CN114703186B

CN114703186B - Tumor specific promoter and application thereof

Info

Publication number: CN114703186B
Application number: CN202210331620.8A
Authority: CN
Inventors: 杨莉; 田要美
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2022-03-31
Filing date: 2022-03-31
Publication date: 2023-08-29
Anticipated expiration: 2042-03-31
Also published as: CN114703186A

Abstract

The invention belongs to the field of tumor immunotherapy, and particularly relates to a tumor specific promoter and application thereof. The invention aims to solve the technical problem that the tumor specific proliferation capacity of oncolytic adenovirus is limited. The scheme of the invention for solving the problems is to provide a core promoter element which has the independent function of promoting gene expression, can be independently used as a promoter, and can also be used as an element construction promoter. The nucleotide sequence is shown as SEQ ID No. 1; or a nucleic acid molecule having a 1 or several base insertion, deletion and/or substitution mutation in the nucleotide sequence shown in SEQ ID No.1 and still having a promoter function. The modified tumor specific promoter has better tumor specific promoter function, and the oncolytic adenovirus constructed by the promoter has the characteristic of being capable of specifically proliferating in tumor cells but not proliferating in normal cells, and is an excellent immunotherapeutic medicine for various tumors.

Description

Tumor specific promoter and application thereof

Technical Field

The invention belongs to the field of tumor immunotherapy, and particularly relates to a tumor specific promoter and application thereof.

Background

Surgical treatment, radiation therapy, chemotherapy, and the like are currently the conventional means for treating tumors. In recent years, tumor immunotherapy has rapidly progressed, and has become a hotspot of clinical treatment research on tumors. Oncolytic adenoviruses are recombinant replication-competent adenoviruses, and viruses which proliferate only in tumor cells can specifically kill tumor cells without killing activity on normal cells by inserting a tumor-specific promoter or a gene associated with the proliferation of the deleted virus in normal cells. Oncolytic adenovirus has the excellent characteristics of easy production, high efficiency, clinical safety and the like. In recent years, oncolytic adenoviruses have become a hotspot in the field of tumor therapy due to their innovativeness and therapeutic effects.

Although oncolytic adenoviruses have made some progress in tumor therapy, they have failed to exhibit complete anti-tumor effects in most clinical trials, and they have mainly faced several challenges, including limited tumor-specific proliferation capacity of oncolytic adenoviruses, limited spread of intratumoral infection, inability to cope with tumor complexity with monotherapy, tumor-inhibiting microenvironment-inhibiting oncolytic adenoviras, and the like. Aiming at the application challenges of oncolytic adenoviruses, the main solutions are to optimize the proliferation capacity of tumor specific promoters in tumors, express pro-apoptosis proteins to sensitize tumor cells, optimize the transportation mode, mediate immune regulation and the like.

The tumor specific efficient proliferation capability is a source innovation link of oncolytic adenoviruses and is one of the greatest challenges of clinical application. To ensure the safety of oncolytic adenoviruses in normal cells, it is ensured that they proliferate only in tumor cells, mainly by two ways: firstly, utilizing a tumor specific promoter to control genes necessary for virus proliferation, thereby controlling the virus proliferation; secondly, genes which are necessary for virus proliferation in normal cells and are not needed in tumor cells are deleted, so that the virus can only proliferate in tumor cells, and the application of the former is an important strategy in targeted gene virus treatment.

Human telomerase reverse transcriptase (Human telomerase reverse transcriptase, hTERT) has been demonstrated to be highly expressed in a variety of malignant tumor tissues, such as lung cancer, esophageal cancer, breast cancer, thyroid cancer, melanoma, cervical cancer, rectal cancer, renal cancer, and leukemia cells, as compared to normal tissues. Therefore, the telomerase promoter can be used as a tumor specific promoter for oncolytic adenovirus treatment, and the prior study shows that the activity of the hTERT promoter as the tumor specific promoter is quite limited, so that the hTERT promoter is difficult to obtain good effect in practical application.

At present, the optimization and reconstruction of a tumor specific promoter are urgently needed in the field, so that the tumor specific efficient proliferation capacity of oncolytic adenoviruses is improved, the efficient specific killing capacity of oncolytic adenoviruses is further realized, and a new effective choice is provided for the research and development of tumor immunotherapy in the field.

Disclosure of Invention

The invention aims to solve the technical problem that the tumor specific proliferation capacity of oncolytic adenovirus is limited. The technical scheme for solving the problems is to provide a core starting element. The core promoter element has the independent function of promoting gene expression, and can be used as a promoter independently or as an element construction promoter.

The core enabling element:

1) The nucleotide sequence is shown as SEQ ID No. 1;

or:

2) A nucleic acid molecule which has 1 or several base insertion, deletion and/or substitution mutations in the nucleotide sequence shown in SEQ ID No.1 and which still has a promoter function.

Preferably, the 1 or several base insertion, deletion and/or substitution mutation is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 base insertion, deletion and/or substitution mutation.

Further, the nucleotide sequence of the core promoter element is shown in any one of SEQ ID No.3, SEQ ID No.4 or SEQ ID No. 5.

The invention also provides a promoter containing the core promoter element.

Further, the nucleotide sequence of the promoter is shown as SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8.

Wherein the promoter is further inserted with at least one E2F binding site.

Wherein the nucleotide sequence of the E2F binding site is shown as SEQ ID No. 15. Or a nucleic acid molecule having a 1 or several base insertion, deletion and/or substitution mutation in the nucleotide sequence shown in SEQ ID No.15 and still having the function of an E2F binding site.

Further, the E2F binding site in the above promoter is inserted at the 5 'and/or 3' end of the above core promoter element.

Further, the nucleotide sequence of the promoter is shown as SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13 or SEQ ID No. 14.

The invention also provides the application of the core promoter element or the promoter in preparing viruses or plasmids. Further, the virus is adenovirus. Further, the adenovirus is an oncolytic adenovirus.

The invention also provides recombinant vectors containing the above-described core promoter element or the above-described promoter.

Wherein the recombinant vector is a plasmid vector or a viral vector.

Wherein the viral vector is an adenovirus vector, an adenovirus-associated virus or a retrovirus vector.

Wherein the viral vector is an oncolytic virus.

Further, the oncolytic virus is at least one of oncolytic adenovirus, oncolytic parvovirus, oncolytic herpesvirus, oncolytic poxvirus, oncolytic vesicular stomatitis virus, oncolytic measles virus, oncolytic myxoma virus, oncolytic retrovirus, oncolytic reovirus, oncolytic vaccinia virus.

Wherein the plasmid vector is at least one of pDC316, pDC311, pDC312, pDC315, pDC511, pDC512, pDC515, pDC516, pShuttle, pShuttle-CMV, pCTAP-shift series plasmid, pNTAP-shift series plasmid, pAdTrack, pAdTrack-CMV, pacAd5 series plasmid, pHBAd series plasmid or pXC1 plasmid.

Wherein the oncolytic adenovirus in the recombinant vector is an adenovirus of which the serotype belongs to the subgenera A, subgenera B, subgenera C, subgenera D, subgenera E, subgenera F or subgenera G.

Wherein, the oncolytic adenovirus in the recombinant vector can be selected from the group consisting of serotype A subgenera types 12, 18, 31 and 61, type B subgenera 3, 7, 11, 14, 16, 21, 34, 35, 55, 66, 68, 76-79, type C subgenera types 1, 2, 5, 6, 57 and 89; types 8, 9, 13, 15, 17, 19, 20, 22 to 30, 32, 33, 36 to 39, 46, 48, 49, 53, 54, 56, 58 to 60, 62 to 65, 67, 69 to 75, 80 to 88, 90 to 103 of the subgenera D; type 4, sub-genus E, type 40 and 41, sub-genus F; adenovirus belonging to subgenera G52 and the like.

Wherein the expression of E1A and/or E1B-19K genes is driven by the core promoter element or the promoter in the oncolytic adenovirus in the recombinant vector.

Wherein, E1A in the recombinant oncolytic adenovirus is E1A (Delta 24) deleted with 24bp in the middle, and the nucleotide sequence is shown in SEQ ID No. 16. Wherein the nucleotide sequence of the E1B 19K is shown as SEQ ID No. 17.

The invention also provides a host cell containing the recombinant vector. Further, the host cell is a eukaryotic cell.

On the basis, the invention provides an anti-tumor medicament. The antitumor drug is prepared by adding pharmaceutically acceptable auxiliary components into the recombinant vector.

Meanwhile, the invention also provides a method for preparing the recombinant vector. The method comprises the following steps:

a) Constructing the core promoter element or the promoter operably linked to a gene required for adenovirus proliferation into a shuttle plasmid;

b) Transferring the shuttle plasmid and adenovirus skeleton plasmid obtained in the step a) into packaging cells, and packaging to obtain the oncolytic adenovirus.

Wherein the genes required for adenovirus proliferation in the method are E1A and/or E1B-19K genes.

Wherein the shuttle plasmid described in the above method is pDC316.

Wherein, the adenovirus backbone plasmid pBHGloxdelE13cre, pBHGfrtdelE FLP, pAdEasy-1, pAdEasy-2, pBHGE3i or pBHGE10i described in the above method;

wherein, the packaging cell in the method is HEK293 cell.

The shuttle vector and adenovirus skeleton plasmid are transferred into HEK293 cells by utilizing Lipofectamine 3000, and oncolytic adenovirus packaging is carried out.

The beneficial effects of the invention are as follows: the invention creatively obtains the modified tumor specific core promoter element and the tumor specific promoter, and has better tumor specific promoter function. The oncolytic adenovirus is constructed by the promoter, has the specific targeting advantage of being capable of being specifically proliferated in tumor cells but not in normal cells, and is an excellent immunotherapeutic medicine for various tumors. Experiments prove that the tumor specific core promoter element and the tumor specific promoter of the invention only have activity in tumor cells, have no activity in normal cells, and have safety and specificity. The oncolytic adenovirus can more effectively kill various tumor cells in vitro, and has no killing effect on normal cells. More importantly, in vivo experiments, the oncolytic adenovirus can effectively inhibit the growth of tumors, and provides a new choice for the development and application of immunotherapeutic drugs in the field.

Drawings

FIG. 1 RT-PCR detection of mRNA expression of human telomerase reverse transcriptase in different human cells.

FIG. 2 detection of hTERT promoter mutation in different human tumor cells.

FIG. 3 schematic diagram of hTERT WT promoter.

FIG. 4 double fluorescein assay for hTERT point mutation promoter activity. * P <0.05; * P <0.01.

FIG. 5 double fluorescein assay for detecting hTERT point mutation core initiation element activity. * P <0.05; * P <0.01; * P <0.001.

FIG. 6 double fluorescein assay for detecting hTERT point mutation promoter activity after E2F binding site modification. * P <0.05; * P <0.01; * P <0.001.

FIG. 7RT-PCR detection of E1A mRNA expression following oncolytic adenovirus OAd-null infected cells.

FIG. 8Western blot detection of E1A protein expression following oncolytic adenovirus OAd-null infection of cells.

FIG. 9 CCK8 assay for in vitro tumor killing activity of oncolytic adenovirus OAd-null. * P <0.05; * P <0.01; * P <0.001.

FIG. 10 tumor killing activity of OAd-null oncolytic adenoviruses in different tumor models. Tumor volume and tumor size after a375 tumor treatment with oad-null oncolytic adenovirus, symbol x indicates tumor regression; tumor volume and tumor size after treatment of U87MG tumors with oad-null oncolytic adenovirus; tumor volume and tumor size after treatment of SKOV3 tumors with oad-null oncolytic adenovirus. * P <0.05; * P <0.05.

Detailed Description

Oncolytic viruses, particularly oncolytic adenoviruses, currently face challenges, one of which is the limited tumor-specific proliferation capacity of oncolytic adenoviruses.

The invention performs a great amount of creative work for enhancing the intratumoral proliferation capacity of oncolytic viruses, in particular the tumor specific proliferation capacity. The invention surprisingly found that by carrying out specific modification on the hTERT promoter, a high-efficiency tumor specific promoter can be obtained. Of course, the promoter can also be applied to other fields besides the preparation of oncolytic adenoviruses, such as the preparation of forward expression plasmids, and the preparation of other oncolytic viruses, such as oncolytic parvoviruses, oncolytic herpesviruses, oncolytic poxviruses, oncolytic vesicular stomatitis viruses, oncolytic measles viruses, oncolytic myxoma viruses, oncolytic retroviruses, oncolytic reoviruses, oncolytic vaccinia viruses, and the like.

Sequencing the hTERT promoter regions of various tumor cells by earlier work shows that two mutations of the promoter and the mutation of C into T result in high expression of the hTERT gene. It is expected that these two mutations may be related to the strong or weak specific promoter capacity of hTERT promoter, and may be used on oncolytic adenovirus promoters to increase their therapeutic effect. A variety of cells were transfected by ligating fragments of the wild type hTERT promoter (hTERT WT, SEQ ID No. 2), the C69T mutant promoter (SEQ ID No. 6), the C47T mutant promoter (SEQ ID No. 7) and the DT double mutant promoter (SEQ ID No. 8) into plasmids. Experimental results show that the reporter gene controlled by the promoter is not expressed basically in normal cells, but is expressed strongly in various tumor cells, and the mutant promoter has stronger expression capacity than the wild type, and the DT double mutant promoter has the strongest tumor specific expression capacity.

Further, the present invention uses a truncated 181bp core promoter region (SEQ ID No. 1) which has been subjected to a C69T mutation and/or a C47T mutation corresponding to the wild type. First, this segment was found to have promoter function and to initiate expression of luciferase in a variety of tumor cells. And the activity of a 181bp core promoter segment of the C69T mutation (SEQ ID No. 3), the C47T mutation (SEQ ID No. 4) and the DT double mutation (SEQ ID No. 5) is obviously improved, and particularly, the activity of the promoter is strongest. I.e., a truncated 181bp core promoter segment is a core promoter element. The core promoter element has the independent function of promoting gene expression and is used as a promoter; other promoters may also be constructed as elements.

Subsequently, to further increase the tumor-specific expression capacity of the above promoters, we have used further engineering in such a way that E2F binding sites on the E2F-1 promoter are inserted into the above promoters. The results indicate that insertion of the E2F binding site on the E2F-1 promoter is effective in enhancing the tumor-specific expression capacity of the above promoters. One skilled in the art can insert one or more (the plurality can be 2, 3, 4, 5, 6 or more) and select an appropriate insertion site. In one example of the invention, the E2F binding site is inserted upstream and/or downstream of the hTERT 181bp core fragment of the promoter. An E2F binding site is inserted between-181 bp and-182 bp of the promoter, an E2F binding site is inserted between +4bp and +5bp of the promoter, and simultaneously, the modified promoters with one E2F binding site inserted at the two positions can improve the tumor specific expression capacity.

It can be seen that the above-described core promoter elements and promoters are particularly useful for preparing recombinant vectors that require specific expression in tumor cells. Such as a plasmid vector or a viral vector.

On the basis, the invention also provides an oncolytic virus preparation and tumor treatment scheme involving the core initiation element and the promoter. The above-described promoter can be used for constructing various oncolytic viruses in which expression of genes mainly used for replication or proliferation is initiated, so that a novel oncolytic virus can be prepared. Such as oncolytic adenoviruses, oncolytic parvoviruses, oncolytic herpesviruses, oncolytic poxviruses, oncolytic vesicular stomatitis viruses, oncolytic myxoma viruses, oncolytic retroviruses, oncolytic reoviruses, oncolytic vaccinia viruses, and the like.

Of course, the promoters provided by the present invention are suitable for participation in the construction of novel oncolytic adenoviruses. If adenovirus of different serotypes replaces the original endogenous promoter, and the expression of multiplication essential genes such as E1 and the like is started, so that the replication and multiplication of adenovirus in tumor cells are controlled, and the oncolytic adenovirus with improved tumor specific multiplication capacity is obtained. Can be used for the preparation of oncolytic adenoviruses of various serotypes, such as types 12, 18, 31 and 61 of subgenera A and types 3, 7, 11, 14, 16, 21, 34, 35, 55, 66, 68, 76-79 of subgenera B and types 1, 2, 5, 6, 57 and 89 of subgenera C; types 8, 9, 13, 15, 17, 19, 20, 22 to 30, 32, 33, 36 to 39, 46, 48, 49, 53, 54, 56, 58 to 60, 62 to 65, 67, 69 to 75, 80 to 88, 90 to 103 of the subgenera D; type 4, sub-genus E, type 40 and 41, sub-genus F; the genus G subgenera 52.

Those skilled in the art will appreciate that the preparation of oncolytic viruses, and in particular oncolytic adenoviruses, requires the use of several commonly used vectors. Shuttle vectors and backbone vectors are typically used. The Shuttle vector may be selected from the group consisting of pDC316, pDC311, pDC312, pDC315, pDC511, pDC512, pDC515, pDC516, pShuttle, pShuttle-CMV, pCTAP-Shuttle series vector, pNTAP-Shuttle series vector, pAdTrack, pAdTrack-CMV, pacAd5 series vector, pHBAd series vector, pXC1, etc. The backbone vector may be selected from the group consisting of pBHGloxdelE13cre, pBHGfrtdele13FLP, pAdEasy-1, pAdEasy-2, pBHGE3i, pBHGE10i, etc. And the constructed shuttle vector and skeleton vector are transfected into cells together, so that the packaging and further proliferation of viruses can be realized.

In one example of the invention, plasmid pDC316 was used as a shuttle plasmid into which the engineered hTERT promoter was ligated with the E1A/E1B-19K fragment necessary for adenovirus proliferation. pBHGlox (delta) E1,3Cre was also used as backbone plasmid. And co-transfecting the constructed shuttle vector and skeleton vector into HEK293 cells, and packaging to obtain the oncolytic adenovirus. The obtained oncolytic adenovirus specifically and efficiently expresses the E1A gene, and simultaneously shows better anti-tumor effect in-vitro and in-vivo anti-tumor tests.

The promoter has tumor specificity and can be used for constructing various medicaments targeting tumors, such as oncolytic adenovirus, tumor targeting plasmid and the like. The oncolytic adenovirus obtained by construction can be specifically proliferated in tumor cells, but not in normal cells, can effectively kill the tumor cells, inhibit tumor growth, and has effectiveness, safety and specificity.

"Gene" or "coding sequence" refers to a nucleotide sequence or region of DNA or RNA that "encodes" a particular protein. When placed under the control of a suitable regulatory region, such as a promoter, the coding DNA sequence is transcribed into RNA and translated into a polypeptide. A gene may also comprise several operably linked fragments, such as promoters, 5 'leader sequences, introns, coding sequences and 3' untranslated sequences, and may also comprise polyadenylation sites or signal sequences. Chimeric or recombinant genes are genes that are not normally found in nature, e.g., genes in which, e.g., the promoter is not naturally associated with part or all of the transcribed DNA region. "expression of a gene" refers to the process of transcription of a gene into RNA and/or translation into an active protein.

The process according to the invention is further illustrated by the following examples.

The main reagents used in the examples were:

Anti-E1A antibodies were purchased from Santa Cruz Biotechnology.

Balb/c nude mice were purchased from Peking Vietnam laboratory animal technologies Inc.

Reverse transcription kit and SYBR dye detection kit used for RT-PCR were purchased from Nanjinouzan Biotechnology Co., ltd.

CCK8 detection reagent was purchased from MCE company.

The dual luciferase assay kit was purchased from Promega Corporation company.

Other reagents are imported or domestic analytically pure products.

Example one mRNA expression assay for human telomerase reverse transcriptase in different human cells

The cells used in this example were human normal cells, human embryonic lung fibroblast MRC-5 (ATCC: CCL-171) and human primary skin fibroblast PCS-201-010 (ATCC: PCS-201-010) ^TM ) Human tumor cells: glioblastoma cell U87MG (ATCC: HTB-14), melanoma A375 (ATCC: CRL-1619), lung cancer cell A549 (ATCC: CRM-CCL-185), breast cancer cell MCF-7 (ATCC: HTB-22), cervical cancer cell Hela (ATCC: CRM-CCL-2) and ovarian cancer cell SKOV3 (ATCC: HTB-77). Cells were harvested, total cellular RNA was extracted and reverse transcribed into cDNA, and expression of human telomerase reverse transcriptase was detected by RT-PCR, GAPDH as an internal reference.

The results show (FIG. 1) that human telomerase reverse transcriptase was hardly expressed in normal cells MRC-5 and PCS-201-010, whereas human telomerase reverse transcriptase was highly expressed in 6 tumor cells of different tumor origin.

Example two different human tumor cell hTERT promoter mutation detection

Tumor cells U87MG, A375, A549, MCF-7, hela and SKOV3 were collected, the cell genome was extracted, and the hTERT promoter nucleotide sequence was sequenced.

Experimental results show (fig. 2): in U87MG cells, the hTERT promoter has partial double mutation of C69T and C47T; in a375 cells, there is a C69T mutation; in other cells, the hTERT promoter is not mutated. It is thus considered whether these mutations can be applied to promoter optimization of oncolytic adenoviruses and improvement of oncolytic effects.

Example three hTERT promoter preliminary optimization

1. hTERT promoter point mutation construction

In this example, the sequence of the +378 to +77 region of the hTERT promoter (from human chromosome 5, TERT 5' regulatory region, SEQ ID: NG_ 055467.1) was used, together with 455bp, and the sequence was designated hTERT WT (designated L-WT in FIG. 3) (SEQ ID No. 2) (see FIG. 3). By studying the sequence, a 181 bp-containing segment of-181- +77 was selected as a core region having strong promoter activity, and labeled as a 181-WT sequence (SEQ ID No. 1) (see FIG. 3). In FIG. 3 +1 represents nucleotide 1 of the mRNA sequence, -1 represents nucleotide 1 to 5' of the transcription initiation site. Both C69T (-69 nucleotide C) and C47T (-47 nucleotide C) indicate that the hTERT promoter sequence has a single cytosine C mutation to thymine T. DT shows that the sequence has double mutations of C.fwdarw.T at positions-47 and-69 as described above. The relevant nucleic acid sequences are shown in Table 1:

TABLE 1 various hTERT promoter nucleic acid sequences

pGL3-basic plasmid (this plasmid is purchased from Microbix Biosystems Inc) can be used for promoter activity detection, i.e.the region of the multiple cloning site is located upstream of the firefly luciferase gene. After pGL3-basic plasmid was digested with restriction enzymes XhoI and HindIII, the above-mentioned hTERT WT, 181-C69T, 181-C47T, 181-DT, L-C69T, L-C47T and L-DT fragments were ligated with the digested pGL3-basic plasmid, respectively, to construct pGL3-L-WT, pGL3-181-C69T, pGL3-181-C47T, pGL3-181-DT, pGL3-L-C69T, pGL 3-L-47T and pGL3-L-DT, and sequencing was correct.

2. hTERT point mutation promoter activity detection

pGL3-basic plasmid carries firefly luciferase gene and can be used for detecting the activity intensity of the promoter. 96-well plates were plated into each well of U87MG 1.5X10 respectively ⁴ Individual cells, 1.5X10 per well of A375 ⁴ Individual cells, MRC-5, PCS-201-010, A549, MCF-7, hela and SKOV3, 1X 10 each ⁴ The individual cells were cultured overnight at 37 ℃.

Grouping: (1) Control

(2) pGL3-basic (100 ng) +pRL-TK (internal plasmid 10 ng)

(3) pGL3-L-WT (100 ng) +pRL-TK (internal plasmid 10 ng)

(4) pGL3-L-C69T (100 ng) +pRL-TK (internal plasmid 10 ng)

(5) pGL3-L-C47T (100 ng) +pRL-TK (internal plasmid 10 ng)

(6) pGL3-L-DT (100 ng) +pRL-TK (internal plasmid 10 ng)

The plasmids in the above group were transfected into each cell using Lipofectamine 3000 for 24 hours, and then double fluorescence was detected. And (3) injection: pRL-TK is the HSV TK promoter which initiates expression of Renilla luciferase and pCMV-TK is the CMV promoter which initiates expression of Renilla luciferase. The reference plasmid used for MRC-5 and PCS-201-010 is pCMV-TK.

The results showed (as in FIG. 4) that in normal cells MRC-5 and PCS-201-010 cells, little firefly luciferase was detected. In tumor cells, compared with the L-WT sequence, the activity of the promoter of the double mutation of L-DT is obviously increased, which indicates that the activity of the promoter of hTERT WT after the double mutation (-378- +77) is obviously enhanced.

3. Promoter activity detection of hTERT point mutation core promoter element

Further detection of promoter Activity of the core region of the truncated 181bp core promoter element, 96-well plates were plated into each well of U87MG 1.5X10 respectively ⁴ Individual cells, 1.5X10 per well of A375 ⁴ Individual cells, MRC-5, PCS-201-010, A549, MCF-7, hela and SKOV3, 1X 10 each ⁴ The individual cells were cultured overnight at 37 ℃.

Grouping: (1) Control

(2) pGL3-basic (100 ng) +pRL-CMV (internal plasmid 5 ng)

(3) pGL3-L-WT (100 ng) +pRL-CMV (internal plasmid 5 ng)

(4) pGL3-181-WT (100 ng) +pRL-CMV (internal plasmid 5 ng)

(5) pGL3-181-C69T (100 ng) +pRL-CMV (internal plasmid 5 ng)

(6) pGL3-181-C47T (100 ng) +pRL-CMV (internal plasmid 5 ng)

(7) pGL3-181-DT (100 ng) +pRL-CMV (internal plasmid 5 ng)

The plasmids in the above group were transfected into each cell using Lipofectamine 3000 for 24 hours, and then double fluorescence was detected. And (3) injection: pCMV-TK is a CMV promoter that initiates expression of Renilla luciferase.

The results showed (as in FIG. 5) that in normal cells MRC-5 and PCS-201-010 cells, little firefly luciferase was detected. In tumor cells, compared with 181-WT sequence, the activity of the 181-DT double mutant promoter is obviously increased, which indicates that the activity of the 181bp core promoter element after double mutation is obviously enhanced.

4. Further optimization of hTERT double mutant promoters

The E2F-1 promoter is also reported in the art for oncolytic adenovirus therapy, capable of selective proliferation in Rb deficient cells. The E2F binding site on the E2F-1 promoter is a key site involved in the binding of the E2F-RB complex, and the nucleic acid sequence of the E2F binding site is TCGGCGGCTCGTGGCTCTTTCGCGGCAAAAAGGATTTGGCGCG TAAAAGTGG (SEQ ID No. 15). The invention considers that the activity of the hTERT promoter can be further enhanced by matching the hTERT promoter with the hTERT promoter, and inserts E2F binding sites between-181 bp and-182 bp to form E2F up, between +4bp and +5bp to form E2F down on the basis of L-WT and L-DT, and inserts the E2F up+down between the two sites (see table 1 and FIG. 3). After pGL3-basic plasmid is digested with restriction enzymes XhoI and HindIII, the fragments L-WT-E2F up, L-WT-E2F down, L-WT-E2F up+down, L-DT-E2F up, L-DT-E2F down and L-DT-E2F up+down shown in FIG. 3 are connected with the digested pGL3-basic plasmid to construct pGL3-L-WT-E2F up, pGL3-L-WT-E2F down, pGL3-L-WT-E2F up+down, pGL3-L-DT-E2F up, pGL3-L-DT-E2F down and pGL3-L-DT-E2F up+down, and the sequence is correct.

96-well plates were plated into each well of U87MG 1.5X10 respectively ⁴ Individual cells, 1.5X10 per well of A375 ⁴ Individual cells, MRC-5, PCS-201-010, A549, MCF-7, hela and SKOV3, 1X 10 each ⁴ The individual cells were cultured overnight at 37 ℃.

Grouping:

(1)Control

(2) pGL3-basic (100 ng) +pRL-TK (internal plasmid 10 ng)

(3) pGL3-L-WT (100 ng) +pRL-TK (internal plasmid 10 ng)

(4) pGL3-L-WT-E2F Down (100 ng) +pRL-TK (internal plasmid 10 ng)

(5) pGL3-L-WT-E2F up (100 ng) +pRL-TK (internal plasmid 10 ng)

(6) pGL3-L-WT-E2 Fup+Down (100 ng) +pRL-TK (internal plasmid 10 ng)

(7) pGL3-L-DT (100 ng) +pRL-TK (internal plasmid 10 ng)

(8) pGL3-L-DT-E2F Down (100 ng) +pRL-TK (internal plasmid 10 ng)

(9) pGL3-L-DT-E2F up (100 ng) +pRL-TK (internal plasmid 10 ng)

(10) pGL3-L-DT-E2 Fup+Down (100 ng) +pRL-TK (internal plasmid 10 ng)

The plasmids in the above group were transfected into each cell using Lipofectamine 3000 for 24 hours, and then double fluorescence was detected. The reference plasmid used for MRC-5 and PCS-201-010 was pCMV-TK 50ng, and the reference plasmid used for the remaining tumor cells was pRL-TK 10ng.

The results showed (as in FIG. 6) that in the normal cells MRC-5 and PCS-201-010, little firefly luciferase was detected, but Renilla luciferase could be detected. In tumor cells, compared with pGL3-L-DT sequence, pGL3-L-DT E2F down promoter activity is significantly increased, pGL3-L-DT-E2F down and pGL3-L-DT-E2F up+down have no significant difference, so that L-DT-E2F down sequence is selected as the optimal promoter sequence in the subsequent experiment, and is marked as mhTRET, and 504bp (SEQ ID No. 12) is obtained.

Example packaging and functional verification of tetraoncolytic adenoviruses OAd-hTERT (hTERT as promoter) and OAd-null (mhTERT as promoter)

After the pDC316 plasmid was digested with restriction enzymes XbaI and HindIII, hTERT WT and mhTERT (optimal promoters L-DT-E2F Down (SEQ ID No. 12) in example III) were ligated into the digested pDC316 plasmid with E1A/E1B-19K (nucleotide sequence shown as SEQ ID No. 18) essential for adenovirus multiplication, respectively, to construct pDC316-hTERT and pDC316-mhTERT, and an EcoRI cleavage site was added between hTERT and E1A for easy verification.

Transferring pDC316-hTERT and adenovirus skeleton plasmids pBHGlox (delta) E1 and 3Cre into HEK293 cells by using Lipofectamine 3000, and packaging the oncolytic adenovirus, namely oncolytic adenovirus OAd-hTERT; the oncolytic adenovirus packaging was also performed using Lipofectamine 3000 to transfer pDC316-mhTERT and adenovirus backbone plasmids pBHGlox (delta) E1,3Cre into HEK293 cells, labeled oncolytic adenovirus OAd-null.

The 6-well plates were plated into MRC-5, PCS-201-010, U87MG, A375, A549 and SKOV3 wells, respectively, 3X 10 each ⁵ The individual cells were cultured overnight at 37 ℃. The following day, a549 cells were infected with Ad-GFP (adenovirus expressing GFP protein), H101, OAd-hTERT and OAd-null, respectively, according to MOI (pfu) =64, the remaining cells according to MOI (pfu) =32. After 24h of infection, cell pellets were collected and the mRNA expression level and protein expression level of E1A were detected by RT-PCR and Western blot methods, respectively. H101 is a positive control oncolytic adenovirus (available from Shanghai three-dimensional Biotechnology Co., ltd.).

As shown in the results (FIG. 7RT-PCR detection and FIG. 8Western blot detection), mRNA and protein expression of E1A were hardly detected in the normal cells MRC-5 and PCS-201-010 cells. In tumor cells, mRNA and protein expression of E1A could be detected, and E1A was significantly up-regulated after OAd-null infection compared to H101 and OAd-hTERT, indicating that OAd-null proliferated efficiently in tumor cells and did not affect normal cells.

Example five oncolytic adenoviruses OAV-hTERT and OAd-null tumor in vitro killing Activity assay

The 96-well plates were plated into MRC-5, PCS-201-010, U87MG, A375, A549 and SKOV3 wells, respectively, 3X 10 each ³ The individual cells were cultured overnight at 37 ℃. The following day, MRC-5, PCS-201-010, U87MG, A375 and A549 sensed by MOI (pfu) =128, 256, 512, 1024, SKOV3 cells sensed by MOI (pfu) =31.25, 62.5, 250, 1000, respectivelyOAd-GFP (hTERT WT promoter followed by GFP protein), H101, OAd-hTERT prepared in example four and OAd-null. The CCK8 method detects cell survival 3-6 days after infection.

The results showed (FIG. 9) that in normal cells MRC-5 and PCS-201-010 cells, the cell survival was better and there was no statistical difference in survival between groups. In contrast, H101 and OAd-hTERT are able to kill tumor cells effectively, whereas OAd-null kills tumor cells with the strongest activity compared to OAd-GFP, with statistical differences.

Example in vivo tumor killing Activity assay of the six oncolytic adenovirus OAd-null

(1) A375 tumor model: balb/c nude mice of 4 weeks size were inoculated subcutaneously 1X 10 ⁷ A375 cells, to a tumor volume of about 50-100mm ³ At the time of administration, the group is as follows:

(1) vehicle 50. Mu.L of sterile PBS;

(2) h101: each 1X 10 ⁷ pfu, volume 50 μl;

(3) OAd-null 1X 10 each ⁷ pfu, volume 50 μl;

the administration mode is as follows: the medicine is administered once every other day, 5 times and intratumorally. The tumor size of the mice was measured periodically.

(2) U87MG tumor model: balb/c nude mice of 4 weeks size were inoculated subcutaneously 2X 10 ⁶ U87MG cells to a tumor volume of about 50-100mm ³ At the time of administration, the group is as follows:

(1) vehicle 50. Mu.L of sterile PBS;

(2) OAd-null 1X 10 each ⁷ pfu, volume 50 μl;

the administration mode is as follows: once a week, 2 times total, intratumoral administration. The tumor size of the mice was measured periodically.

(3) SKOV3 tumor model: balb/c nude mice of 4 weeks size were inoculated subcutaneously 5X 10 ⁶ SKOV3 cells, for tumor volume up to about 50-100mm ³ At the time of administration, the group is as follows:

(1) vehicle 50. Mu.L of sterile PBS;

(2) OAd-null 1X 10 each ⁷ pfu, volume 50 μl;

From the results (fig. 10A), in the a375 tumor model, the tumor growth was faster in the veccle group, and H101 inhibited the tumor growth to some extent, with a tumor inhibition rate of 33% compared to veccle. Whereas OAd-null oncolytic adenovirus was effective in inhibiting tumor growth, tumor inhibition rate reached 77% and tumor regression occurred in 2 mice (symbol X indicated tumor regression). In the U87MG model (FIG. 10B), the tumor growth of the Vehicle group is also relatively quick, and compared with Vehicle, the OAd-null oncolytic adenovirus can effectively inhibit the tumor growth, and the tumor inhibition rate reaches 79 percent. In the SKOV3 model (fig. 10C), tumor growth was also relatively fast in the veccle group, and OAd-null oncolytic adenovirus was able to effectively inhibit tumor growth, up to 75% tumor inhibition, compared to veccle.

Other nucleotide sequences used in the present invention:

SEQ ID NO.16 (nucleotide sequence of E1A (DELTA 24)):

ATGAGACATATTATCTGCCACGGAGGTGTTATTACCGAAGAAATGGCCGCCAGTCTTTTGGACCAGCTGATCGAAGAGGTACTGGCTGATAATCTTCCACCTCCTAGCCATTTTGAACCACCTACCCTTCACGAACTGTATGATTTAGACGTGACGGCCCCCGAAGATCCCAACGAGGAGGCGGTTTCGCAGATTTTTCCCGACTCTGTAATGTTGGCGGTGCAGGAAGGGATTGACTTACTCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCACCTTTCCCGGCAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAACCTTGTACCGGAGGTGATCGATCCACCCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGTGGAGCACCCCGGGCACGGTTGCAGGTCTTGTCATTATCACCGGAGGAATACGGGGGACCCAGATATTATGTGTTCGCTTTGCTATATGAGGACCTGTGGCATGTTTGTCTACAGTAAGTGAAAATTATGGGCAGTGGGTGATAGAGTGGTGGGTTTGGTGTGGTAATTTTTTTTTTAATTTTTACAGTTTTGTGGTTTAAAGAATTTTGTATTGTGATTTTTTTAAAAGGTCCTGTGTCTGAACCTGAGCCTGAGCCCGAGCCAGAACCGGAGCCTGCAAGACCTACCCGCCGTCCTAAAATGGCGCCTGCTATCCTGAGACGCCCGACATCACCTGTGTCTAGAGAATGCAATAGTAGTACGGATAGCTGTGACTCCGGTCCTTCTAACACACCTCCTGAGATACACCCGGTGGTCCCGCTGTGCCCCATTAAACCAGTTGCCGTGAGAGTTGGTGGGCGTCGCCAGGCTGTGGAATGTATCGAGGACTTGCTTAACGAGCCTGGGCAACCTTTGGACTTGAGCTGTAAACGCCCCAGGCCATAAGGTGTAAACCTGTGATTGCGTGTGTGGTTAACGCCTTTGTTTGCTGAATGAGTTGATGTAAGTTTAATAAAGGGTGAGATAATGTTT

SEQ ID NO.17 (nucleotide sequence of E1B 19K)

TATATAATGCGCCGTGGGCTAATCTTGGTTACATCTGACCTCATGGAGGCTTGGGAGTGTTTGGAAGATTTTTCTGCTGTGCGTAACTTGCTGGAACAGAGCTCTAACAGTACCTCTTGGTTTTGGAGGTTTCTGTGGGGCTCATCCCAGGCAAAGTTAGTCTGCAGAATTAAGGAGGATTACAAGTGGGAATTTGAAGAGCTTTTGAAATCCTGTGGTGAGCTGTTTGATTCTTTGAATCTGGGTCACCAGGCGCTTTTCCAAGAGAAGGTCATCAAGACTTTGGATTTTTCCACACCGGGGCGCGCTGCGGCTGCTGTTGCTTTTTTGAGTTTTATAAAGGATAAATGGAGTGAAGAAACCCATCTGAGCGGGGGGTACCTGCTGGATTTTCTGGCCATGCATCTGTGGAGAGCGGTTGTGAGACACAAGAATCGCCTGCTACTGTTGTCTTCCGTCCGCCCGGCGATAATACCGACGGAGGAGCAGCAGCAGCAGCAGGAGGAAGCCAGGCGGCGGCGGCAGGAGCAGAGCCCATGGAACCCGAGAGCCGGCCTGGACCCTCGGGAATGA

SEQ ID NO.18 (nucleotide sequence of E1ADELTA24-E1B 19K):

ATGAGACATATTATCTGCCACGGAGGTGTTATTACCGAAGAAATGGCCGCCAGTCTTTTGGACCAGCTGATCGAAGAGGTACTGGCTGATAATCTTCCACCTCCTAGCCATTTTGAACCACCTACCCTTCACGAACTGTATGATTTAGACGTGACGGCCCCCGAAGATCCCAACGAGGAGGCGGTTTCGCAGATTTTTCCCGACTCTGTAATGTTGGCGGTGCAGGAAGGGATTGACTTACTCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCACCTTTCCCGGCAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAACCTTGTACCGGAGGTGATCGATCCACCCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGTGGAGCACCCCGGGCACGGTTGCAGGTCTTGTCATTATCACCGGAGGAATACGGGGGACCCAGATATTATGTGTTCGCTTTGCTATATGAGGACCTGTGGCATGTTTGTCTACAGTAAGTGAAAATTATGGGCAGTGGGTGATAGAGTGGTGGGTTTGGTGTGGTAATTTTTTTTTTAATTTTTACAGTTTTGTGGTTTAAAGAATTTTGTATTGTGATTTTTTTAAAAGGTCCTGTGTCTGAACCTGAGCCTGAGCCCGAGCCAGAACCGGAGCCTGCAAGACCTACCCGCCGTCCTAAAATGGCGCCTGCTATCCTGAGACGCCCGACATCACCTGTGTCTAGAGAATGCAATAGTAGTACGGATAGCTGTGACTCCGGTCCTTCTAACACACCTCCTGAGATACACCCGGTGGTCCCGCTGTGCCCCATTAAACCAGTTGCCGTGAGAGTTGGTGGGCGTCGCCAGGCTGTGGAATGTATCGAGGACTTGCTTAACGAGCCTGGGCAACCTTTGGACTTGAGCTGTAAACGCCCCAGGCCATAAGGTGTAAACCTGTGATTGCGTGTGTGGTTAACGCCTTTGTTTGCTGAATGAGTTGATGTAAGTTTAATAAAGGGTGAGATAATGTTTAACTTGCATGGCGTGTTAAATGGGGCGGGGCTTAAAGGGTATATAATGCGCCGTGGGCTAATCTTGGTTACATCTGACCTCATGGAGGCTTGGGAGTGTTTGGAAGATTTTTCTGCTGTGCGTAACTTGCTGGAACAGAGCTCTAACAGTACCTCTTGGTTTTGGAGGTTTCTGTGGGGCTCATCCCAGGCAAAGTTAGTCTGCAGAATTAAGGAGGATTACAAGTGGGAATTTGAAGAGCTTTTGAAATCCTGTGGTGAGCTGTTTGATTCTTTGAATCTGGGTCACCAGGCGCTTTTCCAAGAGAAGGTCATCAAGACTTTGGATTTTTCCACACCGGGGCGCGCTGCGGCTGCTGTTGCTTTTTTGAGTTTTATAAAGGATAAATGGAGTGAAGAAACCCATCTGAGCGGGGGGTACCTGCTGGATTTTCTGGCCATGCATCTGTGGAGAGCGGTTGTGAGACACAAGAATCGCCTGCTACTGTTGTCTTCCGTCCGCCCGGCGATAATACCGACGGAGGAGCAGCAGCAGCAGCAGGAGGAAGCCAGGCGGCGGCGGCAGGAGCAGAGCCCATGGAACCCGAGAGCCGGCCTGGACCCTCGGGAATGA

sequence listing

<110> university of Sichuan

<120> tumor-specific promoters and uses thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 258

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ccaggaccgc gctccccacg tggcggaggg actggggacc cgggcacccg tcctgcccct 60

tcaccttcca gctccgcctc ctccgcgcgg accccgcccc gtcccgaccc ctcccgggtc 120

cccggcccag ccccctccgg gccctcccag cccctcccct tcctttccgc ggccccgccc 180

tctcctcgcg gcgcgagttt caggcagcgc tgcgtcctgc tgcgcacgtg ggaagccctg 240

gccccggcca cccccgcg 258

<210> 2

<211> 455

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgccca ggaccgcgct ccccacgtgg cggagggact ggggacccgg 240

gcacccgtcc tgccccttca ccttccagct ccgcctcctc cgcgcggacc ccgccccgtc 300

ccgacccctc ccgggtcccc ggcccagccc cctccgggcc ctcccagccc ctccccttcc 360

tttccgcggc cccgccctct cctcgcggcg cgagtttcag gcagcgctgc gtcctgctgc 420

gcacgtggga agccctggcc ccggccaccc ccgcg 455

<210> 3

<211> 251

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

cgcgctcccc acgtggcgga gggactgggg acccgggcac ccgtcctgcc ccttcacctt 60

ccagctccgc ctcctccgcg cggaccccgc cccgtcccga ccccttccgg gtccccggcc 120

cagccccctc cgggccctcc cagcccctcc ccttcctttc cgcggccccg ccctctcctc 180

gcggcgcgag tttcaggcag cgctgcgtcc tgctgcgcac gtgggaagcc ctggccccgg 240

ccacccccgc g 251

<210> 4

<211> 251

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

cgcgctcccc acgtggcgga gggactgggg acccgggcac ccgtcctgcc ccttcacctt 60

ccagctccgc ctcctccgcg cggaccccgc cccgtcccga cccctcccgg gtccccggcc 120

cagccccttc cgggccctcc cagcccctcc ccttcctttc cgcggccccg ccctctcctc 180

gcggcgcgag tttcaggcag cgctgcgtcc tgctgcgcac gtgggaagcc ctggccccgg 240

ccacccccgc g 251

<210> 5

<211> 251

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

cgcgctcccc acgtggcgga gggactgggg acccgggcac ccgtcctgcc ccttcacctt 60

ccagctccgc ctcctccgcg cggaccccgc cccgtcccga ccccttccgg gtccccggcc 120

cagccccttc cgggccctcc cagcccctcc ccttcctttc cgcggccccg ccctctcctc 180

gcggcgcgag tttcaggcag cgctgcgtcc tgctgcgcac gtgggaagcc ctggccccgg 240

ccacccccgc g 251

<210> 6

<211> 455

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgccca ggaccgcgct ccccacgtgg cggagggact ggggacccgg 240

gcacccgtcc tgccccttca ccttccagct ccgcctcctc cgcgcggacc ccgccccgtc 300

ccgacccctt ccgggtcccc ggcccagccc cctccgggcc ctcccagccc ctccccttcc 360

tttccgcggc cccgccctct cctcgcggcg cgagtttcag gcagcgctgc gtcctgctgc 420

gcacgtggga agccctggcc ccggccaccc ccgcg 455

<210> 7

<211> 455

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgccca ggaccgcgct ccccacgtgg cggagggact ggggacccgg 240

gcacccgtcc tgccccttca ccttccagct ccgcctcctc cgcgcggacc ccgccccgtc 300

ccgacccctc ccgggtcccc ggcccagccc cttccgggcc ctcccagccc ctccccttcc 360

tttccgcggc cccgccctct cctcgcggcg cgagtttcag gcagcgctgc gtcctgctgc 420

gcacgtggga agccctggcc ccggccaccc ccgcg 455

<210> 8

<211> 455

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgccca ggaccgcgct ccccacgtgg cggagggact ggggacccgg 240

gcacccgtcc tgccccttca ccttccagct ccgcctcctc cgcgcggacc ccgccccgtc 300

ccgacccctt ccgggtcccc ggcccagccc cttccgggcc ctcccagccc ctccccttcc 360

tttccgcggc cccgccctct cctcgcggcg cgagtttcag gcagcgctgc gtcctgctgc 420

gcacgtggga agccctggcc ccggccaccc ccgcg 455

<210> 9

<211> 504

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgccca ggaccgcgct ccccacgtgg cggagggact ggggacccgg 240

gcacccgtcc tgccccttca ccttccagct ccgcctcctc cgcgcggacc ccgccccgtc 300

ccgacccctc ccgggtcccc ggcccagccc cctccgggcc ctcccagccc ctccccttcc 360

tttccgcggc cccgccctct cctcggcggc tcgtggctct ttcgcggcaa aaaggatttg 420

gcgcgtaaaa gtggcggcgc gagtttcagg cagcgctgcg tcctgctgcg cacgtgggaa 480

gccctggccc cggccacccc cgcg 504

<210> 10

<211> 507

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgctcg gcggctcgtg gctctttcgc ggcaaaaagg atttggcgcg 240

taaaagtggc caggaccgcg ctccccacgt ggcggaggga ctggggaccc gggcacccgt 300

cctgcccctt caccttccag ctccgcctcc tccgcgcgga ccccgccccg tcccgacccc 360

tcccgggtcc ccggcccagc cccctccggg ccctcccagc ccctcccctt cctttccgcg 420

gccccgccct ctcctcgcgg cgcgagtttc aggcagcgct gcgtcctgct gcgcacgtgg 480

gaagccctgg ccccggccac ccccgcg 507

<210> 11

<211> 556

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgctcg gcggctcgtg gctctttcgc ggcaaaaagg atttggcgcg 240

taaaagtggc caggaccgcg ctccccacgt ggcggaggga ctggggaccc gggcacccgt 300

cctgcccctt caccttccag ctccgcctcc tccgcgcgga ccccgccccg tcccgacccc 360

tcccgggtcc ccggcccagc cccctccggg ccctcccagc ccctcccctt cctttccgcg 420

gccccgccct ctcctcggcg gctcgtggct ctttcgcggc aaaaaggatt tggcgcgtaa 480

aagtggcggc gcgagtttca ggcagcgctg cgtcctgctg cgcacgtggg aagccctggc 540

cccggccacc cccgcg 556

<210> 12

<211> 504

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgccca ggaccgcgct ccccacgtgg cggagggact ggggacccgg 240

gcacccgtcc tgccccttca ccttccagct ccgcctcctc cgcgcggacc ccgccccgtc 300

ccgacccctt ccgggtcccc ggcccagccc cttccgggcc ctcccagccc ctccccttcc 360

tttccgcggc cccgccctct cctcggcggc tcgtggctct ttcgcggcaa aaaggatttg 420

gcgcgtaaaa gtggcggcgc gagtttcagg cagcgctgcg tcctgctgcg cacgtgggaa 480

gccctggccc cggccacccc cgcg 504

<210> 13

<211> 507

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgctcg gcggctcgtg gctctttcgc ggcaaaaagg atttggcgcg 240

taaaagtggc caggaccgcg ctccccacgt ggcggaggga ctggggaccc gggcacccgt 300

cctgcccctt caccttccag ctccgcctcc tccgcgcgga ccccgccccg tcccgacccc 360

ttccgggtcc ccggcccagc cccttccggg ccctcccagc ccctcccctt cctttccgcg 420

gccccgccct ctcctcgcgg cgcgagtttc aggcagcgct gcgtcctgct gcgcacgtgg 480

gaagccctgg ccccggccac ccccgcg 507

<210> 14

<211> 556

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

tggcccctcc ctcgggttac cccacagcct aggccgattc gacctctctc cgctggggcc 60

ctcgctggcg tccctgcacc ctgggagcgc gagcggcgcg cgggcgggga agcgcggccc 120

agacccccgg gtccgcccgg agcagctgcg ctgtcggggc caggccgggc tcccagtgga 180

ttcgcgggca cagacgctcg gcggctcgtg gctctttcgc ggcaaaaagg atttggcgcg 240

taaaagtggc caggaccgcg ctccccacgt ggcggaggga ctggggaccc gggcacccgt 300

cctgcccctt caccttccag ctccgcctcc tccgcgcgga ccccgccccg tcccgacccc 360

ttccgggtcc ccggcccagc cccttccggg ccctcccagc ccctcccctt cctttccgcg 420

gccccgccct ctcctcggcg gctcgtggct ctttcgcggc aaaaaggatt tggcgcgtaa 480

aagtggcggc gcgagtttca ggcagcgctg cgtcctgctg cgcacgtggg aagccctggc 540

cccggccacc cccgcg 556

<210> 15

<211> 52

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

tcggcggctc gtggctcttt cgcggcaaaa aggatttggc gcgtaaaagt gg 52

<210> 16

<211> 1049

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

atgagacata ttatctgcca cggaggtgtt attaccgaag aaatggccgc cagtcttttg 60

gaccagctga tcgaagaggt actggctgat aatcttccac ctcctagcca ttttgaacca 120

cctacccttc acgaactgta tgatttagac gtgacggccc ccgaagatcc caacgaggag 180

gcggtttcgc agatttttcc cgactctgta atgttggcgg tgcaggaagg gattgactta 240

ctcacttttc cgccggcgcc cggttctccg gagccgcctc acctttcccg gcagcccgag 300

cagccggagc agagagcctt gggtccggtt tctatgccaa accttgtacc ggaggtgatc 360

gatccaccca gtgacgacga ggatgaagag ggtgaggagt ttgtgttaga ttatgtggag 420

caccccgggc acggttgcag gtcttgtcat tatcaccgga ggaatacggg ggacccagat 480

attatgtgtt cgctttgcta tatgaggacc tgtggcatgt ttgtctacag taagtgaaaa 540

ttatgggcag tgggtgatag agtggtgggt ttggtgtggt aatttttttt ttaattttta 600

cagttttgtg gtttaaagaa ttttgtattg tgattttttt aaaaggtcct gtgtctgaac 660

ctgagcctga gcccgagcca gaaccggagc ctgcaagacc tacccgccgt cctaaaatgg 720

cgcctgctat cctgagacgc ccgacatcac ctgtgtctag agaatgcaat agtagtacgg 780

atagctgtga ctccggtcct tctaacacac ctcctgagat acacccggtg gtcccgctgt 840

gccccattaa accagttgcc gtgagagttg gtgggcgtcg ccaggctgtg gaatgtatcg 900

aggacttgct taacgagcct gggcaacctt tggacttgag ctgtaaacgc cccaggccat 960

aaggtgtaaa cctgtgattg cgtgtgtggt taacgccttt gtttgctgaa tgagttgatg 1020

taagtttaat aaagggtgag ataatgttt 1049

<210> 17

<211> 573

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

tatataatgc gccgtgggct aatcttggtt acatctgacc tcatggaggc ttgggagtgt 60

ttggaagatt tttctgctgt gcgtaacttg ctggaacaga gctctaacag tacctcttgg 120

ttttggaggt ttctgtgggg ctcatcccag gcaaagttag tctgcagaat taaggaggat 180

tacaagtggg aatttgaaga gcttttgaaa tcctgtggtg agctgtttga ttctttgaat 240

ctgggtcacc aggcgctttt ccaagagaag gtcatcaaga ctttggattt ttccacaccg 300

gggcgcgctg cggctgctgt tgcttttttg agttttataa aggataaatg gagtgaagaa 360

acccatctga gcggggggta cctgctggat tttctggcca tgcatctgtg gagagcggtt 420

gtgagacaca agaatcgcct gctactgttg tcttccgtcc gcccggcgat aataccgacg 480

gaggagcagc agcagcagca ggaggaagcc aggcggcggc ggcaggagca gagcccatgg 540

aacccgagag ccggcctgga ccctcgggaa tga 573

<210> 18

<211> 1661

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

atgagacata ttatctgcca cggaggtgtt attaccgaag aaatggccgc cagtcttttg 60

gaccagctga tcgaagaggt actggctgat aatcttccac ctcctagcca ttttgaacca 120

cctacccttc acgaactgta tgatttagac gtgacggccc ccgaagatcc caacgaggag 180

gcggtttcgc agatttttcc cgactctgta atgttggcgg tgcaggaagg gattgactta 240

ctcacttttc cgccggcgcc cggttctccg gagccgcctc acctttcccg gcagcccgag 300

cagccggagc agagagcctt gggtccggtt tctatgccaa accttgtacc ggaggtgatc 360

gatccaccca gtgacgacga ggatgaagag ggtgaggagt ttgtgttaga ttatgtggag 420

caccccgggc acggttgcag gtcttgtcat tatcaccgga ggaatacggg ggacccagat 480

attatgtgtt cgctttgcta tatgaggacc tgtggcatgt ttgtctacag taagtgaaaa 540

ttatgggcag tgggtgatag agtggtgggt ttggtgtggt aatttttttt ttaattttta 600

cagttttgtg gtttaaagaa ttttgtattg tgattttttt aaaaggtcct gtgtctgaac 660

ctgagcctga gcccgagcca gaaccggagc ctgcaagacc tacccgccgt cctaaaatgg 720

cgcctgctat cctgagacgc ccgacatcac ctgtgtctag agaatgcaat agtagtacgg 780

atagctgtga ctccggtcct tctaacacac ctcctgagat acacccggtg gtcccgctgt 840

gccccattaa accagttgcc gtgagagttg gtgggcgtcg ccaggctgtg gaatgtatcg 900

aggacttgct taacgagcct gggcaacctt tggacttgag ctgtaaacgc cccaggccat 960

aaggtgtaaa cctgtgattg cgtgtgtggt taacgccttt gtttgctgaa tgagttgatg 1020

taagtttaat aaagggtgag ataatgttta acttgcatgg cgtgttaaat ggggcggggc 1080

ttaaagggta tataatgcgc cgtgggctaa tcttggttac atctgacctc atggaggctt 1140

gggagtgttt ggaagatttt tctgctgtgc gtaacttgct ggaacagagc tctaacagta 1200

cctcttggtt ttggaggttt ctgtggggct catcccaggc aaagttagtc tgcagaatta 1260

aggaggatta caagtgggaa tttgaagagc ttttgaaatc ctgtggtgag ctgtttgatt 1320

ctttgaatct gggtcaccag gcgcttttcc aagagaaggt catcaagact ttggattttt 1380

ccacaccggg gcgcgctgcg gctgctgttg cttttttgag ttttataaag gataaatgga 1440

gtgaagaaac ccatctgagc ggggggtacc tgctggattt tctggccatg catctgtgga 1500

gagcggttgt gagacacaag aatcgcctgc tactgttgtc ttccgtccgc ccggcgataa 1560

taccgacgga ggagcagcag cagcagcagg aggaagccag gcggcggcgg caggagcaga 1620

gcccatggaa cccgagagcc ggcctggacc ctcgggaatg a 1661

Claims

1. The core starting element is characterized in that: the nucleotide sequence is shown in any one of SEQ ID No.3, SEQ ID No.4 or SEQ ID No. 5.

2. A promoter comprising the core promoter element of claim 1.

3. The promoter according to claim 2, wherein: the nucleotide sequence is shown as SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8.

4. A promoter according to claim 2 or 3, characterized in that: at least one E2F binding site is also inserted.

5. The promoter according to claim 4, wherein: the nucleotide sequence of the E2F binding site is shown in SEQ ID No. 15.

6. The promoter according to claim 4, wherein: the E2F binding site is inserted at the 5 'and/or 3' end of the core activating element of claim 1 or 2.

7. The promoter according to claim 6, wherein: the nucleotide sequence of the promoter is shown as SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13 or SEQ ID No. 14.

8. Use of the core promoter element of claim 1 or the promoter of any one of claims 2 to 7 in the preparation of an oncolytic virus or plasmid.

9. The use according to claim 8, wherein the oncolytic virus is an oncolytic adenovirus.

10. A recombinant vector comprising the core promoter element of claim 1 or the promoter of any one of claims 2 to 7.

11. The recombinant vector according to claim 10, wherein the recombinant vector is a plasmid vector or a viral vector.

12. The recombinant vector according to claim 11, wherein said viral vector is an adenovirus vector, an adenovirus-associated virus or a retrovirus.

13. The recombinant vector according to claim 11, wherein said viral vector is an oncolytic virus.

14. The recombinant vector according to claim 13, wherein said oncolytic virus is at least one of oncolytic adenovirus, oncolytic parvovirus, oncolytic herpesvirus, oncolytic poxvirus, oncolytic vesicular stomatitis virus, oncolytic measles virus, oncolytic myxoma virus, oncolytic retrovirus, oncolytic reovirus, oncolytic vaccinia virus.

15. The recombinant vector according to claim 14, wherein said oncolytic adenovirus is an adenovirus of the serotype belonging to the subgenera a, subgenera B, subgenera C, subgenera D, subgenera E, subgenera F or subgenera G.

16. The recombinant vector of claim 14, wherein the oncolytic adenovirus is:

at least one selected from the group consisting of type 12, 18, 31 or 61 of subgenera a;

or at least one selected from the group consisting of types 3, 7, 11, 14, 16, 21, 34, 35, 55, 66, 68, 76, 77, 78 or 79 of subgenera B,

or, at least one selected from the group consisting of types 1, 2, 5, 6, 57, and 89 of subgenera C;

or at least one selected from the group consisting of types 8, 9, 13, 15, 17, 19, 20, 22 to 30, 32, 33, 36 to 39, 46, 48, 49, 53, 54, 56, 58 to 60, 62 to 65, 67, 69 to 75, 80 to 88 and 90 to 103 of the subgenera D;

alternatively, form 4 selected from subgenera E;

alternatively, from the subgenera F, type 40 or 41;

alternatively, adenovirus type 52 selected from the subgenera G.

17. The recombinant vector according to claim 11, wherein the plasmid vector is at least one of pDC316, pDC311, pDC312, pDC315, pDC511, pDC512, pDC515, pDC516, pShuttle, pShuttle-CMV, pCTAP-shift series plasmid, pNTAP-shift series plasmid, pAdTrack, pAdTrack-CMV, pacAd5 series plasmid, pHBAd series plasmid, or pXC1 plasmid.

18. The recombinant vector according to claim 14, wherein the oncolytic adenovirus is driven by the core promoter element according to claim 1 or the promoter according to any one of claims 2 to 7 for expression of the E1A and/or E1B-19K genes.

19. The recombinant vector according to claim 18, wherein said E1A is E1A (Delta 24) deleted of 24bp in the middle, and the nucleotide sequence thereof is shown in SEQ ID No. 16; alternatively, the nucleotide sequence of E1B 19K is shown as SEQ ID No. 17.

20. A host cell comprising the recombinant vector of any one of claims 10-19.

21. The host cell of claim 20, which is a eukaryotic cell.

22. An antitumor drug characterized in that: is prepared by adding pharmaceutically acceptable auxiliary components into the recombinant vector according to any one of claims 10 to 19.

23. A method of preparing the recombinant vector of any one of claims 10 to 19:

a) Constructing a core promoter element of claim 1 or a promoter of any one of claims 2 to 7 operably linked to a gene necessary for adenovirus proliferation into a shuttle plasmid;

24. The method according to claim 23, wherein: at least one of the following is satisfied:

genes required for adenovirus proliferation are E1A and/or E1B-19K;

alternatively, the Shuttle plasmid is at least one of pDC316, pDC311, pDC312, pDC315, pDC511, pDC512, pDC515, pDC516, pShuttle, pShuttle-CMV, pCTAP-shift series plasmid, pNTAP-shift series plasmid, pAdTrack, pAdTrack-CMV, pacAd5 series plasmid, pHBAd series plasmid or pXC1 plasmid;

alternatively, the adenovirus skeleton plasmid is at least one of pBHGloxdelE13cre, pBHGfrtdelE FLP, pAdEasy-1, pAdEasy-2, pBHGE3i or pBHGE10 i;

alternatively, the packaging cells are HEK293 and HEK293A cells.