctgagtagga agtctagaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaa 2227
           <![CDATA[ <210> 63]]>
           <![CDATA[ <211> 2227]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 63]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa accttacaaa tgccccgagt gcggcaagag cttcagcaga agcgacgatc 180
          tggtgaggca ccaaagaacc cacaccggcg aaaaacctta caagtgtccc gaatgcggaa 240
          agtccttcag cagagaggac aatctgcaca cccaccagag aacacacacc ggagaaaagc 300
          cttacaagtg ccccgaatgc ggcaaatcct tttctagaag cgatcatctg accacccacc 360
          aaagaacaca taccggcgag aagccttaca aatgtcccga gtgcggaaag tccttctccc 420
          agagagccaa tctgagggct catcaaagga cccataccgg cgaaaagccc tacaaatgcc 480
          ccgagtgcgg aaaatccttc agccagctgg cccatctgag agcccaccaa aggacacaca 540
          ccggagagaa accctataag tgccccgagt gtggaaaaag cttttcccag agggccaatc 600
          tgagggccca tcagaggacc cataccggag agaagcctta taaatgtccc gagtgcggaa 660
          aaagcttcag cgagaggagc catctgaggg aacatcaaag aacccacacc ggcgaaaaac 720
          ccaccggaaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc agcggcggca agcggcccgc cgccaccaag aaggccggcc 1980
          aggccaagaa gaagaagggc agctacccct acgacgtgcc cgactacgcc tgagcggccg 2040
          cttaattaag ctgccttctg cggggcttgc cttctggcca tgcccttctt ctctcccttg 2100
          cacctgtacc tcttggtctt tgaataaagc ctgagtagga agtctagaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaa 2227
           <![CDATA[ <210> 64]]>
           <![CDATA[ <211> 2080]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 64]]>
          agtgtggaaa aagctttagc caaagcggcg atctgaggag acaccaaaga acacacaccg 60
          gcgagaagcc ctacaaatgt cccgagtgcg gaaagagctt cagccagagc ggccatctga 120
          ccgagcatca gagaacccat accggcgaaa aaccttataa gtgccccgag tgtggaaagt 180
          ccttctccga gagatcccat ctgagagaac accagaggac acacaccggc gaaaaacctt 240
          ataagtgtcc cgagtgcgga aagtccttca gcgatcccgg ccatctggtg agacatcaaa 300
          ggacacatac cggcgaaaaa ccttataagt gtcccgaatg cggcaagagc tttagcagaa 360
          acgacacact caccgaacac cagaggaccc acaccggcga gaaaccctac aaatgccccg 420
          agtgcggcaa atccttttct agagccgaca atctgaccga acaccagagg acccataccg 480
          gagaaaagcc ttacaaatgt cccgagtgtg gcaaatcctt ctccacccat ctggatctga 540
          ttagacacca aagaacacat accggagaaa agcccaccgg aaaaaagacc agcgctagcg 600
          gcagcggcgg cggcagcggc ggcgcccggg acaagcaaggt ggagaacaag accaagaagc 660
          tgcgggtgtt cgaggccttc gccggcatcg gcgcccagcg gaaggccctg gagaaggtgc 720
          ggaaggacga gtacgagatc gtgggcctgg ccgagtggta cgtgcccgcc atcgtgatgt 780
          accaggccat ccacaacaac ttccacacca agctggagta caagagcgtg agccgggagg 840
          agatgatcga ctacctggag aacaagaccc tgagctggaa cagcaagaac cccgtgagca 900
          acggctactg gaagcggaag aaggacgacg agctgaagat catctacaac gccatcaagc 960
          tgagcgagaa ggagggcaac atcttcgaca tccgggacct gtacaagcgg accctgaaga 1020
          acatcgacct gctgacctac agcttcccct gccaggacct gagccagcag ggcatccaga 1080
          agggcatgaa gcggggcagc ggcacccgga gcggcctgct gtgggagatc gagcgggccc 1140
          tggacagcac cgagaagaac gacctgccca agtacctgct gatggagaac gtgggcgccc 1200
          tgctgcacaa gaagaacgag gaggagctga accagtggaa gcagaagctg gagagcctgg 1260
          gctaccagaa cagcatcgag gtgctgaacg ccgccgactt cggcagcagc caggcccggc 1320
          ggcgggtgtt catgatcagc accctgaacg agttcgtgga gctgcccaag ggcgacaaga 1380
          agcccaagag catcaagaag gtgctgaaca agatcgtgag cgagaaggac atcctgaaca 1440
          acctgctgaa gtacaacctg accgagttca agaaaaccaa gagcaacatc aacaaggcca 1500
          gcctgatcgg ctacagcaag ttcaacagcg agggctacgt gtacgacccc gagttcaccg 1560
          gccccaccct gaccgccagc ggcgccaaca gccggatcaa gatcaaggac ggcagcaaca 1620
          tccggaagat gaacagcgac gagaccttcc tgtacatcgg cttcgacagc caggacggca 1680
          agcgggtgaa cgagatcgag ttcctgaccg agaaccagaa gatcttcgtg tgcggcaaca 1740
          gcatcagcgt ggaggtgctg gaggccatca tcgacaagat cggcggcccc agcagcggcg 1800
          gcaagcggcc cgccgccacc aagaaggccg gccaggccaa gaagaagaag ggcagctacc 1860
          cctacgacgt gcccgactac gcctgagcgg ccgcttaatt aagctgcctt ctgcggggct 1920
          tgccttctgg ccatgccctt cttctctccc ttgcacctgt acctcttggt ctttgaataa 1980
          agcctgagta ggaagtctag aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2040
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2080
           <![CDATA[ <210> 65]]>
           <![CDATA[ <211> 1929]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 65]]>
          gccttataag tgccccgagt gtggcaaatc cttttccgac tgtagagatc tggccagaca 60
          tcaaagaacc cacaccggag agaaacctta taaatgcccc gagtgcggca agtcctttag 120
          ccataccggc catctgctgg agcaccagag gacccatacc ggcgagaagc cttacaaatg 180
          ccccgagtgc ggcaaaagct tcagcagaaa tgacgctctg accgagcatc aaaggaccca 240
          taccggcgaa aagccctaca agtgtcccga gtgtggaaag tccttctccc agagcggcga 300
          tctgaggaga caccagagaa cacacaccgg cgagaaaccc tataaatgtc ccgagtgcgg 360
          aaagagcttt agcgacagcg gcaatctgag ggtgcatcaa agaacacaca ccggcgaaaa 420
          accacccgga aaaaagacaa gcgctagcgg cagcggcggc ggcagcggcg gcgcccggga 480
          cagcaaggtg gagaacaaga ccaagaagct gcgggtgttc gaggccttcg ccggcatcgg 540
          cgcccagcgg aaggccctgg agaaggtgcg gaaggacgag tacgagatcg tgggcctggc 600
          cgagtggtac gtgcccgcca tcgtgatgta ccaggccatc cacaacaact tccacaccaa 660
          gctggagtac aagagcgtga gccgggagga gatgatcgac tacctggaga acaagaccct 720
          gagctggaac agcaagaacc ccgtgagcaa cggctactgg aagcggaaga aggacgacga 780
          gctgaagatc atctacaacg ccatcaagct gagcgagaag gagggcaaca tcttcgacat 840
          ccgggacctg tacaagcgga ccctgaagaa catcgacctg ctgacctaca gcttcccctg 900
          ccaggacctg agccagcagg gcatccagaa gggcatgaag cggggcagcg gcacccggag 960
          cggcctgctg tgggagatcg agcgggccct ggacagcacc gagaagaacg acctgcccaa 1020
          gtacctgctg atggagaacg tgggcgccct gctgcacaag aagaacgagg aggagctgaa 1080
          ccagtggaag cagaagctgg agagcctggg ctaccagaac agcatcgagg tgctgaacgc 1140
          cgccgacttc ggcagcagcc aggcccggcg gcgggtgttc atgatcagca ccctgaacga 1200
          gttcgtggag ctgcccaagg gcgacaagaa gcccaagagc atcaagaagg tgctgaacaa 1260
          gatcgtgagc gagaaggaca tcctgaacaa cctgctgaag tacaacctga ccgagttcaa 1320
          gaaaaccaag agcaacatca acaaggccag cctgatcggc tacagcaagt tcaacagcga 1380
          gggctacgtg tacgaccccg agttcaccgg ccccaccctg accgccagcg gcgccaacag 1440
          ccggatcaag atcaaggacg gcagcaacat ccggaagatg aacagcgacg agaccttcct 1500
          gtacatcggc ttcgacagcc aggacggcaa gcgggtgaac gagatcgagt tcctgaccga 1560
          gaaccagaag atcttcgtgt gcggcaacag catcagcgtg gaggtgctgg aggccatcat 1620
          cgacaagatc ggcggcccca gcagcggcgg caagcggccc gccgccacca agaaggccgg 1680
          ccaggccaag aagaagaagg gcagctaccc ctacgacgtg cccgactacg cctgagcggc 1740
          cgcttaatta agctgccttc tgcggggctt gccttctggc catgcccttc ttctctccct 1800
          tgcacctgta cctcttggtc tttgaataaa gcctgagtag gaagtctaga aaaaaaaaaa 1860
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1920
          aaaaaaaaa 1929
           <![CDATA[ <210> 66]]>
           <![CDATA[ <211> 1779]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 66]]>
          gacccatacc ggcgaaaagc cttacaagtg tcccgagtgc ggaaagtcct tctctagatc 60
          cgacaacctc gtgaggcacc agagaaccca caccggcgag aaaccttaca aatgtcccga 120
          gtgtggcaaa agcttttcta gaagcgacga gctggtgaga catcaaagaa cccataccgg 180
          cgaaaaacct tataagtgtc ccgagtgcgg caaatccttt agccagctgg cccatctgag 240
          ggcccaccag agaacacata ccggcgaaaa accccaccggc aaaaagacaa gcgctagcgg 300
          cagcggcggc ggcagcggcg gcgcccggga cagcaaggtg gagaacaaga ccaagaagct 360
          gcgggtgttc gaggccttcg ccggcatcgg cgcccagcgg aaggccctgg agaaggtgcg 420
          gaaggacgag tacgagatcg tgggcctggc cgagtggtac gtgcccgcca tcgtgatgta 480
          ccaggccatc cacaacaact tccacaccaa gctggagtac aagagcgtga gccgggagga 540
          gatgatcgac tacctggaga acaagaccct gagctggaac agcaagaacc ccgtgagcaa 600
          cggctactgg aagcggaaga aggacgacga gctgaagatc atctacaacg ccatcaagct 660
          gagcgagaag gagggcaaca tcttcgacat ccgggacctg tacaagcgga ccctgaagaa 720
          catcgacctg ctgacctaca gcttcccctg ccaggacctg agccagcagg gcatccagaa 780
          gggcatgaag cggggcagcg gcacccggag cggcctgctg tgggagatcg agcgggccct 840
          ggacagcacc gagaagaacg acctgcccaa gtacctgctg atggagaacg tgggcgccct 900
          gctgcacaag aagaacgagg aggagctgaa ccagtggaag cagaagctgg agagcctggg 960
          ctaccagaac agcatcgagg tgctgaacgc cgccgacttc ggcagcagcc aggcccggcg 1020
          gcgggtgttc atgatcagca ccctgaacga gttcgtggag ctgcccaagg gcgacaagaa 1080
          gcccaagagc atcaagaagg tgctgaacaa gatcgtgagc gagaaggaca tcctgaacaa 1140
          cctgctgaag tacaacctga ccgagttcaa gaaaaccaag agcaacatca acaaggccag 1200
          cctgatcggc tacagcaagt tcaacagcga gggctacgtg tacgaccccg agttcaccgg 1260
          ccccaccctg accgccagcg gcgccaacag ccggatcaag atcaaggacg gcagcaacat 1320
          ccggaagatg aacagcgacg agaccttcct gtacatcggc ttcgacagcc aggacggcaa 1380
          gcgggtgaac gagatcgagt tcctgaccga gaaccagaag atcttcgtgt gcggcaacag 1440
          catcagcgtg gaggtgctgg aggccatcat cgacaagatc ggcggcccca gcagcggcgg 1500
          caagcggccc gccgccacca agaaggccgg ccaggccaag aagaagaagg gcagctaccc 1560
          ctacgacgtg cccgactacg cctgagcggc cgcttaatta agctgccttc tgcggggctt 1620
          gccttctggc catgcccttc ttctctccct tgcacctgta cctcttggtc tttgaataaa 1680
          gcctgagtag gaagtctaga aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1740
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1779
           <![CDATA[ <210> 67]]>
           <![CDATA[ <211> 4829]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 67]]>
          aaggaaataa gagagaaaag aagagtaaga agaaatataa gagccaccat ggcccccaag 60
          aagaagcgga aggtgggcat ccacggcgtg cccgccgccg acaagaagta cagcatcggc 120
          ctggccatcg gcaccaacag cgtgggctgg gccgtgatca ccgacgagta caaggtgccc 180
          agcaagaagt tcaaggtgct gggcaacacc gaccggcaca gcatcaagaa gaacctgatc 240
          ggcgccctgc tgttcgacag cggcgagacc gccgaggcca cccggctgaa gcggaccgcc 300
          cggcggcggt acacccggcg gaagaaccgg atctgctacc tgcaggagat cttcagcaac 360
          gagatggcca aggtggacga cagcttcttc caccggctgg aggagagctt cctggtggag 420
          gaggacaaga agcacgagcg gcacccccatc ttcggcaaca tcgtggacga ggtggcctac 480
          cacgagaagt accccaccat ctaccacctg cggaagaagc tggtggacag caccgacaag 540
          gccgacctgc ggctgatcta cctggccctg gcccacatga tcaagttccg gggccacttc 600
          ctgatcgagg gcgacctgaa ccccgacaac agcgacgtgg acaagctgtt catccagctg 660
          gtgcagacct acaaccagct gttcgaggag aaccccatca acgccagcgg cgtggacgcc 720
          aaggccatcc tgagcgcccg gctgagcaag agccggcggc tggagaacct gatcgcccag 780
          ctgcccggcg agaagaagaa cggcctgttc ggcaacctga tcgccctgag cctgggcctg 840
          accccccaact tcaagagcaa cttcgacctg gccgaggacg ccaagctgca gctgagcaag 900
          gacacctacg acgacgacct ggacaacctg ctggcccaga tcggcgacca gtacgccgac 960
          ctgttcctgg ccgccaagaa cctgagcgac gccatcctgc tgagcgacat cctgcgggtg 1020
          aacaccgaga tcaccaaggc ccccctgagc gccagcatga tcaagcggta cgacgagcac 1080
          caccaggacc tgaccctgct gaaggccctg gtgcggcagc agctgcccga gaagtacaag 1140
          gagatcttct tcgaccagag caagaacggc tacgccggct acatcgacgg cggcgccagc 1200
          caggagggagt tctacaagtt catcaagccc atcctggaga agatggacgg caccgaggag 1260
          ctgctggtga agctgaaccg ggaggacctg ctgcggaagc agcggacctt cgacaacggc 1320
          agcatccccc accagatcca cctgggcgag ctgcacgcca tcctgcggcg gcaggaggac 1380
          ttctacccct tcctgaagga caaccgggag aagatcgaga agatcctgac cttccggatc 1440
          ccctactacg tgggccccct ggcccggggc aacagccggt tcgcctggat gacccggaaa 1500
          tccgaggaga ccatcacccc ctggaacttc gaggaggtgg tggacaaggg cgccagcgcc 1560
          cagagcttca tcgagcggat gaccaacttc gacaagaacc tgcccaacga gaaggtgctg 1620
          cccaagcaca gcctgctgta cgagtacttc accgtgtaca acgagctgac caaggtgaag 1680
          tacgtgaccg agggcatgcg gaagcccgcc ttcctgagcg gcgagcagaa gaaggccatc 1740
          gtggacctgc tgttcaagac caaccggaag gtgaccgtga agcagctgaa ggaggactac 1800
          ttcaagaagaga tcgagtgctt cgacagcgtg gagatcagcg gcgtggagga ccggttcaac 1860
          gccagcctgg gcacctacca cgacctgctg aagatcatca aggacaagga cttcctggac 1920
          aacgaggaga acgaggacat cctggaggac atcgtgctga ccctgaccct gttcgaggac 1980
          cgggagatga tcgaggagcg gctgaaaacc tacgcccacc tgttcgacga caaggtgatg 2040
          aagcagctga agcggcggcg gtacaccggc tggggccggc tgagccggaa gctgatcaac 2100
          ggcatccggg acaagcagag cggcaagacc atcctggact tcctgaaatc cgacggcttc 2160
          gccaaccgga acttcatgca gctgatccac gacgacagcc tgaccttcaa ggaggacatc 2220
          cagaaggccc aggtgagcgg ccagggcgac agcctgcacg agcacatcgc caacctggcc 2280
          ggcagccccg ccatcaagaa gggcatcctg cagaccgtga aggtggtgga cgagctggtg 2340
          aaggtgatgg gccggcacaa gcccgagaac atcgtgatcg agatggcccg ggagaaccag 2400
          accacccaga agggccagaa gaacagccgg gagcggatga agcggatcga ggagggcatc 2460
          aaggagctgg gcagccagat cctgaaggag caccccgtgg agaacaccca gctgcagaac 2520
          gagaagctgt acctgtacta cctgcagaac ggccgggaca tgtacgtgga ccaggagctg 2580
          gacatcaacc ggctgagcga ctacgacgtg gccgccatcg tgccccagag cttcctgaag 2640
          gacgacagca tcgacaacaa ggtgctgacc cggagcgaca aggcccgggg caagagcgac 2700
          aacgtgccca gcgaggaggt ggtgaagaag atgaagaact actggcggca gctgctgaac 2760
          gccaagctga tcacccagcg gaagttcgac aacctgacca aggccgagcg gggcggcctg 2820
          agcgagctgg acaaggccgg cttcatcaag cggcagctgg tggagacccg gcagatcacc 2880
          aagcacgtgg cccagatcct ggacagccgg atgaacacca agtacgacga gaacgacaag 2940
          ctgatccggg aggtgaaggt gatcaccctg aaatccaagc tggtgagcga cttccggaag 3000
          gacttccagt tctacaaggt gcgggagatc aacaactacc accacgccca cgacgcctac 3060
          ctgaacgccg tggtgggcac cgccctgatc aagaagtacc ccaagctgga gagcgagttc 3120
          gtgtacggcg actacaaggt gtacgacgtg cggaagatga tcgccaagag cgagcaggag 3180
          atcggcaagg ccaccgccaa gtacttcttc tacagcaaca tcatgaactt cttcaagacc 3240
          gagatcaccc tggccaacgg cgagatccgg aagcggcccc tgatcgagac caacggcgag 3300
          accggcgaga tcgtgtggga caagggccgg gacttcgcca ccgtgcggaa ggtgctgagc 3360
          atgccccagg tgaacatcgt gaagaaaacc gaggtgcaga ccggcggctt cagcaaggag 3420
          agcatcctgc ccaagcggaa cagcgacaag ctgatcgccc ggaagaagga ctgggacccc 3480
          aagaagtacg gcggcttcga cagccccacc gtggcctaca gcgtgctggt ggtggccaag 3540
          gtggagaagg gcaagagcaa gaagctgaaa tccgtgaagg agctgctggg catcaccatc 3600
          atggagcgga gcagcttcga gaagaacccc atcgacttcc tggaggccaa gggctacaag 3660
          gaggtgaaga aggacctgat catcaagctg cccaagtaca gcctgttcga gctggagaac 3720
          ggccggaagc ggatgctggc cagcgccggc gagctgcaga agggcaacga gctggccctg 3780
          cccagcaagt acgtgaactt cctgtacctg gccagccact acgagaagct gaagggcagc 3840
          cccgaggaca acgagcagaa gcagctgttc gtggagcagc acaagcacta cctggacgag 3900
          atcatcgagc agatcagcga gttcagcaag cgggtgatcc tggccgacgc caacctggac 3960
          aaggtgctga gcgcctacaa caagcaccgg gacaagccca tccgggagca ggccgagaac 4020
          atcatccacc tgttcaccct gaccaacctg ggcgcccccg ccgccttcaa gtacttcgac 4080
          accaccatcg accggaagcg gtacaccagc accaaggagg tgctggacgc caccctgatc 4140
          caccagagca tcaccggcct gtacgagacc cggatcgacc tgagccagct gggcggcgac 4200
          aagcggcccg ccgccaccaa gaaggccggc caggccaaga agaagaaggc cagcgacgcc 4260
          aagagcctga ccgcctggag ccggaccctg gtgaccttca aggacgtgtt cgtggacttc 4320
          acccgggagg agtggaagct gctggacacc gcccagcaga tcctgtaccg gaacgtgatg 4380
          ctggagaact acaagaacct ggtgagcctg ggctaccagc tgaccaagcc cgacgtgatc 4440
          ctgcggctgg agaagggcga ggagccctgg ctggtggagc gggagatcca ccaggagacc 4500
          caccccgaca gcgagaccgc cttcgagatc aagagcagcg tgagcggcgg caagcggccc 4560
          gccgccacca agaaggccgg ccaggccaag aagaagaagg gcagctaccc ctacgacgtg 4620
          cccgactacg cctgagcggc cgcttaatta agctgccttc tgcggggctt gccttctggc 4680
          catgcccttc ttctctccct tgcacctgta cctcttggtc tttgaataaa gcctgagtag 4740
          gaagtctaga aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 4800
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaa 4829
           <![CDATA[ <210> 68]]>
           <![CDATA[ <211> 2591]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 68]]>
          gagttcgtgt acggcgacta caaggtgtac gacgtgcgga agatgatcgc caagagcgag 60
          caggagatcg gcaaggccac cgccaagtac ttcttctaca gcaacatcat gaacttcttc 120
          aagaccgaga tcaccctggc caacggcgag atccggaagc ggcccctgat cgagaccaac 180
          ggcgagaccg gcgagatcgt gtgggacaag ggccgggact tcgccaccgt gcggaaggtg 240
          ctgagcatgc cccaggtgaa catcgtgaag aaaaccgagg tgcagaccgg cggcttcagc 300
          aaggagagca tcctgcccaa gcggaacagc gacaagctga tcgcccggaa gaaggactgg 360
          gaccccaaga agtacggcgg cttcgacagc cccaccgtgg cctacagcgt gctggtggtg 420
          gccaaggtgg agaagggcaa gagcaagaag ctgaaatccg tgaaggagct gctgggcatc 480
          accatcatgg agcggagcag cttcgagaag aaccccatcg acttcctgga ggccaagggc 540
          tacaaggagg tgaagaagga cctgatcatc aagctgccca agtacagcct gttcgagctg 600
          gagaacggcc ggaagcggat gctggccagc gccggcgagc tgcagaaggg caacgagctg 660
          gccctgccca gcaagtacgt gaacttcctg tacctggcca gccactacga gaagctgaag 720
          ggcagccccg aggacaacga gcagaagcag ctgttcgtgg agcagcacaa gcactacctg 780
          gacgagatca tcgagcagat cagcgagttc agcaagcggg tgatcctggc cgacgccaac 840
          ctggacaagg tgctgagcgc ctacaacaag caccgggaca agcccatccg ggagcaggcc 900
          gagaacatca tccacctgtt caccctgacc aacctgggcg cccccgccgc cttcaagtac 960
          ttcgacacca ccatcgaccg gaagcggtac accagcacca aggaggtgct ggacgccacc 1020
          ctgatccacc agagcatcac cggcctgtac gagacccgga tcgacctgag ccagctgggc 1080
          ggcgacaagc ggcccgccgc caccaagaag gccggccagg ccaagaagaa gaaggcccgg 1140
          gacagcaagg tggagaacaa gaccaagaag ctgcgggtgt tcgaggcctt cgccggcatc 1200
          ggcgcccagc ggaaggccct ggagaaggtg cggaaggacg agtacgagat cgtgggcctg 1260
          gccgagtggt acgtgcccgc catcgtgatg taccaggcca tccacaacaa cttccacacc 1320
          aagctggagt acaagagcgt gagccggggag gagatgatcg actacctgga gaacaagacc 1380
          ctgagctgga acagcaagaa ccccgtgagc aacggctact ggaagcggaa gaaggacgac 1440
          gagctgaaga tcatctacaa cgccatcaag ctgagcgaga aggagggcaa catcttcgac 1500
          atccgggacc tgtacaagcg gaccctgaag aacatcgacc tgctgaccta cagcttcccc 1560
          tgccaggacc tgagccagca gggcatccag aagggcatga agcggggcag cggcacccgg 1620
          agcggcctgc tgtggggagat cgagcggggcc ctggacagca ccgagaagaa cgacctgccc 1680
          aagtacctgc tgatggagaa cgtgggcgcc ctgctgcaca agaagaacga ggaggagctg 1740
          aaccagtgga agcagaagct ggagagcctg ggctaccaga acagcatcga ggtgctgaac 1800
          gccgccgact tcggcagcag ccaggcccgg cggcgggtgttcatgatcag caccctgaac 1860
          gagttcgtgg agctgcccaa gggcgacaag aagcccaaga gcatcaagaa ggtgctgaac 1920
          aagatcgtga gcgagaagga catcctgaac aacctgctga agtacaacct gaccgagttc 1980
          aagaaaacca agagcaacat caacaaggcc agcctgatcg gctacagcaa gttcaacagc 2040
          gagggctacg tgtacgaccc cgagttcacc ggccccaccc tgaccgccag cggcgccaac 2100
          agccggatca agatcaagga cggcagcaac atccggaaga tgaacagcga cgagaccttc 2160
          ctgtacatcg gcttcgacag ccaggacggc aagcgggtga acgagatcga gttcctgacc 2220
          gagaaccaga agatcttcgt gtgcggcaac agcatcagcg tggaggtgct ggaggccatc 2280
          atcgacaaga tcggcggccc cagcagcggc ggcaagcggc ccgccgccac caagaaggcc 2340
          ggccaggcca agaagaagaa gggcagctac ccctacgacg tgcccgacta cgcctgagcg 2400
          gccgcttaat taagctgcct tctgcggggc ttgccttctg gccatgccct tcttctctcc 2460
          cttgcacctg tacctcttgg tctttgaata aagcctgagt aggaagtcta gaaaaaaaaa 2520
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2580
          aaaaaaaaaa a 2591
           <![CDATA[ <210> 69]]>
           <![CDATA[ <211> 6010]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 69]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccga caagaagtac agcatcggcc 120
          tggccatcgg caccaacagc gtgggctggg ccgtgatcac cgacgagtac aaggtgccca 180
          gcaagaagtt caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg 240
          gcgccctgct gttcgacagc ggcgagaccg ccgaggccac ccggctgaag cggaccgccc 300
          ggcggcggta cacccggcgg aagaaccgga tctgctacct gcaggagatc ttcagcaacg 360
          agatggccaa ggtggacgac agcttcttcc accggctgga ggagagcttc ctggtggagg 420
          aggacaagaa gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc 480
          acgagaagta ccccaccatc taccacctgc ggaagaagct ggtggacagc accgacaagg 540
          ccgacctgcg gctgatctac ctggccctgg cccacatgat caagttccgg ggccacttcc 600
          tgatcgaggg cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg 660
          tgcagaccta caaccagctg ttcgaggaga accccatcaa cgccagcggc gtggacgcca 720
          aggccatcct gagcgcccgg ctgagcaaga gccggcggct ggagaacctg atcgcccagc 780
          tgcccggcga gaagaagaac ggcctgttcg gcaacctgat cgccctgagc ctgggcctga 840
          cccccaactt caagagcaac ttcgacctgg ccgaggacgc caagctgcag ctgagcaagg 900
          acacctacga cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc 960
          tgttcctggc cgccaagaac ctgagcgacg ccatcctgct gagcgacatc ctgcgggtga 1020
          acaccgagat caccaaggcc cccctgagcg ccagcatgat caagcggtac gacgagcacc 1080
          accaggacct gaccctgctg aaggccctgg tgcggcagca gctgcccgag aagtacaagg 1140
          agatcttctt cgaccagagc aagaacggct acgccggcta catcgacggc ggcgccagcc 1200
          aggagggagtt ctacaagttc atcaagccca tcctggagaa gatggacggc accgaggagc 1260
          tgctggtgaa gctgaaccgg gaggacctgc tgcggaagca gcggaccttc gacaacggca 1320
          gcatccccca ccagatccac ctgggcgagc tgcacgccat cctgcggcgg caggaggact 1380
          tctacccctt cctgaaggac aaccgggaga agatcgagaa gatcctgacc ttccggatcc 1440
          cctactacgt gggccccctg gcccggggca acagccggtt cgcctggatg acccggaaat 1500
          ccgaggagac catcacccccc tggaacttcg aggaggtggt ggacaagggc gccagcgccc 1560
          agagcttcat cgagcggatg accaacttcg acaagaacct gcccaacgag aaggtgctgc 1620
          ccaagcacag cctgctgtac gagtacttca ccgtgtacaa cgagctgacc aaggtgaagt 1680
          acgtgaccga gggcatgcgg aagcccgcct tcctgagcgg cgagcagaag aaggccatcg 1740
          tggacctgct gttcaagacc aaccggaagg tgaccgtgaa gcagctgaag gaggactact 1800
          tcaagaagat cgagtgcttc gacagcgtgg agatcagcgg cgtggaggac cggttcaacg 1860
          ccagcctggg cacctaccac gacctgctga agatcatcaa ggacaaggac ttcctggaca 1920
          acgaggagaa cgaggacatc ctggaggaca tcgtgctgac cctgaccctg ttcgaggacc 1980
          gggagatgat cgaggagcgg ctgaaaacct acgcccacct gttcgacgac aaggtgatga 2040
          agcagctgaa gcggcggcgg tacaccggct ggggccggct gagccggaag ctgatcaacg 2100
          gcatccggga caagcagagc ggcaagacca tcctggactt cctgaaatcc gacggcttcg 2160
          ccaaccggaa cttcatgcag ctgatccacg acgacagcct gaccttcaag gaggacatcc 2220
          agaaggccca ggtgagcggc cagggcgaca gcctgcacga gcacatcgcc aacctggccg 2280
          gcagccccgc catcaagaag ggcatcctgc agaccgtgaa ggtggtggac gagctggtga 2340
          aggtgatggg ccggcacaag cccgagaaca tcgtgatcga gatggcccgg gagaaccaga 2400
          ccacccagaa gggccagaag aacagccggg agcggatgaa gcggatcgag gagggcatca 2460
          aggagctggg cagccagatc ctgaaggagc accccgtgga gaacacccag ctgcagaacg 2520
          agaagctgta cctgtactac ctgcagaacg gccgggacat gtacgtggac caggagctgg 2580
          acatcaaccg gctgagcgac tacgacgtgg ccgccatcgt gccccagagc ttcctgaagg 2640
          acgacagcat cgacaacaag gtgctgaccc ggagcgacaa ggcccggggc aagagcgaca 2700
          acgtgcccag cgaggaggtg gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg 2760
          ccaagctgat cacccagcgg aagttcgaca acctgaccaa ggccgagcgg ggcggcctga 2820
          gcgagctgga caaggccggc ttcatcaagc ggcagctggt ggagacccgg cagatcacca 2880
          agcacgtggc ccagatcctg gacagccgga tgaacaccaa gtacgacgag aacgacaagc 2940
          tgatccggga ggtgaaggtg atcaccctga aatccaagct ggtgagcgac ttccggaagg 3000
          acttccagtt ctacaaggtg cgggagatca acaactacca ccacgcccac gacgcctacc 3060
          tgaacgccgt ggtgggcacc gccctgatca agaagtaccc caagctggag agcgagttcg 3120
          tgtacggcga ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaga 3180
          tcggcaaggc caccgccaag tacttcttct acagcaacat catgaacttc ttcaagaccg 3240
          agatcaccct ggccaacggc gagatccgga agcggcccct gatcgagacc aacggcgaga 3300
          ccggcgagat cgtgtgggac aagggccggg acttcgccac cgtgcggaag gtgctgagca 3360
          tgccccaggt gaacatcgtg aagaaaaccg aggtgcagac cggcggcttc agcaaggaga 3420
          gcatcctgcc caagcggaac agcgacaagc tgatcgcccg gaagaaggac tgggacccca 3480
          agaagtacgg cggcttcgac agccccaccg tggcctacag cgtgctggtg gtggccaagg 3540
          tggagaaggg caagagcaag aagctgaaat ccgtgaagga gctgctgggc atcaccatca 3600
          tggagcggag cagcttcgag aagaacccca tcgacttcct ggaggccaag ggctacaagg 3660
          aggtgaagaa ggacctgatc atcaagctgc ccaagtacag cctgttcgag ctggagaacg 3720
          gccggaagcg gatgctggcc agcgccggcg agctgcagaa gggcaacgag ctggccctgc 3780
          ccagcaagta cgtgaacttc ctgtacctgg ccagccacta cgagaagctg aagggcagcc 3840
          ccgaggacaa cgagcagaag cagctgttcg tggagcagca caagcactac ctggacgaga 3900
          tcatcgagca gatcagcgag ttcagcaagc gggtgatcct ggccgacgcc aacctggaca 3960
          aggtgctgag cgcctacaac aagcaccggg acaagcccat ccgggagcag gccgagaaca 4020
          tcatccacct gttcaccctg accaacctgg gcgcccccgc cgccttcaag tacttcgaca 4080
          ccaccatcga ccggaagcgg tacaccagca ccaaggaggt gctggacgcc accctgatcc 4140
          accagagcat caccggcctg tacgagaccc ggatcgacct gagccagctg ggcggcgaca 4200
          gcggcggcaa gcggcccgcc gccaccaaga aggccggcca ggccaagaag aagaagtcgg 4260
          gcgggggtgg ctcagtggat ctgaggacac tcgacgtgtt tagcggatgc ggcggactct 4320
          ccgaaggctt ccaccaagcc ggaatttccg acacactctg ggccatgag atgtgggacc 4380
          ccgccgctca agccttcaga ctgaataatc ccggctccac cgtgttcacc gaggactgca 4440
          acattctgct gaagctggtg atggctggcg aaaccaccaa ctctagaggc cagaggctgc 4500
          cccagaaggg agatgtggaa atgctctgtg gaggccctcc ttgccaaggc ttctccggca 4560
          tgaacaggtt caactctaga acatacagca agttcaagaa ctctctggtc gtgagctttc 4620
          tgagctactg cgactactat agacctagt tctttctgct ggagaacgtg agaaatttcg 4680
          tgtccttcaa gaggagcatg gtgctgaagc tgacactgag gtgtctggtg aggatgggct 4740
          accagtgcac attcggagtg ctgcaagctg gccagtacgg cgtggcccag accagaagga 4800
          gggccatcat tctggctgct gcccccggcg agaaactccc tctgttcccc gagcccctcc 4860
          acgtgttcgc ccctagagct tgccagctga gcgtggtggt cgacgataag aagttcgtga 4920
          gcaacatcac aaggctgtcc agcggaccct tcagaaccat taccgtgagg gataccatgt 4980
          ccgacctccc cgaggtgagg aatggcgcca gcgctctgga gatttcctac aacggcgaac 5040
          ctcagagctg gttccaaagg cagctgagag gcgctcagta tcagcccatt ctgagggacc 5100
          acatctgcaa agatatgagc gctctggtgg ccgctagaat gagacatatt cctctggccc 5160
          ccggcagcga ctggagagat ctgcccaata ttgaggtgag actcagcgac ggaacaatgg 5220
          ctagaaaact gaggtacacc catcatgata gaaagaacgg aaggagcagc agcggcgctc 5280
          tgagaggagt gtgtagctgc gtggaagctg gcaaggcttg cgatcccgcc gctaggcagt 5340
          tcaataccct catcccttgg tgtctgcctc acaccggcaa cagacacaat cattgggctg 5400
          gactgtatgg aaggctcgaa tgggacggct ttttcagcac caccgtgacc aatcccgaac 5460
          ctatgggcaa gcaaggaagg gtgctccacc ccgagcagca tagagtcgtg tccgtgagag 5520
          aatgcgctag aagccaaggc ttccccgaca cctatagact gttcggcaac attctggata 5580
          agcacagaca agtgggaaat gctgtccctc ctcctctggc caaggctatc ggactggaga 5640
          tcaagctgtg tatgctcgcc aaagctaggg agagcgcttc cgccaagatt aaggaggagg 5700
          aggccgccaa ggacggaggt ggcggatcgg gaaagcggcc cgccgccacc aagaaggccg 5760
          gtcaggccaa gaagaagaag ggcagctacc cctacgacgt gcccgactac gcctgagcgg 5820
          ccgcttaatt aagctgcctt ctgcggggct tgccttctgg ccatgccctt cttctctccc 5880
          ttgcacctgt acctcttggt ctttgaataa agcctgagta ggaagtctag aaaaaaaaaa 5940
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 6000
          aaaaaaaaaa 6010
           <![CDATA[ <210> 70]]>
           <![CDATA[ <211> 6202]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 70]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccga caagaagtac agcatcggcc 120
          tggccatcgg caccaacagc gtgggctggg ccgtgatcac cgacgagtac aaggtgccca 180
          gcaagaagtt caaggtgctg ggcaacaccg accggcacag catcaagaag aacctgatcg 240
          gcgccctgct gttcgacagc ggcgagaccg ccgaggccac ccggctgaag cggaccgccc 300
          ggcggcggta cacccggcgg aagaaccgga tctgctacct gcaggagatc ttcagcaacg 360
          agatggccaa ggtggacgac agcttcttcc accggctgga ggagagcttc ctggtggagg 420
          aggacaagaa gcacgagcgg caccccatct tcggcaacat cgtggacgag gtggcctacc 480
          acgagaagta ccccaccatc taccacctgc ggaagaagct ggtggacagc accgacaagg 540
          ccgacctgcg gctgatctac ctggccctgg cccacatgat caagttccgg ggccacttcc 600
          tgatcgaggg cgacctgaac cccgacaaca gcgacgtgga caagctgttc atccagctgg 660
          tgcagaccta caaccagctg ttcgaggaga accccatcaa cgccagcggc gtggacgcca 720
          aggccatcct gagcgcccgg ctgagcaaga gccggcggct ggagaacctg atcgcccagc 780
          tgcccggcga gaagaagaac ggcctgttcg gcaacctgat cgccctgagc ctgggcctga 840
          cccccaactt caagagcaac ttcgacctgg ccgaggacgc caagctgcag ctgagcaagg 900
          acacctacga cgacgacctg gacaacctgc tggcccagat cggcgaccag tacgccgacc 960
          tgttcctggc cgccaagaac ctgagcgacg ccatcctgct gagcgacatc ctgcgggtga 1020
          acaccgagat caccaaggcc cccctgagcg ccagcatgat caagcggtac gacgagcacc 1080
          accaggacct gaccctgctg aaggccctgg tgcggcagca gctgcccgag aagtacaagg 1140
          agatcttctt cgaccagagc aagaacggct acgccggcta catcgacggc ggcgccagcc 1200
          aggagggagtt ctacaagttc atcaagccca tcctggagaa gatggacggc accgaggagc 1260
          tgctggtgaa gctgaaccgg gaggacctgc tgcggaagca gcggaccttc gacaacggca 1320
          gcatccccca ccagatccac ctgggcgagc tgcacgccat cctgcggcgg caggaggact 1380
          tctacccctt cctgaaggac aaccgggaga agatcgagaa gatcctgacc ttccggatcc 1440
          cctactacgt gggccccctg gcccggggca acagccggtt cgcctggatg acccggaaat 1500
          ccgaggagac catcacccccc tggaacttcg aggaggtggt ggacaagggc gccagcgccc 1560
          agagcttcat cgagcggatg accaacttcg acaagaacct gcccaacgag aaggtgctgc 1620
          ccaagcacag cctgctgtac gagtacttca ccgtgtacaa cgagctgacc aaggtgaagt 1680
          acgtgaccga gggcatgcgg aagcccgcct tcctgagcgg cgagcagaag aaggccatcg 1740
          tggacctgct gttcaagacc aaccggaagg tgaccgtgaa gcagctgaag gaggactact 1800
          tcaagaagat cgagtgcttc gacagcgtgg agatcagcgg cgtggaggac cggttcaacg 1860
          ccagcctggg cacctaccac gacctgctga agatcatcaa ggacaaggac ttcctggaca 1920
          acgaggagaa cgaggacatc ctggaggaca tcgtgctgac cctgaccctg ttcgaggacc 1980
          gggagatgat cgaggagcgg ctgaaaacct acgcccacct gttcgacgac aaggtgatga 2040
          agcagctgaa gcggcggcgg tacaccggct ggggccggct gagccggaag ctgatcaacg 2100
          gcatccggga caagcagagc ggcaagacca tcctggactt cctgaaatcc gacggcttcg 2160
          ccaaccggaa cttcatgcag ctgatccacg acgacagcct gaccttcaag gaggacatcc 2220
          agaaggccca ggtgagcggc cagggcgaca gcctgcacga gcacatcgcc aacctggccg 2280
          gcagccccgc catcaagaag ggcatcctgc agaccgtgaa ggtggtggac gagctggtga 2340
          aggtgatggg ccggcacaag cccgagaaca tcgtgatcga gatggcccgg gagaaccaga 2400
          ccacccagaa gggccagaag aacagccggg agcggatgaa gcggatcgag gagggcatca 2460
          aggagctggg cagccagatc ctgaaggagc accccgtgga gaacacccag ctgcagaacg 2520
          agaagctgta cctgtactac ctgcagaacg gccgggacat gtacgtggac caggagctgg 2580
          acatcaaccg gctgagcgac tacgacgtgg ccgccatcgt gccccagagc ttcctgaagg 2640
          acgacagcat cgacaacaag gtgctgaccc ggagcgacaa ggcccggggc aagagcgaca 2700
          acgtgcccag cgaggaggtg gtgaagaaga tgaagaacta ctggcggcag ctgctgaacg 2760
          ccaagctgat cacccagcgg aagttcgaca acctgaccaa ggccgagcgg ggcggcctga 2820
          gcgagctgga caaggccggc ttcatcaagc ggcagctggt ggagacccgg cagatcacca 2880
          agcacgtggc ccagatcctg gacagccgga tgaacaccaa gtacgacgag aacgacaagc 2940
          tgatccggga ggtgaaggtg atcaccctga aatccaagct ggtgagcgac ttccggaagg 3000
          acttccagtt ctacaaggtg cgggagatca acaactacca ccacgcccac gacgcctacc 3060
          tgaacgccgt ggtgggcacc gccctgatca agaagtaccc caagctggag agcgagttcg 3120
          tgtacggcga ctacaaggtg tacgacgtgc ggaagatgat cgccaagagc gagcaggaga 3180
          tcggcaaggc caccgccaag tacttcttct acagcaacat catgaacttc ttcaagaccg 3240
          agatcaccct ggccaacggc gagatccgga agcggcccct gatcgagacc aacggcgaga 3300
          ccggcgagat cgtgtgggac aagggccggg acttcgccac cgtgcggaag gtgctgagca 3360
          tgccccaggt gaacatcgtg aagaaaaccg aggtgcagac cggcggcttc agcaaggaga 3420
          gcatcctgcc caagcggaac agcgacaagc tgatcgcccg gaagaaggac tgggacccca 3480
          agaagtacgg cggcttcgac agccccaccg tggcctacag cgtgctggtg gtggccaagg 3540
          tggagaaggg caagagcaag aagctgaaat ccgtgaagga gctgctgggc atcaccatca 3600
          tggagcggag cagcttcgag aagaacccca tcgacttcct ggaggccaag ggctacaagg 3660
          aggtgaagaa ggacctgatc atcaagctgc ccaagtacag cctgttcgag ctggagaacg 3720
          gccggaagcg gatgctggcc agcgccggcg agctgcagaa gggcaacgag ctggccctgc 3780
          ccagcaagta cgtgaacttc ctgtacctgg ccagccacta cgagaagctg aagggcagcc 3840
          ccgaggacaa cgagcagaag cagctgttcg tggagcagca caagcactac ctggacgaga 3900
          tcatcgagca gatcagcgag ttcagcaagc gggtgatcct ggccgacgcc aacctggaca 3960
          aggtgctgag cgcctacaac aagcaccggg acaagcccat ccgggagcag gccgagaaca 4020
          tcatccacct gttcaccctg accaacctgg gcgcccccgc cgccttcaag tacttcgaca 4080
          ccaccatcga ccggaagcgg tacaccagca ccaaggaggt gctggacgcc accctgatcc 4140
          accagagcat caccggcctg tacgagaccc ggatcgacct gagccagctg ggcggcgaca 4200
          gcgccggcgg cggcggcagc ggcggcggcg gcagcggcgg cggcggcagc ggccccaaga 4260
          agaagcggaa ggtggccgcc gccggcagca accacgacca ggagttcgac ccccccaagg 4320
          tgtaccccccc cgtgcccgcc gagaagcgga agcccatccg ggtgctgagc ctgttcgacg 4380
          gcatcgccac cggcctgctg gtgctgaagg acctgggcat ccaggtggac cggtacatcg 4440
          ccagcgaggt gtgcgaggac agcatcaccg tgggcatggt gcggcaccag ggcaagatca 4500
          tgtacgtggg cgacgtgcgg agcgtgaccc agaagcacat ccaggagtgg ggccccttcg 4560
          acctggtgat cggcggcagc ccctgcaacg acctgagcat cgtgaaccccc gcccggaagg 4620
          gcctgtacga gggcaccggc cggctgttct tcgagttcta ccggctgctg cacgacgccc 4680
          ggcccaagga gggcgacgac cggcccttct tctggctgtt cgagaacgtg gtggccatgg 4740
          gcgtgagcga caagcgggac atcagccggt tcctggagag caaccccgtg atgatcgacg 4800
          ccaaggaggt gagcgccgcc caccgggccc ggtacttctg gggcaacctg cccggcatga 4860
          accggcccct ggccagcacc gtgaacgaca agctggagct gcaggagtgc ctggagcacg 4920
          gccggatcgc caagttcagc aaggtgcgga ccatcaccac ccggagcaac agcatcaagc 4980
          agggcaagga ccagcacttc cccgtgttca tgaacgagaa gggaggacatc ctgtggtgca 5040
          ccgagatgga gcgggtgttc ggcttccccg tgcactacac cgacgtgagc aacatgagcc 5100
          ggctggcccg gcagcggctg ctgggccgga gctggagcgt gcccgtgatc cggcacctgt 5160
          tcgcccccct gaaggagtac ttcgcctgcg tgagcagcgg caacagcaac gccaacagcc 5220
          ggggccccag cttcagcagc ggcctggtgc ccctgagcct gcggggcagc cacatgaatc 5280
          ctctggagat gttcgagaca gtgcccgtgt ggagaaggca acccgtgagg gtgctgagcc 5340
          tcttcgagga cattaagaag gagctgacct ctctgggctt tctggaatcc ggcagcgacc 5400
          ccggccagct gaaacacgtg gtggacgtga ccgacacagt gaggaaggac gtggaagagt 5460
          ggggcccctt tgacctcgtg tatggagcca cacctcctct cggccacaca tgcgataggc 5520
          ctcccagctg gtatctcttc cagttccaca gactgctcca gtacgccaga cctaagcccg 5580
          gcagccccag acccttcttc tggatgttcg tggacaatct ggtgctgaac aaggaggatc 5640
          tggatgtggc cagcagattt ctggagatgg aacccgtgac aatccccgac gtgcatggcg 5700
          gctctctgca gaacgccgtg agagtgtggt ccaacatccc cgccattaga agcagacact 5760
          gggctctggt gagcgaggag gaactgtctc tgctggccca gaataagcag tcctccaagc 5820
          tggccgccaa gtggcccacc aagctggtga agaactgctt tctgcctctg agggagtatt 5880
          tcaagtattt cagcaccgaa ctgaccagca gcctgagcgg cggcaagcgg cccgccgcca 5940
          ccaagaaggc cggccaggcc aagaagaaga agggcagcta cccctacgac gtgcccgact 6000
          acgcctgagc ggccgcttaa ttaagctgcc ttctgcgggg cttgccttct ggccatgccc 6060
          ttcttctctc ccttgcacct gtacctcttg gtctttgaat aaagcctgag taggaagtct 6120
          agaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 6180
          aaaaaaaaaaaaaaaaaaaaaa 6202
           <![CDATA[ <210> 71]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic oligonucleotides]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <221> modified_base]]>
           <![CDATA[ <222> (]]>1)..(1)
           <![CDATA[ <223> a, c, t, g, unknown or other]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <221> modified_base]]>
           <![CDATA[ <222> (3)..(3)]]>
           <![CDATA[ <223> a, c, t, g, unknown or other]]>
           <![CDATA[ <400> 71]]>
          nbndccdsha grkgghrshv 20
           <![CDATA[ <210> 72]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic oligonucleotides]]>
           <![CDATA[ <220]]>>]]>
           <br/> &lt;![CDATA[ &lt;221&gt;modified_base]]&gt;
           <br/> &lt;![CDATA[ &lt;222&gt;(18)..(18)]]&gt;
           <br/> &lt;![CDATA[ &lt;223&gt; a, c, t, g, unknown or other]]&gt;
           <br/>
           <br/> &lt;![CDATA[ &lt;220&gt;]]&gt;
           <br/> &lt;![CDATA[ &lt;221&gt;modified_base]]&gt;
           <br/> &lt;![CDATA[ &lt;222&gt;(20)..(20)]]&gt;
           <br/> &lt;![CDATA[ &lt;223&gt; a, c, t, g, unknown or other]]&gt;
           <br/>
           <br/> &lt;![CDATA[ &lt;400&gt;72]]&gt;
           <br/> <![CDATA[vhsrhggkrg ahsdccdnbn 20
           <![CDATA[ <210> 73]]>
           <![CDATA[ <211> 10]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic oligonucleotides]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <221> modified_base]]>
           <![CDATA[ <222> (8)..(8)]]>
           <![CDATA[ <223> a, c, t, g, unknown or other]]>
           <![CDATA[ <400> 73]]>
          ccgccatntt 10
           <![CDATA[ <210> 74]]>
           <![CDATA[ <211> 10]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic oligonucleotides]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <221> modified_base]]>
           <![CDATA[ <222> (3)..(3)]]>
           <![CDATA[ <223> a, c, t, g, unknown or other]]>
           <![CDATA[ <400> 74]]>
          aanatggcgg10
           <![CDATA[ <210> 75]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 75]]>
          gctggaaacc ttgcacctcg g 21
           <![CDATA[ <210> 76]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 76]]>
          ctgctgccag tagagggcac a 21
           <![CDATA[ <210> 77]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 77]]>
          gcccagagag ggggcggagg g 21
           <![CDATA[ <210> 78]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 78]]>
          acgcggggag caaccaatcg c 21
           <![CDATA[ <210> 79]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 79]]>
          actggcagca gagatcatcg c 21
           <![CDATA[ <210> 80]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 80]]>
          gggggcagga gcaggagcgt c 21
           <![CDATA[ <210> 81]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 81]]>
          cagccttagc gaggcgccct g 21
           <![CDATA[ <210> 82]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 82]]>
          actcacagga caaggatgcg g 21
           <![CDATA[ <210> 83]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 83]]>
          agcaaaagaa aatggtaggc g 21
           <![CDATA[ <210> 84]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 84]]>
          actcagccgg gcagccgagc a 21
           <![CDATA[ <210> 85]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 85]]>
          cgtaccaggc tgcagggcgc c 21
           <![CDATA[ <210> 86]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213]]>> Homo sapiens]]&gt;
           <br/>
           <br/> &lt;![CDATA[ &lt;400&gt;86]]&gt;
           <br/> <![CDATA[agagtggagg aaagaagggt a 21
           <![CDATA[ <210> 87]]>
           <![CDATA[ <211> 386]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 87]]>
          Met Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val Phe Glu Ala
          1 5 10 15
          Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys Val Arg Lys
                      20 25 30
          Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val Pro Ala Ile
                  35 40 45
          Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys Leu Glu Tyr
              50 55 60
          Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu Asn Lys Thr
          65 70 75 80
          Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr Trp Lys Arg
                          85 90 95
          Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile Lys Leu Ser
                      100 105 110
          Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr Lys Arg Thr
                  115 120 125
          Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys Gln Asp Leu
              130 135 140
          Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser Gly Thr Arg
          145 150 155 160
          Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser Thr Glu Lys
                          165 170 175
          Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly Ala Leu Leu
                      180 185 190
          His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln Lys Leu Glu
                  195 200 205
          Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala Ala Asp Phe
              210 215 220
          Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser Thr Leu Asn
          225 230 235 240
          Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys Ser Ile Lys
                          245 250 255
          Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu Asn Asn Leu
                      260 265 270
          Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser Asn Ile Asn
                  275 280 285
          Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu Gly Tyr Val
              290 295 300
          Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser Gly Ala Asn
          305 310 315 320
          Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys Met Asn Ser
                          325 330 335
          Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp Gly Lys Arg
                      340 345 350
          Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile Phe Val Cys
                  355 360 365
          Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile Asp Lys Ile
              370 375 380
          Gly Gly
          385
           <![CDATA[ <210> 88]]>
           <![CDATA[ <211> 22]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 88]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser
                      20
           <![CDATA[ <210> 89]]>
           <![CDATA[ <211> 29]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 89]]>
          Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys
          1 5 10 15
          Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                      20 25
           <![CDATA[ <210> 90]]>
           <![CDATA[ <211> 9]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 90]]>
          Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
          1 5
           <![CDATA[ <210> 91]]>
           <![CDATA[ <211> 1123]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 91]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                      660 665 670
          Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn
                  675 680 685
          Pro Gly Pro Thr Ser Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg Gly
              690 695 700
          Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Leu Glu
          705 710 715 720
          Gly Ser Ser Gly Ser Gly Ser Pro Lys Lys Lys Arg Lys Val Gly Ile
                          725 730 735
          His Gly Val Pro Ala Ala Gly Ser Ser Ser Gly Ser Leu Glu Pro Gly Glu
                      740 745 750
          Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp
                  755 760 765
          Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys
              770 775 780
          Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg
          785 790 795 800
          His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys
                          805 810 815
          Gly Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg Thr
                      820 825 830
          His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe
                  835 840 845
          Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu
              850 855 860
          Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala
          865 870 875 880
          His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys
                          885 890 895
          Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu
                      900 905 910
          His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys
                  915 920 925
          Gly Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr
              930 935 940
          His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser
          945 950 955 960
          Gly Gly Gly Ser Gly Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg
                          965 970 975
          Thr Leu Val Thr Phe Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Glu
                      980 985 990
          Trp Lys Leu Leu Asp Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met
                  995 1000 1005
          Leu Glu Asn Tyr Lys Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr
              1010 1015 1020
          Lys Pro Asp Val Ile Leu Arg Leu Glu Lys Gly Glu Glu Pro Trp
              1025 1030 1035
          Leu Val Glu Arg Glu Ile His Gln Glu Thr His Pro Asp Ser Glu
              1040 1045 1050
          Thr Ala Phe Glu Ile Lys Ser Ser Val Ser Gly Gly Lys Arg Pro
              1055 1060 1065
          Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
              1070 1075 1080
          Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Ser Gly Gly Lys Arg
              1085 1090 1095
          Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly
              1100 1105 1110
          Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
              1115 1120
           <![CDATA[ <210> 92]]>
           <![CDATA[ <211> 1123]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 92]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Pro Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln
                      340 345 350
          Ala Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
          Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ala Thr Asn Phe Ser
              370 375 380
          Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Thr Ser
          385 390 395 400
          Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys
                          405 410 415
          Gly Asp Val Glu Glu Asn Pro Gly Pro Leu Glu Gly Ser Ser Gly Ser
                      420 425 430
          Gly Ser Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
                  435 440 445
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
              450 455 460
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
          465 470 475 480
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          485 490 495
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
                      500 505 510
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  515 520 525
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
              530 535 540
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
          545 550 555 560
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
                          565 570 575
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
                      580 585 590
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                  595 600 605
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
              610 615 620
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
          625 630 635 640
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
                          645 650 655
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
                      660 665 670
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                  675 680 685
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
              690 695 700
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
          705 710 715 720
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
                          725 730 735
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
                      740 745 750
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                  755 760 765
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
              770 775 780
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
          785 790 795 800
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
                          805 810 815
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
                      820 825 830
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                  835 840 845
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
              850 855 860
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
          865 870 875 880
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
                          885 890 895
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
                      900 905 910
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                  915 920 925
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
              930 935 940
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
          945 950 955 960
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
                          965 970 975
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
                      980 985 990
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                  995 1000 1005
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln
              1010 1015 1020
          Asp Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln
              1025 1030 1035
          Lys Ile Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu
              1040 1045 1050
          Ala Ile Ile Asp Lys Ile Gly Gly Pro Ser Gly Gly Lys Arg Pro
              1055 1060 1065
          Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
              1070 1075 1080
          Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Ser Gly Gly Lys Arg
              1085 1090 1095
          Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly
              1100 1105 1110
          Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
              1115 1120
           <![CDATA[ <210> 93]]>
           <![CDATA[ <211> 3332]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 93]]>
          gcggcaaatc cttttctaga agcgatcatc tgaccaccca ccaaagaaca cataccggcg 60
          agaagcctta caaatgtccc gagtgcggaa agtccttctc ccagagagcc aatctgaggg 120
          ctcatcaaag gacccatacc ggcgaaaagc cctacaaatg ccccgagtgc ggaaaatcct 180
          tcagccagct ggcccatctg agagcccacc aaaggacaca caccggagag aaaccctata 240
          agtgccccga gtgtggaaaa agcttttccc agagggccaa tctgagggcc catcagagga 300
          cccataccgg agagaagcct tataaatgtc ccgagtgcgg aaaaagcttc agcgagagga 360
          gccatctgag ggaacatcaa agaacccaca ccggcgaaaa accccaccgga aaaaagacca 420
          gcgctagcgg cagcggcggc ggcagcggcg gcgcccggga cagcaaggtg gagaacaaga 480
          ccaagaagct gcgggtgttc gaggccttcg ccggcatcgg cgcccagcgg aaggccctgg 540
          agaaggtgcg gaaggacgag tacgagatcg tgggcctggc cgagtggtac gtgcccgcca 600
          tcgtgatgta ccaggccatc cacaacaact tccacaccaa gctggagtac aagagcgtga 660
          gccggggagga gatgatcgac tacctggaga acaagaccct gagctggaac agcaagaacc 720
          ccgtgagcaa cggctactgg aagcggaaga aggacgacga gctgaagatc atctacaacg 780
          ccatcaagct gagcgagaag gagggcaaca tcttcgacat ccgggacctg tacaagcgga 840
          ccctgaagaa catcgacctg ctgacctaca gcttcccctg ccaggacctg agccagcagg 900
          gcatccagaa gggcatgaag cggggcagcg gcacccggag cggcctgctg tgggagatcg 960
          agcgggccct ggacagcacc gagaagaacg acctgcccaa gtacctgctg atggagaacg 1020
          tgggcgccct gctgcacaag aagaacgagg aggagctgaa ccagtggaag cagaagctgg 1080
          agagcctggg ctaccagaac agcatcgagg tgctgaacgc cgccgacttc ggcagcagcc 1140
          aggcccggcg gcgggtgttc atgatcagca ccctgaacga gttcgtggag ctgcccaagg 1200
          gcgacaagaa gcccaagagc atcaagaagg tgctgaacaa gatcgtgagc gagaaggaca 1260
          tcctgaacaa cctgctgaag tacaacctga ccgagttcaa gaaaaccaag agcaacatca 1320
          acaaggccag cctgatcggc tacagcaagt tcaacagcga gggctacgtg tacgaccccg 1380
          agttcaccgg ccccaccctg accgccagcg gcgccaacag ccggatcaag atcaaggacg 1440
          gcagcaacat ccggaagatg aacagcgacg agaccttcct gtacatcggc ttcgacagcc 1500
          aggacggcaa gcgggtgaac gagatcgagt tcctgaccga gaaccagaag atcttcgtgt 1560
          gcggcaacag catcagcgtg gaggtgctgg aggccatcat cgacaagatc ggcggcccca 1620
          gcagcggcgg caagcggccc gccgccacca agaaggccgg ccaggccaag aagaagaagg 1680
          gcagctaccc ctacgacgtg cccgactacg ccgggtccta cccgtacgac gtgcccgatt 1740
          acgccgccac caacttctcg ctgctgaagc aggccggaga tgtggaagaa aaccctggac 1800
          ctaccagtgc cggaaagctc ggtagcggag agggtcgggg aagcctgctt acttgcggcg 1860
          acgtggaaga gaacccccggt ccgctggagg gttcgtccgg ctccggatcc cccaagaaga 1920
          agcggaaggt gggcatccac ggcgtgcccg ccgccggcag cagcggatcc ctggagcccg 1980
          gcgaaaaacc ttacaagtgc cccgagtgcg gaaagagctt cagcagaagc gacaaactgg 2040
          tgaggcatca aaggacacat accggagaga agccctataa gtgccccgaa tgtggcaaat 2100
          ccttttccca gagggctcat ctggaaagac accagaggac ccataccggc gaaaaaccct 2160
          acaaatgtcc cgagtgtgga aagagctttt ccgatcccgg ccatctggtc agacatcaga 2220
          ggacacatac cggcgaaaag ccttacaagt gtcccgaatg cggaaaatcc ttctccagaa 2280
          gcgacaagct ggtgaggcac caaagaaccc acaccggcga aaaaccctat aaatgccccg 2340
          agtgcggcaa gtcctttagc cagctggccc atctgagagc ccaccagaga acacacaccg 2400
          gagagaagcc ttataagtgt cccgagtgcg gaaagtcctt ctctagagcc gacaatctga 2460
          ccgaacatca aaggacacac accggcgaga aaccttataa atgccccgag tgcggaaaaa 2520
          gcttttccga ctgcagagat ctggctagac accagagaac ccacaccggc gagaaaccca 2580
          ccggcaaaaa gaccagcgct agcggcagcg gcggcggcag cggcggcgac gccaagagcc 2640
          tgaccgcctg gagccggacc ctggtgacct tcaaggacgt gttcgtggac ttcacccggg 2700
          aggagtggaa gctgctggac accgcccagc agatcctgta ccggaacgtg atgctggaga 2760
          actacaagaa cctggtgagc ctgggctacc agctgaccaa gcccgacgtg atcctgcggc 2820
          tggagaaggg cgaggagccc tggctggtgg agcggggagat ccaccaggag accccaccccg 2880
          acagcgagac cgccttcgag atcaagagca gcgtgagcgg cggcaagcgg cccgccgcca 2940
          ccaagaaggc cggccaggcc aagaagaaga agggcagcta cccctacgac gtgcccgact 3000
          acgcctgaag cagcggcggc aagcggcccg ccgccaccaa gaaggccggc caggccaaga 3060
          agaagaaggg cagctacccc tacgacgtgc ccgactacgc ctgagcggcc gcttaattaa 3120
          gctgccttct gcggggcttg ccttctggcc atgcccttct tctctccctt gcacctgtac 3180
          ctcttggtct ttgaataaag cctgagtagg aagtctagaa aaaaaaaaaaaaaaaaaaaa 3240
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3300
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3332
           <![CDATA[ <210> 94]]>
           <![CDATA[ <211> 3012]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 94]]>
          tataaatgcc ccgagtgcgg aaaaagcttt tccgactgca gagatctggc tagacaccag 60
          agaacccaca ccggcgagaa acccaccggc aaaaagacca gcgctagcgg cagcggcggc 120
          ggcagcggcg gcgacgccaa gagcctgacc gcctggagcc ggaccctggt gaccttcaag 180
          gacgtgttcg tggacttcac ccgggaggag tggaagctgc tggacaccgc ccagcagatc 240
          ctgtaccgga acgtgatgct ggagaactac aagaacctgg tgagcctggg ctaccagctg 300
          accaagcccg acgtgatcct gcggctggag aagggcgagg agccctggct ggtggagcgg 360
          gagatccacc aggagaccca ccccgacagc gagaccgcct tcgagatcaa gagcagcgtg 420
          agcagcggcg gcaagcggcc cgccgccacc aagaaggccg gccaggccaa gaagaagaag 480
          ggcagctacc cctacgacgt gcccgactac gccgggtcct acccgtacga cgtgcccgat 540
          tacgccgcca ccaacttctc gctgctgaag caggccggag atgtggaaga aaaccctgga 600
          cctaccagtg ccggaaagct cggtagcgga gagggtcggg gaagcctgct tacttgcggc 660
          gacgtggaag agaacccccgg tccgctggag ggttcgtccg gctccggatc ccccaagaag 720
          aagcggaagg tgggcatcca cggcgtgccc gccgccggca gcagcggatc cctggagccc 780
          ggcgagaaac cttacaaatg ccccgagtgc ggcaagagct tcagcagaag cgacgatctg 840
          gtgaggcacc aaagaaccca caccggcgaa aaaccttaca agtgtcccga atgcggaaag 900
          tccttcagca gagaggacaa tctgcacacc caccagagaa cacacaccgg agaaaagcct 960
          tacaagtgcc ccgaatgcgg caaatccttt tctagaagcg atcatctgac cacccaccaa 1020
          agaacacata ccggcgagaa gccttacaaa tgtcccgagt gcggaaagtc cttctcccag 1080
          agagccaatc tgagggctca tcaaaggacc cataccggcg aaaagcccta caaatgcccc 1140
          gagtgcggaa aatccttcag ccagctggcc catctgagag cccaccaaag gacacacacc 1200
          ggagagaaac cctataagtg ccccgagtgt ggaaaaagct tttcccagag ggccaatctg 1260
          agggcccatc agaggaccca taccggagag aagccttata aatgtcccga gtgcggaaaa 1320
          agcttcagcg agaggagcca tctgagggaa catcaaagaa cccacaccgg cgaaaaaccc 1380
          accggaaaaa agaccagcgc tagcggcagc ggcggcggca gcggcggcgc ccgggacagc 1440
          aaggtggaga acaagaccaa gaagctgcgg gtgttcgagg ccttcgccgg catcggcgcc 1500
          cagcggaagg ccctggagaa ggtgcggaag gacgagtacg agatcgtggg cctggccgag 1560
          tggtacgtgc ccgccatcgt gatgtaccag gccatccaca acaacttcca caccaagctg 1620
          gagtacaaga gcgtgagccg ggaggagatg atcgactacc tggagaacaa gaccctgagc 1680
          tggaacagca agaaccccgt gagcaacggc tactggaagc ggaagaagga cgacgagctg 1740
          aagatcatct acaacgccat caagctgagc gagaaggagg gcaacatctt cgacatccgg 1800
          gacctgtaca agcggaccct gaagaacatc gacctgctga cctacagctt cccctgccag 1860
          gacctgagcc agcagggcat ccagaagggc atgaagcggg gcagcggcac ccggagcggc 1920
          ctgctgtggg agatcgagcg ggccctggac agcaccgaga agaacgacct gcccaagtac 1980
          ctgctgatgg agaacgtggg cgccctgctg cacaagaaga acgaggagga gctgaaccag 2040
          tggaagcaga agctggagag cctgggctac cagaacagca tcgaggtgct gaacgccgcc 2100
          gacttcggca gcagccaggc ccggcggcgg gtgttcatga tcagcaccct gaacgagttc 2160
          gtggagctgc ccaagggcga caagaagccc aagagcatca agaaggtgct gaacaagatc 2220
          gtgagcgaga aggacatcct gaacaacctg ctgaagtaca acctgaccga gttcaagaaa 2280
          accaagagca acatcaacaa ggccagcctg atcggctaca gcaagttcaa cagcgagggc 2340
          tacgtgtacg accccgagtt caccggcccc accctgaccg ccagcggcgc caacagccgg 2400
          atcaagatca aggacggcag caacatccgg aagatgaaca gcgacgagac cttcctgtac 2460
          atcggcttcg acagccagga cggcaagcgg gtgaacgaga tcgagttcct gaccgagaac 2520
          cagaagatct tcgtgtgcgg caacagcatc agcgtggagg tgctggaggc catcatcgac 2580
          aagatcggcg gccccagcgg cggcaagcgg cccgccgcca ccaagaaggc cggccaggcc 2640
          aagaagaagaaga agggcagcta cccctacgac gtgcccgact acgcctgaag cagcggcggc 2700
          aagcggcccg ccgccaccaa gaaggccggc caggccaaga agaagaaggg cagctacccc 2760
          tacgacgtgc ccgactacgc ctgagcggcc gcttaattaa gctgccttct gcggggcttg 2820
          ccttctggcc atgcccttct tctctccctt gcacctgtac ctcttggtct ttgaataaag 2880
          cctgagtagg aagtctagaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2940
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3000
          aaaaaaaaaaaa 3012
           <![CDATA[ <210> 95]]>
           <![CDATA[ <211> 118]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 95]]>
          Pro Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln
          1 5 10 15
          Ala Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                      20 25 30
          Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ala Thr Asn Phe Ser
                  35 40 45
          Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Thr Ser
              50 55 60
          Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys
          65 70 75 80
          Gly Asp Val Glu Glu Asn Pro Gly Pro Leu Glu Gly Ser Ser Gly Ser
                          85 90 95
          Gly Ser Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
                      100 105 110
          Ala Gly Ser Ser Gly Ser
                  115
           <![CDATA[ <210> 96]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 96]]>
          tgccacttcc ccactaaccc 20
           <![CDATA[ <210> 97]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 97]]>
          ggccacacaa ggaagctgca 20
           <![CDATA[ <210> 98]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 98]]>
          ccacacaagg aagctgcagg 20
           <![CDATA[ <210> 99]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 99]]>
          tgattggaat gcaacccgaa 20
           <![CDATA[ <210> 100]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 100]]>
          ttttgccctt gctaccccaa 20
           <![CDATA[ <210> 101]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 101]]>
          agctgatggt atccactagg 20
           <![CDATA[ <210> 102]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 102]]>
          cacatccaag aatgtagtgg 20
           <![CDATA[ <210> 103]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 103]]>
          gatacagcca caaagctcac 20
           <![CDATA[ <210> 104]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 104]]>
          attacataac agaatccagg 20
           <![CDATA[ <210> 105]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 105]]>
          cccttgactg tgctgccacc 20
           <![CDATA[ <210> 106]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 106]]>
          cagacgagga acctgaaccc 20
           <![CDATA[ <210> 107]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 107]]>
          agaatccctt ggggtagcaa 20
           <![CDATA[ <210> 108]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 108]]>
          cagcactctc gctgaccgca 20
           <![CDATA[ <210> 109]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 109]]>
          gttgagtcat gtgtactctg 20
           <![CDATA[ <210> 110]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 110]]>
          aggaacagga tgttacaact 20
           <![CDATA[ <210> 111]]>
           <![CDATA[ <211> 20]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 111]]>
          ggggccacta gggacaggat 20
           <![CDATA[ <210> 112]]>
           <![CDATA[ <211> 3650]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 112]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa accttacaaa tgccccgagt gcggcaagag cttcagcaga agcgacgatc 180
          tggtgaggca ccaaagaacc cacaccggcg aaaaacctta caagtgtccc gaatgcggaa 240
          agtccttcag cagagaggac aatctgcaca cccaccagag aacacacacc ggagaaaagc 300
          cttacaagtg ccccgaatgc ggcaaatcct tttctagaag cgatcatctg accacccacc 360
          aaagaacaca taccggcgag aagccttaca aatgtcccga gtgcggaaag tccttctccc 420
          agagagccaa tctgagggct catcaaagga cccataccgg cgaaaagccc tacaaatgcc 480
          ccgagtgcgg aaaatccttc agccagctgg cccatctgag agcccaccaa aggacacaca 540
          ccggagagaa accctataag tgccccgagt gtggaaaaag cttttcccag agggccaatc 600
          tgagggccca tcagaggacc cataccggag agaagcctta taaatgtccc gagtgcggaa 660
          aaagcttcag cgagaggagc catctgaggg aacatcaaag aacccacacc ggcgaaaaac 720
          ccaccggaaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc agcggcggca agcggcccgc cgccaccaag aaggccggcc 1980
          aggccaagaa gaagaagggc agctacccct acgacgtgcc cgactacgcc gggtcctacc 2040
          cgtacgacgt gcccgattac gccgccacca acttctcgct gctgaagcag gccggagatg 2100
          tggaagaaaa ccctggacct accagtgccg gaaagctcgg tagcggagag ggtcggggaa 2160
          gcctgcttac ttgcggcgac gtggaagaga accccggtcc gctggagggt tcgtccggct 2220
          ccggatcccc caagaagaag cggaaggtgg gcatccacgg cgtgcccgcc gccggcagca 2280
          gcggatccct ggagcccggc gaaaaacctt acaagtgccc cgagtgcgga aagagcttca 2340
          gcagaagcga caaactggtg aggcatcaaa ggacacatac cggagagaag ccctataagt 2400
          gccccgaatg tggcaaatcc ttttccccaga gggctcatct ggaaagacac cagaggaccc 2460
          ataccggcga aaaaccctac aaatgtcccg agtgtggaaa gagcttttcc gatcccggcc 2520
          atctggtcag acatcagagg acacataccg gcgaaaagcc ttacaagtgt cccgaatgcg 2580
          gaaaatcctt ctccagaagc gacaagctgg tgaggcacca aagaacccac accggcgaaa 2640
          aaccctataa atgccccgag tgcggcaagt cctttagcca gctggcccat ctgagagccc 2700
          accagagaac acacaccgga gagaagcctt ataagtgtcc cgagtgcgga aagtccttct 2760
          ctagagccga caatctgacc gaacatcaaa ggacacacac cggcgagaaa ccttataaat 2820
          gccccgagtg cggaaaaagc ttttccgact gcagagatct ggctagacac cagagaaccc 2880
          acaccggcga gaaacccacc ggcaaaaaga ccagcgctag cggcagcggc ggcggcagcg 2940
          gcggcgacgc caagagcctg accgcctgga gccggaccct ggtgaccttc aaggacgtgt 3000
          tcgtggactt cacccggggag gagtggaagc tgctggacac cgcccagcag atcctgtacc 3060
          ggaacgtgat gctggagaac tacaagaacc tggtgagcct gggctaccag ctgaccaagc 3120
          ccgacgtgat cctgcggctg gagaagggcg aggagccctg gctggtggag cgggagatcc 3180
          accaggagac ccaccccgac agcgagaccg ccttcgagat caagagcagc gtgagcggcg 3240
          gcaagcggcc cgccgccacc aagaaggccg gccaggccaa gaagaagaag ggcagctacc 3300
          cctacgacgt gcccgactac gcctgaagca gcggcggcaa gcggcccgcc gccaccaaga 3360
          aggccggcca ggccaagaag aagaagggca gctaccccta cgacgtgccc gactacgcct 3420
          gagcggccgc ttaattaagc tgccttctgc ggggcttgcc ttctggccat gcccttcttc 3480
          tctcccttgc acctgtacct cttggtcttt gaataaagcc tgagtaggaa gtctagaaaa 3540
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3600
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3650
           <![CDATA[ <210> 113]]>
           <![CDATA[ <211> 3650]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 113]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgaaaa accttacaag tgccccgagt gcggaaagag cttcagcaga agcgacaaac 180
          tggtgaggca tcaaaggaca cataccggag agaagcccta taagtgcccc gaatgtggca 240
          aatccttttc ccagagggct catctggaaa gacaccagag gacccatacc ggcgaaaaac 300
          cctacaaatg tcccgagtgt ggaaagagct tttccgatcc cggccatctg gtcagacatc 360
          agaggacaca taccggcgaa aagccttaca agtgtcccga atgcggaaaa tccttctcca 420
          gaagcgacaa gctggtgagg caccaaagaa cccacaccgg cgaaaaaccc tataaatgcc 480
          ccgagtgcgg caagtccttt agccagctgg cccatctgag agcccaccag agaacacaca 540
          ccggagagaa gccttataag tgtcccgagt gcggaaagtc cttctctaga gccgacaatc 600
          tgaccgaaca tcaaaggaca cacaccggcg agaaacctta taaatgcccc gagtgcggaa 660
          aaagcttttc cgactgcaga gatctggcta gacaccagag aacccacacc ggcgagaaac 720
          ccaccggcaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gacgccaaga 780
          gcctgaccgc ctggagccgg accctggtga ccttcaagga cgtgttcgtg gacttcaccc 840
          gggaggagtg gaagctgctg gacaccgccc agcagatcct gtaccggaac gtgatgctgg 900
          agaactacaa gaacctggtg agcctgggct accagctgac caagcccgac gtgatcctgc 960
          ggctggagaa gggcgaggag ccctggctgg tggagcggga gatccaccag gagacccacc 1020
          ccgacagcga gaccgccttc gagatcaaga gcagcgtgag cagcggcggc aagcggcccg 1080
          ccgccaccaa gaaggccggc caggccaaga agaagaaggg cagctacccc tacgacgtgc 1140
          ccgactacgc cgggtcctac ccgtacgacg tgcccgatta cgccgccacc aacttctcgc 1200
          tgctgaagca ggccggagat gtggaagaaa accctggacc taccagtgcc ggaaagctcg 1260
          gtagcggaga gggtcgggga agcctgctta cttgcggcga cgtggaagag aaccccggtc 1320
          cgctggaggg ttcgtccggc tccggatccc ccaagaagaa gcggaaggtg ggcatccacg 1380
          gcgtgcccgc cgccggcagc agcggatccc tggagcccgg cgagaaacct tacaaatgcc 1440
          ccgagtgcgg caagagcttc agcagaagcg acgatctggt gaggcaccaa agaacccaca 1500
          ccggcgaaaa accttacaag tgtcccgaat gcggaaagtc cttcagcaga gaggacaatc 1560
          tgcacaccca ccagagaaca cacaccggag aaaagcctta caagtgcccc gaatgcggca 1620
          aatccttttc tagaagcgat catctgacca cccaccaaag aacacatacc ggcgagaagc 1680
          cttacaaatg tcccgagtgc ggaaagtcct tctcccagag agccaatctg agggctcatc 1740
          aaaggaccca taccggcgaa aagccctaca aatgccccga gtgcggaaaa tccttcagcc 1800
          agctggccca tctgagagcc caccaaagga cacacaccgg agagaaaccc tataagtgcc 1860
          ccgagtgtgg aaaaagcttt tccccagagggg ccaatctgag ggcccatcag aggacccata 1920
          ccggagagaa gccttataaa tgtcccgagt gcggaaaaag cttcagcgag aggagccatc 1980
          tgagggaaca tcaaagaacc cacaccggcg aaaaacccac cggaaaaaag accagcgcta 2040
          gcggcagcgg cggcggcagc ggcggcgccc gggacagcaa ggtggagaac aagaccaaga 2100
          agctgcgggt gttcgaggcc ttcgccggca tcggcgccca gcggaaggcc ctggagaagg 2160
          tgcggaagga cgagtacgag atcgtgggcc tggccgagtg gtacgtgccc gccatcgtga 2220
          tgtaccaggc catccacaac aacttccaca ccaagctgga gtacaagagc gtgagccggg 2280
          aggagatgat cgactacctg gagaacaaga ccctgagctg gaacagcaag aacccccgtga 2340
          gcaacggcta ctggaagcgg aagaaggacg acgagctgaa gatcatctac aacgccatca 2400
          agctgagcga gaaggagggc aacatcttcg acatccggga cctgtacaag cggaccctga 2460
          agaacatcga cctgctgacc tacagcttcc cctgccagga cctgagccag cagggcatcc 2520
          agaagggcat gaagcggggc agcggcaccc ggagcggcct gctgtggggag atcgagcggg 2580
          ccctggacag caccgagaag aacgacctgc ccaagtacct gctgatggag aacgtgggcg 2640
          ccctgctgca caagaagaac gaggaggagc tgaaccagtg gaagcagaag ctggagagcc 2700
          tgggctacca gaacagcatc gaggtgctga acgccgccga cttcggcagc agccaggccc 2760
          ggcggcgggt gttcatgatc agcaccctga acgagttcgt ggagctgccc aagggcgaca 2820
          agaagcccaa gagcatcaag aaggtgctga acaagatcgt gagcgagaag gacatcctga 2880
          acaacctgct gaagtacaac ctgaccgagt tcaagaaaac caagagcaac atcaacaagg 2940
          ccagcctgat cggctacagc aagttcaaca gcgagggcta cgtgtacgac cccgagttca 3000
          ccggccccac cctgaccgcc agcggcgcca acagccggat caagatcaag gacggcagca 3060
          acatccggaa gatgaacagc gacgagacct tcctgtacat cggcttcgac agccaggacg 3120
          gcaagcgggt gaacgagatc gagttcctga ccgagaacca gaagatcttc gtgtgcggca 3180
          acagcatcag cgtggaggtg ctggaggcca tcatcgacaa gatcggcggc cccagcggcg 3240
          gcaagcggcc cgccgccacc aagaaggccg gccaggccaa gaagaagaag ggcagctacc 3300
          cctacgacgt gcccgactac gcctgaagca gcggcggcaa gcggcccgcc gccaccaaga 3360
          aggccggcca ggccaagaag aagaagggca gctaccccta cgacgtgccc gactacgcct 3420
          gagcggccgc ttaattaagc tgccttctgc ggggcttgcc ttctggccat gcccttcttc 3480
          tctcccttgc acctgtacct cttggtcttt gaataaagcc tgagtaggaa gtctagaaaa 3540
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3600
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3650
           <![CDATA[ <210> 114]]>
           <![CDATA[ <211> 542]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 114]]>
          Asn His Asp Gln Glu Phe Asp Pro Pro Lys Val Tyr Pro Pro Val Pro
          1 5 10 15
          Ala Glu Lys Arg Lys Pro Ile Arg Val Leu Ser Leu Phe Asp Gly Ile
                      20 25 30
          Ala Thr Gly Leu Leu Val Leu Lys Asp Leu Gly Ile Gln Val Asp Arg
                  35 40 45
          Tyr Ile Ala Ser Glu Val Cys Glu Asp Ser Ile Thr Val Gly Met Val
              50 55 60
          Arg His Gln Gly Lys Ile Met Tyr Val Gly Asp Val Arg Ser Val Thr
          65 70 75 80
          Gln Lys His Ile Gln Glu Trp Gly Pro Phe Asp Leu Val Ile Gly Gly
                          85 90 95
          Ser Pro Cys Asn Asp Leu Ser Ile Val Asn Pro Ala Arg Lys Gly Leu
                      100 105 110
          Tyr Glu Gly Thr Gly Arg Leu Phe Phe Glu Phe Tyr Arg Leu Leu His
                  115 120 125
          Asp Ala Arg Pro Lys Glu Gly Asp Asp Arg Pro Phe Phe Trp Leu Phe
              130 135 140
          Glu Asn Val Val Ala Met Gly Val Ser Asp Lys Arg Asp Ile Ser Arg
          145 150 155 160
          Phe Leu Glu Ser Asn Pro Val Met Ile Asp Ala Lys Glu Val Ser Ala
                          165 170 175
          Ala His Arg Ala Arg Tyr Phe Trp Gly Asn Leu Pro Gly Met Asn Arg
                      180 185 190
          Pro Leu Ala Ser Thr Val Asn Asp Lys Leu Glu Leu Gln Glu Cys Leu
                  195 200 205
          Glu His Gly Arg Ile Ala Lys Phe Ser Lys Val Arg Thr Ile Thr Thr
              210 215 220
          Arg Ser Asn Ser Ile Lys Gln Gly Lys Asp Gln His Phe Pro Val Phe
          225 230 235 240
          Met Asn Glu Lys Glu Asp Ile Leu Trp Cys Thr Glu Met Glu Arg Val
                          245 250 255
          Phe Gly Phe Pro Val His Tyr Thr Asp Val Ser Asn Met Ser Arg Leu
                      260 265 270
          Ala Arg Gln Arg Leu Leu Gly Arg Ser Trp Ser Val Pro Val Ile Arg
                  275 280 285
          His Leu Phe Ala Pro Leu Lys Glu Tyr Phe Ala Cys Val Ser Ser Gly
              290 295 300
          Asn Ser Asn Ala Asn Ser Arg Gly Pro Ser Phe Ser Ser Gly Leu Val
          305 310 315 320
          Pro Leu Ser Leu Arg Gly Ser His Met Asn Pro Leu Glu Met Phe Glu
                          325 330 335
          Thr Val Pro Val Trp Arg Arg Gln Pro Val Arg Val Leu Ser Leu Phe
                      340 345 350
          Glu Asp Ile Lys Lys Glu Leu Thr Ser Leu Gly Phe Leu Glu Ser Gly
                  355 360 365
          Ser Asp Pro Gly Gln Leu Lys His Val Val Asp Val Thr Asp Thr Val
              370 375 380
          Arg Lys Asp Val Glu Glu Trp Gly Pro Phe Asp Leu Val Tyr Gly Ala
          385 390 395 400
          Thr Pro Pro Leu Gly His Thr Cys Asp Arg Pro Pro Ser Trp Tyr Leu
                          405 410 415
          Phe Gln Phe His Arg Leu Leu Gln Tyr Ala Arg Pro Lys Pro Gly Ser
                      420 425 430
          Pro Arg Pro Phe Phe Trp Met Phe Val Asp Asn Leu Val Leu Asn Lys
                  435 440 445
          Glu Asp Leu Asp Val Ala Ser Arg Phe Leu Glu Met Glu Pro Val Thr
              450 455 460
          Ile Pro Asp Val His Gly Gly Ser Leu Gln Asn Ala Val Arg Val Trp
          465 470 475 480
          Ser Asn Ile Pro Ala Ile Arg Ser Arg His Trp Ala Leu Val Ser Glu
                          485 490 495
          Glu Glu Leu Ser Leu Leu Ala Gln Asn Lys Gln Ser Ser Lys Leu Ala
                      500 505 510
          Ala Lys Trp Pro Thr Lys Leu Val Lys Asn Cys Phe Leu Pro Leu Arg
                  515 520 525
          Glu Tyr Phe Lys Tyr Phe Ser Thr Glu Leu Thr Ser Ser Leu
              530 535 540
           <![CDATA[ <210> 115]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 115]]>
          ctggagcccg gcgagaaacc ctataaatgc cccgaatgcg gaaaaagctt cagccagtcc 60
          agctctctgg tgagacatca gaggacacac accggcgaaa agccttataa gtgccccgag 120
          tgcggcaagt ccttctctag aagcgatcac ctcaccaatc atcagaggac acataccgga 180
          gagaagccct ataagtgccc cgagtgcggc aagagcttta gccagctggc tcatctgaga 240
          gctcaccaaa gaacccatac cggcgagaag ccttacaaat gccccgagtg tggaaaatcc 300
          ttttcccagt ccagcaacct cgtcagacat caaaggaccc ataccggcga aaagccttac 360
          aagtgtcccg agtgcggaaa gtccttctct agatccgaca acctcgtgag gcaccagaga 420
          accccacaccg gcgagaaacc ttacaaatgt cccgagtgtg gcaaaagctt ttctagaagc 480
          gacgagctgg tgagacatca aagaacccat accggcgaaa aaccttataa gtgtcccgag 540
          tgcggcaaat cctttagcca gctggcccat ctgagggccc accagagaac acataccggc 600
          gaaaaaccca ccggcaaaaa gacaagc 627
           <![CDATA[ <210> 116]]>
           <![CDATA[ <211> 2227]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 116]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa accctacaag tgccccgagt gtggaaaaag ctttagccaa agcggcgatc 180
          tgaggagaca ccaaagaaca cacaccggcg agaagcccta caaatgtccc gagtgcggaa 240
          agagcttcag ccagagcggc catctgaccg agcatcagag aacccatacc ggcgaaaaac 300
          cttataagtg ccccgagtgt ggaaagtcct tctccgagag atcccatctg agagaacacc 360
          agaggacaca caccggcgaa aaaccttata agtgtcccga gtgcggaaag tccttcagcg 420
          atcccggcca tctggtgaga catcaaagga cacataccgg cgaaaaacct tataagtgtc 480
          ccgaatgcgg caagagcttt agcagaaacg acacactcac cgaacaccag aggacccaca 540
          ccggcgagaa accctacaaa tgccccgagt gcggcaaatc cttttctaga gccgacaatc 600
          tgaccgaaca ccagaggacc cataccggag aaaagcctta caaatgtccc gagtgtggca 660
          aatccttctc cacccatctg gatctgatta gacaccaaag aacacatacc ggagaaaagc 720
          ccaccggaaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc agcggcggca agcggcccgc cgccaccaag aaggccggcc 1980
          aggccaagaa gaagaagggc agctacccct acgacgtgcc cgactacgcc tgagcggccg 2040
          cttaattaag ctgccttctg cggggcttgc cttctggcca tgcccttctt ctctcccttg 2100
          cacctgtacc tcttggtctt tgaataaagc ctgagtagga agtctagaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaa 2227
           <![CDATA[ <210> 117]]>
           <![CDATA[ <211> 2227]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 117]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgaaaa accctataag tgccccgaat gtggaaagag cttcagccat accggccatc 180
          tgctggaaca ccaaaggaca cacaccggcg agaaacctta caagtgtccc gagtgcggaa 240
          aaagcttctc ctccaaaaag gctctcaccg agcaccagag aacacatacc ggcgaaaagc 300
          cttataagtg ccccgagtgt ggcaaatcct tttccgactg tagagatctg gccagacatc 360
          aaagaaccca caccggagag aaaccttata aatgccccga gtgcggcaag tcctttagcc 420
          ataccggcca tctgctggag caccagagga cccataccgg cgagaagcct tacaaatgcc 480
          ccgagtgcgg caaaagcttc agcagaaatg acgctctgac cgagcatcaa aggacccata 540
          ccggcgaaaa gccctacaag tgtcccgagt gtggaaagtc cttctcccag agcggcgatc 600
          tgaggagaca ccagagaaca cacaccggcg agaaacccta taaatgtccc gagtgcggaa 660
          agagctttag cgacagcggc aatctgaggg tgcatcaaag aacacacacc ggcgaaaaac 720
          ccaccggaaa aaagacaagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc agcggcggca agcggcccgc cgccaccaag aaggccggcc 1980
          aggccaagaa gaagaagggc agctacccct acgacgtgcc cgactacgcc tgagcggccg 2040
          cttaattaag ctgccttctg cggggcttgc cttctggcca tgcccttctt ctctcccttg 2100
          cacctgtacc tcttggtctt tgaataaagc ctgagtagga agtctagaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaa 2227
           <![CDATA[ <210> 118]]>
           <![CDATA[ <211> 2227]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 118]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa accctataaa tgccccgaat gcggaaaaag cttcagccag tccagctctc 180
          tggtgagaca tcagaggaca cacaccggcg aaaagcctta taagtgcccc gagtgcggca 240
          agtccttctc tagaagcgat cacctcacca atcatcagag gacacatacc ggagagaagc 300
          cctataagtg ccccgagtgc ggcaagagct ttagccagct ggctcatctg agagctcacc 360
          aaagaaccca taccggcgag aagccttaca aatgccccga gtgtggaaaa tccttttccc 420
          agtccagcaa cctcgtcaga catcaaagga cccataccgg cgaaaagcct tacaagtgtc 480
          ccgagtgcgg aaagtccttc tctagatccg acaacctcgt gaggcaccag agaacccaca 540
          ccggcgagaa accttacaaa tgtcccgagt gtggcaaaag cttttctaga agcgacgagc 600
          tggtgagaca tcaaagaacc cataccggcg aaaaacctta taagtgtccc gagtgcggca 660
          aatcctttag ccagctggcc catctgaggg cccaccagag aacacatacc ggcgaaaaac 720
          ccaccggcaa aaagacaagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc agcggcggca agcggcccgc cgccaccaag aaggccggcc 1980
          aggccaagaa gaagaagggc agctacccct acgacgtgcc cgactacgcc tgagcggccg 2040
          cttaattaag ctgccttctg cggggcttgc cttctggcca tgcccttctt ctctcccttg 2100
          cacctgtacc tcttggtctt tgaataaagc ctgagtagga agtctagaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaa 2227
           <![CDATA[ <210> 119]]>
           <![CDATA[ <211> 5705]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 119]]>
          aaggaaataa gagagaaaag aagagtaaga agaaatataa gagccaccat ggcccccaag 60
          aagaagcgga aggtgggcat ccacggcgtg cccgccgccg acaagaagta cagcatcggc 120
          ctggccatcg gcaccaacag cgtgggctgg gccgtgatca ccgacgagta caaggtgccc 180
          agcaagaagt tcaaggtgct gggcaacacc gaccggcaca gcatcaagaa gaacctgatc 240
          ggcgccctgc tgttcgacag cggcgagacc gccgaggcca cccggctgaa gcggaccgcc 300
          cggcggcggt acacccggcg gaagaaccgg atctgctacc tgcaggagat cttcagcaac 360
          gagatggcca aggtggacga cagcttcttc caccggctgg aggagagctt cctggtggag 420
          gaggacaaga agcacgagcg gcacccccatc ttcggcaaca tcgtggacga ggtggcctac 480
          cacgagaagt accccaccat ctaccacctg cggaagaagc tggtggacag caccgacaag 540
          gccgacctgc ggctgatcta cctggccctg gcccacatga tcaagttccg gggccacttc 600
          ctgatcgagg gcgacctgaa ccccgacaac agcgacgtgg acaagctgtt catccagctg 660
          gtgcagacct acaaccagct gttcgaggag aaccccatca acgccagcgg cgtggacgcc 720
          aaggccatcc tgagcgcccg gctgagcaag agccggcggc tggagaacct gatcgcccag 780
          ctgcccggcg agaagaagaa cggcctgttc ggcaacctga tcgccctgag cctgggcctg 840
          accccccaact tcaagagcaa cttcgacctg gccgaggacg ccaagctgca gctgagcaag 900
          gacacctacg acgacgacct ggacaacctg ctggcccaga tcggcgacca gtacgccgac 960
          ctgttcctgg ccgccaagaa cctgagcgac gccatcctgc tgagcgacat cctgcgggtg 1020
          aacaccgaga tcaccaaggc ccccctgagc gccagcatga tcaagcggta cgacgagcac 1080
          caccaggacc tgaccctgct gaaggccctg gtgcggcagc agctgcccga gaagtacaag 1140
          gagatcttct tcgaccagag caagaacggc tacgccggct acatcgacgg cggcgccagc 1200
          caggagggagt tctacaagtt catcaagccc atcctggaga agatggacgg caccgaggag 1260
          ctgctggtga agctgaaccg ggaggacctg ctgcggaagc agcggacctt cgacaacggc 1320
          agcatccccc accagatcca cctgggcgag ctgcacgcca tcctgcggcg gcaggaggac 1380
          ttctacccct tcctgaagga caaccgggag aagatcgaga agatcctgac cttccggatc 1440
          ccctactacg tgggccccct ggcccggggc aacagccggt tcgcctggat gacccggaaa 1500
          tccgaggaga ccatcacccc ctggaacttc gaggaggtgg tggacaaggg cgccagcgcc 1560
          cagagcttca tcgagcggat gaccaacttc gacaagaacc tgcccaacga gaaggtgctg 1620
          cccaagcaca gcctgctgta cgagtacttc accgtgtaca acgagctgac caaggtgaag 1680
          tacgtgaccg agggcatgcg gaagcccgcc ttcctgagcg gcgagcagaa gaaggccatc 1740
          gtggacctgc tgttcaagac caaccggaag gtgaccgtga agcagctgaa ggaggactac 1800
          ttcaagaagaga tcgagtgctt cgacagcgtg gagatcagcg gcgtggagga ccggttcaac 1860
          gccagcctgg gcacctacca cgacctgctg aagatcatca aggacaagga cttcctggac 1920
          aacgaggaga acgaggacat cctggaggac atcgtgctga ccctgaccct gttcgaggac 1980
          cgggagatga tcgaggagcg gctgaaaacc tacgcccacc tgttcgacga caaggtgatg 2040
          aagcagctga agcggcggcg gtacaccggc tggggccggc tgagccggaa gctgatcaac 2100
          ggcatccggg acaagcagag cggcaagacc atcctggact tcctgaaatc cgacggcttc 2160
          gccaaccgga acttcatgca gctgatccac gacgacagcc tgaccttcaa ggaggacatc 2220
          cagaaggccc aggtgagcgg ccagggcgac agcctgcacg agcacatcgc caacctggcc 2280
          ggcagccccg ccatcaagaa gggcatcctg cagaccgtga aggtggtgga cgagctggtg 2340
          aaggtgatgg gccggcacaa gcccgagaac atcgtgatcg agatggcccg ggagaaccag 2400
          accacccaga agggccagaa gaacagccgg gagcggatga agcggatcga ggagggcatc 2460
          aaggagctgg gcagccagat cctgaaggag caccccgtgg agaacaccca gctgcagaac 2520
          gagaagctgt acctgtacta cctgcagaac ggccgggaca tgtacgtgga ccaggagctg 2580
          gacatcaacc ggctgagcga ctacgacgtg gccgccatcg tgccccagag cttcctgaag 2640
          gacgacagca tcgacaacaa ggtgctgacc cggagcgaca aggcccgggg caagagcgac 2700
          aacgtgccca gcgaggaggt ggtgaagaag atgaagaact actggcggca gctgctgaac 2760
          gccaagctga tcacccagcg gaagttcgac aacctgacca aggccgagcg gggcggcctg 2820
          agcgagctgg acaaggccgg cttcatcaag cggcagctgg tggagacccg gcagatcacc 2880
          aagcacgtgg cccagatcct ggacagccgg atgaacacca agtacgacga gaacgacaag 2940
          ctgatccggg aggtgaaggt gatcaccctg aaatccaagc tggtgagcga cttccggaag 3000
          gacttccagt tctacaaggt gcgggagatc aacaactacc accacgccca cgacgcctac 3060
          ctgaacgccg tggtgggcac cgccctgatc aagaagtacc ccaagctgga gagcgagttc 3120
          gtgtacggcg actacaaggt gtacgacgtg cggaagatga tcgccaagag cgagcaggag 3180
          atcggcaagg ccaccgccaa gtacttcttc tacagcaaca tcatgaactt cttcaagacc 3240
          gagatcaccc tggccaacgg cgagatccgg aagcggcccc tgatcgagac caacggcgag 3300
          accggcgaga tcgtgtggga caagggccgg gacttcgcca ccgtgcggaa ggtgctgagc 3360
          atgccccagg tgaacatcgt gaagaaaacc gaggtgcaga ccggcggctt cagcaaggag 3420
          agcatcctgc ccaagcggaa cagcgacaag ctgatcgccc ggaagaagga ctgggacccc 3480
          aagaagtacg gcggcttcga cagccccacc gtggcctaca gcgtgctggt ggtggccaag 3540
          gtggagaagg gcaagagcaa gaagctgaaa tccgtgaagg agctgctggg catcaccatc 3600
          atggagcgga gcagcttcga gaagaacccc atcgacttcc tggaggccaa gggctacaag 3660
          gaggtgaaga aggacctgat catcaagctg cccaagtaca gcctgttcga gctggagaac 3720
          ggccggaagc ggatgctggc cagcgccggc gagctgcaga agggcaacga gctggccctg 3780
          cccagcaagt acgtgaactt cctgtacctg gccagccact acgagaagct gaagggcagc 3840
          cccgaggaca acgagcagaa gcagctgttc gtggagcagc acaagcacta cctggacgag 3900
          atcatcgagc agatcagcga gttcagcaag cgggtgatcc tggccgacgc caacctggac 3960
          aaggtgctga gcgcctacaa caagcaccgg gacaagccca tccgggagca ggccgagaac 4020
          atcatccacc tgttcaccct gaccaacctg ggcgcccccg ccgccttcaa gtacttcgac 4080
          accaccatcg accggaagcg gtacaccagc accaaggagg tgctggacgc caccctgatc 4140
          caccagagca tcaccggcct gtacgagacc cggatcgacc tgagccagct gggcggcgac 4200
          aagcggcccg ccgccaccaa gaaggccggc caggccaaga agaagaaggc ccgggacagc 4260
          aaggtggaga acaagaccaa gaagctgcgg gtgttcgagg ccttcgccgg catcggcgcc 4320
          cagcggaagg ccctggagaa ggtgcggaag gacgagtacg agatcgtggg cctggccgag 4380
          tggtacgtgc ccgccatcgt gatgtaccag gccatccaca acaacttcca caccaagctg 4440
          gagtacaaga gcgtgagccg ggaggagatg atcgactacc tggagaacaa gaccctgagc 4500
          tggaacagca agaacccccgt gagcaacggc tactggaagc ggaagaagga cgacgagctg 4560
          aagatcatct acaacgccat caagctgagc gagaaggagg gcaacatctt cgacatccgg 4620
          gacctgtaca agcggaccct gaagaacatc gacctgctga cctacagctt cccctgccag 4680
          gacctgagcc agcagggcat ccagaagggc atgaagcggg gcagcggcac ccggagcggc 4740
          ctgctgtggg agatcgagcg ggccctggac agcaccgaga agaacgacct gcccaagtac 4800
          ctgctgatgg agaacgtggg cgccctgctg cacaagaaga acgaggagga gctgaaccag 4860
          tggaagcaga agctggagag cctgggctac cagaacagca tcgaggtgct gaacgccgcc 4920
          gacttcggca gcagccaggc ccggcggcgg gtgttcatga tcagcaccct gaacgagttc 4980
          gtggagctgc ccaagggcga caagaagccc aagagcatca agaaggtgct gaacaagatc 5040
          gtgagcgaga aggacatcct gaacaacctg ctgaagtaca acctgaccga gttcaagaaa 5100
          accaagagca acatcaacaa ggccagcctg atcggctaca gcaagttcaa cagcgagggc 5160
          tacgtgtacg accccgagtt caccggcccc accctgaccg ccagcggcgc caacagccgg 5220
          atcaagatca aggacggcag caacatccgg aagatgaaca gcgacgagac cttcctgtac 5280
          atcggcttcg acagccagga cggcaagcgg gtgaacgaga tcgagttcct gaccgagaac 5340
          cagaagatct tcgtgtgcgg caacagcatc agcgtggagg tgctggaggc catcatcgac 5400
          aagatcggcg gccccagcag cggcggcaag cggcccgccg ccaccaagaa ggccggccag 5460
          gccaagaaga agaagggcag ctacccctac gacgtgcccg actacgcctg agcggccgct 5520
          taattaagct gccttctgcg gggcttgcct tctggccatg cccttcttct ctcccttgca 5580
          cctgtacctc ttggtctttg aataaagcct gagtaggaag tctagaaaaaaaaaaaaaaa 5640
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 5700
          aaaaa 5705
           <![CDATA[ <210> 120]]>
           <![CDATA[ <211> 18]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 120]]>
          Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro
          1 5 10 15
          GlyPro
           <![CDATA[ <210> 121]]>
           <![CDATA[ <211> 1092]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 121]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                      660 665 670
          Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn
                  675 680 685
          Pro Gly Pro Thr Ser Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg Gly
              690 695 700
          Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Leu Glu
          705 710 715 720
          Gly Ser Ser Gly Ser Gly Ser Pro Lys Lys Lys Arg Lys Val Gly Ile
                          725 730 735
          His Gly Val Pro Ala Ala Gly Ser Ser Ser Gly Ser Leu Glu Pro Gly Glu
                      740 745 750
          Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp
                  755 760 765
          Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys
              770 775 780
          Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg
          785 790 795 800
          His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys
                          805 810 815
          Gly Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg Thr
                      820 825 830
          His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe
                  835 840 845
          Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu
              850 855 860
          Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala
          865 870 875 880
          His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys
                          885 890 895
          Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu
                      900 905 910
          His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys
                  915 920 925
          Gly Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr
              930 935 940
          His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser
          945 950 955 960
          Gly Gly Gly Ser Gly Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg
                          965 970 975
          Thr Leu Val Thr Phe Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Glu
                      980 985 990
          Trp Lys Leu Leu Asp Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met
                  995 1000 1005
          Leu Glu Asn Tyr Lys Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr
              1010 1015 1020
          Lys Pro Asp Val Ile Leu Arg Leu Glu Lys Gly Glu Glu Pro Trp
              1025 1030 1035
          Leu Val Glu Arg Glu Ile His Gln Glu Thr His Pro Asp Ser Glu
              1040 1045 1050
          Thr Ala Phe Glu Ile Lys Ser Ser Val Ser Gly Gly Lys Arg Pro
              1055 1060 1065
          Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
              1070 1075 1080
          Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
              1085 1090
           <![CDATA[ <210> 122]]>
           <![CDATA[ <211> 1092]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 122]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Pro Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln
                      340 345 350
          Ala Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
          Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ala Thr Asn Phe Ser
              370 375 380
          Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Thr Ser
          385 390 395 400
          Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys
                          405 410 415
          Gly Asp Val Glu Glu Asn Pro Gly Pro Leu Glu Gly Ser Ser Gly Ser
                      420 425 430
          Gly Ser Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
                  435 440 445
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
              450 455 460
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
          465 470 475 480
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          485 490 495
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
                      500 505 510
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  515 520 525
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
              530 535 540
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
          545 550 555 560
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
                          565 570 575
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
                      580 585 590
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                  595 600 605
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
              610 615 620
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
          625 630 635 640
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
                          645 650 655
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
                      660 665 670
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                  675 680 685
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
              690 695 700
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
          705 710 715 720
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
                          725 730 735
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
                      740 745 750
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                  755 760 765
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
              770 775 780
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
          785 790 795 800
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
                          805 810 815
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
                      820 825 830
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                  835 840 845
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
              850 855 860
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
          865 870 875 880
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
                          885 890 895
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
                      900 905 910
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                  915 920 925
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
              930 935 940
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
          945 950 955 960
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
                          965 970 975
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
                      980 985 990
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                  995 1000 1005
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln
              1010 1015 1020
          Asp Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln
              1025 1030 1035
          Lys Ile Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu
              1040 1045 1050
          Ala Ile Ile Asp Lys Ile Gly Gly Pro Ser Gly Gly Lys Arg Pro
              1055 1060 1065
          Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
              1070 1075 1080
          Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
              1085 1090
           <![CDATA[ <210> 123]]>
           <![CDATA[ <211> 355]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 123]]>
          cagagaagga ggaagttaat tcacattctt aattttttct aagggcaaaaaaaaaaaaaa 60
          aatgcaccag ctcattttcc atctctgctt gggtcatcag tgtgcattgt gagcctgtac 120
          aaaggcctta gacggggaat gctgccgaga gcatcacctt ttatgtcttc ttttatatga 180
          aatgtgccac ttccccacta accctggctc tgggctctgc ctctgctctc ctgatggtgt 240
          gtttatggtg gattcagcat tctgggccac acaaggaagc tgcagggggt gtccaagttc 300
          acatgtcccc gcattccagg cgaatgtttc tgacattgag caatgatatg gctct 355
           <![CDATA[ <210> 124]]>
           <![CDATA[ <211> 46]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 124]]>
          Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn
          1 5 10 15
          Pro Gly Pro Thr Ser Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg Gly
                      20 25 30
          Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro
                  35 40 45
           <![CDATA[ <210> 125]]>
           <![CDATA[ <211> 19]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 125]]>
          Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn
          1 5 10 15
          Pro Gly Pro
           <![CDATA[ <210> 126]]>
           <![CDATA[ <211> 18]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 126]]>
          Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn
          1 5 10 15
          Pro Gly
           <![CDATA[ <210> 127]]>
           <![CDATA[ <211> 27]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 127]]>
          Pro Thr Ser Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg Gly Ser Leu
          1 5 10 15
          Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly
                      20 25
           <![CDATA[ <210> 128]]>
           <![CDATA[ <211> 1]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 128]]>
          Pro
          1   
           <![CDATA[ <210> 129]]>
           <![CDATA[ <211> 652]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 129]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 130]]>
           <![CDATA[ <211> 2234]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 130]]>
          gggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ccggcgagaa accttacaaa tgccccgagt gcggcaagag cttcagcaga agcgacgatc 180
          tggtgaggca ccaaagaacc cacaccggcg aaaaacctta caagtgtccc gaatgcggaa 240
          agtccttcag cagagaggac aatctgcaca cccaccagag aacacacacc ggagaaaagc 300
          cttacaagtg ccccgaatgc ggcaaatcct tttctagaag cgatcatctg accacccacc 360
          aaagaacaca taccggcgag aagccttaca aatgtcccga gtgcggaaag tccttctccc 420
          agagagccaa tctgagggct catcaaagga cccataccgg cgaaaagccc tacaaatgcc 480
          ccgagtgcgg aaaatccttc agccagctgg cccatctgag agcccaccaa aggacacaca 540
          ccggagagaa accctataag tgccccgagt gtggaaaaag cttttcccag agggccaatc 600
          tgagggccca tcagaggacc cataccggag agaagcctta taaatgtccc gagtgcggaa 660
          aaagcttcag cgagaggagc catctgaggg aacatcaaag aacccacacc ggcgaaaaac 720
          ccaccggaaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc agcggcggca agcggcccgc cgccaccaag aaggccggcc 1980
          aggccaagaa gaagaagggc agctgagcgg ccgcttaatt aagctgcctt ctgcggggct 2040
          tgccttctgg ccatgccctt cttctctccc ttgcacctgt acctcttggt ctttgaataa 2100
          agcctgagta ggaagtctag aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaaaaaaaaa 2234
           <![CDATA[ <210> 131]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 131]]>
          cuggagcccg gcgagaaacc uuacaaaugc cccgagugcg gcaagagcuu cagcagaagc 60
          gacgaucugg ugaggcacca aagaacccac accggcgaaa aaccuuacaa gugucccgaa 120
          ugcggaaagu ccuucagcag agaggacaau cugcacaccc accagagaac acacaccgga 180
          gaaaagccuu acaagugccc cgaaugcggc aaauccuuuu cuagaagcga ucaucugacc 240
          accccaccaaa gaacacauac cggcgagaag ccuuacaaau guccccgagug cggaaagucc 300
          uucucccaga gagccaaucu gagggcucau caaaggaccc auaccggcga aaagcccuac 360
          aaaugccccg agugcggaaa auccuucagc cagcuggccc aucugagagc ccaccaaagg 420
          acacacaccg gagagaaacc cuauaagugc cccgagugug gaaaaagcuu uucccagagg 480
          gccaaucuga gggcccauca gaggacccau accggagaga agccuuauaa augucccgag 540
          ugcggaaaaa gcuucagcga gaggagccau cugagggaac aucaaagaac ccacaccggc 600
          gaaaaaccca ccggaaaaaa gaccagc 627
           <![CDATA[ <210> ]]>132
           <![CDATA[ <211> 1155]]>
           <![CDATA[ <212> RNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 132]]>
          agcaaggugg agaacaagac caagaagcug cggguguucg aggccuucgc cggcaucggc 60
          gcccagcgga aggcccugga gaaggugcgg aaggacgagu acgagaucgu gggccuggcc 120
          gaguguacg ugcccgccau cgugauguac caggccaucc acaacaacuu ccacaccaag 180
          cuggaguaca agagcgugag ccgggaggag augaucgacu accuggagaa caagacccug 240
          agcuggaaca gcaagaaccc cgugagcaac ggcuacugga agcggaagaa ggacgacgag 300
          cugaagauca ucuacaacgc caucaagcug agcgagaagg agggcaacau cuucgacauc 360
          cgggaccugu acaagcggac ccugaagaac aucgaccugc ugaccuacag cuuccccugc 420
          caggaccuga gccagcaggg cauccagaag ggcaugaagc ggggcagcgg cacccggagc 480
          ggccugcugu gggagaucga gcgggcccug gacagcaccg agaagaacga ccugcccaag 540
          uaccugcuga uggagaacgu gggcgcccug cugcacaaga agaacgagga ggagcugaac 600
          caguggaagc agaagcugga gagccugggc uaccagaaca gcaucgaggu gcugaacgcc 660
          gccgacuucg gcagcagcca ggcccggcgg cggguguuca ugaucagcac ccugaacgag 720
          uucguggagc ugcccaaggg cgacaagaag cccaagagca ucaagaaggu gcugaacaag 780
          aucgugagcg agaaggacau ccugaacaac cugcugaagu acaaccugac cgaguucaag 840
          aaaaccaaga gcaacaucaa caaggccagc cugaucggcu acagcaaguu caacagcgag 900
          ggcuacgugu acgaccccga guucaccggc cccacccuga ccgccagcgg cgccaacagc 960
          cggaucaaga ucaaggacgg cagcaacauc cggaagauga acagcgacga gaccuuccug 1020
          uacaucggcu ucgacagcca ggacggcaag cgggugaacg agaucgaguu ccugaccgag 1080
          aaccagaaga ucuucgugug cggcaacagc aucagcgugg aggugcugga ggccaucauc 1140
          gacaagaucg gcggc 1155
           <![CDATA[ <210> 133]]>
           <![CDATA[ <211> 690]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 133]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp
                          645 650 655
          Val Pro Asp Tyr Ala Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                      660 665 670
          Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn
                  675 680 685
          Pro Gly
              690
           <![CDATA[ <210> 134]]>
           <![CDATA[ <211> 366]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 134]]>
          Pro Leu Glu Gly Ser Ser Ser Gly Ser Gly Ser Pro Lys Lys Lys Lys Arg Lys
          1 5 10 15
          Val Gly Ile His Gly Val Pro Ala Ala Gly Ser Ser Gly Ser Leu Glu
                      20 25 30
          Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  35 40 45
          Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
              50 55 60
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala His
          65 70 75 80
          Leu Glu Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
                          85 90 95
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His
                      100 105 110
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                  115 120 125
          Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His
              130 135 140
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
          145 150 155 160
          Gln Leu Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys
                          165 170 175
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala Asp Asn
                      180 185 190
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
                  195 200 205
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala Arg His
              210 215 220
          Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr Ser Ala
          225 230 235 240
          Ser Gly Ser Gly Gly Gly Ser Gly Gly Asp Ala Lys Ser Leu Thr Ala
                          245 250 255
          Trp Ser Arg Thr Leu Val Thr Phe Lys Asp Val Phe Val Asp Phe Thr
                      260 265 270
          Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala Gln Gln Ile Leu Tyr Arg
                  275 280 285
          Asn Val Met Leu Glu Asn Tyr Lys Asn Leu Val Ser Leu Gly Tyr Gln
              290 295 300
          Leu Thr Lys Pro Asp Val Ile Leu Arg Leu Glu Lys Gly Glu Glu Pro
          305 310 315 320
          Trp Leu Val Glu Arg Glu Ile His Gln Glu Thr His Pro Asp Ser Glu
                          325 330 335
          Thr Ala Phe Glu Ile Lys Ser Ser Val Ser Gly Gly Lys Arg Pro Ala
                      340 345 350
          Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                  355 360 365
           <![CDATA[ <210> 135]]>
           <![CDATA[ <211> 6]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 135]]>
          Pro Lys Lys Lys Arg Lys
          1 5
           <![CDATA[ <210> 136]]>
           <![CDATA[ <211> 15]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 136]]>
          Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys
          1 5 10 15
           <![CDATA[ <210> 137]]>
           <![CDATA[ <211> 13]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 137]]>
          Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp
          1 5 10
           <![CDATA[ <210> 138]]>
           <![CDATA[ <211> 10]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 138]]>
          Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly
          1 5 10
           <![CDATA[ <210> 139]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 139]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Thr Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Thr Lys Asn Ser Leu Thr Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Gln Ser Gly Asp Leu Arg Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Ala
                  115 120 125
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Ser Gly Asn Leu Arg Val His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Thr Ser Gly Glu Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 140]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 140]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Ser Pro Ala Asp Leu Thr Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Ser
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser His Ser Leu Thr Glu His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Asn Asp Ala Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Asn Asp Ala Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 141]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 141]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Pro Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 142]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 142]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser His Thr Gly His Leu Leu Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Lys Lys Asp Leu Thr Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp
                  115 120 125
          Leu Arg Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala His Leu Glu Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ser Asp Lys Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Thr Asp Thr Leu Arg Asp His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 143]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 143]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser His Thr Gly His Leu Leu Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Thr Ser Gly Asn Leu Thr Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Thr Ser Gly Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Thr His Leu Asp Leu Ile Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 144]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 144]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro Gly Ala Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Asn His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His
                  115 120 125
          Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr Asn His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Asp Pro Gly His Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe
                          245 250 255
          Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp
                      260 265 270
          Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys
                  275 280 285
          Asn Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu
              290 295 300
          Arg Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His
          305 310 315 320
          Gln Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser
                          325 330 335
          Val Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 145]]>
           <![CDATA[ <211> 652]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 145]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Ala Leu Thr Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Pro Gly His Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly His
                  115 120 125
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Thr Lys Asn Ser Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 146]]>
           <![CDATA[ <211> 652]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 146]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Thr Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Arg Asp Glu Leu Asn Val His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Asn His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Ser Pro Ala Asp
                  115 120 125
          Leu Thr Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr Asn His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Ser Lys Lys Ala Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Thr His Leu Asp Leu Ile Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 147]]>
           <![CDATA[ <211> 652]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 147]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Ser Gly His Leu Thr Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Pro Gly His
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Thr Leu Thr Glu His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Thr His Leu Asp Leu Ile Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 148]]>
           <![CDATA[ <211> 652]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 148]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser His Thr Gly His Leu Leu Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Ser Lys Lys Ala Leu Thr Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser His Thr Gly His
                  115 120 125
          Leu Leu Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Ala Leu Thr Glu His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Ser Gly Asn Leu Arg Val His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 149]]>
           <![CDATA[ <211> 652]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 149]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Ser Asp His Leu Thr Asn His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Gln Leu Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Asn
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asn Leu Val Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ser Asp Glu Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Gln Leu Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr
          625 630 635 640
          Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 150]]>
           <![CDATA[ <211> 1519]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 150]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val
                      20 25 30
          Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe
                  35 40 45
          Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile
              50 55 60
          Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu
          65 70 75 80
          Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys
                          85 90 95
          Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser
                      100 105 110
          Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys
                  115 120 125
          His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr
              130 135 140
          His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp
          145 150 155 160
          Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His
                          165 170 175
          Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro
                      180 185 190
          Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr
                  195 200 205
          Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala
              210 215 220
          Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn
          225 230 235 240
          Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn
                          245 250 255
          Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe
                      260 265 270
          Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp
                  275 280 285
          Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp
              290 295 300
          Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp
          305 310 315 320
          Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser
                          325 330 335
          Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys
                      340 345 350
          Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe
                  355 360 365
          Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser
              370 375 380
          Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp
          385 390 395 400
          Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg
                          405 410 415
          Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu
                      420 425 430
          Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe
                  435 440 445
          Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile
              450 455 460
          Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp
          465 470 475 480
          Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu
                          485 490 495
          Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr
                      500 505 510
          Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser
                  515 520 525
          Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys
              530 535 540
          Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln
          545 550 555 560
          Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr
                          565 570 575
          Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp
                      580 585 590
          Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly
                  595 600 605
          Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp
              610 615 620
          Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr
          625 630 635 640
          Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala
                          645 650 655
          His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr
                      660 665 670
          Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp
                  675 680 685
          Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe
              690 695 700
          Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe
          705 710 715 720
          Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu
                          725 730 735
          His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly
                      740 745 750
          Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly
                  755 760 765
          Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln
              770 775 780
          Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile
          785 790 795 800
          Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro
                          805 810 815
          Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu
                      820 825 830
          Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg
                  835 840 845
          Leu Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys
              850 855 860
          Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Ala Arg
          865 870 875 880
          Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys
                          885 890 895
          Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys
                      900 905 910
          Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp
                  915 920 925
          Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr
              930 935 940
          Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp
          945 950 955 960
          Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser
                          965 970 975
          Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg
                      980 985 990
          Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val
                  995 1000 1005
          Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu
              1010 1015 1020
          Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile
              1025 1030 1035
          Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe
              1040 1045 1050
          Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu
              1055 1060 1065
          Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly
              1070 1075 1080
          Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr
              1085 1090 1095
          Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys
              1100 1105 1110
          Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro
              1115 1120 1125
          Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp
              1130 1135 1140
          Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser
              1145 1150 1155
          Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu
              1160 1165 1170
          Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser
              1175 1180 1185
          Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr
              1190 1195 1200
          Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser
              1205 1210 1215
          Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala
              1220 1225 1230
          Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr
              1235 1240 1245
          Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly
              1250 1255 1260
          Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His
              1265 1270 1275
          Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser
              1280 1285 1290
          Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser
              1295 1300 1305
          Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu
              1310 1315 1320
          Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala
              1325 1330 1335
          Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr
              1340 1345 1350
          Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile
              1355 1360 1365
          Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly
              1370 1375 1380
          Asp Lys Arg Pro Ala Ala Thr Lys Lys Lys Ala Gly Gln Ala Lys Lys
              1385 1390 1395
          Lys Lys Ala Ser Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr
              1400 1405 1410
          Leu Val Thr Phe Lys Asp Val Phe Val Asp Phe Thr Arg Glu Glu Glu
              1415 1420 1425
          Trp Lys Leu Leu Asp Thr Ala Gln Gln Ile Leu Tyr Arg Asn Val
              1430 1435 1440
          Met Leu Glu Asn Tyr Lys Asn Leu Val Ser Leu Gly Tyr Gln Leu
              1445 1450 1455
          Thr Lys Pro Asp Val Ile Leu Arg Leu Glu Lys Gly Glu Glu Pro
              1460 1465 1470
          Trp Leu Val Glu Arg Glu Ile His Gln Glu Thr His Pro Asp Ser
              1475 1480 1485
          Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Ser Gly Gly Lys Arg
              1490 1495 1500
          Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly
              1505 1510 1515
          Ser
           <![CDATA[ <210> 151]]>
           <![CDATA[ <211> 1811]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 151]]> Met Ala Pro Lys Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 20 25 30 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 35 40 45 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 50 55 60 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 65 70 75 80 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 85 90 95 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 100 105 110 Phe Phe His Arg Leu Glu Glu Ser PHE Leu Val Glu Glu Glu ASP LYS LYS LYS LYS LYS LYS LYS LYS 115 120 HIS GLU ARG HIS Pro Ile PHE GLE Val ASP GLU Val Ala Tyr 130 135 His Glu Lys Tyr His Leu ARG LYS LYS LYS LYS LYS LYS Leu Val ASP 145 150 155 160 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 165 170 175 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 180 185 190 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 195 200 205 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 210 215 220 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 225 230 235 240 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 245 250 255 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 260 265 270 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 275 280 285 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 290 295 300 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 305 310 315 320 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 325 330 335 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 340 345 350 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 355 360 365 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 370 375 380 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 385 390 395 400 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu ASP Leu Leu ARG 410 415 LYS GLN ARG THR PHR PHE Asn Gly Serle Pro His Gln Ile His Leu 420 425 430 GLU HIS ALA ILE Leu ARG Gln Gln Glu Asr Pro PHE 4 35 440 445 leu lys asp asn arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 450 455 460 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 465 470 475 480 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 485 490 495 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 500 505 510 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 515 520 525 Leu Leu Tyr Glu Tyr Phe Thr Val Ty r Asn Glu Leu Thr Lys Val Lys 530 535 540 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 545 550 555 560 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 565 570 575 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 580 585 590 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 595 600 605 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 610 615 620 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 625 630 635 640 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 645 650 655 His Leu Phe Asp A sp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 660 665 670 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 675 680 685 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 690 695 700 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 705 710 715 720 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 725 730 735 His Glu His Ile Ala Asn Leu A la Gly Ser Pro Ala Ile Lys Lys Gly 740 745 750 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 755 760 765 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 770 775 780 Thr Thr GLN LYS GLY GLN LSN Serg Glu ARG MET LYS ARG ILE 785 795 800 GLU GLY ILE LYS GLU Leu GLN ILE Leu Ly Glu His Pro 805 Val Gl Gln Leu GLN Asn Glu LYS Leu Tyr Leu Tyr Tyr Leu 820 825 830 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 835 840 845 Leu Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys 850 855 860 Asp Asp Ser Ile Asp Asn LYS VAL Leu Thr ASP LYS ALA ALA ALA ARG 865 870 880 Gly LYS Sern Val Pro Serg Val Val Val Lys Met Lys 885 895 ARG Gln Leu Leu asn Ala LYS Leu Ile Thr Gln ARG LYS 900 905 910 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 915 920 925 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 930 935 940 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 945 950 955 960 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 965 970 975 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 980 985 990 G lu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 995 1000 1005 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu 1010 1015 1020 Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys M et Ile 1025 1030 1035 Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1040 1045 1050 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu 1055 1060 1065 Ala Asn Gly Glu Ile Ar g Lys Arg Pro Leu Ile Glu Thr Asn Gly 1070 1075 1080 Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr 1085 1090 1095 Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys 1100 1105 1110 Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro 1115 1120 1125 Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp 1130 1135 1140 Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser 1145 1150 1155 Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu 1160 1165 1170 Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser 1175 1180 1185 Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr 1190 1 195 1200 Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser 1205 1210 1215 Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro S er Lys Tyr 1235 1240 1245 Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly 1250 1255 1260 Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His 1265 1270 1275 Lys His Ty r Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1280 1285 1290 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser 1295 1300 1305 Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu 1310 1315 1320 Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala 1325 1330 1335 Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr 1340 1345 1350 Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile 1355 136 0 1365 Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly 1370 1375 1380 Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys 1385 1390 1395 Lys Lys Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Lys Leu 1400 1405 1410 Arg Val Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala 1415 1420 1425 Leu Glu Lys Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala 1430 1435 1440 Glu Trp Tyr Val Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn 1445 1450 1455 Asn Phe His Thr Lys Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu 1460 1465 1470 Met Ile Asp Tyr Leu Glu Asn Lys Thr Leu Ser Trp Asn Ser Lys 1475 1480 1485 As n Pro Val Ser Asn Gly Tyr Trp Lys Arg Lys Lys Asp Asp Glu 1490 1495 1500 Leu Lys Ile Ile Tyr Asn Ala Ile Lys Leu Ser Glu Lys Glu Gly 1505 1510 1515 Asn Ile Phe Asp Ile Arg Asp Leu Tyr Lys Arg Thr Leu Lys Asn 1520 1525 1530 Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys Gln Asp Leu Ser Gln 1535 1540 1545 Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser Gly Thr Arg Ser 1550 1555 1560 Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser Thr Glu Lys 15 65 1570 1575 Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly Ala Leu 1580 1585 1590 Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln Lys 1595 1600 1605 Leu Glu Ser Leu Gly Tyr Gln Asn S er Ile Glu Val Leu Asn Ala 1610 1615 1620 Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile 1625 1630 1635 Ser Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys 1640 1645 1650 Pro Lys Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys 1655 1660 1665 Asp Ile Leu Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys 1670 1675 1680 Lys Thr Lys Ser Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser 1685 1690 16 95 Lys Phe Asn Ser Glu Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly 1700 1705 1710 Pro Thr Leu Thr Ala Ser Gly Ala Asn Ser Arg Ile Lys Ile Lys 1715 1720 1725 Asp Gly Ser Asn Ile Arg Lys Met Asn Ser Asp Glu Thr Phe Leu 1730 173 5 1740 Tyr Ile Gly Phe Asp Ser Gln Asp Gly Lys Arg Val Asn Glu Ile 1745 1750 1755 Glu Phe Leu Thr Glu Asn Gln Lys Ile Phe Val Cys Gly Asn Ser 1760 1765 1770 Ile Ser Val Glu Val Leu Glu Ala Ile Ile Asp Lys Ile Gly G ly 1775 1780 1785 Pro Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly 1790 1795 1800 Gln Ala Lys Lys Lys Lys Lys Gly Ser 1805 1810 <![CDATA[ <210> 152]]>
           <![CDATA[ <211> 1913]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 152]]> Met Ala Pro Lys Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 20 25 30 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 35 40 45 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 50 55 60 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 65 70 75 80 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 85 90 95 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 100 105 110 Phe Phe His Arg Leu Glu Glu Ser PHE Leu Val Glu Glu Glu ASP LYS LYS LYS LYS LYS LYS LYS LYS 115 120 HIS GLU ARG HIS Pro Ile PHE GLE Val ASP GLU Val Ala Tyr 130 135 His Glu Lys Tyr His Leu ARG LYS LYS LYS LYS LYS LYS Leu Val ASP 145 150 155 160 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 165 170 175 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 180 185 190 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 195 200 205 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 210 215 220 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 225 230 235 240 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 245 250 255 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 260 265 270 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 275 280 285 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 290 295 300 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 305 310 315 320 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 325 330 335 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 340 345 350 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 355 360 365 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 370 375 380 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 385 390 395 400 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu ASP Leu Leu ARG 410 415 LYS GLN ARG THR PHR PHE Asn Gly Serle Pro His Gln Ile His Leu 420 425 430 GLU HIS ALA ILE Leu ARG Gln Gln Glu Asr Pro PHE 4 35 440 445 leu lys asp asn arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 450 455 460 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 465 470 475 480 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 485 490 495 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 500 505 510 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 515 520 525 Leu Leu Tyr Glu Tyr Phe Thr Val Ty r Asn Glu Leu Thr Lys Val Lys 530 535 540 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 545 550 555 560 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 565 570 575 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 580 585 590 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 595 600 605 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 610 615 620 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 625 630 635 640 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 645 650 655 His Leu Phe Asp A sp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 660 665 670 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 675 680 685 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 690 695 700 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 705 710 715 720 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 725 730 735 His Glu His Ile Ala Asn Leu A la Gly Ser Pro Ala Ile Lys Lys Gly 740 745 750 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 755 760 765 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 770 775 780 Thr Thr GLN LYS GLY GLN LSN Serg Glu ARG MET LYS ARG ILE 785 795 800 GLU GLY ILE LYS GLU Leu GLN ILE Leu Ly Glu His Pro 805 Val Gl Gln Leu GLN Asn Glu LYS Leu Tyr Leu Tyr Tyr Leu 820 825 830 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 835 840 845 Leu Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys 850 855 860 Asp Asp Ser Ile Asp Asn LYS VAL Leu Thr ASP LYS ALA ALA ALA ARG 865 870 880 Gly LYS Sern Val Pro Serg Val Val Val Lys Met Lys 885 895 ARG Gln Leu Leu asn Ala LYS Leu Ile Thr Gln ARG LYS 900 905 910 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 915 920 925 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 930 935 940 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 945 950 955 960 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 965 970 975 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 980 985 990 G lu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 995 1000 1005 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu 1010 1015 1020 Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys M et Ile 1025 1030 1035 Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1040 1045 1050 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu 1055 1060 1065 Ala Asn Gly Glu Ile Ar g Lys Arg Pro Leu Ile Glu Thr Asn Gly 1070 1075 1080 Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr 1085 1090 1095 Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys 1100 1105 1110 Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro 1115 1120 1125 Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp 1130 1135 1140 Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser 1145 1150 1155 Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu 1160 1165 1170 Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser 1175 1180 1185 Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr 1190 1 195 1200 Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser 1205 1210 1215 Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro S er Lys Tyr 1235 1240 1245 Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly 1250 1255 1260 Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His 1265 1270 1275 Lys His Ty r Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1280 1285 1290 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser 1295 1300 1305 Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu 1310 1315 1320 Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala 1325 1330 1335 Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr 1340 1345 1350 Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile 1355 136 0 1365 Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly 1370 1375 1380 Asp Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln 1385 1390 1395 Ala Lys Lys Lys Lys Ser Gly Gly Gly Gly Ser Val Asp Leu Arg 1400 1405 1410 Thr Leu Asp Val Phe Ser Gly Cys Gly Gly Leu Ser Glu Gly Phe 1415 1420 1425 His Gln Ala Gly Ile Ser Asp Thr Leu Trp Ala Ile Glu Met Trp 1430 1435 1440 Asp Pro Ala Ala Gln Ala Phe Arg Leu Asn Asn Pro Gly Ser Thr 1445 1450 1455 Val Phe Thr Glu Asp Cys Asn Ile Leu Leu Lys Leu Val Met Ala 1460 1465 1470 Gly Glu Thr Asn Ser Arg Gly Gln Arg Leu Pro Gln Lys Gly 1475 1480 1485 Asp Val Glu M et Leu Cys Gly Gly Pro Pro Cys Gln Gly Phe Ser 1490 1495 1500 Gly Met Asn Arg Phe Asn Ser Arg Thr Tyr Ser Lys Phe Lys Asn 1505 1510 1515 Ser Leu Val Val Ser Phe Leu Ser Tyr Cys Asp Tyr Tyr Arg Pro 1520 1525 1530 Arg Phe Phe Leu Leu Glu Asn Val Arg Asn Phe Val Ser Phe Lys 1535 1540 1545 Arg Ser Met Val Leu Lys Leu Thr Leu Arg Cys Leu Val Arg Met 1550 1555 1560 Gly Tyr Gln Cys Thr Phe Gly Val Leu Gln Ala Gly Gln Tyr Gly 1565 1570 1575 Val Ala Gln Thr Arg Arg Arg Ala Ile Ile Ile Leu Ala Ala Ala Pro 1580 1585 1590 Gly Glu Lys Leu Pro Leu Phe Pro Glu Pro Leu His Val Phe Ala 1595 1600 1605 Pro Arg Ala Cys Gln Leu Ser Val Val Val Asp Asp Lys Lys Phe 1610 1615 1620 Val Ser Asn Ile Thr Arg Leu Ser Ser Gly Pro Phe Arg Thr Ile 1625 1630 1635 Thr Val Arg Asp Thr Met Ser Asp Leu Pro Glu Val Arg Asn Gly 1640 1645 1650 Ala Ser Ala Leu Glu Ile S er Tyr Asn Gly Glu Pro Gln Ser Trp 1655 1660 1665 Phe Gln Arg Gln Leu Arg Gly Ala Gln Tyr Gln Pro Ile Leu Arg 1670 1675 1680 Asp His Ile Cys Lys Asp Met Ser Ala Leu Val Ala Ala Arg Met 1685 1690 1695 Arg His Ile Pro Leu Ala Pro Gly Ser Asp Trp Arg Asp Leu Pro 1700 1705 1710 Asn Ile Glu Val Arg Leu Ser Asp Gly Thr Met Ala Arg Lys Leu 1715 1720 1725 Arg Tyr Thr His His Asp Arg Lys Asn Gly Arg Ser Ser Ser Ser Gly 1730 1735 1740 Ala. Leu ARG GLY VAL CYS VAL GLU Ala Gly Lys Ala Cys 1745 1755 ASP Pro Ala Ala ARG Gln PHR Leu Ile Pro TRP CYS Leu 1760 1770 PRO His Thr Gly ass n aRG HIS Asn His Tyr Gly Leu Tyr Gly 1775 1780 1785 Arg Leu Glu Trp Asp Gly Phe Phe Ser Thr Thr Val Thr Asn Pro 1790 1795 1800 Glu Pro Met Gly Lys Gln Gly Arg Val Leu His Pro Glu Gln His 1805 1810 1815 Arg Val Val Ser Val Arg Glu Cys Ala Arg Ser Gln Gly Phe Pro 1820 1825 1830 Asp Thr Tyr Arg Leu Phe Gly Asn Ile Leu Asp Lys His Arg Gln 1835 1840 1845 Val Gly Asn Ala Val Pro Pro Pro Leu Ala Lys Ala Ile Gly Leu 1850 1855 1860 Glu Ile Lys Leu Cys Met Leu Ala Lys Ala Arg Glu Ser Ala Ser 1865 1870 1875 Ala Lys Ile Lys Glu Glu Glu Ala Ala Lys Asp Gly Gly Gly Gly 1880 1885 1890 Ser Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys 1895 1900 1905 L ys Lys Lys Gly Ser 1910 <![CDATA[ <210> 153]]>
           <![CDATA[ <211> 1977]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 153]]> Met Ala Pro Lys Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 20 25 30 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 35 40 45 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 50 55 60 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 65 70 75 80 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 85 90 95 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 100 105 110 Phe Phe His Arg Leu Glu Glu Ser PHE Leu Val Glu Glu Glu ASP LYS LYS LYS LYS LYS LYS LYS LYS 115 120 HIS GLU ARG HIS Pro Ile PHE GLE Val ASP GLU Val Ala Tyr 130 135 His Glu Lys Tyr His Leu ARG LYS LYS LYS LYS LYS LYS Leu Val ASP 145 150 155 160 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 165 170 175 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 180 185 190 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 195 200 205 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 210 215 220 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 225 230 235 240 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 245 250 255 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 260 265 270 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 275 280 285 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 290 295 300 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 305 310 315 320 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 325 330 335 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 340 345 350 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 355 360 365 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 370 375 380 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 385 390 395 400 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu ASP Leu Leu ARG 410 415 LYS GLN ARG THR PHR PHE Asn Gly Serle Pro His Gln Ile His Leu 420 425 430 GLU HIS ALA ILE Leu ARG Gln Gln Glu Asr Pro PHE 4 35 440 445 leu lys asp asn arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 450 455 460 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 465 470 475 480 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 485 490 495 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 500 505 510 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 515 520 525 Leu Leu Tyr Glu Tyr Phe Thr Val Ty r Asn Glu Leu Thr Lys Val Lys 530 535 540 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 545 550 555 560 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 565 570 575 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 580 585 590 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 595 600 605 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 610 615 620 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 625 630 635 640 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 645 650 655 His Leu Phe Asp A sp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 660 665 670 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 675 680 685 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 690 695 700 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 705 710 715 720 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 725 730 735 His Glu His Ile Ala Asn Leu A la Gly Ser Pro Ala Ile Lys Lys Gly 740 745 750 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 755 760 765 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 770 775 780 Thr Thr GLN LYS GLY GLN LSN Serg Glu ARG MET LYS ARG ILE 785 795 800 GLU GLY ILE LYS GLU Leu GLN ILE Leu Ly Glu His Pro 805 Val Gl Gln Leu GLN Asn Glu LYS Leu Tyr Leu Tyr Tyr Leu 820 825 830 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 835 840 845 Leu Ser Asp Tyr Asp Val Ala Ala Ile Val Pro Gln Ser Phe Leu Lys 850 855 860 Asp Asp Ser Ile Asp Asn LYS VAL Leu Thr ASP LYS ALA ALA ALA ARG 865 870 880 Gly LYS Sern Val Pro Serg Val Val Val Lys Met Lys 885 895 ARG Gln Leu Leu asn Ala LYS Leu Ile Thr Gln ARG LYS 900 905 910 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 915 920 925 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 930 935 940 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 945 950 955 960 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 965 970 975 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 980 985 990 G lu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 995 1000 1005 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu 1010 1015 1020 Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys M et Ile 1025 1030 1035 Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1040 1045 1050 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu 1055 1060 1065 Ala Asn Gly Glu Ile Ar g Lys Arg Pro Leu Ile Glu Thr Asn Gly 1070 1075 1080 Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr 1085 1090 1095 Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys 1100 1105 1110 Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro 1115 1120 1125 Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp 1130 1135 1140 Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser 1145 1150 1155 Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu 1160 1165 1170 Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser 1175 1180 1185 Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr 1190 1 195 1200 Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser 1205 1210 1215 Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro S er Lys Tyr 1235 1240 1245 Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly 1250 1255 1260 Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His 1265 1270 1275 Lys His Ty r Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1280 1285 1290 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser 1295 1300 1305 Ala Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu 1310 1315 1320 Asn Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala 1325 1330 1335 Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr 1340 1345 1350 Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile 1355 136 0 1365 Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly 1370 1375 1380 Asp Ser Ala Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 1385 1390 1395 Gly Gly Ser Gly Pro Lys Lys Lys Lys Arg Lys Val Ala Ala Ala Gly 1400 1405 1410 Ser Asn His Asp Gln Glu Phe Asp Pro Pro Lys Val Tyr Pro Pro 1415 1420 1425 Val Pro Ala Glu Lys Arg Lys Pro Ile Arg Val Leu Ser Leu Phe 1430 1435 1440 Asp Gly Ile Ala Thr Gly Leu Leu Val Leu Lys Asp Leu Gly Ile 1445 1450 1455 Gln Val Asp Arg Tyr Ile Ala Ser Glu Val Cys Glu Asp Ser Ile 1460 1465 1470 Thr Val Gly Met Val Arg His Gln Gly Lys Ile Met Tyr Val Gly 1475 1480 1485 Asp Val Ar g Ser Val Thr Gln Lys His Ile Gln Glu Trp Gly Pro 1490 1495 1500 Phe Asp Leu Val Ile Gly Gly Ser Pro Cys Asn Asp Leu Ser Ile 1505 1510 1515 Val Asn Pro Ala Arg Lys Gly Leu Tyr Glu Gly Thr Gly Arg Leu 1520 1525 153 0 Phe Phe Glu Phe Tyr Arg Leu Leu His Asp Ala Arg Pro Lys Glu 1535 1540 1545 Gly Asp Asp Arg Pro Phe Phe Trp Leu Phe Glu Asn Val Val Ala 1550 1555 1560 Met Gly Val Ser Asp Lys Arg Asp Ile Ser Arg Phe Leu Glu Ser 1565 1 570 1575 Asn Pro Val Met Ile Asp Ala Lys Glu Val Ser Ala Ala His Arg 1580 1585 1590 Ala Arg Tyr Phe Trp Gly Asn Leu Pro Gly Met Asn Arg Pro Leu 1595 1600 1605 Ala Ser Thr Val Asn Asp Lys Leu Glu Leu Gln G lu Cys Leu Glu 1610 1615 1620 His Gly Arg Ile Ala Lys Phe Ser Lys Val Arg Thr Ile Thr Thr 1625 1630 1635 Arg Ser Asn Ser Ile Lys Gln Gly Lys Asp Gln His Phe Pro Val 1640 1645 1650 Phe Met Asn Glu Lys Glu Asp Ile Leu Trp Cys Thr Glu Met Glu 1655 1660 1665 Arg Val Phe Gly Phe Pro Val His Tyr Thr Asp Val Ser Asn Met 1670 1675 1680 Ser Arg Leu Ala Arg Gln Arg Leu Leu Gly Arg Ser Trp Ser Val 1685 1690 1695 Pro Val Ile Arg His Leu Phe Ala Pro Leu Lys Glu Tyr Phe Ala 1700 1705 1710 Cys Val Ser Ser Gly Asn Ser Asn Ala Asn Ser Arg Gly Pro Ser 1715 1720 1725 Phe Ser Ser Gly Leu Val Pro Leu Ser Leu Arg Gly Ser His Met 1730 1735 1740 Asn Pro Leu Glu Met Phe Glu Thr Val Pro Val Trp Arg Arg Gln 1745 1750 1755 Pro Val Arg Val Leu Ser Leu Phe Glu Asp Ile Lys Lys Glu Leu 1760 1765 1770 Thr Ser Leu Gly Phe Leu Glu Ser Gly Ser Asp Pro Gly Gln Leu 1775 1780 1785 Lys His Val Asp Val Thr Asp Thr Val Arg Lys Asp Val Glu 1790 1795 1800 Glu Trp Gly Pro Phe Asp Leu Val Tyr Gly Ala Thr Pro Pro Leu 1805 1810 1815 Gly His Thr Cys Asp Arg Pro Pro Ser Tr p Tyr Leu Phe Gln Phe 1820 1825 1830 His Arg Leu Leu Gln Tyr Ala Arg Pro Lys Pro Gly Ser Pro Arg 1835 1840 1845 Pro Phe Phe Trp Met Phe Val Asp Asn Leu Val Leu Asn Lys Glu 1850 1855 1860 Asp Leu Asp Val Ala Ser Arg Phe Leu Glu Met Glu Pro Val Thr 1865 1870 1875 Ile Pro Asp Val His Gly Gly Ser Leu Gln Asn Ala Val Arg Val 1880 1885 1890 Trp Ser Asn Ile Pro Ala Ile Arg Ser Arg His Trp Ala Leu Val 1895 1900 190 5 Ser Glu Glu Glu Leu Ser Leu Leu Ala Gln Asn Lys Gln Ser Ser 1910 1915 1920 Lys Leu Ala Ala Lys Trp Pro Thr Lys Leu Val Lys Asn Cys Phe 1925 1930 1935 Leu Pro Leu Arg Glu Tyr Phe Lys Tyr Phe Ser Thr Glu Leu Thr 19 40 1945 1950 Ser Ser Leu Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala 1955 1960 1965 Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser 1970 1975 <![CDATA[ <210> 154]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 154]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Thr Ser Gly Glu Leu Val Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg
                  35 40 45
          Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Thr Leu Thr
          65 70 75 80
          Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr Glu His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Thr Ser Gly Ser Leu Val Arg His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Ser Pro
          145 150 155 160
          Ala Asp Leu Thr Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Ser Gly Asn Leu Arg
                      180 185 190
          Val His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 155]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 155]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg
                  35 40 45
          Ala Asn Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala Asp Asn Leu Thr
          65 70 75 80
          Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Leu Val Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Asp Lys Lys Asp Leu Thr Arg His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Ser Pro
          145 150 155 160
          Ala Asp Leu Thr Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly His Leu Thr
                      180 185 190
          Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 156]]>
           <![CDATA[ <211> 209]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 156]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Gln Ser Gly Asp Leu Arg Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser
                  35 40 45
          Gly Asp Leu Arg Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg
          65 70 75 80
          Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser His Arg Thr Thr Leu Thr Asn His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Ser
          145 150 155 160
          Gly Asn Leu Arg Val His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Leu Val
                      180 185 190
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr
                  195 200 205
          Ser
           <![CDATA[ <210> 157]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 157]]>
          cttgagcccg gagaaaagcc atacaaatgt cctgaatgcg gaaagtcatt ttctacgagc 60
          ggcgaactcg tgcggcacca aaggactcat accggcgaaa agccttacaa atgcccggag 120
          tgcggaaaaa gcttctccga gcgctcgcac ttgcgggaac accagcgaac ccacacaggg 180
          gagaaaccgt ataagtgccc agagtgcggc aaatcgttct cccggaacga caccctgacc 240
          gaacaccaac gcactcatac tggcgaaaaa ccttacaagt gccctgagtg tggaaagagc 300
          ttctcccgcg ccgataacct gaccgagcac cagcggaccc ataccgggga aaagccgtac 360
          aagtgtccgg aatgcggcaa aagcttcagc acctcgggtt ccctggtccg gcatcagaga 420
          actcacaccg gagagaaacc ctataagtgt cctgagtgcg ggaagtcctt ttcatcgccc 480
          gcggacctga ctagacacca gaggacccac accggggaga agccctacaa gtgccccgaa 540
          tgtggaaagt ccttctccga ctccggcaac ctccgggtgc accagcgcac ccacactgga 600
          gagaagccga ccggaaagaa aacttcc 627
           <![CDATA[ <210> 158]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 158]]>
          ctggaacccg gagaaaaacc ttataagtgc cctgaatgcg gaaagtcatt ctcgaggtcg 60
          gacaagctcg tgcggcacca gaggacacac accggggaaa agccatacaa gtgtcccgaa 120
          tgtggaaagt ccttcagcca acgcgccaac ctgagagctc atcagcggac tcacactggc 180
          gaaaaaccgt acaaatgccc cgaatgcggc aaaagcttct cccgcgccga caacttgacc 240
          gagcaccagc ggacccatac cggcgaaaag ccgtacaagt gcccggagtg tgggaagtcg 300
          ttcagccagt cctcttccct cgtgcgccac caacgcaccc atactgggga gaagccctat 360
          aagtgtcctg agtgtggcaa atcattcagc gataagaagg atcttacccg gcaccaacgg 420
          actcataccg gagagaagcc ttacaagtgc cccgagtgcg gaaagagctt ctcgtccccg 480
          gcggacctga ctagacacca gcgcacccac accggagaaa agccctacaa gtgcccagag 540
          tgcgggaagt ccttttccca atccggtcac ctgactgagc accagagaac ccacacggga 600
          gagaaaccga ccggaaagaa aacctcc 627
           <![CDATA[ <210> 159]]>
           <![CDATA[ <211> 627]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 159]]>
          ttggaacccg gagaaaagcc atacaaatgc cccgaatgcg gaaagtcgtt cagccagtcc 60
          ggcgacctca gacggcacca acggactcac accggcgaaa aaccgtacaa gtgcccagag 120
          tgcggcaaaa gctttagcca gtcgggcgat ctgcggagac atcagcgcac tcacactggt 180
          gaaaagccct acaagtgtcc tgagtgcggg aagtccttca gcgagcgctc ccatcttcgc 240
          gagcaccaga gaacccacac tggagaaaaa ccttataagt gccctgagtg tggcaaatcc 300
          ttctcaacca ccggcaacct gactgtgcac cagcggaccc acacaggggga gaagccttac 360
          aagtgcccgg agtgtgggaa gtcattctcc catcggacga ccctgaccaa ccaccagagg 420
          acccatactg gcgaaaagcc gtataagtgt ccggagtgcg gaaagagctt ctccgactcc 480
          ggaaacctca gggtgcacca acgcacccac accggagaga agccgtacaa atgtcccgaa 540
          tgtggaaagt ccttctccca atcctcttcg ctggtccggc accagcgaac tcataccggg 600
          gaaaagccca ccggaaagaa aacctcg 627
           <![CDATA[ <210> 160]]>
           <![CDATA[ <211> 659]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 160]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Asn Asp Thr Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala Asp Asn
                  115 120 125
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Ser Leu Val Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Ser Pro Ala Asp Leu Thr Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Ser Gly Asn Leu Arg Val His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys
          625 630 635 640
          Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro
                          645 650 655
          Asp Tyr Ala
           <![CDATA[ <210> 161]]>
           <![CDATA[ <211> 659]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 161]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Ser
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Lys Lys Asp Leu Thr Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Ser Pro Ala Asp Leu Thr Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Gln Ser Gly His Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys
          625 630 635 640
          Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro
                          645 650 655
          Asp Tyr Ala
           <![CDATA[ <210> 162]]>
           <![CDATA[ <211> 659]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 162]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn
                  115 120 125
          Leu Thr Val His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser His Arg Thr Thr Leu Thr Asn His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Asp Ser Gly Asn Leu Arg Val His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Gln Ser Ser Ser Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys
          625 630 635 640
          Ala Gly Gln Ala Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro
                          645 650 655
          Asp Tyr Ala
           <![CDATA[ <210> 163]]>
           <![CDATA[ <211> 650]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 163]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Asn Asp Thr Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ala Asp Asn
                  115 120 125
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Ser Leu Val Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Ser Pro Ala Asp Leu Thr Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Ser Gly Asn Leu Arg Val His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys
          625 630 635 640
          Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 164]]>
           <![CDATA[ <211> 650]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 164]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ala Asp Asn Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Ser Ser
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Lys Lys Asp Leu Thr Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Ser Pro Ala Asp Leu Thr Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Gln Ser Gly His Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys
          625 630 635 640
          Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 165]]>
           <![CDATA[ <211> 650]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 165]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn
                  115 120 125
          Leu Thr Val His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser His Arg Thr Thr Leu Thr Asn His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Asp Ser Gly Asn Leu Arg Val His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Gln Ser Ser Ser Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys
          625 630 635 640
          Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser
                          645 650
           <![CDATA[ <210> 166]]>
           <![CDATA[ <211> 2255]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 166]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tcccttgagc 120
          ccggagaaaa gccatacaaa tgtcctgaat gcggaaagtc attttctacg agcggcgaac 180
          tcgtgcggca ccaaaggact cataccggcg aaaagcctta caaatgcccg gagtgcggaa 240
          aaagcttctc cgagcgctcg cacttgcggg aacaccagcg aacccacaca ggggagaaac 300
          cgtataagtg cccagagtgc ggcaaatcgt tctcccggaa cgacaccctg accgaacacc 360
          aacgcactca tactggcgaa aaaccttaca agtgccctga gtgtggaaag agcttctccc 420
          gcgccgataa cctgaccgag caccagcgga cccataccgg ggaaaagccg tacaagtgtc 480
          cggaatgcgg caaaagcttc agcacctcgg gttccctggt ccggcatcag agaactcaca 540
          ccggagagaa accctataag tgtcctgagt gcgggaagtc cttttcatcg cccgcggacc 600
          tgactagaca ccagaggacc cacaccgggg agaagcccta caagtgcccc gaatgtggaa 660
          agtccttctc cgactccggc aacctccggg tgcaccagcg cacccacact ggagagaagc 720
          cgaccggaaa gaaaacttcc gcctccggtt cgggaggagg ctcaggagga gcgagagatt 780
          ccaaggtcga gaacaagacc aagaagctgc gggtgttcga ggcctttgct ggcatcggag 840
          cccagaggaa ggccctcgag aaggtccgca aggatgagta cgagatcgtg ggactcgcgg 900
          agtggtacgt gcccgccatt gtgatgtacc aggccatcca taacaacttc cacactaagc 960
          tggagtacaa gtccgtgtcc cgggaggaaa tgattgacta cctggagaat aagaccctgt 1020
          catggaactc taagaaccccc gtgtcgaacg gttactggaa gagaaagaag gatgacgaac 1080
          tgaagattat ctacaacgcg atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctcta caagcgcacc ttgaagaaca tcgatctgct gacctactcc ttcccgtgcc 1200
          aagacctgag ccagcagggc atccagaagg ggatgaaacg gggctccggt actcgcagcg 1260
          gcttgctgtg ggaaattgag cgggccctgg atagcaccga gaagaacgac ttgccgaagt 1320
          atcttctcat ggaaaacgtc ggggctctcc ttcacaagaa gaacgaggaa gaactgaacc 1380
          agtggaagca aaagctggaa tccctcggat accagaactc cattgaggtc ctgaacgccg 1440
          ccgacttcgg atcgtcgcaa gccagacgga gggtgttcat gattagcact ctgaacgaat 1500
          tcgtggaact gccgaagggc gacaagaagc ctaagtccat caagaaggtg ctgaacaaga 1560
          tcgtgtccga gaaggacatt ctcaacaatc tgctgaagta caacctgaca gagttcaaga 1620
          aaaccaagtc caacatcaac aaggcctcct tgattggtta ctcaaagttc aacagcgagg 1680
          gatacgtgta cgaccccgaa ttcactggac ccactctgac cgcctccgga gcaaactcta 1740
          ggattaagat caaggacggc tccaacatcc ggaagatgaa ctccgacgaa acctttctgt 1800
          acatcggctt cgactcgcaa gacggaaagc gcgtgaacga gatcgaattt cttaccgaaa 1860
          accagaagat cttcgtgtgc ggcaattcaa tctccgtgga agtcctggaa gcgattatcg 1920
          acaagatcgg aggcagtggt ggaaagcgcc cagcagccac taagaaggcc ggacaggcca 1980
          agaagaagaagaa gggatcctac ccttacgatg tgccggatta cgcttgagcg gccgcttaat 2040
          taagctgcct tctgcggggc ttgccttctg gccatgccct tcttctctcc cttgcacctg 2100
          tacctcttgg tctttgaata aagcctgagt aggaagtcta gaaaaaaaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2255
           <![CDATA[ <210> 167]]>
           <![CDATA[ <211> 2255]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 167]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggaac 120
          ccggagaaaa accttataag tgccctgaat gcggaaagtc attctcgagg tcggacaagc 180
          tcgtgcggca ccagaggaca cacaccgggg aaaagccata caagtgtccc gaatgtggaa 240
          agtccttcag ccaacgcgcc aacctgagag ctcatcagcg gactcacact ggcgaaaaac 300
          cgtacaaatg ccccgaatgc ggcaaaagct tctcccgcgc cgacaacttg accgagcacc 360
          agcggaccca taccggcgaa aagccgtaca agtgcccgga gtgtgggaag tcgttcagcc 420
          agtcctcttc cctcgtgcgc caccaacgca cccatactgg ggagaagccc tataagtgtc 480
          ctgagtgtgg caaatcattc agcgataaga aggatcttac ccggcaccaa cggactcata 540
          ccggagagaa gccttacaag tgccccgagt gcggaaagag cttctcgtcc ccggcggacc 600
          tgactagaca ccagcgcacc cacaccggag aaaagcccta caagtgccca gagtgcggga 660
          agtccttttc ccaatccggt cacctgactg agcaccagag aacccacacg ggagagaaac 720
          cgaccggaaa gaaaacctcc gcctccggtt cgggaggagg ctcaggagga gcgagagatt 780
          ccaaggtcga gaacaagacc aagaagctgc gggtgttcga ggcctttgct ggcatcggag 840
          cccagaggaa ggccctcgag aaggtccgca aggatgagta cgagatcgtg ggactcgcgg 900
          agtggtacgt gcccgccatt gtgatgtacc aggccatcca taacaacttc cacactaagc 960
          tggagtacaa gtccgtgtcc cgggaggaaa tgattgacta cctggagaat aagaccctgt 1020
          catggaactc taagaaccccc gtgtcgaacg gttactggaa gagaaagaag gatgacgaac 1080
          tgaagattat ctacaacgcg atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctcta caagcgcacc ttgaagaaca tcgatctgct gacctactcc ttcccgtgcc 1200
          aagacctgag ccagcagggc atccagaagg ggatgaaacg gggctccggt actcgcagcg 1260
          gcttgctgtg ggaaattgag cgggccctgg atagcaccga gaagaacgac ttgccgaagt 1320
          atcttctcat ggaaaacgtc ggggctctcc ttcacaagaa gaacgaggaa gaactgaacc 1380
          agtggaagca aaagctggaa tccctcggat accagaactc cattgaggtc ctgaacgccg 1440
          ccgacttcgg atcgtcgcaa gccagacgga gggtgttcat gattagcact ctgaacgaat 1500
          tcgtggaact gccgaagggc gacaagaagc ctaagtccat caagaaggtg ctgaacaaga 1560
          tcgtgtccga gaaggacatt ctcaacaatc tgctgaagta caacctgaca gagttcaaga 1620
          aaaccaagtc caacatcaac aaggcctcct tgattggtta ctcaaagttc aacagcgagg 1680
          gatacgtgta cgaccccgaa ttcactggac ccactctgac cgcctccgga gcaaactcta 1740
          ggattaagat caaggacggc tccaacatcc ggaagatgaa ctccgacgaa acctttctgt 1800
          acatcggctt cgactcgcaa gacggaaagc gcgtgaacga gatcgaattt cttaccgaaa 1860
          accagaagat cttcgtgtgc ggcaattcaa tctccgtgga agtcctggaa gcgattatcg 1920
          acaagatcgg aggcagtggt ggaaagcgcc cagcagccac taagaaggcc ggacaggcca 1980
          agaagaagaagaa gggatcctac ccttacgatg tgccggatta cgcttgagcg gccgcttaat 2040
          taagctgcct tctgcggggc ttgccttctg gccatgccct tcttctctcc cttgcacctg 2100
          tacctcttgg tctttgaata aagcctgagt aggaagtcta gaaaaaaaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2255
           <![CDATA[ <210> 168]]>
           <![CDATA[ <211> 2255]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 168]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccttggaac 120
          ccggagaaaa gccatacaaa tgccccgaat gcggaaagtc gttcagccag tccggcgacc 180
          tcagacggca ccaacggact cacaccggcg aaaaaccgta caagtgccca gagtgcggca 240
          aaagctttag ccagtcgggc gatctgcgga gacatcagcg cactcacact ggtgaaaagc 300
          cctacaagtg tcctgagtgc gggaagtcct tcagcgagcg ctcccatctt cgcgagcacc 360
          agagaaccca cactggagaa aaaccttata agtgccctga gtgtggcaaa tccttctcaa 420
          ccaccggcaa cctgactgtg caccagcgga cccacacagg ggagaagcct tacaagtgcc 480
          cggagtgtgg gaagtcattc tcccatcgga cgaccctgac caaccaccag aggacccata 540
          ctggcgaaaa gccgtataag tgtccggagt gcggaaagag cttctccgac tccggaaacc 600
          tcagggtgca ccaacgcacc cacaccggag agaagccgta caaatgtccc gaatgtggaa 660
          agtccttctc ccaatcctct tcgctggtcc ggcaccagcg aactcatacc ggggaaaagc 720
          ccaccggaaa gaaaacctcg gcctccggtt cgggaggagg ctcaggagga gcgagagatt 780
          ccaaggtcga gaacaagacc aagaagctgc gggtgttcga ggcctttgct ggcatcggag 840
          cccagaggaa ggccctcgag aaggtccgca aggatgagta cgagatcgtg ggactcgcgg 900
          agtggtacgt gcccgccatt gtgatgtacc aggccatcca taacaacttc cacactaagc 960
          tggagtacaa gtccgtgtcc cgggaggaaa tgattgacta cctggagaat aagaccctgt 1020
          catggaactc taagaaccccc gtgtcgaacg gttactggaa gagaaagaag gatgacgaac 1080
          tgaagattat ctacaacgcg atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctcta caagcgcacc ttgaagaaca tcgatctgct gacctactcc ttcccgtgcc 1200
          aagacctgag ccagcagggc atccagaagg ggatgaaacg gggctccggt actcgcagcg 1260
          gcttgctgtg ggaaattgag cgggccctgg atagcaccga gaagaacgac ttgccgaagt 1320
          atcttctcat ggaaaacgtc ggggctctcc ttcacaagaa gaacgaggaa gaactgaacc 1380
          agtggaagca aaagctggaa tccctcggat accagaactc cattgaggtc ctgaacgccg 1440
          ccgacttcgg atcgtcgcaa gccagacgga gggtgttcat gattagcact ctgaacgaat 1500
          tcgtggaact gccgaagggc gacaagaagc ctaagtccat caagaaggtg ctgaacaaga 1560
          tcgtgtccga gaaggacatt ctcaacaatc tgctgaagta caacctgaca gagttcaaga 1620
          aaaccaagtc caacatcaac aaggcctcct tgattggtta ctcaaagttc aacagcgagg 1680
          gatacgtgta cgaccccgaa ttcactggac ccactctgac cgcctccgga gcaaactcta 1740
          ggattaagat caaggacggc tccaacatcc ggaagatgaa ctccgacgaa acctttctgt 1800
          acatcggctt cgactcgcaa gacggaaagc gcgtgaacga gatcgaattt cttaccgaaa 1860
          accagaagat cttcgtgtgc ggcaattcaa tctccgtgga agtcctggaa gcgattatcg 1920
          acaagatcgg aggcagtggt ggaaagcgcc cagcagccac taagaaggcc ggacaggcca 1980
          agaagaagaagaa gggatcctac ccttacgatg tgccggatta cgcttgagcg gccgcttaat 2040
          taagctgcct tctgcggggc ttgccttctg gccatgccct tcttctctcc cttgcacctg 2100
          tacctcttgg tctttgaata aagcctgagt aggaagtcta gaaaaaaaaaaaaaaaaaaa 2160
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2220
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 2255
           <![CDATA[ <210> 169]]>
           <![CDATA[ <211> 204]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 169]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser
                  35 40 45
          Asp Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu Leu Val Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Thr Thr Gly Asn Leu Thr Val His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser
          145 150 155 160
          Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Thr Asp Thr Leu Arg
                      180 185 190
          Asp His Gln Arg Thr His Thr Gly Lys Lys Thr Ser
                  195 200
           <![CDATA[ <210> 170]]>
           <![CDATA[ <211> 204]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 170]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Gln Lys Ser Ser Leu Ile Ala His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser His Lys
                  35 40 45
          Asn Ala Leu Gln Asn His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Ser Asn Leu Val
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Arg Asn Asp Ala Leu Thr Glu His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Asp Lys Lys Asp Leu Thr Arg His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ala
          145 150 155 160
          Gly His Leu Ala Ser His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Lys Lys Asp Leu Thr
                      180 185 190
          Arg His Gln Arg Thr His Thr Gly Lys Lys Thr Ser
                  195 200
           <![CDATA[ <210> 171]]>
           <![CDATA[ <211> 204]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400]]>> 171]]>
           <br/> <![CDATA[Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Arg Ser Asp Asn Leu Val Arg His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Cys
                  35 40 45
          Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu Leu Val
          65 70 75 80
          Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Thr
          145 150 155 160
          Asp Thr Leu Arg Asp His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Glu Asp Asn Leu His
                      180 185 190
          Thr His Gln Arg Thr His Thr Gly Lys Lys Thr Ser
                  195 200
           <![CDATA[ <210> 172]]>
           <![CDATA[ <211> 204]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 172]]>
          Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
          1 5 10 15
          Phe Ser Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly
                      20 25 30
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Lys
                  35 40 45
          Ser Ser Leu Ile Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
              50 55 60
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Arg Asp Glu Leu Asn
          65 70 75 80
          Val His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                          85 90 95
          Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp Leu Arg Arg His Gln Arg
                      100 105 110
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
                  115 120 125
          Phe Ser Gln Ala Gly His Leu Ala Ser His Gln Arg Thr His Thr Gly
              130 135 140
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser
          145 150 155 160
          Gly Asn Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                          165 170 175
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ala Gly His Leu Ala
                      180 185 190
          Ser His Gln Arg Thr His Thr Gly Lys Lys Thr Ser
                  195 200
           <![CDATA[ <210> 173]]>
           <![CDATA[ <211> 612]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 173]]>
          ctggagcctg gagagaaacc ctacaaatgc ccggaatgcg ggaagtcctt ttccgaacgc 60
          tcgcacctga gggaaccacca gagaactcac accggcgaaa aaccctataa gtgcccagaa 120
          tgcggaaaga gcttttcacg gtcggacaac ctcgtgcggc accaacgcac tcataccgga 180
          gagaagccgt acaagtgtcc tgagtgcgga aagtcattct ccgactgccg ggatttggcc 240
          cgccaccaaa gaacacacac tggcgaaaag ccctacaagt gcccggagtg tggaaagtcc 300
          ttcagcactt ccggagagct ggtccggcac cagaggaccc acaccggggga gaagccttac 360
          aaatgtccag agtgcggtaa aagcttctcc accacccggca acctcaccgt gcaccagcgg 420
          accacacactg gagaaaagcc gtataaatgc cccgaatgcg gcaagagctt ctcgcgatcc 480
          gataagcttg tgcggcatca gagaacgcac actggggaaa agccttataa gtgtccggag 540
          tgcggcaaat ccttctcccg cactgacacc ctgcgggacc atcagcgcac ccataccggc 600
          aaaaagacct ct 612
           <![CDATA[ <210> 174]]>
           <![CDATA[ <211> 61]]>2
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 174]]>
          cttgaacccg gggagaagcc ctacaagtgc ccggaatgcg gaaagagctt cagccagaag 60
          tcctcgctga tcgcgcacca gaggactcac accggcgaaa agccatacaa gtgtcctgag 120
          tgtggcaaat ccttctcgca caagaacgca ctgcagaacc accagagaac ccacaccggg 180
          gaaaagccgt ataagtgccc cgaatgtgga aagtcgttca gccagtcatc caacctcgtg 240
          cgccatcaaa ggactcatac cggagagaaa ccttacaaat gccctgaatg cggcaaatct 300
          ttctcccgga atgatgccct gaccgagcac cagcgcactc acacgggaga gaagccgtac 360
          aaatgtccgg agtgcggaaa gtccttctcc gacaagaagg acttgaccag acaccagcgg 420
          acccatactg gcgaaaaacc ctataagtgt ccagagtgcg ggaagtcctt tagccaagcc 480
          ggtcacctcg cttccccacca acggacccac acaggagaaa agccttataa atgccccgag 540
          tgcggcaaaa gcttctccga taagaaggac ctgactcggc atcagcgcac ccataccgga 600
          aagaaaacct ca 612
           <![CDATA[ <210> 175]]>
           <![CDATA[ <211> 612]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 175]]>
          ctggagcctg gcgaaaaacc ctataagtgc ccagaatgcg gaaagagctt ttcacggtcg 60
          gacaacctcg tgcggcacca acgcactcat accggagaga agccgtacaa gtgtcctgag 120
          tgcggaaagt cattctccga ctgccgggat ttggcccgcc accaaagaac acacactggc 180
          gaaaagccct acaagtgccc ggagtgtgga aagtccttca gcacttccgg agagctggtc 240
          cggcaccaga ggacccacac cggggagaag ccttacaaat gtccagagtg cggtaaaagc 300
          ttctccacca ccggcaacct caccgtgcac cagcggaccc aacactggaga aaagccgtat 360
          aaatgccccg aatgcggcaa gagcttctcg cgatccgata agcttgtgcg gcatcagaga 420
          acgcacactg gggaaaagcc ttataagtgt ccggagtgcg gcaaatcctt ctcccgcact 480
          gacaccctgc gggaccacca gagaacccat actggcgaga agccatacaa atgcccggaa 540
          tgtggaaaga gtttctcgcg cgaggacaac ctccacaccc atcagcgcac ccataccggc 600
          aaaaagacct ct 612
           <![CDATA[ <210> 176]]>
           <![CDATA[ <211> 612]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 176]]>
          ctggaacccg gagagaaacc ctacaaatgc ccagagtgcg gcaaatcgtt ctcacggtcc 60
          gatcacctca ccaccccacca gaggaccccat accggggaga agccttacaa gtgtcctgag 120
          tgtggaaagt ccttcagcca aaagtcctcg ctgatcgcac accagcgcac gcacactggg 180
          gaaaagccat ataaatgccc ggagtgtggc aaatccttct cccgccgcga cgaactgaac 240
          gtgcaccaga gaacccacac tggagagaag ccgtataagt gtccggagtg cggaaagagc 300
          ttctcgcaat ccggggacct tcggagacat cagaggacac acactggcga aaagccctat 360
          aagtgccctg agtgcgggaa gtcctttagc caagccggtc acctggcctc ccaccaacgg 420
          actcacaccg gcgaaaaacc gtacaagtgc cccgaatgcg gaaagtcgtt ctctacctcc 480
          ggaaacttga ccgaaccacca gcggacccac accggagaaa agccgtacaa atgtcctgaa 540
          tgcggcaaaa gcttcagcca ggccggtcat ctcgcgagcc atcagcggac tcatactggc 600
          aaaaagacct ca 612
           <![CDATA[ <210> 177]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 177]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Ser Asp Asn Leu Val Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Thr Asp Thr Leu Arg Asp His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 178]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 178]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Lys Ser Ser Leu Ile Ala His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser His Lys Asn Ala Leu Gln Asn His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Gln Ser Ser Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Ala
                  115 120 125
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Lys Lys Asp Leu Thr Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Ala Gly His Leu Ala Ser His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Lys Lys Asp Leu Thr Arg His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 179]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 179]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asn Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Thr Ser Gly Glu Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn
                  115 120 125
          Leu Thr Val His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Thr Asp Thr Leu Arg Asp His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 180]]>
           <![CDATA[ <211> 367]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 180]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr Thr His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Lys Ser Ser Leu Ile Ala His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Arg Asp Glu Leu Asn Val His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp
                  115 120 125
          Leu Arg Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Ala Gly His Leu Ala Ser His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Thr Ser Gly Asn Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Gln Ala Gly His Leu Ala Ser His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
                  355 360 365
           <![CDATA[ <210> 181]]>
           <![CDATA[ <211> 1082]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 181]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys
          625 630 635 640
          Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val
                          645 650 655
          Pro Asp Tyr Ala Gly Ser Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala
                      660 665 670
          Gly Asp Val Glu Glu Asn Pro Gly Pro Thr Ser Ala Gly Lys Leu Gly
                  675 680 685
          Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu
              690 695 700
          Asn Pro Gly Pro Leu Glu Gly Ser Ser Gly Ser Gly Ser Pro Lys Lys
          705 710 715 720
          Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala Gly Ser Ser Gly
                          725 730 735
          Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys
                      740 745 750
          Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr
                  755 760 765
          Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg
              770 775 780
          Ser Asp Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro
          785 790 795 800
          Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Cys Arg Asp Leu
                          805 810 815
          Ala Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro
                      820 825 830
          Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu Leu Val Arg His Gln
                  835 840 845
          Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys
              850 855 860
          Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His Gln Arg Thr His Thr
          865 870 875 880
          Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg
                          885 890 895
          Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro
                      900 905 910
          Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Thr Asp Thr Leu
                  915 920 925
          Arg Asp His Gln Arg Thr His Thr Gly Lys Lys Thr Ser Ala Ser Gly
              930 935 940
          Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp Ala Lys Ser Leu Thr
          945 950 955 960
          Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp Val Phe Val Asp Phe
                          965 970 975
          Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala Gln Gln Ile Leu Tyr
                      980 985 990
          Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu Val Ser Leu Gly Tyr
                  995 1000 1005
          Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu Glu Lys Gly Glu
              1010 1015 1020
          Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu Thr His Pro
              1025 1030 1035
          Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro Ser Ser
              1040 1045 1050
          Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys
              1055 1060 1065
          Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
              1070 1075 1080
           <![CDATA[ <210> 182]]>
           <![CDATA[ <211> 1082]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 182]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Ser Asp Asn Leu Val Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Thr Asp Thr Leu Arg Asp His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Gly
                  355 360 365
          Ser Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu
              370 375 380
          Asn Pro Gly Pro Thr Ser Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg
          385 390 395 400
          Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Leu
                          405 410 415
          Glu Gly Ser Ser Gly Ser Gly Ser Pro Lys Lys Lys Arg Lys Val Gly
                      420 425 430
          Ile His Gly Val Pro Ala Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly
                  435 440 445
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser
              450 455 460
          Asp Asp Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
          465 470 475 480
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Glu Asp Asn Leu His
                          485 490 495
          Thr His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                      500 505 510
          Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr Thr His Gln Arg
                  515 520 525
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
              530 535 540
          Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His Thr Gly
          545 550 555 560
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu
                          565 570 575
          Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                      580 585 590
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg
                  595 600 605
          Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
              610 615 620
          Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg
          625 630 635 640
          Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly
                          645 650 655
          Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Ser Lys Val Glu Asn Lys
                      660 665 670
          Thr Lys Lys Leu Arg Val Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln
                  675 680 685
          Arg Lys Ala Leu Glu Lys Val Arg Lys Asp Glu Tyr Glu Ile Val Gly
              690 695 700
          Leu Ala Glu Trp Tyr Val Pro Ala Ile Val Met Tyr Gln Ala Ile His
          705 710 715 720
          Asn Asn Phe His Thr Lys Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu
                          725 730 735
          Met Ile Asp Tyr Leu Glu Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn
                      740 745 750
          Pro Val Ser Asn Gly Tyr Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys
                  755 760 765
          Ile Ile Tyr Asn Ala Ile Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe
              770 775 780
          Asp Ile Arg Asp Leu Tyr Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu
          785 790 795 800
          Thr Tyr Ser Phe Pro Cys Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys
                          805 810 815
          Gly Met Lys Arg Gly Ser Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile
                      820 825 830
          Glu Arg Ala Leu Asp Ser Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu
                  835 840 845
          Leu Met Glu Asn Val Gly Ala Leu Leu His Lys Lys Asn Glu Glu Glu Glu
              850 855 860
          Leu Asn Gln Trp Lys Gln Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser
          865 870 875 880
          Ile Glu Val Leu Asn Ala Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg
                          885 890 895
          Arg Val Phe Met Ile Ser Thr Leu Asn Glu Phe Val Glu Leu Pro Lys
                      900 905 910
          Gly Asp Lys Lys Pro Lys Ser Ile Lys Lys Val Leu Asn Lys Ile Val
                  915 920 925
          Ser Glu Lys Asp Ile Leu Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu
              930 935 940
          Phe Lys Lys Thr Lys Ser Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr
          945 950 955 960
          Ser Lys Phe Asn Ser Glu Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly
                          965 970 975
          Pro Thr Leu Thr Ala Ser Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp
                      980 985 990
          Gly Ser Asn Ile Arg Lys Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile
                  995 1000 1005
          Gly Phe Asp Ser Gln Asp Gly Lys Arg Val Asn Glu Ile Glu Phe
              1010 1015 1020
          Leu Thr Glu Asn Gln Lys Ile Phe Val Cys Gly Asn Ser Ile Ser
              1025 1030 1035
          Val Glu Val Leu Glu Ala Ile Ile Asp Lys Ile Gly Gly Pro Ser
              1040 1045 1050
          Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys
              1055 1060 1065
          Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala
              1070 1075 1080
           <![CDATA[ <210> 183]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 183]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Ser Asp Asn Leu Val Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Thr Asp Thr Leu Arg Asp His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 184]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 184]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Lys Ser Ser Leu Ile Ala His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser His Lys Asn Ala Leu Gln Asn His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Gln Ser Ser Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Asn Asp Ala
                  115 120 125
          Leu Thr Glu His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Asp Lys Lys Asp Leu Thr Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Ala Gly His Leu Ala Ser His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Asp Lys Lys Asp Leu Thr Arg His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 185]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 185]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asn Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Thr Ser Gly Glu Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn
                  115 120 125
          Leu Thr Val His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Thr Asp Thr Leu Arg Asp His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 186]]>
           <![CDATA[ <211> 358]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 186]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr Thr His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Gln Lys Ser Ser Leu Ile Ala His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Arg Asp Glu Leu Asn Val His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Ser Gly Asp
                  115 120 125
          Leu Arg Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Ala Gly His Leu Ala Ser His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Thr Ser Gly Asn Leu Thr Glu His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Gln Ala Gly His Leu Ala Ser His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser
                  355
           <![CDATA[ <210> 187]]>
           <![CDATA[ <211> 1073]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 187]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser Asp Asp Leu Val Arg His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Glu Asp Asn Leu His Thr His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Arg Ser Asp His Leu Thr Thr His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn
                  115 120 125
          Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu Ala His Leu Arg Ala His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr Gly Glu Lys
              210 215 220
          Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly
          225 230 235 240
          Gly Ala Arg Asp Ser Lys Val Glu Asn Lys Thr Lys Lys Leu Arg Val
                          245 250 255
          Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln Arg Lys Ala Leu Glu Lys
                      260 265 270
          Val Arg Lys Asp Glu Tyr Glu Ile Val Gly Leu Ala Glu Trp Tyr Val
                  275 280 285
          Pro Ala Ile Val Met Tyr Gln Ala Ile His Asn Asn Phe His Thr Lys
              290 295 300
          Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu Met Ile Asp Tyr Leu Glu
          305 310 315 320
          Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn Pro Val Ser Asn Gly Tyr
                          325 330 335
          Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys Ile Ile Tyr Asn Ala Ile
                      340 345 350
          Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe Asp Ile Arg Asp Leu Tyr
                  355 360 365
          Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu Thr Tyr Ser Phe Pro Cys
              370 375 380
          Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys Gly Met Lys Arg Gly Ser
          385 390 395 400
          Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile Glu Arg Ala Leu Asp Ser
                          405 410 415
          Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu Leu Met Glu Asn Val Gly
                      420 425 430
          Ala Leu Leu His Lys Lys Asn Glu Glu Glu Leu Asn Gln Trp Lys Gln
                  435 440 445
          Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser Ile Glu Val Leu Asn Ala
              450 455 460
          Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg Arg Val Phe Met Ile Ser
          465 470 475 480
          Thr Leu Asn Glu Phe Val Glu Leu Pro Lys Gly Asp Lys Lys Pro Lys
                          485 490 495
          Ser Ile Lys Lys Val Leu Asn Lys Ile Val Ser Glu Lys Asp Ile Leu
                      500 505 510
          Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu Phe Lys Lys Thr Lys Ser
                  515 520 525
          Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr Ser Lys Phe Asn Ser Glu
              530 535 540
          Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly Pro Thr Leu Thr Ala Ser
          545 550 555 560
          Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp Gly Ser Asn Ile Arg Lys
                          565 570 575
          Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile Gly Phe Asp Ser Gln Asp
                      580 585 590
          Gly Lys Arg Val Asn Glu Ile Glu Phe Leu Thr Glu Asn Gln Lys Ile
                  595 600 605
          Phe Val Cys Gly Asn Ser Ile Ser Val Glu Val Leu Glu Ala Ile Ile
              610 615 620
          Asp Lys Ile Gly Gly Pro Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys
          625 630 635 640
          Lys Ala Gly Gln Ala Lys Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val
                          645 650 655
          Pro Asp Tyr Ala Gly Ser Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala
                      660 665 670
          Gly Asp Val Glu Glu Asn Pro Gly Pro Thr Ser Ala Gly Lys Leu Gly
                  675 680 685
          Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu
              690 695 700
          Asn Pro Gly Pro Leu Glu Gly Ser Ser Gly Ser Gly Ser Pro Lys Lys
          705 710 715 720
          Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala Gly Ser Ser Gly
                          725 730 735
          Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys
                      740 745 750
          Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg Thr His Thr
                  755 760 765
          Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg
              770 775 780
          Ser Asp Asn Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro
          785 790 795 800
          Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Asp Cys Arg Asp Leu
                          805 810 815
          Ala Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro
                      820 825 830
          Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu Leu Val Arg His Gln
                  835 840 845
          Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys
              850 855 860
          Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His Gln Arg Thr His Thr
          865 870 875 880
          Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg
                          885 890 895
          Ser Asp Lys Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro
                      900 905 910
          Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Thr Asp Thr Leu
                  915 920 925
          Arg Asp His Gln Arg Thr His Thr Gly Lys Lys Thr Ser Ala Ser Gly
              930 935 940
          Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp Ala Lys Ser Leu Thr
          945 950 955 960
          Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp Val Phe Val Asp Phe
                          965 970 975
          Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala Gln Gln Ile Leu Tyr
                      980 985 990
          Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu Val Ser Leu Gly Tyr
                  995 1000 1005
          Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu Glu Lys Gly Glu
              1010 1015 1020
          Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu Thr His Pro
              1025 1030 1035
          Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro Ser Ser
              1040 1045 1050
          Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys
              1055 1060 1065
          Lys Lys Lys Gly Ser
              1070
           <![CDATA[ <210> 188]]>
           <![CDATA[ <211> 1073]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 188]]>
          Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala
          1 5 10 15
          Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly Glu Lys Pro Tyr Lys Cys
                      20 25 30
          Pro Glu Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His
                  35 40 45
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
              50 55 60
          Lys Ser Phe Ser Arg Ser Asp Asn Leu Val Arg His Gln Arg Thr His
          65 70 75 80
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                          85 90 95
          Asp Cys Arg Asp Leu Ala Arg His Gln Arg Thr His Thr Gly Glu Lys
                      100 105 110
          Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Thr Ser Gly Glu
                  115 120 125
          Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys
              130 135 140
          Pro Glu Cys Gly Lys Ser Phe Ser Thr Thr Gly Asn Leu Thr Val His
          145 150 155 160
          Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly
                          165 170 175
          Lys Ser Phe Ser Arg Ser Asp Lys Leu Val Arg His Gln Arg Thr His
                      180 185 190
          Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser
                  195 200 205
          Arg Thr Asp Thr Leu Arg Asp His Gln Arg Thr His Thr Gly Lys Lys
              210 215 220
          Thr Ser Ala Ser Gly Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Asp
          225 230 235 240
          Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys Asp
                          245 250 255
          Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr Ala
                      260 265 270
          Gln Gln Ile Leu Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn Leu
                  275 280 285
          Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg Leu
              290 295 300
          Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln Glu
          305 310 315 320
          Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val Pro
                          325 330 335
          Ser Ser Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala
                      340 345 350
          Lys Lys Lys Lys Gly Ser Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Gly
                  355 360 365
          Ser Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu
              370 375 380
          Asn Pro Gly Pro Thr Ser Ala Gly Lys Leu Gly Ser Gly Glu Gly Arg
          385 390 395 400
          Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Leu
                          405 410 415
          Glu Gly Ser Ser Gly Ser Gly Ser Pro Lys Lys Lys Arg Lys Val Gly
                      420 425 430
          Ile His Gly Val Pro Ala Ala Gly Ser Ser Gly Ser Leu Glu Pro Gly
                  435 440 445
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Ser
              450 455 460
          Asp Asp Leu Val Arg His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
          465 470 475 480
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Arg Glu Asp Asn Leu His
                          485 490 495
          Thr His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
                      500 505 510
          Cys Gly Lys Ser Phe Ser Arg Ser Asp His Leu Thr Thr His Gln Arg
                  515 520 525
          Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser
              530 535 540
          Phe Ser Gln Arg Ala Asn Leu Arg Ala His Gln Arg Thr His Thr Gly
          545 550 555 560
          Glu Lys Pro Tyr Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Leu
                          565 570 575
          Ala His Leu Arg Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr
                      580 585 590
          Lys Cys Pro Glu Cys Gly Lys Ser Phe Ser Gln Arg Ala Asn Leu Arg
                  595 600 605
          Ala His Gln Arg Thr His Thr Gly Glu Lys Pro Tyr Lys Cys Pro Glu
              610 615 620
          Cys Gly Lys Ser Phe Ser Glu Arg Ser His Leu Arg Glu His Gln Arg
          625 630 635 640
          Thr His Thr Gly Glu Lys Pro Thr Gly Lys Lys Thr Ser Ala Ser Gly
                          645 650 655
          Ser Gly Gly Gly Ser Gly Gly Ala Arg Asp Ser Lys Val Glu Asn Lys
                      660 665 670
          Thr Lys Lys Leu Arg Val Phe Glu Ala Phe Ala Gly Ile Gly Ala Gln
                  675 680 685
          Arg Lys Ala Leu Glu Lys Val Arg Lys Asp Glu Tyr Glu Ile Val Gly
              690 695 700
          Leu Ala Glu Trp Tyr Val Pro Ala Ile Val Met Tyr Gln Ala Ile His
          705 710 715 720
          Asn Asn Phe His Thr Lys Leu Glu Tyr Lys Ser Val Ser Arg Glu Glu
                          725 730 735
          Met Ile Asp Tyr Leu Glu Asn Lys Thr Leu Ser Trp Asn Ser Lys Asn
                      740 745 750
          Pro Val Ser Asn Gly Tyr Trp Lys Arg Lys Lys Asp Asp Glu Leu Lys
                  755 760 765
          Ile Ile Tyr Asn Ala Ile Lys Leu Ser Glu Lys Glu Gly Asn Ile Phe
              770 775 780
          Asp Ile Arg Asp Leu Tyr Lys Arg Thr Leu Lys Asn Ile Asp Leu Leu
          785 790 795 800
          Thr Tyr Ser Phe Pro Cys Gln Asp Leu Ser Gln Gln Gly Ile Gln Lys
                          805 810 815
          Gly Met Lys Arg Gly Ser Gly Thr Arg Ser Gly Leu Leu Trp Glu Ile
                      820 825 830
          Glu Arg Ala Leu Asp Ser Thr Glu Lys Asn Asp Leu Pro Lys Tyr Leu
                  835 840 845
          Leu Met Glu Asn Val Gly Ala Leu Leu His Lys Lys Asn Glu Glu Glu Glu
              850 855 860
          Leu Asn Gln Trp Lys Gln Lys Leu Glu Ser Leu Gly Tyr Gln Asn Ser
          865 870 875 880
          Ile Glu Val Leu Asn Ala Ala Asp Phe Gly Ser Ser Gln Ala Arg Arg
                          885 890 895
          Arg Val Phe Met Ile Ser Thr Leu Asn Glu Phe Val Glu Leu Pro Lys
                      900 905 910
          Gly Asp Lys Lys Pro Lys Ser Ile Lys Lys Val Leu Asn Lys Ile Val
                  915 920 925
          Ser Glu Lys Asp Ile Leu Asn Asn Leu Leu Lys Tyr Asn Leu Thr Glu
              930 935 940
          Phe Lys Lys Thr Lys Ser Asn Ile Asn Lys Ala Ser Leu Ile Gly Tyr
          945 950 955 960
          Ser Lys Phe Asn Ser Glu Gly Tyr Val Tyr Asp Pro Glu Phe Thr Gly
                          965 970 975
          Pro Thr Leu Thr Ala Ser Gly Ala Asn Ser Arg Ile Lys Ile Lys Asp
                      980 985 990
          Gly Ser Asn Ile Arg Lys Met Asn Ser Asp Glu Thr Phe Leu Tyr Ile
                  995 1000 1005
          Gly Phe Asp Ser Gln Asp Gly Lys Arg Val Asn Glu Ile Glu Phe
              1010 1015 1020
          Leu Thr Glu Asn Gln Lys Ile Phe Val Cys Gly Asn Ser Ile Ser
              1025 1030 1035
          Val Glu Val Leu Glu Ala Ile Ile Asp Lys Ile Gly Gly Pro Ser
              1040 1045 1050
          Gly Gly Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys
              1055 1060 1065
          Lys Lys Lys Gly Ser
              1070
           <![CDATA[ <210> 189]]>
           <![CDATA[ <211> 1376]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 189]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ctggagagaa accctacaaa tgcccggaat gcgggaagtc cttttccgaa cgctcgcacc 180
          tgagggaaca ccagagaact cacaccggcg aaaaacccta taagtgccca gaatgcggaa 240
          agagcttttc acggtcggac aacctcgtgc ggcaccaacg cactcatacc ggagagaagc 300
          cgtacaagtg tcctgagtgc ggaaagtcat tctccgactg ccggatttg gcccgccacc 360
          aaagaacaca cactggcgaa aagccctaca agtgcccgga gtgtggaaag tccttcagca 420
          cttccggaga gctggtccgg caccagagga cccacaccgg ggagaagcct tacaaatgtc 480
          cagagtgcgg taaaagcttc tccaccaccg gcaacctcac cgtgcaccag cggacccaca 540
          ctggagaaaa gccgtataaa tgccccgaat gcggcaagag cttctcgcga tccgataagc 600
          ttgtgcggca tcagagaacg cacactgggg aaaagcctta taagtgtccg gagtgcggca 660
          aatccttctc ccgcactgac accctgcggg accatcagcg cacccatacc ggcaaaaaga 720
          cctctgctag cggcagcggc ggcggcagcg gcggcgcccg ggacgacgcc aagagcctga 780
          ccgcctggag ccggaccctg gtgaccttca aggacgtgtt cgtggacttc acccgggagg 840
          agtggaagct gctggacacc gcccagcaga tcctgtaccg gaacgtgatg ctggagaact 900
          acaagaacct ggtgagcctg ggctaccagc tgaccaagcc cgacgtgatc ctgcggctgg 960
          agaagggcga ggagccctgg ctggtggagc gggagatcca ccaggaaacc caccccgaca 1020
          gcgaaaccgc cttcgagatc aagagcagcg tgcccagcag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1376
           <![CDATA[ <210> 190]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 190]]>
          aacacagttc agccgagcgc t 21
           <![CDATA[ <210> 191]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 191]]>
          cgaacaaccg tacagaaagg g 21
           <![CDATA[ <210> 192]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 192]]>
          gtaaacagta atagcgcagc a 21
           <![CDATA[ <210> 193]]>
           <![CDATA[ <211> 1376]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 193]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tcccttgaac 120
          ccggggagaa gccctacaag tgcccggaat gcggaaagag cttcagccag aagtcctcgc 180
          tgatcgcgca ccagaggact cacaccggcg aaaagccata caagtgtcct gagtgtggca 240
          aatccttctc gcacaagaac gcactgcaga accacccagag aacccacacc ggggaaaagc 300
          cgtataagtg ccccgaatgt ggaaagtcgt tcagccagtc atccaacctc gtgcgccatc 360
          aaaggactca taccggagag aaaccttaca aatgccctga atgcggcaaa tctttctccc 420
          ggaatgatgc cctgaccgag caccagcgca ctcacacggg agagaagccg tacaaatgtc 480
          cggagtgcgg aaagtccttc tccgacaaga aggacttgac cagacaccag cggacccata 540
          ctggcgaaaa accctataag tgtccagagt gcgggaagtc ctttagccaa gccggtcacc 600
          tcgcttccca ccaacggacc cacacaggag aaaagcctta taaatgcccc gagtgcggca 660
          aaagcttctc cgataagaag gacctgactc ggcatcagcg cacccatacc ggaaagaaaa 720
          cctcagctag cggcagcggc ggcggcagcg gcggcgcccg ggacgacgcc aagagcctga 780
          ccgcctggag ccggaccctg gtgaccttca aggacgtgtt cgtggacttc acccgggagg 840
          agtggaagct gctggacacc gcccagcaga tcctgtaccg gaacgtgatg ctggagaact 900
          acaagaacct ggtgagcctg ggctaccagc tgaccaagcc cgacgtgatc ctgcggctgg 960
          agaagggcga ggagccctgg ctggtggagc gggagatcca ccaggaaacc caccccgaca 1020
          gcgaaaccgc cttcgagatc aagagcagcg tgcccagcag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1376
           <![CDATA[ <210> 194]]>
           <![CDATA[ <211> 1376]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 194]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggagc 120
          ctggcgaaaa accctataag tgccccagaat gcggaaagag cttttcacgg tcggacaacc 180
          tcgtgcggca ccaacgcact cataccggag agaagccgta caagtgtcct gagtgcggaa 240
          agtcattctc cgactgccgg gatttggccc gccaccaaag aacacacact ggcgaaaagc 300
          cctacaagtg cccggagtgt ggaaagtcct tcagcacttc cggagagctg gtccggcacc 360
          agaggaccca caccggggag aagccttaca aatgtccaga gtgcggtaaa agcttctcca 420
          ccaccggcaa cctcaccgtg caccagcgga cccaacactgg agaaaagccg tataaatgcc 480
          ccgaatgcgg caagagcttc tcgcgatccg ataagcttgt gcggcatcag agaacgcaca 540
          ctggggaaaa gccttataag tgtccggagt gcggcaaatc cttctcccgc actgacaccc 600
          tgcgggacca ccagagaacc catactggcg agaagccata caaatgcccg gaatgtggaa 660
          agagtttctc gcgcgaggac aacctccaca cccatcagcg cacccatacc ggcaaaaaga 720
          cctctgctag cggcagcggc ggcggcagcg gcggcgcccg ggacgacgcc aagagcctga 780
          ccgcctggag ccggaccctg gtgaccttca aggacgtgtt cgtggacttc acccgggagg 840
          agtggaagct gctggacacc gcccagcaga tcctgtaccg gaacgtgatg ctggagaact 900
          acaagaacct ggtgagcctg ggctaccagc tgaccaagcc cgacgtgatc ctgcggctgg 960
          agaagggcga ggagccctgg ctggtggagc gggagatcca ccaggaaacc caccccgaca 1020
          gcgaaaccgc cttcgagatc aagagcagcg tgcccagcag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1376
           <![CDATA[ <210> 195]]>
           <![CDATA[ <211> 1376]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 195]]>
          aggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gcccccaaga 60
          agaagcggaa ggtgggcatc cacggcgtgc ccgccgccgg cagcagcgga tccctggaac 120
          ccggagagaa accctacaaa tgcccagagt gcggcaaatc gttctcacgg tccgatcacc 180
          tcaccaccca ccagaggacc cataccgggg agaagcctta caagtgtcct gagtgtggaa 240
          agtccttcag ccaaaagtcc tcgctgatcg cacaccagcg cacgcacact ggggaaaagc 300
          catataaatg cccggagtgt ggcaaatcct tctcccgccg cgacgaactg aacgtgcacc 360
          agagaaccca cactggagag aagccgtata agtgtccgga gtgcggaaag agcttctcgc 420
          aatccgggga ccttcggaga catcagagga cacacactgg cgaaaagccc tataagtgcc 480
          ctgagtgcgg gaagtccttt agccaagccg gtcacctggc ctccaccaa cggactcaca 540
          ccggcgaaaa accgtacaag tgccccgaat gcggaaagtc gttctctacc tccggaaact 600
          tgaccgaaca ccagcggacc cacaccggag aaaagccgta caaatgtcct gaatgcggca 660
          aaagcttcag ccaggccggt catctcgcga gccatcagcg gactcatact ggcaaaaaga 720
          cctcagctag cggcagcggc ggcggcagcg gcggcgcccg ggacgacgcc aagagcctga 780
          ccgcctggag ccggaccctg gtgaccttca aggacgtgtt cgtggacttc acccgggagg 840
          agtggaagct gctggacacc gcccagcaga tcctgtaccg gaacgtgatg ctggagaact 900
          acaagaacct ggtgagcctg ggctaccagc tgaccaagcc cgacgtgatc ctgcggctgg 960
          agaagggcga ggagccctgg ctggtggagc gggagatcca ccaggaaacc caccccgaca 1020
          gcgaaaccgc cttcgagatc aagagcagcg tgcccagcag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgcctg agcggccgct taattaagct gccttctgcg gggcttgcct tctggccatg 1200
          cccttcttct ctcccttgca cctgtacctc ttggtctttg aataaagcct gagtaggaag 1260
          tctagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1376
           <![CDATA[ <210> 196]]>
           <![CDATA[ <211> 3521]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 196]]>
          gggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gccccaaaga 60
          agaagagaaa ggtcggaatt catggcgtgc ccgcagccgg cagcagcggt tccctggagc 120
          ccggcgagaa accttacaaa tgccccgagt gcggcaagag cttcagcaga agcgacgatc 180
          tggtgaggca ccaaagaacc cacaccggcg aaaaacctta caagtgtccc gaatgcggaa 240
          agtccttcag cagagaggac aatctgcaca cccaccagag aacacacacc ggagaaaagc 300
          cttacaagtg ccccgaatgc ggcaaatcct tttctagaag cgatcatctg accacccacc 360
          aaagaacaca taccggcgag aagccttaca aatgtcccga gtgcggaaag tccttctccc 420
          agagagccaa tctgagggct catcaaagga cccataccgg cgaaaagccc tacaaatgcc 480
          ccgagtgcgg aaaatccttc agccagctgg cccatctgag agcccaccaa aggacacaca 540
          ccggagagaa accctataag tgccccgagt gtggaaaaag cttttcccag agggccaatc 600
          tgagggccca tcagaggacc cataccggag agaagcctta taaatgtccc gagtgcggaa 660
          aaagcttcag cgagaggagc catctgaggg aacatcaaag aacccacacc ggcgaaaaac 720
          ccaccggaaa aaagaccagc gctagcggca gcggcggcgg cagcggcggc gcccgggaca 780
          gcaaggtgga gaacaagacc aagaagctgc gggtgttcga ggccttcgcc ggcatcggcg 840
          cccagcggaa ggccctggag aaggtgcgga aggacgagta cgagatcgtg ggcctggccg 900
          agtggtacgt gcccgccatc gtgatgtacc aggccatcca caacaacttc cacaccaagc 960
          tggagtacaa gagcgtgagc cgggaggaga tgatcgacta cctggagaac aagaccctga 1020
          gctggaacag caagaaccccc gtgagcaacg gctactggaa gcggaagaag gacgacgagc 1080
          tgaagatcat ctacaacgcc atcaagctga gcgagaagga gggcaacatc ttcgacatcc 1140
          gggacctgta caagcggacc ctgaagaaca tcgacctgct gacctacagc ttcccctgcc 1200
          aggacctgag ccagcagggc atccagaagg gcatgaagcg gggcagcggc acccggagcg 1260
          gcctgctgtg ggagatcgag cgggccctgg acagcaccga gaagaacgac ctgcccaagt 1320
          acctgctgat ggagaacgtg ggcgccctgc tgcacaagaa gaacgaggag gagctgaacc 1380
          agtggaagca gaagctggag agcctgggct accagaacag catcgaggtg ctgaacgccg 1440
          ccgacttcgg cagcagccag gcccggcggc gggtgttcat gatcagcacc ctgaacgagt 1500
          tcgtggagct gcccaagggc gacaagaagc ccaagagcat caagaaggtg ctgaacaaga 1560
          tcgtgagcga gaaggacatc ctgaacaacc tgctgaagta caacctgacc gagttcaaga 1620
          aaaccaagag caacatcaac aaggccagcc tgatcggcta cagcaagttc aacagcgagg 1680
          gctacgtgta cgaccccgag ttcaccggcc ccaccctgac cgccagcggc gccaacagcc 1740
          ggatcaagat caaggacggc agcaacatcc ggaagatgaa cagcgacgag accttcctgt 1800
          acatcggctt cgacagccag gacggcaagc gggtgaacga gatcgagttc ctgaccgaga 1860
          accagaagat cttcgtgtgc ggcaacagca tcagcgtgga ggtgctggag gccatcatcg 1920
          acaagatcgg cggccccagc ggcggcaagc ggcccgccgc caccaagaag gccggccagg 1980
          ccaagaagaagaa gaagggcagc tacccctacg acgtgcccga ctacgccggg tccgccacca 2040
          acttctcgct gctgaagcag gccggagacg tggaagaaaa ccctggacct accagtgccg 2100
          gaaagctcgg tagcggagag ggtcggggaa gcctgcttac ttgcggcgac gtggaagaga 2160
          accccggtcc gctggagggt tcgtccggct ccggatcccc caagaagaag cggaaggtgg 2220
          gcatccacgg cgtgcccgcc gccggcagca gcggatccct ggagcctgga gagaaaccct 2280
          acaaatgccc ggaatgcggg aagtcctttt ccgaacgctc gcacctgagg gaacaccaga 2340
          gaactcacac cggcgaaaaa ccctataagt gcccagaatg cggaaagagc ttttcacggt 2400
          cggacaacct cgtgcggcac caacgcactc ataccggaga gaagccgtac aagtgtcctg 2460
          agtgcggaaa gtcattctcc gactgccggg atttggcccg ccaccaaaga aacacacactg 2520
          gcgaaaagcc ctacaagtgc ccggagtgtg gaaagtcctt cagcacttcc ggagagctgg 2580
          tccggcacca gaggacccac accggggaga agccttacaa atgtccagag tgcggtaaaa 2640
          gcttctccac caccggcaac ctcaccgtgc accagcggac ccaacactgga gaaaagccgt 2700
          ataaatgccc cgaatgcggc aagagcttct cgcgatccga taagcttgtg cggcatcaga 2760
          gaacgcacac tggggaaaag ccttataagt gtccggagtg cggcaaatcc ttctcccgca 2820
          ctgacaccct gcgggaccat cagcgcaccc ataccggcaa aaagaccctct gctagcggca 2880
          gcggcggcgg cagcggcggc gcccgggacg acgccaagag cctgaccgcc tggagccgga 2940
          ccctggtgac cttcaaggac gtgttcgtgg acttcacccg ggaggagtgg aagctgctgg 3000
          acaccgccca gcagatcctg taccggaacg tgatgctgga gaactacaag aacctggtga 3060
          gcctgggcta ccagctgacc aagcccgacg tgatcctgcg gctggagaag ggcgaggagc 3120
          cctggctggt ggagcggggag atccaccagg aaacccaccc cgacagcgaa accgccttcg 3180
          agatcaagag cagcgtgccc agcagcggcg gcaagcggcc cgccgccacc aagaaggccg 3240
          gccaggccaa gaagaagaag ggcagctacc cctacgacgt gcccgactac gcctgagcgg 3300
          ccgcttaatt aagctgcctt ctgcggggct tgccttctgg ccatgccctt cttctctccc 3360
          ttgcacctgt acctcttggt ctttgaataa agcctgagta ggaagtctag aaaaaaaaaa 3420
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3480
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa a 3521
           <![CDATA[ <210> 197]]>
           <![CDATA[ <211> 3521]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 197]]>
          gggaaataag agagaaaaga agagtaagaa gaaatataag agccaccatg gccccaaaga 60
          agaagagaaa ggtcggaatt catggcgtgc ccgcagccgg cagcagcggt tccctggagc 120
          ctggagagaa accctacaaa tgcccggaat gcgggaagtc cttttccgaa cgctcgcacc 180
          tgagggaaca ccagagaact cacaccggcg aaaaacccta taagtgccca gaatgcggaa 240
          agagcttttc acggtcggac aacctcgtgc ggcaccaacg cactcatacc ggagagaagc 300
          cgtacaagtg tcctgagtgc ggaaagtcat tctccgactg ccggatttg gcccgccacc 360
          aaagaacaca cactggcgaa aagccctaca agtgcccgga gtgtggaaag tccttcagca 420
          cttccggaga gctggtccgg caccagagga cccacaccgg ggagaagcct tacaaatgtc 480
          cagagtgcgg taaaagcttc tccaccaccg gcaacctcac cgtgcaccag cggacccaca 540
          ctggagaaaa gccgtataaa tgccccgaat gcggcaagag cttctcgcga tccgataagc 600
          ttgtgcggca tcagagaacg cacactgggg aaaagcctta taagtgtccg gagtgcggca 660
          aatccttctc ccgcactgac accctgcggg accatcagcg cacccatacc ggcaaaaaga 720
          cctctgctag cggcagcggc ggcggcagcg gcggcgcccg ggacgacgcc aagagcctga 780
          ccgcctggag ccggaccctg gtgaccttca aggacgtgtt cgtggacttc acccgggagg 840
          agtggaagct gctggacacc gcccagcaga tcctgtaccg gaacgtgatg ctggagaact 900
          acaagaacct ggtgagcctg ggctaccagc tgaccaagcc cgacgtgatc ctgcggctgg 960
          agaagggcga ggagccctgg ctggtggagc gggagatcca ccaggaaacc caccccgaca 1020
          gcgaaaccgc cttcgagatc aagagcagcg tgcccagcag cggcggcaag cggcccgccg 1080
          ccaccaagaa ggccggccag gccaagaaga agaagggcag ctacccctac gacgtgcccg 1140
          actacgccgg gtccgccacc aacttctcgc tgctgaagca ggccggagac gtggaagaaa 1200
          accctggacc taccagtgcc ggaaagctcg gtagcggaga gggtcgggga agcctgctta 1260
          cttgcggcga cgtggaagag aaccccggtc cgctggaggg ttcgtccggc tccggatccc 1320
          ccaagaagaa gcggaaggtg ggcatccacg gcgtgcccgc cgccggcagc agcggatccc 1380
          tggagcccgg cgagaaacct tacaaatgcc ccgagtgcgg caagagcttc agcagaagcg 1440
          acgatctggt gaggcaccaa agaacccaca ccggcgaaaa accttacaag tgtcccgaat 1500
          gcggaaagtc cttcagcaga gaggacaatc tgcacaccca ccagagaaca cacaccggag 1560
          aaaagcctta caagtgcccc gaatgcggca aatccttttc tagaagcgat catctgacca 1620
          cccaccaaag aacacatacc ggcgagaagc cttacaaatg tcccgagtgc ggaaagtcct 1680
          tctccccagag agccaatctg agggctcatc aaaggaccca taccggcgaa aagccttaca 1740
          aatgccccga gtgcggaaaa tccttcagcc agctggccca tctgagagcc caccaaagga 1800
          cacacaccgg agagaaaccc tataagtgcc ccgagtgtgg aaaaagcttt tcccagaggg 1860
          ccaatctgag ggcccatcag aggacccata ccggagagaa gccttataaa tgtcccgagt 1920
          gcggaaaaag cttcagcgag aggagccatc tgagggaaca tcaaagaacc cacaccggcg 1980
          aaaaacccac cggaaaaaag accagcgcta gcggcagcgg cggcggcagc ggcggcgccc 2040
          gggacagcaa ggtggagaac aagaccaaga agctgcgggt gttcgaggcc ttcgccggca 2100
          tcggcgccca gcggaaggcc ctggagaagg tgcggaagga cgagtacgag atcgtgggcc 2160
          tggccgagtg gtacgtgccc gccatcgtga tgtaccaggc catccacaac aacttccaca 2220
          ccaagctgga gtacaagagc gtgagccggg aggagatgat cgactacctg gagaacaaga 2280
          ccctgagctg gaacagcaag aacccccgtga gcaacggcta ctggaagcgg aagaaggacg 2340
          acgagctgaa gatcatctac aacgccatca agctgagcga gaaggagggc aacatcttcg 2400
          acatccggga cctgtacaag cggaccctga agaacatcga cctgctgacc tacagcttcc 2460
          cctgccagga cctgagccag cagggcatcc agaagggcat gaagcggggc agcggcaccc 2520
          ggagcggcct gctgtggggag atcgagcggg ccctggacag caccgagaag aacgacctgc 2580
          ccaagtacct gctgatggag aacgtgggcg ccctgctgca caagaagaac gaggaggagc 2640
          tgaaccagtg gaagcagaag ctggagagcc tgggctacca gaacagcatc gaggtgctga 2700
          acgccgccga cttcggcagc agccaggccc ggcggcgggt gttcatgatc agcaccctga 2760
          acgagttcgt ggagctgccc aagggcgaca agaagcccaa gagcatcaag aaggtgctga 2820
          acaagatcgt gagcgagaag gacatcctga acaacctgct gaagtacaac ctgaccgagt 2880
          tcaagaaaac caagagcaac atcaacaagg ccagcctgat cggctacagc aagttcaaca 2940
          gcgagggcta cgtgtacgac cccgagttca ccggccccac cctgaccgcc agcggcgcca 3000
          acagccggat caagatcaag gacggcagca acatccggaa gatgaacagc gacgagacct 3060
          tcctgtacat cggcttcgac agccaggacg gcaagcgggt gaacgagatc gagttcctga 3120
          ccgagaacca gaagatcttc gtgtgcggca acagcatcag cgtggaggtg ctggaggcca 3180
          tcatcgacaa gatcggcggc cccagcggcg gcaagcggcc cgccgccacc aagaaggccg 3240
          gccaggccaa gaagaagaag ggcagctacc cctacgacgt gcccgactac gcctgagcgg 3300
          ccgcttaatt aagctgcctt ctgcggggct tgccttctgg ccatgccctt cttctctccc 3360
          ttgcacctgt acctcttggt ctttgaataa agcctgagta ggaagtctag aaaaaaaaaa 3420
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3480
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa a 3521
           <![CDATA[ <210> 198]]>
           <![CDATA[ <211> 1385]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 198]]>
          gaaataagag agaaaagaag agtaagaaga aatataagac ctaatagtaa tagtaatagc 60
          ccaagaagaaa gcgcaaggtc gggatccacg gagtcccggc agcaggatcc tcaggctcac 120
          tggaaccggg ggaaaaaccc tacaagtgcc cggagtgcgg caagagcttc tcgacctccg 180
          ggaacctgac cgagcaccag cgcacccaca ccggagagaa accgtacaag tgccccgagt 240
          gcgggaaatc gttctcagac tcgggaaacc tcagggtgca ccagcgggacc cacacgggggg 300
          aaaagccgta caagtgcccg gagtgcggga agtcattctc ccacaagaac gcgctgcaga 360
          accaccaaag aacccacacc ggcgaaaaac cgtacaagtg ccccgagtgc ggaaagtcct 420
          tctcccgcaa cgacaccctc accgaacacc aacgcaccca caccggagaa aagccctaca 480
          agtgcccgga gtgcggaaag agcttcagcc agagggccca cctggaaaga caccagagaa 540
          cccacaccgg cgaaaagccg tacaagtgcc cggagtgcgg gaagtccttc agccggtcag 600
          acaagctggt ccgccaccaa aggacccaca caggagaaaa gccctacaag tgcccggagt 660
          gcggaaaatc gttcagcgac cccggacacc tggtccggca ccagaggacc cacaccgggg 720
          agaagccgac cggcaaaaag acctcagcaa gcgggagcgg aggaggaagc ggaggggacg 780
          ccaagagcct gaccgcgtgg agcaggaccc tcgtgacctt caaagacgtg ttcgtggact 840
          tcacccgcga agagtggaag ctgctggaca ccgcgcagca aatcctgtac cggaacgtga 900
          tgctggaaaa ctacaagaac ctcgtcagcc tcggctacca actgaccaag cccgacgtga 960
          tcctgcggct ggaaaagggc gaagaaccct ggctcgtgga gcgggagatc caccaggaaa 1020
          cccaccccgga cagcgaaacc gcgttcgaaa tcaagagcag cgtcagcgga ggaaaaagac 1080
          cagccgccac caagaaggcc ggccaagcca agaagaaaaa gggcagctac ccctacgacg 1140
          tgccggacta cgcatgagcg gccgcttaat taagctgcct tctgcggggc ttgccttctg 1200
          gccatgccct tcttctctcc cttgcacctg tacctcttgg tctttgaata aagcctgagt 1260
          aggaagtcta gaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1320
          aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1380
          aaaaa 1385
           <![CDATA[ <210> 199]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 199]]>
          acggggaatg ctgccgagag c 21
           <![CDATA[ <210> 200]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 200]]>
          acctgaaccc tggaaattat a 21
           <![CDATA[ <210> 201]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 201]]>
          tagacgggga atgctgccga g 21
           <![CDATA[ <210> 202]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 202]]>
          tgacattgag caatgatatg g 21
           <![CDATA[ <210> 203]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 203]]>
          agcaaaagaa aatggtaggc g 21
           <![CDATA[ <210> 204]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 204]]>
          acggggaatg ctgccgagag c 21
           <![CDATA[ <210> 205]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 205]]>
          acggggaatg ctgccgagag c 21
           <![CDATA[ <210> 206]]>
           <![CDATA[ <211> 21]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Sapiens]]>
           <![CDATA[ <400> 206]]>
          agcaaaagaa aatggtaggc g 21
           <![CDATA[ <210> 207]]>
           <![CDATA[ <211> 5]]>
           <![CDATA[ <212> PRT]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of Artificial Sequences: Synthetic Peptides]]>
           <![CDATA[ <400> 207]]>
          Gly Gly Gly Gly Ser
          1 5
           <![CDATA[ <210> 208]]>
           <![CDATA[ <211> 830]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 208]]>
          gatgttcatt agcagtggtg ataggttaat tttcaccatc tcttatgcgg ttgaatagtc 60
          acctctgaac cactttttcc tccagtaact cctctttctt cggaccttct gcagccaacc 120
          tgaaagaata acaaggaggt ggctggaaac ttgttttaag gaaccgcctg tccttccccc 180
          gctggaaacc ttgcacctcg gacgctcctg ctcctgcccc cacctgaccc ccgccctcgt 240
          tgacatccag gcgcgatgat ctctgctgcc agtagagggc acacttactt tactttcgca 300
          aacctgaacg cgggtgctgc ccagagagggg ggcggaggga aagacgcttt gcagcaaaat 360
          ccagcatagc gattggttgc tccccgcgtt tgcggcaaag gcctggaggc aggagtaatt 420
          tgcaatcctt aaagctgaat tgtgcagtgc atcggatttg gaagctacta tattcactta 480
          acacttgaac gctgagctgc aaactcaacg ggtaataacc catcttgaac agcgtacatg 540
          ctatacacgc acccctttcc cccgaattgt tttctctttt ggaggtggtg gagggagaga 600
          aaagtttact taaaatgcct ttgggtgagg gaccaaggat gagaagaatg ttttttgttt 660
          ttcatgccgt ggaataacac aaaataaaaa atcccgaggg aatatcatatt atatattaaa 720
          tatagatcat ttcagggagc aaacaaatca tgtgtggggc tgggcaacta gctaagtcga 780
          agcgtaaata aaatgtgaat acacgtttgc gggttacatacagtgcactt 830
           <![CDATA[ <210> 209]]>
           <![CDATA[ <211> 830]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic polynucleotides]]>
           <![CDATA[ <400> 209]]>
          taggcatcgt tttcctcctt atgcctctat cattcctccc tatctacact aacatcccac 60
          gctctgaacg cgcgcccatt aatacccttc tttcctccac tctccctggg actcttgatc 120
          aaagcgcggc cctttcccca gccttagcga ggcgccctgc agcctggtac gcgcgtggcg 180
          tggcggtggg cgcgcagtgc gttctcggtg tggagggcag ctgttccgcc tgcgatgatt 240
          tatactcaca ggacaaggat gcggtttgtc aaacagtact gctacggagg agcagcagag 300
          aaagggagag ggtttgagag ggagcaaaag aaaatggtag gcgcgcgtag ttaattcatg 360
          cggctctctt actctgttta catcctagag ctagagtgct cggctgcccg gctgagtctc 420
          ctccccacct tccccaccct ccccaccctc cccataagcg cccctcccgg gttcccaaag 480
          cagagggcgt gggggaaaag aaaaaagatc ctctctcgct aatctccgcc caccggccct 540
          ttataatgcg agggtctgga cggctgagga cccccgagct gtgctgctcg cggccgccac 600
          cgccgggccc cggccgtccc tggctcccct cctgcctcga gaagggcagg gcttctcaga 660
          ggcttggcgg gaaaaagaac ggagggaggg atcgcgctga gtataaaagc cggttttcgg 720
          ggctttatct aactcgctgt agtaattcca gcgagaggca gagggagcga gcgggcggcc 780
          ggctagggtg gaagagccgg gcgagcagag ctgcgctgcg ggcgtcctgg 830
           <![CDATA[ <210> 210]]>
           <![CDATA[ <211> 7]]>
           <![CDATA[ <212>DNA]]>
           <![CDATA[ <213> Artificial Sequence]]>
           <![CDATA[ <220>]]>
           <![CDATA[ <223> Description of artificial sequences: synthetic oligonucleotides]]>
           <![CDATA[ <400> 210]]>
          tatawaw 7
          
      

Claims (57)

A performance suppressor comprising: a first targeting moiety that binds to a gene body locus comprising at least 16, 17, 18, 19 or 20 nucleotides of the sequence SEQ ID NO: 83, and A first effector moiety comprising a DNA methyltransferase. The expression suppressor according to claim 1, wherein the first targeting moiety comprises a zinc finger domain. The expression inhibitor of claim 1 or 2, wherein the first targeting moiety comprises an amino acid sequence according to SEQ ID NO: 13 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or A sequence that differs therefrom by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. The expression suppressor according to any one of the preceding claims, wherein the first effector moiety comprises MQ1 or a functional variant or fragment thereof. The expression suppressor according to any one of the preceding claims, wherein the first effector moiety comprises the sequence SEQ ID NO: 19 or 87, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a sequence thereof Sequences in which the number of differing positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. The expression suppressor according to any one of the preceding claims, wherein the first effector moiety comprises the sequence SEQ ID NO: 30 or 129, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a sequence thereof Sequences in which the number of differing positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. A nucleic acid encoding the expression suppressor according to any one of the preceding claims. The nucleic acid of claim 7, which comprises a nucleotide sequence encoding the first targeting moiety, wherein the nucleotide sequence encoding the first targeting moiety comprises a sequence according to SEQ ID NO: 46 or 131, or with it Sequences that are at least 80, 85, 90, 95, 99, or 100% identical, or differ by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, Sequence of 8, 7, 6, 5, 4, 3, 2 or 1. The nucleic acid of claim 7 or 8, which comprises a nucleotide sequence encoding the first effector portion, wherein the nucleotide sequence encoding the first effector portion comprises a sequence according to SEQ ID NO: 52 or 132, or with it Sequences that are at least 80, 85, 90, 95, 99, or 100% identical, or differ by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, Sequence of 8, 7, 6, 5, 4, 3, 2 or 1. The nucleic acid according to any one of claims 7 to 9, which comprises a nucleotide sequence according to SEQ ID NO: 63 or 130, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a sequence identical thereto A sequence whose number of different positions does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1, wherein A polyA sequence is optionally present. A system comprising: The first expression inhibitor of any one of claims 1 to 6, and Second expression suppressor. The system according to claim 11, wherein the second performance inhibitor comprises: a second targeting moiety that binds the gene body locus, and Second effect part. The system of claim 12, wherein the second targeting moiety binds to a gene body locus comprising at least 14, 15, 16, 17, 18, 19 or 20 of the sequence SEQ ID NO: 77, 199 or 201 Nucleotides. The system according to claim 12 or 13, wherein the second targeting moiety comprises a zinc finger domain. The system according to any one of claims 12 to 14, wherein the second targeting moiety comprises an amino acid sequence according to SEQ ID NO: 7, 169, 171, or at least 80, 85, 90, 95, 99 or 100% identical sequence, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 , 2 or 1 sequence. The system according to any one of claims 12 to 15, wherein the second effector moiety comprises KRAB or a functional variant or fragment thereof. The system according to any one of claims 12 to 16, wherein the second effector moiety comprises an amino acid sequence according to SEQ ID NO: 18, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto , or the number of positions differing therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence. The system according to any one of claims 12 to 17, wherein the second expression inhibitor comprises an amino acid sequence according to SEQ ID NO: 24, 177, 183, 179 or 185 or at least 80%, 85%, 90% thereof %, 95%, 99% or 100% identical sequence, or the number of positions that differ from it does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7 , 6, 5, 4, 3, 2 or 1 sequence. A nucleic acid encoding the first expression inhibitor and the second inhibitor in the system according to any one of claims 12 to 18. The nucleic acid according to claim 19, comprising a nucleotide sequence according to SEQ ID NO: 113, 196 or 197, wherein a polyadenylic acid sequence is optionally present. A performance inhibition system comprising: a) a first expression suppressor comprising: i) a first targeting moiety having an amino acid sequence according to SEQ ID NO: 13 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a first effector moiety having an amino acid sequence according to SEQ ID NO: 19 or 87 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a number of positions that differ therefrom by no more than the sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and b) a second expression suppressor comprising: i) a second targeting moiety having an amino acid sequence according to SEQ ID NO: 7 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differing therefrom by no more than 20 positions , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a second effector moiety having an amino acid sequence according to SEQ ID NO: 18, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. A performance inhibition system comprising: a) a first expression suppressor comprising: i) a first targeting moiety having an amino acid sequence according to SEQ ID NO: 13 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a first effector moiety having an amino acid sequence according to SEQ ID NO: 19 or 87 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a number of positions that differ therefrom by no more than the sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and b) a second expression suppressor comprising: i) a second targeting moiety having an amino acid sequence according to SEQ ID NO: 169, 171 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a different number of positions therefrom Sequences exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a second effector moiety having an amino acid sequence according to SEQ ID NO: 18, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. A performance inhibition system comprising: a) a first expression suppressor comprising: i) a first targeting moiety having an amino acid sequence according to SEQ ID NO: 169, 171, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a position different therefrom a sequence of numbers not exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a first effector moiety having an amino acid sequence according to SEQ ID NO: 18 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differing therefrom by no more than 20 positions, the sequence of 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and b) a second expression suppressor comprising: i) a second targeting moiety having an amino acid sequence according to SEQ ID NO: 13 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a second effector moiety having an amino acid sequence according to SEQ ID NO: 19 or 87, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a different number of positions therefrom More than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence. The performance suppressor or performance suppression system according to any one of the preceding claims, which is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, During a period of 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cell divisions, MYC Significant reduction in expression, eg as measured by ELISA. A fusion protein comprising a first amino acid region encoding a first expression inhibitor described herein and a second amino acid region comprising a second expression inhibitor described herein. The expression inhibitor, fusion protein or expression inhibition system according to any one of the preceding claims, wherein 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, 80, or 96 hours, the expression suppressor binds to the MYC gene Blocks significantly reduce MYC performance. The expression inhibitor, fusion protein or expression inhibition system according to any one of the preceding claims, wherein a plurality of cells are associated with the expression inhibitor, expression inhibition system or encode the expression inhibitor or the first expression inhibitor and the second expression inhibitor Exposure to a nucleic acid expressing a suppressor reduces the survival of the plurality of cells. The expression inhibitor, fusion protein or expression inhibition system according to any one of the preceding claims, wherein the expression inhibitor or expression inhibition system is administered such that at least 5%, 6%, 7% of target cells (e.g. cancer cells) , 8%, 9%, 10%, 12%, 15%, 17%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 75% cells apoptosis. The expression inhibitor, fusion protein or expression inhibition system according to claim 17d, wherein the plurality of cells comprises a plurality of cancer cells and a plurality of non-cancer cells. The expression inhibitor, fusion protein or expression inhibition system of claim 17e, wherein contacting the plurality of cells with the system or the nucleic acid encoding the system causes the survival rate of the plurality of cancer cells to decrease more than that of the plurality of non-cancerous cells The decrease in the survival rate of the cells, as the case may be, wherein the decrease in the survival rate of the plurality of cancer cells is 1.05x (that is, 1.05 times), 1.1x, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1.45x, 1.5x, 1.6x, 1.7x, 1.8x, 1.9x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x , 20x, 50x or 100x. A nucleic acid comprising a sequence encoding the expression inhibitor, fusion protein or system according to any one of claims 1 to 30. A nucleic acid encoding an expression suppression system, the nucleic acid comprising: a) a first region encoding a first expression suppressor comprising: i) a first targeting moiety having an amino acid sequence according to SEQ ID NO: 13 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a first effector moiety having an amino acid sequence according to SEQ ID NO: 19 or 87 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a number of positions that differ therefrom by no more than the sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and b) a second region encoding a second expression suppressor comprising: i) a second targeting moiety having an amino acid sequence according to SEQ ID NO: 7 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differing therefrom by no more than 20 positions , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a second effector moiety having an amino acid sequence according to SEQ ID NO: 18, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. A nucleic acid encoding an expression suppression system, the nucleic acid comprising: a) a first region encoding a first expression suppressor comprising: i) a first targeting moiety having an amino acid sequence according to SEQ ID NO: 13 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a first effector moiety having an amino acid sequence according to SEQ ID NO: 19 or 87 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a number of positions that differ therefrom by no more than the sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and b) a second region encoding a second expression suppressor comprising: i) a second targeting moiety having an amino acid sequence according to SEQ ID NO: 169, 171, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or the number of positions at which it differs A sequence not exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a second effector moiety having an amino acid sequence according to SEQ ID NO: 18, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. A nucleic acid encoding an expression suppression system, the nucleic acid comprising: a) a first region encoding a first expression suppressor comprising: i) a first targeting moiety having an amino acid sequence according to SEQ ID NO: 169, 171, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or the number of positions differing therefrom A sequence not exceeding 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a first effector moiety having an amino acid sequence according to SEQ ID NO: 18 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differing therefrom by no more than 20 positions, the sequence of 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and b) a second region encoding a second expression suppressor comprising: i) a second targeting moiety having an amino acid sequence according to SEQ ID NO: 13 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or having no more than 20 positions differing therefrom , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and ii) a second effector moiety having an amino acid sequence according to SEQ ID NO: 19 or 87, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or a different number of positions therefrom More than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence. The nucleic acid according to any one of claims 19, 21 or 22, which comprises the nucleotide sequence of SEQ ID NO: 93, 94, 112, 113, 196, 197, or at least 80, 85, 90, 95 or 99% thereof Consistent sequence, or the number of positions that differ therefrom does not exceed 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or a sequence of 1s. A performance suppressor comprising: A targeting moiety that binds to a gene body locus comprising at least 16, 17, 18, 19, or 20 nucleotides of the sequence of Table 12; and Optional effect section. A performance suppressor comprising: A targeting moiety having an amino acid sequence according to Table 4, or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differing therefrom by no more than 20, 19, 18, 17 positions , 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1; and Optional effect section. Such as the expression inhibitor of claim 37, which comprises the amino acid sequence according to Table 7 or Table 9, or a sequence at least 80, 85, 90, 95, 99 or 100% identical to it, or the number of positions different from it is different More than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 sequence. A nucleic acid comprising a sequence according to Table 5, Table 6, Table 8, Table 16 or Table 10 or a sequence at least 80, 85, 90, 95, 99 or 100% identical thereto, or differing therefrom in a number of positions not exceeding A sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1. A vector comprising a nucleic acid encoding a fusion protein, system or expression inhibitor according to any one of the preceding claims. A reaction mixture comprising the expression inhibitor, system, fusion protein, nucleic acid or vector according to any one of the preceding claims. A pharmaceutical composition comprising the expression inhibitor, system, fusion protein, nucleic acid, carrier or reaction mixture according to any one of the preceding claims. A method of treating cancer in an individual in need thereof, the method comprising: Administration of the expression inhibitor, system, fusion protein or nucleic acid encoding the expression inhibitor or the system according to any one of claims 1 to 20. The method of claim 43, wherein the cancer is hepatocellular carcinoma (HCC), fibrolamellar hepatocellular carcinoma (FHCC), cholangiocarcinoma, angiosarcoma, secondary liver cancer, lung cancer, non-small cell lung cancer (NSCLC), adenocarcinoma , small cell lung cancer (SCLC), large cell (undifferentiated) carcinoma, triple negative breast cancer, gastric adenocarcinoma, endometrial cancer, or pancreatic cancer. A method of treating hepatitis in a subject in need thereof, the method comprising: Administration of the expression inhibitor, fusion protein, system or nucleic acid encoding the expression inhibitor or the system according to any one of claims 1 to 42. A method of reducing tumor growth in an individual in need thereof, the method comprising: administering the expression inhibitor, fusion protein, system, nucleic acid, vector or pharmaceutical composition of any one of claims 1 to 42 to the individual, Thereby reducing tumor growth in the individual. A method of enhancing or restoring the sensitivity of cancer to a kinase inhibitor such as sorafenib, the method comprising administering an expression inhibitor or system according to any one of claims 1 to 42 to a patient suffering from the cancer Optionally, wherein administration of the expression inhibitor or system reduces the _IC50 of the kinase inhibitor by 10%, 20%, 30% or 40%, eg, in a cancer cell survival assay. A method of enhancing or restoring the sensitivity of cancer to a bromodomain inhibitor, such as a BET inhibitor, such as JQ1, the method comprising expressing an inhibitor or system according to any one of claims 1 to 42 Administration to an individual with the cancer, wherein optionally, administration of the expression inhibitor or system reduces the _IC50 of the bromodomain inhibitor by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%, for example in a cancer cell survival assay. A method of enhancing or restoring the sensitivity of a cancer to a MEK inhibitor such as Trametinib, the method comprising administering an expression inhibitor or system according to any one of claims 1 to 42 to a patient suffering from the cancer wherein optionally, administration of the expression inhibitor or system reduces the _IC50 of the MEK inhibitor by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% % or 95%, for example in cancer cell survival assays. The method of any one of claims 43 to 49, wherein the cancer is characterized by an increase in MYC expression relative to a reference level (e.g. MYC expression relative to a reference cell, e.g. an otherwise similar non-cancerous cell in the individual) and cells that are not characterized (e.g., have normal MYC expression) by increased MYC expression relative to a reference level (e.g., MYC expression relative to a reference cell, e.g., an otherwise similar non-cancerous cell in the individual). The method according to any one of claims 43 to 50, comprising: a) First, administering to the individual a first plurality of doses of the expression inhibitor or system according to any one of claims _____, wherein optionally, 5 doses after an earlier dose in the first plurality of doses days, administering each subsequent dose of the first plurality of doses; b) Second, administration of the expression inhibitor or system is discontinued for a period of time ("drug holiday"), for example about 2 weeks, and c) Third, administering a second plurality of doses of the expression inhibitor or system to the individual, wherein the second plurality of doses is administered, optionally, 5 days after an earlier dose in the second plurality of doses Subsequent doses in doses. The method of any one of claims 43 to 51, wherein tumor volume is reduced (eg, to an undetectable level) after cessation of the expression inhibitor, fusion protein or systemic treatment. The method according to any one of claims 43 to 52, wherein the method further comprises a. contacting the cell with a second therapeutic agent, or b. Administering a second therapeutic agent to the subject, where the second therapeutic agent is not an expression inhibitor, system, fusion protein, nucleic acid, vector, reaction mixture, or pharmaceutical as in any of the claims _____ combination. The method according to any one of claims 43 to 53, wherein the second therapeutic agent is one or both of immunotherapy, immune checkpoint and anti-vascular endothelial cell growth factor therapy, systemic chemotherapy, tyrosine kinase Inhibitors (eg, sorafenib), mitogen-activated protein kinase inhibitors (eg, trametinib), or bromodomain inhibitors (eg, BET inhibitors, eg, JQ1, eg, birabresib) . The method of any one of claims 43 to 54, wherein the first therapeutic agent and the second therapeutic agent are administered simultaneously. The method of any one of claims 43 to 55, wherein the first therapeutic agent and the second therapeutic agent are administered sequentially. The method according to any one of claims 43 to 56, wherein there is overexpression of MYC in at least some cells of the individual.

Images