TW202313982A - Hsv viral vector and uses thereof - Google Patents

Abstract

An HSV virus vector and the use thereof. ICP47 and ICP34.5 genes of the HSV virus vector are silenced, and the HSV virus vector carries the CCL19 gene. The HSV virus vector can continue to express chemotactic factor CCL19, thereby effectively inhibiting tumors.

Description

HSV virus vector and its application

The present invention relates to the field of biomedicine. Specifically, the present invention relates to HSV viral vectors and their applications.

Due to some limitations inherent in the molecular properties of CCL19, its clinical application is limited. Basically, these include stability issues, such as acid degradation, and the tendency to aggregate irreversibly under mild denaturing conditions with subsequent loss of biological activity. Furthermore, when administered intravenously, CCL19 is rapidly cleared from the blood, requiring frequent re-administration at high concentrations to elicit an effective response at the target site, and leading to systemic toxicity and side effects such as fever, fatigue, nausea, vomiting, diarrhea, Neurotoxicity and leukopenia.

The use of HSV1 to carry the chemokine CCL19 not only enhances the targeting of the virus strain to tumor cells, but also further enhances the anti-tumor immune efficacy of the virus strain through the recruitment of immune cells by the exogenous gene CCL19. The use of oncolytic viruses expressing CCL19 can allow the virus to replicate in tumors and continuously express CCL19 locally through intratumoral injection, avoiding the rapid clearance of CCL19 and systemic toxic side effects caused by intravenous administration. The role of CCL19 and CCR7 in anti-tumor therapy has become a research hotspot and has made significant progress. They infiltrate tumors by chemotactic dendritic cells, CD4+ and CD8+ T cells, mediate the release of cytokines by immune cells, and inhibit tumor proliferation, migration and It plays a key role in invasion and assisting in the treatment of tumors. Combining anti-tumor drugs with CCL19 will help find new tumor treatments and gene vaccines. However, there are currently no reports of using HSV1 viruses to express CCL19.

The present invention is based on the inventor's discovery and understanding of the following problems:

At present, the clinical application of chemokines is limited by unstable product quality and the need for frequent administration. After extensive experimental research, the inventors were surprised to find that CCL19 can be better expressed in the HSV virus than other chemokines. , especially when the CCL19 gene is inserted into the ICP34.5 site, the expression of CCL19 is significantly increased. When carrying double copies of the mutated chemokine CCL19, the HSV viral vector can continue to express high levels of the chemokine CCL19. The expression level is significantly higher than that of the HSV virus carrying only a single copy of mutated CCL19. The oncolytic virus containing the HSV virus vector retains the sensitivity and proliferation activity to tumor cells, and further increases the expression level of CCL19, breaking through the trend. Due to the limitations of low chemokine expression, unstable expression and frequent administration, its tumor inhibition effect is better than viruses containing other chemokine-encoding nucleic acid vectors.

In a first aspect of the invention, the invention provides an HSV viral vector. According to an embodiment of the present invention, the HSV viral vector has ICP47 and ICP34.5 genes silenced and carries the CCL19 gene. The HSV1 virus carries double copies of the ICP34.5 gene. Inserting the CCL19 gene at the ICP34.5 gene site can effectively reduce the neurotoxicity of the virus and improve the anti-tumor selectivity of the virus; HSV1 carrying double copies of the chemokine CCL19 can enhance The targeting ability of the virus strain to tumor cells and the recruitment of immune cells through the exogenous gene CCL19 further enhance the anti-tumor immune efficacy of the virus strain. By intratumoral injection of an oncolytic virus expressing CCL19, the virus can replicate in tumor cells and continuously express CCL19 locally, thus preventing CCL19 from being rapidly cleared and causing systemic toxic side effects after intravenous administration. Knocking out the replication-non-essential gene ICP47 in the HSV genome can improve the expression of MHC-1 on the surface of virus-infected tumor cells and the ability of cells to present antigens; the inventors screened for chemokines highly expressed in HSV and found that CCL19 is Compared with other chemokines, it can be better expressed in HSV virus. At the same time, the inventors explored the insertion site of CCL19 and unexpectedly found that knocking out the ICP34.5 gene in the HSV genome allows HSV to selectively express in tumors. Replicates in cells instead of replicating and proliferating in normal cells, thereby improving the drug safety of HSV virus. In addition, inserting the nucleic acid encoding the chemokine into this site can effectively improve the safety of the virus containing the HSV virus vector. Anti-tumor ability. According to the embodiment of the present invention, the HSV virus vector can continuously express the chemokine CCL19 at a high level. By inserting the CCL19 gene into the ICP34.5 gene locus, the expression of CCL19 is significantly improved, and the HSV virus replicates in tumor cells. On the premise that the ability is not affected, the killing power of tumor cells is significantly improved, and tumors can be effectively prevented or treated.

According to embodiments of the present invention, the above-mentioned HSV viral vector may further include at least one of the following additional technical features:

According to embodiments of the invention, two copies of the CCL19 gene are carried. The inventors screened the copy number of the CCL19 gene carried by the expression vector and found that the HSV viral vector carrying two copies of the CCL19 gene according to the embodiment of the present invention can significantly increase the expression level of CCL19, and the expression level of CCL19 is significantly higher than that of the CCL19 gene alone. HSV virus carrying a single copy of the CCL19 gene.

According to an embodiment of the present invention, the CCL19 gene has a 6.A>C mutation. Through base optimization, the expression level of the target gene in the host can be improved without changing the expressed amino acids.

The gene nucleic acid sequence of wild-type CCL19 is as follows:

ATGGCCCTGCTACTGGCCCTCAGCCTGCTGGTTCTCTGGACTTCCCCAGCCCCAACTCTGAGTGGCACCAATGATGCTGAAGACTGCTGCCTGTCTGTGACCCAGAAACCCATCCCTGGGTACATCGTGAGGAACTTCCACTACCTTCTCATCAAGGATGGCTGCAGGGTGCCTGCTGTAGTGTTCACCACACTGAGGGGCCGCCAGCTCTGTGCACCCCCAGACCAGCCCTGGGTAGAACGCATCATCCAGAGACTGCAGAGGACCTC AGCCAAGATGAAGCGCCGCAGCAGTTAA (SEQ ID NO: 1).

The nucleic acid sequence of the CCL19 gene containing the 6.A>C mutation is as follows:

ATGGC A CTGCTGCTGGCCCTGTCCCTGCTGGTGCTGTGGACCTCTCCAGCACCCACCCTGAGCGGAACAAACGACGCAGAGGATTGCTGTCTGTCTGTGACACAGAAGCCTATCCCAGGCTACATCGTGAGGAATTTCCACTATCTGCTGATCAAGGACGGATGCAGGGTGCCAGCTGGTGTTTACCACACTGAGGGGCCGCCAGCTGTGCGCACCACCTGATCAGCCTTGGGTGGAGCGGATCATCCAGCGGCTG CAGAGAACCAGCGCCAAGATGAAGCGGAGAAGCTCCTGA (SEQ ID NO: 2).

According to an embodiment of the present invention, the ICP34.5 gene silencing is achieved by knocking out nucleotides 135-723 of the ICP34.5 gene. The ICP34.5 gene sequence encoding is sequentially encoded with the first nucleotide of the ICP34.5 gene start codon as the first position. The sequence of the ICP34.5 gene can be referred to https://www.ncbi. nlm.nih.gov/nuccore/NC_001806.2?from=124834&to=125861&report=genbank&strand=true, the specific sequence of the ICP34.5 gene is shown in SEQ ID NO: 3, where the underlined part is the ICP34.5 gene Sequence encoding.

CCTCTGCACGCACATGCTTGCCTGTCAAACTCTACCACCCCGGCACGCTCTCTGTCTCCATGGCCCGCCGCCGCCATCGCGGCCCCCGCCGCCGGCCGCCCGGGCCCACGGGCGCGGTCCCAACCGCACAGTCCCAGGTAACCTCCACGCCCAACTCGGAACCCGTGGTCAGGAGCGCGCCCGCGGCCGC atggcccgccgccgccatcgcggcccccgccgcccccggccgcccgggcccacgggcgcggtcccaaccgcacagtcccaggtaacctccacgcccaactcggaacccgtggtcaggagcgcgcccgcggccgccccgccgccgccccccgccagtgggcccccgccttcttgttcgctgctgctgcgccagtggctccacgttcccgagtccgcgtccgacgacgacgacgacgactggccggacagccccccgcccgagccggcgccagaggcccggcccaccgccgccgccccccgcccccggtccccaccgcccggcgcgggcccggggggcggggctaacccctcccaccccccctcacgccccttccgccttccgccgcgcctcgccctccgcctgcgcgtcaccgcagagcacctggcgcgcctgcgcctgcgacgcgcgggcggggagggggcgccgaagccccccgcgacccccgcgacccccgcgacccccacgcgggtgcgcttctcgccccacgtccgggtgcgccacctggtggtctgggcctcggccgcccgcctggcgcgccgcggctcgtgggcccgcgagcgggccgaccgggctcggttccggcgccgggtggcggaggccgaggcggtcatcgggccgtgcctggggcccgaggcccgtgcccgggccctggcccgcggagccggcccggcgaactcggtctaa (SEQ ID NO: 3).

According to an embodiment of the present invention, the ICP47 gene silencing is achieved by knocking out nucleotides 3-266 of the ICP47 gene. The ICP47 gene sequence encoding is sequentially encoded with the first nucleotide of the ICP47 gene start codon as the first position. The sequence of the ICP47 gene can be found at https://www.ncbi.nlm.nih.gov/ nuccore/NC_001806.2?report=genbank&from=46609&to=47803&strand=true, the specific sequence of the ICP47 gene is shown in SEQ ID NO: 4, where the underlined part codes for the ICP47 gene sequence.

GACCGGCGGCGACCGTTGCGTGGACCGCTTCCTGCTCGTCGGGGCGACCGGCGGCGACCGTTGCGTGGACCGCTCCCTGCTCGTCGGGAAAAGC atgtcgtgggccctggaaatggcggacaccttcctggacaacatgcgggttgggcccaggacgtacgccgacgtacgcgatgagatcaataaaagggggcgtgaggaccgggaggcggccaga accgccgtgcacgacccggagcgtcccctgctgcgctctcccgggctgctgcccgaaatcgcccccaacgcatccttgggtgtggcacatcgaagaaccggcgggaccgtgaccgacagtccccgtaatccggtaacccgttga GTCCCGGGTACGACCATCACCCGAGTCTCTGGGCGGAGGGTGGTTCCCCCCCGTGTCTCTCG (SEQ ID NO. :4).

According to an embodiment of the present invention, the CCL19 gene is located between nucleotide 134 and nucleotide 724 of the ICP34.5 gene, so that the constructed HSV-1 carries CCL19.

According to embodiments of the present invention, CMV and polyA are further included.

According to an embodiment of the invention, the CMV is operably linked to the CCL19 gene.

According to an embodiment of the present invention, the polyA is disposed between the 3′ end nucleotide of the CCL19 gene and the 134th nucleotide of the ICP34.5 gene.

According to an embodiment of the present invention, the viral vector has the nucleotide sequence shown in SEQ ID NO: 5.

AGCCCGGGCCCCCCGCGGGCTGAGACTAGCGAGTTAGACAGGCAAGCACTACTCGCCTCTGCACGCACATGCTTGCCTGTCAAACTCTACCACCCCGGCACGCTCTCTGTCTCC atggcccgccgccgccatcgcggcccccgccgcccccggccgcccgggcccacgggcgcggtcccaaccgcacagtcccaggtaacctccacgcccaactcggaacccgtggtcaggagcgcgcccgcggccgc [AAGCCATAGAGCCCACCGCATCCCCAGCATGCCTGCTATTGTCTTCCCAATCCTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAATAGAATGACACCTACTCAGACAATGCGATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCACCTTCCAGGTCAAGGAAGGCACGGGGGAGGGGCAAACAGATGGCTGGCAACTAGAAGGCACAGTCGAGGCTGATCAGCGGGTTTAAACGGGCCCTCTA GACTCGAGCGGCCGCCACTGTGCTGGATATCTG TCAGGAGCTTCTCCGCTTCATCTTGGCGCTGGTTCTCTGCAGCCGCTGGATGATCCGCTCCACCCAAGGCTGATCAGGTGGGTGCGCACAGCTGGCGGCCCTCAGTGTGGTAAACACCACTGCTGGCACCCTGCATCCGTCCTTGATCAGCAGATAGTGGAAATTCCTCACGATGTAGCCTGGGATAGGCTTCTGTGTCACAGACAGACAGCAATCCTCTGCGTCGTTTGTTCCGCTCAGGGTGGGTGCTGGAG AGGTCCACAGCACCAGCAGGGACAGGGCCAGCAGCAGTGCCAT ] (SEQ ID NO: 5).

In a second aspect of the invention, the invention provides an oncolytic virus. According to an embodiment of the present invention, the HSV viral vector described in the first aspect is carried. According to embodiments of the present invention, the oncolytic virus containing the HSV virus vector retains sensitivity to tumor cells and proliferative activity. Due to the characteristics of the ICP34.5 gene, after the CCL19 gene is inserted into the ICP34.5 gene of the HSV virus, CCL19 The expression amount of CCL19 is significantly increased, and the expression amount of CCL19 of HSV viruses carrying double copies of CCL19 is significantly increased compared with HSV viruses carrying other copies of CCL19. The oncolytic virus can continuously express the chemokine CCL19 at a high level, which is beneficial to tumor cells. The lethality is significantly improved and can effectively inhibit tumor cells.

According to embodiments of the present invention, the above-mentioned oncolytic virus may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the oncolytic virus is HSV-1. The inventor found that HSV-2 has safety risks and may cause viral infection in the genitals. Therefore, the use of HSV-1 can improve the safety of oncolytic viruses.

According to an embodiment of the present invention, the HSV-1 includes at least one selected from the group consisting of F strain, HF strain, KOS strain, HrR3 strain and 17 strain.

In a third aspect of the invention, the invention provides a pharmaceutical composition. According to an embodiment of the present invention, the HSV viral vector described in the first aspect or the oncolytic virus described in the second aspect is included. The pharmaceutical composition according to the embodiment of the present invention has stable quality and can be effective when using a lower dose, especially the inhibitory effect on recurrent and large-volume tumors is very significant.

According to embodiments of the present invention, the above-mentioned pharmaceutical composition may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the pharmaceutical composition contains 10^5-10^12 pfu of the HSV viral vector or oncolytic virus per unit dose.

In the fourth aspect of the present invention, the present invention proposes the use of the HSV viral vector described in the first aspect, the oncolytic virus described in the second aspect, or the pharmaceutical composition described in the third aspect in the preparation of medicines. According to embodiments of the present invention, the medicament is used to treat or prevent tumors. As mentioned above, the HSV viral vector described in the first aspect and the oncolytic virus described in the second aspect can both highly express the CCL19 under appropriate conditions and can effectively treat or prevent tumors. Therefore, using the HSV Drugs prepared from viral vectors, oncolytic viruses, or pharmaceutical compositions can also effectively treat or prevent tumors.

According to an embodiment of the present invention, the tumor includes a tumor selected from the group consisting of lung cancer, liver cancer, pharyngeal squamous cell carcinoma, colon cancer, osteosarcoma, ovarian cancer, prostate cancer, glioma, melanoma, colorectal cancer, esophageal cancer, and pancreatic cancer. At least one.

In a fourth aspect of the invention, the invention provides a method for treating tumors. According to an embodiment of the present invention, the method includes applying a therapeutically effective amount of the HSV viral vector of the first aspect, or the oncolytic virus of the second aspect, or the pharmaceutical composition of the third aspect to a patient. individuals in need. According to the method of the embodiment of the present invention, tumors can be effectively treated with low frequency of drug administration.

According to embodiments of the present invention, the above method may further include at least one of the following additional technical features:

According to an embodiment of the invention, the individual in need is a patient suffering from at least one of the following cancers: lung cancer, liver cancer, pharyngeal squamous cell carcinoma, colon cancer, osteosarcoma, ovarian cancer, prostate cancer, glioma, melanoma tumors, colorectal cancer, esophageal cancer, and pancreatic cancer.

In a fifth aspect of the invention, the invention proposes a method of recruiting immune cells to tumors. According to an embodiment of the present invention, the method includes contacting the tumor with the HSV viral vector of the first aspect or the recombinant oncolytic virus of the second aspect. As mentioned before, the HSV viral vector described in the first aspect and the oncolytic virus described in the second aspect can both highly express the CCL19 under appropriate conditions. Chemokines are a type of chemokines that can induce the directional movement of chemotactic immune cells. Small molecule secreted proteins, CCL19 and its receptors (such as CCR7), are expressed on dendritic cells, T cells and various tumor cells. Therefore, the HSV viral vector or oncolytic virus of the present invention can be effectively used to target immune cells. Recruited to tumors, thereby effectively inhibiting tumors.

In a sixth aspect of the present invention, the present invention provides a method for inhibiting tumor cell growth or promoting tumor cell death. According to an embodiment of the present invention, the method includes contacting the tumor cells with the HSV viral vector described in the first aspect or the recombinant oncolytic virus described in the second aspect.

According to embodiments of the present invention, the above method may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the tumor cells are selected from the group consisting of lung cancer, liver cancer, pharyngeal squamous cell carcinoma, colon cancer, osteosarcoma, ovarian cancer, prostate cancer, glioma, melanoma, colorectal cancer, esophageal cancer, and pancreatic cancer.

According to an embodiment of the invention, the recombinant oncolytic virus is provided in a dose sufficient to cause death of the tumor cells.

Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

Embodiments of the invention are described in detail below, examples of which are illustrated in the drawings. The embodiments described below with reference to the drawings are exemplary and are intended to explain the present invention and are not to be understood as limiting the present invention.

In addition, the terms “first” and “second” are used for descriptive purposes only and cannot be understood as indicating or implying relative importance or implicitly indicating the quantity of indicated technical features. Therefore, features defined as "first" and "second" may explicitly or implicitly include at least one of these features. In the description of the present invention, "plurality" means at least two, such as two, three, etc., unless otherwise expressly and specifically limited.

It should be noted that the "chemokine" mentioned in the present invention is a type of cytokine expressed on the cell membrane of immune cells and endothelial cells, which chemoattracts the directional movement of various immune cells, such as CCL19. CCL19 can chemoattract dendritic cells, CD4 ⁺ and CD8+ cells infiltrate tumors, mediate immune cells to release cytokines, inhibit tumor proliferation, migration and invasion, and play a key role in assisting in the treatment of tumors.

"Operably connected" as used in the present invention refers to connecting an exogenous gene to a vector so that the control elements in the vector, such as promoter sequences, etc., can exert their intended function of regulating the transcription and translation of the exogenous gene. .

The "oncolytic virus" of the present invention has lost part of its functional genes, thereby weakening its ability to infect and replicate in normal cells, and is an attenuated oncolytic virus, such as the HSV-1 oncolytic virus of the present invention, ICP47 The ICP34.5 gene is knocked out so that it can only selectively replicate in tumor cells.

In the present invention, the inventors screened the chemokines that need to be inserted into the expression vector and found that the CCL19 chemokine is easier to express in the expression vector than other chemokines, and the HSV virus carrying CCL19 is easier to express than other chemokines. Chemokine viruses have better oncolytic and immune effects, and better effects in treating or preventing tumors; the inventor further screened the insertion site of the CCL19 gene in the HSV virus. Due to the characteristics of the ICP34.5 gene, The inventor found that when the CCL19 gene was inserted into the ICP34.5 site, the HSV virus obtained had a significantly higher CCL19 gene expression than the virus in which CCL19 was inserted into the site other than the ICP34.5 gene, including all HSV viruses. Compared with the oncolytic virus containing the expression vector inserting CCL19 at a site other than the ICP34.5 gene, the oncolytic virus of the HSV expression vector has significantly improved CCL19 gene expression and is safer; at the same time, The copy number of the CCL19 gene inserted into the expression vector was explored, and it was found that after the double copies of the ICP34.5 gene in the expression vector were knocked out and the double copies of the CCL19 gene were inserted, the expression level of the CCL19 gene in the HSV expression vector was significantly higher than For an HSV expression vector carrying a single copy of the CCL19 gene, the expression level of the CCL19 gene containing the oncolytic protein of the HSV expression vector is significantly higher than that of the oncolytic virus of the HSV expression vector containing a single copy of the CCL19 gene.

In the following examples of the present invention, "Δ47 virus genome" refers to the HSV-1 oncolytic virus genome in which the ICP47 gene has been deleted, and "KOS-Δ47-S1-gDNA-hCCL19" refers to the HSV-1 oncolytic virus genome in which KOS-Δ47 has been inserted. hCCL19; Use the CRISSPR/Cas9 system to construct recombinant HSV-1 viruses, including plasmid construction, preparation and screening of single-copy recombinant oncolytic viruses, identification of single-copy viruses, preparation and screening of double-copy recombinant oncolytic viruses, and detection of double-copy viruses identification.

The present invention will be described below with reference to specific embodiments. It should be noted that these embodiments are only illustrative and do not limit the present invention in any way.

If specific techniques or conditions are not specified in the examples, the techniques or conditions described in literature in the field or product instructions will be followed. If the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be purchased commercially.

Example 1 The first round of virus recombination and screening

In this example, the inventor used phenol chloroform to extract the KOS-△47 virus genome; used Lipofectamine 3000 transfection reagent to transfect 293T cells to obtain the recombinant virus; the recombinant virus underwent the first round of limiting dilution screening and the second round of limiting dilution screening. , the positive recombinant virus was obtained, and the positive recombinant virus was amplified, genome extracted, PCR identified, and sequenced; the results showed that after the first round of virus recombination and screening, the recombinant virus was obtained as a single copy insertion. The specific experimental operations are as follows:

1. Phenol-chloroform extraction of KOS-△47 virus genome

For vero cell culture infected with KOS-△47 virus, the supernatant was discarded, leaving cells that had adherent lesions (~100% lesions) and frozen at -80°C. Follow these steps to extract the viral genome:

① Add 1mL of cell lysis solution to the cells, shake evenly to lyse the cells, gently scrape them into a 2mL centrifuge tube with a cell scraper, and keep in ice bath for 20 minutes.

②Add 660µL of 5M NaCl to the product in step ①, mix gently and place in the refrigerator at 4°C overnight.

③ Process the product of step ② under the following conditions: 4°C, centrifuge at 12,000 rpm for 30 minutes.

④Use a sharp tip to absorb the centrifuged supernatant into a new centrifuge tube, add an equal volume of phenol, chloroform, isoamyl alcohol (25:24:1), extract the protein, and gently invert the centrifuge tube up and down for 5 minutes.

⑤Centrifuge the product of step ④ at 4°C and 12000rpm for 10 minutes, use a sharpened pipette tip to absorb the supernatant, and extract the protein again.

⑥ Add 2 times the volume of pre-cooled absolute ethanol to the extracted supernatant, mix gently, and let stand at -20°C for 2 hours.

⑦Centrifuge the product of step ⑥ at 4℃, 12000rpm for 10min, discard the supernatant, and wash the pellet twice with 500µL of 75% ethanol (gently flick instead of pipetting), 4℃, 12000rpm, 10min.

⑧Discard the supernatant, run at 12000rpm, 1min, 4℃, and use a 10µL gun to absorb the liquid.

⑨Add 30µL deionized water to the product of step ⑦ to dissolve the DNA.

2. Transfect 293T cells to prepare recombinant virus. Use Lipofectamine 3000 transfection reagent to combine A and B (CRISPR/Cas9 gene editing plasmid (34.5-S1-2 plasmid) + homologous repair donor plasmid (dornor DNA (hCCL19) in Table 1 - RL1-PMD18T) + KOS-△47 virus genome) were mixed and co-transfected into 293T cells in a 6-well plate to obtain a virus liquid containing the recombinant virus. Among them, the 34.5-S1-2 plasmid is a plasmid containing gRNA. The plasmid is a CRISPR/Cas9 gene editing plasmid targeting the ICP34.5 gene locus, and dormor DNA (hCCL19- RL1-PMD18T) is a donor plasmid containing hCCL19. [Table 1] No. Reagent name Adding amount A Opti-MEM (Gibco) 125 µL lipofectamine3000 Reagent 24 µL B Opti-MEM (Gibco) 125 µL 34.5-S1-2 plasmid 1 µg dormor DNA(hCCL19-RL1-PMD18T) 1µg KOS-△47 virus genome 10µg ^p3000TM 12µL

Before cell transfection, replace the 10% FBS/DMEM complete culture medium incubated at 37°C, then mix A and B evenly in the EP tube (gently mix, flick with your hands) and let stand at room temperature for 15 minutes, then press Add 300 µL per well of the transfection complex dropwise to the 293T cell culture in the 6-well plate. After culturing for 6 hours, replace with fresh incubated DMEM+10% FBS complete medium and continue to culture the cells.

Two days after transfection, observe the cell lesions, discard the old culture medium, add 1 mL of 1% FBS/DMEM complete culture medium incubated at 37°C, collect the cells, freeze and thaw repeatedly at minus 70 degrees for 3 times, centrifuge at 4000 rpm for 10 minutes, and take out the cells. The purified virus liquid containing the recombinant virus is named KOS-△47-S1-gDNA-hCCL19-201224. It is ready for use or frozen at -80°C.

3. The first round of limiting dilution screening of recombinant viruses

The first round of recombinant virus obtained in step 2 is subjected to the first round of limiting dilution screening. The specific operations are as follows:

Dilute the recombinant virus liquid KOS-△47-S1-gDNA-hCCL19-201224 according to the dilution factor of 100 times and 500 times, and add 100 µL/well to a 96-well plate with a single layer of Vero, 2 pieces of each dilution. 96-well plate, named: KOS-△47-S1-gDNA-hCCL19-201224 (10 ^-2 , ①~②), KOS-△47-S1-gDNA-hCCL19-201224 (2×10 ^-3 , ①~ ②), place the 96-well plate in a 37°C, 5% CO ₂ incubator.

Observe the cell lesions after 72 hours. All wells of KOS-△47-S1-gDNA-hCCL19-201224 (2×10 ^-3 , ①~②) have obvious lesions. For KOS-△47-S1-gDNA-hCCL19-201224 (2×10 ^-3 , ①) Use the supernatant from the 96-well plate for crude extraction of viral gDNA. The method is as follows:

2µL virus liquid + 8µL gDNA Extraction Buffer (add proteinase K at 10µL/mL before use), mix and react in a PCR machine, 55℃ 1h, 95℃ 10min, 16℃ ∞, recorded as: KOS-△47-S1- gDNA-hCCL19-201227-2×10 ^-3 -①-1-96), used for PCR amplification verification.

Among them, the virus strains obtained after the first round of limiting dilution screening were crudely extracted from viral gDNA. The specific operation was: 2µL virus liquid + 8µL gDNA Extraction Buffer (add proteinase K at 10µL/mL before use), mix and react in a PCR machine , PCR reaction conditions are 55°C for 1h, 95°C for 10min, 16°C ∞. Use PCR amplification to verify whether hCCL19 is inserted into the viral genome. The hCCL19 gene detection primers are shown in Table 2, and the PCR amplification reaction system is shown in Table 3. [Table 2] primer Synthetic order number (Aiji) Sequence 5'→3' amplification product hCCL19-screen-F2 TWO012160419 TGATCAAGGACCGGATGCAGG(SEQ ID NO:6) 150bp hCCL19-screen-R2 TWO012160420 GTCAGGAGCTTCTCCGCTTC(SEQ ID NO:7) [table 3] Components Volume µL Crude gDNA extraction 0.5µL MightyAmp DNA Polymerase 0.25µL 2×MightyAmp Buffer Ver.2 5µL hCCL19-screen-F2 0.25µL hCCL19-screen-R2 0.25µL ddH ₂ O 3.75µL total volume 10µL

The PCR results of the first round of limiting dilution screening of recombinant viruses are shown in Figure 1. The PCR electrophoresis results showed that KOS-△47-S1-gDNA-hCCL19-9 and No. 32 were suspected positive recombinant viruses. The virus liquid was collected and KOS-△ 47-S1-gDNA-hCCL19-9 was named KOS-△47-S1gDNA-hCCL19-9-200227.

4. The recombinant virus undergoes the second round of limiting dilution screening.

Conduct the second round of limiting dilution screening on the suspected positive recombinant viruses obtained in step 3 after the first round of limiting dilution screening. The specific operations are as follows:

Dilute the recombinant virus liquid KOS-△47-S1gDNA-hCCL19-9-200227 at a dilution factor of 1×10 ⁶ and add 100 µL/well into a 96-well plate filled with a single layer of Vero cells. Name it: KOS-△47- S1gDNA-hCCL19-201231-1x10 ⁶ , 37℃, 5% CO ₂ After culturing for 2 hours, discard the virus solution, add 200µL/well DPBS, wash once, discard, add 100µL/well 1% FBS/DMEM, and continue culturing . After 96 hours of culture, the cell lesions were observed. KOS-△47-S1gDNA-hCCL19-201231-1x10 ⁶ had obvious lesions in 28 wells, numbered: s1g-9-1~28. The supernatant of the lesioned wells was tested for viruses. gDNA crude extraction, the method is the same as above.

Among them, the virus strain (KOS-△47-S1-gDNA-hCCL19-9) obtained after the second round of limiting dilution screening was subjected to crude viral gDNA extraction. The specific operation was: 2µL virus liquid + 8µL gDNA Extraction Buffer (press 10µL before use) /mL, add proteinase K), mix and react in a PCR machine. The reaction conditions are: 55°C for 1 hour, 95°C for 10 minutes, 16°C ∞. Use PCR amplification to verify whether hCCL19 is inserted into the viral genome. The hCCL19 gene detection primers are as shown in the table. 2, and the PCR amplification reaction system is shown in Table 3.

The PCR results of the second round of limiting dilution screening of recombinant viruses are shown in Figure 2. The PCR electrophoresis results showed that KOS-△47-S1-gDNA-hCCL19-9-2, KOS-△47-S1-gDNA-hCCL19-9- Suspected positive recombinant virus No. 6; KOS-△47-S1-gDNA-hCCL19-9-2 was named KOS-△47-hCCL19-S1g-9-2 No.-210104.

5. Identification of the recombinant oncolytic viruses obtained in the second round of limiting dilution screening

The recombinant oncolytic virus obtained in step 4 is identified and sequenced. The specific operations are as follows:

The positive recombinant virus (KOS-△47-S1-gDNA-hCCL19-9-2) was propagated, genome extracted, PCR identified, and sequenced. The specific operations of genome extraction were as follows: recombinant virus KOS-△47-hCCL19 -S1g-9-2-210104 was propagated with vero cells in a 6-well plate, added 5 µL of virus, and cultured at 37°C, 5% CO ₂ for 24 hours. The cells were completely damaged. The culture medium was collected and named KOS-△47-S1g- 9-2-P01-210107, take 200µL of virus liquid, use Viral RNA/DNA Extraction Kit ver.5.0 to extract the virus genome, name it: KOS-△47-S1g-9-2-gDNA-210107, The hCCL19 homology arm sequence detection primers used in the PCR amplification reaction are shown in Table 4, and the PCR amplification reaction system is shown in Table 5. [Table 4] primer Synthetic order number (Aiji) Sequence 5'→3' amplification product 345-HOM1-F2 TWO11200517 GCAAGCACTACTCGCCTCTGCACGC(SEQ ID NO:8) 1189bp, 1749bp 345-HOM2-R2 TWO02210201 GTTGCCCATTAAGGGCCGCGGGAAT(SEQ ID NO:9) [table 5] Element Volume gDNA 1.0µL MightyAmp DNA Polymerase 1.0µL 2×MightyAmp Buffer Ver.2 25.0µL 345-HOM1-F2 1.0µL 345-HOM2-R2 1.0µL ddH ₂ O 21.0µL total volume 50µL

The results of recombinant virus propagation and PCR identification after the first round of virus recombination are shown in Figure 3. Among them, KOS-△47-S1g-9-2-gDNA-210107 (9-2 in Figure 3) is the virus KOS-△ The genome of 47-S1g-9-2-P01-210107 was cut into gels before and after recombination, and sent to Guangzhou Aiji for sequencing (sanger sequencing) to confirm the recombinant bands. The hCCL19 gene expression cassette sequencing was completely correct, and the pre-recombination strips were The band was confirmed to be the band before KOS genome recombination; it was confirmed that the recombinant virus KOS-△47-S1g-9-2-P01-210107 obtained through the first round of virus recombination and screening was a single copy insertion.

Example 2 Second round of virus recombination and screening

In this example, the single-copy inserted KOS-Δ47-S1-gDNA-hCCL19-9-2 obtained in Example 1 was subjected to the second round of recombination and screening. The single-copy recombinant virus genome was extracted with phenol-chloroform; Lipofectamine 3000 was used for transfection. The reagent is used to transfect 293T cells to obtain the recombinant virus; the recombinant virus is subjected to limited dilution, first round of PCR screening, and second round of PCR screening to obtain a positive recombinant virus. The positive recombinant virus undergoes amplification, genome extraction, PCR identification, and sequencing. The specific operations are as follows:

1. Phenol-chloroform extraction of KOS-△47-hCCL19-9-2 (i.e., KOS-△47-S1-gDNA-hCCL19-9-2) viral genome

Vero cell culture infected with KOS-△47-S1g-9-2-P01 (i.e., KOS-△47-S1g-9-2-P01-210107) virus, discard the supernatant, and leave the adherent lesions. Effector cells (~100% diseased) were frozen at -80°C, and the steps for extracting viral genomes were the same as above.

2. Transfect 293T cells to prepare recombinant virus

Use Lipofectamine 3000 transfection reagent to mix A and B in Table 6 (CRISPR/Cas9 gene editing plasmid (Cas9-sgRNA345-5 plasmid) + homologous repair donor plasmid (dornor DNA (hCCL19- RL1-PMD18T) + viral genome ( KOS-△47-hCCL19-9-2) were mixed and co-transfected into 293T cells in a 6-well plate to obtain a virus liquid containing the recombinant virus. Among them, Cas9-sgRNA345-5 is a plasmid containing gRNA and is directed against ICP34. A 5-gene locus CRISPR/Cas9 gene editing plasmid, dormor DNA (hCCL19- RL1-PMD18T) is the donor plasmid containing hCCL19. [Table 6] No. Reagent name Adding amount A Opti-MEM (Gibco) 125 µL lipofectamine3000 Reagent 24 µL B Opti-MEM (Gibco) 125 µL Cas9-sgRNA345-5 plasmid 1 µg Dornor DNA(hCCL19- RL1-PMD18T) 1µg KOS-Δ47-hCCL19-9-2 viral genome 10µg ^p3000TM 12µL

The cell transfection operation was the same as above, and the virus liquid containing the recombinant virus was named KOS-Δ47-hCCL19-S5g-P00-210117 for later use.

3. The first round of limiting dilution screening of recombinant viruses

The second round of recombinant virus obtained in step 2 is subjected to the first round of limiting dilution screening. The specific operations are as follows:

Dilute the recombinant virus liquid KOS-△47-hCCL19-S5g-P00-210117 according to the dilution factor of 400 times, 1000 times, and 3000 times. Add 100 µL/well to a 96-well plate filled with a single layer of Vero cells. Each dilution Two 96-well plates each, named: KOS-△47-S5g-hCCL19-3000X/1000X/400X-P01-210117-01~02, incubate in a 37°C, 5% _CO2 incubator for 2 hours, then discard For the virus liquid, add 100 µL/well DPBS to wash the plate, discard it, add 100 µL/well 1% FBS/DMEM, and place the 96-well plate in a 37°C, 5% CO ₂ incubator.

The above cells were cultured for 72 hours and the cell lesions were observed. KOS-△47-S5g-hCCL19-3000X-P01-210117-01 had 45-well lesions, and KOS-△47-S5g-hCCL19-3000X-P01-210117-02 had lesions. 57-well lesions were used to crudely extract viral gDNA from the lesion wells. The method was the same as above and was recorded as: KOS-△47-S5g-hCCL19-3000X-P01-210121-01~102, which was used for PCR amplification verification.

Among them, the virus strains obtained after the first round of limiting dilution screening were crudely extracted from viral gDNA, and PCR amplification was used to verify whether the ICP34.5 gene sequence was successfully knocked out. The ICP34.5 gene sequence detection primers are as shown in Table 7. PCR The amplification reaction system is shown in Table 8. [Table 7] primer Synthetic order number (Aiji) Sequence 5'→3' amplification product LP-F2 TWO1170893 TCTAACGTTACACCCGAGGC(SEQ ID NO:10) 319bp LP-R2 TWO1170894 ATACCGGGAAGCGGAACAAG(SEQ ID NO:11) [Table 8] Element Volume Crude gDNA extraction 0.5µL MightyAmp DNA Polymerase 0.25µL 2×MightyAmp Buffer Ver.2 5µL LP-F2 0.25µL LP-R2 0.25µL ddH ₂ O 3.75µL total volume 10µL

The results of the first round of PCR screening after the second round of limiting dilution of the recombinant viruses are shown in Figure 4. The PCR electrophoresis results showed that a total of 60 positive recombinant viruses were obtained after limiting dilution.

4. Second round of PCR screening of recombinant viruses

The 60 positive recombinant viruses obtained after the first round of limiting dilution in step 3 of this example were screened in the second round of PCR to verify whether hCCL19 was inserted into the viral genome. The hCCL19 gene detection primers are shown in Table 9 (amplification of hCCL19 gene expression cassette full length), the PCR amplification reaction system is shown in Table 10. [Table 9] primer Synthetic order number (Aiji) Sequence 5'→3' amplification product 345-HOM1-F2 TWO11200517 GCAAGCACTACTCGCCTCTGCACGC(SEQ ID NO:12) 1189bp, 1749bp 345-HOM2-R2 TWO02210201 GTTGCCCATTAAGGGCCGCGGGAAT(SEQ ID NO:13) [Table 10] Element Volume Crude gDNA extraction 0.5µL MightyAmp DNA Polymerase 0.25µL 2×MightyAmp Buffer Ver.2 5µL 345-HOM1-F2 0.25µL 345-HOM2-R2 0.25µL ddH ₂ O 3.75µL total volume 10µL

The amplification results of the second round of recombinant viruses after the second round of PCR screening are shown in Figure 5: The PCR electrophoresis results show that only the samples with amplified recombinant bands are obviously 4 and 5 in KOS-△47-S5g-hCCL19 ,8-10,12,15,18,19,21,26,28-31,36,37,43,45,47,48,53,54,56,57,59,60,63,67,68 , 71, 72, 77, 79-81, 84, 87, 88, 90, 93-98, and 101, a total of 47 positive recombinant viruses.

5. Identification of positive recombinant oncolytic viruses

The recombinant oncolytic virus obtained in step 4 is identified and sequenced. The specific operations are as follows:

The positive recombinant viruses (4, 5, 8-10, and 12 in KOS-△47-S5g-hCCL19) were amplified, genome extracted, PCR identified, and sequenced. The recombinant viruses were amplified, and the viral genomes were extracted and named respectively. : KOS-Δ47-S5g-hCCL19-04/05/08/09/10/12-gDNA-210125. The specific operation of genome extraction is: propagate vero cells in a 6-well plate, add 2 µL virus liquid, and culture at 37°C and 5% _CO2 for 24 hours. When the cells are completely damaged, collect the culture medium and name it KOS-△47-S5g-hCCL19. -04/05/08/09/10/12210124, stored at -70°C, take 200µL virus liquid, use the kit Viral RNA/DNA Extraction Kit ver.5.0 to extract the genome, elute with 50µL sterile water, and name them respectively: KOS-△47-S5g-hCCL19-04/05/08/09/10/12-gDNA-210125, the sequence design primers of the ICP34.5 gene in the PCR amplification reaction are shown in Table 7, and the PCR amplification reaction system As shown in Table 8. The PCR electrophoresis results are shown in Figure 6. The PCR electrophoresis results showed that KOS-△47-S5g-hCCL19-04, 05, 08, 09, 10, and 12 failed to amplify the knockout fragments, and the recombinant virus successfully knocked out ICP34. 5 genes.

Among them, primers were designed based on the homology arm sequence of the hCCL19 expression cassette to amplify the full length of the hCCL19 expression cassette. The primer sequences are shown in Tables 11 and 12, and the PCR amplification reaction system is shown in Table 13. [Table 11] primer Synthetic order number (Aiji) Sequence 5'→3' amplification product 345-HOM1-F2 TWO11200517 GCAAGCACTACTCGCCTCTGCACGC(SEQ ID NO:14) 1189bp, 1749bp 345-HOM2-R2 TWO02210201 GTTGCCCATTAAGGGCCGCGGGAAT(SEQ ID NO:15) [Table 12] primer Synthetic order number (Aiji) Sequence 5'→3' amplification product 345-HOM1-F2 TWO11200517 GCAAGCACTACTCGCCTCTGCACGC(SEQ ID NO:16) 2292bp, 2852bp 345-flank-seq TWO02210201 GTTGCCCATTAAGGGCCGCGGGAAT(SEQ ID NO:17) [Table 13] Element Volume gDNA 1.0µL MightyAmp DNA Polymerase 1.0µL 2×MightyAmp Buffer Ver.2 25.0µL Primer F 1.0µL Primer R 1.0µL ddH ₂ O 21.0µL total volume 50µL

Among them, primer F is 345-HOM1-F2 in Table 11 and Table 12; primer R is 345-HOM2-R2 or 345-flank-seq in Table 11 and Table 12.

The PCR results are shown in Figure 7. The KOS-△47-S5g-hCCL19-04, 05, 08, 09, 10, and 12 samples have single bands, and the bands are the same size as the hCCL19-RL1-pMD18T plasmid positive control sample. consistent. The gel was cut to recover KOS-△47-S5g-hCCL19-04, 05, 08, 09, 10, and 12 bands, and the samples were sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing. The sequencing results showed that KOS-△47-S5g-hCCL19 -The sequencing of hCCL19 gene expression cassettes of recombinant viruses 04, 05, 08, 09, 10, and 12 are all correct, and they are named: KOS-△47-S5g-hCCL19-04/05/08/09/10/12-P01- 210123, that is, after two rounds of recombination, a double-copy integrated KOS-△47-hCCL19 recombinant virus was successfully obtained.

Example 3 The first round of plaque purification of positive recombinant oncolytic viruses

1. Monoclonal preparation and genome extraction

Select KOS-△47-S5g-hCCL19-05/12-P01-210123 for the first round of plaque purification, and use 1% FBS/DMEM to dilute the virus solution to "5E+03", "5E+04", "5E+05", discard the old culture medium of vero cells in the 6-well plate, add 300µL virus dilution, 2 duplicate wells for each dilution, and continue culturing after infection; after staining the cells, observe the staining situation, each virus Pick 5 virus spots from each strain, add 200 µL virus liquid to the vero cells in the overgrown 6-well plate. After 2 days of culture, the cells have become completely diseased, collect the virus liquid, and name it: KOS-△47-hCCL19-05- P01-01/02/03/04/05-210205, KOS-△47-hCCL19-12-P01-01/02/03/04/05-210205, take 200µL virus liquid and use the Viral RNA/DNA Extraction Kit ver.5.0 to extract viral genes. The specific extraction operations are carried out according to the kit instructions. The extracted viral genes are named: KOS-△47-hCCL19-05-01/02/03/04/05-gDNA-210205, KOS -Δ47-hCCL19-12-01/02/03/04/05-gDNA-210205.

2. PCR identification

The specific operations of PCR amplification are as follows: the primer sequences used are shown in Table 11 and Table 12, and the reaction system used is shown in Table 13.

The electrophoresis results of the recombinant virus KOS-△47-hCCL19-05/12 are shown in Figure 8. The electrophoresis results show that KOS-△47-hCCL19-05-01/02/03/04/05, KOS-△47-hCCL19 -12-01/02/03/04/05 all express hCCL19 gene but not ICP34.5 gene.

3. Sequencing

The gel was cut to recover the bands of KOS-△47- hCCL19-05-01/02/03 and KOS-△47- hCCL19-12-01/02/03, and the samples were sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing. The specific operations of sequencing were: Sanger sequencing. The sequencing results showed that Aiji-IGC280537 and 6 clones were sequenced and confirmed to be recombinant viruses. The hCCL19 gene expression cassette sequencing was completely correct and consistent with the theoretical sequence. The sequencing quality was good.

Example 4 Recombinant oncolytic virus Second round of plaque purification

1. Monoclonal preparation and genome extraction

Select KOS-△47-hCCL19-05-02-P01-210205 and KOS-△47-hCCL19-12-03-P01-210205 for the second round of plaque purification, and dilute the virus liquid to "2E+04", " 2E+05" and "2E+06", the virus infection operation was the same as in Example 3. Five virus spots were picked from each virus strain and propagated using vero cells as the host. After 2 days of culture, the cells were completely diseased. Collect the virus liquid and name it: KOS-△47-hCCL19-05-02-P01-01/02/03/04/05-210303, KOS-△47-hCCL19-12-03-P01-01/02/03 /04/05- 210303, take 200 µL of the virus liquid, and use the Viral RNA/DNA Extraction Kit ver.5.0 to extract the viral genome. The specific operation is performed according to the kit instructions. The extracted viral genome is named: KOS-△47- hCCL19 -05-02-01/02/03/04/05-gDNA-210303, KOS-Δ47-hCCL19-12-03-01/02/03/04/05-gDNA-210303.

2. PCR identification

The specific operations of PCR amplification are as follows: the primer sequences used are shown in Table 11 and Table 12, and the reaction system used is shown in Table 13.

The electrophoresis results of the recombinant virus KOS-△47-hCCL19-05-02/12-03 are shown in Figure 9. The electrophoresis results show that after amplification by 2 pairs of primers, KOS-△47-hCCL19-05-02-01/02/ No. 03/04/05, KOS-△47-hCCL19-12-03-01/02/03/04/05 sample has single bands, and the band size is consistent with the band of hCCL19- RL1-PMD18T plasmid positive control substance , which is a large band after reorganization.

3. Sequencing

Cut the glue and recover the strips of KOS-△47- hCCL19-05-02-01/02/03 and KOS-△47- hCCL19-12-03-01/02/03, and send the samples to Guangzhou Aiji Biotechnology Co., Ltd. Sequencing. The specific operations of sequencing are: Sanger sequencing results show that Ig-IGC282403, 6 clones were confirmed to be recombinant viruses by sequencing, the hCCL19 gene expression cassette sequencing was completely correct, consistent with the theoretical sequence, and the sequencing quality was good.

Example 5 Recombinant oncolytic virus Third round of plaque purification

1. Monoclonal preparation and genome extraction

Select KOS-Δ47-hCCL19-05-02-02 and KOS-Δ47-hCCL19-12-03-01 obtained in Example 4 for the third round of plaque purification, and dilute the virus liquid to "5E+05" , "1E+06", "2E+06", "4E+06", the virus infection operation is the same as in Example 3; 5 virus spots are picked from each virus strain, propagated (vero cells are used as hosts), and cultured After 2 days, the cells were completely diseased, and the virus liquid was collected and named: KOS-△47-hCCL19-05-02-02-01/02/03/04/05-P01-210315, KOS-△47-hCCL19- 12-03-01-01/02/03/04/05-P01-210315, take 200µL virus liquid, use the Viral RNA/DNA Extraction Kit ver.5.0 to extract the viral genome, name it: KOS-△47-hCCL19 -05-02-02-01/02/03/04/05-gDNA-210315, KOS-Δ47-hCCL19-12-03-01-01/02/03/04/05-gDNA-210315.

2. PCR identification

For PCR amplification of the genome extracted in step 1, the primer sequences used are shown in Table 7, Table 11, Table 12, and Table 14, and the reaction systems used are shown in Table 8, Table 15, and Table 16. [Table 14] primer Synthetic order number (Aiji) Sequence 5'→3' amplification product 345-HOM1-F2 TWO11200517 GCAAGCACTACTCGCCTCTGCACGC(SEQ ID NO:18) 2784bp, 3344bp 345-flank-seq-R3 TWO012110638 TCGGAGGCGGAGTCGTCGTCATGGT(SEQ ID NO:19) [Table 15] Element Volume gDNA 1.0µL MightyAmp DNA Polymerase 1.0µL 2×MightyAmp Buffer Ver.2 25.0µL 345-HOM1-F2 1.0µL 345-HOM2-R2 1.0µL ddH ₂ O 21.0µL total volume 50µL [Table 16] Element Volume gDNA 1.0µL MightyAmp DNA Polymerase 1.0µL 2×MightyAmp Buffer Ver.2 25.0µL 345-HOM1-F2 1.0µL 345-flank-seq-R3 1.0µL ddH ₂ O 21.0µL total volume 50µL

The electrophoresis results of the recombinant viruses KOS-△47-hCCL19-05-02-02 and KOS-△47-hCCL19-12-03-01 are shown in Figure 10. The electrophoresis results show that after amplification by two pairs of primers, KOS-△47 -hCCL19-05-02-02-01/02/03/04/05, KOS-△47-hCCL19-12-03-01/02/03/04/05 have single bands, and the bands are the same The bands of hCCL19-RL1-PMD18T plasmid positive control products were consistent in size and were large bands after recombination.

3. Sequencing

Cut the glue to recover the strips of KOS-△47-hCCL19-05-02-02-01/02/04 and KOS-△47-hCCL19-12-03-01-01/02/03, and send the samples to Guangzhou Aiji Biotechnology Ltd. Sequencing. The specific operation of sequencing is: Sanger sequencing. The sequencing results showed that IGC283714, IGC283898, and the 6 selected clone expression cassettes were all sequenced correctly. The hCCL19 gene expression cassette was sequenced completely correctly, consistent with the theoretical sequence, and the sequencing quality was good.

Example 6 : Recombinant virus KOS- △ 47-hCCL19-05-02-02-02 Sequencing verification

High-fidelity PCR amplification enzymes (PrimeSTAR® Max DNA Polymerase, ApexHF HS DNA Polymerase FS) were used to perform TA cloning and sequencing of the gene expression box sequence of the recombinant virus KOS-△47-hCCL19-05-02-02-02, and the primer sequences were As shown in Table 17, the reaction system is shown in Table 18. [Table 17] primer Synthetic order number (Aiji) Sequence 5'→3' amplification product 345-HOM1-F2 TWO11200517 GCAAGCACTACTCGCCTCTGCACGC(SEQ ID NO:20) 2784bp, 3344bp 345-flank-seq-R3 TWO012110638 TCGGAGGCGGAGTCGTCGTCATGGT(SEQ ID NO:21) [Table 18] Element Volume template 1µL PCR amplification enzyme (2X) 25µL 345-HOM1-F2(10uM) 1µL 345-flank-seq-R3 (10uM) 1µL DMSO 2µL ddH ₂ 0 20µL total volume 50µL

The PCR amplification program is: 98℃ 3min; (98℃ 10s, 64℃ 15s, 72℃ 3min) for 30 cycles; 72℃ 5min; 16℃∞, after completion, 1.5% agarose gel electrophoresis, the electrophoresis diagram is shown in the figure 11. After recovery using the cycle-pure kit (omega), add A tail, serial T loading, and transform into large intestine competent DH5a. The positive clone screening results are shown in Figure 12. Pick 6 positive clones each and send samples. to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing.

Sequencing results: Aiji IGC287528, IGC287406, IGC287407, high-fidelity enzyme ApexHF HS DNA Polymerase FS selected clones: 1, 3, 4, 6, 7 clone gene expression box is correct, sequencing quality is good, hCCL19 gene expression box is correct, consistent with theory The sequences are completely consistent, and the sequencing quality is good; the clones selected by the high-fidelity enzyme Prime star max: the gene expression boxes of clones 3, 5, 6, 7, and 8 are correct and the sequencing quality is good. The hCCL19 gene expression box is correct and completely consistent with the theoretical sequence. The sequencing Good quality.

Example 7 Viral cytotoxicity test

Culture the cell lines shown in Table 19 in vitro and inoculate them into a 96-well culture plate at an appropriate cell density. After culturing overnight, add 12 gradient concentrations (MOI=20, 5, 1.25, 0.3125, 0.078125, 0.01953125, 0.004882813, 0.001220703). , 0.000305176, 7.62939E-05, 1.90735E-05, 4.76837E-06), the specific information of the two viruses is shown in Table 20, and then cultured for 24, 48 or 72h respectively, according to the CCK8 kit (purchased The cell viability was tested according to the instructions of colleagues from Japan. [Table 19] cell type cell name medium NCI-H460 large cell lung cancer cells RPMI-1640+10%FBS Fadu human pharyngeal squamous cell carcinoma MEM+10%FBS HepG2 liver cancer cells DMEM+10%FBS Hep3B2.1-7 liver cancer cells DMEM+10%FBS HCT-116 colon cancer cells RPMI-1640+10%FBS HT-29 colon cancer cells RPMI-1640+10%FBS SW620 colon cancer cells DMEM+10%FBS [Table 20] Sample name Titer Source KOS-ATCC 8.33x10^7 SHS21054,P06 KOS-△47-hCCL19 7.76x10^7 SHS21054,P18

Note: KOS-ATCC is a wild-type virus; KOS-△47-hCCL19 is a virus that knocks out 47 and inserts the hCCL19 gene at position 34.5.

The IC50 values of the two viruses against different cells are shown in Table 21. According to the judgment standard of MOI IC50 < 0.6 after 72 hours of incubation: Judging from the virus killing results, HT29, SW620, hepG 2, Hep3B2.1-7, NCI- H460 cells are oncolytic virus-sensitive tumor cell lines. Compared with the KOS-ATCC original virus strain, the KOS-hCCL19 recombinant virus strain still retains sensitivity to HCT-116 cells. [Table 21] cells Virus time IC50 goodness of fit HT29 KOS-ATCC 24h 4.374 0.7991 48h 0.242 0.8058 72h 0.0192 0.9624 KOS-hCCL19 24h 3.723 0.6944 48h 0.2638 0.8473 72h 0.0684 0.9234 SW620 KOS-ATCC 24h 0.9004 0.8208 48 hours 0.04022 0.9549 72 hours 0.000232 0.908 KOS-hCCL19 24h 0.4613 0.7669 48h 0.2716 0.9074 72 hours 0.005805 0.8987 hepG 2 KOS-ATCC 24h 18.07 0.3458 48h 0.6676 0.509 72 hours 0.01669 0.8495 KOS-hCCL19 24h 10.06 0.5428 48h 1.747 0.4688 72 hours 0.1998 0.8442 HCT-116 KOS-ATCC 24h N/A N/A 48h 0.7569 0.7096 72 hours 0.04677 0.8901 KOS-hCCL19 24h N/A N/A 48h 5.518 0.3941 72 hours 0.1322 0.9066 Hep3B2.1-7 KOS-ATCC 24h 0.09674 0.7730 48 hours 0.004995 0.9108 72 hours 0.000208 0.8956 KOS-hCCL19 24h 0.03229 0.9140 48h 0.002691 0.9594 72 hours 0.0005236 0.9280 NCI-H460 KOS-ATCC 24h N/A N/A 48h 2.267 0.7429 72 hours 0.07985 0.9472 KOS-hCCL19 24h 7.531 0.436 48h 1.393 0.8633 72 hours 0.2139 0.8525

Note: N/A indicates that nonlinear fitting cannot be made due to poor dose-response relationship or unmeasured. The numbers marked with horizontal lines indicate poor fitting (fitting degree <80%), which corresponds to the MOI IC50 value. For reference only.

Example 8 Virus replication ability test

Take the KOS-ATCC (the wild-type virus mentioned above) and KOS-hCCL19 (HSV1 carrying hCCL19) in the logarithmic growth phase, and the cells are Hep3B2.1-7 liver cancer cells, NCI-H460 large cell lung cancer cells, and HepG2 Liver cancer cells, HT29 colon cancer cells, HCT-116 human colon cancer cells and SW620 human colon cancer cells were seeded in a 6-well culture plate at an appropriate cell density. After culturing overnight, the cells in the 6-well plate were counted according to the number of cells in each well. Dilute the virus stock solution with high-sugar DMEM or RPMI-1640 culture medium containing 1% inactivated FBS to prepare a virus solution with MOI=0.1. Add 300 μL of virus solution to each well, and incubate at 37°C and 5% _CO2 . Shake the culture plate every 15 minutes to allow the virus to better adsorb the cells. After 1.25 h, add 1 mL of culture medium. Discard the culture medium after 2 h, add 2 mL of culture medium, and place in a CO ₂ incubator for incubation for 24 h, 48 h, or 72 h respectively.

After the culture, the virus liquid was collected for virus titer determination. After freezing and thawing three times (-80 ℃, 37 ℃), gradient dilute the collected virus liquid, take 300 µL to infect Vero cells (6-well plate), shake the culture plate every 15 minutes to allow the virus to better adsorb the cells, add 2 mL after 1.25 hours culture medium. After 2 hours, discard the medium and add 300 µL of complete DMEM medium and 3 mL of 2% methylcellulose to fix the virus. After culturing for 3-4 days, remove the covering medium, add 10% HCHO solution, 1 mL/well, and fix for 20 min. Then absorb the formaldehyde solution, add 1% crystal violet staining solution, 500 μL/well, and stain for 30 minutes. Finally, pour away the staining solution, rinse slowly with tap water, dry with absorbent paper, count the plaques, and calculate the virus titer. Virus titer = virus dilution factor * (1000/300) * number of plaques.

This example evaluates the replication capabilities of the original virus strain (KOS-ATCC) and the modified virus strain (KOS-hCCL19) in 6 cancer cell lines (Hep3B2.1-7, HepG2, NCI-H460, SW620, HT29, HCT116) A T test was performed on them. The replication abilities of KOS-ATCC and KOS-hCCL19 in six types of cancer cells are shown in Figure 13. Among them, the replication abilities of two strains of viruses in different tumor cells are different. Overall, , the modified virus strain retained its proliferative activity against tumor cells.

Example 9 Virus expression level test

In this example, a virus expression level experiment was carried out in vero cells. The specific experimental operations are as follows:

9.1 Test materials

Reagent materials are shown in Tables 22 and 23: [Table 22] Name Manufacturer Batch number Level DMEM medium Gibco 2186832, 2186840 biological grade trypan blue Gibco 35050-061 biological grade Fetal bovine serum (FBS) Gibco 2175442p biological grade DPBS Gibco 223126 biological grade Trypsin Gibco 2276876 biological grade P/S Gibco 2289320 biological grade [Table 23] Name Source medium vero african green monkey kidney cells ATCC DMEM+10%FBS+1%P/S

9.2 Test methods

9.2.1 Cell culture

Culture vero cells in a 37°C, 5% carbon dioxide incubator. Observe cells once a day using an inverted microscope. When the cell growth confluence rate in the culture dish reaches 80~90%, perform cell passage: discard the old culture medium, wash away the residual culture medium with DPBS, add 1 mL of 0.25% trypsin digestion solution, and place it in the incubator for digestion for 2 minutes. After the cells become round and float, discard the trypsin, add new culture medium to terminate digestion, and culture in fresh sterile petri dishes according to a certain ratio.

9.2.2 Cell plating

Remove the Vero cells from the cell culture incubator, aspirate the culture medium, wash away the remaining culture medium with DPBS, add 1 ml of trypsin to the culture dish, digest it in a 37°C incubator for 2 minutes, then aspirate the trypsin, and use DPBS to wash the cells in each dish. Resuspend the cells in 10 mL (10% FBS, 1% P/S) DMEM and count. Plate the cells in a 6-well plate at a density of 1*10^6 cells/mL. Plate the cells with 2 mL of cell solution per well. After completion, place the cells in a cell culture incubator and continue culturing for 24 hours.

9.3 Viral infection

9.3.1 Cell counting

Take out the Vero cells cultured in the 6-well plate from the cell culture incubator, select two wells for cell counting: aspirate the culture medium, wash away the remaining culture medium with DPBS, add 500 µL of trypsin to each well, digest it in a 37°C incubator for 2 minutes, and then add Add 500 µL of DMEM medium with 10% FBS and 1% P/S to stop digestion, count, and calculate the average number of cells per well.

9.3.2 Virus dilution and viral infection

HSV1-hCCL19 and HSV1-2k viruses were used to infect the above cells at MOI=0.01 and 0.1 pfu/cell respectively. 2-3 duplicate wells were made respectively, and blank controls were set up. First use virus diluent to dilute HSV1-hCCL19 and HSV1-2k viruses 1000 times respectively, and then prepare infection virus culture media according to the infection MOI and the number of cells per well; add 1 mL of the above-prepared virus culture media to each well for infection, and blank control Use virus diluent instead.

After virus infection for 2 hours, shake the plate once every 20 minutes, discard the supernatant, and replace it with 10% FBS, 1% P/S DMEM medium, 2 mL per well.

Continue culturing in the incubator for 48 hours or 72 hours, collect the supernatant, centrifuge at 4°C and 4500 rpm for 5 minutes, take the supernatant, aliquot and use ELISA to detect the expression of hCCL19.

The expression of hCCL19 in the supernatant was determined according to the Human MIP-3b ELISA Kit (EhCCL19).

The specific results are shown in Figure 14, where blank represents the well of blank culture medium, and 2k represents HSV1 with ICP34.5 and ICP47 deleted; the results show that there is no significant difference in the expression of hCCL19 between 48h and 72h of virus infection. Under the same infection time conditions , the virus used MOI=0.01 and 0.1 pfu/cell to infect cells, and there was no significant difference in the expression of hCCL19. However, when MOI=0.01 pfu/cell infected cells, the expression of hCCL19 was higher after 48 hours of virus infection.

Example 10 Virus replication ability test

Take the KOS-ATCC (i.e., the wild-type virus mentioned above) and KOS-hCCL19 (HSV1 carrying hCCL19) in the logarithmic growth phase, and evaluate the replication ability of the two viruses after infecting tumor cells respectively. The tumor cells were CAL27 oral squamous cell carcinoma cells, A549 human lung cancer cells, PC-3 prostate cancer cells, CNE-2Z nasopharyngeal carcinoma cells, Panc-1 pancreatic cancer cells, 143B osteosarcoma cells, fadu human nasopharyngeal carcinoma cells, and KYSE510 human Esophageal squamous cell carcinoma cells, KB human oral epidermoid carcinoma cells, ECA109 human esophageal phosphocarcinoma cells, Aspc human pancreatic cancer cells, colo829 human melanoma cells, SK-OV-3 ovarian cancer cells, hela cervical cancer cells, U87MG human brain glial cells tumor cells, skmel-28 human melanoma cells, LOVO intestinal adenocarcinoma, T.Tn human esophageal cancer cells, Calu-6 lung epithelial cell carcinoma and NCI-H226 (lung) squamous carcinoma cells.

The above tumor cells were seeded into a 6-well culture plate at an appropriate cell density. After culturing overnight, the cells in the 6-well plate were counted. According to the number of cells in each well, the virus stock solution was treated with high-sugar DMEM containing 1% inactivated FBS, RPMI- Dilute with 1640 or F12K culture medium to prepare a virus solution with MOI=0.02. Discard the old culture medium from the cell plate, and transfer the two diluted virus solutions sequentially to the cell plate containing different tumor cells at 1 mL per well, and incubate for 2 hours in a 7°C, 5% _CO2 incubator; the virus Discard the supernatant after 2 hours of infected cells, add 2 mL of 1% FBS basic medium to each well, and place in a 37°C, 5% CO ₂ incubator to continue culturing for 24 hours, 48 hours, or 72 hours.

After the culture, collect the virus fluid at two time points of 24 h, 48 h or 72 h according to the cytopathic condition (samples will be collected when the cytopathic condition exceeds 50%), and measure the virus titer. After freezing and thawing three times (-80 ℃, 37 ℃), the collected virus liquid was gradient diluted, and 300 µL was taken to infect Vero cells (6-well plate). Shake the culture plate every 15 minutes to allow the virus to better adsorb the cells. After 75 minutes of virus infection, , add 1 mL of DMEM medium with 1% inactivated FBS to each well, incubate for 2 hours in a 37°C, 5% _CO2 incubator, discard the virus liquid, and then add 300 μL of DMEM medium with 1% inactivated FBS and 3 mL of methylcellulose medium that has been equilibrated to room temperature and placed in a 37°C, 5% _CO2 incubator. After culturing for 2 days, 2 mL of basic medium containing 0.01% neutral red was evenly added to stain the cells. Place in a 37°C, 5% _CO2 incubator for more than 12 hours. Use a suction pump to discard all the liquid in the 6-well plate, count the plaques, and calculate the virus titer. Virus titer = virus dilution factor * (1000/300) * number of plaques.

This example evaluates the effects of the original virus strain (KOS-ATCC) and the modified virus strain (KOS-hCCL19) on 20 cancer cell lines (CAL27, A549, PC-3, CNE-2Z, Panc-1, 143B, fadu, KYSE510 , KB, ECA109, Aspc, colo829, SK-OV-3, hela, U87MG, skmel-28, LOVO, T.Tn, Calu-6, NCI-H226), KOS-ATCC, KOS-hCCL19 in 20 The replication ability in cancer cells is shown in Figure 15-17. The modified virus strain retains the proliferative activity on tumor cells.

“KOS” and “KOS-ATCC” in Figure 1-17 both refer to the original virus strain; “hCCL19” and “KOS-hCCL19” both refer to the modified virus strain.

Example 11 Antitumor activity of viruses in xenograft animal models

NCI-H460 human lung cancer cells were inoculated subcutaneously on the right back of BALB/c nude mice to establish a mouse tumor-bearing model. When the tumor size grows to about ^100mm3 , drug administration will be carried out in groups, with 8 animals in each group. In the NCI-H460 model, the KOS-hCCL19 high dose group (KOS-hCCL19 (high)) and the KOS-hCCL19 low dose (KOS-hCCL19 (low)) group are set up, and the corresponding administration doses are 3.33E+06 pfu/ mouse/once, 3.33E+05 pfu/mouse/once. In the model, a virus vector group (Vehicle group) is also set up. After grouping, the drugs were administered via intratumoral administration, once every 3 days (days 0, 3, and 6). The NCI-H460 mouse model was administered three times consecutively. After the start of drug administration, measure the tumor size twice a week, monitor tumor changes, and calculate the relative tumor growth inhibition rate TGI (TGI % = (1-T/C) × 100 %; where T/C% is the relative tumor proliferation rate, the percentage value of the relative tumor volume between the treatment group and the control group at a certain time point).

This example evaluates the anti-tumor activity of KOS-hCCL19 on the NCI-H460 human lung cancer xenograft tumor animal model. The anti-tumor effect exerted by the virus in vivo is shown in Figure 18. On the NCI-H460 model, on the 20th day after the start of administration, at the two dose levels of KOS-hCCL19, the relative tumor inhibition rates TGI were 69.44% ( p <0.001) and 57.36% ( p <0.05) respectively. Overall, KOS-hCCL19 showed significant in vivo anti-tumor activity after administration in the NCI-H460 human lung cancer model.

Example 12 Evaluation of viral neurotoxicity

Five different virus gradients were set up for KOS-WT (i.e. "KOS" or "KOS-ATCC") virus and KOS-hCCL19 virus, and the above-mentioned viruses with certain concentration gradients were injected into the brains of female BALB/c mice ( 20 µL/mouse), then observe the survival of the animals, and calculate the LD ₅₀ of different viruses. Among them, the virus dosages of each group corresponding to the KOS-WT virus are 5.00E+06 pfu/mouse, 8.33E+05 pfu/mouse, 1.39E+05 pfu/mouse, and 2.31E+04 pfu/mouse respectively. mouse, 3.86E+03 pfu/mouse; the virus dosages of each group corresponding to KOS-hCCL19 virus are 4.64E+06 pfu/mouse, 1.55E+06 pfu/mouse, 5.16E+05 pfu/mouse, 1.72E+05 pfu/mouse, 5.73E+04 pfu/mouse. At the same time, a virus vehicle group (Vehicle group) was set up, with 6 animals in each group. After the experiment, LD ₅₀ was calculated through SPSS-Probit.

This example evaluates the neurotoxicity of the wild-type KOS-WT strain and KOS-hCCL19 virus, and counts the survival of the above-mentioned groups of experimental animals within 14 days of administration. The specific experimental results are shown in Figure 19. No animals died in the Vehicle group. The number of animal deaths in the KOS-WT virus group from high to low were 6, 4, 4, 4, and 0 respectively. KOS-hCCL19 The number of animal deaths in the virus group from high to low were 0, 2, 1, 0, and 0 respectively. Based on the death of animals under different virus administration gradients, the median lethal dose LD ₅₀ of different viruses was calculated. The corresponding LD ₅₀ of KOS-WT virus and KOS-hCCL19 virus are 5.403E+04 pfu and >4.64E+06 pfu respectively. The KOS-hCCL19 virus obtained after modification has significantly reduced neurotoxicity compared with the wild-type KOS-WT strain. Among the three viruses, the KOS-hCCL19 virus has the highest mortality rate and the lowest toxicity. The KOS-hCCL19 virus is approximately 100 times more attenuated than the KOS-WT virus.

Example 13 Effect of target gene insertion site on viral anti-tumor activity

This example studies the difference in anti-tumor activity of viruses with different hCCL19 insertion sites. The viruses tested are KOS-△47-△ICP34.5-△TK-hCCL19 and KOS-△47-△ICP34.5-hCCL19. , among which, KOS-△47-△ICP34.5-△TK-hCCL19 is hCCL19 inserted at TK, and KOS-△47-△ICP34.5-hCCL19 is hCCL19 inserted at ICP34.5 (that is, the recombinant virus of the present invention , KOS-Δ47-hCCL19 or KOS-hCCL19), in addition, a virus vehicle group (Vehicle group) was also set up as a control. For the method of obtaining the target virus, refer to Examples 1-7. The specific experimental operations are as follows:

A20 cells were subcutaneously inoculated on the left and right sides of mice to establish a murine B-cell lymphoma subcutaneous transplant tumor model. When the tumor size on the left and right sides grew to about 100 mm, the above ^three viruses were administered in groups, and the dosage of each virus was equal. It was 8.0E+07 pfu/mouse/once; there were 8 animals in each group; the right tumor was administered intratumorally on days 0, 3, 6, and 9 for a total of 4 times. After the start of administration, measure the size of the tumor every 3 days, monitor tumor changes, and calculate the relative tumor inhibition rate TGI (TGI % = (1-T/C) × 100%; where T/C% is the relative tumor proliferation rate , the percentage value of the relative tumor volume between the treatment group and the vehicle control group at a certain time point).

This example evaluates the anti-tumor activity of KOS-Δ47-ΔICP34.5-ΔTK-hCCL19 and KOS-Δ47-ΔICP34.5-hCCL19 on the A20 homograft tumor animal model. The anti-tumor effect exerted by the virus in vivo is shown in Figure 20 (administered side) and Figure 21 (non-administered side). The results showed that under the dosing regimen, KOS-△47-△ICP34.5-△TK-hCCL19 and KOS-△47-△ICP34.5-hCCL19 significantly inhibited A20 charge by the 12th day after dosing. The tumors on the right side of the tumor mice grew (TGI were 64.24% and 94.40% respectively), and they were statistically significant compared with the vehicle control group ( p <0.05). For left tumors without intratumoral injection, KOS-△47-△ICP34.5-△TK-hCCL19 and KOS-△47-△ICP34.5-hCCL19 also showed a certain degree of tumor growth inhibition (TGI respectively (14.86%, 50.28%), but compared with the control group, there was no statistical difference ( p >0.05). Compared with KOS-△47-△ICP34.5-△TK-hCCL19, KOS-△47-△ICP34.5-hCCL19 showed relatively better tumor inhibitory effects on both the administered and unadministered sides. . As shown in Figure 22, it is a picture of the death status of the A20 mouse model in each group after the 28th day of administration. As of the 28th day after administration, KOS-△47-△ICP34.5-△TK-hCCL19 and KOS-△47 - In the △ICP34.5-hCCL19 group, 0 and 3 mice respectively had bilateral tumors cured (TV=0 mm ³ ); the overall experimental data showed that KOS-△47-△ICP34.5-△TK-hCCL19 Both KOS-△47-△ICP34.5-hCCL19 and KOS-△47-△ICP34.5-hCCL19 can significantly inhibit the tumor growth on the administration side of the A20 model at a dosage of 1.6E+08 pfu/mouse. At the same time, on the unadministered side, although there was no statistical difference compared with the control group, the two test drugs also showed a certain tumor inhibitory effect. In terms of anti-tumor effect, KOS-△47-△ICP34.5-hCCL19 showed better tumor killing activity than KOS-△47-△ICP34.5-△TK-hCCL19, indicating that different insertion sites will affect Antitumor activity of viruses. For tumor inhibition on the unadministered side, KOS-△47-△ICP34.5-△TK-hCCL19 and KOS-△47-△ICP34.5-hCCL19 can produce certain distal anti-tumor activity after administration.

In the description of this specification, reference to the terms "one embodiment," "some embodiments," "an example," "specific examples," or "some examples" or the like means that specific features are described in connection with the embodiment or example. , structures, materials or features are included in at least one embodiment or example of the invention. In this specification, the schematic expressions of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the specific features, structures, materials or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, those skilled in the art may combine and combine different embodiments or examples and features of different embodiments or examples described in this specification unless they are inconsistent with each other.

Although the embodiments of the present invention have been shown and described above, it can be understood that the above-mentioned embodiments are illustrative and should not be construed as limitations of the present invention. Those of ordinary skill in the art can make modifications to the above-mentioned embodiments within the scope of the present invention. The embodiments are subject to changes, modifications, substitutions and variations.

without

The above and/or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments in conjunction with the following drawings, in which: [Figure 1] is a PCR result diagram after the first round of limiting dilution screening of the recombinant oncolytic virus obtained after the first round of recombination according to the embodiment of the present invention, where M is the marker; 1-32 are the selected virus strain clones; +: is the positive control with hCCL19 recombinant virus as template (expressing hCCL19 gene); D: is the treatment with hCCL19-RL1-pMD18T plasmid as template (expressing hccl19hCCL19 gene); K: is the treatment with KOS-△47 virus gene as template (expressing ICP34 .5 gene) treatment; water: negative control using water as template; [Figure 2] is a PCR result diagram of the second round of limiting dilution screening of the recombinant oncolytic virus obtained after the first round of recombination according to the embodiment of the present invention, where M is a marker; 1-28 are selected in the second round of screening. 28 clones (1-13 are KOS-△47-S1-gDNA-hCCL19-32, 1-28 are KOS-△47-S1-gDNA-hCCL19-9); D: hCCL19-RL1-PMD18T plasmid is used as template (Expressing hCCL19 gene); K: Treatment using KOS-△47 virus gene as template (Expressing ICP34.5 gene); Water: Negative control using water as template; [Figure 3] is a diagram showing the PCR identification results after amplification of the recombinant oncolytic virus obtained after the first round of recombination according to the embodiment of the present invention, where M is marker-DL5000; 9-2: is KOS-△47- S1-gDNA-hCCL19-9-2 viral genome as template; D: hCCL19-RL1-PMD18T plasmid as template (expressing hCCL19 gene); K: KOS-△47 viral gene as template (expressing ICP34. 5 genes) treatment; water: negative control using water as template; [Figure 4] is a PCR result diagram of the recombinant oncolytic virus obtained after the second round of recombination according to the embodiment of the present invention after the first round of screening, where M is marker-DL2000; 1-102 are the 102 selected clones ; 9-2: is the processing using KOS-△47-S1-gDNA-hCCL19-9-2 viral genome as template; D: is processing using hCCL19-RL1-PMD18T plasmid as template (expressing hCCL19 gene); K: is KOS - Treatment of △47 virus gene as template (expressing ICP34.5 gene); water: negative control using water as template; KOS-△47-S5g-hCCL19 is KOS-△47-S1-gDNA-hCCL19-9-2 The new virus strain obtained through the second round of recombinant transfection; [Figure 5] is a PCR result diagram of the recombinant oncolytic virus obtained after the second round of recombination according to the embodiment of the present invention after the second round of screening, where M is marker-DL2000; 4, 5, 8, 9...101 is: 60 positive viruses obtained through the first round of PCR screening; 9-2: is the processing of KOS-△47-S1-gDNA-hCCL19-9-2 virus genome as template (expressing hCCL19 gene and ICP34.5 gene) ; D: is the treatment where hCCL19-RL1-PMD18T plasmid is used as template (expressing hCCL19 gene); K: is the treatment where KOS-△47 virus gene is used as template (expressing ICP34.5 gene); Water: negative control where water is used as template; KOS-△47-S5g-hCCL19 is a new virus strain obtained by the second round of recombinant transfection of KOS-△47-S1-gDNA-hCCL19-9-2; [Figure 6] is a diagram of the PCR identification results after amplification of the positive recombinant oncolytic virus obtained after the second round of recombination according to the embodiment of the present invention, where M is marker-DL2000; 9-2: is KOS-△47 -S1-gDNA-hCCL19-9-2 viral genome is used as a template (expressing hCCL19 gene and ICP34.5 gene); D: Processing where hCCL19-RL1-PMD18T plasmid is used as a template (expressing hCCL19 gene); 32-6: For the processing of KOS-△47-S1-hCCL19-32-6 viral gene as template, a single-copy inserted virus clone (expressing hCCL19 gene) was screened for the first round of recombination; water: water was used as a negative control for the template; KOS-△ 47-S5g-hCCL19 is a new virus strain obtained through the second round of recombinant transfection of KOS-△47-S1-gDNA-hCCL19-9-2; [Figure 7] is a PCR result diagram obtained after amplifying the full length of hCCL19 expression cassette according to the embodiment of the present invention, where M is marker-DL2000; 9-2: is KOS-Δ47-S1-gDNA-hCCL19-9- 2: Processing where the viral genome is used as a template (expressing hCCL19 gene and ICP34.5 gene); D: Processing where hCCL19-RL1-PMD18T plasmid is used as a template (expressing hCCL19 gene); 32-6: Processing where KOS-△47-S1-hCCL19 is used -32-6 Viral gene is used as a template, and a single-copy inserted virus clone (expressing hCCL19) is screened for the first round of recombination; water: water is used as a negative control for the template; [Figure 8] is an electrophoresis result diagram obtained after the first round of plaque purification of the positive recombinant oncolytic virus according to the embodiment of the present invention, in which M is marker-DL5000; D is hCCL19-RL1-PMD18T plasmid as template (expression hCCL19 gene); K is the treatment of KOS-△47 virus genome as template (expressing ICP34.5 gene); water: used as a negative control for water template; [Figure 9] is an electrophoresis result diagram obtained after the second round of plaque purification of the positive recombinant oncolytic virus according to the embodiment of the present invention, where M is marker-DL5000; D is hCCL19-RL1-PMD18T plasmid as template (expression hCCL19 gene); K is the treatment of KOS-△47 virus genome as template (expressing ICP34.5 gene); water: used as a negative control for water template; [Figure 10] is an electrophoresis result diagram obtained after the third round of plaque purification of the positive recombinant oncolytic virus according to the embodiment of the present invention, where M is the marker; D is the hCCL19-RL1-PMD18T plasmid as the template (expressing hCCL19 gene ); K is the treatment of KOS-△47 virus genome as template (expressing ICP34.5 gene); water: negative control using water template; [Figure 11] is an electrophoresis diagram of a positive recombinant oncolytic virus in an embodiment of the present invention, in which the size of the amplified fragment of the recombinant virus KOS-Δ47-hCCL19-05-02-02-02 is in line with expectations; [Figure 12] is a picture of the screening results of TA-linked positive clones of the recombinant virus KOS-Δ47-hCCL19-05-02-02-02; [Figure 13] is a graph showing the replication ability results of KOS-ATCC and KOS-hCCL19 in six types of cancer cells according to the embodiment of the present invention; [Figure 14] is a graph showing the results of virus expression levels detected after cells were infected with the 2k virus and the KOS-hCCL19 recombinant virus according to the embodiment of the present invention; [Figure 15]-[Figure 17] is a graph showing the replication ability results of KOS and hCCL19 in 20 types of cancer cells according to the embodiment of the present invention; KOS is a wild-type strain; hCCL19 (also known as KOS-hCCL19) is a recombinant strain of virus; [Fig. 18] is a graph showing the results of changes in tumor size of the NCI-H460 mouse model according to the embodiment of the present invention; [Figure 19] is a survival curve chart of each group of animals in the virus neurotoxicity evaluation experiment according to the embodiment of the present invention; [Figure 20] is a graph showing the changes in tumor size on the right side (administration side) of each group of A20 mouse models according to the embodiment of the present invention; [Figure 21] is a graph showing the changes in tumor size on the left side (non-administered side) of the A20 mouse model in each group according to the embodiment of the present invention; [Fig. 22] is a diagram showing the death status of the A20 mouse model in each group after 28 days of administration according to the embodiment of the present invention.

TW202313982A_111131226_SEQL.xml

Claims (14)

An HSV viral vector, wherein the ICP47 and ICP34.5 genes of the HSV viral vector are silenced and carry the CCL19 gene. The HSV viral vector as described in claim 1, which carries two copies of the CCL19 gene. The HSV viral vector according to claim 1, wherein the CCL19 gene has a 6.A>C mutation. The HSV viral vector according to claim 1, wherein the ICP34.5 gene silencing is achieved by knocking out nucleotides 135-723 of the ICP34.5 gene; The ICP47 gene silencing is achieved by knocking out nucleotides 3-266 of the ICP47 gene. The HSV viral vector according to any one of claims 1 to 4, wherein the CCL19 gene is located between the 134th nucleotide and the 724th nucleotide of the ICP34.5 gene. The HSV viral vector as described in claim 5, further comprising CMV and polyA; The CMV is operably linked to the CCL19 gene; The polyA is located between the 3' end nucleotide of the CCL19 gene and the 134th nucleotide of the ICP34.5 gene. The HSV viral vector according to claim 1, wherein the HSV viral vector has the nucleotide sequence shown in SEQ ID NO: 5. An oncolytic virus carrying the HSV viral vector as described in any one of claims 1 to 7. The oncolytic virus according to claim 8, wherein the oncolytic virus is HSV-1; The HSV-1 includes at least one selected from the group consisting of F strain, HF strain, KOS strain, HrR3 strain and 17 strain. A pharmaceutical composition comprising the HSV viral vector as described in any one of claims 1 to 7, or the oncolytic virus as described in claim 8 or 9. The pharmaceutical composition according to claim 10, wherein each unit dose of the pharmaceutical composition contains 10^5-10^12 pfu of the HSV viral vector or oncolytic virus. The pharmaceutical composition according to claim 10 or 11, further comprising a pharmaceutically acceptable carrier. An HSV viral vector as described in any one of claims 1 to 7, an oncolytic virus as described in claim 8 or 9, or a pharmaceutical composition as described in any one of claims 10 to 12 is prepared Use in medicines for treating or preventing tumors. The use as claimed in claim 13, wherein the tumor is selected from the group consisting of lung cancer, liver cancer, pharyngeal squamous cell carcinoma, colon cancer, osteosarcoma, ovarian cancer, prostate cancer, glioma, melanoma, colorectal cancer, and esophageal cancer , at least one of pancreatic cancer.

Images